WorldWideScience

Sample records for developmental gene regulation

  1. Developmental regulation of Xenopus 5S RNA genes

    International Nuclear Information System (INIS)

    Wormington, W.M.; Schlissel, M.; Brown, D.D.

    1983-01-01

    In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table

  2. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

  3. Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

    Directory of Open Access Journals (Sweden)

    Ishida Betty K

    2003-08-01

    Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.

  4. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    Science.gov (United States)

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

  5. DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions

    Science.gov (United States)

    Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.

    2011-01-01

    The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518

  6. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    Science.gov (United States)

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

    2005-04-01

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  7. Developmental transitions in Arabidopsis are regulated by antisense RNAs resulting from bidirectionally transcribed genes.

    Science.gov (United States)

    Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon

    2017-07-03

    Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.

  8. The Drosophila Perlecan gene trol regulates multiple signaling pathways in different developmental contexts

    Directory of Open Access Journals (Sweden)

    Perry Trinity L

    2007-11-01

    Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and

  9. A co-expression gene network associated with developmental regulation of apple fruit acidity.

    Science.gov (United States)

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong

    2015-08-01

    Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.

  10. EST analysis in Ginkgo biloba: an assessment of conserved developmental regulators and gymnosperm specific genes

    Directory of Open Access Journals (Sweden)

    Runko Suzan J

    2005-10-01

    Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and

  11. Functional Analysis of Developmentally Regulated Genes chs7 and sec22 in the Ascomycete Sordaria macrospora.

    Science.gov (United States)

    Traeger, Stefanie; Nowrousian, Minou

    2015-04-14

    During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.

  12. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Science.gov (United States)

    Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

    2013-01-01

    Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy

  13. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    Directory of Open Access Journals (Sweden)

    David Cohen

    Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of

  14. Developmental and growth temperature regulation of two different microsomal omega-6 desaturase genes in soybeans.

    Science.gov (United States)

    Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H

    1996-01-01

    The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990

  15. Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene

    Directory of Open Access Journals (Sweden)

    Michael Hadjiargyrou

    2018-01-01

    Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.

  16. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    Institute of Scientific and Technical Information of China (English)

    HSU Heng; Robert L. CHURCH

    2004-01-01

    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  17. Suppression subtractive hybridization and comparative expression analysis to identify developmentally regulated genes in filamentous fungi.

    Science.gov (United States)

    Gesing, Stefan; Schindler, Daniel; Nowrousian, Minou

    2013-09-01

    Ascomycetes differentiate four major morphological types of fruiting bodies (apothecia, perithecia, pseudothecia and cleistothecia) that are derived from an ancestral fruiting body. Thus, fruiting body differentiation is most likely controlled by a set of common core genes. One way to identify such genes is to search for genes with evolutionary conserved expression patterns. Using suppression subtractive hybridization (SSH), we selected differentially expressed transcripts in Pyronema confluens (Pezizales) by comparing two cDNA libraries specific for sexual and for vegetative development, respectively. The expression patterns of selected genes from both libraries were verified by quantitative real time PCR. Expression of several corresponding homologous genes was found to be conserved in two members of the Sordariales (Sordaria macrospora and Neurospora crassa), a derived group of ascomycetes that is only distantly related to the Pezizales. Knockout studies with N. crassa orthologues of differentially regulated genes revealed a functional role during fruiting body development for the gene NCU05079, encoding a putative MFS peptide transporter. These data indicate conserved gene expression patterns and a functional role of the corresponding genes during fruiting body development; such genes are candidates of choice for further functional analysis. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Identification of 2 novel genes developmentally regulated in the mouse aorta-gonad-mesonephros region

    NARCIS (Netherlands)

    C. Orelio; E.A. Dzierzak (Elaine)

    2003-01-01

    textabstractThe first adult-repopulating hematopoietic stem cells (HSCs) emerge in the mouse aorta-gonad-mesonephros (AGM) region at embryonic day 10.5 prior to their appearance in the yolk sac and fetal liver. Although several genes are implicated in the regulation of HSCs, there

  19. Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

    Science.gov (United States)

    Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

    2014-05-01

    Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

  20. Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana.

    Science.gov (United States)

    Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott

    2016-08-01

    Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.

  1. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    Science.gov (United States)

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  2. NeuroD1: developmental expression and regulated genes in the rodent pineal gland

    DEFF Research Database (Denmark)

    Muñoz, Estela M; Bailey, Michael J; Rath, Martin F

    2007-01-01

    NeuroD1/BETA2, a member of the bHLH transcription factor family, is known to influence the fate of specific neuronal, endocrine and retinal cells. We report here that NeuroD1 mRNA is highly abundant in the developing and adult rat pineal gland. Pineal expression begins in the 17-day embryo at which...... time it is also detectable in other brain regions. Expression in the pineal gland increases during the embryonic period and is maintained thereafter at levels equivalent to those found in the cerebellum and retina. In contrast, NeuroD1 mRNA decreases markedly in non-cerebellar brain regions during...... development. Pineal NeuroD1 levels are similar during the day and night, and do not appear to be influenced by sympathetic neural input. Gene expression analysis of the pineal glands from neonatal NeuroD1 knockout mice identifies 127 transcripts that are down-regulated (>twofold, p

  3. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Science.gov (United States)

    Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

    2016-01-01

    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  5. The Tomato Hoffman's Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures.

    Directory of Open Access Journals (Sweden)

    Zhengkun Qiu

    Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.

  6. The Tomato Hoffman’s Anthocyaninless Gene Encodes a bHLH Transcription Factor Involved in Anthocyanin Biosynthesis That Is Developmentally Regulated and Induced by Low Temperatures

    Science.gov (United States)

    Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen

    2016-01-01

    Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362

  7. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Directory of Open Access Journals (Sweden)

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  8. Developmental fluoxetine exposure increases behavioral despair and alters epigenetic regulation of the hippocampal BDNF gene in adult female offspring.

    Science.gov (United States)

    Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A

    2016-04-01

    A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Directory of Open Access Journals (Sweden)

    Escalante Ricardo

    2008-01-01

    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  10. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  11. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  12. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  13. Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

    Science.gov (United States)

    Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

    2003-12-01

    Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

  14. A retinoblastoma orthologue is a major regulator of S-phase, mitotic, and developmental gene expression in Dictyostelium.

    Directory of Open Access Journals (Sweden)

    Kimchi Strasser

    Full Text Available The retinoblastoma tumour suppressor, Rb, has two major functions. First, it represses genes whose products are required for S-phase entry and progression thus stabilizing cells in G1. Second, Rb interacts with factors that induce cell-cycle exit and terminal differentiation. Dictyostelium lacks a G1 phase in its cell cycle but it has a retinoblastoma orthologue, rblA.Using microarray analysis and mRNA-Seq transcriptional profiling, we show that RblA strongly represses genes whose products are involved in S phase and mitosis. Both S-phase and mitotic genes are upregulated at a single point in late G2 and again in mid-development, near the time when cell cycling is reactivated. RblA also activates a set of genes unique to slime moulds that function in terminal differentiation.Like its mammalian counterpart Dictyostelium, RblA plays a dual role, regulating cell-cycle progression and transcriptional events leading to terminal differentiation. In the absence of a G1 phase, however, RblA functions in late G2 controlling the expression of both S-phase and mitotic genes.

  15. Differential tissue distribution, developmental programming, estrogen regulation and promoter characteristics of cyp19 genes in teleost fish.

    Science.gov (United States)

    Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E

    2001-12-01

    Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the

  16. Sexually dimorphic gene regulation in brain as a target for endocrine disrupters: Developmental exposure of rats to 4-methylbenzylidene camphor

    International Nuclear Information System (INIS)

    Maerkel, Kirsten; Durrer, Stefan; Henseler, Manuel; Schlumpf, Margret; Lichtensteiger, Walter

    2007-01-01

    The developing neuroendocrine brain represents a potential target for endocrine active chemicals. The UV filter 4-methylbenzylidene camphor (4-MBC) exhibits estrogenic activity, but also interferes with the thyroid axis. We investigated effects of pre- and postnatal exposure to 4-MBC in the same rat offspring at brain and reproductive organ levels. 4-MBC (7, 24, 47 mg/kg/day) was administered in chow to the parent generation before mating, during gestation and lactation, and to the offspring until adulthood. mRNA of estrogen target genes involved in control of sexual behavior and gonadal functions was measured by real-time RT-PCR in ventromedial hypothalamic nucleus (VMH) and medial preoptic area (MPO) of adult offspring. 4-MBC exposure affected mRNA levels of ER alpha, progesterone receptor (PR), preproenkephalin (PPE) and insulin-like growth factor-I (IGF-I) in a sex- and region-specific manner. In order to assess possible changes in sensitivity of target genes to estrogens, offspring were gonadectomized on day 70, injected with estradiol (E2, 10 or 50 μg/kg s.c.) or vehicle on day 84, and sacrificed 6 h later. The acute induction of PR mRNA, and repression (at 6 h) of PPE mRNA by E2 was enhanced by 4-MBC in male and female VMH and female MPO, whereas male MPO exhibited reduced responsiveness of both genes. Steroid receptor coactivator SRC-1 mRNA levels were increased in female VMH and MPO. The data indicate profound sex- and region-specific alterations in the regulation of estrogen target genes at brain level. Effect patterns in baseline and E2-induced gene expression differ from those in uterus and prostate

  17. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins.

