WorldWideScience

Sample records for developmental gene regulation

  1. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    Science.gov (United States)

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

  2. Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

    Directory of Open Access Journals (Sweden)

    Ishida Betty K

    2003-08-01

    Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.

  3. Distinguishing epigenetic marks of developmental and imprinting regulation

    Directory of Open Access Journals (Sweden)

    McEwen Kirsten R

    2010-01-01

    Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two

  4. A co-expression gene network associated with developmental regulation of apple fruit acidity.

    Science.gov (United States)

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

    2015-08-01

    Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

  5. DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions

    Science.gov (United States)

    Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.

    2011-01-01

    The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518

  6. Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

    Directory of Open Access Journals (Sweden)

    Susanta K Behura

    Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

  7. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    Science.gov (United States)

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

    2005-04-01

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  8. Mural granulosa cell gene expression associated with oocyte developmental competence

    Directory of Open Access Journals (Sweden)

    Jiang Jin-Yi

    2010-03-01

    Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

  9. Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

    Science.gov (United States)

    Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

    2017-07-03

    Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

  10. The Drosophila Perlecan gene trol regulates multiple signaling pathways in different developmental contexts

    Directory of Open Access Journals (Sweden)

    Perry Trinity L

    2007-11-01

    Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and

  11. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    Institute of Scientific and Technical Information of China (English)

    HSU Heng; Robert L. CHURCH

    2004-01-01

    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  12. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

    Directory of Open Access Journals (Sweden)

    Runko Suzan J

    2005-10-01

    Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

  13. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  14. Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

    Directory of Open Access Journals (Sweden)

    Michael Hadjiargyrou

    2018-01-01

    Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

  15. Prepatterning of developmental gene expression by modified histones before zygotic genome activation

    DEFF Research Database (Denmark)

    Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

    2011-01-01

    A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

  16. Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

    Directory of Open Access Journals (Sweden)

    Jinyi Liu

    Full Text Available Growth regulating factors (GRFs are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

  17. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  18. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  19. Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

    Science.gov (United States)

    Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott

    2016-08-01

    Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

  20. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    Energy Technology Data Exchange (ETDEWEB)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

  1. Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

    Science.gov (United States)

    Traeger, Stefanie; Nowrousian, Minou

    2015-04-14

    During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

  2. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Science.gov (United States)

    Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

    2013-01-01

    Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

  3. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Directory of Open Access Journals (Sweden)

    David Cohen

    Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of

  4. Developmental and growth temperature regulation of two different microsomal omega-6 desaturase genes in soybeans.

    Science.gov (United States)

    Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H

    1996-01-01

    The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990

  5. Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

    Science.gov (United States)

    Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

    2010-05-16

    Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

  6. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    Directory of Open Access Journals (Sweden)

    Conforto Tara L

    2012-04-01

    Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

  7. A Drosophila Genome-Wide Screen Identifies Regulators of Steroid Hormone Production and Developmental Timing

    DEFF Research Database (Denmark)

    Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki

    2016-01-01

    Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...

  8. Gene expression regulation in photomorphogenesis from the perspective of the central dogma.

    Science.gov (United States)

    Wu, Shu-Hsing

    2014-01-01

    Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.

  9. The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

    Science.gov (United States)

    Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

    2013-09-01

    The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

  10. Transcriptional regulation of genes involved in terpenoid índole alkaloid production in Catharanthus roseus seedlings

    Directory of Open Access Journals (Sweden)

    Pedro J. Rocha

    2002-07-01

    Full Text Available Catharanthus roseus (L. G Don is a medicinal plant that produces a variety of terpenoid indole alkaloids (TIAs, some of which display pharmacological activity. C. roseus plants and cell cultures have been used to elucidate the TIAs biosynthetic pathway. A considerable number or enzymes have also been characterised, and their respective genes cloned. TIAs production in C. roseus plant and cell cultures is highly regulated at transcriptional-, develop-mental-, and environmental-level. Studies into TIAs biosynthetic gene regulation have been carried out using cell cultures. However, regulation in plants is almost unknown. Here, biosynthetic genes idc, strl, d4h and dat expres-sion levels are qualitatively examined in a developmental series of C. roseus seedlings. The effect of water- and light-stress and methyl jasmonate (MeJa and acetyl salicylic acid (ASA elicitation is also examined. Comparison between seedlings and cell cultures strongly suggests that TIAs biosynthetic gene transcriptional regulation is different in C.roseus plants and cell cultures.

  11. Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

    Science.gov (United States)

    Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

    2017-07-01

    In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

  12. Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

    Science.gov (United States)

    Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

    2003-12-01

    Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

  13. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Science.gov (United States)

    Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

    2016-01-01

    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  14. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Directory of Open Access Journals (Sweden)

    Zhengkun Qiu

    Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  15. Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

    Directory of Open Access Journals (Sweden)

    Xiao-Jian Sun

    Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

  16. Spatiotemporal network motif reveals the biological traits of developmental gene regulatory networks in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Kim Man-Sun

    2012-05-01

    Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.

  17. Regulation of root hair initiation and expansin gene expression in Arabidopsis

    Science.gov (United States)

    Cho, Hyung-Taeg; Cosgrove, Daniel J.

    2002-01-01

    The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

  18. Activity-regulated genes as mediators of neural circuit plasticity.

    Science.gov (United States)

    Leslie, Jennifer H; Nedivi, Elly

    2011-08-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. The Tomato Hoffman’s Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures

    Science.gov (United States)

    Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

    2016-01-01

    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362

  20. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  1. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  2. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)

    2016-08-15

    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  4. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    International Nuclear Information System (INIS)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-01-01

    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  5. Regulation of signaling genes by TGFβ during entry into dauer diapause in C. elegans

    Directory of Open Access Journals (Sweden)

    Patterson Garth I

    2004-09-01

    Full Text Available Abstract Background When resources are scant, C. elegans larvae arrest as long-lived dauers under the control of insulin/IGF- and TGFβ-related signaling pathways. However, critical questions remain regarding the regulation of this developmental event. How do three dozen insulin-like proteins regulate one tyrosine kinase receptor to control complex events in dauer, metabolism and aging? How are signals from the TGFβ and insulin/IGF pathways integrated? What gene expression programs do these pathways regulate, and how do they control complex downstream events? Results We have identified genes that show different levels of expression in a comparison of wild-type L2 or L3 larvae (non-dauer to TGFβ mutants at similar developmental stages undergoing dauer formation. Many insulin/IGF pathway and other known dauer regulatory genes have changes in expression that suggest strong positive feedback by the TGFβ pathway. In addition, many insulin-like ligand and novel genes with similarity to the extracellular domain of insulin/IGF receptors have altered expression. We have identified a large group of regulated genes with putative binding sites for the FOXO transcription factor, DAF-16. Genes with DAF-16 sites upstream of the transcription start site tend to be upregulated, whereas genes with DAF-16 sites downstream of the coding region tend to be downregulated. Finally, we also see strong regulation of many novel hedgehog- and patched-related genes, hormone biosynthetic genes, cell cycle genes, and other regulatory genes. Conclusions The feedback regulation of insulin/IGF pathway and other dauer genes that we observe would be predicted to amplify signals from the TGFβ pathway; this amplification may serve to ensure a decisive choice between "dauer" and "non-dauer", even if environmental cues are ambiguous. Up and down regulation of insulin-like ligands and novel genes with similarity to the extracellular domain of insulin/IGF receptors suggests opposing

  6. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    Science.gov (United States)

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  7. Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

    Science.gov (United States)

    Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

    2014-05-01

    Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

  8. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  9. Developmental changes in the metabolic network of snapdragon flowers.

    Directory of Open Access Journals (Sweden)

    Joëlle K Muhlemann

    Full Text Available Evolutionary and reproductive success of angiosperms, the most diverse group of land plants, relies on visual and olfactory cues for pollinator attraction. Previous work has focused on elucidating the developmental regulation of pathways leading to the formation of pollinator-attracting secondary metabolites such as scent compounds and flower pigments. However, to date little is known about how flowers control their entire metabolic network to achieve the highly regulated production of metabolites attracting pollinators. Integrative analysis of transcripts and metabolites in snapdragon sepals and petals over flower development performed in this study revealed a profound developmental remodeling of gene expression and metabolite profiles in petals, but not in sepals. Genes up-regulated during petal development were enriched in functions related to secondary metabolism, fatty acid catabolism, and amino acid transport, whereas down-regulated genes were enriched in processes involved in cell growth, cell wall formation, and fatty acid biosynthesis. The levels of transcripts and metabolites in pathways leading to scent formation were coordinately up-regulated during petal development, implying transcriptional induction of metabolic pathways preceding scent formation. Developmental gene expression patterns in the pathways involved in scent production were different from those of glycolysis and the pentose phosphate pathway, highlighting distinct developmental regulation of secondary metabolism and primary metabolic pathways feeding into it.

  10. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  11. Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex

    Directory of Open Access Journals (Sweden)

    Okada Yasukazu

    2010-04-01

    Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.

  12. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    Science.gov (United States)

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution

  13. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  14. RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

    Science.gov (United States)

    Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

    2017-05-01

    To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p  0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

  15. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

    Science.gov (United States)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-08-01

    2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Developmentally regulated expression and complex processing of barley pri-microRNAs

    Directory of Open Access Journals (Sweden)

    Kruszka Katarzyna

    2013-01-01

    Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression via mRNA cleavage or translation inhibition. In spite of barley being a cereal of great economic importance, very little data is available concerning its miRNA biogenesis. There are 69 barley miRNA and 67 pre-miRNA sequences available in the miRBase (release 19. However, no barley pri-miRNA and MIR gene structures have been shown experimentally. In the present paper, we examine the biogenesis of selected barley miRNAs and the developmental regulation of their pri-miRNA processing to learn more about miRNA maturation in barely. Results To investigate the organization of barley microRNA genes, nine microRNAs - 156g, 159b, 166n, 168a-5p/168a-3p, 171e, 397b-3p, 1120, and 1126 - were selected. Two of the studied miRNAs originate from one MIR168a-5p/168a-3p gene. The presence of all miRNAs was confirmed using a Northern blot approach. The miRNAs are encoded by genes with diverse organizations, representing mostly independent transcription units with or without introns. The intron-containing miRNA transcripts undergo complex splicing events to generate various spliced isoforms. We identified miRNAs that were encoded within introns of the noncoding genes MIR156g and MIR1126. Interestingly, the intron that encodes miR156g is spliced less efficiently than the intron encoding miR1126 from their specific precursors. miR397b-3p was detected in barley as a most probable functional miRNA, in contrast to rice where it has been identified as a complementary partner miRNA*. In the case of miR168a-5p/168a-3p, we found the generation of stable, mature molecules from both pre-miRNA arms, confirming evolutionary conservation of the stability of both species, as shown in rice and maize. We suggest that miR1120, located within the 3′ UTR of a protein-coding gene and described as a functional miRNA in wheat, may represent a siRNA generated from a mariner-like transposable element. Conclusions Seven of the

  17. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  18. Developmental regulation of ecdysone receptor (EcR and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Tathyana Rachel Palo Mello

    2014-12-01

    Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.

  19. Characterization of a chickpea (Cicer arietinum L.) NAC family gene, CarNAC5, which is both developmentally- and stress-regulated.

    Science.gov (United States)

    Peng, Hui; Cheng, Hui-Ying; Yu, Xin-Wang; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao

    2009-01-01

    It has been documented that the plant-specific NAC (for NAM, ATAF1,2 and CUC2) transcription factors play an important role in plant development and stress responses. In this study, a chickpea NAC gene CarNAC5 (for Cicer arietinum L. NAC gene 5) was isolated from a cDNA library from chickpea leaves treated by polyethylene glycol (PEG). CarNAC5, as a single/low copy gene, contained three exons and two introns within genomic DNA sequence and encoded a polypeptide with 291 amino acids. CarNAC5 protein had a conserved NAC domain in the N-terminus and showed high similarity to other NACs, especially ATAF subgroup members. The CarNAC5:GFP fusion protein was localized in the nucleus of onion epidermal cells. Furthermore, CarNAC5 protein activated the reporter genes LacZ and HIS3 in yeast. The transactivation activity was mapped to the C-terminal region. The transcripts of CarNAC5 appeared in many chickpea tissues including seedling leaves, stems, roots, flowers, seeds and pods, but mostly accumulated in flowers. Meanwhile, CarNAC5 was strongly expressed during seed maturation and in embryos of the early germinating seeds. It was also significantly induced by drought, heat, wounding, salicylic acid (SA), and indole-3-acetic acid (IAA) treatments. Our results suggest that CarNAC5 encodes a novel NAC-domain protein and acts as a transcriptional activator involved in plant developmental regulation and various stress responses.

  20. WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

    Science.gov (United States)

    Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

    2017-03-01

    Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Limb development: a paradigm of gene regulation.

    Science.gov (United States)

    Petit, Florence; Sears, Karen E; Ahituv, Nadav

    2017-04-01

    The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

  2. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    Science.gov (United States)

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  3. Transcription regulation of sex-biased genes during ontogeny in the malaria vector Anopheles gambiae.

    Directory of Open Access Journals (Sweden)

    Kalle Magnusson

    Full Text Available In Anopheles gambiae, sex-regulated genes are responsible for controlling gender dimorphism and are therefore crucial in determining the ability of female mosquitoes to transmit human malaria. The identification and functional characterization of these genes will shed light on the sexual development and maturation of mosquitoes and provide useful targets for genetic control measures aimed at reducing mosquito fertility and/or distorting the sex ratio.We conducted a genome wide transcriptional analysis of sex-regulated genes from early developmental stages through adulthood combined with functional screening of novel gonadal genes. Our results demonstrate that the male-biased genes undergo a major transcription turnover starting from larval stages to adulthood. The male biased genes at the adult stage include a significant high number of unique sequences compared to the rest of the genome. This is in contrast to female-biased genes that are much more conserved and are mainly activated during late developmental stages.The high frequency of unique sequences would indicate that male-biased genes evolve more rapidly than the rest of the genome. This finding is particularly intriguing because A. gambiae is a strictly female monogamous species suggesting that driving forces in addition to sperm competition must account for the rapid evolution of male-biased genes. We have also identified and functionally characterized a number of previously unknown A. gambiae testis- and ovary-specific genes. Two of these genes, zero population growth and a suppressor of defective silencing 3 domain of the histone deacetylase co-repressor complex, were shown to play a key role in gonad development.

  4. Identification and Transcription Profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): Developmental Regulation and Environmental Response

    Science.gov (United States)

    2014-12-18

    Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation and environmental response...7205 Email lmzhao@ufl.edu Abstract: The cDNA of a NADH dehydrogenase-ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus...information useful for developing dsRNA pesticide for mosquito control. Keywords: Aedes taeniorhynchus, AetNDUFS8, mRNA expression, development

  5. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    Science.gov (United States)

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  6. Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

    Science.gov (United States)

    Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

    2008-04-01

    The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

  7. The ribonuclease Dis3 is an essential regulator of the developmental transcriptome

    Directory of Open Access Journals (Sweden)

    Hou Dezhi

    2012-08-01

    Full Text Available Abstract Background Dis3 is ribonuclease that acts directly in the processing, turnover, and surveillance of a large number of distinct RNA species. Evolutionarily conserved from eubacteria to eukaryotes and a crucial component of the RNA processing exosome, Dis3 has been shown to be essential in yeast and fly S2 cells. However, it is not known whether Dis3 has essential functions in a metazoan. This study inquires whether Dis3 is required for Drosophila development and viability and how Dis3 regulates the transcriptome in the developing fly. Results Using transgenic flies, we show that Dis3 knock down (Dis3KD retards growth, induces melanotic tumor formation, and ultimately results in 2nd instar larval lethality. In order to determine whether Dis3KD fly phenotypes were a consequence of disrupting developmentally regulated RNA turnover, we performed RNA deep sequencing analysis on total RNA isolated from developmentally staged animals. Bioinformatic analysis of transcripts from Dis3KD flies reveals substantial transcriptomic changes, most notably down-regulation in early expressed RNAs. Finally, gene ontology analysis of this early stage shows that Dis3 regulates transcripts related to extracellular structure and remodelling, neurogenesis, and nucleotide metabolism. Conclusions We conclude that Dis3 is essential for early Drosophila melanogaster development and has specific and important stage-specific roles in regulating RNA metabolism. In showing for the first time that Dis3 is required for the development of a multicellular organism, our work provides mechanistic insight into how Dis3—either independent of or associated with the RNA processing exosome—participates in cell type-specific RNA turnover in metazoan development.

  8. Developmental gene expression profiles of the human pathogen Schistosoma japonicum

    Directory of Open Access Journals (Sweden)

    McManus Donald P

    2009-03-01

    Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.

  9. Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

    Science.gov (United States)

    Kovacs, Maria; Lopez-Duran, Nestor L

    2012-04-01

    For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

  10. RNAi Screen in Drosophila melanogastor Identifies Regulators of Steroidogenesis and Developmental Maturation

    DEFF Research Database (Denmark)

    Danielsen, Erik Thomas

    and duration required for juvenile-adult transition. This PhD project demonstrates the power of Drosophila genetics by taking an in vivo genome-wide RNAi screening approach to uncover genes required for the function of steroid producing tissue and developmental maturation. In total, 1909 genes were found...... to be required for the prothoracic gland function and affected the developmental timing for the juvenile-adult transition. Among the screen hits, we focused on an uncharacterized gene, sit (CG5278), which is highly expressed in the gland and is required for ecdysone production. Sit is a homolog of mammalian very...... flux of cholesterol uptake in the gland cells and affected the endosomal trafficking. Therefore this gene was suggested to be named stuck in traffic (sit). Sit’s role in cholesterol uptake was also supported by the observation that the developmental delayed phenotype from loss of sit expression...

  11. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  12. Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

    Directory of Open Access Journals (Sweden)

    Heying Zhou

    Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

  13. CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

    Science.gov (United States)

    Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

    2012-07-01

    Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

  14. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    Science.gov (United States)

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  15. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  16. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  17. Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

    Directory of Open Access Journals (Sweden)

    Vanessa C McFadden

    2017-02-01

    Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

  18. Identification of 2 novel genes developmentally regulated in the mouse aorta-gonad-mesonephros region

    NARCIS (Netherlands)

    C. Orelio; E.A. Dzierzak (Elaine)

    2003-01-01

    textabstractThe first adult-repopulating hematopoietic stem cells (HSCs) emerge in the mouse aorta-gonad-mesonephros (AGM) region at embryonic day 10.5 prior to their appearance in the yolk sac and fetal liver. Although several genes are implicated in the regulation of HSCs, there

  19. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

  20. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  1. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  2. Epigenetics and the Developmental Origins of Health and ...

    Science.gov (United States)

    Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.

  3. Developmental expression of the alpha-skeletal actin gene

    Directory of Open Access Journals (Sweden)

    Vonk Freek J

    2008-06-01

    Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

  4. One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

    Science.gov (United States)

    Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

    2009-01-01

    Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

  5. Developmental Regulation across the Life Span: Toward a New Synthesis

    Science.gov (United States)

    Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

    2013-01-01

    How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

  6. Detection of genes regulated by Lmx1b during limb dorsalization.

    Science.gov (United States)

    Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

    2012-05-01

    Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. © 2012 The Authors. Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  7. Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

    Science.gov (United States)

    Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

    2015-12-22

    Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

  8. Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

    Science.gov (United States)

    Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

    2017-01-01

    Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

  9. Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

    Science.gov (United States)

    Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

    2013-09-01

    Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    Science.gov (United States)

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

    2002-09-01

    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  11. IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

    Science.gov (United States)

    Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

    2016-08-01

    Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

  12. GCN5 Regulates FGF Signaling and Activates Selective MYC Target Genes during Early Embryoid Body Differentiation

    Directory of Open Access Journals (Sweden)

    Li Wang

    2018-01-01

    Full Text Available Precise control of gene expression during development is orchestrated by transcription factors and co-regulators including chromatin modifiers. How particular chromatin-modifying enzymes affect specific developmental processes is not well defined. Here, we report that GCN5, a histone acetyltransferase essential for embryonic development, is required for proper expression of multiple genes encoding components of the fibroblast growth factor (FGF signaling pathway in early embryoid bodies (EBs. Gcn5−/− EBs display deficient activation of ERK and p38, mislocalization of cytoskeletal components, and compromised capacity to differentiate toward mesodermal lineage. Genomic analyses identified seven genes as putative direct targets of GCN5 during early differentiation, four of which are cMYC targets. These findings established a link between GCN5 and the FGF signaling pathway and highlighted specific GCN5-MYC partnerships in gene regulation during early differentiation.

  13. Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens.

    Science.gov (United States)

    Lin, Shumao; Li, Hongmei; Mu, Heping; Luo, Wen; Li, Ying; Jia, Xinzheng; Wang, Sibing; Jia, Xiaolu; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

    2012-07-10

    A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3' untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. There is a critical miRNA, let-7b

  14. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta

    DEFF Research Database (Denmark)

    Rewitz, Kim; Rybczynski, Robert; Warren, James T.

    2006-01-01

    this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...

  15. Developmental evolution in social insects: regulatory networks from genes to societies.

    Science.gov (United States)

    Linksvayer, Timothy A; Fewell, Jennifer H; Gadau, Jürgen; Laubichler, Manfred D

    2012-05-01

    The evolution and development of complex phenotypes in social insect colonies, such as queen-worker dimorphism or division of labor, can, in our opinion, only be fully understood within an expanded mechanistic framework of Developmental Evolution. Conversely, social insects offer a fertile research area in which fundamental questions of Developmental Evolution can be addressed empirically. We review the concept of gene regulatory networks (GRNs) that aims to fully describe the battery of interacting genomic modules that are differentially expressed during the development of individual organisms. We discuss how distinct types of network models have been used to study different levels of biological organization in social insects, from GRNs to social networks. We propose that these hierarchical networks spanning different organizational levels from genes to societies should be integrated and incorporated into full GRN models to elucidate the evolutionary and developmental mechanisms underlying social insect phenotypes. Finally, we discuss prospects and approaches to achieve such an integration. © 2012 WILEY PERIODICALS, INC.

  16. Gene expression analysis in human osteoblasts exposed to dexamethasone identifies altered developmental pathways as putative drivers of osteoporosis

    Directory of Open Access Journals (Sweden)

    Sadlier Denise M

    2007-02-01

    Full Text Available Abstract Background Osteoporosis, a disease of decreased bone mineral density represents a significant and growing burden in the western world. Aging population structure and therapeutic use of glucocorticoids have contributed in no small way to the increase in the incidence of this disease. Despite substantial investigative efforts over the last number of years the exact molecular mechanism underpinning the initiation and progression of osteoporosis remain to be elucidated. This has meant that no significant advances in therapeutic strategies have emerged, with joint replacement surgery being the mainstay of treatment. Methods In this study we have used an integrated genomics profiling and computational biology based strategy to identify the key osteoblast genes and gene clusters whose expression is altered in response to dexamethasone exposure. Primary human osteoblasts were exposed to dexamethasone in vitro and microarray based transcriptome profiling completed. Results These studies identified approximately 500 osteoblast genes whose expression was altered. Functional characterization of the transcriptome identified developmental networks as being reactivated with 106 development associated genes found to be differentially regulated. Pathway reconstruction revealed coordinate alteration of members of the WNT signaling pathway, including frizzled-2, frizzled-7, DKK1 and WNT5B, whose differential expression in this setting was confirmed by real time PCR. Conclusion The WNT pathway is a key regulator of skeletogenesis as well as differentiation of bone cells. Reactivation of this pathway may lead to altered osteoblast activity resulting in decreased bone mineral density, the pathological hallmark of osteoporosis. The data herein lend weight to the hypothesis that alterations in developmental pathways drive the initiation and progression of osteoporosis.

  17. Analysis of a lin-42/period Null Allele Implicates All Three Isoforms in Regulation of Caenorhabditis elegans Molting and Developmental Timing

    Directory of Open Access Journals (Sweden)

    Theresa L. B. Edelman

    2016-12-01

    Full Text Available The Caenorhabditis elegans heterochronic gene pathway regulates the relative timing of events during postembryonic development. lin-42, the worm homolog of the circadian clock gene, period, is a critical element of this pathway. lin-42 function has been defined by a set of hypomorphic alleles that cause precocious phenotypes, in which later developmental events, such as the terminal differentiation of hypodermal cells, occur too early. A subset of alleles also reveals a significant role for lin-42 in molting; larval stages are lengthened and ecdysis often fails in these mutant animals. lin-42 is a complex locus, encoding overlapping and nonoverlapping isoforms. Although existing alleles that affect subsets of isoforms have illuminated important and distinct roles for this gene in developmental timing, molting, and the decision to enter the alternative dauer state, it is essential to have a null allele to understand all of the roles of lin-42 and its individual isoforms. To remedy this problem and discover the null phenotype, we engineered an allele that deletes the entire lin-42 protein-coding region. lin-42 null mutants are homozygously viable, but have more severe phenotypes than observed in previously characterized hypomorphic alleles. We also provide additional evidence for this conclusion by using the null allele as a base for reintroducing different isoforms, showing that each isoform can provide heterochronic and molting pathway activities. Transcript levels of the nonoverlapping isoforms appear to be under coordinate temporal regulation, despite being driven by independent promoters. The lin-42 null allele will continue to be an important tool for dissecting the functions of lin-42 in molting and developmental timing.

  18. Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

    Science.gov (United States)

    Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

    2016-01-01

    Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

  19. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  20. Mig-6 regulates endometrial genes involved in cell cycle and progesterone signaling

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jung-Yoon; Kim, Tae Hoon; Lee, Jae Hee [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Dunwoodie, Sally L. [Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, Darlinghurst, New South Wales 2010 (Australia); St. Vincent' s Clinical School and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Kensington, New South Wales 2033 (Australia); Ku, Bon Jeong, E-mail: bonjeong@cnu.ac.kr [Department of Internal Medicine, Chungnam National University School of Medicine, Daejeon (Korea, Republic of); Jeong, Jae-Wook, E-mail: JaeWook.Jeong@hc.msu.edu [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Department of Women' s Health, Spectrum Health System, Grand Rapids, MI (United States)

    2015-07-10

    Mitogen inducible gene 6 (Mig-6) is an important mediator of progesterone (P4) signaling to inhibit estrogen (E2) signaling in the uterus. Ablation of Mig-6 in the murine uterus leads to the development of endometrial hyperplasia and E2-induced endometrial cancer. To identify the molecular pathways regulated by Mig-6, we performed microarray analysis on the uterus of ovariectomized Mig-6{sup f/f} and PGR{sup cre/+}Mig-6{sup f/f} (Mig-6{sup d/d}) mice treated with vehicle or P4 for 6 h. The results revealed that 772 transcripts were significantly regulated in the Mig-6{sup d/d} uterus treated with vehicle as compared with Mig-6{sup f/f} mice. The pathway analysis showed that Mig-6 suppressed the expression of gene-related cell cycle regulation in the absence of ovarian steroid hormone. The epithelium of Mig-6{sup d/d} mice showed a significant increase in the number of proliferative cells compared to Mig-6{sup f/f} mice. This microarray analysis also revealed that 324 genes are regulated by P4 as well as Mig-6. Cited2, the developmentally important transcription factor, was identified as being regulated by the P4-Mig-6 axis. To determine the role of Cited2 in the uterus, we used the mice with Cited2 that were conditionally ablated in progesterone receptor-positive cells (PGR{sup cre/+}Cited2{sup f/f}; Cited2{sup d/d}). Ablation of Cited2 in the uterus resulted in a significant reduction in the ability of the uterus to undergo a hormonally induced decidual reaction. Identification and analysis of these responsive genes will help define the role of P4 as well as Mig-6 in regulating uterine biology. - Highlights: • We identify Mig-6- and P4-regulated uterine genes by microarray analysis. • Mig-6 suppresses cell cycle progression and epithelial cell proliferation in uterus. • We identify the Mig-6 dependent induced genes by P4. • Cited2 plays an important role for decidualization as a P4 and Mig-6 target gene.

  1. Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

    Directory of Open Access Journals (Sweden)

    Westerdahl Ann-Charlotte

    2010-06-01

    Full Text Available Abstract Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper

  2. Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

    Science.gov (United States)

    Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

    2010-06-09

    Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be

  3. Robustness and accuracy in sea urchin developmental gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Smadar eBen-Tabou De-Leon

    2016-02-01

    Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  4. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  5. Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

    Science.gov (United States)

    Sundararajan, Vignesh; Civetta, Alberto

    2011-01-01

    Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

  6. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  7. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  8. Developmental control of hypoxia during bud burst in grapevine.

    Science.gov (United States)

    Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

    2018-05-01

    Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

  9. An oscillopathic approach to developmental dyslexia: From genes to speech processing.

    Science.gov (United States)

    Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio

    2017-06-30

    Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. A single cis element maintains repression of the key developmental regulator Gata2.

    Directory of Open Access Journals (Sweden)

    Jonathan W Snow

    2010-09-01

    Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

  11. A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

    Science.gov (United States)

    Kück, Ulrich

    2005-10-01

    Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

  12. Zfp206 regulates ES cell gene expression and differentiation.

    Science.gov (United States)

    Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R

    2006-01-01

    Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

  13. A novel lens epithelium gene, LEP503, is highly conserved in different vertebrate species and is developmentally regulated in postnatal rat lens.

    Science.gov (United States)

    Wen, Y; Sachs, G; Athmann, C

    2000-02-01

    The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.

  14. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    International Nuclear Information System (INIS)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.

    2008-01-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

  15. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Directory of Open Access Journals (Sweden)

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  16. Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

    Science.gov (United States)

    Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

    2016-02-01

    Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life

  17. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    Science.gov (United States)

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

    2018-05-01

    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. CFP1 Regulates Histone H3K4 Trimethylation and Developmental Potential in Mouse Oocytes

    Directory of Open Access Journals (Sweden)

    Chao Yu

    2017-08-01

    Full Text Available Trimethylation of histone H3 at lysine-4 (H3K4me3 is associated with eukaryotic gene promoters and poises their transcriptional activation during development. To examine the in vivo function of H3K4me3 in the absence of DNA replication, we deleted CXXC finger protein 1 (CFP1, the DNA-binding subunit of the SETD1 histone H3K4 methyltransferase, in developing oocytes. We find that CFP1 is required for H3K4me3 accumulation and the deposition of histone variants onto chromatin during oocyte maturation. Decreased H3K4me3 in oocytes caused global downregulation of transcription activity. Oocytes lacking CFP1 failed to complete maturation and were unable to gain developmental competence after fertilization, due to defects in cytoplasmic lattice formation, meiotic division, and maternal-zygotic transition. Our study highlights the importance of H3K4me3 in continuous histone replacement for transcriptional regulation, chromatin remodeling, and normal developmental progression in a non-replicative system.

  19. PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes.

    Science.gov (United States)

    Soto-Feliciano, Yadira M; Bartlebaugh, Jordan M E; Liu, Yunpeng; Sánchez-Rivera, Francisco J; Bhutkar, Arjun; Weintraub, Abraham S; Buenrostro, Jason D; Cheng, Christine S; Regev, Aviv; Jacks, Tyler E; Young, Richard A; Hemann, Michael T

    2017-05-15

    Developmental and lineage plasticity have been observed in numerous malignancies and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the plant homeodomain finger protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alteration of the chromatin landscape at the transcriptional start sites of B-cell- and T-cell-specific factors. Additionally, Phf6 KO cells show significant down-regulation of genes involved in the development and function of normal B cells, show up-regulation of genes involved in T-cell signaling, and give rise to mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. © 2017 Soto-Feliciano et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    Science.gov (United States)

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

    2012-01-01

    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  1. Hydroxylated PBDEs induce developmental arrest in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu; Bruce, Erica D., E-mail: Erica_bruce@baylor.edu

    2012-07-01

    The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was not observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.

  2. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  3. Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

    Science.gov (United States)

    Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro

    2009-01-01

    Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

  4. Regulation of the Drosophila Enhancer of split and invected-engrailed gene complexes by sister chromatid cohesion proteins.

    Directory of Open Access Journals (Sweden)

    Cheri A Schaaf

    2009-07-01

    Full Text Available The cohesin protein complex was first recognized for holding sister chromatids together and ensuring proper chromosome segregation. Cohesin also regulates gene expression, but the mechanisms are unknown. Cohesin associates preferentially with active genes, and is generally absent from regions in which histone H3 is methylated by the Enhancer of zeste [E(z] Polycomb group silencing protein. Here we show that transcription is hypersensitive to cohesin levels in two exceptional cases where cohesin and the E(z-mediated histone methylation simultaneously coat the entire Enhancer of split and invected-engrailed gene complexes in cells derived from Drosophila central nervous system. These gene complexes are modestly transcribed, and produce seven of the twelve transcripts that increase the most with cohesin knockdown genome-wide. Cohesin mutations alter eye development in the same manner as increased Enhancer of split activity, suggesting that similar regulation occurs in vivo. We propose that cohesin helps restrain transcription of these gene complexes, and that deregulation of similarly cohesin-hypersensitive genes may underlie developmental deficits in Cornelia de Lange syndrome.

  5. Neuroendocrine Regulation of Maternal Behavior

    Science.gov (United States)

    Bridges, Robert S.

    2015-01-01

    The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107

  6. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Directory of Open Access Journals (Sweden)

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  7. Comparison of 454-ESTs from Huperzia serrata and Phlegmariurus carinatus reveals putative genes involved in lycopodium alkaloid biosynthesis and developmental regulation

    Directory of Open Access Journals (Sweden)

    Steinmetz André

    2010-09-01

    . serrata and P. carinatus 454-ESTs and real-time PCR analysis. Four unique putative CYP450 transcripts (Hs01891, Hs04010, Hs13557 and Hs00093 which are the most likely to be involved in the biosynthesis of lycopodium alkaloids were selected based on a phylogenetic analysis. Approximately 115 H. serrata and 98 P. carinatus unique putative transcripts associated with the biosynthesis of triterpenoids, alkaloids and flavones/flavonoids were located in the 454-EST datasets. Transcripts related to phytohormone biosynthesis and signal transduction as well as transcription factors were also obtained. In addition, we discovered 2,729 and 1,573 potential SSR-motif microsatellite loci in the H. serrata and P. carinatus 454-ESTs, respectively. Conclusions The 454-EST resource allowed for the first large-scale acquisition of ESTs from H. serrata and P. carinatus, which are representative members of the Huperziaceae family. We discovered many genes likely to be involved in the biosynthesis of bioactive compounds and transcriptional regulation as well as a large number of potential microsatellite markers. These results constitute an essential resource for understanding the molecular basis of developmental regulation and secondary metabolite biosynthesis (especially that of lycopodium alkaloids in the Huperziaceae, and they provide an overview of the genetic diversity of this family.

  8. Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo

    International Nuclear Information System (INIS)

    Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu

    2016-01-01

    Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.

  9. Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

    Directory of Open Access Journals (Sweden)

    Feng Ding

    Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

  10. In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.

    Directory of Open Access Journals (Sweden)

    Juan Du

    Full Text Available Hedgehog (Hh signaling is highly conserved in all metazoan animals and plays critical roles in many developmental processes. Dysregulation of the Hh signaling cascade has been implicated in many diseases, including cancer. Although key components of the Hh pathway have been identified, significant gaps remain in our understanding of the regulation of individual Hh signaling molecules. Here, we report the identification of novel regulators of the Hh pathway, obtained from an in vivo RNA interference (RNAi screen in Drosophila. By selectively targeting critical genes functioning in post-translational modification systems utilizing ubiquitin (Ub and Ub-like proteins, we identify two novel genes (dUba3 and dUbc12 that negatively regulate Hh signaling activity. We provide in vivo and in vitro evidence illustrating that dUba3 and dUbc12 are essential components of the neddylation pathway; they function in an enzyme cascade to conjugate the ubiquitin-like NEDD8 modifier to Cullin proteins. Neddylation activates the Cullin-containing ubiquitin ligase complex, which in turn promotes the degradation of Cubitus interruptus (Ci, the downstream transcription factor of the Hh pathway. Our study reveals a conserved molecular mechanism of the neddylation pathway in Drosophila and sheds light on the complex post-translational regulations in Hh signaling.

  11. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  12. A tale with a Twist: a developmental gene with potential relevance for metabolic dysfunction and inflammation in adipose tissue

    Directory of Open Access Journals (Sweden)

    Anca Dana Dobrian

    2012-08-01

    Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.

  13. Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

    Energy Technology Data Exchange (ETDEWEB)

    Henrique Barreta, Marcos [Universidade Federal de Santa Catarina, Campus Universitario de Curitibanos, Curitibanos, SC (Brazil); Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Ferreira, Rogerio [Centro de Educacao Superior do Oeste-Universidade do Estado de Santa Catarina, Chapeco, SC (Brazil); Oliveira, Joao Francisco de; Goncalves, Paulo Bayard Dias [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Bordignon, Vilceu, E-mail: vilceu.bordignon@mcgill.ca [Department of Animal Science, McGill University, Ste-Anne-De-Bellevue, QC (Canada)

    2012-10-01

    This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.

  14. Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

    International Nuclear Information System (INIS)

    Henrique Barreta, Marcos; Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de; Ferreira, Rogério; Oliveira, João Francisco de; Gonçalves, Paulo Bayard Dias; Bordignon, Vilceu

    2012-01-01

    This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.