    Science.gov (United States)

    Hoffmann, H M; Catron, K M; van Wijnen, A J; McCabe, L R; Lian, J B; Stein, G S; Stein, J L

    1994-12-20

    The OC box of the rat osteocalcin promoter (nt -99 to -76) is the principal proximal regulatory element contributing to both tissue-specific and developmental control of osteocalcin gene expression. The central motif of the OC box includes a perfect consensus DNA binding site for certain homeodomain proteins. Homeodomain proteins are transcription factors that direct proper development by regulating specific temporal and spatial patterns of gene expression. We therefore addressed the role of the homeodomain binding motif in the activity of the OC promoter. In this study, by the combined application of mutagenesis and site-specific protein recognition analysis, we examined interactions of ROS 17/2.8 osteosarcoma cell nuclear proteins and purified Msx-1 homeodomain protein with the OC box. We detected a series of related specific protein-DNA interactions, a subset of which were inhibited by antibodies directed against the Msx-1 homeodomain but which also recognize the Msx-2 homeodomain. Our results show that the sequence requirements for binding the Msx-1 or Msx-2 homeodomain closely parallel those necessary for osteocalcin gene promoter activity in vivo. This functional relationship was demonstrated by transient expression in ROS 17/2.8 osteosarcoma cells of a series of osteocalcin promoter (nt -1097 to +24)-reporter gene constructs containing mutations within and flanking the homeodomain binding site of the OC box. Northern blot analysis of several bone-related cell types showed that all of the cells expressed msx-1, whereas msx-2 expression was restricted to cells transcribing osteocalcin. Taken together, our results suggest a role for Msx-1 and -2 or related homeodomain proteins in transcription of the osteocalcin gene.

  18. A novel lens epithelium gene, LEP503, is highly conserved in different vertebrate species and is developmentally regulated in postnatal rat lens.

    Science.gov (United States)

    Wen, Y; Sachs, G; Athmann, C

    2000-02-01

    The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.

  19. One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

    Science.gov (United States)

    Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

    2009-01-01

    Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

  20. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)

    2016-08-15

    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  1. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus

    International Nuclear Information System (INIS)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-01-01

    Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47

  2. Characterization of a chickpea (Cicer arietinum L.) NAC family gene, CarNAC5, which is both developmentally- and stress-regulated.

    Science.gov (United States)

    Peng, Hui; Cheng, Hui-Ying; Yu, Xin-Wang; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao

    2009-01-01

    It has been documented that the plant-specific NAC (for NAM, ATAF1,2 and CUC2) transcription factors play an important role in plant development and stress responses. In this study, a chickpea NAC gene CarNAC5 (for Cicer arietinum L. NAC gene 5) was isolated from a cDNA library from chickpea leaves treated by polyethylene glycol (PEG). CarNAC5, as a single/low copy gene, contained three exons and two introns within genomic DNA sequence and encoded a polypeptide with 291 amino acids. CarNAC5 protein had a conserved NAC domain in the N-terminus and showed high similarity to other NACs, especially ATAF subgroup members. The CarNAC5:GFP fusion protein was localized in the nucleus of onion epidermal cells. Furthermore, CarNAC5 protein activated the reporter genes LacZ and HIS3 in yeast. The transactivation activity was mapped to the C-terminal region. The transcripts of CarNAC5 appeared in many chickpea tissues including seedling leaves, stems, roots, flowers, seeds and pods, but mostly accumulated in flowers. Meanwhile, CarNAC5 was strongly expressed during seed maturation and in embryos of the early germinating seeds. It was also significantly induced by drought, heat, wounding, salicylic acid (SA), and indole-3-acetic acid (IAA) treatments. Our results suggest that CarNAC5 encodes a novel NAC-domain protein and acts as a transcriptional activator involved in plant developmental regulation and various stress responses.

  3. Developmental regulation of ecdysone receptor (EcR and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Tathyana Rachel Palo Mello

    2014-12-01

    Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.

  4. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

    Science.gov (United States)

    Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2016-08-01

    2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. The olive DGAT2 gene is developmentally regulated and shares overlapping but distinct expression patterns with DGAT1

    OpenAIRE

    Banilas, Georgios; Karampelias, Michael; Makariti, Ifigenia; Kourti, Anna; Hatzopoulos, Polydefkis

    2010-01-01

    Diacylglycerol acyltransferases (DGATs) catalyse the final step of the triacylglycerol (TAG) biosynthesis of the Kennedy pathway. Two major gene families have been shown to encode DGATs, DGAT1 (type-1) and DGAT2 (type-2). Both genes encode membrane-bound proteins, with no sequence homology to each other. In this study, the molecular cloning and characterization of a type-2 DGAT cDNA from olive is presented. Southern blot analysis showed that OeDGAT2 is represented by a single copy in the oliv...

  6. Developmentally-Regulated Excision of the SPβ Prophage Reconstitutes a Gene Required for Spore Envelope Maturation in Bacillus subtilis

    Science.gov (United States)

    Abe, Kimihiro; Kawano, Yuta; Iwamoto, Keito; Arai, Kenji; Maruyama, Yuki; Eichenberger, Patrick; Sato, Tsutomu

    2014-01-01

    Temperate phages infect bacteria by injecting their DNA into bacterial cells, where it becomes incorporated into the host genome as a prophage. In the genome of Bacillus subtilis 168, an active prophage, SPβ, is inserted into a polysaccharide synthesis gene, spsM. Here, we show that a rearrangement occurs during sporulation to reconstitute a functional composite spsM gene by precise excision of SPβ from the chromosome. SPβ excision requires a putative site-specific recombinase, SprA, and an accessory protein, SprB. A minimized SPβ, where all the SPβ genes were deleted, except sprA and sprB, retained the SPβ excision activity during sporulation, demonstrating that sprA and sprB are necessary and sufficient for the excision. While expression of sprA was observed during vegetative growth, sprB was induced during sporulation and upon mitomycin C treatment, which triggers the phage lytic cycle. We also demonstrated that overexpression of sprB (but not of sprA) resulted in SPβ prophage excision without triggering the lytic cycle. These results suggest that sprB is the factor that controls the timing of phage excision. Furthermore, we provide evidence that spsM is essential for the addition of polysaccharides to the spore envelope. The presence of polysaccharides on the spore surface renders the spore hydrophilic in water. This property may be beneficial in allowing spores to disperse in natural environments via water flow. A similar rearrangement occurs in Bacillus amyloliquefaciens FZB42, where a SPβ-like element is excised during sporulation to reconstitute a polysaccharide synthesis gene, suggesting that this type of gene rearrangement is common in spore-forming bacteria because it can be spread by phage infection. PMID:25299644

  7. Distinguishing epigenetic marks of developmental and imprinting regulation

    Directory of Open Access Journals (Sweden)

    McEwen Kirsten R

    2010-01-01

    Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two

  8. Nogo-receptor gene activity: cellular localization and developmental regulation of mRNA in mice and humans.

    Science.gov (United States)

    Josephson, Anna; Trifunovski, Alexandra; Widmer, Hans Ruedi; Widenfalk, Johan; Olson, Lars; Spenger, Christian

    2002-11-18

    Nogo (reticulon-4) is a myelin-associated protein that is expressed in three different splice variants, Nogo-A, Nogo-B, and Nogo-C. Nogo-A inhibits neurite regeneration in the central nervous system. Messenger RNA encoding Nogo is expressed in oligodendrocytes and central and peripheral neurons, but not in astrocytes or Schwann cells. Nogo is a transmembraneous protein; the extracellular domain is termed Nogo-66, and a Nogo-66-receptor (Nogo-R) has been identified. We performed in situ hybridization in human and mouse nervous tissues to map the cellular distribution of Nogo-R gene activity patterns in fetal and adult human spinal cord and sensory ganglia, adult human brain, and the nervous systems of developing and adult mice. In the human fetus Nogo-R was transcribed in the ventral horn of the spinal cord and in dorsal root ganglia. In adult human tissues Nogo-R gene activity was found in neocortex, hippocampus, amygdala, and a subset of large and medium-sized neurons of the dorsal root ganglia. Nogo-R mRNA was not expressed in the adult human spinal cord at detectable levels. In the fetal mouse, Nogo-R was diffusely expressed in brain, brainstem, trigeminal ganglion, spinal cord, and dorsal root ganglia at all stages. In the adult mouse strong Nogo-R mRNA expression was found in neurons in neocortex, hippocampus, amygdala, habenula, thalamic nuclei, brainstem, the granular cell layer of cerebellum, and the mitral cell layer of the olfactory bulb. Neurons in the adult mouse striatum, the medial septal nucleus, and spinal cord did not express Nogo-R mRNA at detectable levels. In summary, Nogo-66-R mRNA expression in humans and mice was observed in neurons of the developing nervous system Expression was downregulated in the adult spinal cord of both species, and specific expression patterns were seen in the adult brain. Copyright 2002 Wiley-Liss, Inc.

  9. Comparison of 454-ESTs from Huperzia serrata and Phlegmariurus carinatus reveals putative genes involved in lycopodium alkaloid biosynthesis and developmental regulation

    Directory of Open Access Journals (Sweden)

    Steinmetz André

    2010-09-01

    . serrata and P. carinatus 454-ESTs and real-time PCR analysis. Four unique putative CYP450 transcripts (Hs01891, Hs04010, Hs13557 and Hs00093 which are the most likely to be involved in the biosynthesis of lycopodium alkaloids were selected based on a phylogenetic analysis. Approximately 115 H. serrata and 98 P. carinatus unique putative transcripts associated with the biosynthesis of triterpenoids, alkaloids and flavones/flavonoids were located in the 454-EST datasets. Transcripts related to phytohormone biosynthesis and signal transduction as well as transcription factors were also obtained. In addition, we discovered 2,729 and 1,573 potential SSR-motif microsatellite loci in the H. serrata and P. carinatus 454-ESTs, respectively. Conclusions The 454-EST resource allowed for the first large-scale acquisition of ESTs from H. serrata and P. carinatus, which are representative members of the Huperziaceae family. We discovered many genes likely to be involved in the biosynthesis of bioactive compounds and transcriptional regulation as well as a large number of potential microsatellite markers. These results constitute an essential resource for understanding the molecular basis of developmental regulation and secondary metabolite biosynthesis (especially that of lycopodium alkaloids in the Huperziaceae, and they provide an overview of the genetic diversity of this family.

  10. Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.

    Directory of Open Access Journals (Sweden)

    Susanta K Behura

    Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.

  11. Mural granulosa cell gene expression associated with oocyte developmental competence

    Directory of Open Access Journals (Sweden)

    Jiang Jin-Yi

    2010-03-01

    Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and

  12. Tomato UDP-Glucose Sterol Glycosyltransferases: A Family of Developmental and Stress Regulated Genes that Encode Cytosolic and Membrane-Associated Forms of the Enzyme

    Directory of Open Access Journals (Sweden)

    Karla Ramirez-Estrada

    2017-06-01

    Full Text Available Sterol glycosyltransferases (SGTs catalyze the glycosylation of the free hydroxyl group at C-3 position of sterols to produce sterol glycosides. Glycosylated sterols and free sterols are primarily located in cell membranes where in combination with other membrane-bound lipids play a key role in modulating their properties and functioning. In contrast to most plant species, those of the genus Solanum contain very high levels of glycosylated sterols, which in the case of tomato may account for more than 85% of the total sterol content. In this study, we report the identification and functional characterization of the four members of the tomato (Solanum lycopersicum cv. Micro-Tom SGT gene family. Expression of recombinant SlSGT proteins in E. coli cells and N. benthamiana leaves demonstrated the ability of the four enzymes to glycosylate different sterol species including cholesterol, brassicasterol, campesterol, stigmasterol, and β-sitosterol, which is consistent with the occurrence in their primary structure of the putative steroid-binding domain found in steroid UDP-glucuronosyltransferases and the UDP-sugar binding domain characteristic for a superfamily of nucleoside diphosphosugar glycosyltransferases. Subcellular localization studies based on fluorescence recovery after photobleaching and cell fractionation analyses revealed that the four tomato SGTs, like the Arabidopsis SGTs UGT80A2 and UGT80B1, localize into the cytosol and the PM, although there are clear differences in their relative distribution between these two cell fractions. The SlSGT genes have specialized but still largely overlapping expression patterns in different organs of tomato plants and throughout the different stages of fruit development and ripening. Moreover, they are differentially regulated in response to biotic and abiotic stress conditions. SlSGT4 expression increases markedly in response to osmotic, salt, and cold stress, as well as upon treatment with abscisic

  13. IGF-1 deficiency in a critical period early in life influences the vascular aging phenotype in mice by altering miRNA-mediated post-transcriptional gene regulation: implications for the developmental origins of health and disease hypothesis.

    Science.gov (United States)

    Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna

    2016-08-01

    Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the

  14. Aberrant Epigenetic Gene Regulation in GABAergic Interneuron Subpopulations in the Hippocampal Dentate Gyrus of Mouse Offspring Following Developmental Exposure to Hexachlorophene.

    Science.gov (United States)

    Watanabe, Yousuke; Abe, Hajime; Nakajima, Kota; Ideta-Otsuka, Maky; Igarashi, Katsuhide; Woo, Gye-Hyeong; Yoshida, Toshinori; Shibutani, Makoto

    2018-05-01

    Maternal hexachlorophene (HCP) exposure causes transient disruption of hippocampal neurogenesis in mouse offspring. We examined epigenetically hypermethylated and downregulated genes related to this HCP-induced disrupted neurogenesis. Mated female mice were dietary exposed to 0 or 100 ppm HCP from gestational day 6 to postnatal day (PND) 21 on weaning. The hippocampal dentate gyrus of male offspring was subjected to methyl-capture sequencing and real-time reverse transcription-polymerase chain reaction analyses on PND 21. Validation analyses on methylation identified three genes, Dlx4, Dmrt1, and Plcb4, showing promoter-region hypermethylation. Immunohistochemically, DLX4+, DMRT1+, and PLCB4+ cells in the dentate hilus co-expressed GAD67, a γ-aminobutyric acid (GABA)ergic neuron marker. HCP decreased all of three subpopulations as well as GAD67+ cells on PND 21. PLCB4+ cells also co-expressed the metabotropic glutamate receptor, GRM1. HCP also decreased transcript level of synaptic plasticity-related genes in the dentate gyrus and immunoreactive granule cells for synaptic plasticity-related ARC. On PND 77, all immunohistochemical cellular density changes were reversed, whereas the transcript expression of the synaptic plasticity-related genes fluctuated. Thus, HCP-exposed offspring transiently reduced the number of GABAergic interneurons. Among them, subpopulations expressing DLX4, DMRT1, or PLCB4 were transiently reduced in number through an epigenetic mechanism. Considering the role of the Dlx gene family in GABAergic interneuron migration and differentiation, the decreased number of DLX4+ cells may be responsible for reducing those GABAergic interneurons regulating neurogenesis. The effect on granule cell synaptic plasticity was sustained until the adult stage, and reduced GABAergic interneurons active in GRM1-PLCB4 signaling may be responsible for the suppression on weaning.

  15. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  16. Intermediate filaments and gene regulation.

    Science.gov (United States)

    Traub, P

    1995-01-01

    The biological role of intermediate filaments (IFs) of eukaryotic cells is still a matter of conjecture. On the basis of immunofluorescence and electron microscopic observations, they appear to play a cytoskeletal role in that they stabilize cellular structure and organize the distribution and interactions of intracellular organelles and components. The expression of a large number of cell type-specific and developmentally regulated subunit proteins is believed to provide multicellular organisms with different IF systems capable of differential interactions with the various substructures and components of their multiple, differentiated cells. However, the destruction of distinct IF systems by manipulation of cultured cells or by knock-out mutation of IF subunit proteins in transgenic mice exerts relatively little influence on cellular morphology and physiology and on development of mutant animals. In order to rationalize this dilemma, the cytoskeletal concept of IF function has been extended to purport that cytoplasmic (c) IFs and their subunit proteins also play fundamental roles in gene regulation. It is based on the in vitro capacity of cIF(protein)s to interact with guanine-rich, single-stranded DNA, supercoiled DNA and histones, as well as on their close structural relatedness to gene-regulatory DNA-binding and nuclear matrix proteins. Since cIF proteins do not possess classical nuclear localization signals, it is proposed that cIFs directly penetrate the double nuclear membrane, exploiting the amphiphilic, membrane-active character of their subunit proteins. Since they can establish metastable multisite contacts with nuclear matrix structures and/or chromatin areas containing highly repetitive DNA sequence elements at the nuclear periphery, they are supposed to participate in chromosome distribution and chromatin organization in interphase nuclei of differentiated cells. Owing to their different DNA-binding specificities, the various cIF systems may in this

  17. Sense and antisense transcripts of the developmentally regulated murine hsp70.2 gene are expressed in distinct and only partially overlapping areas in the adult brain

    Science.gov (United States)

    Murashov, A. K.; Wolgemuth, D. J.

    1996-01-01

    We have examined the spatial pattern of expression of a member of the hsp70 gene family, hsp70.2, in the mouse central nervous system. Surprisingly, RNA blot analysis and in situ hybridization revealed abundant expression of an 'antisense' hsp70.2 transcript in several areas of adult mouse brain. Two different transcripts recognized by sense and antisense riboprobes for the hsp70.2 gene were expressed in distinct and only partially overlapping neuronal populations. RNA blot analysis revealed low levels of the 2.7 kb transcript of hsp70.2 in several areas of the brain, with highest signal in the hippocampus. Abundant expression of a slightly larger (approximately 2.8 kb) 'antisense' transcript was detected in several brain regions, notably in the brainstem, cerebellum, mesencephalic tectum, thalamus, cortex, and hippocampus. In situ hybridization revealed that the sense and antisense transcripts were both predominantly neuronal and localized to the same cell types in the granular layer of the cerebellum, trapezoid nucleus of the superior olivary complex, locus coeruleus and hippocampus. The hsp70.2 antisense transcripts were particularly abundant in the frontal cortex, dentate gyrus, subthalamic nucleus, zona incerta, superior and inferior colliculi, central gray, brainstem, and cerebellar Purkinje cells. Our findings have revealed a distinct cellular and spatial localization of both sense and antisense transcripts, demonstrating a new level of complexity in the function of the heat shock genes.

  18. Developmental Regulation across the Life Span: Toward a New Synthesis

    Science.gov (United States)

    Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

    2013-01-01

    How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

  19. Limb development: a paradigm of gene regulation.

    Science.gov (United States)

    Petit, Florence; Sears, Karen E; Ahituv, Nadav

    2017-04-01

    The limb is a commonly used model system for developmental biology. Given the need for precise control of complex signalling pathways to achieve proper patterning, the limb is also becoming a model system for gene regulation studies. Recent developments in genomic technologies have enabled the genome-wide identification of regulatory elements that control limb development, yielding insights into the determination of limb morphology and forelimb versus hindlimb identity. The modulation of regulatory interactions - for example, through the modification of regulatory sequences or chromatin architecture - can lead to morphological evolution, acquired regeneration capacity or limb malformations in diverse species, including humans.

  20. Subcellular location of Arabidopsis thaliana subfamily a1 β-galactosidases and developmental regulation of transcript levels of their coding genes.

    Science.gov (United States)

    Moneo-Sánchez, María; Izquierdo, Lucía; Martín, Ignacio; Labrador, Emilia; Dopico, Berta

    2016-12-01

    The aim of this work is to gain insight into the six members of the a1 subfamily of the β-galactosidases (BGAL) from Arabidopsis thaliana. First, the subcellular location of all these six BGAL proteins from a1 subfamily has been established in the cell wall by the construction of transgenic plants producing the enhanced green fluorescent protein (eGFP) fused to the BGAL proteins. BGAL12 is also located in the endoplasmic reticulum. Our study of the AtBGAL transcript accumulation along plant development indicated that all AtBGAL transcript appeared in initial stages of development, both dark- and light-grown seedlings, being AtBGAL1, AtBGAL2 and AtBGAL3 transcripts the predominant ones in the latter condition, mainly in the aerial part and with levels decreasing with age. The high accumulation of transcript of AtBGAL4 in basal internodes and in leaves at the end of development, and their strong increase after treatment both with BL and H 3 BO 3 point to an involvement of BGAL4 in cell wall changes leading to the cease of elongation and increased rigidity. The changes of AtBGAL transcript accumulation in relation to different stages and conditions of plant development, suggest that each of the different gene products have a plant-specific function and provides support for the proposed function of the subfamily a1 BGAL in plant cell wall remodelling for cell expansion or for cell response to stress conditions. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Prepatterning of developmental gene expression by modified histones before zygotic genome activation

    DEFF Research Database (Denmark)

    Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.