  15. Regulation of C. elegans L4 cuticle collagen genes by the heterochronic protein LIN-29.

    Science.gov (United States)

    Abete-Luzi, Patricia; Eisenmann, David M

    2018-05-01

    The cuticle, the outer covering of the nematode C. elegans, is synthesized five times during the worm's life by the underlying hypodermis. Cuticle collagens, the major cuticle component, are encoded by a large family of col genes and, interestingly, many of these genes express predominantly at a single developmental stage. This temporal preference motivated us to investigate the mechanisms underlying col gene expression and here we focus on a subset of col genes expressed in the L4 stage. We identified minimal promoter regions of <300 bp for col-38, col-49, and col-63. In these regions, we predicted cis-regulatory sequences and evaluated their function in vivo via mutagenesis of a col-38p::yfp reporter. We used RNAi to study the requirement for candidate transcription regulators ELT-1 and ELT-3, LIN-29, and the LIN-29 co-factor MAB-10, and found LIN-29 to be necessary for the expression of four L4-specific genes (col-38, col-49, col-63, and col-138). Temporal misexpression of LIN-29 was also sufficient to activate these genes at a different developmental stage. The LIN-29 DNA-binding domain bound the col-38, col-49, and col-63 minimal promoters in vitro. For col-38 we showed that the LIN-29 sites necessary for reporter expression in vivo are also bound in vitro: this is the first identification of specific binding sites for LIN-29 necessary for in vivo target gene expression. © 2018 Wiley Periodicals, Inc.

  16. Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.

    Science.gov (United States)

    Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A

    2016-04-01

    A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues.

    Directory of Open Access Journals (Sweden)

    Daifeng Cheng

    Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.

  18. Atrial natriuretic peptide regulates Ca channel in early developmental cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Lin Miao

    Full Text Available BACKGROUND: Cardiomyocytes derived from murine embryonic stem (ES cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP in regulation of membrane potentials and Ca(2+ currents has not been investigated in developmental cardiomyocytes. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the role of ANP in regulating L-type Ca(2+ channel current (I(CaL in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs in early developmental stage (EDS cardiomyocytes, embryonic bodies (EB as well as whole embryo hearts. ANP exerted an inhibitory effect on basal I(CaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS cells. However, after stimulation of I(CaL by isoproterenol (ISO in LDS cells, ANP inhibited the response in about 70% cells. The depression of I(CaL induced by ANP was not affected by either Nomega, Nitro-L-Arginine methyl ester (L-NAME, a nitric oxide synthetase (NOS inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG selective inhibitor, in either EDS and LDS cells; whereas depression of I(CaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl adenine (EHNA, a selective inhibitor of type 2 phosphodiesterase(PDE2 in most cells tested. CONCLUSION/SIGNIFICANCES: Taken together, these results indicate that ANP induced depression of action potentials and I(CaL is due to activation of particulate guanylyl cyclase (GC, cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3', 5'-cyclic monophophate (cAMP-cAMP-dependent protein kinase (PKA in early cardiomyogenesis.

  19. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

  20. Dynamic regulation of mRNA and miRNA associated with the developmental stages of skin pigmentation in Japanese ornamental carp.

    Science.gov (United States)

    Tian, Xue; Pang, Xiaolei; Wang, Liangyan; Li, Mengrong; Dong, Chuanju; Ma, Xiao; Wang, Lei; Song, Dongying; Feng, Jianxin; Xu, Peng; Li, Xuejun

    2018-04-20

    The Japanese ornamental carp (Cyprinus carpio var. Koi) is famous for multifarious colors and patterns, making it commonly culture and trade across the world. Although functional genes and inheritance of color traits have been commonly studied, seldom attentions were focused on the genetic regulation during the developmental process of pigmentation. To better understand the mechanism of skin color development, we observed the morphogenesis of pigment cells during the post-embryonic stages and analysed the temporal expression pattern of mRNAs/miRNAs profiles in four distinct developmental stages. 59 and 103 differentially expressed genes/miRNAs (DEGs/DEMs) associated with pigmentation and skin were identified, including pax7, mitf, tyr, tyrp1, etc., and the highest DEGs were detected at 11 days post hatching (dph). In addition, the functional characteristics of mRNAs/miRNAs associated with pteridine and carotenoid pathway were also examined. Furthermore, 65 miRNA-mRNA interaction pairs related to pigmentation, pteridines and carotenoids metabolism were detected between different stages. Interestingly, the largest pairs appeared in the transition from 11 dph to 48 dph, which had the similar trend with DEGs further manifesting the importance of 11 dph. This study produced a comprehensive programme of DEGs/DEMs during color development, which will provide resources to understand the regulation mechanism in color formation. The understanding of genetic basis in color formation might promote the production and breeding of the Koi carp. Copyright © 2017. Published by Elsevier B.V.

  1. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

    Science.gov (United States)

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

    2015-11-01

    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  2. Regulation of somatic embryo development in Norway spruce (Picea abies). A molecular approach to the characterization of specific developmental stages

    Energy Technology Data Exchange (ETDEWEB)

    Sabala, I. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics

    1998-12-31

    Embryo development is a complex process involving a set of strictly regulated events. The regulation of these events is poorly understood especially during the early stages of embryo development. Somatic embryos go through the same developmental stages as zygotic embryos making them an ideal model system for studying the regulation of embryo development. We have used embryogenic cultures of Picea abies to study some aspects of the regulation of embryo development in gymnosperms. The bottle neck during somatic embryogenesis is the switch from the proliferation stage to the maturation stage. This switch is initiated by giving somatic embryos a maturation treatment i.e. the embryos are treated with abscisic acid (ABA). Somatic embryos which respond to ABA by forming mature somatic embryos were stimulated to secret a 70 kDa protein, AF70. The af70 gene was isolated and characterised. The expression of the af70 gene was constitutive in embryos but was highly ABA-induced in seedlings. Moreover, expression of this gene was stimulated during cold acclimation of Picea abies seedlings. A full length Picea abies cDNA clone Pa18, encoding a protein with the characteristics of plant lipid transfer proteins (LTPs), was isolated and characterised. The Pa18 gene is constitutively expressed in embryogenic cultures of Picea abies representing different stages of development as well as in nonembryogenic callus and seedlings. In situ hybridization showed that Pa18 gene is expressed in all embryonic cells of proliferating somatic embryos but the expression of the gene in mature somatic and zygotic embryos is restricted to the outer cell layer. Southern blot analysis at different stringencies was consistent with a single gene. An alteration in expression of Pa18 causes disturbance in the formation of the proper outer cell layer in the maturing somatic embryos. In addition to its influence on embryo development the Pa18 gene product also inhibits growth of Agrobacterium tumefaciens 195

  3. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.

    Directory of Open Access Journals (Sweden)

    Vijee Mohan

    Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.

  4. A retinoblastoma orthologue is a major regulator of S-phase, mitotic, and developmental gene expression in Dictyostelium.

    Directory of Open Access Journals (Sweden)

    Kimchi Strasser

    Full Text Available The retinoblastoma tumour suppressor, Rb, has two major functions. First, it represses genes whose products are required for S-phase entry and progression thus stabilizing cells in G1. Second, Rb interacts with factors that induce cell-cycle exit and terminal differentiation. Dictyostelium lacks a G1 phase in its cell cycle but it has a retinoblastoma orthologue, rblA.Using microarray analysis and mRNA-Seq transcriptional profiling, we show that RblA strongly represses genes whose products are involved in S phase and mitosis. Both S-phase and mitotic genes are upregulated at a single point in late G2 and again in mid-development, near the time when cell cycling is reactivated. RblA also activates a set of genes unique to slime moulds that function in terminal differentiation.Like its mammalian counterpart Dictyostelium, RblA plays a dual role, regulating cell-cycle progression and transcriptional events leading to terminal differentiation. In the absence of a G1 phase, however, RblA functions in late G2 controlling the expression of both S-phase and mitotic genes.

  5. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    Science.gov (United States)

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  6. The evolution of Msx gene function: expression and regulation of a sea urchin Msx class homeobox gene.

    Science.gov (United States)

    Dobias, S L; Ma, L; Wu, H; Bell, J R; Maxson, R

    1997-01-01

    Msx- class homeobox genes, characterized by a distinct and highly conserved homeodomain, have been identified in a wide variety of metazoans from vertebrates to coelenterates. Although there is evidence that they participate in inductive tissue interactions that underlie vertebrate organogenesis, including those that pattern the neural crest, there is little information about their function in simple deuterostomes. Both to learn more about the ancient function of Msx genes, and to shed light on the evolution of developmental mechanisms within the lineage that gave rise to vertebrates, we have isolated and characterized Msx genes from ascidians and echinoderms. Here we describe the sequence and expression of a sea urchin (Strongylocentrotus purpouratus) Msx gene whose homeodomain is very similar to that of vertebrate Msx2. This gene, designated SpMsx, is first expressed in blastula stage embryos, apparently in a non-localized manner. Subsequently, during the early phases of gastrulation, SpMsx transcripts are expressed intensely in the invaginating archenteron and secondary mesenchyme, and at reduced levels in the ectoderm. In the latter part of gastrulation, SpMsx transcripts are concentrated in the oral ectoderm and gut, and continue to be expressed at those sites through the remainder of embryonic development. That vertebrate Msx genes are regulated by inductive tissue interactions and growth factors suggested to us that the restriction of SpMsx gene expression to the oral ectoderm and derivatives of the vegetal plate might similarly be regulated by the series of signaling events that pattern these embryonic territories. As a first test of this hypothesis, we examined the influence of exogastrulation and cell-dissociation on SpMsx gene expression. In experimentally-induced exogastrulae, SpMsx transcripts were distributed normally in the oral ectoderm, evaginated gut, and secondary mesenchyme. However, when embryos were dissociated into their component cells, Sp

  7. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  8. The search for evolutionary developmental origins of aging in zebrafish: a novel intersection of developmental and senescence biology in the zebrafish model system.

    Science.gov (United States)

    Kishi, Shuji

    2011-09-01

    regulation. We wish to ascertain whether we can identify such genes promptly in a comprehensive manner. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. Copyright © 2011 Wiley-Liss, Inc.

  9. Photoperiodic regulation of the sucrose transporter StSUT4 affects the expression of circadian-regulated genes and ethylene production

    Directory of Open Access Journals (Sweden)

    Izabela eChincinska

    2013-02-01

    Full Text Available Several recent publications report different subcellular localisation of members of the SUT4 subfamily of sucrose transporters. The physiological function of SUT4 sucrose transporters is still not entirely clarified as down-regulation of members of the SUT4 clade had very different effects in rice, poplar and potato. Here, we provide new data on the localization and function of the Solanaceous StSUT4 protein, further elucidating involvement in the onset of flowering, tuberization and in the shade avoidance syndrome of potato plants.Induction of early flowering and tuberization in SUT4-inhibited potato plants correlates with increased sucrose export from leaves and increased sucrose and starch accumulation in terminal sink organs such as developing tubers. SUT4 does not only affect the expression of gibberellin and ethylene biosynthetic enzymes, but also the rate of ethylene synthesis in potato. In SUT4-inhibited plants, the ethylene production no longer follows a diurnal rhythm, leading to the assumption that StSUT4 controls circadian gene expression, potentially by regulating sucrose export from leaves. Furthermore, SUT4 expression affects clock-regulated genes such as StFT, StSOC1 and StCO, which might also be involved in a photoperiod-dependently controlled tuberization. A model is proposed in which StSUT4 controls a phloem-mobile signalling molecule generated in leaves which together with enhanced sucrose export affects developmental switches in apical meristems. SUT4 seems to link photoreceptor-perceived information about the light quality and day length, with phytohormone biosynthesis and the expression of circadian genes.

  10. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes

    Science.gov (United States)

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

    2018-01-01

    Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203

  11. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.

    Science.gov (United States)

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

    2018-04-01

    The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.

  12. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    Science.gov (United States)

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  13. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Energy Technology Data Exchange (ETDEWEB)

    Lichtensteiger, W; Faass, O; Ceccatelli, R; Schlumpf, M [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology

    2004-09-15

    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  14. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    Science.gov (United States)

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  15. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  16. Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

    Science.gov (United States)

    Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

    2018-01-01

    Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

  17. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  18. Effects of Larval Density on Gene Regulation in Caenorhabditis elegans During Routine L1 Synchronization.

    Science.gov (United States)

    Chan, Io Long; Rando, Oliver J; Conine, Colin C

    2018-05-04

    Bleaching gravid C. elegans followed by a short period of starvation of the L1 larvae is a routine method performed by worm researchers for generating synchronous populations for experiments. During the process of investigating dietary effects on gene regulation in L1 stage worms by single-worm RNA-Seq, we found that the density of resuspended L1 larvae affects expression of many mRNAs. Specifically, a number of genes related to metabolism and signaling are highly expressed in worms arrested at low density, but are repressed at higher arrest densities. We generated a GFP reporter strain based on one of the most density-dependent genes in our dataset - lips-15 - and confirmed that this reporter was expressed specifically in worms arrested at relatively low density. Finally, we show that conditioned media from high density L1 cultures was able to downregulate lips-15 even in L1 animals arrested at low density, and experiments using daf-22 mutant animals demonstrated that this effect is not mediated by the ascaroside family of signaling pheromones. Together, our data implicate a soluble signaling molecule in density sensing by L1 stage C. elegans , and provide guidance for design of experiments focused on early developmental gene regulation. Copyright © 2018 Chan et al.

  19. Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

    Science.gov (United States)

    Blume, B; Grierson, D

    1997-10-01

    The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

  20. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  1. Intermediate filaments and gene regulation.

    Science.gov (United States)

    Traub, P

    1995-01-01

    The biological role of intermediate filaments (IFs) of eukaryotic cells is still a matter of conjecture. On the basis of immunofluorescence and electron microscopic observations, they appear to play a cytoskeletal role in that they stabilize cellular structure and organize the distribution and interactions of intracellular organelles and components. The expression of a large number of cell type-specific and developmentally regulated subunit proteins is believed to provide multicellular organisms with different IF systems capable of differential interactions with the various substructures and components of their multiple, differentiated cells. However, the destruction of distinct IF systems by manipulation of cultured cells or by knock-out mutation of IF subunit proteins in transgenic mice exerts relatively little influence on cellular morphology and physiology and on development of mutant animals. In order to rationalize this dilemma, the cytoskeletal concept of IF function has been extended to purport that cytoplasmic (c) IFs and their subunit proteins also play fundamental roles in gene regulation. It is based on the in vitro capacity of cIF(protein)s to interact with guanine-rich, single-stranded DNA, supercoiled DNA and histones, as well as on their close structural relatedness to gene-regulatory DNA-binding and nuclear matrix proteins. Since cIF proteins do not possess classical nuclear localization signals, it is proposed that cIFs directly penetrate the double nuclear membrane, exploiting the amphiphilic, membrane-active character of their subunit proteins. Since they can establish metastable multisite contacts with nuclear matrix structures and/or chromatin areas containing highly repetitive DNA sequence elements at the nuclear periphery, they are supposed to participate in chromosome distribution and chromatin organization in interphase nuclei of differentiated cells. Owing to their different DNA-binding specificities, the various cIF systems may in this

  2. Toward epigenetic and gene regulation models of specific language impairment: looking for links among growth, genes, and impairments

    Directory of Open Access Journals (Sweden)

    Rice Mabel L

    2012-11-01

    Full Text Available Abstract Children with specific language impairment (SLI are thought to have an inherited form of language impairment that spares other developmental domains. SLI shows strong heritability and recent linkage and association studies have replicated results for candidate genes. Regulatory regions of the genes may be involved. Behavioral growth models of language development of children with SLI reveal that the onset of language is delayed, and the growth trajectories of children with SLI parallel those of younger children without SLI. The rate of language acquisition decelerates in the pre-adolescent period, resulting in immature language levels for the children with SLI that persist into adolescence and beyond. Recent genetic and epigenetic discoveries and models relevant to language impairment are reviewed. T cell regulation of onset, acceleration, and deceleration signaling are described as potential conceptual parallels to the growth timing elements of language acquisition and impairment. A growth signaling disruption (GSD hypothesis is proposed for SLI, which posits that faulty timing mechanisms at the cellular level, intrinsic to neurocortical functioning essential for language onset and growth regulation, are at the core of the growth outcomes of SLI. The GSD highlights the need to document and account for growth patterns over childhood and suggests needed directions for future investigation.

  3. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Li, Bo; Fang, Lusheng; Li, Bo

    2011-01-01

    To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene...... is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  4. Global identification of bursicon-regulated genes in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Beerntsen Brenda

    2008-09-01

    Full Text Available Abstract Background Bursicon is a heterodimer neuropeptide responsible for regulating cuticle sclerotization and wing expansion in several insect species. Recent studies indicate that the action of bursicon is mediated by a specific G protein-coupled receptor DLGR2 and the cAMP/PKA signaling pathway. However, little is known regarding the genes that are regulated by bursicon. The identification of bursicon-regulated genes is the focus of this investigation. Results We used DNA microarray analysis to identify bursicon-regulated genes in neck-ligated flies (Drosophila melanogaster that received recombinant bursicon (r-bursicon. Fifty four genes were found to be regulated by bursicon 1 h post r-bursicon injection, 52 being up-regulated and 2 down-regulated while 33 genes were influenced by r-bursicon 3 h post-injection (24 up-regulated and 9 down-regulated genes. Analysis of these genes by inference from the fly database http://flybase.bio.indiana.edu revealed that these genes encode proteins with diverse functions, including cell signaling, gene transcription, DNA/RNA binding, ion trafficking, proteolysis-peptidolysis, metabolism, cytoskeleton formation, immune response and cell-adhesion. Twenty eight genes randomly selected from the microarray-identified list were verified by real time PCR (qPCR which supported the microarray data. Temporal response studies of 13 identified and verified genes by qPCR revealed that the temporal expression patterns of these genes are consistent with the microarray data. Conclusion Using r-bursicon, we identified 87 genes that are regulated by bursicon, 30 of which have no previously known function. Most importantly, all genes randomly selected from the microarray-identified list were verified by real time PCR. Temporal analysis of 13 verified genes revealed that the expression of these genes was indeed induced by bursicon and correlated well with the cuticle sclerotization process. The composite data suggest that

  5. Regulation, overexpression, and target gene identification of Potato Homeobox 15 (POTH15) – a class-I KNOX gene in potato

    Science.gov (United States)

    Mahajan, Ameya S.; Kondhare, Kirtikumar R.; Rajabhoj, Mohit P.; Kumar, Amit; Ghate, Tejashree; Ravindran, Nevedha; Habib, Farhat; Siddappa, Sundaresha; Banerjee, Anjan K.

    2016-01-01

    Potato Homeobox 15 (POTH15) is a KNOX-I (Knotted1-like homeobox) family gene in potato that is orthologous to Shoot Meristemless (STM) in Arabidopsis. Despite numerous reports on KNOX genes from different species, studies in potato are limited. Here, we describe photoperiodic regulation of POTH15, its overexpression phenotype, and identification of its potential targets in potato (Solanum tuberosum ssp. andigena). qRT-PCR analysis showed a higher abundance of POTH15 mRNA in shoot tips and stolons under tuber-inducing short-day conditions. POTH15 promoter activity was detected in apical and axillary meristems, stolon tips, tuber eyes, and meristems of tuber sprouts, indicating its role in meristem maintenance and leaf development. POTH15 overexpression altered multiple morphological traits including leaf and stem development, leaflet number, and number of nodes and branches. In particular, the rachis of the leaf was completely reduced and leaves appeared as a bouquet of leaflets. Comparative transcriptomic analysis of 35S::GUS and two POTH15 overexpression lines identified more than 6000 differentially expressed genes, including 2014 common genes between the two overexpression lines. Functional analysis of these genes revealed their involvement in responses to hormones, biotic/abiotic stresses, transcription regulation, and signal transduction. qRT-PCR of selected candidate target genes validated their differential expression in both overexpression lines. Out of 200 randomly chosen POTH15 targets, 173 were found to have at least one tandem TGAC core motif, characteristic of KNOX interaction, within 3.0kb in the upstream sequence of the transcription start site. Overall, this study provides insights to the role of POTH15 in controlling diverse developmental processes in potato. PMID:27217546

  6. Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

    Science.gov (United States)

    Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab

    2015-09-04

    A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our

  7. Developmental and genetic modulation of arsenic biotransformation: A gene by environment interaction?

    International Nuclear Information System (INIS)

    Meza, Mercedes; Gandolfi, A. Jay; Klimecki, Walter T.

    2007-01-01

    The complexity of arsenic toxicology has confounded the identification of specific pathways of disease causation. One focal point of arsenic research is aimed at fully characterizing arsenic biotransformation in humans, a process that appears to be quite variable, producing a mixture of several arsenic species with greatly differing toxic potencies. In an effort to characterize genetic determinants of variability in arsenic biotransformation, a genetic association study of 135 subjects in western Sonora, Mexico was performed by testing 23 polymorphic sites in three arsenic biotransformation candidate genes. One gene, arsenic 3 methyltransferase (AS3MT), was strongly associated with the ratio of urinary dimethylarsinic acid to monomethylarsonic acid (D/M) in children (7-11 years) but not in adults (18-79 years). Subsequent analyses revealed that the high D/M values associated with variant AS3MT alleles were primarily due to lower levels of monomethylarsonic acid as percent of total urinary arsenic (%MMA5). In light of several reports of arsenic-induced disease being associated with relatively high %MMA5 levels, these findings raise the possibility that variant AS3MT individuals may suffer less risk from arsenic exposure than non-variant individuals. These analyses also provide evidence that, in this population, regardless of AS3MT variant status, children tend to have lower %MMA5 values than adults, suggesting that the global developmental regulation of arsenic biotransformation may interact with genetic variants in metabolic genes to result in novel genetic effects such as those in this report

  8. Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

    Science.gov (United States)

    Eickelberg, Garrett J; Fisher, Alison J

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

  9. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Directory of Open Access Journals (Sweden)

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  10. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Science.gov (United States)

    Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

    2012-01-01

    Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  11. CEP genes regulate root and shoot development in response to environmental cues and are specific to seed plants.

    Science.gov (United States)

    Delay, Christina; Imin, Nijat; Djordjevic, Michael A

    2013-12-01

    The manifestation of repetitive developmental programmes during plant growth can be adjusted in response to various environmental cues. During root development, this means being able to precisely control root growth and lateral root development. Small signalling peptides have been found to play roles in many aspects of root development. One member of the CEP (C-TERMINALLY ENCODED PEPTIDE) gene family has been shown to arrest root growth. Here we report that CEP genes are widespread among seed plants but are not present in land plants that lack true branching roots or root vasculature. We have identified 10 additional CEP genes in Arabidopsis. Expression analysis revealed that CEP genes are regulated by environmental cues such as nitrogen limitation, increased salt levels, increased osmotic strength, and increased CO2 levels in both roots and shoots. Analysis of synthetic CEP variants showed that both peptide sequence and modifications of key amino acids affect CEP biological activity. Analysis of several CEP over-expression lines revealed distinct roles for CEP genes in root and shoot development. A cep3 knockout mutant showed increased root and shoot growth under a range of abiotic stress, nutrient, and light conditions. We demonstrate that CEPs are negative regulators of root development, slowing primary root growth and reducing lateral root formation. We propose that CEPs are negative regulators that mediate environmental influences on plant development.

  12. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  13. cGMP and NHR signaling co-regulate expression of insulin-like peptides and developmental activation of infective larvae in Strongyloides stercoralis.

    Directory of Open Access Journals (Sweden)

    Jonathan D Stoltzfus

    2014-07-01

    Full Text Available The infectious form of the parasitic nematode Strongyloides stercoralis is a developmentally arrested third-stage larva (L3i, which is morphologically similar to the developmentally arrested dauer larva in the free-living nematode Caenorhabditis elegans. We hypothesize that the molecular pathways regulating C. elegans dauer development also control L3i arrest and activation in S. stercoralis. This study aimed to determine the factors that regulate L3i activation, with a focus on G protein-coupled receptor-mediated regulation of cyclic guanosine monophosphate (cGMP pathway signaling, including its modulation of the insulin/IGF-1-like signaling (IIS pathway. We found that application of the membrane-permeable cGMP analog 8-bromo-cGMP potently activated development of S. stercoralis L3i, as measured by resumption of feeding, with 85.1 ± 2.2% of L3i feeding in 200 µM 8-bromo-cGMP in comparison to 0.6 ± 0.3% in the buffer diluent. Utilizing RNAseq, we examined L3i stimulated with DMEM, 8-bromo-cGMP, or the DAF-12 nuclear hormone receptor (NHR ligand Δ7-dafachronic acid (DA--a signaling pathway downstream of IIS in C. elegans. L3i stimulated with 8-bromo-cGMP up-regulated transcripts of the putative agonistic insulin-like peptide (ILP -encoding genes Ss-ilp-1 (20-fold and Ss-ilp-6 (11-fold in comparison to controls without stimulation. Surprisingly, we found that Δ7-DA similarly modulated transcript levels of ILP-encoding genes. Using the phosphatidylinositol-4,5-bisphosphate 3-kinase inhibitor LY294002, we demonstrated that 400 nM Δ7-DA-mediated activation (93.3 ± 1.1% L3i feeding can be blocked using this IIS inhibitor at 100 µM (7.6 ± 1.6% L3i feeding. To determine the tissues where promoters of ILP-encoding genes are active, we expressed promoter::egfp reporter constructs in transgenic S. stercoralis post-free-living larvae. Ss-ilp-1 and Ss-ilp-6 promoters are active in the hypodermis and neurons and the Ss-ilp-7 promoter is active in the

  14. Endogenous TasiRNAs mediate non-cell autonomous effects on gene regulation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Rebecca Schwab

    Full Text Available BACKGROUND: Different classes of small RNAs (sRNAs refine the expression of numerous genes in higher eukaryotes by directing protein partners to complementary nucleic acids, where they mediate gene silencing. Plants encode a unique class of sRNAs, called trans-acting small interfering RNAs (tasiRNAs, which post-transcriptionally regulate protein-coding transcripts, as do microRNAs (miRNAs, and both sRNA classes control development through their targets. TasiRNA biogenesis requires multiple components of the siRNA pathway and also miRNAs. But while 21mer siRNAs originating from transgenes can mediate silencing across several cell layers, miRNA action seems spatially restricted to the producing or closely surrounding cells. PRINCIPAL FINDINGS: We have previously described the isolation of a genetrap reporter line for TAS3a, the major locus producing AUXIN RESPONS FACTOR (ARF-regulating tasiRNAs in the Arabidopsis shoot. Its activity is limited to the adaxial (upper side of leaf primordia, thus spatially isolated from ARF-activities, which are located in the abaxial (lower side. We show here by in situ hybridization and reporter fusions that the silencing activities of ARF-regulating tasiRNAs are indeed manifested non-cell autonomously to spatially control ARF activities. CONCLUSIONS/SIGNIFICANCE: Endogenous tasiRNAs are thus mediators of a mobile developmental signal and might provide effective gene silencing at a distance beyond the reach of most miRNAs.

  15. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    Science.gov (United States)

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

    2001-12-01

    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

  16. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    Science.gov (United States)

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  17. Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis

    Science.gov (United States)

    Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong

    2011-01-01

    Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and

  18. Developmental transcriptomic features of the carcinogenic liver fluke, Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Won Gi Yoo

    2011-06-01

    Full Text Available Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs. Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development

  19. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  20. Mechanisms for the environmental regulation of gene expression

    Indian Academy of Sciences (India)

    2005-01-07

    Jan 7, 2005 ... The environment can play a significant role in the production of phenotypes. However, the developmental mechanisms by which the environmental agents effect normal development are just becoming known. At least three paths have been found through which the environment can modify gene activity.

  1. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Energy Technology Data Exchange (ETDEWEB)

    Lichtensteiger, W.; Faass, O.; Ceccatelli, R.; Schlumpf, M. [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology

    2004-09-15

    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  2. NeuroD1: developmental expression and regulated genes in the rodent pineal gland

    DEFF Research Database (Denmark)

    Muñoz, Estela M; Bailey, Michael J; Rath, Martin F

    2007-01-01

    NeuroD1/BETA2, a member of the bHLH transcription factor family, is known to influence the fate of specific neuronal, endocrine and retinal cells. We report here that NeuroD1 mRNA is highly abundant in the developing and adult rat pineal gland. Pineal expression begins in the 17-day embryo at which...... time it is also detectable in other brain regions. Expression in the pineal gland increases during the embryonic period and is maintained thereafter at levels equivalent to those found in the cerebellum and retina. In contrast, NeuroD1 mRNA decreases markedly in non-cerebellar brain regions during...... development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

  3. CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING

    Directory of Open Access Journals (Sweden)

    Mario U Manto

    2012-01-01

    Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.

  4. MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

    Directory of Open Access Journals (Sweden)

    Mohammed Alsaweed

    2015-10-01

    Full Text Available Human milk (HM is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance.

  5. Insights into the regulation of human CNV-miRNAs from the view of their target genes

    Directory of Open Access Journals (Sweden)

    Wu Xudong

    2012-12-01

    Full Text Available Abstract Background microRNAs (miRNAs represent a class of small (typically 22 nucleotides in length non-coding RNAs that can degrade their target mRNAs or block their translation. Recent research showed that copy number alterations of miRNAs and their target genes are highly prevalent in cancers; however, the evolutionary and biological functions of naturally existing copy number variable miRNAs (CNV-miRNAs among individuals have not been studied extensively throughout the genome. Results In this study, we comprehensively analyzed the properties of genes regulated by CNV-miRNAs, and found that CNV-miRNAs tend to target a higher average number of genes and prefer to synergistically regulate the same genes; further, the targets of CNV-miRNAs tend to have higher variability of expression within and between populations. Finally, we found the targets of CNV-miRNAs are more likely to be differentially expressed among tissues and developmental stages, and participate in a wide range of cellular responses. Conclusions Our analyses of CNV-miRNAs provide new insights into the impact of copy number variations on miRNA-mediated post-transcriptional networks. The deeper interpretation of patterns of gene expression variation and the functional characterization of CNV-miRNAs will help to broaden the current understanding of the molecular basis of human phenotypic diversity.

  6. Developmentally regulated sesquiterpene production confers resistance to Colletotrichum gloeosporioides in ripe pepper fruits.

    Directory of Open Access Journals (Sweden)

    Sangkyu Park

    Full Text Available Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR and squalene synthase (SS genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS, belonging to a sesquiterpene cyclase (STC family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA, resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits.

  7. Global gene expression analysis of the zoonotic parasite Trichinella spiralis revealed novel genes in host parasite interaction.

    Directory of Open Access Journals (Sweden)

    Xiaolei Liu

    Full Text Available BACKGROUND: Trichinellosis is a typical food-borne zoonotic disease which is epidemic worldwide and the nematode Trichinella spiralis is the main pathogen. The life cycle of T. spiralis contains three developmental stages, i.e. adult worms, new borne larva (new borne L1 larva and muscular larva (infective L1 larva. Stage-specific gene expression in the parasites has been investigated with various immunological and cDNA cloning approaches, whereas the genome-wide transcriptome and expression features of the parasite have been largely unknown. The availability of the genome sequence information of T. spiralis has made it possible to deeply dissect parasite biology in association with global gene expression and pathogenesis. METHODOLOGY AND PRINCIPAL FINDINGS: In this study, we analyzed the global gene expression patterns in the three developmental stages of T. spiralis using digital gene expression (DGE analysis. Almost 15 million sequence tags were generated with the Illumina RNA-seq technology, producing expression data for more than 9,000 genes, covering 65% of the genome. The transcriptome analysis revealed thousands of differentially expressed genes within the genome, and importantly, a panel of genes encoding functional proteins associated with parasite invasion and immuno-modulation were identified. More than 45% of the genes were found to be transcribed from both strands, indicating the importance of RNA-mediated gene regulation in the development of the parasite. Further, based on gene ontological analysis, over 3000 genes were functionally categorized and biological pathways in the three life cycle stage were elucidated. CONCLUSIONS AND SIGNIFICANCE: The global transcriptome of T. spiralis in three developmental stages has been profiled, and most gene activity in the genome was found to be developmentally regulated. Many metabolic and biological pathways have been revealed. The findings of the differential expression of several protein

  8. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Directory of Open Access Journals (Sweden)

    Escalante Ricardo

    2008-01-01

    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  9. Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

    Science.gov (United States)

    Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

    2017-07-30

    The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. HPRT deficiency coordinately dysregulates canonical Wnt and presenilin-1 signaling: a neuro-developmental regulatory role for a housekeeping gene?

    Directory of Open Access Journals (Sweden)

    Tae Hyuk Kang

    2011-01-01

    Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for

  11. Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

    Directory of Open Access Journals (Sweden)

    William P. Bewg

    2017-12-01

    Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

  12. Transcriptional regulation of the grape cytochrome P450 monooxygenase gene CYP736B expression in response to Xylella fastidiosa infection

    Directory of Open Access Journals (Sweden)

    Walker M Andrew

    2010-07-01

    Full Text Available Abstract Background Plant cytochrome P450 monooxygenases (CYP mediate synthesis and metabolism of many physiologically important primary and secondary compounds that are related to plant defense against a range of pathogenic microbes and insects. To determine if cytochrome P450 monooxygenases are involved in defense response to Xylella fastidiosa (Xf infection, we investigated expression and regulatory mechanisms of the cytochrome P450 monooxygenase CYP736B gene in both disease resistant and susceptible grapevines. Results Cloning of genomic DNA and cDNA revealed that the CYP736B gene was composed of two exons and one intron with GT as a donor site and AG as an acceptor site. CYP736B transcript was up-regulated in PD-resistant plants and down-regulated in PD-susceptible plants 6 weeks after Xf inoculation. However, CYP736B expression was very low in stem tissues at all evaluated time points. 5'RACE and 3'RACE sequence analyses revealed that there were three candidate transcription start sites (TSS in the upstream region and three candidate polyadenylation (PolyA sites in the downstream region of CYP736B. Usage frequencies of each transcription initiation site and each polyadenylation site varied depending on plant genotype, developmental stage, tissue, and treatment. These results demonstrate that expression of CYP736B is regulated developmentally and in response to Xf infection at both transcriptional and post-transcriptional levels. Multiple transcription start and polyadenylation sites contribute to regulation of CYP736B expression. Conclusions This report provides evidence that the cytochrome P450 monooxygenase CYP736B gene is involved in defense response at a specific stage of Xf infection in grapevines; multiple transcription initiation and polyadenylation sites exist for CYP736B in grapevine; and coordinative and selective use of transcription initiation and polyadenylation sites play an important role in regulation of CYP736B expression

  13. Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

    Science.gov (United States)

    de Oliveira, Rita F.; Wann, John P.

    2011-01-01

    In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

  14. Hormonal regulation and developmental role of Krüppel homolog 1, a repressor of metamorphosis, in the silkworm Bombyx mori.

    Science.gov (United States)

    Kayukawa, Takumi; Murata, Mika; Kobayashi, Isao; Muramatsu, Daisuke; Okada, Chieko; Uchino, Keiro; Sezutsu, Hideki; Kiuchi, Makoto; Tamura, Toshiki; Hiruma, Kiyoshi; Ishikawa, Yukio; Shinoda, Tetsuro

    2014-04-01

    Juvenile hormone (JH) has an ability to repress the precocious metamorphosis of insects during their larval development. Krüppel homolog 1 (Kr-h1) is an early JH-inducible gene that mediates this action of JH; however, the fine hormonal regulation of Kr-h1 and the molecular mechanism underlying its antimetamorphic effect are little understood. In this study, we attempted to elucidate the hormonal regulation and developmental role of Kr-h1. We found that the expression of Kr-h1 in the epidermis of penultimate-instar larvae of the silkworm Bombyx mori was induced by JH secreted by the corpora allata (CA), whereas the CA were not involved in the transient induction of Kr-h1 at the prepupal stage. Tissue culture experiments suggested that the transient peak of Kr-h1 at the prepupal stage is likely to be induced cooperatively by JH derived from gland(s) other than the CA and the prepupal surge of ecdysteroid, although involvement of unknown factor(s) could not be ruled out. To elucidate the developmental role of Kr-h1, we generated transgenic silkworms overexpressing Kr-h1. The transgenic silkworms grew normally until the spinning stage, but their development was arrested at the prepupal stage. The transgenic silkworms from which the CA were removed in the penultimate instar did not undergo precocious pupation or larval-larval molt but fell into prepupal arrest. This result demonstrated that Kr-h1 is indeed involved in the repression of metamorphosis but that Kr-h1 alone is incapable of implementing normal larval molt. Moreover, the expression profiles and hormonal responses of early ecdysone-inducible genes (E74, E75, and Broad) in transgenic silkworms suggested that Kr-h1 is not involved in the JH-dependent modulation of these genes, which is associated with the control of metamorphosis. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Streptomyces sporulation - Genes and regulators involved in bacterial cell differentiation

    OpenAIRE

    Larsson, Jessica

    2010-01-01

    Streptomycetes are Gram-positive bacteria with a complex developmental life cycle. They form spores on specialized cells called aerial hyphae, and this sporulation involves alterations in growth, morphogenesis and cell cycle processes like cell division and chromosome segregation. Understanding the developmental mechanisms that streptomycetes have evolved for regulating for example cell division is of general interest in bacterial cell biology. It can also be valuable in the design of new dru...

  16. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Science.gov (United States)

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  17. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  18. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  19. The expression of petunia strigolactone pathway genes is altered as part of the endogenous developmental program

    Directory of Open Access Journals (Sweden)

    Revel S M Drummond

    2012-01-01

    Full Text Available Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signalling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologues of the Arabidopsis MAX1 and MAX2 genes to characterise their role in petunia architecture. A single orthologue of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels increase as leaves age. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over the development series. Alterations to the expression of these genes over time, or in different regions of the plant, may influence the branching growth habit of the plant. Alterations to strigolactone production and/or sensitivity could allow both subtle and dramatic changes to branching within and between species.

  20. Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

    Science.gov (United States)

    Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

    2002-05-01

    Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

  1. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Science.gov (United States)

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  2. TFII-I regulates target genes in the PI-3K and TGF-β signaling pathways through a novel DNA binding motif.