    2011-01-01

    A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...

  2. A Drosophila Genome-Wide Screen Identifies Regulators of Steroid Hormone Production and Developmental Timing

    DEFF Research Database (Denmark)

    Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki

    2016-01-01

    Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...

  3. Developmental expression of the alpha-skeletal actin gene

    Directory of Open Access Journals (Sweden)

    Vonk Freek J

    2008-06-01

    Full Text Available Abstract Background Actin is a cytoskeletal protein which exerts a broad range of functions in almost all eukaryotic cells. In higher vertebrates, six primary actin isoforms can be distinguished: alpha-skeletal, alpha-cardiac, alpha-smooth muscle, gamma-smooth muscle, beta-cytoplasmic and gamma-cytoplasmic isoactin. Expression of these actin isoforms during vertebrate development is highly regulated in a temporal and tissue-specific manner, but the mechanisms and the specific differences are currently not well understood. All members of the actin multigene family are highly conserved, suggesting that there is a high selective pressure on these proteins. Results We present here a model for the evolution of the genomic organization of alpha-skeletal actin and by molecular modeling, illustrate the structural differences of actin proteins of different phyla. We further describe and compare alpha-skeletal actin expression in two developmental stages of five vertebrate species (mouse, chicken, snake, salamander and fish. Our findings confirm that alpha-skeletal actin is expressed in skeletal muscle and in the heart of all five species. In addition, we identify many novel non-muscular expression domains including several in the central nervous system. Conclusion Our results show that the high sequence homology of alpha-skeletal actins is reflected by similarities of their 3 dimensional protein structures, as well as by conserved gene expression patterns during vertebrate development. Nonetheless, we find here important differences in 3D structures, in gene architectures and identify novel expression domains for this structural and functional important gene.

  4. Efficient Reverse-Engineering of a Developmental Gene Regulatory Network

    Science.gov (United States)

    Cicin-Sain, Damjan; Ashyraliyev, Maksat; Jaeger, Johannes

    2012-01-01

    Understanding the complex regulatory networks underlying development and evolution of multi-cellular organisms is a major problem in biology. Computational models can be used as tools to extract the regulatory structure and dynamics of such networks from gene expression data. This approach is called reverse engineering. It has been successfully applied to many gene networks in various biological systems. However, to reconstitute the structure and non-linear dynamics of a developmental gene network in its spatial context remains a considerable challenge. Here, we address this challenge using a case study: the gap gene network involved in segment determination during early development of Drosophila melanogaster. A major problem for reverse-engineering pattern-forming networks is the significant amount of time and effort required to acquire and quantify spatial gene expression data. We have developed a simplified data processing pipeline that considerably increases the throughput of the method, but results in data of reduced accuracy compared to those previously used for gap gene network inference. We demonstrate that we can infer the correct network structure using our reduced data set, and investigate minimal data requirements for successful reverse engineering. Our results show that timing and position of expression domain boundaries are the crucial features for determining regulatory network structure from data, while it is less important to precisely measure expression levels. Based on this, we define minimal data requirements for gap gene network inference. Our results demonstrate the feasibility of reverse-engineering with much reduced experimental effort. This enables more widespread use of the method in different developmental contexts and organisms. Such systematic application of data-driven models to real-world networks has enormous potential. Only the quantitative investigation of a large number of developmental gene regulatory networks will allow us to

  5. Developmental gene expression profiles of the human pathogen Schistosoma japonicum

    Directory of Open Access Journals (Sweden)

    McManus Donald P

    2009-03-01

    Full Text Available Abstract Background The schistosome blood flukes are complex trematodes and cause a chronic parasitic disease of significant public health importance worldwide, schistosomiasis. Their life cycle is characterised by distinct parasitic and free-living phases involving mammalian and snail hosts and freshwater. Microarray analysis was used to profile developmental gene expression in the Asian species, Schistosoma japonicum. Total RNAs were isolated from the three distinct environmental phases of the lifecycle – aquatic/snail (eggs, miracidia, sporocysts, cercariae, juvenile (lung schistosomula and paired but pre-egg laying adults and adult (paired, mature males and egg-producing females, both examined separately. Advanced analyses including ANOVA, principal component analysis, and hierarchal clustering provided a global synopsis of gene expression relationships among the different developmental stages of the schistosome parasite. Results Gene expression profiles were linked to the major environmental settings through which the developmental stages of the fluke have to adapt during the course of its life cycle. Gene ontologies of the differentially expressed genes revealed a wide range of functions and processes. In addition, stage-specific, differentially expressed genes were identified that were involved in numerous biological pathways and functions including calcium signalling, sphingolipid metabolism and parasite defence. Conclusion The findings provide a comprehensive database of gene expression in an important human pathogen, including transcriptional changes in genes involved in evasion of the host immune response, nutrient acquisition, energy production, calcium signalling, sphingolipid metabolism, egg production and tegumental function during development. This resource should help facilitate the identification and prioritization of new anti-schistosome drug and vaccine targets for the control of schistosomiasis.

  6. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  7. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    Energy Technology Data Exchange (ETDEWEB)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.

  8. Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.

    Directory of Open Access Journals (Sweden)

    Xiao-Jian Sun

    Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.

  9. Crosstalk between histone modifications maintains the developmental pattern of gene expression on a tissue-specific locus.

    Science.gov (United States)

    Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie

    2010-05-16

    Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.

  10. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  11. Robustness and accuracy in sea urchin developmental gene regulatory networks

    Directory of Open Access Journals (Sweden)

    Smadar eBen-Tabou De-Leon

    2016-02-01

    Full Text Available Developmental gene regulatory networks robustly control the timely activation of regulatory and differentiation genes. The structure of these networks underlies their capacity to buffer intrinsic and extrinsic noise and maintain embryonic morphology. Here I illustrate how the use of specific architectures by the sea urchin developmental regulatory networks enables the robust control of cell fate decisions. The Wnt-βcatenin signaling pathway patterns the primary embryonic axis while the BMP signaling pathway patterns the secondary embryonic axis in the sea urchin embryo and across bilateria. Interestingly, in the sea urchin in both cases, the signaling pathway that defines the axis controls directly the expression of a set of downstream regulatory genes. I propose that this direct activation of a set of regulatory genes enables a uniform regulatory response and a clear cut cell fate decision in the endoderm and in the dorsal ectoderm. The specification of the mesodermal pigment cell lineage is activated by Delta signaling that initiates a triple positive feedback loop that locks down the pigment specification state. I propose that the use of compound positive feedback circuitry provides the endodermal cells enough time to turn off mesodermal genes and ensures correct mesoderm vs. endoderm fate decision. Thus, I argue that understanding the control properties of repeatedly used regulatory architectures illuminates their role in embryogenesis and provides possible explanations to their resistance to evolutionary change.

  12. Spatiotemporal network motif reveals the biological traits of developmental gene regulatory networks in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Kim Man-Sun

    2012-05-01

    Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.

  13. Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

    Directory of Open Access Journals (Sweden)

    Jinyi Liu

    Full Text Available Growth regulating factors (GRFs are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

  14. Atrial natriuretic peptide regulates Ca channel in early developmental cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Lin Miao

    Full Text Available BACKGROUND: Cardiomyocytes derived from murine embryonic stem (ES cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP in regulation of membrane potentials and Ca(2+ currents has not been investigated in developmental cardiomyocytes. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the role of ANP in regulating L-type Ca(2+ channel current (I(CaL in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs in early developmental stage (EDS cardiomyocytes, embryonic bodies (EB as well as whole embryo hearts. ANP exerted an inhibitory effect on basal I(CaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS cells. However, after stimulation of I(CaL by isoproterenol (ISO in LDS cells, ANP inhibited the response in about 70% cells. The depression of I(CaL induced by ANP was not affected by either Nomega, Nitro-L-Arginine methyl ester (L-NAME, a nitric oxide synthetase (NOS inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG selective inhibitor, in either EDS and LDS cells; whereas depression of I(CaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl adenine (EHNA, a selective inhibitor of type 2 phosphodiesterase(PDE2 in most cells tested. CONCLUSION/SIGNIFICANCES: Taken together, these results indicate that ANP induced depression of action potentials and I(CaL is due to activation of particulate guanylyl cyclase (GC, cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3', 5'-cyclic monophophate (cAMP-cAMP-dependent protein kinase (PKA in early cardiomyogenesis.

  15. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  16. Developmental programming: impact of prenatal testosterone excess on pre- and postnatal gonadotropin regulation in sheep.

    Science.gov (United States)

    Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha

    2008-04-01

    The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.

  17. Transcriptome profiles of embryos before and after cleavage in Eriocheir sinensis: identification of developmental genes at the earliest stages

    Science.gov (United States)

    Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen

    2017-07-01

    In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.

  18. Developmental delays in emotion regulation strategies in preschoolers with autism.

    Science.gov (United States)

    Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl

    2017-11-01

    Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These

  19. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2004-12-31

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  20. Signal Transduction Pathways that Regulate CAB Gene Expression

    Energy Technology Data Exchange (ETDEWEB)

    Chory, Joanne

    2006-01-16

    The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.

  1. Activity-regulated genes as mediators of neural circuit plasticity.

    Science.gov (United States)

    Leslie, Jennifer H; Nedivi, Elly

    2011-08-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Identification of let-7-regulated oncofetal genes

    DEFF Research Database (Denmark)

    Boyerinas, Benjamin; Park, Sun-Mi; Shomron, Noam

    2008-01-01

    -regulated at the end of embryonic development. Let-7 is often down-regulated early during cancer development, suggesting that let-7-regulated oncofetal genes (LOG) may become reexpressed in cancer cells. Using comparative bioinformatics, we have identified 12 conserved LOGs that include HMGA2 and IMP-1/CRD-BP. IMP-1...

  3. Let-7 microRNAs are developmentally regulated in circulating human erythroid cells

    Directory of Open Access Journals (Sweden)

    Reed Christopher

    2009-11-01

    Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.

  4. Identification and Transcription Profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): Developmental Regulation and Environmental Response

    Science.gov (United States)

    2014-12-18

    Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation and environmental response...7205 Email lmzhao@ufl.edu Abstract: The cDNA of a NADH dehydrogenase-ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus...information useful for developing dsRNA pesticide for mosquito control. Keywords: Aedes taeniorhynchus, AetNDUFS8, mRNA expression, development

  5. The ribonuclease Dis3 is an essential regulator of the developmental transcriptome

    Directory of Open Access Journals (Sweden)

    Hou Dezhi

    2012-08-01

    Full Text Available Abstract Background Dis3 is ribonuclease that acts directly in the processing, turnover, and surveillance of a large number of distinct RNA species. Evolutionarily conserved from eubacteria to eukaryotes and a crucial component of the RNA processing exosome, Dis3 has been shown to be essential in yeast and fly S2 cells. However, it is not known whether Dis3 has essential functions in a metazoan. This study inquires whether Dis3 is required for Drosophila development and viability and how Dis3 regulates the transcriptome in the developing fly. Results Using transgenic flies, we show that Dis3 knock down (Dis3KD retards growth, induces melanotic tumor formation, and ultimately results in 2nd instar larval lethality. In order to determine whether Dis3KD fly phenotypes were a consequence of disrupting developmentally regulated RNA turnover, we performed RNA deep sequencing analysis on total RNA isolated from developmentally staged animals. Bioinformatic analysis of transcripts from Dis3KD flies reveals substantial transcriptomic changes, most notably down-regulation in early expressed RNAs. Finally, gene ontology analysis of this early stage shows that Dis3 regulates transcripts related to extracellular structure and remodelling, neurogenesis, and nucleotide metabolism. Conclusions We conclude that Dis3 is essential for early Drosophila melanogaster development and has specific and important stage-specific roles in regulating RNA metabolism. In showing for the first time that Dis3 is required for the development of a multicellular organism, our work provides mechanistic insight into how Dis3—either independent of or associated with the RNA processing exosome—participates in cell type-specific RNA turnover in metazoan development.

  6. Combinatorial gene regulation in Plasmodium falciparum.

    NARCIS (Netherlands)

    Noort, V. van; Huynen, M.A.

    2006-01-01

    The malaria parasite Plasmodium falciparum has a complicated life cycle with large variations in its gene expression pattern, but it contains relatively few specific transcriptional regulators. To elucidate this paradox, we identified regulatory sequences, using an approach that integrates the

  7. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  8. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1.

    Directory of Open Access Journals (Sweden)

    Christopher Terranova

    Full Text Available Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development.

  9. Tomato Fruits Show Wide Phenomic Diversity but Fruit Developmental Genes Show Low Genomic Diversity.

    Directory of Open Access Journals (Sweden)

    Vijee Mohan

    Full Text Available Domestication of tomato has resulted in large diversity in fruit phenotypes. An intensive phenotyping of 127 tomato accessions from 20 countries revealed extensive morphological diversity in fruit traits. The diversity in fruit traits clustered the accessions into nine classes and identified certain promising lines having desirable traits pertaining to total soluble salts (TSS, carotenoids, ripening index, weight and shape. Factor analysis of the morphometric data from Tomato Analyzer showed that the fruit shape is a complex trait shared by several factors. The 100% variance between round and flat fruit shapes was explained by one discriminant function having a canonical correlation of 0.874 by stepwise discriminant analysis. A set of 10 genes (ACS2, COP1, CYC-B, RIN, MSH2, NAC-NOR, PHOT1, PHYA, PHYB and PSY1 involved in various plant developmental processes were screened for SNP polymorphism by EcoTILLING. The genetic diversity in these genes revealed a total of 36 non-synonymous and 18 synonymous changes leading to the identification of 28 haplotypes. The average frequency of polymorphism across the genes was 0.038/Kb. Significant negative Tajima'D statistic in two of the genes, ACS2 and PHOT1 indicated the presence of rare alleles in low frequency. Our study indicates that while there is low polymorphic diversity in the genes regulating plant development, the population shows wider phenotype diversity. Nonetheless, morphological and genetic diversity of the present collection can be further exploited as potential resources in future.

  10. Developmental regulation of human truncated nerve growth factor receptor

    Energy Technology Data Exchange (ETDEWEB)

    DiStefano, P.S.; Clagett-Dame, M.; Chelsea, D.M.; Loy, R. (Abbott Laboratories, Abbott Park, IL (USA))

    1991-01-01

    Monoclonal antibodies (designated XIF1 and IIIG5) recognizing distinct epitopes of the human truncated nerve growth factor receptor (NGF-Rt) were used in a two-site radiometric immunosorbent assay to monitor levels of NGF-Rt in human urine as a function of age. Urine samples were collected from 70 neurologically normal subjects ranging in age from 1 month to 68 years. By using this sensitive two-site radiometric immunosorbent assay, NGF-Rt levels were found to be highest in urine from 1-month old subjects. By 2.5 months, NGF-Rt values were half of those seen at 1 month and decreased more gradually between 0.5 and 15 years. Between 15 and 68 years, urine NGF-Rt levels were relatively constant at 5% of 1-month values. No evidence for diurnal variation of adult NGF-Rt was apparent. Pregnant women in their third trimester showed significantly elevated urine NGF-Rt values compared with age-matched normals. Affinity labeling of NGF-Rt with 125I-NGF followed by immunoprecipitation with ME20.4-IgG and gel autoradiography indicated that neonatal urine contained high amounts of truncated receptor (Mr = 50 kd); decreasingly lower amounts of NGF-Rt were observed on gel autoradiograms with development, indicating that the two-site radiometric immunosorbent assay correlated well with the affinity labeling technique for measuring NGF-Rt. NGF-Rt in urines from 1-month-old and 36-year-old subjects showed no differences in affinities for NGF or for the monoclonal antibody IIIG5. These data show that NGF-Rt is developmentally regulated in human urine, and are discussed in relation to the development and maturation of the peripheral nervous system.

  11. Developmental regulation of human truncated nerve growth factor receptor

    International Nuclear Information System (INIS)

    DiStefano, P.S.; Clagett-Dame, M.; Chelsea, D.M.; Loy, R.

    1991-01-01

    Monoclonal antibodies (designated XIF1 and IIIG5) recognizing distinct epitopes of the human truncated nerve growth factor receptor (NGF-Rt) were used in a two-site radiometric immunosorbent assay to monitor levels of NGF-Rt in human urine as a function of age. Urine samples were collected from 70 neurologically normal subjects ranging in age from 1 month to 68 years. By using this sensitive two-site radiometric immunosorbent assay, NGF-Rt levels were found to be highest in urine from 1-month old subjects. By 2.5 months, NGF-Rt values were half of those seen at 1 month and decreased more gradually between 0.5 and 15 years. Between 15 and 68 years, urine NGF-Rt levels were relatively constant at 5% of 1-month values. No evidence for diurnal variation of adult NGF-Rt was apparent. Pregnant women in their third trimester showed significantly elevated urine NGF-Rt values compared with age-matched normals. Affinity labeling of NGF-Rt with 125I-NGF followed by immunoprecipitation with ME20.4-IgG and gel autoradiography indicated that neonatal urine contained high amounts of truncated receptor (Mr = 50 kd); decreasingly lower amounts of NGF-Rt were observed on gel autoradiograms with development, indicating that the two-site radiometric immunosorbent assay correlated well with the affinity labeling technique for measuring NGF-Rt. NGF-Rt in urines from 1-month-old and 36-year-old subjects showed no differences in affinities for NGF or for the monoclonal antibody IIIG5. These data show that NGF-Rt is developmentally regulated in human urine, and are discussed in relation to the development and maturation of the peripheral nervous system

  12. Posttranscriptional Regulation of the Neurofibromatosis 2 Gene

    Science.gov (United States)

    2006-07-01

    signaling and division were downregulated, including an apoptosis - related, putative tumor suppressor gene, LUCA-15, which was downregulated in seven of... embryologically from the outgrowth of the developing brain (Martinez-Morales et al., 2004). It is comprised of two major layers, the inner layer (prospective...eight genes involved with cell signaling and division were down- regulated. These include an apoptosis -related, putative tumor suppressor gene LUCA-15

  13. [Regulation of heat shock gene expression in response to stress].

    Science.gov (United States)

    Garbuz, D G

    2017-01-01

    Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

  14. Neonatal maternal deprivation response and developmental changes in gene expression revealed by hypothalamic gene expression profiling in mice.

    Directory of Open Access Journals (Sweden)

    Feng Ding

    Full Text Available Neonatal feeding problems are observed in several genetic diseases including Prader-Willi syndrome (PWS. Later in life, individuals with PWS develop hyperphagia and obesity due to lack of appetite control. We hypothesized that failure to thrive in infancy and later-onset hyperphagia are related and could be due to a defect in the hypothalamus. In this study, we performed gene expression microarray analysis of the hypothalamic response to maternal deprivation in neonatal wild-type and Snord116del mice, a mouse model for PWS in which a cluster of imprinted C/D box snoRNAs is deleted. The neonatal starvation response in both strains was dramatically different from that reported in adult rodents. Genes that are affected by adult starvation showed no expression change in the hypothalamus of 5 day-old pups after 6 hours of maternal deprivation. Unlike in adult rodents, expression levels of Nanos2 and Pdk4 were increased, and those of Pgpep1, Ndp, Brms1l, Mett10d, and Snx1 were decreased after neonatal deprivation. In addition, we compared hypothalamic gene expression profiles at postnatal days 5 and 13 and observed significant developmental changes. Notably, the gene expression profiles of Snord116del deletion mice and wild-type littermates were very similar at all time points and conditions, arguing against a role of Snord116 in feeding regulation in the neonatal period.