    Science.gov (United States)

    Segura-Puimedon, Maria; Borralleras, Cristina; Pérez-Jurado, Luis A; Campuzano, Victoria

    2013-09-25

    General transcription factor (TFII-I) is a multi-functional protein involved in the transcriptional regulation of critical developmental genes, encoded by the GTF2I gene located on chromosome 7q11.23. Haploinsufficiency at GTF2I has been shown to play a major role in the neurodevelopmental features of Williams-Beuren syndrome (WBS). Identification of genes regulated by TFII-I is thus critical to detect molecular determinants of WBS as well as to identify potential new targets for specific pharmacological interventions, which are currently absent. We performed a microarray screening for transcriptional targets of TFII-I in cortex and embryonic cells from Gtf2i mutant and wild-type mice. Candidate genes with altered expression were verified using real-time PCR. A novel motif shared by deregulated genes was found and chromatin immunoprecipitation assays in embryonic fibroblasts were used to document in vitro TFII-I binding to this motif in the promoter regions of deregulated genes. Interestingly, the PI3K and TGFβ signaling pathways were over-represented among TFII-I-modulated genes. In this study we have found a highly conserved DNA element, common to a set of genes regulated by TFII-I, and identified and validated novel in vivo neuronal targets of this protein affecting the PI3K and TGFβ signaling pathways. Overall, our data further contribute to unravel the complexity and variability of the different genetic programs orchestrated by TFII-I. © 2013 Elsevier B.V. All rights reserved.

  3. Simulation study on effects of signaling network structure on the developmental increase in complexity

    Energy Technology Data Exchange (ETDEWEB)

    Keranen, Soile V.E.

    2003-04-02

    The developmental increase in structural complexity in multicellular life forms depends on local, often non-periodic differences in gene expression. These depend on a network of gene-gene interactions coded within the organismal genome. To better understand how genomic information generates complex expression patterns, I have modeled the pattern forming behavior of small artificial genomes in virtual blastoderm embryos. I varied several basic properties of these genomic signaling networks, such as the number of genes, the distributions of positive (inductive) and negative (repressive) interactions, and the strengths of gene-gene interactions, and analyzed their effects on developmental pattern formation. The results show how even simple genomes can generate complex non-periodic patterns under suitable conditions. They also show how the frequency of complex patterns depended on the numbers and relative arrangements of positive and negative interactions. For example, negative co-regulation of signaling pathway components increased the likelihood of (complex) patterns relative to differential negative regulation of the pathway components. Interestingly, neither quantitative differences either in strengths of signaling interactions nor multiple response thresholds to signal concentration (as in morphogen gradients) were essential for formation of multiple, spatially unique cell types. Thus, with combinatorial code of gene regulation and hierarchical signaling interactions, it is theoretically possible to organize metazoan embryogenesis with just a small fraction of the metazoan genome. Because even small networks can generate complex patterns when they contain a suitable set of connections, evolution of metazoan complexity may have depended more on selection for favourable configurations of signaling interactions than on the increase in numbers of regulatory genes.

  4. Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.

    Science.gov (United States)

    Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R

    2018-06-01

    Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.

  5. Genome-wide identification and expression profiling reveal tissue-specific expression and differentially-regulated genes involved in gibberellin metabolism between Williams banana and its dwarf mutant.

    Science.gov (United States)

    Chen, Jingjing; Xie, Jianghui; Duan, Yajie; Hu, Huigang; Hu, Yulin; Li, Weiming

    2016-05-27

    better understanding of GA-regulated development in banana. The present results revealed that MaGA20ox4, MaGA20ox5, MaGA20ox7, MaGA2ox7, MaGA2ox12, and MaGA2ox14 were the main genes regulating GA content difference between 8818 and 8818-1. All of these genes may perform important functions in the developmental processes of banana, but each gene may perform different functions in different tissues or during different developmental stages.

  6. A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

    Science.gov (United States)

    Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

    2017-01-11

    A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Timing is everything: Reiterative Wnt, BMP and RA signaling regulate developmental competence during endoderm organogenesis.

    Science.gov (United States)

    Rankin, Scott A; McCracken, Kyle W; Luedeke, David M; Han, Lu; Wells, James M; Shannon, John M; Zorn, Aaron M

    2018-02-01

    A small number of signaling pathways are used repeatedly during organogenesis, and they can have drastically different effects on the same population of cells depending on the embryonic stage. How cellular competence changes over developmental time is not well understood. Here we used Xenopus, mouse, and human pluripotent stem cells to investigate how the temporal sequence of Wnt, BMP, and retinoic acid (RA) signals regulates endoderm developmental competence and organ induction, focusing on respiratory fate. While Nkx2-1+ lung fate is not induced until late somitogenesis stages, here we show that lung competence is restricted by the gastrula stage as a result of Wnt and BMP-dependent anterior-posterior (A-P) patterning. These early Wnt and BMP signals make posterior endoderm refractory to subsequent RA/Wnt/BMP-dependent lung induction. We further mapped how RA modulates the response to Wnt and BMP in a temporal specific manner. In the gastrula RA promotes posterior identity, however in early somite stages of development RA regulates respiratory versus pharyngeal potential in anterior endoderm and midgut versus hindgut potential in posterior endoderm. Together our data suggest a dynamic and conserved response of vertebrate endoderm during organogenesis, wherein early Wnt/BMP/RA impacts how cells respond to later Wnt/BMP/RA signals, illustrating how reiterative combinatorial signaling can regulate both developmental competence and subsequent fate specification. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

    2017-01-01

    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  9. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

    2017-01-01

    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  10. Co-regulation of a large and rapidly evolving repertoire of odorant receptor genes

    Directory of Open Access Journals (Sweden)

    Lane Robert P

    2007-09-01

    Full Text Available Abstract The olfactory system meets niche- and species-specific demands by an accelerated evolution of its odorant receptor repertoires. In this review, we describe evolutionary processes that have shaped olfactory and vomeronasal receptor gene families in vertebrate genomes. We emphasize three important periods in the evolution of the olfactory system evident by comparative genomics: the adaptation to land in amphibian ancestors, the decline of olfaction in primates, and the delineation of putative pheromone receptors concurrent with rodent speciation. The rapid evolution of odorant receptor genes, the sheer size of the repertoire, as well as their wide distribution in the genome, presents a developmental challenge: how are these ever-changing odorant receptor repertoires coordinated within the olfactory system? A central organizing principle in olfaction is the specialization of sensory neurons resulting from each sensory neuron expressing only ~one odorant receptor allele. In this review, we also discuss this mutually exclusive expression of odorant receptor genes. We have considered several models to account for co-regulation of odorant receptor repertoires, as well as discussed a new hypothesis that invokes important epigenetic properties of the system.

  11. Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

    Science.gov (United States)

    McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

    2015-01-01

    Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

  12. The conserved splicing factor SUA controls alternative splicing of the developmental regulator ABI3 in Arabidopsis.

    NARCIS (Netherlands)

    Sugliani, M.; Brambilla, V.; Clerkx, E.J.M.; Koornneef, M.; Soppe, W.J.J.

    2010-01-01

    ABSCISIC ACID INSENSITIVE3 (ABI3) is a major regulator of seed maturation in Arabidopsis thaliana. We detected two ABI3 transcripts, ABI3- and ABI3-ß, which encode full-length and truncated proteins, respectively. Alternative splicing of ABI3 is developmentally regulated, and the ABI3-ß transcript

  13. Gene Regulation, Modulation, and Their Applications in Gene Expression Data Analysis

    Directory of Open Access Journals (Sweden)

    Mario Flores

    2013-01-01

    Full Text Available Common microarray and next-generation sequencing data analysis concentrate on tumor subtype classification, marker detection, and transcriptional regulation discovery during biological processes by exploring the correlated gene expression patterns and their shared functions. Genetic regulatory network (GRN based approaches have been employed in many large studies in order to scrutinize for dysregulation and potential treatment controls. In addition to gene regulation and network construction, the concept of the network modulator that has significant systemic impact has been proposed, and detection algorithms have been developed in past years. Here we provide a unified mathematic description of these methods, followed with a brief survey of these modulator identification algorithms. As an early attempt to extend the concept to new RNA regulation mechanism, competitive endogenous RNA (ceRNA, into a modulator framework, we provide two applications to illustrate the network construction, modulation effect, and the preliminary finding from these networks. Those methods we surveyed and developed are used to dissect the regulated network under different modulators. Not limit to these, the concept of “modulation” can adapt to various biological mechanisms to discover the novel gene regulation mechanisms.

  14. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  15. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Directory of Open Access Journals (Sweden)

    Shutao Zhang

    Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  16. Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

    International Nuclear Information System (INIS)

    Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J.; Flaws, Jodi A.; Helferich, William G.; Pan, Yuan-Xiang; Lezmi, Stéphane

    2015-01-01

    Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

  17. Developmental bisphenol A (BPA) exposure leads to sex-specific modification of hepatic gene expression and epigenome at birth that may exacerbate high-fat diet-induced hepatic steatosis

    Energy Technology Data Exchange (ETDEWEB)

    Strakovsky, Rita S.; Wang, Huan; Engeseth, Nicki J. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Flaws, Jodi A. [Department of Comparative Biosciences, University of Illinois Urbana-Champaign (United States); Helferich, William G. [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Pan, Yuan-Xiang, E-mail: yxpan@illinois.edu [Department of Food Science and Human Nutrition, University of Illinois Urbana-Champaign (United States); Lezmi, Stéphane, E-mail: slezmi@illinois.edu [Department of Pathobiology, University of Illinois Urbana-Champaign (United States)

    2015-04-15

    Developmental bisphenol A (BPA) exposure increases adulthood hepatic steatosis with reduced mitochondrial function. To investigate the potential epigenetic mechanisms behind developmental BPA-induced hepatic steatosis, pregnant Sprague–Dawley rats were dosed with vehicle (oil) or BPA (100 μg/kg/day) from gestational day 6 until postnatal day (PND) 21. After weaning, offspring were either challenged with a high-fat (HF; 45% fat) or remained on a control (C) diet until PND110. From PND60 to 90, both BPA and HF diet increased the fat/lean ratio in males only, and the combination of BPA and HF diet appeared to cause the highest ratio. On PND110, Oil-HF, BPA-C, and BPA-HF males had higher hepatic lipid accumulation than Oil-C, with microvesicular steatosis being marked in the BPA-HF group. Furthermore, on PND1, BPA increased and modified hepatic triglyceride (TG) and free fatty acid (FFA) compositions in males only. In PND1 males, BPA increased hepatic expression of FFA uptake gene Fat/Cd36, and decreased the expression of TG synthesis- and β-oxidation-related genes (Dgat, Agpat6, Cebpα, Cebpβ, Pck1, Acox1, Cpt1a, Cybb). BPA altered DNA methylation and histone marks (H3Ac, H4Ac, H3Me2K4, H3Me3K36), and decreased the binding of several transcription factors (Pol II, C/EBPβ, SREBP1) within the male Cpt1a gene, the key β-oxidation enzyme. In PND1 females, BPA only increased the expression of genes involved in FFA uptake and TG synthesis (Lpl, Fasn, and Dgat). These data suggest that developmental BPA exposure alters and reprograms hepatic β-oxidation capacity in males, potentially through the epigenetic regulation of genes, and further alters the response to a HF diet. - Highlights: • Developmental BPA exposure exacerbates HF-diet induced steatosis in adult males. • Gestational BPA exposure increases hepatic lipid accumulation in neonatal males. • BPA decreases Cpt1a and other hepatic β-oxidation genes in neonatal males. • BPA alters neonatal male Cpt1a

  18. Epigenetic regulation during fetal femur development: DNA methylation matters.

    Directory of Open Access Journals (Sweden)

    María C de Andrés

    Full Text Available Epigenetic modifications are heritable changes in gene expression without changes in DNA sequence. DNA methylation has been implicated in the control of several cellular processes including differentiation, gene regulation, development, genomic imprinting and X-chromosome inactivation. Methylated cytosine residues at CpG dinucleotides are commonly associated with gene repression; conversely, strategic loss of methylation during development could lead to activation of lineage-specific genes. Evidence is emerging that bone development and growth are programmed; although, interestingly, bone is constantly remodelled throughout life. Using human embryonic stem cells, human fetal bone cells (HFBCs, adult chondrocytes and STRO-1(+ marrow stromal cells from human bone marrow, we have examined a spectrum of developmental stages of femur development and the role of DNA methylation therein. Using pyrosequencing methodology we analysed the status of methylation of genes implicated in bone biology; furthermore, we correlated these methylation levels with gene expression levels using qRT-PCR and protein distribution during fetal development evaluated using immunohistochemistry. We found that during fetal femur development DNA methylation inversely correlates with expression of genes including iNOS (NOS2 and COL9A1, but not catabolic genes including MMP13 and IL1B. Furthermore, significant demethylation was evident in the osteocalcin promoter between the fetal and adult developmental stages. Increased TET1 expression and decreased expression of DNA (cytosine-5--methyltransferase 1 (DNMT1 in adult chondrocytes compared to HFBCs could contribute to the loss of methylation observed during fetal development. HFBC multipotency confirms these cells to be an ideal developmental system for investigation of DNA methylation regulation. In conclusion, these findings demonstrate the role of epigenetic regulation, specifically DNA methylation, in bone development

  19. Effects of Phytosterol in Feed on Growth and Related Gene ...

    African Journals Online (AJOL)

    depressed antioxidant defence systems in the broiler chickens. Myogen, eIF4E, and S6k1 gene ... Furthermore, the data suggest that developmental decline in skeletal muscle protein synthesis, may be partly attributed to developmental regulation of the activation of growth factor and nutrient components. Keywords: Broiler ...

  20. Homeobox Genes in the Rodent Pineal Gland

    DEFF Research Database (Denmark)

    Rath, Martin Fredensborg; Rohde, Kristian; Klein, David C

    2013-01-01

    The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential...... for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental...... functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function...

  1. Genome-wide prediction and functional validation of promoter motifs regulating gene expression in spore and infection stages of Phytophthora infestans.

    Directory of Open Access Journals (Sweden)

    Sourav Roy

    2013-03-01

    Full Text Available Most eukaryotic pathogens have complex life cycles in which gene expression networks orchestrate the formation of cells specialized for dissemination or host colonization. In the oomycete Phytophthora infestans, the potato late blight pathogen, major shifts in mRNA profiles during developmental transitions were identified using microarrays. We used those data with search algorithms to discover about 100 motifs that are over-represented in promoters of genes up-regulated in hyphae, sporangia, sporangia undergoing zoosporogenesis, swimming zoospores, or germinated cysts forming appressoria (infection structures. Most of the putative stage-specific transcription factor binding sites (TFBSs thus identified had features typical of TFBSs such as position or orientation bias, palindromy, and conservation in related species. Each of six motifs tested in P. infestans transformants using the GUS reporter gene conferred the expected stage-specific expression pattern, and several were shown to bind nuclear proteins in gel-shift assays. Motifs linked to the appressoria-forming stage, including a functionally validated TFBS, were over-represented in promoters of genes encoding effectors and other pathogenesis-related proteins. To understand how promoter and genome architecture influence expression, we also mapped transcription patterns to the P. infestans genome assembly. Adjacent genes were not typically induced in the same stage, including genes transcribed in opposite directions from small intergenic regions, but co-regulated gene pairs occurred more than expected by random chance. These data help illuminate the processes regulating development and pathogenesis, and will enable future attempts to purify the cognate transcription factors.

  2. Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

    Science.gov (United States)

    Arenas-Mena, Cesar; Coffman, James A.

    2016-01-01

    Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

  3. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  4. The phenotypic plasticity of developmental modules

    Directory of Open Access Journals (Sweden)

    Aabha I. Sharma

    2016-08-01

    Full Text Available Abstract Background Organisms develop and evolve in a modular fashion, but how individual modules interact with the environment remains poorly understood. Phenotypically plastic traits are often under selection, and studies are needed to address how traits respond to the environment in a modular fashion. In this study, tissue-specific plasticity of melanic spots was examined in the large milkweed bug, Oncopeltus fasciatus. Results Although the size of the abdominal melanic bands varied according to rearing temperatures, wing melanic bands were more robust. To explore the regulation of abdominal pigmentation plasticity, candidate genes involved in abdominal melanic spot patterning and biosynthesis of melanin were analyzed. While the knockdown of dopa decarboxylase (Ddc led to lighter pigmentation in both the wings and the abdomen, the shape of the melanic elements remained unaffected. Although the knockdown of Abdominal-B (Abd-B partially phenocopied the low-temperature phenotype, the abdominal bands were still sensitive to temperature shifts. These observations suggest that regulators downstream of Abd-B but upstream of DDC are responsible for the temperature response of the abdomen. Ablation of wings led to the regeneration of a smaller wing with reduced melanic bands that were shifted proximally. In addition, the knockdown of the Wnt signaling nuclear effector genes, armadillo 1 and armadillo 2, altered both the melanic bands and the wing shape. Thus, the pleiotropic effects of Wnt signaling may constrain the amount of plasticity in wing melanic bands. Conclusions We propose that when traits are regulated by distinct pre-patterning mechanisms, they can respond to the environment in a modular fashion, whereas when the environment impacts developmental regulators that are shared between different modules, phenotypic plasticity can manifest as a developmentally integrated system.

  5. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  6. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  7. Global developmental gene expression and pathway analysis of normal brain development and mouse models of human neuronal migration defects.

    Directory of Open Access Journals (Sweden)

    Tiziano Pramparo

    2011-03-01

    Full Text Available Heterozygous LIS1 mutations are the most common cause of human lissencephaly, a human neuronal migration defect, and DCX mutations are the most common cause of X-linked lissencephaly. LIS1 is part of a protein complex including NDEL1 and 14-3-3ε that regulates dynein motor function and microtubule dynamics, while DCX stabilizes microtubules and cooperates with LIS1 during neuronal migration and neurogenesis. Targeted gene mutations of Lis1, Dcx, Ywhae (coding for 14-3-3ε, and Ndel1 lead to neuronal migration defects in mouse and provide models of human lissencephaly, as well as aid the study of related neuro-developmental diseases. Here we investigated the developing brain of these four mutants and wild-type mice using expression microarrays, bioinformatic analyses, and in vivo/in vitro experiments to address whether mutations in different members of the LIS1 neuronal migration complex lead to similar and/or distinct global gene expression alterations. Consistent with the overall successful development of the mutant brains, unsupervised clustering and co-expression analysis suggested that cell cycle and synaptogenesis genes are similarly expressed and co-regulated in WT and mutant brains in a time-dependent fashion. By contrast, focused co-expression analysis in the Lis1 and Ndel1 mutants uncovered substantial differences in the correlation among pathways. Differential expression analysis revealed that cell cycle, cell adhesion, and cytoskeleton organization pathways are commonly altered in all mutants, while synaptogenesis, cell morphology, and inflammation/immune response are specifically altered in one or more mutants. We found several commonly dysregulated genes located within pathogenic deletion/duplication regions, which represent novel candidates of human mental retardation and neurocognitive disabilities. Our analysis suggests that gene expression and pathway analysis in mouse models of a similar disorder or within a common pathway can

  8. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

    Science.gov (United States)

    Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

    2012-06-06

    As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

  9. RNAseq analysis of the parasitic nematode Strongyloides stercoralis reveals divergent regulation of canonical dauer pathways.

    Directory of Open Access Journals (Sweden)

    Jonathan D Stoltzfus

    Full Text Available The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i. The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP signaling, insulin/IGF-1-like signaling (IIS, transforming growth factor β (TGFβ signaling, and biosynthesis of dafachronic acid (DA ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between

  10. Prostate Cancer Epigenetics: A Review on Gene Regulation

    Directory of Open Access Journals (Sweden)

    Lena Diaw

    2007-01-01

    Full Text Available Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play important roles either independently or by interaction in tumor initiation and progression. This review will discuss the genes associated with epigenetic alterations in prostate cancer progression: their regulation and importance as possible markers for the disease.

  11. Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences

    Science.gov (United States)

    Chandra, Govind; Chater, Keith F

    2014-01-01

    To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321

  12. Identification and transcription profiling of trypsin in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation, blood feeding, and permethrin exposure.

    Science.gov (United States)

    Zhao, Liming; Chen, Jian; Becnel, James J; Kline, Daniel L; Clark, Gary G; Linthicum, Kenneth J

    2011-05-01

    The cDNA of a trypsin gene from Aedes (Ochlerotatus) taeniorhynchus (Weidemann) was cloned and sequenced. The full-length mRNA sequence (890 bp) for trypsin from Ae. taeniorhynchus (AetTryp1) was obtained, which encodes an open reading frame of 765 bp (i.e., 255 amino acids). To detect whether AetTryp is developmentally regulated, a quantitative real-time polymerase chain reaction was used to examine AetTrypl mRNA expression levels in different developmental stages of Ae. taeniorhynchus. AetTryp1 was expressed at low levels in egg, larval, and pupal stages, but was differentially expressed in adult Ae. taeniorhynchus, with highest levels found in 5-d-old female adults when compared with teneral adults. In addition, AetTryp1 mRNA expression differed between sexes, with expression levels much lower in males. However, in both males and females, there was a significant increase in AetTryp1 transcription levels as age increased and peaked in 5-d-old adults. AetTrypl expressed in 5-d-old female Ae. taeniorhynchus significantly increased after 30 min postblood feeding compared with the control. The AetTryp1 mRNA expression in 5-d-old female Ae. taeniorhynchus was affected by different concentrations of permethrin.

  13. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  14. Gene regulation is governed by a core network in hepatocellular carcinoma.

    Science.gov (United States)

    Gu, Zuguang; Zhang, Chenyu; Wang, Jin

    2012-05-01

    Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide, and the mechanisms that lead to the disease are still relatively unclear. However, with the development of high-throughput technologies it is possible to gain a systematic view of biological systems to enhance the understanding of the roles of genes associated with HCC. Thus, analysis of the mechanism of molecule interactions in the context of gene regulatory networks can reveal specific sub-networks that lead to the development of HCC. In this study, we aimed to identify the most important gene regulations that are dysfunctional in HCC generation. Our method for constructing gene regulatory network is based on predicted target interactions, experimentally-supported interactions, and co-expression model. Regulators in the network included both transcription factors and microRNAs to provide a complete view of gene regulation. Analysis of gene regulatory network revealed that gene regulation in HCC is highly modular, in which different sets of regulators take charge of specific biological processes. We found that microRNAs mainly control biological functions related to mitochondria and oxidative reduction, while transcription factors control immune responses, extracellular activity and the cell cycle. On the higher level of gene regulation, there exists a core network that organizes regulations between different modules and maintains the robustness of the whole network. There is direct experimental evidence for most of the regulators in the core gene regulatory network relating to HCC. We infer it is the central controller of gene regulation. Finally, we explored the influence of the core gene regulatory network on biological pathways. Our analysis provides insights into the mechanism of transcriptional and post-transcriptional control in HCC. In particular, we highlight the importance of the core gene regulatory network; we propose that it is highly related to HCC and we believe further

  15. Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways.

    Science.gov (United States)

    Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula

    2014-01-20

    Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus

  16. The NSL Complex Regulates Housekeeping Genes in Drosophila

    Science.gov (United States)

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  17. BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

    Science.gov (United States)

    Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

    2010-08-01

    Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

  18. Conservation and co-option in developmental programmes: the importance of homology relationships

    Directory of Open Access Journals (Sweden)

    Becker May-Britt

    2005-10-01

    Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

  19. Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

    Directory of Open Access Journals (Sweden)

    Sumedha S Gunewardena

    Full Text Available During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth to maturity (60-days after birth. Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2 RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

  20. Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

    Science.gov (United States)

    Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

    2016-01-01

    The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

  1. Inferring gene expression dynamics via functional regression analysis

    Directory of Open Access Journals (Sweden)

    Leng Xiaoyan

    2008-01-01

    Full Text Available Abstract Background Temporal gene expression profiles characterize the time-dynamics of expression of specific genes and are increasingly collected in current gene expression experiments. In the analysis of experiments where gene expression is obtained over the life cycle, it is of interest to relate temporal patterns of gene expression associated with different developmental stages to each other to study patterns of long-term developmental gene regulation. We use tools from functional data analysis to study dynamic changes by relating temporal gene expression profiles of different developmental stages to each other. Results We demonstrate that functional regression methodology can pinpoint relationships that exist between temporary gene expression profiles for different life cycle phases and incorporates dimension reduction as needed for these high-dimensional data. By applying these tools, gene expression profiles for pupa and adult phases are found to be strongly related to the profiles of the same genes obtained during the embryo phase. Moreover, one can distinguish between gene groups that exhibit relationships with positive and others with negative associations between later life and embryonal expression profiles. Specifically, we find a positive relationship in expression for muscle development related genes, and a negative relationship for strictly maternal genes for Drosophila, using temporal gene expression profiles. Conclusion Our findings point to specific reactivation patterns of gene expression during the Drosophila life cycle which differ in characteristic ways between various gene groups. Functional regression emerges as a useful tool for relating gene expression patterns from different developmental stages, and avoids the problems with large numbers of parameters and multiple testing that affect alternative approaches.

  2. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  3. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  4. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  5. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  6. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  7. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Directory of Open Access Journals (Sweden)

    Ram Prakash Gupta

    2017-11-01

    Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

  8. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  9. Differential endometrial gene expression in pregnant and nonpregnant sows

    DEFF Research Database (Denmark)

    Østrup, Esben; Bauersachs, Stefan; Blum, Helmut

    2010-01-01

    obtained from the endometrium of pregnant sows and sows inseminated with inactivated semen. Analysis of the microarray data revealed 263 genes to be significantly differentially expressed between the pregnant and nonpregnant sows. Most gene ontology terms significantly enriched at pregnancy had allocated...... more up-regulated genes than down-regulated genes. These terms included developmental process, transporter activity, calcium ion binding, apoptosis, cell motility, enzyme-linked receptor protein signaling pathway, positive regulation of cell proliferation, ion homeostasis, and hormone activity. Only...... in the process of placentation. Pregnancy-specific localization of IL11RA to the surface epithelium of the endometrium suggests a role of interleukin 11 signaling in formation of the porcine epitheliochorial placenta. Furthermore, up-regulation of FGF9 mRNA in pregnant endometrium and localization of FGF9...

  10. Coupling gene expression and multicellular morphogenesis during fruiting body formation in Myxococcus xanthus

    DEFF Research Database (Denmark)

    Søgaard-Andersen, L.; Overgaard, M.; Lobedanz, S.

    2003-01-01

    xanthus illustrates this coupling in the construction of a multicellular structure. Fruiting body formation involves two stages: aggregation of cells into mounds and the position-specific sporulation of cells that have accumulated inside mounds. Developmental gene expression propels these two processes...... morphogenesis. Accumulation of the C-signal is tightly regulated and involves transcriptional activation of the csgA gene and proteolysis of the full-length CsgA protein to produce the shorter cell surface-associated 17 kDa C-signal protein. The C-signal induces aggregation, sporulation and developmental gene...

  11. Intrinsic limits to gene regulation by global crosstalk

    Science.gov (United States)

    Friedlander, Tamar; Prizak, Roshan; Guet, Călin C.; Barton, Nicholas H.; Tkačik, Gašper

    2016-01-01

    Gene regulation relies on the specificity of transcription factor (TF)–DNA interactions. Limited specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to noncognate TF–DNA interactions or remains erroneously inactive. As each TF can have numerous interactions with noncognate cis-regulatory elements, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyse the effects of global crosstalk on gene regulation. We find that crosstalk presents a significant challenge for organisms with low-specificity TFs, such as metazoans. Crosstalk is not easily mitigated by known regulatory schemes acting at equilibrium, including variants of cooperativity and combinatorial regulation. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. PMID:27489144

  12. A gene network switch enhances the oxidative capacity of ovine skeletal muscle during late fetal development

    Directory of Open Access Journals (Sweden)

    Bidwell Christopher A

    2010-06-01

    Full Text Available Abstract Background The developmental transition between the late fetus and a newborn animal is associated with profound changes in skeletal muscle function as it adapts to the new physiological demands of locomotion and postural support against gravity. The mechanisms underpinning this adaption process are unclear but are likely to be initiated by changes in hormone levels. We tested the hypothesis that this developmental transition is associated with large coordinated changes in the transcription of skeletal muscle genes. Results Using an ovine model, transcriptional profiling was performed on Longissimus dorsi skeletal muscle taken at three fetal developmental time points (80, 100 and 120 d of fetal development and two postnatal time points, one approximately 3 days postpartum and a second at 3 months of age. The developmental time course was dominated by large changes in expression of 2,471 genes during the interval between late fetal development (120 d fetal development and 1-3 days postpartum. Analysis of the functions of genes that were uniquely up-regulated in this interval showed strong enrichment for oxidative metabolism and the tricarboxylic acid cycle indicating enhanced mitochondrial activity. Histological examination of tissues from these developmental time points directly confirmed a marked increase in mitochondrial activity between the late fetal and early postnatal samples. The promoters of genes that were up-regulated during this fetal to neonatal transition were enriched for estrogen receptor 1 and estrogen related receptor alpha cis-regulatory motifs. The genes down-regulated during this interval highlighted de-emphasis of an array of functions including Wnt signaling, cell adhesion and differentiation. There were also changes in gene expression prior to this late fetal - postnatal transition and between the two postnatal time points. The former genes were enriched for functions involving the extracellular matrix and immune

  13. Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells.

    Science.gov (United States)

    Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen

    2010-10-01

    Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    International Nuclear Information System (INIS)

    Aluru, Neelakanteswar; Kuo, Elaine; Helfrich, Lily W.; Karchner, Sibel I.; Linney, Elwood A.; Pais, June E.; Franks, Diana G.

    2015-01-01

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt

  15. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Kuo, Elaine [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stanford University, 450 Serra Mall, Stanford, CA 94305 (United States); Helfrich, Lily W. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Northwestern University, 633 Clark St, Evanston, IL 60208 (United States); Karchner, Sibel I. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Linney, Elwood A. [Department of Molecular Genetics and Microbiology, Duke University Medical Center, Box 3020, Durham, NC 27710 (United States); Pais, June E. [New England Biolabs, 240 County Road, Ipswich, MA 01938 (United States); Franks, Diana G. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt

  16. Nitric Oxide- and Hydrogen Peroxide-Responsive Gene Regulation during Cell Death Induction in Tobacco1[W

    Science.gov (United States)

    Zago, Elisa; Morsa, Stijn; Dat, James F.; Alard, Philippe; Ferrarini, Alberto; Inzé, Dirk; Delledonne, Massimo; Van Breusegem, Frank

    2006-01-01

    Nitric oxide (NO) and hydrogen peroxide (H2O2) are regulatory molecules in various developmental processes and stress responses. Tobacco (Nicotiana tabacum) leaves exposed to moderate high light dramatically potentiated NO-mediated cell death in catalase-deficient (CAT1AS) but not in wild-type plants, providing genetic evidence for a partnership between NO and H2O2 during the induction of programmed cell death. With this experimental model system, the specific impact on gene expression was characterized by either NO or H2O2 alone or both molecules combined. By means of genome-wide cDNA-amplified fragment length polymorphism analysis, transcriptional changes were compared in high light-treated CAT1AS and wild-type leaves treated with or without the NO donor sodium nitroprusside. Differential gene expression was detected for 214 of the approximately 8,000 transcript fragments examined. For 108 fragments, sequence analysis revealed homology to genes with a role in signal transduction, defense response, hormone interplay, proteolysis, transport, and metabolism. Surprisingly, only 16 genes were specifically induced by the combined action of NO and H2O2, whereas the majority were regulated by either of them alone. At least seven transcription factors were mutually up-regulated, indicating significant overlap between NO and H2O2 signaling pathways. These results consolidate significant cross-talk between NO and H2O2, provide new insight into the early transcriptional response of plants to increased NO and H2O2 levels, and identify target genes of the combined action of NO and H2O2 during the induction of plant cell death. PMID:16603664

  17. cDREM: inferring dynamic combinatorial gene regulation.

    Science.gov (United States)

    Wise, Aaron; Bar-Joseph, Ziv

    2015-04-01

    Genes are often combinatorially regulated by multiple transcription factors (TFs). Such combinatorial regulation plays an important role in development and facilitates the ability of cells to respond to different stresses. While a number of approaches have utilized sequence and ChIP-based datasets to study combinational regulation, these have often ignored the combinational logic and the dynamics associated with such regulation. Here we present cDREM, a new method for reconstructing dynamic models of combinatorial regulation. cDREM integrates time series gene expression data with (static) protein interaction data. The method is based on a hidden Markov model and utilizes the sparse group Lasso to identify small subsets of combinatorially active TFs, their time of activation, and the logical function they implement. We tested cDREM on yeast and human data sets. Using yeast we show that the predicted combinatorial sets agree with other high throughput genomic datasets and improve upon prior methods developed to infer combinatorial regulation. Applying cDREM to study human response to flu, we were able to identify several combinatorial TF sets, some of which were known to regulate immune response while others represent novel combinations of important TFs.

  18. Frequency Modulation of Transcriptional Bursting Enables Sensitive and Rapid Gene Regulation.

    Science.gov (United States)

    Li, Congxin; Cesbron, François; Oehler, Michael; Brunner, Michael; Höfer, Thomas

    2018-04-25

    Gene regulation is a complex non-equilibrium process. Here, we show that quantitating the temporal regulation of key gene states (transcriptionally inactive, active, and refractory) provides a parsimonious framework for analyzing gene regulation. Our theory makes two non-intuitive predictions. First, for transcription factors (TFs) that regulate transcription burst frequency, as opposed to amplitude or duration, weak TF binding is sufficient to elicit strong transcriptional responses. Second, refractoriness of a gene after a transcription burst enables rapid responses to stimuli. We validate both predictions experimentally by exploiting the natural, optogenetic-like responsiveness of the Neurospora GATA-type TF White Collar Complex (WCC) to blue light. Further, we demonstrate that differential regulation of WCC target genes is caused by different gene activation rates, not different TF occupancy, and that these rates are tuned by both the core promoter and the distance between TF-binding site and core promoter. In total, our work demonstrates the relevance of a kinetic, non-equilibrium framework for understanding transcriptional regulation. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  19. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  20. Distinct developmental defense activations in barley embryos identified by transcriptome profiling

    DEFF Research Database (Denmark)

    Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn

    2006-01-01

    analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...

  1. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  2. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Science.gov (United States)

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  3. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2017-04-15

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA

  4. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    International Nuclear Information System (INIS)

    Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

    2017-01-01

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT

  5. Glue protein production can be triggered by steroid hormone signaling independent of the developmental program in Drosophila melanogaster.

    Science.gov (United States)

    Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime

    2017-10-01

    Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Alternative splicing: a novel mechanism of regulation identified in the chorismate mutase gene of the potato cyst nematode Globodera rostochiensis.

    Science.gov (United States)

    Lu, Shun-Wen; Tian, Duanhua; Borchardt-Wier, Harmony B; Wang, Xiaohong

    2008-11-01

    Chorismate mutase (CM) secreted from the stylet of plant-parasitic nematodes plays an important role in plant parasitism. We isolated and characterized a new nematode CM gene (Gr-cm-1) from the potato cyst nematode, Globodera rostochiensis. The Gr-cm-1 gene was found to exist in the nematode genome as a single-copy gene that has two different alleles, Gr-cm-1A and Gr-cm-1B, both of which could give rise to two different mRNA transcripts of Gr-cm-1 and Gr-cm-1-IRII. In situ mRNA hybridization showed that the Gr-cm-1 gene was exclusively expressed within the subventral oesophageal gland cells of the nematode. Gr-cm-1 was demonstrated to encode a functional CM (GR-CM-1) potentially having a dimeric structure as the secreted bacterial *AroQ CMs. Gr-cm-1-IRII, generated by retention of intron 2 of the Gr-cm-1 pre-mRNA through alternative splicing (AS), would encode a truncated protein (GR-CM-1t) lacking the CM domain with no CM activity. The quantitative real-time reverse transcription-PCR assay revealed that splicing of the Gr-cm-1 gene was developmentally regulated; Gr-cm-1 was up-regulated whereas Gr-cm-1-IRII was down-regulated in early nematode parasitic stages compared to the preparasitic juvenile stage. Low-temperature SDS-PAGE analysis revealed that GR-CM-1 could form homodimers when expressed in Escherichia coli and the dimerization domain was retained in the truncated GR-CM-1t protein. The specific interaction between the two proteins was demonstrated in yeast. Our data suggested that the novel splice variant might function as a dominant negative isoform through heterodimerization with the full-length GR-CM-1 protein and that AS may represent an important mechanism for regulating CM activity during nematode parasitism.

  7. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    Science.gov (United States)

    2006-07-01

    signaling and division were downregulated, including an apoptosis - related, putative tumor suppressor gene, LUCA-15, which was downregulated in seven of... embryologically from the outgrowth of the developing brain (Martinez-Morales et al., 2004). It is comprised of two major layers, the inner layer (prospective...eight genes involved with cell signaling and division were down- regulated. These include an apoptosis -related, putative tumor suppressor gene LUCA-15

  8. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  9. Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

    Science.gov (United States)

    Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

    2016-01-01

    An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also

  10. Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

    2016-02-01

    Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  12. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  13. Developmental Toxicity of Zinc Oxide Nanoparticles to Zebrafish (Danio rerio: A Transcriptomic Analysis.