  15. A single cis element maintains repression of the key developmental regulator Gata2.

    Directory of Open Access Journals (Sweden)

    Jonathan W Snow

    2010-09-01

    Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.

  16. Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

    Science.gov (United States)

    Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

    2002-09-01

    Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

  17. Sex-specific mouse liver gene expression: genome-wide analysis of developmental changes from pre-pubertal period to young adulthood

    Directory of Open Access Journals (Sweden)

    Conforto Tara L

    2012-04-01

    Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.

  18. CFP1 Regulates Histone H3K4 Trimethylation and Developmental Potential in Mouse Oocytes

    Directory of Open Access Journals (Sweden)

    Chao Yu

    2017-08-01

    Full Text Available Trimethylation of histone H3 at lysine-4 (H3K4me3 is associated with eukaryotic gene promoters and poises their transcriptional activation during development. To examine the in vivo function of H3K4me3 in the absence of DNA replication, we deleted CXXC finger protein 1 (CFP1, the DNA-binding subunit of the SETD1 histone H3K4 methyltransferase, in developing oocytes. We find that CFP1 is required for H3K4me3 accumulation and the deposition of histone variants onto chromatin during oocyte maturation. Decreased H3K4me3 in oocytes caused global downregulation of transcription activity. Oocytes lacking CFP1 failed to complete maturation and were unable to gain developmental competence after fertilization, due to defects in cytoplasmic lattice formation, meiotic division, and maternal-zygotic transition. Our study highlights the importance of H3K4me3 in continuous histone replacement for transcriptional regulation, chromatin remodeling, and normal developmental progression in a non-replicative system.

  19. The expression of petunia strigolactone pathway genes is altered as part of the endogenous developmental program

    Directory of Open Access Journals (Sweden)

    Revel S M Drummond

    2012-01-01

    Full Text Available Analysis of mutants with increased branching has revealed the strigolactone synthesis/perception pathway which regulates branching in plants. However, whether variation in this well conserved developmental signalling system contributes to the unique plant architectures of different species is yet to be determined. We examined petunia orthologues of the Arabidopsis MAX1 and MAX2 genes to characterise their role in petunia architecture. A single orthologue of MAX1, PhMAX1 which encodes a cytochrome P450, was identified and was able to complement the max1 mutant of Arabidopsis. Petunia has two copies of the MAX2 gene, PhMAX2A and PhMAX2B which encode F-Box proteins. Differences in the transcript levels of these two MAX2-like genes suggest diverging functions. Unlike PhMAX2B, PhMAX2A mRNA levels increase as leaves age. Nonetheless, this gene functionally complements the Arabidopsis max2 mutant indicating that the biochemical activity of the PhMAX2A protein is not significantly different from MAX2. The expression of the petunia strigolactone pathway genes (PhCCD7, PhCCD8, PhMAX1, PhMAX2A, and PhMAX2B was then further investigated throughout the development of wild-type petunia plants. Three of these genes showed changes in mRNA levels over the development series. Alterations to the expression of these genes over time, or in different regions of the plant, may influence the branching growth habit of the plant. Alterations to strigolactone production and/or sensitivity could allow both subtle and dramatic changes to branching within and between species.

  20. Developmentally regulated sesquiterpene production confers resistance to Colletotrichum gloeosporioides in ripe pepper fruits.

    Directory of Open Access Journals (Sweden)

    Sangkyu Park

    Full Text Available Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR and squalene synthase (SS genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS, belonging to a sesquiterpene cyclase (STC family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA, resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits.

  1. Contextual emotion regulation therapy: a developmentally based intervention for pediatric depression.

    Science.gov (United States)

    Kovacs, Maria; Lopez-Duran, Nestor L

    2012-04-01

    For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.

  2. Detection of genes associated with developmental competence of bovine oocytes

    Czech Academy of Sciences Publication Activity Database

    Němcová, Lucie; Jansová, Denisa; Vodičková Kepková, Kateřina; Vodička, Petr; Jeseta, M.; Machatková, M.; Kaňka, Jiří

    2016-01-01

    Roč. 166, č. 1 (2016), s. 58-71 ISSN 0378-4320 Institutional support: RVO:67985904 Keywords : oocyte * embryo * bovine * developmental competence * transcription Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.605, year: 2016

  3. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  4. Developmentally regulated expression and complex processing of barley pri-microRNAs

    Directory of Open Access Journals (Sweden)

    Kruszka Katarzyna

    2013-01-01

    Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression via mRNA cleavage or translation inhibition. In spite of barley being a cereal of great economic importance, very little data is available concerning its miRNA biogenesis. There are 69 barley miRNA and 67 pre-miRNA sequences available in the miRBase (release 19. However, no barley pri-miRNA and MIR gene structures have been shown experimentally. In the present paper, we examine the biogenesis of selected barley miRNAs and the developmental regulation of their pri-miRNA processing to learn more about miRNA maturation in barely. Results To investigate the organization of barley microRNA genes, nine microRNAs - 156g, 159b, 166n, 168a-5p/168a-3p, 171e, 397b-3p, 1120, and 1126 - were selected. Two of the studied miRNAs originate from one MIR168a-5p/168a-3p gene. The presence of all miRNAs was confirmed using a Northern blot approach. The miRNAs are encoded by genes with diverse organizations, representing mostly independent transcription units with or without introns. The intron-containing miRNA transcripts undergo complex splicing events to generate various spliced isoforms. We identified miRNAs that were encoded within introns of the noncoding genes MIR156g and MIR1126. Interestingly, the intron that encodes miR156g is spliced less efficiently than the intron encoding miR1126 from their specific precursors. miR397b-3p was detected in barley as a most probable functional miRNA, in contrast to rice where it has been identified as a complementary partner miRNA*. In the case of miR168a-5p/168a-3p, we found the generation of stable, mature molecules from both pre-miRNA arms, confirming evolutionary conservation of the stability of both species, as shown in rice and maize. We suggest that miR1120, located within the 3′ UTR of a protein-coding gene and described as a functional miRNA in wheat, may represent a siRNA generated from a mariner-like transposable element. Conclusions Seven of the

  5. RNAi Screen in Drosophila melanogastor Identifies Regulators of Steroidogenesis and Developmental Maturation

    DEFF Research Database (Denmark)

    Danielsen, Erik Thomas

    and duration required for juvenile-adult transition. This PhD project demonstrates the power of Drosophila genetics by taking an in vivo genome-wide RNAi screening approach to uncover genes required for the function of steroid producing tissue and developmental maturation. In total, 1909 genes were found...... to be required for the prothoracic gland function and affected the developmental timing for the juvenile-adult transition. Among the screen hits, we focused on an uncharacterized gene, sit (CG5278), which is highly expressed in the gland and is required for ecdysone production. Sit is a homolog of mammalian very...... flux of cholesterol uptake in the gland cells and affected the endosomal trafficking. Therefore this gene was suggested to be named stuck in traffic (sit). Sit’s role in cholesterol uptake was also supported by the observation that the developmental delayed phenotype from loss of sit expression...

  6. Developmental and genetic modulation of arsenic biotransformation: A gene by environment interaction?

    International Nuclear Information System (INIS)

    Meza, Mercedes; Gandolfi, A. Jay; Klimecki, Walter T.

    2007-01-01

    The complexity of arsenic toxicology has confounded the identification of specific pathways of disease causation. One focal point of arsenic research is aimed at fully characterizing arsenic biotransformation in humans, a process that appears to be quite variable, producing a mixture of several arsenic species with greatly differing toxic potencies. In an effort to characterize genetic determinants of variability in arsenic biotransformation, a genetic association study of 135 subjects in western Sonora, Mexico was performed by testing 23 polymorphic sites in three arsenic biotransformation candidate genes. One gene, arsenic 3 methyltransferase (AS3MT), was strongly associated with the ratio of urinary dimethylarsinic acid to monomethylarsonic acid (D/M) in children (7-11 years) but not in adults (18-79 years). Subsequent analyses revealed that the high D/M values associated with variant AS3MT alleles were primarily due to lower levels of monomethylarsonic acid as percent of total urinary arsenic (%MMA5). In light of several reports of arsenic-induced disease being associated with relatively high %MMA5 levels, these findings raise the possibility that variant AS3MT individuals may suffer less risk from arsenic exposure than non-variant individuals. These analyses also provide evidence that, in this population, regardless of AS3MT variant status, children tend to have lower %MMA5 values than adults, suggesting that the global developmental regulation of arsenic biotransformation may interact with genetic variants in metabolic genes to result in novel genetic effects such as those in this report

  7. Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks.

    Science.gov (United States)

    Mai, Hans-Jörg; Pateyron, Stéphanie; Bauer, Petra

    2016-10-03

    FIT (FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR) is the central regulator of iron uptake in Arabidopsis thaliana roots. We performed transcriptome analyses of six day-old seedlings and roots of six week-old plants using wild type, a fit knock-out mutant and a FIT over-expression line grown under iron-sufficient or iron-deficient conditions. We compared genes regulated in a FIT-dependent manner depending on the developmental stage of the plants. We assembled a high likelihood dataset which we used to perform co-expression and functional analysis of the most stably iron deficiency-induced genes. 448 genes were found FIT-regulated. Out of these, 34 genes were robustly FIT-regulated in root and seedling samples and included 13 novel FIT-dependent genes. Three hundred thirty-one genes showed differential regulation in response to the presence and absence of FIT only in the root samples, while this was the case for 83 genes in the seedling samples. We assembled a virtual dataset of iron-regulated genes based on a total of 14 transcriptomic analyses of iron-deficient and iron-sufficient wild-type plants to pinpoint the best marker genes for iron deficiency and analyzed this dataset in depth. Co-expression analysis of this dataset revealed 13 distinct regulons part of which predominantly contained functionally related genes. We could enlarge the list of FIT-dependent genes and discriminate between genes that are robustly FIT-regulated in roots and seedlings or only in one of those. FIT-regulated genes were mostly induced, few of them were repressed by FIT. With the analysis of a virtual dataset we could filter out and pinpoint new candidates among the most reliable marker genes for iron deficiency. Moreover, co-expression and functional analysis of this virtual dataset revealed iron deficiency-induced and functionally distinct regulons.