    Directory of Open Access Journals (Sweden)

    Jin Soo Choi

    Full Text Available Zinc oxide nanoparticles (ZnO NPs are being utilized in an increasing number of fields and commercial applications. While their general toxicity and associated oxidative stress have been extensively studied, the toxicological pathways that they induce in developmental stages are still largely unknown. In this study, the developmental toxicity of ZnO NPs to embryonic/larval zebrafish was investigated. The transcriptional expression profiles induced by ZnO NPs were also investigated to ascertain novel genomic responses related to their specific toxicity pathway. Zebrafish embryos were exposed to 0.01, 0.1, 1, and 10 mg/L ZnO NPs for 96 h post-fertilization. The toxicity of ZnO NPs, based on their Zn concentration, was quite similar to that in embryonic/larval zebrafish exposed to corresponding ZnSO4 concentrations. Pericardial edema and yolk-sac edema were the principal malformations induced by ZnO NPs. Gene-expression profiling using microarrays demonstrated 689 genes that were differentially regulated (fold change >1.5 following exposure to ZnO NPs (498 upregulated, 191 downregulated. Several genes that were differentially regulated following ZnO NP exposure shared similar biological pathways with those observed with ZnSO4 exposure, but six genes (aicda, cyb5d1, edar, intl2, ogfrl2 and tnfsf13b associated with inflammation and the immune system responded specifically to ZnO NPs (either in the opposite direction or were unchanged in ZnSO4 exposure. Real-time reverse-transcription quantitative polymerase chain reaction confirmed that the responses of these genes to ZnO NPs were significantly different from their response to ZnSO4 exposure. ZnO NPs may affect genes related to inflammation and the immune system, resulting in yolk-sac edema and pericardia edema in embryonic/larval developmental stages. These results will assist in elucidating the mechanisms of toxicity of ZnO NPs during development of zebrafish.

  14. Identification of Cell Cycle-Regulated Genes by Convolutional Neural Network.

    Science.gov (United States)

    Liu, Chenglin; Cui, Peng; Huang, Tao

    2017-01-01

    The cell cycle-regulated genes express periodically with the cell cycle stages, and the identification and study of these genes can provide a deep understanding of the cell cycle process. Large false positives and low overlaps are big problems in cell cycle-regulated gene detection. Here, a computational framework called DLGene was proposed for cell cycle-regulated gene detection. It is based on the convolutional neural network, a deep learning algorithm representing raw form of data pattern without assumption of their distribution. First, the expression data was transformed to categorical state data to denote the changing state of gene expression, and four different expression patterns were revealed for the reported cell cycle-regulated genes. Then, DLGene was applied to discriminate the non-cell cycle gene and the four subtypes of cell cycle genes. Its performances were compared with six traditional machine learning methods. At last, the biological functions of representative cell cycle genes for each subtype are analyzed. Our method showed better and more balanced performance of sensitivity and specificity comparing to other machine learning algorithms. The cell cycle genes had very different expression pattern with non-cell cycle genes and among the cell-cycle genes, there were four subtypes. Our method not only detects the cell cycle genes, but also describes its expression pattern, such as when its highest expression level is reached and how it changes with time. For each type, we analyzed the biological functions of the representative genes and such results provided novel insight to the cell cycle mechanisms. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  15. Developmental Science: Past, Present, and Future

    Science.gov (United States)

    Lerner, Richard M.

    2012-01-01

    The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…

  16. Autism Spectrum Disorder and High Confidence Gene Factors

    OpenAIRE

    Mai, MOCHIZUKI

    2017-01-01

    Autism spectrum disorder (ASD) is a neurological developmental disorder whose mechanism isyet unclear. However, recent ASD studies, which employ exome- and genome-wide sequencing,have identified some high-confidence ASD genes. Those ASD studies have revealed that CHD8is likely associated with ASD. In this article, we highlight that CHD8 may regulate othercandidate ASD risk genes. Current research indicates that there exist some thousand autismsusceptibility candidate genes. Moreover, we sugge...

  17. Mining disease genes using integrated protein-protein interaction and gene-gene co-regulation information.

    Science.gov (United States)

    Li, Jin; Wang, Limei; Guo, Maozu; Zhang, Ruijie; Dai, Qiguo; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Xuan, Ping; Zhang, Mingming

    2015-01-01

    In humans, despite the rapid increase in disease-associated gene discovery, a large proportion of disease-associated genes are still unknown. Many network-based approaches have been used to prioritize disease genes. Many networks, such as the protein-protein interaction (PPI), KEGG, and gene co-expression networks, have been used. Expression quantitative trait loci (eQTLs) have been successfully applied for the determination of genes associated with several diseases. In this study, we constructed an eQTL-based gene-gene co-regulation network (GGCRN) and used it to mine for disease genes. We adopted the random walk with restart (RWR) algorithm to mine for genes associated with Alzheimer disease. Compared to the Human Protein Reference Database (HPRD) PPI network alone, the integrated HPRD PPI and GGCRN networks provided faster convergence and revealed new disease-related genes. Therefore, using the RWR algorithm for integrated PPI and GGCRN is an effective method for disease-associated gene mining.

  18. Prostate Cancer Epigenetics: A Review on Gene Regulation

    OpenAIRE

    Diaw, Lena; Woodson, Karen; Gillespie, John W.

    2007-01-01

    Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play ...

  19. Tight regulation of the intS gene of the KplE1 prophage: a new paradigm for integrase gene regulation.

    Directory of Open Access Journals (Sweden)

    Gaël Panis

    2010-10-01

    Full Text Available Temperate phages have the ability to maintain their genome in their host, a process called lysogeny. For most, passive replication of the phage genome relies on integration into the host's chromosome and becoming a prophage. Prophages remain silent in the absence of stress and replicate passively within their host genome. However, when stressful conditions occur, a prophage excises itself and resumes the viral cycle. Integration and excision of phage genomes are mediated by regulated site-specific recombination catalyzed by tyrosine and serine recombinases. In the KplE1 prophage, site-specific recombination is mediated by the IntS integrase and the TorI recombination directionality factor (RDF. We previously described a sub-family of temperate phages that is characterized by an unusual organization of the recombination module. Consequently, the attL recombination region overlaps with the integrase promoter, and the integrase and RDF genes do not share a common activated promoter upon lytic induction as in the lambda prophage. In this study, we show that the intS gene is tightly regulated by its own product as well as by the TorI RDF protein. In silico analysis revealed that overlap of the attL region with the integrase promoter is widely encountered in prophages present in prokaryotic genomes, suggesting a general occurrence of negatively autoregulated integrase genes. The prediction that these integrase genes are negatively autoregulated was biologically assessed by studying the regulation of several integrase genes from two different Escherichia coli strains. Our results suggest that the majority of tRNA-associated integrase genes in prokaryotic genomes could be autoregulated and that this might be correlated with the recombination efficiency as in KplE1. The consequences of this unprecedented regulation for excessive recombination are discussed.

  20. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  1. De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

    Science.gov (United States)

    Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin

    2015-01-01

    We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  2. An explanatory evo-devo model for the developmental hourglass [v1; ref status: indexed, http://f1000r.es/3s6

    Directory of Open Access Journals (Sweden)

    Saamer Akhshabi

    2014-07-01

    Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

  3. An explanatory evo-devo model for the developmental hourglass [v2; ref status: indexed, http://f1000r.es/4x3

    Directory of Open Access Journals (Sweden)

    Saamer Akhshabi

    2014-12-01

    Full Text Available The "developmental hourglass'' describes a pattern of increasing morphological divergence towards earlier and later embryonic development, separated by a period of significant conservation across distant species (the "phylotypic stage''. Recent studies have found evidence in support of the hourglass effect at the genomic level. For instance, the phylotypic stage expresses the oldest and most conserved transcriptomes. However, the regulatory mechanism that causes the hourglass pattern remains an open question. Here, we use an evolutionary model of regulatory gene interactions during development to identify the conditions under which the hourglass effect can emerge in a general setting. The model focuses on the hierarchical gene regulatory network that controls the developmental process, and on the evolution of a population under random perturbations in the structure of that network. The model predicts, under fairly general assumptions, the emergence of an hourglass pattern in the structure of a temporal representation of the underlying gene regulatory network. The evolutionary age of the corresponding genes also follows an hourglass pattern, with the oldest genes concentrated at the hourglass waist. The key behind the hourglass effect is that developmental regulators should have an increasingly specific function as development progresses. Analysis of developmental gene expression profiles from Drosophila melanogaster and Arabidopsis thaliana provide consistent results with our theoretical predictions.

  4. Functional mapping imprinted quantitative trait loci underlying developmental characteristics

    Directory of Open Access Journals (Sweden)

    Li Gengxin

    2008-03-01

    Full Text Available Abstract Background Genomic imprinting, a phenomenon referring to nonequivalent expression of alleles depending on their parental origins, has been widely observed in nature. It has been shown recently that the epigenetic modification of an imprinted gene can be detected through a genetic mapping approach. Such an approach is developed based on traditional quantitative trait loci (QTL mapping focusing on single trait analysis. Recent studies have shown that most imprinted genes in mammals play an important role in controlling embryonic growth and post-natal development. For a developmental character such as growth, current approach is less efficient in dissecting the dynamic genetic effect of imprinted genes during individual ontology. Results Functional mapping has been emerging as a powerful framework for mapping quantitative trait loci underlying complex traits showing developmental characteristics. To understand the genetic architecture of dynamic imprinted traits, we propose a mapping strategy by integrating the functional mapping approach with genomic imprinting. We demonstrate the approach through mapping imprinted QTL controlling growth trajectories in an inbred F2 population. The statistical behavior of the approach is shown through simulation studies, in which the parameters can be estimated with reasonable precision under different simulation scenarios. The utility of the approach is illustrated through real data analysis in an F2 family derived from LG/J and SM/J mouse stains. Three maternally imprinted QTLs are identified as regulating the growth trajectory of mouse body weight. Conclusion The functional iQTL mapping approach developed here provides a quantitative and testable framework for assessing the interplay between imprinted genes and a developmental process, and will have important implications for elucidating the genetic architecture of imprinted traits.

  5. Conservation of AtTZF1, AtTZF2 and AtTZF3 homolog gene regulation by salt stress in evolutionarily distant plant species

    Directory of Open Access Journals (Sweden)

    Fabio eD'Orso

    2015-06-01

    Full Text Available Arginine-rich tandem zinc-finger proteins (RR-TZF participate in a wide range of plant developmental processes and adaptive responses to abiotic stress, such as cold, salt and drought. This study investigates the conservation of the genes AtTZF1-5 at the level of their sequences and expression across plant species. The genomic sequences of the two RR-TZF genes TdTZF1-A and TdTZF1-B were isolated in durum wheat and assigned to chromosomes 3A and 3B, respectively. Sequence comparisons revealed that they encode proteins that are highly homologous to AtTZF1, AtTZF2 and AtTZF3. The expression profiles of these RR-TZF durum wheat and Arabidopsis proteins support a common function in the regulation of seed germination and responses to abiotic stress. In particular, analysis of plants with attenuated and overexpressed AtTZF3 indicate that AtTZF3 is a negative regulator of seed germination under conditions of salt stress. Finally, comparative sequence analyses establish that the RR-TZF genes are encoded by lower plants, including the bryophyte Physcomitrella patens and the alga Chlamydomonas reinhardtii. The regulation of the Physcomitrella AtTZF1-2-3-like genes by salt stress strongly suggests that a subgroup of the RR-TZF proteins has a function that has been conserved throughout evolution.

  6. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  7. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian; Schaefer, Ulf; MacPherson, Cameron R.; Bajic, Vladimir B.

    2011-01-01

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  8. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  9. Regulation of Life Cycle Checkpoints and Developmental Activation of Infective Larvae in Strongyloides stercoralis by Dafachronic Acid.

    Directory of Open Access Journals (Sweden)

    Mennatallah M Y Albarqi

    2016-01-01

    Full Text Available The complex life cycle of the parasitic nematode Strongyloides stercoralis leads to either developmental arrest of infectious third-stage larvae (iL3 or growth to reproductive adults. In the free-living nematode Caenorhabditis elegans, analogous determination between dauer arrest and reproductive growth is governed by dafachronic acids (DAs, a class of steroid hormones that are ligands for the nuclear hormone receptor DAF-12. Biosynthesis of DAs requires the cytochrome P450 (CYP DAF-9. We tested the hypothesis that DAs also regulate S. stercoralis development via DAF-12 signaling at three points. First, we found that 1 μM Δ7-DA stimulated 100% of post-parasitic first-stage larvae (L1s to develop to free-living adults instead of iL3 at 37°C, while 69.4±12.0% (SD of post-parasitic L1s developed to iL3 in controls. Second, we found that 1 μM Δ7-DA prevented post-free-living iL3 arrest and stimulated 85.2±16.9% of larvae to develop to free-living rhabditiform third- and fourth-stages, compared to 0% in the control. This induction required 24-48 hours of Δ7-DA exposure. Third, we found that the CYP inhibitor ketoconazole prevented iL3 feeding in host-like conditions, with only 5.6±2.9% of iL3 feeding in 40 μM ketoconazole, compared to 98.8±0.4% in the positive control. This inhibition was partially rescued by Δ7-DA, with 71.2±16.4% of iL3 feeding in 400 nM Δ7-DA and 35 μM ketoconazole, providing the first evidence of endogenous DA production in S. stercoralis. We then characterized the 26 CYP-encoding genes in S. stercoralis and identified a homolog with sequence and developmental regulation similar to DAF-9. Overall, these data demonstrate that DAF-12 signaling regulates S. stercoralis development, showing that in the post-parasitic generation, loss of DAF-12 signaling favors iL3 arrest, while increased DAF-12 signaling favors reproductive development; that in the post-free-living generation, absence of DAF-12 signaling is crucial for

  10. Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

    Science.gov (United States)

    Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

    2004-01-01

    This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

  11. Path from schizophrenia genomics to biology: gene regulation and perturbation in neurons derived from induced pluripotent stem cells and genome editing.

    Science.gov (United States)

    Duan, Jubao

    2015-02-01

    Schizophrenia (SZ) is a devastating mental disorder afflicting 1% of the population. Recent genome-wide association studies (GWASs) of SZ have identified >100 risk loci. However, the causal variants/genes and the causal mechanisms remain largely unknown, which hinders the translation of GWAS findings into disease biology and drug targets. Most risk variants are noncoding, thus likely regulate gene expression. A major mechanism of transcriptional regulation is chromatin remodeling, and open chromatin is a versatile predictor of regulatory sequences. MicroRNA-mediated post-transcriptional regulation plays an important role in SZ pathogenesis. Neurons differentiated from patient-specific induced pluripotent stem cells (iPSCs) provide an experimental model to characterize the genetic perturbation of regulatory variants that are often specific to cell type and/or developmental stage. The emerging genome-editing technology enables the creation of isogenic iPSCs and neurons to efficiently characterize the effects of SZ-associated regulatory variants on SZ-relevant molecular and cellular phenotypes involving dopaminergic, glutamatergic, and GABAergic neurotransmissions. SZ GWAS findings equipped with the emerging functional genomics approaches provide an unprecedented opportunity for understanding new disease biology and identifying novel drug targets.

  12. Comparative genomics identification of a novel set of temporally regulated hedgehog target genes in the retina.

    Science.gov (United States)

    McNeill, Brian; Perez-Iratxeta, Carol; Mazerolle, Chantal; Furimsky, Marosh; Mishina, Yuji; Andrade-Navarro, Miguel A; Wallace, Valerie A

    2012-03-01

    The hedgehog (Hh) signaling pathway is involved in numerous developmental and adult processes with many links to cancer. In vertebrates, the activity of the Hh pathway is mediated primarily through three Gli transcription factors (Gli1, 2 and 3) that can serve as transcriptional activators or repressors. The identification of Gli target genes is essential for the understanding of the Hh-mediated processes. We used a comparative genomics approach using the mouse and human genomes to identify 390 genes that contained conserved Gli binding sites. RT-qPCR validation of 46 target genes in E14.5 and P0.5 retinal explants revealed that Hh pathway activation resulted in the modulation of 30 of these targets, 25 of which demonstrated a temporal regulation. Further validation revealed that the expression of Bok, FoxA1, Sox8 and Wnt7a was dependent upon Sonic Hh (Shh) signaling in the retina and their regulation is under positive and negative controls by Gli2 and Gli3, respectively. We also show using chromatin immunoprecipitation that Gli2 binds to the Sox8 promoter, suggesting that Sox8 is an Hh-dependent direct target of Gli2. Finally, we demonstrate that the Hh pathway also modulates the expression of Sox9 and Sox10, which together with Sox8 make up the SoxE group. Previously, it has been shown that Hh and SoxE group genes promote Müller glial cell development in the retina. Our data are consistent with the possibility for a role of SoxE group genes downstream of Hh signaling on Müller cell development. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  13. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  14. Biomarkers of adult and developmental neurotoxicity

    International Nuclear Information System (INIS)

    Slikker, William; Bowyer, John F.

    2005-01-01

    Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations

  15. Tomato UDP-Glucose Sterol Glycosyltransferases: A Family of Developmental and Stress Regulated Genes that Encode Cytosolic and Membrane-Associated Forms of the Enzyme

    Directory of Open Access Journals (Sweden)

    Karla Ramirez-Estrada

    2017-06-01

    Full Text Available Sterol glycosyltransferases (SGTs catalyze the glycosylation of the free hydroxyl group at C-3 position of sterols to produce sterol glycosides. Glycosylated sterols and free sterols are primarily located in cell membranes where in combination with other membrane-bound lipids play a key role in modulating their properties and functioning. In contrast to most plant species, those of the genus Solanum contain very high levels of glycosylated sterols, which in the case of tomato may account for more than 85% of the total sterol content. In this study, we report the identification and functional characterization of the four members of the tomato (Solanum lycopersicum cv. Micro-Tom SGT gene family. Expression of recombinant SlSGT proteins in E. coli cells and N. benthamiana leaves demonstrated the ability of the four enzymes to glycosylate different sterol species including cholesterol, brassicasterol, campesterol, stigmasterol, and β-sitosterol, which is consistent with the occurrence in their primary structure of the putative steroid-binding domain found in steroid UDP-glucuronosyltransferases and the UDP-sugar binding domain characteristic for a superfamily of nucleoside diphosphosugar glycosyltransferases. Subcellular localization studies based on fluorescence recovery after photobleaching and cell fractionation analyses revealed that the four tomato SGTs, like the Arabidopsis SGTs UGT80A2 and UGT80B1, localize into the cytosol and the PM, although there are clear differences in their relative distribution between these two cell fractions. The SlSGT genes have specialized but still largely overlapping expression patterns in different organs of tomato plants and throughout the different stages of fruit development and ripening. Moreover, they are differentially regulated in response to biotic and abiotic stress conditions. SlSGT4 expression increases markedly in response to osmotic, salt, and cold stress, as well as upon treatment with abscisic

  16. Thyroid Hormone Regulates the Expression of the Sonic Hedgehog Signaling Pathway in the Embryonic and Adult Mammalian Brain

    OpenAIRE

    Desouza, Lynette A.; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E.; Kottmann, Andreas H.; Tole, Shubha; Vaidya, Vidita A.

    2011-01-01

    Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and...

  17. Intrinsic noise of microRNA-regulated genes and the ceRNA hypothesis.

    Directory of Open Access Journals (Sweden)

    Javad Noorbakhsh

    Full Text Available MicroRNAs are small noncoding RNAs that regulate genes post-transciptionally by binding and degrading target eukaryotic mRNAs. We use a quantitative model to study gene regulation by inhibitory microRNAs and compare it to gene regulation by prokaryotic small non-coding RNAs (sRNAs. Our model uses a combination of analytic techniques as well as computational simulations to calculate the mean-expression and noise profiles of genes regulated by both microRNAs and sRNAs. We find that despite very different molecular machinery and modes of action (catalytic vs stoichiometric, the mean expression levels and noise profiles of microRNA-regulated genes are almost identical to genes regulated by prokaryotic sRNAs. This behavior is extremely robust and persists across a wide range of biologically relevant parameters. We extend our model to study crosstalk between multiple mRNAs that are regulated by a single microRNA and show that noise is a sensitive measure of microRNA-mediated interaction between mRNAs. We conclude by discussing possible experimental strategies for uncovering the microRNA-mRNA interactions and testing the competing endogenous RNA (ceRNA hypothesis.

  18. Reconstructing a Network of Stress-Response Regulators via Dynamic System Modeling of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Wei-Sheng Wu

    2008-01-01

    Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  19. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  20. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

    Science.gov (United States)

    Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

    2016-05-01

    The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori.

    Science.gov (United States)

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-03-25

    Hoxgenes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hoxgenes can also function in terminally differentiated tissue of the lepidopteranBombyx mori In this species,Antennapedia(Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antpcan regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antpin the posterior silk gland induced ectopic expression of major silk protein genes such assericin-3,fhxh4, and fhxh5 These genes are normally expressed specifically in the middle silk gland as is Antp Therefore, the evidence strongly suggests that Antpactivates these silk protein genes in the middle silk gland. The putativesericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antpdirectly activates their expression. We also found that the pattern of gene expression was well conserved between B. moriand the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori We suggest that Hoxgenes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Joshua F. [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Verhoef, Aart; Beelen, Vincent A. van; Pennings, Jeroen L.A. [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Piersma, Aldert H., E-mail: aldert.piersma@rivm.nl [National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, Utrecht (Netherlands)

    2012-10-01

    The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing gene expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.

  3. A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.

    Science.gov (United States)

    Zhang, Zhong-Lin; Shin, Margaret; Zou, Xiaolu; Huang, Jianzhi; Ho, Tun-hua David; Shen, Qingxi J

    2009-05-01

    Abscisic acid (ABA) and gibberellins (GAs) control several developmental processes including seed maturation, dormancy, and germination. The antagonism of these two hormones is well-documented. However, recent data from transcription profiling studies indicate that they can function as agonists in regulating the expression of many genes although the underlying mechanism is unclear. Here we report a rice WRKY gene, OsWRKY24, which encodes a protein that functions as a negative regulator of both GA and ABA signaling. Overexpression of OsWRKY24 via particle bombardment-mediated transient expression in aleurone cells represses the expression of two reporter constructs: the beta-glucuronidase gene driven by the GA-inducible Amy32b alpha-amylase promoter (Amy32b-GUS) and the ABA-inducible HVA22 promoter (HVA22-GUS). OsWRKY24 is unlikely a general repressor because it has little effect on the expression of the luciferase reporter gene driven by a constitutive ubiquitin promoter (UBI-Luciferase). As to the GA signaling, OsWRKY24 differs from OsWRKY51 and -71, two negative regulators specifically function in the GA signaling pathway, in several ways. First, OsWRKY24 contains two WRKY domains while OsWRKY51 and -71 have only one; both WRKY domains are essential for the full repressing activity of OsWRKY24. Second, binding of OsWRKY24 to the Amy32b promoter appears to involve sequences in addition to the TGAC cores of the W-boxes. Third, unlike OsWRKY71, OsWRKY24 is stable upon GA treatment. Together, these data demonstrate that OsWRKY24 is a novel type of transcriptional repressor that inhibits both GA and ABA signaling.

  4. Targeted genome regulation via synthetic programmable transcriptional regulators

    KAUST Repository

    Piatek, Agnieszka Anna

    2016-04-19

    Regulation of gene transcription controls cellular functions and coordinates responses to developmental, physiological and environmental cues. Precise and efficient molecular tools are needed to characterize the functions of single and multiple genes in linear and interacting pathways in a native context. Modular DNA-binding domains from zinc fingers (ZFs) and transcriptional activator-like proteins (TALE) are amenable to bioengineering to bind DNA target sequences of interest. As a result, ZF and TALE proteins were used to develop synthetic programmable transcription factors. However, these systems are limited by the requirement to re-engineer proteins for each new target sequence. The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated 9 (Cas9) genome editing tool was recently repurposed for targeted transcriptional regulation by inactivation of the nuclease activity of Cas9. Due to the facile engineering, simplicity, precision and amenability to library construction, the CRISPR/Cas9 system is poised to revolutionize the functional genomics field across diverse eukaryotic species. In this review, we discuss the development of synthetic customizable transcriptional regulators and provide insights into their current and potential applications, with special emphasis on plant systems, in characterization of gene functions, elucidation of molecular mechanisms and their biotechnological applications. © 2016 Informa UK Limited, trading as Taylor & Francis Group

  5. Identification and characterization of cis-acting elements involved in the regulation of ABA- and/or GA-mediated LuPLR1 gene expression and lignan biosynthesis in flax (Linum usitatissimum L.) cell cultures.

    Science.gov (United States)

    Corbin, Cyrielle; Renouard, Sullivan; Lopez, Tatiana; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe

    2013-03-15

    Pinoresinol lariciresinol reductase 1, encoded by the LuPLR1 gene in flax (Linum usitatissimum L.), is responsible for the biosynthesis of (+)-secoisolariciresinol, a cancer chemopreventive phytoestrogenic lignan accumulated in high amount in the hull of flaxseed. Our recent studies have demonstrated a key role of abscisic acid (ABA) in the regulation of LuPLR1 gene expression and thus of the (+)-secoisolariciresinol synthesis during the flax seedcoat development. It is well accepted that gibberellins (GA) and ABA play antagonistic roles in the regulation of numerous developmental processes; therefore it is of interest to clarify their respective effects on lignan biosynthesis. Herein, using flax cell suspension cultures, we demonstrate that LuPLR1 gene expression and (+)-secoisolariciresinol synthesis are up-regulated by ABA and down-regulated by GA. The LuPLR1 gene promoter analysis and mutation experiments allow us to identify and characterize two important cis-acting sequences (ABRE and MYB2) required for these regulations. These results imply that a cross-talk between ABA and GA signaling orchestrated by transcription factors is involved in the regulation of lignan biosynthesis. This is particularly evidenced in the case of the ABRE cis-regulatory sequence of LuPLR1 gene promoter that appears to be a common target sequence of GA and ABA signals. Copyright © 2012 Elsevier GmbH. All rights reserved.

  6. CONDOR: a database resource of developmentally associated conserved non-coding elements

    Directory of Open Access Journals (Sweden)

    Smith Sarah

    2007-08-01

    Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.

  7. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  8. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  9. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  10. Is transcriptomic regulation of berry development more important at night than during the day?

    Science.gov (United States)

    Rienth, Markus; Torregrosa, Laurent; Kelly, Mary T; Luchaire, Nathalie; Pellegrino, Anne; Grimplet, Jérôme; Romieu, Charles

    2014-01-01

    Diurnal changes in gene expression occur in all living organisms and have been studied on model plants such as Arabidopsis thaliana. To our knowledge the impact of the nycthemeral cycle on the genetic program of fleshly fruit development has been hitherto overlooked. In order to circumvent environmental changes throughout fruit development, young and ripening berries were sampled simultaneously on continuously flowering microvines acclimated to controlled circadian light and temperature changes. Gene expression profiles along fruit development were monitored during both day and night with whole genome microarrays (Nimblegen® vitis 12x), yielding a total number of 9273 developmentally modulated probesets. All day-detected transcripts were modulated at night, whereas 1843 genes were night-specific. Very similar developmental patterns of gene expression were observed using independent hierarchical clustering of day and night data, whereas functional categories of allocated transcripts varied according to time of day. Many transcripts within pathways, known to be up-regulated during ripening, in particular those linked to secondary metabolism exhibited a clearer developmental regulation at night than during the day. Functional enrichment analysis also indicated that diurnally modulated genes considerably varied during fruit development, with a shift from cellular organization and photosynthesis in green berries to secondary metabolism and stress-related genes in ripening berries. These results reveal critical changes in gene expression during night development that differ from daytime development, which have not been observed in other transcriptomic studies on fruit development thus far.

  11. Impact of developmental lead exposure on splenic factors

    International Nuclear Information System (INIS)

    Kasten-Jolly, Jane; Heo, Yong; Lawrence, David A.

    2010-01-01

    Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, in order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.

  12. Pyrosequencing of Haliotis diversicolor transcriptomes: insights into early developmental molluscan gene expression.

    Directory of Open Access Journals (Sweden)

    Zi-Xia Huang

    Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.

  13. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  14. Developmental Transcriptome Analysis and Identification of Genes Involved in Larval Metamorphosis of the Razor Clam, Sinonovacula constricta.

    Science.gov (United States)

    Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale

    2016-04-01

    The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.

  15. Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

    Science.gov (United States)

    Aoyagi, N; Wassarman, D A

    2001-10-01

    In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

  16. Stabilizing in vitro ultrasound-mediated gene transfection by regulating cavitation.

    Science.gov (United States)

    Lo, Chia-Wen; Desjouy, Cyril; Chen, Shing-Ru; Lee, Jyun-Lin; Inserra, Claude; Béra, Jean-Christophe; Chen, Wen-Shiang

    2014-03-01

    It is well known that acoustic cavitation can facilitate the inward transport of genetic materials across cell membranes (sonoporation). However, partially due to the unstationary behavior of the initiation and leveling of cavitation, the sonoporation effect is usually unstable, especially in low intensity conditions. A system which is able to regulate the cavitation level during sonication by modulating the applied acoustic intensity with a feedback loop is implemented and its effect on in vitro gene transfection is tested. The regulated system provided better time stability and reproducibility of the cavitation levels than the unregulated conditions. Cultured hepatoma cells (BNL) mixed with 10 μg luciferase plasmids are exposed to 1-MHz pulsed ultrasound with or without cavitation regulation, and the gene transfection efficiency and cell viability are subsequently assessed. Experimental results show that for all exposure intensities (low, medium, and high), stable and intensity dependent, although not higher, gene expression could be achieved in the regulated cavitation system than the unregulated conditions. The cavitation regulation system provides a better control of cavitation and its bioeffect which are crucial important for clinical applications of ultrasound-mediated gene transfection. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

    Science.gov (United States)

    Tarone, Aaron M; Foran, David R

    2011-01-01

    Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

  18. Reduce, reuse, and recycle: developmental evolution of trait diversification.

    Science.gov (United States)

    Preston, Jill C; Hileman, Lena C; Cubas, Pilar

    2011-03-01

    A major focus of evolutionary developmental (evo-devo) studies is to determine the genetic basis of variation in organismal form and function, both of which are fundamental to biological diversification. Pioneering work on metazoan and flowering plant systems has revealed conserved sets of genes that underlie the bauplan of organisms derived from a common ancestor. However, the extent to which variation in the developmental genetic toolkit mirrors variation at the phenotypic level is an active area of research. Here we explore evidence from the angiosperm evo-devo literature supporting the frugal use of genes and genetic pathways in the evolution of developmental patterning. In particular, these examples highlight the importance of genetic pleiotropy in different developmental modules, thus reducing the number of genes required in growth and development, and the reuse of particular genes in the parallel evolution of ecologically important traits.

  19. Combinatorial gene regulation in Plasmodium falciparum.

    NARCIS (Netherlands)

    Noort, V. van; Huynen, M.A.

    2006-01-01

    The malaria parasite Plasmodium falciparum has a complicated life cycle with large variations in its gene expression pattern, but it contains relatively few specific transcriptional regulators. To elucidate this paradox, we identified regulatory sequences, using an approach that integrates the

  20. Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

    Directory of Open Access Journals (Sweden)

    Byrne Keren A

    2007-08-01

    Full Text Available Abstract Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60, secondary myogenesis (d 135, as well as beginning (d 195 and final stages (birth of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24 were from Hereford dams and crossed with either Wagyu (high intramuscular fat or Piedmontese (GDF8 mutant sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5 RNA at birth. The developing longissimus muscle of

  1. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  2. Rice Gene Network Inferred from Expression Profiling of Plants Overexpressing OsWRKY13,a Positive Regulator of Disease Resistance

    Institute of Scientific and Technical Information of China (English)

    Deyun Qiu; Jun Xiao; Weibo Xie; Hongbo Liu; Xianghua Li; Lizhong Xiong; Shiping Wang

    2008-01-01

    Accumulating information indicates that plant disease resistance signaling pathways frequently interact with other pathways regulating developmental processes or abiotic stress responses. However, the molecular mechanisms of these types of crosstalk remain poorly understood in most cases. Here we report that OsWRKY13, an activator of rice resistance to both bacterial and fungal pathogens, appears to function as a convergent point for crosstalk among the pathogen-induced salicylate-dependent defense pathway and five other physiologic pathways. Genome-wide analysis of the expression profiles of OsWRKY13-overexpressing lines suggests that OsWRKY13 directly or indirectly regulates the expression of more than 500 genes that are potentially involved in different physiologic processes according to the classification of the Gene Ontology database. By comparing the expression patterns of genes functioning in known pathways or cellular processes of pathogen infection and the phenotypes between OsWRKY13-overexpressing and wildtype plants, our data suggest that OsWRKY13 is also a regulator of other physiologic processes during pathogen infection. The OsWRKY13-associated disease resistance pathway synergistically interacts via OsWRKY13 with the glutathione/glutaredoxin system and flavonoid biosynthesis pathway to monitor redox homeostasis and to putatively enhance the biosynthesis of antimicrobial flavonoid phytoalexins, respectively, in OsWRKY13-overexpressing lines. Meanwhile, the OsWRKY13-associated disease resistance pathway appears to interact antagonistically with the SNAC1-mediated abiotic stress defense pathway, jasmonic acid signaling pathway, and terpenoid metabolism pathway via OsWRKY13 to suppress salt and cold defense responses as well as to putatively retard rice growth and development.

  3. Transcription regulation by the Mediator complex.

    Science.gov (United States)

    Soutourina, Julie

    2018-04-01

    Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.

  4. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  5. Serial analysis of gene expression in the silkworm, Bombyx mori.

    Science.gov (United States)

    Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

    2005-08-01

    The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

  6. Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.

    Science.gov (United States)

    Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco

    2017-10-01

    The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.

  7. Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

    Science.gov (United States)

    Xiong, Li-Ping; Ma, Yu-Qiang; Tang, Lei-Han

    2010-09-01

    Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology.

  8. Synergistic Effect of Auto-Activation and Small RNA Regulation on Gene Expression

    International Nuclear Information System (INIS)

    Li-Ping, Xiong; Yu-Qiang, Ma; Lei-Han, Tang

    2010-01-01

    Auto-activation and small ribonucleic acid (RNA)-mediated regulation are two important mechanisms in controlling gene expression. We study the synergistic effect of these two regulations on gene expression. It is found that under this combinatorial regulation, gene expression exhibits bistable behaviors at the transition regime, while each of these two regulations, if working solely, only leads to monostability. Within the stochastic framework, the base pairing strength between sRNA and mRNA plays an important role in controlling the transition time between on and off states. The noise strength of protein number in the off state approaches 1 and is smaller than that in the on state. The noise strength also depends on which parameters, the feedback strength or the synthesis rate of small RNA, are tuned in switching the gene expression on and off. Our findings may provide a new insight into gene-regulation mechanism and can be applied in synthetic biology

  9. Reporter-Based Isolation of Developmental Myogenic Progenitors

    Directory of Open Access Journals (Sweden)

    Eyemen Kheir

    2018-04-01

    Full Text Available The formation and activity of mammalian tissues entail finely regulated processes, involving the concerted organization and interaction of multiple cell types. In recent years the prospective isolation of distinct progenitor and stem cell populations has become a powerful tool in the hands of developmental biologists and has rendered the investigation of their intrinsic properties possible. In this protocol, we describe how to purify progenitors with different lineage history and degree of differentiation from embryonic and fetal skeletal muscle by fluorescence-activated cell sorting (FACS. The approach takes advantage of a panel of murine strains expressing fluorescent reporter genes specifically in the myogenic progenitors. We provide a detailed description of the dissection procedures and of the enzymatic dissociation required to maximize the yield of mononucleated cells for subsequent FACS-based purification. The procedure takes ~6–7 h to complete and allows for the isolation and the subsequent molecular and phenotypic characterization of developmental myogenic progenitors.

  10. Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus

    Energy Technology Data Exchange (ETDEWEB)

    Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon, E-mail: jeonghoon@skku.edu; Lee, Jae-Seong, E-mail: jslee2@skku.edu

    2017-03-15

    Highlights: • Impaired effects of UV-B on the copepod Tigriopus japonicus were examined. • Modulation of entire CYP genes were analyzed in response to UV-B. • CYP inhibitor (PBO) confirmed the role of CYP in UV-B induced mortality. • Low-dose UV-B found induce developmental delays, and higher doses cause reproductive impairments. • Study predicted the mechanistic effects of UV-B in copepods through the AhR-mediated up-regulation of CYP genes. - Abstract: To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P < 0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48 h LD10 and LD50 were 1.35 and 1.84 kJ/m{sup 2}, and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5 kJ/m{sup 2}) induced developmental delays, and higher doses (6–18 kJ/m{sup 2}) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12 kJ/m{sup 2}) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes.

  11. Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus

    International Nuclear Information System (INIS)

    Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

    2017-01-01

    Highlights: • Impaired effects of UV-B on the copepod Tigriopus japonicus were examined. • Modulation of entire CYP genes were analyzed in response to UV-B. • CYP inhibitor (PBO) confirmed the role of CYP in UV-B induced mortality. • Low-dose UV-B found induce developmental delays, and higher doses cause reproductive impairments. • Study predicted the mechanistic effects of UV-B in copepods through the AhR-mediated up-regulation of CYP genes. - Abstract: To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (P < 0.05) in the survival of T. japonicus that began as a developmental delay and decreased fecundity. The 48 h LD10 and LD50 were 1.35 and 1.84 kJ/m"2, and the CYP inhibitor (PBO) elevated mortality, confirming the involvement of CYP genes in UV-B induced toxicity. Low-dose UV-B (1.5 kJ/m"2) induced developmental delays, and higher doses (6–18 kJ/m"2) caused reproductive impairments in ovigerous females. The significant up-regulation of CYP genes belonging to clans 2/3/MT/4/20 in T. japonicus exposed to UV-B (12 kJ/m"2) confirmed molecular interaction between UV-B and CYP genes. Moreover, orphan CYPs, such as CYP20A1, provide good insight on the deorphanization of invertebrate CYPs. Overall, these results demonstrate the involvement of UV-B radiation in the expression of all the CYP genes in T. japonicus and their susceptibility to UV-B radiation. This will provide a better understanding of the mechanistic effects of UV-B in copepods through the predicted AhR-mediated up-regulation of CYP genes.

  12. Developmental Pathways Are Blueprints for Designing Successful Crops

    Directory of Open Access Journals (Sweden)

    Ben Trevaskis

    2018-06-01

    Full Text Available Genes controlling plant development have been studied in multiple plant systems. This has provided deep insights into conserved genetic pathways controlling core developmental processes including meristem identity, phase transitions, determinacy, stem elongation, and branching. These pathways control plant growth patterns and are fundamentally important to crop biology and agriculture. This review describes the conserved pathways that control plant development, using Arabidopsis as a model. Historical examples of how plant development has been altered through selection to improve crop performance are then presented. These examples, drawn from diverse crops, show how the genetic pathways controlling development have been modified to increase yield or tailor growth patterns to suit local growing environments or specialized crop management practices. Strategies to apply current progress in genomics and developmental biology to future crop improvement are then discussed within the broader context of emerging trends in plant breeding. The ways that knowledge of developmental processes and understanding of gene function can contribute to crop improvement, beyond what can be achieved by selection alone, are emphasized. These include using genome re-sequencing, mutagenesis, and gene editing to identify or generate novel variation in developmental genes. The expanding scope for comparative genomics, the possibility to engineer new developmental traits and new approaches to resolve gene–gene or gene–environment interactions are also discussed. Finally, opportunities to integrate fundamental research and crop breeding are highlighted.

  13. Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

    Science.gov (United States)

    Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

    2012-03-01

    The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

  14. Discovery of time-delayed gene regulatory networks based on temporal gene expression profiling

    Directory of Open Access Journals (Sweden)

    Guo Zheng

    2006-01-01

    Full Text Available Abstract Background It is one of the ultimate goals for modern biological research to fully elucidate the intricate interplays and the regulations of the molecular determinants that propel and characterize the progression of versatile life phenomena, to name a few, cell cycling, developmental biology, aging, and the progressive and recurrent pathogenesis of complex diseases. The vast amount of large-scale and genome-wide time-resolved data is becoming increasing available, which provides the golden opportunity to unravel the challenging reverse-engineering problem of time-delayed gene regulatory networks. Results In particular, this methodological paper aims to reconstruct regulatory networks from temporal gene expression data by using delayed correlations between genes, i.e., pairwise overlaps of expression levels shifted in time relative each other. We have thus developed a novel model-free computational toolbox termed TdGRN (Time-delayed Gene Regulatory Network to address the underlying regulations of genes that can span any unit(s of time intervals. This bioinformatics toolbox has provided a unified approach to uncovering time trends of gene regulations through decision analysis of the newly designed time-delayed gene expression matrix. We have applied the proposed method to yeast cell cycling and human HeLa cell cycling and have discovered most of the underlying time-delayed regulations that are supported by multiple lines of experimental evidence and that are remarkably consistent with the current knowledge on phase characteristics for the cell cyclings. Conclusion We established a usable and powerful model-free approach to dissecting high-order dynamic trends of gene-gene interactions. We have carefully validated the proposed algorithm by applying it to two publicly available cell cycling datasets. In addition to uncovering the time trends of gene regulations for cell cycling, this unified approach can also be used to study the complex

  15. Functional Profiling of Transcription Factor Genes in Neurospora crassa

    Directory of Open Access Journals (Sweden)

    Alexander J. Carrillo

    2017-09-01

    Full Text Available Regulation of gene expression by DNA-binding transcription factors is essential for proper control of growth and development in all organisms. In this study, we annotate and characterize growth and developmental phenotypes for transcription factor genes in the model filamentous fungus Neurospora crassa. We identified 312 transcription factor genes, corresponding to 3.2% of the protein coding genes in the genome. The largest class was the fungal-specific Zn2Cys6 (C6 binuclear cluster, with 135 members, followed by the highly conserved C2H2 zinc finger group, with 61 genes. Viable knockout mutants were produced for 273 genes, and complete growth and developmental phenotypic data are available for 242 strains, with 64% possessing at least one defect. The most prominent defect observed was in growth of basal hyphae (43% of mutants analyzed, followed by asexual sporulation (38%, and the various stages of sexual development (19%. Two growth or developmental defects were observed for 21% of the mutants, while 8% were defective in all three major phenotypes tested. Analysis of available mRNA expression data for a time course of sexual development revealed mutants with sexual phenotypes that correlate with transcription factor transcript abundance in wild type. Inspection of this data also implicated cryptic roles in sexual development for several cotranscribed transcription factor genes that do not produce a phenotype when mutated.

  16. Regulation of hepatic PPARγ2 and lipogenic gene expression by melanocortin

    International Nuclear Information System (INIS)

    Poritsanos, Nicole J.; Wong, Davie; Vrontakis, Maria E.; Mizuno, Tooru M.

    2008-01-01

    The central melanocortin system regulates hepatic lipid metabolism. Hepatic lipogenic gene expression is regulated by transcription factors including sterol regulatory element-binding protein 1c (SREBP-1c), carbohydrate responsive element-binding protein (ChREBP), and peroxisome proliferator-activated receptor γ2 (PPARγ2). However, it is unclear if central melanocortin signaling regulates hepatic lipogenic gene expression through the activation of these transcription factors. To delineate the molecular mechanisms by which the melanocortin system regulates hepatic lipid metabolism, we examined the effect of intracerebroventricular injection of SHU9119, a melanocortin receptor antagonist, on hepatic expression levels of genes involved in lipid metabolism in mice. SHU9119 treatment increased hepatic triglyceride content and mRNA levels of lipogenic genes, SREBP-1c, and PPARγ2, whereas it did not cause any changes in hepatic ChREBP mRNA levels. These findings suggest that reduced central melanocortin signaling increases hepatic lipid deposition by stimulating hepatic lipogenic gene expression at least partly through the activation of SREBP-1c and PPARγ2

  17. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  18. Challenges for modeling global gene regulatory networks during development: insights from Drosophila.

    Science.gov (United States)

    Wilczynski, Bartek; Furlong, Eileen E M

    2010-04-15

    Development is regulated by dynamic patterns of gene expression, which are orchestrated through the action of complex gene regulatory networks (GRNs). Substantial progress has been made in modeling transcriptional regulation in recent years, including qualitative "coarse-grain" models operating at the gene level to very "fine-grain" quantitative models operating at the biophysical "transcription factor-DNA level". Recent advances in genome-wide studies have revealed an enormous increase in the size and complexity or GRNs. Even relatively simple developmental processes can involve hundreds of regulatory molecules, with extensive interconnectivity and cooperative regulation. This leads to an explosion in the number of regulatory functions, effectively impeding Boolean-based qualitative modeling approaches. At the same time, the lack of information on the biophysical properties for the majority of transcription factors within a global network restricts quantitative approaches. In this review, we explore the current challenges in moving from modeling medium scale well-characterized networks to more poorly characterized global networks. We suggest to integrate coarse- and find-grain approaches to model gene regulatory networks in cis. We focus on two very well-studied examples from Drosophila, which likely represent typical developmental regulatory modules across metazoans. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  19. Sexually dimorphic gene regulation in brain as a target for endocrine disrupters: Developmental exposure of rats to 4-methylbenzylidene camphor

    International Nuclear Information System (INIS)

    Maerkel, Kirsten; Durrer, Stefan; Henseler, Manuel; Schlumpf, Margret; Lichtensteiger, Walter

    2007-01-01

    The developing neuroendocrine brain represents a potential target for endocrine active chemicals. The UV filter 4-methylbenzylidene camphor (4-MBC) exhibits estrogenic activity, but also interferes with the thyroid axis. We investigated effects of pre- and postnatal exposure to 4-MBC in the same rat offspring at brain and reproductive organ levels. 4-MBC (7, 24, 47 mg/kg/day) was administered in chow to the parent generation before mating, during gestation and lactation, and to the offspring until adulthood. mRNA of estrogen target genes involved in control of sexual behavior and gonadal functions was measured by real-time RT-PCR in ventromedial hypothalamic nucleus (VMH) and medial preoptic area (MPO) of adult offspring. 4-MBC exposure affected mRNA levels of ER alpha, progesterone receptor (PR), preproenkephalin (PPE) and insulin-like growth factor-I (IGF-I) in a sex- and region-specific manner. In order to assess possible changes in sensitivity of target genes to estrogens, offspring were gonadectomized on day 70, injected with estradiol (E2, 10 or 50 μg/kg s.c.) or vehicle on day 84, and sacrificed 6 h later. The acute induction of PR mRNA, and repression (at 6 h) of PPE mRNA by E2 was enhanced by 4-MBC in male and female VMH and female MPO, whereas male MPO exhibited reduced responsiveness of both genes. Steroid receptor coactivator SRC-1 mRNA levels were increased in female VMH and MPO. The data indicate profound sex- and region-specific alterations in the regulation of estrogen target genes at brain level. Effect patterns in baseline and E2-induced gene expression differ from those in uterus and prostate

  20. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  1. Developmental psychopathology in an era of molecular genetics and neuroimaging: A developmental neurogenetics approach.

    Science.gov (United States)

    Hyde, Luke W

    2015-05-01

    The emerging field of neurogenetics seeks to model the complex pathways from gene to brain to behavior. This field has focused on imaging genetics techniques that examine how variability in common genetic polymorphisms predict differences in brain structure and function. These studies are informed by other complimentary techniques (e.g., animal models and multimodal imaging) and have recently begun to incorporate the environment through examination of Imaging Gene × Environment interactions. Though neurogenetics has the potential to inform our understanding of the development of psychopathology, there has been little integration between principles of neurogenetics and developmental psychopathology. The paper describes a neurogenetics and Imaging Gene × Environment approach and how these approaches have been usefully applied to the study of psychopathology. Six tenets of developmental psychopathology (the structure of phenotypes, the importance of exploring mechanisms, the conditional nature of risk, the complexity of multilevel pathways, the role of development, and the importance of who is studied) are identified, and how these principles can further neurogenetics applications to understanding the development of psychopathology is discussed. A major issue of this piece is how neurogenetics and current imaging and molecular genetics approaches can be incorporated into developmental psychopathology perspectives with a goal of providing models for better understanding pathways from among genes, environments, the brain, and behavior.

  2. Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

    Science.gov (United States)

    Stiles, Kari A; Van Volkenburgh, Elizabeth

    2002-07-01

    Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

  3. Local and global responses in complex gene regulation networks

    Science.gov (United States)

    Tsuchiya, Masa; Selvarajoo, Kumar; Piras, Vincent; Tomita, Masaru; Giuliani, Alessandro

    2009-04-01

    An exacerbated sensitivity to apparently minor stimuli and a general resilience of the entire system stay together side-by-side in biological systems. This apparent paradox can be explained by the consideration of biological systems as very strongly interconnected network systems. Some nodes of these networks, thanks to their peculiar location in the network architecture, are responsible for the sensitivity aspects, while the large degree of interconnection is at the basis of the resilience properties of the system. One relevant feature of the high degree of connectivity of gene regulation networks is the emergence of collective ordered phenomena influencing the entire genome and not only a specific portion of transcripts. The great majority of existing gene regulation models give the impression of purely local ‘hard-wired’ mechanisms disregarding the emergence of global ordered behavior encompassing thousands of genes while the general, genome wide, aspects are less known. Here we address, on a data analysis perspective, the discrimination between local and global scale regulations, this goal was achieved by means of the examination of two biological systems: innate immune response in macrophages and oscillating growth dynamics in yeast. Our aim was to reconcile the ‘hard-wired’ local view of gene regulation with a global continuous and scalable one borrowed from statistical physics. This reconciliation is based on the network paradigm in which the local ‘hard-wired’ activities correspond to the activation of specific crucial nodes in the regulation network, while the scalable continuous responses can be equated to the collective oscillations of the network after a perturbation.

  4. Tissue and cell-specific transcriptomes in cotton reveal the subtleties of gene regulation underlying the diversity of plant secondary cell walls.

    Science.gov (United States)

    MacMillan, Colleen P; Birke, Hannah; Chuah, Aaron; Brill, Elizabeth; Tsuji, Yukiko; Ralph, John; Dennis, Elizabeth S; Llewellyn, Danny; Pettolino, Filomena A

    2017-07-18

    Knowledge of plant secondary cell wall (SCW) regulation and deposition is mainly based on the Arabidopsis model of a 'typical' lignocellulosic SCW. However, SCWs in other plants can vary from this. The SCW of mature cotton seed fibres is highly cellulosic and lacks lignification whereas xylem SCWs are lignocellulosic. We used cotton as a model to study different SCWs and the expression of the genes involved in their formation via RNA deep sequencing and chemical analysis of stem and seed fibre. Transcriptome comparisons from cotton xylem and pith as well as from a developmental series of seed fibres revealed tissue-specific and developmentally regulated expression of several NAC transcription factors some of which are likely to be important as top tier regulators of SCW formation in xylem and/or seed fibre. A so far undescribed hierarchy was identified between the top tier NAC transcription factors SND1-like and NST1/2 in cotton. Key SCW MYB transcription factors, homologs of Arabidopsis MYB46/83, were practically absent in cotton stem xylem. Lack of expression of other lignin-specific MYBs in seed fibre relative to xylem could account for the lack of lignin deposition in seed fibre. Expression of a MYB103 homolog correlated with temporal expression of SCW CesAs and cellulose synthesis in seed fibres. FLAs were highly expressed and may be important structural components of seed fibre SCWs. Finally, we made the unexpected observation that cell walls in the pith of cotton stems contained lignin and had a higher S:G ratio than in xylem, despite that tissue's lacking many of the gene transcripts normally associated with lignin biosynthesis. Our study in cotton confirmed some features of the currently accepted gene regulatory cascade for 'typical' plant SCWs, but also revealed substantial differences, especially with key downstream NACs and MYBs. The lignocellulosic SCW of cotton xylem appears to be achieved differently from that in Arabidopsis. Pith cell walls in

  5. The cell cycle-regulated genes of Schizosaccharomyces pombe.

    Science.gov (United States)

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve; Futcher, Bruce; Leatherwood, Janet

    2005-07-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know.

  6. The Cell Cycle–Regulated Genes of Schizosaccharomyces pombe

    Science.gov (United States)

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve

    2005-01-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know. PMID:15966770

  7. Transcriptomics-based identification of developmental toxicants through their interference with cardiomyocyte differentiation of embryonic stem cells

    International Nuclear Information System (INIS)

    Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Schooten, Frederik J. van; Piersma, Aldert H.

    2010-01-01

    The embryonic stem cell test (EST) predicts developmental toxicity based on the inhibition of cardiomyocyte differentiation of embryonic stem cells (ESC). The subjective endpoint, the long culture duration together with the undefined applicability domain and related predictivity need further improvement to facilitate implementation of the EST into regulatory strategies. These aspects may be improved by studying gene expression changes in the ESC differentiation cultures and their modulation by compound exposure using transcriptomics. Here, we tested the developmental toxicants monobutyl phthalate and 6-aminonicotinamide. ESC were allowed to differentiated, and cardiomyocyte differentiation was assessed after 10 days of culture. RNA of solvent controls was collected after 0, 24, 48, 72 and 96 h of exposure, and RNA of developmental-toxicant-exposed cultures was collected after 24 and 96 h. Samples were hybridized to DNA microarrays, and 1355 genes were found differentially expressed among the unexposed experimental groups. These regulated genes were involved in differentiation-related processes, and Principal Component Analysis (PCA) based on these genes showed that the unexposed experimental groups appeared in chronological order in the PCA, which can therefore be regarded as a continuous representation of the differentiation track. The developmental-toxicant-exposed cultures appeared to deviate significantly from this differentiation track, which confirms the compound-modulating effects on the differentiation process. The incorporation of transcriptomics in the EST is expected to provide a more informative and improved endpoint in the EST as compared with morphology, allowing early detection of differentiation modulation. Furthermore, this approach may improve the definition of the applicability domain and predictivity of the EST.

  8. Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

    Science.gov (United States)

    Xi, Ting; Zhang, Guizhi

    2017-02-01

    Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

  9. Developmental delays in emotion regulation strategies in preschoolers with autism.

    Science.gov (United States)

    Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl

    2017-11-01

    Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These

  10. Developmental expression of “germline”- and “sex determination”-related genes in the ctenophore Mnemiopsis leidyi

    Directory of Open Access Journals (Sweden)

    Adam M. Reitzel

    2016-08-01

    Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for

  11. A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships.

    Science.gov (United States)

    Pucci, Ferdinando; Venneri, Mary Anna; Biziato, Daniela; Nonis, Alessandro; Moi, Davide; Sica, Antonio; Di Serio, Clelia; Naldini, Luigi; De Palma, Michele

    2009-07-23

    We previously showed that Tie2-expressing monocytes (TEMs) have nonredundant proangiogenic activity in tumors. Here, we compared the gene expression profile of tumor-infiltrating TEMs with that of tumor-associated macrophages (TAMs), spleen-derived Gr1(+)Cd11b(+) neutrophils/myeloid-derived suppressor cells, circulating "inflammatory" and "resident" monocytes, and tumor-derived endothelial cells (ECs) by quantitative polymerase chain reaction-based gene arrays. TEMs sharply differed from ECs and Gr1(+)Cd11b(+) cells but were highly related to TAMs. Nevertheless, several genes were differentially expressed between TEMs and TAMs, highlighting a TEM signature consistent with enhanced proangiogenic/tissue-remodeling activity and lower proinflammatory activity. We validated these findings in models of oncogenesis and transgenic mice expressing a microRNA-regulated Tie2-GFP reporter. Remarkably, resident monocytes and TEMs on one hand, and inflammatory monocytes and TAMs on the other hand, expressed coordinated gene expression profiles, suggesting that the 2 blood monocyte subsets are committed to distinct extravascular fates in the tumor microenvironment. We further showed that a prominent proportion of embryonic/fetal macrophages, which participate in tissue morphogenesis, expressed distinguishing TEM genes. It is tempting to speculate that Tie2(+) embryonic/fetal macrophages, resident blood monocytes, and tumor-infiltrating TEMs represent distinct developmental stages of a TEM lineage committed to execute physiologic proangiogenic and tissue-remodeling programs, which can be co-opted by tumors.

  12. Transcription of the soybean leghemoglobin genes during nodule development

    DEFF Research Database (Denmark)

    Marcker, Anne; Ø Jensen, Erik; Marcker, Kjeld A

    1984-01-01

    During the early stages of soybean nodule development the leghemoglobin (Lb) genes are activated sequentially in the opposite order to which they are arranged in the soybean genome. At a specific stage after the initial activation of all the Lb genes, a large increment occurs in the transcription...... of the Lb(c1), Lb(c3) and Lb(a) genes while the transcription of the Lb(c2) gene is not amplified to a similar extent. All the Lb genes retain significant activity for a long period during the lifetime of a nodule. Consequently the soybean Lb genes are not regulated by a developmental gene switching...

  13. Microarray profiling of progesterone-regulated endometrial genes during the rhesus monkey secretory phase

    Directory of Open Access Journals (Sweden)

    Okulicz William C

    2004-07-01

    Full Text Available Abstract Background In the endometrium the steroid hormone progesterone (P, acting through its nuclear receptors, regulates the expression of specific target genes and gene networks required for endometrial maturation. Proper endometrial maturation is considered a requirement for embryo implantation. Endometrial receptivity is a complex process that is spatially and temporally restricted and the identity of genes that regulate receptivity has been pursued by a number of investigators. Methods In this study we have used high density oligonucleotide microarrays to screen for changes in mRNA transcript levels between normal proliferative and adequate secretory phases in Rhesus monkey artificial menstrual cycles. Biotinylated cRNA was prepared from day 13 and days 21–23 of the reproductive cycle and transcript levels were compared by hybridization to Affymetrix HG-U95A arrays. Results Of ~12,000 genes profiled, we identified 108 genes that were significantly regulated during the shift from a proliferative to an adequate secretory endometrium. Of these genes, 39 were up-regulated at days 21–23 versus day 13, and 69 were down-regulated. Genes up-regulated in P-dominant tissue included: secretoglobin (uteroglobin, histone 2A, polo-like kinase (PLK, spermidine/spermine acetyltransferase 2 (SAT2, secretory leukocyte protease inhibitor (SLPI and metallothionein 1G (MT1G, all of which have been previously documented as elevated in the Rhesus monkey or human endometrium during the secretory phase. Genes down-regulated included: transforming growth factor beta-induced (TGFBI or BIGH3, matrix metalloproteinase 11 (stromelysin 3, proenkephalin (PENK, cysteine/glycine-rich protein 2 (CSRP2, collagen type VII alpha 1 (COL7A1, secreted frizzled-related protein 4 (SFRP4, progesterone receptor membrane component 1 (PGRMC1, chemokine (C-X-C ligand 12 (CXCL12 and biglycan (BGN. In addition, many novel/unknown genes were also identified. Validation of array data

  14. Developmental Vitamin D Availability Impacts Hematopoietic Stem Cell Production

    Directory of Open Access Journals (Sweden)

    Mauricio Cortes

    2016-10-01

    Full Text Available Vitamin D insufficiency is a worldwide epidemic affecting billions of individuals, including pregnant women and children. Despite its high incidence, the impact of active vitamin D3 (1,25(OHD3 on embryonic development beyond osteo-regulation remains largely undefined. Here, we demonstrate that 1,25(OHD3 availability modulates zebrafish hematopoietic stem and progenitor cell (HSPC production. Loss of Cyp27b1-mediated biosynthesis or vitamin D receptor (VDR function by gene knockdown resulted in significantly reduced runx1 expression and Flk1+cMyb+ HSPC numbers. Selective modulation in vivo and in vitro in zebrafish indicated that vitamin D3 acts directly on HSPCs, independent of calcium regulation, to increase proliferation. Notably, ex vivo treatment of human HSPCs with 1,25(OHD3 also enhanced hematopoietic colony numbers, illustrating conservation across species. Finally, gene expression and epistasis analysis indicated that CXCL8 (IL-8 was a functional target of vitamin D3-mediated HSPC regulation. Together, these findings highlight the relevance of developmental 1,25(OHD3 availability for definitive hematopoiesis and suggest potential therapeutic utility in HSPC expansion.

  15. Every which way--nanos gene regulation in echinoderms.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2014-03-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio binds to and changes the fate of several known transcripts. We summarize here the documented functions of Nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way. Copyright © 2013 Wiley Periodicals, Inc.

  16. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

    OpenAIRE

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

  17. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  18. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  19. Multi-Omics and Integrated Network Analyses Reveal New Insights into the Systems Relationships between Metabolites, Structural Genes, and Transcriptional Regulators in Developing Grape Berries (Vitis vinifera L. Exposed to Water Deficit

    Directory of Open Access Journals (Sweden)

    Stefania Savoi

    2017-07-01

    Full Text Available Grapes are one of the major fruit crops and they are cultivated in many dry environments. This study comprehensively characterizes the metabolic response of grape berries exposed to water deficit at different developmental stages. Increases of proline, branched-chain amino acids, phenylpropanoids, anthocyanins, and free volatile organic compounds have been previously observed in grape berries exposed to water deficit. Integrating RNA-sequencing analysis of the transcriptome with large-scale analysis of central and specialized metabolites, we reveal that these increases occur via a coordinated regulation of key structural pathway genes. Water deficit-induced up-regulation of flavonoid genes is also coordinated with the down-regulation of many stilbene synthases and a consistent decrease in stilbenoid concentration. Water deficit activated both ABA-dependent and ABA-independent signal transduction pathways by modulating the expression of several transcription factors. Gene-gene and gene-metabolite network analyses showed that water deficit-responsive transcription factors such as bZIPs, AP2/ERFs, MYBs, and NACs are implicated in the regulation of stress-responsive metabolites. Enrichment of known and novel cis-regulatory elements in the promoters of several ripening-specific/water deficit-induced modules further affirms the involvement of a transcription factor cross-talk in the berry response to water deficit. Together, our integrated approaches show that water deficit-regulated gene modules are strongly linked to key fruit-quality metabolites and multiple signal transduction pathways may be critical to achieve a balance between the regulation of the stress-response and the berry ripening program. This study constitutes an invaluable resource for future discoveries and comparative studies, in grapes and other fruits, centered on reproductive tissue metabolism under abiotic stress.

  20. Multi-Omics and Integrated Network Analyses Reveal New Insights into the Systems Relationships between Metabolites, Structural Genes, and Transcriptional Regulators in Developing Grape Berries (Vitis vinifera L.) Exposed to Water Deficit.

    Science.gov (United States)

    Savoi, Stefania; Wong, Darren C J; Degu, Asfaw; Herrera, Jose C; Bucchetti, Barbara; Peterlunger, Enrico; Fait, Aaron; Mattivi, Fulvio; Castellarin, Simone D

    2017-01-01

    Grapes are one of the major fruit crops and they are cultivated in many dry environments. This study comprehensively characterizes the metabolic response of grape berries exposed to water deficit at different developmental stages. Increases of proline, branched-chain amino acids, phenylpropanoids, anthocyanins, and free volatile organic compounds have been previously observed in grape berries exposed to water deficit. Integrating RNA-sequencing analysis of the transcriptome with large-scale analysis of central and specialized metabolites, we reveal that these increases occur via a coordinated regulation of key structural pathway genes. Water deficit-induced up-regulation of flavonoid genes is also coordinated with the down-regulation of many stilbene synthases and a consistent decrease in stilbenoid concentration. Water deficit activated both ABA-dependent and ABA-independent signal transduction pathways by modulating the expression of several transcription factors. Gene-gene and gene-metabolite network analyses showed that water deficit-responsive transcription factors such as bZIPs, AP2/ERFs, MYBs, and NACs are implicated in the regulation of stress-responsive metabolites. Enrichment of known and novel cis -regulatory elements in the promoters of several ripening-specific/water deficit-induced modules further affirms the involvement of a transcription factor cross-talk in the berry response to water deficit. Together, our integrated approaches show that water deficit-regulated gene modules are strongly linked to key fruit-quality metabolites and multiple signal transduction pathways may be critical to achieve a balance between the regulation of the stress-response and the berry ripening program. This study constitutes an invaluable resource for future discoveries and comparative studies, in grapes and other fruits, centered on reproductive tissue metabolism under abiotic stress.

  1. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  2. Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1.

    Science.gov (United States)

    Gutiérrez, Rodrigo A; Stokes, Trevor L; Thum, Karen; Xu, Xiaodong; Obertello, Mariana; Katari, Manpreet S; Tanurdzic, Milos; Dean, Alexis; Nero, Damion C; McClung, C Robertson; Coruzzi, Gloria M

    2008-03-25

    Understanding how nutrients affect gene expression will help us to understand the mechanisms controlling plant growth and development as a function of nutrient availability. Nitrate has been shown to serve as a signal for the control of gene expression in Arabidopsis. There is also evidence, on a gene-by-gene basis, that downstream products of nitrogen (N) assimilation such as glutamate (Glu) or glutamine (Gln) might serve as signals of organic N status that in turn regulate gene expression. To identify genome-wide responses to such organic N signals, Arabidopsis seedlings were transiently treated with ammonium nitrate in the presence or absence of MSX, an inhibitor of glutamine synthetase, resulting in a block of Glu/Gln synthesis. Genes that responded to organic N were identified as those whose response to ammonium nitrate treatment was blocked in the presence of MSX. We showed that some genes previously identified to be regulated by nitrate are under the control of an organic N-metabolite. Using an integrated network model of molecular interactions, we uncovered a subnetwork regulated by organic N that included CCA1 and target genes involved in N-assimilation. We validated some of the predicted interactions and showed that regulation of the master clock control gene CCA1 by Glu or a Glu-derived metabolite in turn regulates the expression of key N-assimilatory genes. Phase response curve analysis shows that distinct N-metabolites can advance or delay the CCA1 phase. Regulation of CCA1 by organic N signals may represent a novel input mechanism for N-nutrients to affect plant circadian clock function.

  3. Ciona intestinalis as a Marine Model System to Study Some Key Developmental Genes Targeted by the Diatom-Derived Aldehyde Decadienal

    Directory of Open Access Journals (Sweden)

    Anna Lettieri

    2015-03-01

    Full Text Available The anti-proliferative effects of diatoms, described for the first time in copepods, have also been demonstrated in benthic invertebrates such as polychaetes, sea urchins and tunicates. In these organisms PUAs (polyunsaturated aldehydes induce the disruption of gametogenesis, gamete functionality, fertilization, embryonic mitosis, and larval fitness and competence. These inhibitory effects are due to the PUAs, produced by diatoms in response to physical damage as occurs during copepod grazing. The cell targets of these compounds remain largely unknown. Here we identify some of the genes targeted by the diatom PUA 2-trans-4-trans-decadienal (DD using the tunicate Ciona intestinalis. The tools, techniques and genomic resources available for Ciona, as well as the suitability of Ciona embryos for medium-to high-throughput strategies, are key to their employment as model organisms in different fields, including the investigation of toxic agents that could interfere with developmental processes. We demonstrate that DD can induce developmental aberrations in Ciona larvae in a dose-dependent manner. Moreover, through a preliminary analysis, DD is shown to affect the expression level of genes involved in stress response and developmental processes.

  4. LCGbase: A Comprehensive Database for Lineage-Based Co-regulated Genes.

    Science.gov (United States)

    Wang, Dapeng; Zhang, Yubin; Fan, Zhonghua; Liu, Guiming; Yu, Jun

    2012-01-01

    Animal genes of different lineages, such as vertebrates and arthropods, are well-organized and blended into dynamic chromosomal structures that represent a primary regulatory mechanism for body development and cellular differentiation. The majority of genes in a genome are actually clustered, which are evolutionarily stable to different extents and biologically meaningful when evaluated among genomes within and across lineages. Until now, many questions concerning gene organization, such as what is the minimal number of genes in a cluster and what is the driving force leading to gene co-regulation, remain to be addressed. Here, we provide a user-friendly database-LCGbase (a comprehensive database for lineage-based co-regulated genes)-hosting information on evolutionary dynamics of gene clustering and ordering within animal kingdoms in two different lineages: vertebrates and arthropods. The database is constructed on a web-based Linux-Apache-MySQL-PHP framework and effective interactive user-inquiry service. Compared to other gene annotation databases with similar purposes, our database has three comprehensible advantages. First, our database is inclusive, including all high-quality genome assemblies of vertebrates and representative arthropod species. Second, it is human-centric since we map all gene clusters from other genomes in an order of lineage-ranks (such as primates, mammals, warm-blooded, and reptiles) onto human genome and start the database from well-defined gene pairs (a minimal cluster where the two adjacent genes are oriented as co-directional, convergent, and divergent pairs) to large gene clusters. Furthermore, users can search for any adjacent genes and their detailed annotations. Third, the database provides flexible parameter definitions, such as the distance of transcription start sites between two adjacent genes, which is extendable to genes that flanking the cluster across species. We also provide useful tools for sequence alignment, gene

  5. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...

  6. Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

    Science.gov (United States)

    Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

    2018-06-01

    Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

  7. An Effective Tri-Clustering Algorithm Combining Expression Data with Gene Regulation Information

    Directory of Open Access Journals (Sweden)

    Ao Li

    2009-04-01

    Full Text Available Motivation: Bi-clustering algorithms aim to identify sets of genes sharing similar expression patterns across a subset of conditions. However direct interpretation or prediction of gene regulatory mechanisms may be difficult as only gene expression data is used. Information about gene regulators may also be available, most commonly about which transcription factors may bind to the promoter region and thus control the expression level of a gene. Thus a method to integrate gene expression and gene regulation information is desirable for clustering and analyzing. Methods: By incorporating gene regulatory information with gene expression data, we define regulated expression values (REV as indicators of how a gene is regulated by a specific factor. Existing bi-clustering methods are extended to a three dimensional data space by developing a heuristic TRI-Clustering algorithm. An additional approach named Automatic Boundary Searching algorithm (ABS is introduced to automatically determine the boundary threshold. Results: Results based on incorporating ChIP-chip data representing transcription factor-gene interactions show that the algorithms are efficient and robust for detecting tri-clusters. Detailed analysis of the tri-cluster extracted from yeast sporulation REV data shows genes in this cluster exhibited significant differences during the middle and late stages. The implicated regulatory network was then reconstructed for further study of defined regulatory mechanisms. Topological and statistical analysis of this network demonstrated evidence of significant changes of TF activities during the different stages of yeast sporulation, and suggests this approach might be a general way to study regulatory networks undergoing transformations.

  8. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  9. Human developmental enhancers conserved between deuterostomes and protostomes.

    Directory of Open Access Journals (Sweden)

    Shoa L Clarke

    Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.

  10. Developmental transcriptomic analyses for mechanistic insights into critical pathways involved in embryogenesis of pelagic mahi-mahi (Coryphaena hippurus.

    Directory of Open Access Journals (Sweden)

    Elvis Genbo Xu

    Full Text Available Mahi-mahi (Coryphaena hippurus is a commercially and ecologically important species of fish occurring in tropical and temperate waters worldwide. Understanding early life events is crucial for predicting effects of environmental stress, which is largely restricted by a lack of genetic resources regarding expression of early developmental genes and regulation of pathways. The need for anchoring developmental stages to transcriptional activities is highlighted by increasing evidence on the impacts of recurrent worldwide oil spills in this sensitive species during early development. By means of high throughput sequencing, we characterized the developmental transcriptome of mahi-mahi at three critical developmental stages, from pharyngula embryonic stage (24 hpf to 48 hpf yolk-sac larva (transition 1, and to 96 hpf free-swimming larva (transition 2. With comparative analysis by multiple bioinformatic tools, a larger number of significantly altered genes and more diverse gene ontology terms were observed during transition 2 than transition 1. Cellular and tissue development terms were more significantly enriched in transition 1, while metabolism related terms were more enriched in transition 2, indicating a switch progressing from general embryonic development to metabolism during the two transitions. Special focus was given on the most significant common canonical pathways (e.g. calcium signaling, glutamate receptor signaling, cAMP response element-binding protein signaling, cardiac β-adrenergic signaling, etc. and expression of developmental genes (e.g. collagens, myosin, notch, glutamate metabotropic receptor etc., which were associated with morphological changes of nervous, muscular, and cardiovascular system. These data will provide an important basis for understanding embryonic development and identifying molecular mechanisms of abnormal development in fish species.

  11. The cell cycle-regulated genes of Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Anna Oliva

    2005-07-01

    Full Text Available Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast. The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know.

  12. DAF-16/FOXO and EGL-27/GATA promote developmental growth in response to persistent somatic DNA damage.

    Science.gov (United States)

    Mueller, Michael M; Castells-Roca, Laia; Babu, Vipin; Ermolaeva, Maria A; Müller, Roman-Ulrich; Frommolt, Peter; Williams, Ashley B; Greiss, Sebastian; Schneider, Jennifer I; Benzing, Thomas; Schermer, Bernhard; Schumacher, Björn

    2014-12-01

    Genome maintenance defects cause complex disease phenotypes characterized by developmental failure, cancer susceptibility and premature ageing. It remains poorly understood how DNA damage responses function during organismal development and maintain tissue functionality when DNA damage accumulates with ageing. Here we show that the FOXO transcription factor DAF-16 is activated in response to DNA damage during development, whereas the DNA damage responsiveness of DAF-16 declines with ageing. We find that in contrast to its established role in mediating starvation arrest, DAF-16 alleviates DNA-damage-induced developmental arrest and even in the absence of DNA repair promotes developmental growth and enhances somatic tissue functionality. We demonstrate that the GATA transcription factor EGL-27 co-regulates DAF-16 target genes in response to DNA damage and together with DAF-16 promotes developmental growth. We propose that EGL-27/GATA activity specifies DAF-16-mediated DNA damage responses to enable developmental progression and to prolong tissue functioning when DNA damage persists.

  13. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  14. Intrinsic limits to gene regulation by global crosstalk

    Science.gov (United States)

    Friedlander, Tamar; Prizak, Roshan; Guet, Calin; Barton, Nicholas H.; Tkacik, Gasper

    Gene activity is mediated by the specificity of binding interactions between special proteins, called transcription factors, and short regulatory sequences on the DNA, where different protein species preferentially bind different DNA targets. Limited interaction specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to spurious interactions or remains erroneously inactive. Since each protein can potentially interact with numerous DNA targets, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyze the effects of global crosstalk on gene regulation, using statistical mechanics. We find that crosstalk in regulatory interactions puts fundamental limits on the reliability of gene regulation that are not easily mitigated by tuning proteins concentrations or by complex regulatory schemes proposed in the literature. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. The research leading to these results has received funding from the People Programme (Marie Curie Actions) of the European Union's Seventh Framework Programme (FP7/2007-2013) under REA Grant agreement Nr. 291734 (T.F.) and ERC Grant Nr. 250152 (N.B.).

  15. Regulated expression of homeobox genes Msx-1 and Msx-2 in mouse mammary gland development suggests a role in hormone action and epithelial-stromal interactions.

    Science.gov (United States)

    Friedmann, Y; Daniel, C W

    1996-07-10

    The murine homeobox genes Msx-1 and Msx-2 are related to the Drosophila msh gene and are expressed in a variety of tissues during mouse embryogenesis. We now report the developmentally regulated expression of Msx-1 and Msx-2 in the mouse mammary gland and show that their expression patterns point toward significant functional roles. Msx-1 and Msx-2 transcripts were present in glands of virgin mice and in glands of mice in early pregnancy, but transcripts decreased dramatically during late pregnancy. Low levels of Msx-1 transcripts were detected in glands from lactating animals and during the first days of involution, whereas Msx-2 expression was not detected during lactation or early involution. Expression of both genes increased gradually as involution progressed. Msx-2 but not Msx-1 expression was decreased following ovariectomy or following exposure to anti-estrogen implanted directly into the gland. Hormonal regulation of Msx-2 expression was confirmed when transcripts returned to normal levels after estrogen was administered to ovariectomized animals. In situ molecular hybridization for Msx-1 showed transcripts localized to the mammary epithelium, whereas Msx-2 expression was confined to the periductal stroma. Mammary stroma from which mammary epithelium had been removed did not transcribe detectable amounts of Msx-2, showing that expression is regulated by contiguous mammary epithelium, and indicating a role for these homeobox genes in mesenchymal-epithelial interactions during mammary development.