  8. Regulation of signaling genes by TGFβ during entry into dauer diapause in C. elegans

    Directory of Open Access Journals (Sweden)

    Patterson Garth I

    2004-09-01

    Full Text Available Abstract Background When resources are scant, C. elegans larvae arrest as long-lived dauers under the control of insulin/IGF- and TGFβ-related signaling pathways. However, critical questions remain regarding the regulation of this developmental event. How do three dozen insulin-like proteins regulate one tyrosine kinase receptor to control complex events in dauer, metabolism and aging? How are signals from the TGFβ and insulin/IGF pathways integrated? What gene expression programs do these pathways regulate, and how do they control complex downstream events? Results We have identified genes that show different levels of expression in a comparison of wild-type L2 or L3 larvae (non-dauer to TGFβ mutants at similar developmental stages undergoing dauer formation. Many insulin/IGF pathway and other known dauer regulatory genes have changes in expression that suggest strong positive feedback by the TGFβ pathway. In addition, many insulin-like ligand and novel genes with similarity to the extracellular domain of insulin/IGF receptors have altered expression. We have identified a large group of regulated genes with putative binding sites for the FOXO transcription factor, DAF-16. Genes with DAF-16 sites upstream of the transcription start site tend to be upregulated, whereas genes with DAF-16 sites downstream of the coding region tend to be downregulated. Finally, we also see strong regulation of many novel hedgehog- and patched-related genes, hormone biosynthetic genes, cell cycle genes, and other regulatory genes. Conclusions The feedback regulation of insulin/IGF pathway and other dauer genes that we observe would be predicted to amplify signals from the TGFβ pathway; this amplification may serve to ensure a decisive choice between "dauer" and "non-dauer", even if environmental cues are ambiguous. Up and down regulation of insulin-like ligands and novel genes with similarity to the extracellular domain of insulin/IGF receptors suggests opposing

  9. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues.

    Directory of Open Access Journals (Sweden)

    Daifeng Cheng

    Full Text Available To accurately assess gene expression levels, it is essential to normalize real-time quantitative PCR (RT-qPCR data with suitable internal reference genes. For the red imported fire ant, Solenopsis invicta, reliable reference genes to assess the transcript expression levels of the target genes have not been previously investigated. In this study, we examined the expression levels of five candidate reference genes (rpl18, ef1-beta, act, GAPDH, and tbp in different developmental stages, castes and tissues of S. invicta. To evaluate the suitability of these genes as endogenous controls, three software-based approaches (geNorm, BestKeeper and NormFinder and one web-based comprehensive tool (RefFinder were used to analyze and rank the tested genes. Furthermore, the optimal number of reference gene(s was determined by the pairwise variation value. Our data showed that two of the five candidate genes, rpl18 and ef1-beta, were the most suitable reference genes because they have the most stable expression among different developmental stages, castes and tissues in S. invicta. Although widely used as reference gene in other species, in S. invicta the act gene has high variation in expression and was consequently excluded as a reliable reference gene. The two validated reference genes, rpl18 and ef1-beta, can be widely used for quantification of target gene expression with RT-qPCR technology in S. invicta.

  10. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  11. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    Science.gov (United States)

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  12. Driving Skills of Young Adults with Developmental Coordination Disorder: Regulating Speed and Coping with Distraction

    Science.gov (United States)

    de Oliveira, Rita F.; Wann, John P.

    2011-01-01

    In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…

  13. The conserved splicing factor SUA controls alternative splicing of the developmental regulator ABI3 in Arabidopsis.

    NARCIS (Netherlands)

    Sugliani, M.; Brambilla, V.; Clerkx, E.J.M.; Koornneef, M.; Soppe, W.J.J.

    2010-01-01

    ABSCISIC ACID INSENSITIVE3 (ABI3) is a major regulator of seed maturation in Arabidopsis thaliana. We detected two ABI3 transcripts, ABI3- and ABI3-ß, which encode full-length and truncated proteins, respectively. Alternative splicing of ABI3 is developmentally regulated, and the ABI3-ß transcript

  14. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    Science.gov (United States)

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  15. Regulation of Gene Expression in Protozoa Parasites

    Directory of Open Access Journals (Sweden)

    Consuelo Gomez

    2010-01-01

    Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  16. Regulation of gene expression in protozoa parasites.

    Science.gov (United States)

    Gomez, Consuelo; Esther Ramirez, M; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  17. Regulation of somatic embryo development in Norway spruce (Picea abies). A molecular approach to the characterization of specific developmental stages

    Energy Technology Data Exchange (ETDEWEB)

    Sabala, I. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics

    1998-12-31

    Embryo development is a complex process involving a set of strictly regulated events. The regulation of these events is poorly understood especially during the early stages of embryo development. Somatic embryos go through the same developmental stages as zygotic embryos making them an ideal model system for studying the regulation of embryo development. We have used embryogenic cultures of Picea abies to study some aspects of the regulation of embryo development in gymnosperms. The bottle neck during somatic embryogenesis is the switch from the proliferation stage to the maturation stage. This switch is initiated by giving somatic embryos a maturation treatment i.e. the embryos are treated with abscisic acid (ABA). Somatic embryos which respond to ABA by forming mature somatic embryos were stimulated to secret a 70 kDa protein, AF70. The af70 gene was isolated and characterised. The expression of the af70 gene was constitutive in embryos but was highly ABA-induced in seedlings. Moreover, expression of this gene was stimulated during cold acclimation of Picea abies seedlings. A full length Picea abies cDNA clone Pa18, encoding a protein with the characteristics of plant lipid transfer proteins (LTPs), was isolated and characterised. The Pa18 gene is constitutively expressed in embryogenic cultures of Picea abies representing different stages of development as well as in nonembryogenic callus and seedlings. In situ hybridization showed that Pa18 gene is expressed in all embryonic cells of proliferating somatic embryos but the expression of the gene in mature somatic and zygotic embryos is restricted to the outer cell layer. Southern blot analysis at different stringencies was consistent with a single gene. An alteration in expression of Pa18 causes disturbance in the formation of the proper outer cell layer in the maturing somatic embryos. In addition to its influence on embryo development the Pa18 gene product also inhibits growth of Agrobacterium tumefaciens 195

  18. BMP signaling in the human fetal ovary is developmentally regulated and promotes primordial germ cell apoptosis.

    Science.gov (United States)

    Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A

    2010-08-01

    Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.

  19. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  20. The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

    Science.gov (United States)

    Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

    2013-09-01

    The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

  1. Gene expression regulation in photomorphogenesis from the perspective of the central dogma.

    Science.gov (United States)

    Wu, Shu-Hsing

    2014-01-01

    Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.

  2. Regulation of methane genes and genome expression

    Energy Technology Data Exchange (ETDEWEB)

    John N. Reeve

    2009-09-09

    At the start of this project, it was known that methanogens were Archaeabacteria (now Archaea) and were therefore predicted to have gene expression and regulatory systems different from Bacteria, but few of the molecular biology details were established. The goals were then to establish the structures and organizations of genes in methanogens, and to develop the genetic technologies needed to investigate and dissect methanogen gene expression and regulation in vivo. By cloning and sequencing, we established the gene and operon structures of all of the “methane” genes that encode the enzymes that catalyze methane biosynthesis from carbon dioxide and hydrogen. This work identified unique sequences in the methane gene that we designated mcrA, that encodes the largest subunit of methyl-coenzyme M reductase, that could be used to identify methanogen DNA and establish methanogen phylogenetic relationships. McrA sequences are now the accepted standard and used extensively as hybridization probes to identify and quantify methanogens in environmental research. With the methane genes in hand, we used northern blot and then later whole-genome microarray hybridization analyses to establish how growth phase and substrate availability regulated methane gene expression in Methanobacterium thermautotrophicus ΔH (now Methanothermobacter thermautotrophicus). Isoenzymes or pairs of functionally equivalent enzymes catalyze several steps in the hydrogen-dependent reduction of carbon dioxide to methane. We established that hydrogen availability determine which of these pairs of methane genes is expressed and therefore which of the alternative enzymes is employed to catalyze methane biosynthesis under different environmental conditions. As were unable to establish a reliable genetic system for M. thermautotrophicus, we developed in vitro transcription as an alternative system to investigate methanogen gene expression and regulation. This led to the discovery that an archaeal protein

  3. Developmental expression of "germline"- and "sex determination"-related genes in the ctenophore Mnemiopsis leidyi.

    Science.gov (United States)

    Reitzel, Adam M; Pang, Kevin; Martindale, Mark Q

    2016-01-01

    An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The "germline" genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of "germline genes," which are areas of high cell proliferation, suggesting that these genes are involved with "stem cell" specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for expression in future gametogenic regions of the adult. We also

  4. Importance of globin gene order for correct developmental expression.

    NARCIS (Netherlands)

    O. Hanscombe (Olivia); D. Whyatt (David); P.J. Fraser (Peter); N. Yannoutsos (Nikos); D.R. Greaves (David); N.O. Dillon (Niall); F.G. Grosveld (Frank)

    1991-01-01

    textabstractWe have used transgenic mice to study the influence of position of the human globin genes relative to the locus control region (LCR) on their expression pattern during development. The LCR, which is located 5' of the globin gene cluster, is normally required for the activation of all the

  5. P63 gene mutations and human developmental syndromes.

    NARCIS (Netherlands)

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van

    2002-01-01

    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  6. Genome-wide Analysis of Gene Regulation

    DEFF Research Database (Denmark)

    Chen, Yun

    to protein: through epigenetic modifications, transcription regulators or post-transcriptional controls. The following papers concern several layers of gene regulation with questions answered by different HTS approaches. Genome-wide screening of epigenetic changes by ChIP-seq allowed us to study both spatial...... and temporal alterations of histone modifications (Papers I and II). Coupling the data with machine learning approaches, we established a prediction framework to assess the most informative histone marks as well as their most influential nucleosome positions in predicting the promoter usages. (Papers I...... they regulated or if the sites had global elevated usage rates by multiple TFs. Using RNA-seq, 5’end-seq in combination with depletion of 5’exonuclease as well as nonsensemediated decay (NMD) factors, we systematically analyzed NMD substrates as well as their degradation intermediates in human cells (Paper V...