  16. Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish

    Science.gov (United States)

    Sasaki, Tomoyuki; Kishi, Shuji

    2013-01-01

    The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins

  17. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    Science.gov (United States)

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  18. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...

  19. Frequent down-regulation of ABC transporter genes in prostate cancer

    International Nuclear Information System (INIS)

    Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata

    2015-01-01

    ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users

  20. Studying gene regulation in methanogenic archaea.

    Science.gov (United States)

    Rother, Michael; Sattler, Christian; Stock, Tilmann

    2011-01-01

    Methanogenic archaea are a unique group of strictly anaerobic microorganisms characterized by their ability, and dependence, to convert simple C1 and C2 compounds to methane for growth. The major models for studying the biology of methanogens are members of the Methanococcus and Methanosarcina species. Recent development of sophisticated tools for molecular analysis and for genetic manipulation allows investigating not only their metabolism but also their cell cycle, and their interaction with the environment in great detail. One aspect of such analyses is assessment and dissection of methanoarchaeal gene regulation, for which, at present, only a handful of cases have been investigated thoroughly, partly due to the great methodological effort required. However, it becomes more and more evident that many new regulatory paradigms can be unraveled in this unique archaeal group. Here, we report both molecular and physiological/genetic methods to assess gene regulation in Methanococcus maripaludis and Methanosarcina acetivorans, which should, however, be applicable for other methanogens as well. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Identification of a developmental gene expression signature, including HOX genes, for the normal human colonic crypt stem cell niche: overexpression of the signature parallels stem cell overpopulation during colon tumorigenesis.

    Science.gov (United States)

    Bhatlekar, Seema; Addya, Sankar; Salunek, Moreh; Orr, Christopher R; Surrey, Saul; McKenzie, Steven; Fields, Jeremy Z; Boman, Bruce M

    2014-01-15

    Our goal was to identify a unique gene expression signature for human colonic stem cells (SCs). Accordingly, we determined the gene expression pattern for a known SC-enriched region--the crypt bottom. Colonic crypts and isolated crypt subsections (top, middle, and bottom) were purified from fresh, normal, human, surgical specimens. We then used an innovative strategy that used two-color microarrays (∼18,500 genes) to compare gene expression in the crypt bottom with expression in the other crypt subsections (middle or top). Array results were validated by PCR and immunostaining. About 25% of genes analyzed were expressed in crypts: 88 preferentially in the bottom, 68 in the middle, and 131 in the top. Among genes upregulated in the bottom, ∼30% were classified as growth and/or developmental genes including several in the PI3 kinase pathway, a six-transmembrane protein STAMP1, and two homeobox (HOXA4, HOXD10) genes. qPCR and immunostaining validated that HOXA4 and HOXD10 are selectively expressed in the normal crypt bottom and are overexpressed in colon carcinomas (CRCs). Immunostaining showed that HOXA4 and HOXD10 are co-expressed with the SC markers CD166 and ALDH1 in cells at the normal crypt bottom, and the number of these co-expressing cells is increased in CRCs. Thus, our findings show that these two HOX genes are selectively expressed in colonic SCs and that HOX overexpression in CRCs parallels the SC overpopulation that occurs during CRC development. Our study suggests that developmental genes play key roles in the maintenance of normal SCs and crypt renewal, and contribute to the SC overpopulation that drives colon tumorigenesis.

  2. Regulation of human protein S gene (PROS1) transcription

    NARCIS (Netherlands)

    Wolf, Cornelia de

    2006-01-01

    This thesis describes the investigation of the transcriptional regulation of the gene for anticoagulant plasma Protein S, PROS1. Protein S is a cofactor for Protein C in the Protein C anticoagulant pathway. The coagulation cascade is negatively regulated by this pathway through inactivation of

  3. Cloning-free regulated monitoring of reporter and gene expression

    Directory of Open Access Journals (Sweden)

    Demirkaya Omer

    2009-03-01

    Full Text Available Abstract Background The majority of the promoters, their regulatory elements, and their variations in the human genome remain unknown. Reporter gene technology for transcriptional activity is a widely used tool for the study of promoter structure, gene regulation, and signaling pathways. Construction of transcriptional reporter vectors, including use of cis-acting sequences, requires cloning and time-demanding manipulations, particularly with introduced mutations. Results In this report, we describe a cloning-free strategy to generate transcriptionally-controllable linear reporter constructs. This approach was applied in common transcriptional models of inflammatory response and the interferon system. In addition, it was used to delineate minimal transcriptional activity of selected ribosomal protein promoters. The approach was tested for conversion of genes into TetO-inducible/repressible expression cassettes. Conclusion The simple introduction and tuning of any transcriptional control in the linear DNA product renders promoter activation and regulated gene studies simple and versatile.

  4. A role for circadian evening elements in cold-regulated gene expression in Arabidopsis.

    Science.gov (United States)

    Mikkelsen, Michael D; Thomashow, Michael F

    2009-10-01

    The plant transcriptome is dramatically altered in response to low temperature. The cis-acting DNA regulatory elements and trans-acting factors that regulate the majority of cold-regulated genes are unknown. Previous bioinformatic analysis has indicated that the promoters of cold-induced genes are enriched in the Evening Element (EE), AAAATATCT, a DNA regulatory element that has a role in circadian-regulated gene expression. Here we tested the role of EE and EE-like (EEL) elements in cold-induced expression of two Arabidopsis genes, CONSTANS-like 1 (COL1; At5g54470) and a gene encoding a 27-kDa protein of unknown function that we designated COLD-REGULATED GENE 27 (COR27; At5g42900). Mutational analysis indicated that the EE/EEL elements were required for cold induction of COL1 and COR27, and that their action was amplified through coupling with ABA response element (ABRE)-like (ABREL) motifs. An artificial promoter consisting solely of four EE motifs interspersed with three ABREL motifs was sufficient to impart cold-induced gene expression. Both COL1 and COR27 were found to be regulated by the circadian clock at warm growth temperatures and cold-induction of COR27 was gated by the clock. These results suggest that cold- and clock-regulated gene expression are integrated through regulatory proteins that bind to EE and EEL elements supported by transcription factors acting at ABREL sequences. Bioinformatic analysis indicated that the coupling of EE and EEL motifs with ABREL motifs is highly enriched in cold-induced genes and thus may constitute a DNA regulatory element pair with a significant role in configuring the low-temperature transcriptome.

  5. Transcriptional signatures of ancient floral developmental genetics in avocado (Persea americana; Lauraceae).

    Science.gov (United States)

    Chanderbali, André S; Albert, Victor A; Leebens-Mack, Jim; Altman, Naomi S; Soltis, Douglas E; Soltis, Pamela S

    2009-06-02

    The debate on the origin and evolution of flowers has recently entered the field of developmental genetics, with focus on the design of the ancestral floral regulatory program. Flowers can differ dramatically among angiosperm lineages, but in general, male and female reproductive organs surrounded by a sterile perianth of sepals and petals constitute the basic floral structure. However, the basal angiosperm lineages exhibit spectacular diversity in the number, arrangement, and structure of floral organs, whereas the evolutionarily derived monocot and eudicot lineages share a far more uniform floral ground plan. Here we show that broadly overlapping transcriptional programs characterize the floral transcriptome of the basal angiosperm Persea americana (avocado), whereas floral gene expression domains are considerably more organ specific in the model eudicot Arabidopsis thaliana. Our findings therefore support the "fading borders" model for organ identity determination in basal angiosperm flowers and extend it from the action of regulatory genes to downstream transcriptional programs. Furthermore, the declining expression of components of the staminal transcriptome in central and peripheral regions of Persea flowers concurs with elements of a previous hypothesis for developmental regulation in a gymnosperm "floral progenitor." Accordingly, in contrast to the canalized organ-specific regulatory apparatus of Arabidopsis, floral development may have been originally regulated by overlapping transcriptional cascades with fading gradients of influence from focal to bordering organs.

  6. microRNA-mediated R gene regulation: molecular scabbards for double-edged swords.

    Science.gov (United States)

    Deng, Yingtian; Liu, Minglei; Li, Xiaofei; Li, Feng

    2018-02-01

    Plant resistance (R) proteins are immune receptors that recognize pathogen effectors and trigger rapid defense responses, namely effector-triggered immunity. R protein-mediated pathogen resistance is usually race specific. During plant-pathogen coevolution, plant genomes accumulated large numbers of R genes. Even though plant R genes provide important natural resources for breeding disease-resistant crops, their presence in the plant genome comes at a cost. Misregulation of R genes leads to developmental defects, such as stunted growth and reduced fertility. In the past decade, many microRNAs (miRNAs) have been identified to target various R genes in plant genomes. miRNAs reduce R gene levels under normal conditions and allow induction of R gene expression under various stresses. For these reasons, we consider R genes to be double-edged "swords" and miRNAs as molecular "scabbards". In the present review, we summarize the contributions and potential problems of these "swords" and discuss the features and production of the "scabbards", as well as the mechanisms used to pull the "sword" from the "scabbard" when needed.

  7. Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

    Science.gov (United States)

    Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

  8. Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.

    Directory of Open Access Journals (Sweden)

    Anupama Khare

    2010-02-01

    Full Text Available The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC, a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway.

  9. Cheating by Exploitation of Developmental Prestalk Patterning in Dictyostelium discoideum

    Science.gov (United States)

    Khare, Anupama; Shaulsky, Gad

    2010-01-01

    The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters—strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway. PMID:20195510

  10. Early gene Broad complex plays a key role in regulating the immune response triggered by ecdysone in the Malpighian tubules of Drosophila melanogaster.

    Science.gov (United States)

    Verma, Puja; Tapadia, Madhu G

    2015-08-01

    In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Social Regulation of Gene Expression in Threespine Sticklebacks.

    Directory of Open Access Journals (Sweden)

    Anna K Greenwood

    Full Text Available Identifying genes that are differentially expressed in response to social interactions is informative for understanding the molecular basis of social behavior. To address this question, we described changes in gene expression as a result of differences in the extent of social interactions. We housed threespine stickleback (Gasterosteus aculeatus females in either group conditions or individually for one week, then measured levels of gene expression in three brain regions using RNA-sequencing. We found that numerous genes in the hindbrain/cerebellum had altered expression in response to group or individual housing. However, relatively few genes were differentially expressed in either the diencephalon or telencephalon. The list of genes upregulated in fish from social groups included many genes related to neural development and cell adhesion as well as genes with functions in sensory signaling, stress, and social and reproductive behavior. The list of genes expressed at higher levels in individually-housed fish included several genes previously identified as regulated by social interactions in other animals. The identified genes are interesting targets for future research on the molecular mechanisms of normal social interactions.

  12. Transcriptional regulation of genes related to progesterone production.

    Science.gov (United States)

    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

    2015-01-01

    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production.

  13. The silkworm (Bombyx mori microRNAs and their expressions in multiple developmental stages.

    Directory of Open Access Journals (Sweden)

    Xiaomin Yu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. METHODOLOGY/PRINCIPAL FINDINGS: We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs and 14 novel miRNAs (including 11 predicted novel miRNAs. Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5' and/or 3' ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. CONCLUSIONS/SIGNIFICANCE: Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over

  14. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  15. CPC, a single-repeat R3 MYB, is a negative regulator of anthocyanin biosynthesis in Arabidopsis.

    Science.gov (United States)

    Zhu, Hui-Fen; Fitzsimmons, Karen; Khandelwal, Abha; Kranz, Robert G

    2009-07-01

    Single-repeat R3 MYB transcription factors like CPC (CAPRICE) are known to play roles in developmental processes such as root hair differentiation and trichome initiation. However, none of the six Arabidopsis single-repeat R3 MYB members has been reported to regulate flavonoid biosynthesis. We show here that CPC is a negative regulator of anthocyanin biosynthesis. In the process of using CPC to test GAL4-dependent driver lines, we observed a repression of anthocyanin synthesis upon GAL4-mediated CPC overexpression. We demonstrated that this is not due to an increase in nutrient uptake because of more root hairs. Rather, CPC expression level tightly controls anthocyanin accumulation. Microarray analysis on the whole genome showed that, of 37 000 features tested, 85 genes are repressed greater than three-fold by CPC overexpression. Of these 85, seven are late anthocyanin biosynthesis genes. Also, anthocyanin synthesis genes were shown to be down-regulated in 35S::CPC overexpression plants. Transient expression results suggest that CPC competes with the R2R3-MYB transcription factor PAP1/2, which is an activator of anthocyanin biosynthesis genes. This report adds anthocyanin biosynthesis to the set of programs that are under CPC control, indicating that this regulator is not only for developmental programs (e.g. root hairs, trichomes), but can influence anthocyanin pigment synthesis.

  16. Post-transcriptional trafficking and regulation of neuronal gene expression.

    Science.gov (United States)

    Goldie, Belinda J; Cairns, Murray J

    2012-02-01

    Intracellular messenger RNA (mRNA) traffic and translation must be highly regulated, both temporally and spatially, within eukaryotic cells to support the complex functional partitioning. This capacity is essential in neurons because it provides a mechanism for rapid input-restricted activity-dependent protein synthesis in individual dendritic spines. While this feature is thought to be important for synaptic plasticity, the structures and mechanisms that support this capability are largely unknown. Certainly specialized RNA binding proteins and binding elements in the 3' untranslated region (UTR) of translationally regulated mRNA are important, but the subtlety and complexity of this system suggests that an intermediate "specificity" component is also involved. Small non-coding microRNA (miRNA) are essential for CNS development and may fulfill this role by acting as the guide strand for mediating complex patterns of post-transcriptional regulation. In this review we examine post-synaptic gene regulation, mRNA trafficking and the emerging role of post-transcriptional gene silencing in synaptic plasticity.

  17. Synergistic and Dose-Controlled Regulation of Cellulase Gene Expression in Penicillium oxalicum.

    Science.gov (United States)

    Li, Zhonghai; Yao, Guangshan; Wu, Ruimei; Gao, Liwei; Kan, Qinbiao; Liu, Meng; Yang, Piao; Liu, Guodong; Qin, Yuqi; Song, Xin; Zhong, Yaohua; Fang, Xu; Qu, Yinbo

    2015-09-01

    Filamentous fungus Penicillium oxalicum produces diverse lignocellulolytic enzymes, which are regulated by the combinations of many transcription factors. Here, a single-gene disruptant library for 470 transcription factors was constructed and systematically screened for cellulase production. Twenty transcription factors (including ClrB, CreA, XlnR, Ace1, AmyR, and 15 unknown proteins) were identified to play putative roles in the activation or repression of cellulase synthesis. Most of these regulators have not been characterized in any fungi before. We identified the ClrB, CreA, XlnR, and AmyR transcription factors as critical dose-dependent regulators of cellulase expression, the core regulons of which were identified by analyzing several transcriptomes and/or secretomes. Synergistic and additive modes of combinatorial control of each cellulase gene by these regulatory factors were achieved, and cellulase expression was fine-tuned in a proper and controlled manner. With one of these targets, the expression of the major intracellular β-glucosidase Bgl2 was found to be dependent on ClrB. The Bgl2-deficient background resulted in a substantial gene activation by ClrB and proved to be closely correlated with the relief of repression mediated by CreA and AmyR during cellulase induction. Our results also signify that probing the synergistic and dose-controlled regulation mechanisms of cellulolytic regulators and using it for reconstruction of expression regulation network (RERN) may be a promising strategy for cellulolytic fungi to develop enzyme hyper-producers. Based on our data, ClrB was identified as focal point for the synergistic activation regulation of cellulase expression by integrating cellulolytic regulators and their target genes, which refined our understanding of transcriptional-regulatory network as a "seesaw model" in which the coordinated regulation of cellulolytic genes is established by counteracting activators and repressors.

  18. The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

    Science.gov (United States)

    MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

  19. Developmental transcriptome of Aplysia californica'

    KAUST Repository

    Heyland, Andreas

    2010-12-06

    Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.

  20. Primetime for Learning Genes.

    Science.gov (United States)

    Keifer, Joyce

    2017-02-11

    Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene ( BDNF ), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.

  1. Signaling pathways in PACAP regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Falktoft, B.; Georg, B.; Fahrenkrug, J.

    2009-01-01

    Ganglia expressing the neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) innervate vasoactive intestinal peptide (VIP) containing neurons suggesting a role of PACAP in regulating VIP expression. Human NB-1 neuroblastoma cells were applied to study PACAP regulated VIP gene...... in PACAP regulation of the FOS and VIP gene expressions suggest for the first time a role of FOS in PACAP-induced VIP gene expression in human NB-1 neuroblastoma cells. (C) 2009 Elsevier Ltd. All rights reserved Udgivelsesdato: 2009/10...

  2. Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

    Science.gov (United States)

    Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

    2013-01-01

    Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

  3. Identification of pathogenic genes and upstream regulators in age-related macular degeneration.

    Science.gov (United States)

    Zhao, Bin; Wang, Mengya; Xu, Jing; Li, Min; Yu, Yuhui

    2017-06-26

    Age-related macular degeneration (AMD) is the leading cause of irreversible blindness in older individuals. Our study aims to identify the key genes and upstream regulators in AMD. To screen pathogenic genes of AMD, an integrated analysis was performed by using the microarray datasets in AMD derived from the Gene Expression Omnibus (GEO) database. The functional annotation and potential pathways of differentially expressed genes (DEGs) were further discovered by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. We constructed the AMD-specific transcriptional regulatory network to find the crucial transcriptional factors (TFs) which target the DEGs in AMD. Quantitative real time polymerase chain reaction (qRT-PCR) was performed to verify the DEGs and TFs obtained by integrated analysis. From two GEO datasets obtained, we identified 1280 DEGs (730 up-regulated and 550 down-regulated genes) between AMD and normal control (NC). After KEGG analysis, steroid biosynthesis is a significantly enriched pathway for DEGs. The expression of 8 genes (TNC, GRP, TRAF6, ADAMTS5, GPX3, FAP, DHCR7 and FDFT1) was detected. Except for TNC and GPX3, the other 6 genes in qRT-PCR played the same pattern with that in our integrated analysis. The dysregulation of these eight genes may involve with the process of AMD. Two crucial transcription factors (c-rel and myogenin) were concluded to play a role in AMD. Especially, myogenin was associated with AMD by regulating TNC, GRP and FAP. Our finding can contribute to developing new potential biomarkers, revealing the underlying pathogenesis, and further raising new therapeutic targets for AMD.

  4. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    to protein: through epigenetic modifications, transcription regulators or post-transcriptional controls. The following papers concern several layers of gene regulation with questions answered by different HTS approaches. Genome-wide screening of epigenetic changes by ChIP-seq allowed us to study both spatial...... and temporal alterations of histone modifications (Papers I and II). Coupling the data with machine learning approaches, we established a prediction framework to assess the most informative histone marks as well as their most influential nucleosome positions in predicting the promoter usages. (Papers I...... they regulated or if the sites had global elevated usage rates by multiple TFs. Using RNA-seq, 5’end-seq in combination with depletion of 5’exonuclease as well as nonsensemediated decay (NMD) factors, we systematically analyzed NMD substrates as well as their degradation intermediates in human cells (Paper V...

  5. A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.

    Science.gov (United States)

    Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis

    2014-09-01

    A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of

  6. The transcription factor, Nuclear factor, erythroid 2 (Nfe2), is a regulator of the oxidative stress response during Danio rerio development

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Larissa M., E-mail: lwillia2@bates.edu [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Lago, Briony A., E-mail: lagoba@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); McArthur, Andrew G., E-mail: mcarthua@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Raphenya, Amogelang R., E-mail: raphenar@mcmaster.ca [M.G. DeGroote Institute for Infectious Disease Research, Department of Biochemistry and Biomedical Sciences, DeGroote School of Medicine, McMaster University, Hamilton, ON L8S 4K1 (Canada); Pray, Nicholas, E-mail: pray.nicholas@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); Saleem, Nabil, E-mail: nabilsaleem@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Salas, Sophia, E-mail: sophia.salas2@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Paulson, Katherine, E-mail: krpaulson@gmail.com [Biology Department, Bates College, 44 Campus Avenue, Lewiston, ME 04240 (United States); The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); Mangar, Roshni S., E-mail: rmangar@coa.edu [The MDI Biological Laboratory, 159 Old Bar Harbor Road, Bar Harbor, ME 04609 USA (United States); College of the Atlantic, 105 Eden Street, Bar Harbor, ME 04609 (United States); and others

    2016-11-15

    Highlights: • Nfe2 is involved in erythropoiesis in zebrafish. • Nfe2 is a novel regulator of pro-oxidant induced oxidative stress. • Embryos mount a molecularly unique oxidative stress response compared to larvae. • Nfe2 regulates a wide-variety of genes beyond erythropoiesis. - Abstract: Development is a complex and well-defined process characterized by rapid cell proliferation and apoptosis. At this stage in life, a developmentally young organism is more sensitive to toxicants as compared to an adult. In response to pro-oxidant exposure, members of the Cap’n’Collar (CNC) basic leucine zipper (b-ZIP) transcription factor family (including Nfe2 and Nfe2-related factors, Nrfs) activate the expression of genes whose protein products contribute to reduced toxicity. Here, we studied the role of the CNC protein, Nfe2, in the developmental response to pro-oxidant exposure in the zebrafish (Danio rerio). Following acute waterborne exposures to diquat or tert-buytlhydroperoxide (tBOOH) at one of three developmental stages, wildtype (WT) and nfe2 knockout (KO) embryos and larvae were morphologically scored and their transcriptomes sequenced. Early in development, KO animals suffered from hypochromia that was made more severe through exposure to pro-oxidants; this phenotype in the KO may be linked to decreased expression of alas2, a gene involved in heme synthesis. WT and KO eleutheroembryos and larvae were phenotypically equally affected by exposure to pro-oxidants, where tBOOH caused more pronounced phenotypes as compared to diquat. Comparing diquat and tBOOH exposed embryos relative to the WT untreated control, a greater number of genes were up-regulated in the tBOOH condition as compared to diquat (tBOOH: 304 vs diquat: 148), including those commonly found to be differentially regulated in the vertebrate oxidative stress response (OSR) (e.g. hsp70.2, txn1, and gsr). When comparing WT and KO across all treatments and times, there were 1170 genes that were

  7. Genome-wide screening of Saccharomyces cerevisiae genes regulated by vanillin.

    Science.gov (United States)

    Park, Eun-Hee; Kim, Myoung-Dong

    2015-01-01

    During pretreatment of lignocellulosic biomass, a variety of fermentation inhibitors, including acetic acid and vanillin, are released. Using DNA microarray analysis, this study explored genes of the budding yeast Saccharomyces cerevisiae that respond to vanillin-induced stress. The expression of 273 genes was upregulated and that of 205 genes was downregulated under vanillin stress. Significantly induced genes included MCH2, SNG1, GPH1, and TMA10, whereas NOP2, UTP18, FUR1, and SPR1 were down regulated. Sequence analysis of the 5'-flanking region of upregulated genes suggested that vanillin might regulate gene expression in a stress response element (STRE)-dependent manner, in addition to a pathway that involved the transcription factor Yap1p. Retardation in the cell growth of mutant strains indicated that MCH2, SNG1, and GPH1 are intimately involved in vanillin stress response. Deletion of the genes whose expression levels were decreased under vanillin stress did not result in a notable change in S. cerevisiae growth under vanillin stress. This study will provide the basis for a better understanding of the stress response of the yeast S. cerevisiae to fermentation inhibitors.

  8. The transcriptome of the intraerythrocytic developmental cycle of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Zbynek Bozdech

    2003-10-01

    Full Text Available Plasmodium falciparum is the causative agent of the most burdensome form of human malaria, affecting 200-300 million individuals per year worldwide. The recently sequenced genome of P. falciparum revealed over 5,400 genes, of which 60% encode proteins of unknown function. Insights into the biochemical function and regulation of these genes will provide the foundation for future drug and vaccine development efforts toward eradication of this disease. By analyzing the complete asexual intraerythrocytic developmental cycle (IDC transcriptome of the HB3 strain of P. falciparum, we demonstrate that at least 60% of the genome is transcriptionally active during this stage. Our data demonstrate that this parasite has evolved an extremely specialized mode of transcriptional regulation that produces a continuous cascade of gene expression, beginning with genes corresponding to general cellular processes, such as protein synthesis, and ending with Plasmodium-specific functionalities, such as genes involved in erythrocyte invasion. The data reveal that genes contiguous along the chromosomes are rarely coregulated, while transcription from the plastid genome is highly coregulated and likely polycistronic. Comparative genomic hybridization between HB3 and the reference genome strain (3D7 was used to distinguish between genes not expressed during the IDC and genes not detected because of possible sequence variations. Genomic differences between these strains were found almost exclusively in the highly antigenic subtelomeric regions of chromosomes. The simple cascade of gene regulation that directs the asexual development of P. falciparum is unprecedented in eukaryotic biology. The transcriptome of the IDC resembles a "just-in-time" manufacturing process whereby induction of any given gene occurs once per cycle and only at a time when it is required. These data provide to our knowledge the first comprehensive view of the timing of transcription throughout the

  9. Noise-induced multistability in the regulation of cancer by genes and pseudogenes

    Energy Technology Data Exchange (ETDEWEB)

    Petrosyan, K. G., E-mail: pkaren@phys.sinica.edu.tw [Institute of Physics, Academia Sinica, Nankang, Taipei 11529, Taiwan (China); Hu, Chin-Kun, E-mail: huck@phys.sinica.edu.tw [Institute of Physics, Academia Sinica, Nankang, Taipei 11529, Taiwan (China); National Center for Theoretical Sciences, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Business School, University of Shanghai for Science and Technology, Shanghai 200093 (China)

    2016-07-28

    We extend a previously introduced model of stochastic gene regulation of cancer to a nonlinear case having both gene and pseudogene messenger RNAs (mRNAs) self-regulated. The model consists of stochastic Boolean genetic elements and possesses noise-induced multistability (multimodality). We obtain analytical expressions for probabilities for the case of constant but finite number of microRNA molecules which act as a noise source for the competing gene and pseudogene mRNAs. The probability distribution functions display both the global bistability regime as well as even-odd number oscillations for a certain range of model parameters. Statistical characteristics of the mRNA’s level fluctuations are evaluated. The obtained results of the extended model advance our understanding of the process of stochastic gene and pseudogene expressions that is crucial in regulation of cancer.

  10. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  11. The precise regulation of different COR genes by individual CBF transcription factors in Arabidopsis thaliana.

    Science.gov (United States)

    Shi, Yihao; Huang, Jiaying; Sun, Tianshu; Wang, Xuefei; Zhu, Chenqi; Ai, Yuxi; Gu, Hongya

    2017-02-01

    The transcription factors CBF1/2/3 are reported to play a dominant role in the cold responsive network of Arabidopsis by directly regulating the expression levels of cold responsive (COR) genes. In this study, we obtained CRISPR/Cas9-mediated loss-of-function mutants of cbf1∼3. Over 3,000 COR genes identified by RNA-seq analysis showed a slight but significant change in their expression levels in the mutants compared to the wild-type plants after being treated at 4 °C for 12 h. The C-repeat (CRT) motif (5'-CCGAC-3') was enriched in promoters of genes that were up-regulated by CBF2 and CBF3 but not in promoters of genes up-regulated by CBF1. These data suggest that CBF2 and CBF3 play a more important role in directing the cold response by regulating different sets of downstream COR genes. More than 2/3 of COR genes were co-regulated by two or three CBFs and were involved mainly in cellular signal transduction and metabolic processes; less than 1/3 of the genes were regulated by one CBF, and those genes up-regulated were enriched in cold-related abiotic stress responses. Our results indicate that CBFs play an important role in the trade-off between cold tolerance and plant growth through the precise regulation of COR genes in the complicated transcriptional network. © 2016 The Authors. Journal of Integrative Plant Biology Published by John Wiley & Sons Australia, Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  12. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    Science.gov (United States)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  13. Small RNAs and the regulation of cis-natural antisense transcripts in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Lonardi Stefano

    2008-01-01

    Full Text Available Abstract Background In spite of large intergenic spaces in plant and animal genomes, 7% to 30% of genes in the genomes encode overlapping cis-natural antisense transcripts (cis-NATs. The widespread occurrence of cis-NATs suggests an evolutionary advantage for this type of genomic arrangement. Experimental evidence for the regulation of two cis-NAT gene pairs by natural antisense transcripts-generated small interfering RNAs (nat-siRNAs via the RNA interference (RNAi pathway has been reported in Arabidopsis. However, the extent of siRNA-mediated regulation of cis-NAT genes is still unclear in any genome. Results The hallmarks of RNAi regulation of NATs are 1 inverse regulation of two genes in a cis-NAT pair by environmental and developmental cues and 2 generation of siRNAs by cis-NAT genes. We examined Arabidopsis transcript profiling data from public microarray databases to identify cis-NAT pairs whose sense and antisense transcripts show opposite expression changes. A subset of the cis-NAT genes displayed negatively correlated expression profiles as well as inverse differential expression changes under at least one of the examined developmental stages or treatment conditions. By searching the Arabidopsis Small RNA Project (ASRP and Massively Parallel Signature Sequencing (MPSS small RNA databases as well as our stress-treated small RNA dataset, we found small RNAs that matched at least one gene in 646 pairs out of 1008 (64% protein-coding cis-NAT pairs, which suggests that siRNAs may regulate the expression of many cis-NAT genes. 209 putative siRNAs have the potential to target more than one gene and half of these small RNAs could target multiple members of a gene family. Furthermore, the majority of the putative siRNAs within the overlapping regions tend to target only one transcript of a given NAT pair, which is consistent with our previous finding on salt- and bacteria-induced nat-siRNAs. In addition, we found that genes encoding plastid- or

  14. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages

    DEFF Research Database (Denmark)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man

    2018-01-01

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed...... with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes...... have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays...

  15. Thyroid Hormone Receptor α Controls Developmental Timing and Regulates the Rate and Coordination of Tissue-Specific Metamorphosis in Xenopus tropicalis.

    Science.gov (United States)

    Wen, Luan; Shibata, Yuki; Su, Dan; Fu, Liezhen; Luu, Nga; Shi, Yun-Bo

    2017-06-01

    Thyroid hormone (T3) receptors (TRs) mediate the effects of T3 on organ metabolism and animal development. There are two TR genes, TRα and TRβ, in all vertebrates. During animal development, TRα expression is activated earlier than zygotic T3 synthesis and secretion into the plasma, implicating a developmental role of TRα both in the presence and absence of T3. Using T3-dependent amphibian metamorphosis as a model, we previously proposed a dual-function model for TRs, in particular TRα, during development. That is, unliganded TR represses the expression of T3-inducible genes during premetamorphosis to ensure proper animal growth and prevent premature metamorphosis, whereas during metamorphosis, liganded TR activates target gene transcription to promote the transformation of the tadpole into a frog. To determine if TRα has such a dual function, we generated homozygous TRα-knockout animal lines. We show that, indeed, TRα knockout affects both premetamorphic animal development and metamorphosis. Surprisingly, we observed that TRα is not essential for amphibian metamorphosis, given that homozygous knockout animals complete metamorphosis within a similar time period after fertilization as their wild-type siblings. On the other hand, the timing of metamorphosis for different organs is altered by the knockout; limb metamorphosis occurs earlier, whereas intestinal metamorphosis is completed later than in wild-type siblings. Thus, our studies have demonstrated a critical role of endogenous TRα, not only in regulating both the timing and rate of metamorphosis, but also in coordinating temporal metamorphosis of different organs.

  16. Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle

    International Nuclear Information System (INIS)

    Sherman, S.J.

    1985-01-01

    The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel

  17. Identification of conserved drought stress responsive gene-network across tissues and developmental stages in rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Pandey, Dev Mani; Chinnusamy, Viswanathan; Archak, Sunil; Bansal, Kailash Chander

    2013-01-01

    Identification of genes that are coexpressed across various tissues and environmental stresses is biologically interesting, since they may play coordinated role in similar biological processes. Genes with correlated expression patterns can be best identified by using coexpression network analysis of transcriptome data. In the present study, we analyzed the temporal-spatial coordination of gene expression in root, leaf and panicle of rice under drought stress and constructed network using WGCNA and Cytoscape. Total of 2199 differentially expressed genes (DEGs) were identified in at least three or more tissues, wherein 88 genes have coordinated expression profile among all the six tissues under drought stress. These 88 highly coordinated genes were further subjected to module identification in the coexpression network. Based on chief topological properties we identified 18 hub genes such as ABC transporter, ATP-binding protein, dehydrin, protein phosphatase 2C, LTPL153 - Protease inhibitor, phosphatidylethanolaminebinding protein, lactose permease-related, NADP-dependent malic enzyme, etc. Motif enrichment analysis showed the presence of ABRE cis-elements in the promoters of > 62% of the coordinately expressed genes. Our results suggest that drought stress mediated upregulated gene expression was coordinated through an ABA-dependent signaling pathway across tissues, at least for the subset of genes identified in this study, while down regulation appears to be regulated by tissue specific pathways in rice.

  18. Ultraviolet B radiation induces impaired lifecycle traits and modulates expression of cytochrome P450 (CYP) genes in the copepod Tigriopus japonicus.

    Science.gov (United States)

    Puthumana, Jayesh; Lee, Min-Chul; Park, Jun Chul; Kim, Hui-Su; Hwang, Dae-Sik; Han, Jeonghoon; Lee, Jae-Seong

    2017-03-01

    To evaluate the effects of ultraviolet B (UV-B) radiation at the developmental, reproductive, and molecular levels in aquatic invertebrates, we measured UV-B-induced acute toxicity, impairments in developmental and reproductive traits, and UV-B interaction with the entire family of cytochrome P450 (CYP) genes in the intertidal benthic copepod Tigriopus japonicus. We found a significant, dose-dependent reduction (Pcopepods through the predicted AhR-mediated up-regulation of CYP genes. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. A laser pointer driven microheater for precise local heating and conditional gene regulation in vivo. Microheater driven gene regulation in zebrafish

    Directory of Open Access Journals (Sweden)

    Achermann Marc

    2009-12-01

    Full Text Available Abstract Background Tissue heating has been employed to study a variety of biological processes, including the study of genes that control embryonic development. Conditional regulation of gene expression is a particularly powerful approach for understanding gene function. One popular method for mis-expressing a gene of interest employs heat-inducible heat shock protein (hsp promoters. Global heat shock of hsp-promoter-containing transgenic animals induces gene expression throughout all tissues, but does not allow for spatial control. Local heating allows for spatial control of hsp-promoter-driven transgenes, but methods for local heating are cumbersome and variably effective. Results We describe a simple, highly controllable, and versatile apparatus for heating biological tissue and other materials on the micron-scale. This microheater employs micron-scale fiber optics and uses an inexpensive laser-pointer as a power source. Optical fibers can be pulled on a standard electrode puller to produce tips of varying sizes that can then be used to reliably heat 20-100 μm targets. We demonstrate precise spatiotemporal control of hsp70l:GFP transgene expression in a variety of tissue types in zebrafish embryos and larvae. We also show how this system can be employed as part of a new method for lineage tracing that would greatly facilitate the study of organogenesis and tissue regulation at any time in the life cycle. Conclusion This versatile and simple local heater has broad utility for the study of gene function and for lineage tracing. This system could be used to control hsp-driven gene expression in any organism simply by bringing the fiber optic tip in contact with the tissue of interest. Beyond these uses for the study of gene function, this device has wide-ranging utility in materials science and could easily be adapted for therapeutic purposes in humans.

  20. Aberrant Epigenetic Gene Regulation in GABAergic Interneuron Subpopulations in the Hippocampal Dentate Gyrus of Mouse Offspring Following Developmental Exposure to Hexachlorophene.

    Science.gov (United States)

    Watanabe, Yousuke; Abe, Hajime; Nakajima, Kota; Ideta-Otsuka, Maky; Igarashi, Katsuhide; Woo, Gye-Hyeong; Yoshida, Toshinori; Shibutani, Makoto

    2018-05-01

    Maternal hexachlorophene (HCP) exposure causes transient disruption of hippocampal neurogenesis in mouse offspring. We examined epigenetically hypermethylated and downregulated genes related to this HCP-induced disrupted neurogenesis. Mated female mice were dietary exposed to 0 or 100 ppm HCP from gestational day 6 to postnatal day (PND) 21 on weaning. The hippocampal dentate gyrus of male offspring was subjected to methyl-capture sequencing and real-time reverse transcription-polymerase chain reaction analyses on PND 21. Validation analyses on methylation identified three genes, Dlx4, Dmrt1, and Plcb4, showing promoter-region hypermethylation. Immunohistochemically, DLX4+, DMRT1+, and PLCB4+ cells in the dentate hilus co-expressed GAD67, a γ-aminobutyric acid (GABA)ergic neuron marker. HCP decreased all of three subpopulations as well as GAD67+ cells on PND 21. PLCB4+ cells also co-expressed the metabotropic glutamate receptor, GRM1. HCP also decreased transcript level of synaptic plasticity-related genes in the dentate gyrus and immunoreactive granule cells for synaptic plasticity-related ARC. On PND 77, all immunohistochemical cellular density changes were reversed, whereas the transcript expression of the synaptic plasticity-related genes fluctuated. Thus, HCP-exposed offspring transiently reduced the number of GABAergic interneurons. Among them, subpopulations expressing DLX4, DMRT1, or PLCB4 were transiently reduced in number through an epigenetic mechanism. Considering the role of the Dlx gene family in GABAergic interneuron migration and differentiation, the decreased number of DLX4+ cells may be responsible for reducing those GABAergic interneurons regulating neurogenesis. The effect on granule cell synaptic plasticity was sustained until the adult stage, and reduced GABAergic interneurons active in GRM1-PLCB4 signaling may be responsible for the suppression on weaning.

  1. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  2. MTA3 regulates CGB5 and Snail genes in trophoblast

    International Nuclear Information System (INIS)

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-01-01

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  3. In vitro selection of mutants: Inducible gene regulation for salt tolerance

    International Nuclear Information System (INIS)

    Winicov, I.; Bastola, D.R.; Deutch, C.E.; Pethe, V.V.; Petrusa, L.

    2001-01-01

    Regulation of differentially expressed genes in plants may be involved in inducing tolerance to stress. Isogenic salt-sensitive and salt-tolerant alfalfa lines were investigated for molecular differences in their response to salt. The genes, which are differentially induced by salt in the salt-tolerant alfalfa cells and are also regulated by salt at the whole plant level, were cloned. Both transcriptional and post- transcriptional mechanisms influenced salt-induced product accumulation in the salt-tolerant alfalfa. The salt-tolerant plants doubled proline concentration rapidly in roots, while salt-sensitive plants showed a delayed response. To understand the regulatory system in the salt-tolerant alfalfa, two genes that are expressed in roots were studied. Alfin1 encodes a zinc-finger type putative DNA transcription factor conserved in alfalfa, rice and Arabidopsis, and MsPRP2 encodes a protein that serves as a cell wall- membrane linker in roots. Recombinant Alfin1 protein was selected, amplified, cloned and its consensus sequence was identified. The recombinant Alfin1 also bound specifically to fragments of the MsPRP2 promoter in vitro, containing the Alfin1 binding consensus sequence. The results show unambiguously binding specificity of Alfin1 DNA, supporting its role in gene regulation. Alfin1 function was tested in transformed alfalfa in vivo by over-expressing Alfin1 from 35S CaMV promoter. The transgenic plants appeared normal. However, plants harboring the anti-sense construct did not grow well in soil, indicating that Alfin1 expression was essential. Alfin1 over-expression in transgenic alfalfa led to enhanced levels of MsPRP2 transcript accumulation, demonstrating that Alfin1 functioned in vivo in gene regulation. Since MsPRP2 gene is also induced by salt, it is likely that Alfin1 is an important transcription factor for gene regulation in salt-tolerant alfalfa, and an excellent target for manipulation to improve salt tolerance. (author)

  4. DMPD: Interferon gene regulation: not all roads lead to Tolls. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16095970 Interferon gene regulation: not all roads lead to Tolls. Jefferies CA, Fit...zgerald KA. Trends Mol Med. 2005 Sep;11(9):403-11. (.png) (.svg) (.html) (.csml) Show Interferon gene regulation: not all roads... lead to Tolls. PubmedID 16095970 Title Interferon gene regulation: not all roads lead to

  5. Every which way – nanos gene regulation in echinoderms

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M.

    2014-01-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio, binds to and changes the fate of several known transcripts. We summarize here the documented functions of nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way. PMID:24376110

  6. Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

    Science.gov (United States)

    Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

    2010-10-01

    To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

  7. DNA Methylation: A Frontier in Tooth Organogenesis and Developmental Dental Defects.

    Science.gov (United States)

    Wan, Mian; Li, Hongyu; Zhou, Yachuan; Du, Wei; Xu, Xin; Ye, Ling; Zhou, Xuedong; Zheng, Liwei

    2018-01-01

    Tooth development relies on interactions between epithelial and mesenchymal tissues, which are controlled by sophisticated networks of conserved signaling. The signaling networks regulating odontogenesis have been well characterized, but the epigenetic mechanisms underlying remain to be elucidated. In this review, we describe current researches regarding the control of various genes expression by DNA methylation during odontogenesis, summarize genomic mapping of DNA methylation in various stages of tooth formation and diverse dental tissues by high-throughput approaches, and highlight the roles of DNA methylation in odontogenesis. Researches on mammals have revealed that the genomic methylation, which occurs on cytosine residues, regulates certain genes transcription. Consequently, DNA methylation plays a crucial role in spatiotemporal organization of signaling pathways, and is essential for organogenesis. Recently, mounting evidence proves that methylation of genomes contributes to the spatiotemporal gene dynamics during odontogenesis. With emerging new technologies of mapping cytosine modifications in global genome, investigators are seeking an overall view of DNA methylome dynamics that characterize genetic information to manifest across incredibly varied tooth development stages, dental tissues, and developmental dental defects. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Frequent down-regulation of ABC transporter genes in prostate cancer.

    Science.gov (United States)

    Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata

    2015-10-12

    ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors.

  9. Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

    KAUST Repository

    Ariel, Federico D.; Jé gu, Teddy; Latrasse, David; Romero-Barrios, Natali; Christ, Auré lie; Benhamed, Moussa; Crespi, Martí n D.

    2014-01-01

    The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

  10. Noncoding transcription by alternative rna polymerases dynamically regulates an auxin-driven chromatin loop

    KAUST Repository

    Ariel, Federico D.

    2014-08-01

    The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.

  11. Trisomy 21 and facial developmental instability.

    Science.gov (United States)

    Starbuck, John M; Cole, Theodore M; Reeves, Roger H; Richtsmeier, Joan T

    2013-05-01

    The most common live-born human aneuploidy is trisomy 21, which causes Down syndrome (DS). Dosage imbalance of genes on chromosome 21 (Hsa21) affects complex gene-regulatory interactions and alters development to produce a wide range of phenotypes, including characteristic facial dysmorphology. Little is known about how trisomy 21 alters craniofacial morphogenesis to create this characteristic appearance. Proponents of the "amplified developmental instability" hypothesis argue that trisomy 21 causes a generalized genetic imbalance that disrupts evolutionarily conserved developmental pathways by decreasing developmental homeostasis and precision throughout development. Based on this model, we test the hypothesis that DS faces exhibit increased developmental instability relative to euploid individuals. Developmental instability was assessed by a statistical analysis of fluctuating asymmetry. We compared the magnitude and patterns of fluctuating asymmetry among siblings using three-dimensional coordinate locations of 20 anatomic landmarks collected from facial surface reconstructions in four age-matched samples ranging from 4 to 12 years: (1) DS individuals (n = 55); (2) biological siblings of DS individuals (n = 55); 3) and 4) two samples of typically developing individuals (n = 55 for each sample), who are euploid siblings and age-matched to the DS individuals and their euploid siblings (samples 1 and 2). Identification in the DS sample of facial prominences exhibiting increased fluctuating asymmetry during facial morphogenesis provides evidence for increased developmental instability in DS faces. We found the highest developmental instability in facial structures derived from the mandibular prominence and lowest in facial regions derived from the frontal prominence. Copyright © 2013 Wiley Periodicals, Inc.

  12. Developmental Deltamethrin Exposure Causes Persistent Changes in Dopaminergic Gene Expression, Neurochemistry, and Locomotor Activity in Zebrafish.

    Science.gov (United States)

    Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A

    2015-08-01

    Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Identification of genes differentially regulated in rat alveolar bone wound healing by subtractive hybridization.

    Science.gov (United States)

    Ohira, T; Myokai, F; Shiomi, N; Yamashiro, K; Yamamoto, T; Murayama, Y; Arai, H; Nishimura, F; Takashiba, S

    2004-07-01

    Periodontal healing requires the participation of regulatory molecules, cells, and scaffold or matrix. Here, we hypothesized that a certain set of genes is expressed in alveolar bone wound healing. Reciprocal subtraction gave 400 clones from the injured alveolar bone of Wistar rats. Identification of 34 genes and analysis of their expression in injured tissue revealed several clusters of unique gene regulation patterns, including the up-regulation at 1 wk of cytochrome c oxidase regulating electron transfer and energy metabolism, presumably occurring at the site of inflammation; up-regulation at 2.5 wks of pro-alpha-2 type I collagen involving the formation of a connective tissue structure; and up-regulation at 1 and 2 wks and down-regulation at 2.5 and 4 wks of ubiquitin carboxyl-terminal hydrolase l3 involving cell cycle, DNA repair, and stress response. The differential expression of genes may be associated with the processes of inflammation, wound contraction, and formation of a connective tissue structure.

  14. Cell fate regulation in the shoot meristem.

    Science.gov (United States)

    Laux, T; Mayer, K F

    1998-04-01

    The shoot meristem is a proliferative centre containing pluripotent stem cells that are the ultimate source of all cells and organs continuously added to the growing shoot. The progeny of the stem cells have two developmental options, either to renew the stem cell population or to leave the meristem and to differentiate, possibly according to signals from more mature tissue. The destiny of each cell depends on its position within the dynamic shoot meristem. Genetic data suggest a simple model in which graded positional information is provided by antagonistic gene functions and is interpreted by genes which regulate cell fate.

  15. Discovering hidden relationships between renal diseases and regulated genes through 3D network visualizations

    Directory of Open Access Journals (Sweden)

    Bhavnani Suresh K

    2010-11-01

    Full Text Available Abstract Background In a recent study, two-dimensional (2D network layouts were used to visualize and quantitatively analyze the relationship between chronic renal diseases and regulated genes. The results revealed complex relationships between disease type, gene specificity, and gene regulation type, which led to important insights about the underlying biological pathways. Here we describe an attempt to extend our understanding of these complex relationships by reanalyzing the data using three-dimensional (3D network layouts, displayed through 2D and 3D viewing methods. Findings The 3D network layout (displayed through the 3D viewing method revealed that genes implicated in many diseases (non-specific genes tended to be predominantly down-regulated, whereas genes regulated in a few diseases (disease-specific genes tended to be up-regulated. This new global relationship was quantitatively validated through comparison to 1000 random permutations of networks of the same size and distribution. Our new finding appeared to be the result of using specific features of the 3D viewing method to analyze the 3D renal network. Conclusions The global relationship between gene regulation and gene specificity is the first clue from human studies that there exist common mechanisms across several renal diseases, which suggest hypotheses for the underlying mechanisms. Furthermore, the study suggests hypotheses for why the 3D visualization helped to make salient a new regularity that was difficult to detect in 2D. Future research that tests these hypotheses should enable a more systematic understanding of when and how to use 3D network visualizations to reveal complex regularities in biological networks.

  16. Searching for biomarkers of developmental toxicity with microarrays: normal eye morphogenesis in rodent embryos

    International Nuclear Information System (INIS)

    Nemeth, Kimberly A.; Singh, Amar V.; Knudsen, Thomas B.

    2005-01-01

    Gene expression arrays reveal the potential linkage of altered gene expression with specific adverse effects leading to disease phenotypes. But how closely do microarray data reflect early physiological or pharmacological measures that predict toxic event(s)? To explore this issue, we have undertaken experiments in early mouse embryos exposed to various teratogens during neurulation stages with the aim of correlating large-scale changes in gene expression across the critical period during exposure. This study reports some of the large-scale changes in gene expression that can be detected in the optic rudiment of the developing mouse and rat embryo across the window of development during which the eye is exceedingly sensitive to teratogen-induced micro-/anophthalmia. Microarray analysis was performed on RNA from the headfold or ocular region at the optic vesicle and optic cup stages when the ocular primordium is enriched for Pax-6, a master control gene for eye morphogenesis. Statistical selection of differentially regulated genes and various clustering techniques identified groups of genes in upward or downward trajectories in the normal optic primordium during early eye development in mouse and rat species. We identified 165 genes with significant differential expression during eye development, and a smaller subset of 58 genes that showed a tight correlation between mouse-rat development. Significantly over-represented functional categories included fatty acid metabolism (up-regulated) and glycolysis (down-regulated). From studies such as these that benchmark large-scale gene expression during normal embryonic development, we may be able to identify the panel of biomarkers that best correlate with species differences and the risks for developmental toxicity

  17. In silico identification of NF-kappaB-regulated genes in pancreatic beta-cells

    Directory of Open Access Journals (Sweden)

    Eizirik Decio L

    2007-02-01

    Full Text Available Abstract Background Pancreatic beta-cells are the target of an autoimmune attack in type 1 diabetes mellitus (T1DM. This is mediated in part by cytokines, such as interleukin (IL-1β and interferon (IFN-γ. These cytokines modify the expression of hundreds of genes, leading to beta-cell dysfunction and death by apoptosis. Several of these cytokine-induced genes are potentially regulated by the IL-1β-activated transcription factor (TF nuclear factor (NF-κB, and previous studies by our group have shown that cytokine-induced NF-κB activation is pro-apoptotic in beta-cells. To identify NF-κB-regulated gene networks in beta-cells we presently used a discriminant analysis-based approach to predict NF-κB responding genes on the basis of putative regulatory elements. Results The performance of linear and quadratic discriminant analysis (LDA, QDA in identifying NF-κB-responding genes was examined on a dataset of 240 positive and negative examples of NF-κB regulation, using stratified cross-validation with an internal leave-one-out cross-validation (LOOCV loop for automated feature selection and noise reduction. LDA performed slightly better than QDA, achieving 61% sensitivity, 91% specificity and 87% positive predictive value, and allowing the identification of 231, 251 and 580 NF-κB putative target genes in insulin-producing INS-1E cells, primary rat beta-cells and human pancreatic islets, respectively. Predicted NF-κB targets had a significant enrichment in genes regulated by cytokines (IL-1β or IL-1β + IFN-γ and double stranded RNA (dsRNA, as compared to genes not regulated by these NF-κB-dependent stimuli. We increased the confidence of the predictions by selecting only evolutionary stable genes, i.e. genes with homologs predicted as NF-κB targets in rat, mouse, human and chimpanzee. Conclusion The present in silico analysis allowed us to identify novel regulatory targets of NF-κB using a supervised classification method based on

  18. Interpersonal Stress Regulation and the Development of Anxiety Disorders: An Attachment-Based Developmental Framework

    Science.gov (United States)

    Nolte, Tobias; Guiney, Jo; Fonagy, Peter; Mayes, Linda C.; Luyten, Patrick

    2011-01-01

    Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the etiology and maintenance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework. The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety, and activation of the attachment system. This interplay directly affects the development of social–cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualized as the key organizer of a complex interplay between genetic, environmental, and epigenetic contributions to the development of anxiety disorders – a multifactorial etiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterized by hyperactivation strategies in the face of anxiety. The cumulative allostatic load and subsequent “wear and tear” effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments are outlined. PMID

  19. Nitrogen assimilation system in maize is regulated by developmental and tissue-specific mechanisms

    KAUST Repository

    Plett, Darren

    2016-08-10

    Key message: We found metabolites, enzyme activities and enzyme transcript abundances vary significantly across the maize lifecycle, but weak correlation exists between the three groups. We identified putative genes regulating nitrate assimilation. Abstract: Progress in improving nitrogen (N) use efficiency (NUE) of crop plants has been hampered by the complexity of the N uptake and utilisation systems. To understand this complexity we measured the activities of seven enzymes and ten metabolites related to N metabolism in the leaf and root tissues of Gaspe Flint maize plants grown in 0.5 or 2.5 mM NO3 − throughout the lifecycle. The amino acids had remarkably similar profiles across the lifecycle except for transient responses, which only appeared in the leaves for aspartate or in the roots for asparagine, serine and glycine. The activities of the enzymes for N assimilation were also coordinated to a certain degree, most noticeably with a peak in root activity late in the lifecycle, but with wide variation in the activity levels over the course of development. We analysed the transcriptional data for gene sets encoding the measured enzymes and found that, unlike the enzyme activities, transcript levels of the corresponding genes did not exhibit the same coordination across the lifecycle and were only weakly correlated with the levels of various amino acids or individual enzyme activities. We identified gene sets which were correlated with the enzyme activity profiles, including seven genes located within previously known quantitative trait loci for enzyme activities and hypothesise that these genes are important for the regulation of enzyme activities. This work provides insights into the complexity of the N assimilation system throughout development and identifies candidate regulatory genes, which warrant further investigation in efforts to improve NUE in crop plants. © 2016, Springer Science+Business Media Dordrecht.

  20. Nitrogen assimilation system in maize is regulated by developmental and tissue-specific mechanisms

    KAUST Repository

    Plett, Darren; Holtham, Luke; Baumann, Ute; Kalashyan, Elena; Francis, Karen; Enju, Akiko; Toubia, John; Roessner, Ute; Bacic, Antony; Rafalski, Antoni; Dhugga, Kanwarpal S.; Tester, Mark A.; Garnett, Trevor; Kaiser, Brent N.

    2016-01-01

    Key message: We found metabolites, enzyme activities and enzyme transcript abundances vary significantly across the maize lifecycle, but weak correlation exists between the three groups. We identified putative genes regulating nitrate assimilation. Abstract: Progress in improving nitrogen (N) use efficiency (NUE) of crop plants has been hampered by the complexity of the N uptake and utilisation systems. To understand this complexity we measured the activities of seven enzymes and ten metabolites related to N metabolism in the leaf and root tissues of Gaspe Flint maize plants grown in 0.5 or 2.5 mM NO3 − throughout the lifecycle. The amino acids had remarkably similar profiles across the lifecycle except for transient responses, which only appeared in the leaves for aspartate or in the roots for asparagine, serine and glycine. The activities of the enzymes for N assimilation were also coordinated to a certain degree, most noticeably with a peak in root activity late in the lifecycle, but with wide variation in the activity levels over the course of development. We analysed the transcriptional data for gene sets encoding the measured enzymes and found that, unlike the enzyme activities, transcript levels of the corresponding genes did not exhibit the same coordination across the lifecycle and were only weakly correlated with the levels of various amino acids or individual enzyme activities. We identified gene sets which were correlated with the enzyme activity profiles, including seven genes located within previously known quantitative trait loci for enzyme activities and hypothesise that these genes are important for the regulation of enzyme activities. This work provides insights into the complexity of the N assimilation system throughout development and identifies candidate regulatory genes, which warrant further investigation in efforts to improve NUE in crop plants. © 2016, Springer Science+Business Media Dordrecht.

  1. Pseudogenes regulate parental gene expression via ceRNA network.

    Science.gov (United States)

    An, Yang; Furber, Kendra L; Ji, Shaoping

    2017-01-01

    The concept of competitive endogenous RNA (ceRNA) was first proposed by Salmena and colleagues. Evidence suggests that pseudogene RNAs can act as a 'sponge' through competitive binding of common miRNA, releasing or attenuating repression through sequestering miRNAs away from parental mRNA. In theory, ceRNAs refer to all transcripts such as mRNA, tRNA, rRNA, long non-coding RNA, pseudogene RNA and circular RNA, because all of them may become the targets of miRNA depending on spatiotemporal situation. As binding of miRNA to the target RNA is not 100% complementary, it is possible that one miRNA can bind to multiple target RNAs and vice versa. All RNAs crosstalk through competitively binding to miRNAvia miRNA response elements (MREs) contained within the RNA sequences, thus forming a complex regulatory network. The ratio of a subset of miRNAs to the corresponding number of MREs determines repression strength on a given mRNA translation or stability. An increase in pseudogene RNA level can sequester miRNA and release repression on the parental gene, leading to an increase in parental gene expression. A massive number of transcripts constitute a complicated network that regulates each other through this proposed mechanism, though some regulatory significance may be mild or even undetectable. It is possible that the regulation of gene and pseudogene expression occurring in this manor involves all RNAs bearing common MREs. In this review, we will primarily discuss how pseudogene transcripts regulate expression of parental genes via ceRNA network and biological significance of regulation. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  2. Post-transcriptional bursting in genes regulated by small RNA molecules

    Science.gov (United States)

    Rodrigo, Guillermo

    2018-03-01

    Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.

  3. The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis.

    Science.gov (United States)

    Zhao, D; Yu, Q; Chen, M; Ma, H

    2001-07-01

    The Arabidopsis floral regulatory genes APETALA3 (AP3) and PISTILLATA (PI) are required for the B function according to the ABC model for floral organ identity. AP3 and PI expression are positively regulated by the LEAFY (LFY) and UNUSUAL FLORAL ORGANS (UFO) genes. UFO encodes an F-box protein, and we have shown previously that UFO genetically interacts with the ASK1 gene encoding a SKP1 homologue; both the F-box containing protein and SKP1 are subunits of ubiquitin ligases. We show here that the ask1-1 mutation can enhance the floral phenotypes of weak lfy and ap3 mutants; therefore, like UFO, ASK1 also interacts with LFY and AP3 genetically. Furthermore, our results from RNA in situ hybridizations indicate that ASK1 regulates early AP3 and PI expression. These results support the idea that UFO and ASK1 together positively regulate AP3 and PI expression. We propose that the UFO and ASK1 proteins are components of a ubiquitin ligase that mediates the proteolysis of a repressor of AP3 and PI expression. Our genetic studies also indicate that ASK1 and UFO play a role in regulating the number of floral organ primordia, and we discuss possible mechanisms for such a regulation.

  4. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Regulation of Gene Expression in Protozoa Parasites

    Directory of Open Access Journals (Sweden)

    Consuelo Gomez

    2010-01-01

    Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  6. Regulation of gene expression in protozoa parasites.

    Science.gov (United States)

    Gomez, Consuelo; Esther Ramirez, M; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  7. Regulating Hypothalamus Gene Expression in Food Intake: Dietary Composition or Calorie Density?

    Directory of Open Access Journals (Sweden)

    Mi Jang

    2017-01-01

    Full Text Available BackgroundThe proportion of saturated fatty acids/unsaturated fatty acids in the diet seems to act as a physiological regulation on obesity, cardiovascular diseases, and diabetes. Differently composed fatty acid diets may induce satiety of the hypothalamus in different ways. However, the direct effect of the different fatty acid diets on satiety in the hypothalamus is not clear.MethodsThree experiments in mice were conducted to determine whether: different compositions of fatty acids affects gene mRNA expression of the hypothalamus over time; different types of fatty acids administered into the stomach directly affect gene mRNA expression of the hypothalamus; and fat composition changes in the diet affects gene mRNA expression of the hypothalamus.ResultsThe type of fat in cases of purified fatty acid administration directly into the stomach may cause changes of gene expressions in the hypothalamus. Gene expression by dietary fat may be regulated by calorie amount ingested rather than weight amount or type of fat.ConclusionTherefore, the calorie density factor of the diet in regulating hypothalamic gene in food intake may be detrimental, although the possibility of type of fat cannot be ruled out.

  8. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  9. Oestrogen regulates the expression of cathepsin E-A-like gene ...

    Indian Academy of Sciences (India)

    Hang Zheng

    2018-02-28

    Feb 28, 2018 ... 1College of Animal Science and Veterinary Medicine, Henan Agricultural .... evaluated the expression regulation mechanism of the gene ... C with ad libitum water and food. ... embryonic liver following the method previously described .... Cloning and sequence analysis of chicken cathepsin E-A-like gene.

  10. A framework for modelling gene regulation which accommodates non-equilibrium mechanisms.

    Science.gov (United States)

    Ahsendorf, Tobias; Wong, Felix; Eils, Roland; Gunawardena, Jeremy

    2014-12-05

    Gene regulation has, for the most part, been quantitatively analysed by assuming that regulatory mechanisms operate at thermodynamic equilibrium. This formalism was originally developed to analyse the binding and unbinding of transcription factors from naked DNA in eubacteria. Although widely used, it has made it difficult to understand the role of energy-dissipating, epigenetic mechanisms, such as DNA methylation, nucleosome remodelling and post-translational modification of histones and co-regulators, which act together with transcription factors to regulate gene expression in eukaryotes. Here, we introduce a graph-based framework that can accommodate non-equilibrium mechanisms. A gene-regulatory system is described as a graph, which specifies the DNA microstates (vertices), the transitions between microstates (edges) and the transition rates (edge labels). The graph yields a stochastic master equation for how microstate probabilities change over time. We show that this framework has broad scope by providing new insights into three very different ad hoc models, of steroid-hormone responsive genes, of inherently bounded chromatin domains and of the yeast PHO5 gene. We find, moreover, surprising complexity in the regulation of PHO5, which has not yet been experimentally explored, and we show that this complexity is an inherent feature of being away from equilibrium. At equilibrium, microstate probabilities do not depend on how a microstate is reached but, away from equilibrium, each path to a microstate can contribute to its steady-state probability. Systems that are far from equilibrium thereby become dependent on history and the resulting complexity is a fundamental challenge. To begin addressing this, we introduce a graph-based concept of independence, which can be applied to sub-systems that are far from equilibrium, and prove that history-dependent complexity can be circumvented when sub-systems operate independently. As epigenomic data become increasingly

  11. Autism and increased paternal age related changes in global levels of gene expression regulation.

    Directory of Open Access Journals (Sweden)

    Mark D Alter

    2011-02-01

    Full Text Available A causal role of mutations in multiple general transcription factors in neurodevelopmental disorders including autism suggested that alterations in global levels of gene expression regulation might also relate to disease risk in sporadic cases of autism. This premise can be tested by evaluating for changes in the overall distribution of gene expression levels. For instance, in mice, variability in hippocampal-dependent behaviors was associated with variability in the pattern of the overall distribution of gene expression levels, as assessed by variance in the distribution of gene expression levels in the hippocampus. We hypothesized that a similar change in variance might be found in children with autism. Gene expression microarrays covering greater than 47,000 unique RNA transcripts were done on RNA from peripheral blood lymphocytes (PBL of children with autism (n = 82 and controls (n = 64. Variance in the distribution of gene expression levels from each microarray was compared between groups of children. Also tested was whether a risk factor for autism, increased paternal age, was associated with variance. A decrease in the variance in the distribution of gene expression levels in PBL was associated with the diagnosis of autism and a risk factor for autism, increased paternal age. Traditional approaches to microarray analysis of gene expression suggested a possible mechanism for decreased variance in gene expression. Gene expression pathways involved in transcriptional regulation were down-regulated in the blood of children with autism and children of older fathers. Thus, results from global and gene specific approaches to studying microarray data were complimentary and supported the hypothesis that alterations at the global level of gene expression regulation are related to autism and increased paternal age. Global regulation of transcription, thus, represents a possible point of convergence for multiple etiologies of autism and other

  12. Ethylene regulates Apple (Malus x domestica) fruit softening through a dose x time-dependent mechanism and through differential sensitivities and dependencies of cell wall-modifying genes.

    Science.gov (United States)

    Ireland, Hilary S; Gunaseelan, Kularajathevan; Muddumage, Ratnasiri; Tacken, Emma J; Putterill, Jo; Johnston, Jason W; Schaffer, Robert J

    2014-05-01

    In fleshy fruit species that have a strong requirement for ethylene to ripen, ethylene is synthesized autocatalytically, producing increasing concentrations as the fruits ripen. Apple fruit with the ACC OXIDASE 1 (ACO1) gene suppressed cannot produce ethylene autocatalytically at ripening. Using these apple lines, an ethylene sensitivity dependency model was previously proposed, with traits such as softening showing a high dependency for ethylene as well as low sensitivity. In this study, it is shown that the molecular control of fruit softening is a complex process, with different cell wall-related genes being independently regulated and exhibiting differential sensitivities to and dependencies on ethylene at the transcriptional level. This regulation is controlled through a dose × time mechanism, which results in a temporal transcriptional response that would allow for progressive cell wall disassembly and thus softening. This research builds on the sensitivity dependency model and shows that ethylene-dependent traits can progress over time to the same degree with lower levels of ethylene. This suggests that a developmental clock measuring cumulative ethylene controls the fruit ripening process.

  13. Additional file 10: Figure S3. of Uncovering co-expression gene network modules regulating fruit acidity in diverse apples

    OpenAIRE

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Zhong, Gan-Yuan; Xu, Kenong

    2015-01-01

    Other regulators from modules Turquoise and Brown and their assigned tight clusters. Elements and their contents, formats and messages are same as those noted in Fig. 8a. (A) Regulator M239684 and Cluster 41 of 68 genes. (B) Regulator M239684 and Cluster 5 of 14 genes. (C) Regulator M239684 and Cluster 7 of 14 genes. (D) Regulator M753318 and Cluster 23 of 11 genes. (E) Regulator M753318 and Cluster 32 of 11 genes. (F) Regulator M175481 and Cluster 2 of 16 genes. (G) Regulator M134341 and Cl...

  14. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Directory of Open Access Journals (Sweden)

    Shirai Leila T

    2012-02-01

    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  15. Characterization of cucurbita maxima phloem serpin-1 (CmPS-1). A developmentally regulated elastase inhibitor.

    Science.gov (United States)

    Yoo, B C; Aoki, K; Xiang, Y; Campbell, L R; Hull, R J; Xoconostle-Cázares, B; Monzer, J; Lee, J Y; Ullman, D E; Lucas, W J

    2000-11-10

    We report on the molecular, biochemical, and functional characterization of Cucurbita maxima phloem serpin-1 (CmPS-1), a novel 42-kDa serine proteinase inhibitor that is developmentally regulated and has anti-elastase properties. CmPS-1 was purified to near homogeneity from C. maxima (pumpkin) phloem exudate and, based on microsequence analysis, the cDNA encoding CmPS-1 was cloned. The association rate constant (k(a)) of phloem-purified and recombinant His(6)-tagged CmPS-1 for elastase was 3.5 +/- 1.6 x 10(5) and 2.7 +/- 0.4 x 10(5) m(-)(1) s(-)(1), respectively. The fraction of complex-forming CmPS-1, X(inh), was estimated at 79%. CmPS-1 displayed no detectable inhibitory properties against chymotrypsin, trypsin, or thrombin. The elastase cleavage sites within the reactive center loop of CmPS-1 were determined to be Val(347)-Gly(348) and Val(350)-Ser(351) with a 3:2 molar ratio. In vivo feeding assays conducted with the piercing-sucking aphid, Myzus persicae, established a close correlation between the developmentally regulated increase in CmPS-1 within the phloem sap and the reduced ability of these insects to survive and reproduce on C. maxima. However, in vitro feeding experiments, using purified phloem CmPS-1, failed to demonstrate a direct effect on aphid survival. Likely roles of this novel phloem serpin in defense against insects/pathogens are discussed.

  16. Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression.

    Science.gov (United States)

    Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha

    2013-05-01

    Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.

  17. Rice ethylene-response AP2/ERF factor OsEATB restricts internode elongation by down-regulating a gibberellin biosynthetic gene.

    Science.gov (United States)

    Qi, Weiwei; Sun, Fan; Wang, Qianjie; Chen, Mingluan; Huang, Yunqing; Feng, Yu-Qi; Luo, Xiaojin; Yang, Jinshui

    2011-09-01

    Plant height is a decisive factor in plant architecture. Rice (Oryza sativa) plants have the potential for rapid internodal elongation, which determines plant height. A large body of physiological research has shown that ethylene and gibberellin are involved in this process. The APETALA2 (AP2)/Ethylene-Responsive Element Binding Factor (ERF) family of transcriptional factors is only present in the plant kingdom. This family has various developmental and physiological functions. A rice AP2/ERF gene, OsEATB (for ERF protein associated with tillering and panicle branching) was cloned from indica rice variety 9311. Bioinformatic analysis suggested that this ERF has a potential new function. Ectopic expression of OsEATB showed that the cross talk between ethylene and gibberellin, which is mediated by OsEATB, might underlie differences in rice internode elongation. Analyses of gene expression demonstrated that OsEATB restricts ethylene-induced enhancement of gibberellin responsiveness during the internode elongation process by down-regulating the gibberellin biosynthetic gene, ent-kaurene synthase A. Plant height is negatively correlated with tiller number, and higher yields are typically obtained from dwarf crops. OsEATB reduces rice plant height and panicle length at maturity, promoting the branching potential of both tillers and spikelets. These are useful traits for breeding high-yielding crops.

  18. Radiation-modulated gene expression in C. elegans

    International Nuclear Information System (INIS)

    Nelson, G.A.; Bayeta, E.; Perez, C.; Lloyd, E.; Jones, T.; Smith, A.; Tian, J.

    2003-01-01

    Full text: We use the nematode C. elegans to characterize the genotoxic and cytotoxic effects of ionizing radiation with emphasis effects of charged particle radiation and have described the fluence vs. response relationships for mutation, chromosome aberration and certain developmental errors. These endpoints quantify the biological after repair and compensation pathways have completed their work. In order to address the control of these reactions we have turned to gene expression profiling to identify genes that uniquely respond to high LET species or respond differentially as a function of radiation properties. We have employed whole genome microarray methods to map gene expression following exposure to gamma rays, protons and accelerated iron ions. We found that 599 of 17871 genes analyzed showed differential expression 3 hrs after exposure to 3 Gy of at least one radiation types. 193 were up-regulated, 406 were down-regulated, and 90% were affected by only one species of radiation. Genes whose transcription levels responded significantly mapped to definite statistical clusters that were unique for each radiation type. We are now trying to establish the functional relationships of the genes their relevance to mitigation of radiation-induced damage. Three approaches are being used. First, bioinformatics tools are being used to determine the roles of genes in co-regulated gene sets. Second, we are applying the technique of RNA interference to determine whether our radiation-induced genes affect cell survival (measured in terms of embryo survival) and chromosome aberration (intestinal anaphase bridges). Finally we are focussing on the response of the most strongly-regulated gene in our data set. This is the autosomal gene, F36D3.9, whose predicted structure is that of a cysteine protease resembling cathepsin B. An enzymological approach is being used to characterize this gene at the protein level. This work was supported by NASA Cooperative Agreement NCC9-149

  19. Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

    Science.gov (United States)

    Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

    2012-05-01

    Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

  20. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  1. Developmentally regulated GTP-binding protein 2 is required for stabilization of Rac1-positive membrane tubules.

    Science.gov (United States)

    Mani, Muralidharan; Lee, Unn Hwa; Yoon, Nal Ae; Yoon, Eun Hye; Lee, Byung Ju; Cho, Wha Ja; Park, Jeong Woo

    2017-11-04

    Previously we have reported that developmentally regulated GTP-binding protein 2 (DRG2) localizes on Rab5 endosomes and plays an important role in transferrin (Tfn) recycling. We here identified DRG2 as a key regulator of membrane tubule stability. At 30 min after Tfn treatment, DRG2 localized to membrane tubules which were enriched with phosphatidylinositol 4-monophosphate [PI(4)P] and did not contain Rab5. DRG2 interacted with Rac1 more strongly with GTP-bound Rac1 and tubular localization of DRG2 depended on Rac1 activity. DRG2 depletion led to destabilization of membrane tubules, while ectopic expression of DRG2 rescued the stability of the membrane tubules in DRG2-depleted cells. Our results reveal a novel mechanism for regulation of membrane tubule stability mediated by DRG2. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

    Science.gov (United States)

    Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

    2018-01-01

    The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

  3. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    Science.gov (United States)

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  4. Rapid male-specific regulatory divergence and down regulation of spermatogenesis genes in Drosophila species hybrids.

    Directory of Open Access Journals (Sweden)

    Jennifer Ferguson

    Full Text Available In most crosses between closely related species of Drosophila, the male hybrids are sterile and show postmeiotic abnormalities. A series of gene expression studies using genomic approaches have found significant down regulation of postmeiotic spermatogenesis genes in sterile male hybrids. These results have led some to suggest a direct relationship between down regulation in gene expression and hybrid sterility. An alternative explanation to a cause-and-effect relationship between misregulation of gene expression and male sterility is rapid divergence of male sex regulatory elements leading to incompatible interactions in an interspecies hybrid genome. To test the effect of regulatory divergence in spermatogenesis gene expression, we isolated 35 fertile D. simulans strains with D. mauritiana introgressions in either the X, second or third chromosome. We analyzed gene expression in these fertile hybrid strains for a subset of spermatogenesis genes previously reported as significantly under expressed in sterile hybrids relative to D. simulans. We found that fertile autosomal introgressions can cause levels of gene down regulation similar to that of sterile hybrids. We also found that X chromosome heterospecific introgressions cause significantly less gene down regulation than autosomal introgressions. Our results provide evidence that rapid male sex gene regulatory divergence can explain misexpression of spermatogenesis genes in hybrids.

  5. Lvr, a Signaling System That Controls Global Gene Regulation and Virulence in Pathogenic Leptospira

    Science.gov (United States)

    Adhikarla, Haritha; Wunder, Elsio A.; Mechaly, Ariel E.; Mehta, Sameet; Wang, Zheng; Santos, Luciane; Bisht, Vimla; Diggle, Peter; Murray, Gerald; Adler, Ben; Lopez, Francesc; Townsend, Jeffrey P.; Groisman, Eduardo; Picardeau, Mathieu; Buschiazzo, Alejandro; Ko, Albert I.

    2018-01-01

    Leptospirosis is an emerging zoonotic disease with more than 1 million cases annually. Currently there is lack of evidence for signaling pathways involved during the infection process of Leptospira. In our comprehensive genomic analysis of 20 Leptospira spp. we identified seven pathogen-specific Two-Component System (TCS) proteins. Disruption of two these TCS genes in pathogenic Leptospira strain resulted in loss-of-virulence in a hamster model of leptospirosis. Corresponding genes lvrA and lvrB (leptospira virulence regulator) are juxtaposed in an operon and are predicted to encode a hybrid histidine kinase and a hybrid response regulator, respectively. Transcriptome analysis of lvr mutant strains with disruption of one (lvrB) or both genes (lvrA/B) revealed global transcriptional regulation of 850 differentially expressed genes. Phosphotransfer assays demonstrated that LvrA phosphorylates LvrB and predicted further signaling downstream to one or more DNA-binding response regulators, suggesting that it is a branched pathway. Phylogenetic analyses indicated that lvrA and lvrB evolved independently within different ecological lineages in Leptospira via gene duplication. This study uncovers a novel-signaling pathway that regulates virulence in pathogenic Leptospira (Lvr), providing a framework to understand the molecular bases of regulation in this life-threatening bacterium. PMID:29600195

  6. Neonatal manipulation of oxytocin prevents lipopolysaccharide-induced decrease in gene expression of growth factors in two developmental stages of the female rat.

    Science.gov (United States)

    Bakos, Jan; Lestanova, Zuzana; Strbak, Vladimir; Havranek, Tomas; Bacova, Zuzana

    2014-10-01

    Oxytocin production and secretion is important for early development of the brain. Long-term consequences of manipulation of oxytocin system might include changes in markers of brain plasticity - cytoskeletal proteins and neurotrophins. The aim of the present study was (1) to determine whether neonatal oxytocin administration affects gene expression of nestin, microtubule-associated protein-2 (MAP-2), brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) in the brain of two developmental stages of rat and (2) to evaluate whether neonatal oxytocin administration protects against lipopolysaccharide (LPS) induced inflammation. Neonatal oxytocin did not prevent a decrease of body weight in the LPS treated animals. Oxytocin significantly increased gene expression of BDNF in the right hippocampus in 21-day and 2-month old rats of both sexes. Gene expression of NGF and MAP-2 significantly increased in males treated with oxytocin. Both, growth factors and intermediate filament-nestin mRNA levels, were reduced in females exposed to LPS. Oxytocin treatment prevented a decrease in the gene expression of only growth factors. In conclusion, neonatal manipulation of oxytocin has developmental and sex-dependent effect on markers of brain plasticity. These results also indicate, that oxytocin may be protective against inflammation particularly in females. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  8. Endogenous methanol regulates mammalian gene activity.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  9. Co-ordinate regulation of lactate metabolism genes in yeast: the role of the lactate permease gene JEN1.

    Science.gov (United States)

    Lodi, T; Fontanesi, F; Guiard, B

    2002-01-01

    In the yeast Saccharomyces cerevisiae, the first step in lactate metabolism is its transport across the plasma membrane, a proton symport process mediated by the product of the gene JEN1. Under aerobic conditions, the expression of JEN1 is regulated by the carbon source: the gene is repressed by glucose and induced by non-fermentable substrates. JEN1 expression is also controlled by oxygen availability, but is unaffected by the absence of haem biosynthesis. JEN1 is negatively regulated by the repressors Mig1p and Mig2p, and requires Cat8p for full derepression. In this report we demonstrate that, in addition to these regulators, the Hap2/3/4/5 complex interacts specifically with a CAAT-box element in the JEN1 promoter, and acts to derepress JEN1 expression. We also provide evidence for transcriptional stimulation of JEN1 by the protein kinase Snf1p. Data are presented which provide a better understanding of the molecular mechanisms implicated in the co-regulation of genes involved in the metabolism of lactate.

  10. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L.

    Science.gov (United States)

    Moreira, Viviane S; Soares, Virgínia L F; Silva, Raner J S; Sousa, Aurizangela O; Otoni, Wagner C; Costa, Marcio G C

    2018-05-01

    Bixa orellana L., popularly known as annatto, produces several secondary metabolites of pharmaceutical and industrial interest, including bixin, whose molecular basis of biosynthesis remain to be determined. Gene expression analysis by quantitative real-time PCR (qPCR) is an important tool to advance such knowledge. However, correct interpretation of qPCR data requires the use of suitable reference genes in order to reduce experimental variations. In the present study, we have selected four different candidates for reference genes in B. orellana , coding for 40S ribosomal protein S9 (RPS9), histone H4 (H4), 60S ribosomal protein L38 (RPL38) and 18S ribosomal RNA (18SrRNA). Their expression stabilities in different tissues (e.g. flower buds, flowers, leaves and seeds at different developmental stages) were analyzed using five statistical tools (NormFinder, geNorm, BestKeeper, ΔCt method and RefFinder). The results indicated that RPL38 is the most stable gene in different tissues and stages of seed development and 18SrRNA is the most unstable among the analyzed genes. In order to validate the candidate reference genes, we have analyzed the relative expression of a target gene coding for carotenoid cleavage dioxygenase 1 (CCD1) using the stable RPL38 and the least stable gene, 18SrRNA , for normalization of the qPCR data. The results demonstrated significant differences in the interpretation of the CCD1 gene expression data, depending on the reference gene used, reinforcing the importance of the correct selection of reference genes for normalization.

  11. Properties and regulation of biosynthesis of cottonseed storage proteins. Comprehensive progress report, December 1, 1976 to September 1, 1979

    Energy Technology Data Exchange (ETDEWEB)

    Dure, III, L S

    1979-01-01

    The regulation of gene expression in cotton seed embryogenesis was studied by attempting to define what gene products are likely to be highly regulated during this developmental progression. The flow of nitrogen into the free amino acids pools of the developing cotyledons, and into the principal nitrogen nutritional reserve of the seed, the storage proteins was measured. This was continued by following the flow of nitrogen from the storage proteins to the principal exported amino acid asparagine that occurs during the first several days of germination. In this fashion the rise and fall of certain enzymes of amino acid intermediary metabolism could be postulated, and in some cases, verified. The subsets of abundant mRNAs whose appearance and disappearance coincided with developmental events in cotyledon embryogenesis/germination with the short range goal of identifying proteins/enzyme activities were delineated as well as their mRNAs that represent specific developmental stages and the long range goal of using these representatives as probes for studying the mechanisms controlling the rise and fall of these mRNAs and their protein products.

  12. A Predictive Coexpression Network Identifies Novel Genes Controlling the Seed-to-Seedling Phase Transition in Arabidopsis thaliana.

    Science.gov (United States)

    Silva, Anderson Tadeu; Ribone, Pamela A; Chan, Raquel L; Ligterink, Wilco; Hilhorst, Henk W M

    2016-04-01

    The transition from a quiescent dry seed to an actively growing photoautotrophic seedling is a complex and crucial trait for plant propagation. This study provides a detailed description of global gene expression in seven successive developmental stages of seedling establishment in Arabidopsis (Arabidopsis thaliana). Using the transcriptome signature from these developmental stages, we obtained a coexpression gene network that highlights interactions between known regulators of the seed-to-seedling transition and predicts the functions of uncharacterized genes in seedling establishment. The coexpressed gene data sets together with the transcriptional module indicate biological functions related to seedling establishment. Characterization of the homeodomain leucine zipper I transcription factor AtHB13, which is expressed during the seed-to-seedling transition, demonstrated that this gene regulates some of the network nodes and affects late seedling establishment. Knockout mutants for athb13 showed increased primary root length as compared with wild-type (Columbia-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time that cells elongate. The signal transduction pathways present during the early phases of the seed-to-seedling transition anticipate the control of important events for a vigorous seedling, such as root growth. This study demonstrates that a gene coexpression network together with transcriptional modules can provide insights that are not derived from comparative transcript profiling alone. © 2016 American Society of Plant Biologists. All Rights Reserved.

  13. Renal-Retinal Ciliopathy Gene Sdccag8 Regulates DNA Damage Response Signaling

    DEFF Research Database (Denmark)

    Airik, Rannar; Slaats, Gisela G; Guo, Zhi

    2014-01-01

    Nephronophthisis-related ciliopathies (NPHP-RCs) are developmental and degenerative kidney diseases that are frequently associated with extrarenal pathologies such as retinal degeneration, obesity, and intellectual disability. We recently identified mutations in a gene encoding the centrosomal...... protein SDCCAG8 as causing NPHP type 10 in humans. To study the role of Sdccag8 in disease pathogenesis, we generated a Sdccag8 gene-trap mouse line. Homozygous Sdccag8(gt/gt) mice lacked the wild-type Sdccag8 transcript and protein, and recapitulated the human phenotypes of NPHP and retinal degeneration....... These mice exhibited early onset retinal degeneration that was associated with rhodopsin mislocalization in the photoreceptors and reduced cone cell numbers, and led to progressive loss of vision. By contrast, renal histologic changes occurred later, and no global ciliary defects were observed in the kidneys...

  14. The R2R3-MYB-like regulatory factor EOBI, acting downstream of EOBII, regulates scent production by activating ODO1 and structural scent-related genes in petunia.

    Science.gov (United States)

    Spitzer-Rimon, Ben; Farhi, Moran; Albo, Boaz; Cna'ani, Alon; Ben Zvi, Michal Moyal; Masci, Tania; Edelbaum, Orit; Yu, Yixun; Shklarman, Elena; Ovadis, Marianna; Vainstein, Alexander

    2012-12-01

    Flower scent is a highly dynamic trait, under developmental, spatial, and diurnal regulation. The mechanism governing scent production is only beginning to be unraveled. In petunia (Petunia hybrida), EMISSION OF BENZENOIDS II (EOBII) controls transcription of both the shikimate pathway-regulating MYB factor ODORANT1 (ODO1) and phenylpropanoid scent-related structural genes. A promoter-activation screen identified an R2R3-MYB-like regulatory factor of phenylpropanoid volatile biosynthesis acting downstream of EOBII, designated EOBI. EOBI silencing led to downregulation of ODO1 and numerous structural scent-related genes from both the shikimate and phenylpropanoid pathways. The ability of EOBI to directly activate ODO1, as revealed by electrophoretic mobility shift assay and yeast one-hybrid analysis, place EOBI upstream of ODO1 in regulating substrate availability for volatile biosynthesis. Interestingly, ODO1-silenced transgenic petunia flowers accumulated higher EOBI transcript levels than controls, suggesting a complex feedback loop between these regulatory factors. The accumulation pattern of EOBI transcript relative to EOBII and ODO1, and the effect of up/downregulation of EOBII on transcript levels of EOBI and ODO1, further support these factors' hierarchical relationships. The dependence of scent production on EOBI expression and its direct interaction with both regulatory and structural genes provide evidence for EOBI's wide-ranging involvement in the production of floral volatiles.

  15. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    Science.gov (United States)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  16. HOXB4 Gene Expression Is Regulated by CDX2 in Intestinal Epithelial Cells

    DEFF Research Database (Denmark)

    Jørgensen, Steffen; Coshun, Mehmet; Mikkelsen Homburg, Keld

    2016-01-01

    analysis and expression data from Caco2 cells also suggests a role for CDX2 in the regulation of HOXB4 gene expression in the intestinal epithelium. Thus, the aim of this study was to investigate whether HOXB4 gene expression is regulated by CDX2 in the intestinal epithelium. We demonstrated binding of CDX......The mammalian Caudal-related homeobox transcription factor 2 (CDX2) plays a key role in the homeobox regulatory network and is essential in regulating the expression of several homeobox (HOX) genes during embryonic development, particularly in the gut. Genome-wide CDX2 chromatin immunoprecipitation......2 to four different CDX2 binding sites in an enhancer region located upstream of the HOXB4 transcription start site. Mutations in the CDX2 binding sites reduced HOXB4 gene activity, and knock down of endogenous CDX2 expression by shRNA reduced HOXB4 gene expression. This is the first report...

  17. Changes in gravitational force affect gene expression in developing organ systems at different developmental times

    Directory of Open Access Journals (Sweden)

    Moorman Stephen J

    2005-05-01

    Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.

  18. Differential regulation of the foraging gene associated with task behaviors in harvester ants

    Directory of Open Access Journals (Sweden)

    Kleeman Lindsay

    2011-08-01

    Full Text Available Abstract Background The division of labor in social insect colonies involves transitions by workers from one task to another and is critical to the organization and ecological success of colonies. The differential regulation of genetic pathways is likely to be a key mechanism involved in plasticity of social insect task behavior. One of the few pathways implicated in social organization involves the cGMP-activated protein kinase gene, foraging, a gene associated with foraging behavior in social insect species. The association of the foraging gene with behavior is conserved across diverse species, but the observed expression patterns and proposed functions of this gene vary across taxa. We compared the protein sequence of foraging across social insects and explored whether the differential regulation of this gene is associated with task behaviors in the harvester ant, Pogonomyrmex occidentalis. Results Phylogenetic analysis of the coding region of the foraging gene reveals considerable conservation in protein sequence across insects, particularly among hymenopteran species. The absence of amino acid variation in key active and binding sites suggests that differences in behaviors associated with this gene among species may be the result of changes in gene expression rather than gene divergence. Using real time qPCR analyses with a harvester ant ortholog to foraging (Pofor, we found that the brains of harvester ant foragers have a daily fluctuation in expression of foraging with mRNA levels peaking at midday. In contrast, young workers inside the nest have low levels of Pofor mRNA with no evidence of daily fluctuations in expression. As a result, the association of foraging expression with task behavior within a species changes depending on the time of day the individuals are sampled. Conclusions The amino acid protein sequence of foraging is highly conserved across social insects. Differences in foraging behaviors associated with this gene among

  19. Medicago truncatula SOC1 Genes Are Up-regulated by Environmental Cues That Promote Flowering

    Directory of Open Access Journals (Sweden)

    Jared B. Fudge

    2018-04-01

    Full Text Available Like Arabidopsis thaliana, the flowering of the legume Medicago truncatula is promoted by long day (LD photoperiod and vernalization. However, there are differences in the molecular mechanisms involved, with orthologs of two key Arabidopsis thaliana regulators, FLOWERING LOCUS C (FLC and CONSTANS (CO, being absent or not having a role in flowering time function in Medicago. In Arabidopsis, the MADS-box transcription factor gene, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (AtSOC1, plays a key role in integrating the photoperiodic and vernalization pathways. In this study, we set out to investigate whether the Medicago SOC1 genes play a role in regulating flowering time. Three Medicago SOC1 genes were identified and characterized (MtSOC1a–MtSOC1c. All three MtSOC1 genes, when heterologously expressed, were able to promote earlier flowering of the late-flowering Arabidopsis soc1-2 mutant. The three MtSOC1 genes have different patterns of expression. However, consistent with a potential role in flowering time regulation, all three MtSOC1 genes are expressed in the shoot apex and are up-regulated in the shoot apex of plants in response to LD photoperiods and vernalization. The up-regulation of MtSOC1 genes was reduced in Medicago fta1-1 mutants, indicating that they are downstream of MtFTa1. Insertion mutant alleles of Medicago soc1b do not flower late, suggestive of functional redundancy among Medicago SOC1 genes in promoting flowering.

  20. Regulation of Cell and Gene Therapy Medicinal Products in Taiwan.

    Science.gov (United States)

    Lin, Yi-Chu; Wang, Po-Yu; Tsai, Shih-Chih; Lin, Chien-Liang; Tai, Hsuen-Yung; Lo, Chi-Fang; Wu, Shiow-Ing; Chiang, Yu-Mei; Liu, Li-Ling

    2015-01-01

    Owing to the rapid and mature development of emerging biotechnology in the fields of cell culture, cell preservation, and recombinant DNA technology, more and more cell or gene medicinal therapy products have been approved for marketing, to treat serious diseases which have been challenging to treat with current medical practice or medicine. This chapter will briefly introduce the Taiwan Food and Drug Administration (TFDA) and elaborate regulation of cell and gene therapy medicinal products in Taiwan, including regulatory history evolution, current regulatory framework, application and review procedures, and relevant jurisdictional issues. Under the promise of quality, safety, and efficacy of medicinal products, it is expected the regulation and environment will be more flexible, streamlining the process of the marketing approval of new emerging cell or gene therapy medicinal products and providing diverse treatment options for physicians and patients.

  1. Interpersonal stress regulation and the development of anxiety disorders: an attachment-based developmental framework

    Directory of Open Access Journals (Sweden)

    Tobias eNolte

    2011-09-01

    Full Text Available Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the aetiology and maintainance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework.The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety and activation of the attachment system. This interplay directly affects the development of social cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualised as the key organiser of a complex interplay between genetic, environmental and epigentic contributions to the development of anxiety disorders – a multifactorial aetiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterised by hyperactivation strategies in the face of anxiety.In the model, the cumulative allostatic load and subsequent wear and tear effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments

  2. The dynamic landscape of gene regulation during Bombyx mori oogenesis.

    Science.gov (United States)

    Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze

    2017-09-11

    Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.

  3. MicroRNA regulation of immune events at conception.

    Science.gov (United States)

    Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E

    2017-09-01

    The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.

  4. Developmental Transcriptome for a Facultatively Eusocial Bee, Megalopta genalis.

    Science.gov (United States)

    Jones, Beryl M; Wcislo, William T; Robinson, Gene E

    2015-08-14

    Transcriptomes provide excellent foundational resources for mechanistic and evolutionary analyses of complex traits. We present a developmental transcriptome for the facultatively eusocial bee Megalopta genalis, which represents a potential transition point in the evolution of eusociality. A de novo transcriptome assembly of Megalopta genalis was generated using paired-end Illumina sequencing and the Trinity assembler. Males and females of all life stages were aligned to this transcriptome for analysis of gene expression profiles throughout development. Gene Ontology analysis indicates that stage-specific genes are involved in ion transport, cell-cell signaling, and metabolism. A number of distinct biological processes are upregulated in each life stage, and transitions between life stages involve shifts in dominant functional processes, including shifts from transcriptional regulation in embryos to metabolism in larvae, and increased lipid metabolism in adults. We expect that this transcriptome will provide a useful resource for future analyses to better understand the molecular basis of the evolution of eusociality and, more generally, phenotypic plasticity. Copyright © 2015 Jones et al.

  5. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  6. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    International Nuclear Information System (INIS)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting

    2014-01-01

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd 2+ uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance

  7. Splicing factor SR34b mutation reduces cadmium tolerance in Arabidopsis by regulating iron-regulated transporter 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wentao; Du, Bojing; Liu, Di; Qi, Xiaoting, E-mail: qixiaoting@cnu.edu.cn

    2014-12-12

    Highlights: • Arabidopsis splicing factor SR34b gene is cadmium-inducible. • SR34b T-DNA insertion mutant is sensitive to cadmium due to high cadmium uptake. • SR34b is a regulator of cadmium transporter IRT1 at the posttranscription level. • These results highlight the roles of splicing factors in cadmium tolerance of plant. - Abstract: Serine/arginine-rich (SR) proteins are important splicing factors. However, the biological functions of plant SR proteins remain unclear especially in abiotic stresses. Cadmium (Cd) is a non-essential element that negatively affects plant growth and development. In this study, we provided clear evidence for SR gene involved in Cd tolerance in planta. Systemic expression analysis of 17 Arabidopsis SR genes revealed that SR34b is the only SR gene upregulated by Cd, suggesting its potential roles in Arabidopsis Cd tolerance. Consistent with this, a SR34b T-DNA insertion mutant (sr34b) was moderately sensitive to Cd, which had higher Cd{sup 2+} uptake rate and accumulated Cd in greater amounts than wild-type. This was due to the altered expression of iron-regulated transporter 1 (IRT1) gene in sr34b mutant. Under normal growth conditions, IRT1 mRNAs highly accumulated in sr34b mutant, which was a result of increased stability of IRT1 mRNA. Under Cd stress, however, sr34b mutant plants had a splicing defect in IRT1 gene, thus reducing the IRT1 mRNA accumulation. Despite of this, sr34b mutant plants still constitutively expressed IRT1 proteins under Cd stress, thereby resulting in Cd stress-sensitive phenotype. We therefore propose the essential roles of SR34b in posttranscriptional regulation of IRT1 expression and identify it as a regulator of Arabidopsis Cd tolerance.

  8. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    Science.gov (United States)

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-03-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  9. Divergent RNA Localisation Patterns of Maternal Genes Regulating Embryonic Patterning in the Butterfly Pararge aegeria.

    Directory of Open Access Journals (Sweden)

    Jean-Michel Carter

    Full Text Available The maternal effect genes responsible for patterning the embryo along the antero-posterior (AP axis are broadly conserved in insects. The precise function of these maternal effect genes is the result of the localisation of their mRNA in the oocyte. The main developmental mechanisms involved have been elucidated in Drosophila melanogaster, but recent studies have shown that other insect orders often diverge in RNA localisation patterns. A recent study has shown that in the butterfly Pararge aegeria the distinction between blastodermal embryonic (i.e. germ band and extra-embryonic tissue (i.e. serosa is already specified in the oocyte during oogenesis in the ovariole, long before blastoderm cellularisation. To examine the extent by which a female butterfly specifies and patterns the AP axis within the region fated to be the germ band, and whether she specifies a germ plasm, we performed in situ hybridisation experiments on oocytes in P. aegeria ovarioles and on early embryos. RNA localisation of the following key maternal effect genes were investigated: caudal (cad, orthodenticle (otd, hunchback (hb and four nanos (nos paralogs, as well as TDRD7 a gene containing a key functional domain (OST-HTH/LOTUS shared with oskar. TDRD7 was mainly confined to the follicle cells, whilst hb was exclusively zygotically transcribed. RNA of some of the nos paralogs, otd and cad revealed complex localisation patterns within the cortical region prefiguring the germ band (i.e. germ cortex. Rather interestingly, otd was localised within and outside the anterior of the germ cortex. Transcripts of nos-O formed a distinct granular ring in the middle of the germ cortex possibly prefiguring the region where germline stem cells form. These butterfly RNA localisation patterns are highly divergent with respect to other insects, highlighting the diverse ways in which different insect orders maternally regulate early embryogenesis of their offspring.

  10. Divergent RNA Localisation Patterns of Maternal Genes Regulating Embryonic Patterning in the Butterfly Pararge aegeria

    Science.gov (United States)

    Carter, Jean-Michel; Gibbs, Melanie; Breuker, Casper J.

    2015-01-01

    The maternal effect genes responsible for patterning the embryo along the antero-posterior (AP) axis are broadly conserved in insects. The precise function of these maternal effect genes is the result of the localisation of their mRNA in the oocyte. The main developmental mechanisms involved have been elucidated in Drosophila melanogaster, but recent studies have shown that other insect orders often diverge in RNA localisation patterns. A recent study has shown that in the butterfly Pararge aegeria the distinction between blastodermal embryonic (i.e. germ band) and extra-embryonic tissue (i.e. serosa) is already specified in the oocyte during oogenesis in the ovariole, long before blastoderm cellularisation. To examine the extent by which a female butterfly specifies and patterns the AP axis within the region fated to be the germ band, and whether she specifies a germ plasm, we performed in situ hybridisation experiments on oocytes in P. aegeria ovarioles and on early embryos. RNA localisation of the following key maternal effect genes were investigated: caudal (cad), orthodenticle (otd), hunchback (hb) and four nanos (nos) paralogs, as well as TDRD7 a gene containing a key functional domain (OST-HTH/LOTUS) shared with oskar. TDRD7 was mainly confined to the follicle cells, whilst hb was exclusively zygotically transcribed. RNA of some of the nos paralogs, otd and cad revealed complex localisation patterns within the cortical region prefiguring the germ band (i.e. germ cortex). Rather interestingly, otd was localised within and outside the anterior of the germ cortex. Transcripts of nos-O formed a distinct granular ring in the middle of the germ cortex possibly prefiguring the region where germline stem cells form. These butterfly RNA localisation patterns are highly divergent with respect to other insects, highlighting the diverse ways in which different insect orders maternally regulate early embryogenesis of their offspring. PMID:26633019

  11. Differential gene expression related to Nora virus infection of Drosophila melanogaster.

    Science.gov (United States)

    Cordes, Ethan J; Licking-Murray, Kellie D; Carlson, Kimberly A

    2013-08-01

    Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. Copyright © 2013. Published by Elsevier B.V.

  12. Distinctive features and differential regulation of the DRTS genes of Arabidopsis thaliana.

    Science.gov (United States)

    Maniga, Antonio; Ghisaura, Stefania; Perrotta, Lara; Marche, Maria Giovanna; Cella, Rino; Albani, Diego

    2017-01-01

    In plants and protists, dihydrofolate reductase (DHFR) and thymidylate synthase (TS) are part of a bifunctional enzyme (DRTS) that allows efficient recycling of the dihydrofolate resulting from TS activity. Arabidopsis thaliana possesses three DRTS genes, called AtDRTS1, AtDRTS2 and AtDRTS3, that are located downstream of three members of the sec14-like SFH gene family. In this study, a characterization of the AtDRTS genes identified alternatively spliced transcripts coding for AtDRTS isoforms which may account for monofunctional DHFR enzymes supporting pathways unrelated to DNA synthesis. Moreover, we discovered a complex differential regulation of the AtDRTS genes that confirms the expected involvement of the AtDRTS genes in cell proliferation and endoreduplication, but indicates also functions related to other cellular activities. AtDRTS1 is widely expressed in both meristematic and differentiated tissues, whereas AtDRTS2 expression is almost exclusively limited to the apical meristems and AtDRTS3 is preferentially expressed in the shoot apex, in stipules and in root cap cells. The differential regulation of the AtDRTS genes is associated to distinctive promoter architectures and the expression of AtDRTS1 in the apical meristems is strictly dependent on the presence of an intragenic region that includes the second intron of the gene. Upon activation of cell proliferation in germinating seeds, the activity of the AtDRTS1 and AtDRTS2 promoters in meristematic cells appears to be maximal at the G1/S phase of the cell cycle. In addition, the promoters of AtDRTS2 and AtDRTS3 are negatively regulated through E2F cis-acting elements and both genes, but not AtDRTS1, are downregulated in plants overexpressing the AtE2Fa factor. Our study provides new information concerning the function and the regulation of plant DRTS genes and opens the way to further investigations addressing the importance of folate synthesis with respect to specific cellular activities.

  13. Compound-specific effects of diverse neurodevelopmental toxicants on global gene expression in the neural embryonic stem cell test (ESTn)

    International Nuclear Information System (INIS)

    Theunissen, P.T.; Robinson, J.F.; Pennings, J.L.A.; Herwijnen, M.H. van; Kleinjans, J.C.S.; Piersma, A.H.

    2012-01-01

    Alternative assays for developmental toxicity testing are needed to reduce animal use in regulatory toxicology. The in vitro murine neural embryonic stem cell test (ESTn) was designed as an alternative for neurodevelopmental toxicity testing. The integration of toxicogenomic-based approaches may further increase predictivity as well as provide insight into underlying mechanisms of developmental toxicity. In the present study, we investigated concentration-dependent effects of six mechanistically diverse compounds, acetaldehyde (ACE), carbamazepine (CBZ), flusilazole (FLU), monoethylhexyl phthalate (MEHP), penicillin G (PENG) and phenytoin (PHE), on the transcriptome and neural differentiation in the ESTn. All compounds with the exception of PENG altered ESTn morphology (cytotoxicity and neural differentiation) in a concentration-dependent manner. Compound induced gene expression changes and corresponding enriched gene ontology biological processes (GO–BP) were identified after 24 h exposure at equipotent differentiation-inhibiting concentrations of the compounds. Both compound-specific and common gene expression changes were observed between subsets of tested compounds, in terms of significance, magnitude of regulation and functionality. For example, ACE, CBZ and FLU induced robust changes in number of significantly altered genes (≥ 687 genes) as well as a variety of GO–BP, as compared to MEHP, PHE and PENG (≤ 55 genes with no significant changes in GO–BP observed). Genes associated with developmentally related processes (embryonic morphogenesis, neuron differentiation, and Wnt signaling) showed diverse regulation after exposure to ACE, CBZ and FLU. In addition, gene expression and GO–BP enrichment showed concentration dependence, allowing discrimination of non-toxic versus toxic concentrations on the basis of transcriptomics. This information may be used to define adaptive versus toxic responses at the transcriptome level.

  14. Compound-specific effects of diverse neurodevelopmental toxicants on global gene expression in the neural embryonic stem cell test (ESTn)

    Energy Technology Data Exchange (ETDEWEB)

    Theunissen, P.T., E-mail: Peter.Theunissen@rivm.nl [Laboratory for Health Protection Research, National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Robinson, J.F. [Laboratory for Health Protection Research, National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Netherlands Toxicogenomics Centre, Maastricht (Netherlands); Pennings, J.L.A. [Laboratory for Health Protection Research, National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Netherlands Toxicogenomics Centre, Maastricht (Netherlands); Herwijnen, M.H. van [Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Kleinjans, J.C.S. [Department of Toxicogenomics, Maastricht University, Maastricht (Netherlands); Netherlands Toxicogenomics Centre, Maastricht (Netherlands); Piersma, A.H. [Laboratory for Health Protection Research, National Institute for Public Health and the Environment (RIVM), Bilthoven (Netherlands); Netherlands Toxicogenomics Centre, Maastricht (Netherlands); Institute for Risk Assessment Sciences, Faculty of Veterinary Sciences, Utrecht University, Utrecht (Netherlands)

    2012-08-01

    Alternative assays for developmental toxicity testing are needed to reduce animal use in regulatory toxicology. The in vitro murine neural embryonic stem cell test (ESTn) was designed as an alternative for neurodevelopmental toxicity testing. The integration of toxicogenomic-based approaches may further increase predictivity as well as provide insight into underlying mechanisms of developmental toxicity. In the present study, we investigated concentration-dependent effects of six mechanistically diverse compounds, acetaldehyde (ACE), carbamazepine (CBZ), flusilazole (FLU), monoethylhexyl phthalate (MEHP), penicillin G (PENG) and phenytoin (PHE), on the transcriptome and neural differentiation in the ESTn. All compounds with the exception of PENG altered ESTn morphology (cytotoxicity and neural differentiation) in a concentration-dependent manner. Compound induced gene expression changes and corresponding enriched gene ontology biological processes (GO–BP) were identified after 24 h exposure at equipotent differentiation-inhibiting concentrations of the compounds. Both compound-specific and common gene expression changes were observed between subsets of tested compounds, in terms of significance, magnitude of regulation and functionality. For example, ACE, CBZ and FLU induced robust changes in number of significantly altered genes (≥ 687 genes) as well as a variety of GO–BP, as compared to MEHP, PHE and PENG (≤ 55 genes with no significant changes in GO–BP observed). Genes associated with developmentally related processes (embryonic morphogenesis, neuron differentiation, and Wnt signaling) showed diverse regulation after exposure to ACE, CBZ and FLU. In addition, gene expression and GO–BP enrichment showed concentration dependence, allowing discrimination of non-toxic versus toxic concentrations on the basis of transcriptomics. This information may be used to define adaptive versus toxic responses at the transcriptome level.

  15. Enantioselective developmental toxicity and immunotoxicity of pyraclofos toward zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Shulin, E-mail: shulin@zju.edu.cn [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhejiang Provincial Key Laboratory of Organic Pollution Process and Control, Hangzhou 310058 (China); Zhang, Zhisheng [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhang, Wenjing; Bao, Lingling [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhejiang Provincial Key Laboratory of Organic Pollution Process and Control, Hangzhou 310058 (China); Xu, Chao, E-mail: chaoxu@zjut.edu.cn [Research Center of Environmental Science, College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou 310032 (China); Zhang, Hu [Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou 210021 (China)

    2015-02-15

    Highlights: • Pyraclofos has significant enantioselective aquatic toxicities to zebrafish. • Pyraclofos induces time- and concentration-dependent developmental toxicity and immunotoxicity. • The mRNA level of IL-1β gene was significantly up-regulated by pyraclofos. • Pyraclofos binds potently to IL-1β, potentially affecting IL-1β-dependent proinflammatory signal transduction. • Our in vitro and in silico studies help to understand the molecular basis for aquatic toxicity of pyraclofos. - Abstract: Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially

  16. Enantioselective developmental toxicity and immunotoxicity of pyraclofos toward zebrafish (Danio rerio)

    International Nuclear Information System (INIS)

    Zhuang, Shulin; Zhang, Zhisheng; Zhang, Wenjing; Bao, Lingling; Xu, Chao; Zhang, Hu

    2015-01-01

    Highlights: • Pyraclofos has significant enantioselective aquatic toxicities to zebrafish. • Pyraclofos induces time- and concentration-dependent developmental toxicity and immunotoxicity. • The mRNA level of IL-1β gene was significantly up-regulated by pyraclofos. • Pyraclofos binds potently to IL-1β, potentially affecting IL-1β-dependent proinflammatory signal transduction. • Our in vitro and in silico studies help to understand the molecular basis for aquatic toxicity of pyraclofos. - Abstract: Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially

  17. The Mediator complex and transcription regulation

    Science.gov (United States)

    Poss, Zachary C.; Ebmeier, Christopher C.

    2013-01-01

    The Mediator complex is a multi-subunit assembly that appears to be required for regulating expression of most RNA polymerase II (pol II) transcripts, which include protein-coding and most non-coding RNA genes. Mediator and pol II function within the pre-initiation complex (PIC), which consists of Mediator, pol II, TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH and is approximately 4.0 MDa in size. Mediator serves as a central scaffold within the PIC and helps regulate pol II activity in ways that remain poorly understood. Mediator is also generally targeted by sequence-specific, DNA-binding transcription factors (TFs) that work to control gene expression programs in response to developmental or environmental cues. At a basic level, Mediator functions by relaying signals from TFs directly to the pol II enzyme, thereby facilitating TF-dependent regulation of gene expression. Thus, Mediator is essential for converting biological inputs (communicated by TFs) to physiological responses (via changes in gene expression). In this review, we summarize an expansive body of research on the Mediator complex, with an emphasis on yeast and mammalian complexes. We focus on the basics that underlie Mediator function, such as its structure and subunit composition, and describe its broad regulatory influence on gene expression, ranging from chromatin architecture to transcription initiation and elongation, to mRNA processing. We also describe factors that influence Mediator structure and activity, including TFs, non-coding RNAs and the CDK8 module. PMID:24088064

  18. Myostatin regulates miR-431 expression via the Ras-Mek-Erk signaling pathway.

    Science.gov (United States)

    Wu, Rimao; Li, Hu; Li, Tingting; Zhang, Yong; Zhu, Dahai

    2015-05-29

    MicroRNAs (miRNAs) play critical regulatory roles in controlling myogenic development both in vitro and in vivo; however, the molecular mechanisms underlying transcriptional regulation of miRNA genes in skeletal muscle cells are largely unknown. Here, using a microarray hybridization approach, we identified myostatin-regulated miRNA genes in skeletal muscle tissues by systematically searching miRNAs that are differentially expressed between wild-type and myostatin-null mice during development. We found that 116 miRNA genes were differentially expressed in muscles between these mice across different developmental stages. We further characterized myostatin-regulated miR-431 was upregulated in skeletal muscle tissues of myostatin-null mice. In functional studies, we found that overexpression of miR-431 in C2C12 myoblast cells attenuated myostatin-induced suppression of myogenic differentiation. Mechanistic studies further demonstrated that myostatin acted through the Ras-Mek-Erk signaling pathway to transcriptionally regulate miR-431 expression C2C12 cells. Our findings provide new insight into the mechanisms underlying transcriptional regulation of miRNA genes by myostatin during skeletal muscle development. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Turmeric (Curcuma longa): miRNAs and their regulating targets are involved in development and secondary metabolite pathways.

    Science.gov (United States)

    Singh, Noopur; Sharma, Ashok

    Turmeric has been used as a therapeutic herb over centuries in traditional medicinal systems due to the presence of several secondary metabolite compounds. microRNAs are known to regulate gene expression at the post-transcriptional level by transcriptional cleavage or translation repression. miRNAs have been demonstrated to play an active role in secondary metabolism regulation. The present work was focused on the identification of the miRNAs involved in the regulation of secondary metabolite and development process of turmeric. Eighteen miRNA families were identified for turmeric. Sixteen miRNA families were observed to regulate 238 target transcripts. LncRNAs targets of the putative miRNA candidates were also predicted. Our results indicated their role in binding, reproduction, stress, and other developmental processes. Gene annotation and pathway analysis illustrated the biological function of the targets regulated by the putative miRNAs. The miRNA-mediated gene regulatory network also revealed co-regulated targets that were regulated by two or more miRNA families. miR156 and miR5015 were observed to be involved in rhizome development. miR5021 showed regulation for terpenoid backbone biosynthesis and isoquinoline alkaloid biosynthesis pathways. The flavonoid biosynthesis pathway was observed to be regulated by miR2919. The analysis revealed the probable involvement of three miRNAs (miR1168.2, miR156b and miR1858) in curcumin biosynthesis. Other miRNAs were found to be involved in the growth and developmental process of turmeric. Phylogenetic analysis of selective miRNAs was also performed. Copyright © 2017 Académie des sciences. Published by Elsevier Masson SAS. All rights reserved.

  20. Photosynthetic control of electron transport and the regulation of gene expression.

    Science.gov (United States)

    Foyer, Christine H; Neukermans, Jenny; Queval, Guillaume; Noctor, Graham; Harbinson, Jeremy

    2012-02-01

    The term 'photosynthetic control' describes the short- and long-term mechanisms that regulate reactions in the photosynthetic electron transport (PET) chain so that the rate of production of ATP and NADPH is coordinated with the rate of their utilization in metabolism. At low irradiances these mechanisms serve to optimize light use efficiency, while at high irradiances they operate to dissipate excess excitation energy as heat. Similarly, the production of ATP and NADPH in ratios tailored to meet demand is finely tuned by a sophisticated series of controls that prevents the accumulation of high NAD(P)H/NAD(P) ratios and ATP/ADP ratios that would lead to potentially harmful over-reduction and inactivation of PET chain components. In recent years, photosynthetic control has also been extrapolated to the regulation of gene expression because mechanisms that are identical or similar to those that serve to regulate electron flow through the PET chain also coordinate the regulated expression of genes encoding photosynthetic proteins. This requires coordinated gene expression in the chloroplasts, mitochondria, and nuclei, involving complex networks of forward and retrograde signalling pathways. Photosynthetic control operates to control photosynthetic gene expression in response to environmental and metabolic changes. Mining literature data on transcriptome profiles of C(3) and C(4) leaves from plants grown under high atmospheric carbon dioxide (CO(2)) levels compared with those grown with ambient CO(2) reveals that the transition to higher photorespiratory conditions in C(3) plants enhances the expression of genes associated with cyclic electron flow pathways in Arabidopsis thaliana, consistent with the higher ATP requirement (relative to NADPH) of photorespiration.