  7. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    Science.gov (United States)

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  8. Cis-regulatory timers for developmental gene expression.

    Directory of Open Access Journals (Sweden)

    Lionel Christiaen

    2013-10-01

    Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

  9. Hemodynamic forces regulate developmental patterning of atrial conduction.

    Directory of Open Access Journals (Sweden)

    Michael C Bressan

    Full Text Available Anomalous action potential conduction through the atrial chambers of the heart can lead to severe cardiac arrhythmia. To date, however, little is known regarding the mechanisms that pattern proper atrial conduction during development. Here we demonstrate that atrial muscle functionally diversifies into at least two heterogeneous subtypes, thin-walled myocardium and rapidly conducting muscle bundles, during a developmental window just following cardiac looping. During this process, atrial muscle bundles become enriched for the fast conduction markers Cx40 and Nav1.5, similar to the precursors of the fast conduction Purkinje fiber network located within the trabeculae of the ventricles. In contrast to the ventricular trabeculae, however, atrial muscle bundles display an increased proliferation rate when compared to the surrounding myocardium. Interestingly, mechanical loading of the embryonic atrial muscle resulted in an induction of Cx40, Nav1.5 and the cell cycle marker Cyclin D1, while decreasing atrial pressure via in vivo ligation of the vitelline blood vessels results in decreased atrial conduction velocity. Taken together, these data establish a novel model for atrial conduction patterning, whereby hemodynamic stretch coordinately induces proliferation and fast conduction marker expression, which in turn promotes the formation of large diameter muscle bundles to serve as preferential routes of conduction.

  10. Developmental regulation of aromatase activity in the rat hypothalamus

    International Nuclear Information System (INIS)

    Lephart, E.D.

    1989-01-01

    The brain of all mammalian species studied thus far contain an enzymatic activity (aromatase) that catalyzes the conversion of androgens to estrogens. The activity is highest during prenatal development and contributes to the establishment of sex differences which determine adult gonadotropin secretion patterns and reproductive behavior. The studies presented in this dissertation represent a systematic effort to elucidate the mechanism(s) that control the initiation of and contribute to maintaining rat hypothalamic aromatase activity during pre- and postnatal development. Aromatase enzyme activity was measured by the 3 H 2 O release assay or by traditional estrogen product isolation. Brain aromatase mRNA was detected by hybridization to a cDNA encoding rat aromatase cytochrome P-450. In both males and females the time of puberty was associated with a decline in hypothalamic aromatase activity. This decline may represent a factor underlying the peri-pubertal decrease in the sensitivity to gonadal steroid feedback that accompanies completion of puberty. The results also indicate that androgens regulate brain aromatase levels during both the prepubertal and peri-pubertal stages of sexual development and that this regulation is transiently lost in young adults. Utilizing a hypothalamic organotypic culture system, aromatase activity in vitro was maintained for as long as two days. The results of studies of a variety of hormonal and metabolic regulators suggest that prenatal aromatase activity is regulated by factor(s) that function independently from the classical cyclic AMP and protein kinase C trans-membrane signaling pathways

  11. Zfp206 regulates ES cell gene expression and differentiation.

    Science.gov (United States)

    Zhang, Wen; Walker, Emily; Tamplin, Owen J; Rossant, Janet; Stanford, William L; Hughes, Timothy R

    2006-01-01

    Understanding transcriptional regulation in early developmental stages is fundamental to understanding mammalian development and embryonic stem (ES) cell properties. Expression surveys suggest that the putative SCAN-Zinc finger transcription factor Zfp206 is expressed specifically in ES cells [Zhang,W., Morris,Q.D., Chang,R., Shai,O., Bakowski,M.A., Mitsakakis,N., Mohammad,N., Robinson,M.D., Zirngibl,R., Somogyi,E. et al., (2004) J. Biol., 3, 21; Brandenberger,R., Wei,H., Zhang,S., Lei,S., Murage,J., Fisk,G.J., Li,Y., Xu,C., Fang,R., Guegler,K. et al., (2004) Nat. Biotechnol., 22, 707-716]. Here, we confirm this observation, and we show that ZFP206 expression decreases rapidly upon differentiation of cultured mouse ES cells, and during development of mouse embryos. We find that there are at least six isoforms of the ZFP206 transcript, the longest being predominant. Overexpression and depletion experiments show that Zfp206 promotes formation of undifferentiated ES cell clones, and positively regulates abundance of a very small set of transcripts whose expression is also specific to ES cells and the two- to four-cell stages of preimplantation embryos. This set includes members of the Zscan4, Thoc4, Tcstv1 and eIF-1A gene families, none of which have been functionally characterized in vivo but whose members include apparent transcription factors, RNA-binding proteins and translation factors. Together, these data indicate that Zfp206 is a regulator of ES cell differentiation that controls a set of genes expressed very early in development, most of which themselves appear to be regulators.

  12. Developmental programming of energy balance regulation: is physical activity more 'programmable' than food intake?

    Science.gov (United States)

    Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A

    2016-02-01

    Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life

  13. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Li, Bo; Fang, Lusheng; Li, Bo

    2011-01-01

    To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene...... is proposed and analyzed, as well as its three categories i.e., the operator gene, the structural gene and the regulator gene. Second, the trigger mechanism that design objectives and constraints trigger the operator gene is constructed. Third, the expression principle of structural gene is analyzed...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  14. Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides

    Directory of Open Access Journals (Sweden)

    Achanta Mallika

    2012-05-01

    Full Text Available Abstract Cathelicidins are a major family of antimicrobial peptides present in vertebrate animals with potent microbicidal and immunomodulatory activities. Four cathelicidins, namely fowlicidins 1 to 3 and cathelicidin B1, have been identified in chickens. As a first step to understand their role in early innate host defense of chickens, we examined the tissue and developmental expression patterns of all four cathelicidins. Real-time PCR revealed an abundant expression of four cathelicidins throughout the gastrointestinal, respiratory, and urogenital tracts as well as in all primary and secondary immune organs of chickens. Fowlicidins 1 to 3 exhibited a similar tissue expression pattern with the highest expression in the bone marrow and lung, while cathelicidin B1 was synthesized most abundantly in the bursa of Fabricius. Additionally, a tissue-specific regulatory pattern was evident for all four cathelicidins during the first 28 days after hatching. The expression of fowlicidins 1 to 3 showed an age-dependent increase both in the cecal tonsil and lung, whereas all four cathelicidins were peaked in the bursa on day 4 after hatching, with a gradual decline by day 28. An abrupt augmentation in the expression of fowlicidins 1 to 3 was also observed in the cecum on day 28, while the highest expression of cathelicidin B1 was seen in both the lung and cecal tonsil on day 14. Collectively, the presence of cathelicidins in a broad range of tissues and their largely enhanced expression during development are suggestive of their potential important role in early host defense and disease resistance of chickens.

  15. Developmental regulation of nucleolus size during Drosophila eye differentiation.

    Directory of Open Access Journals (Sweden)

    Nicholas E Baker

    Full Text Available When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.

  16. Developmental regulation of nucleolus size during Drosophila eye differentiation.

    Science.gov (United States)

    Baker, Nicholas E

    2013-01-01

    When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.

  17. Developmental Regulation with Progressive Vision Loss: Use of Control Strategies and Affective Well-Being

    Science.gov (United States)

    Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta

    2016-01-01

    The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…

  18. Developmental evolution in social insects: regulatory networks from genes to societies.

    Science.gov (United States)

    Linksvayer, Timothy A; Fewell, Jennifer H; Gadau, Jürgen; Laubichler, Manfred D

    2012-05-01

    The evolution and development of complex phenotypes in social insect colonies, such as queen-worker dimorphism or division of labor, can, in our opinion, only be fully understood within an expanded mechanistic framework of Developmental Evolution. Conversely, social insects offer a fertile research area in which fundamental questions of Developmental Evolution can be addressed empirically. We review the concept of gene regulatory networks (GRNs) that aims to fully describe the battery of interacting genomic modules that are differentially expressed during the development of individual organisms. We discuss how distinct types of network models have been used to study different levels of biological organization in social insects, from GRNs to social networks. We propose that these hierarchical networks spanning different organizational levels from genes to societies should be integrated and incorporated into full GRN models to elucidate the evolutionary and developmental mechanisms underlying social insect phenotypes. Finally, we discuss prospects and approaches to achieve such an integration. © 2012 WILEY PERIODICALS, INC.

  19. Retrotransposons as regulators of gene expression.

    Science.gov (United States)

    Elbarbary, Reyad A; Lucas, Bronwyn A; Maquat, Lynne E

    2016-02-12

    Transposable elements (TEs) are both a boon and a bane to eukaryotic organisms, depending on where they integrate into the genome and how their sequences function once integrated. We focus on two types of TEs: long interspersed elements (LINEs) and short interspersed elements (SINEs). LINEs and SINEs are retrotransposons; that is, they transpose via an RNA intermediate. We discuss how LINEs and SINEs have expanded in eukaryotic genomes and contribute to genome evolution. An emerging body of evidence indicates that LINEs and SINEs function to regulate gene expression by affecting chromatin structure, gene transcription, pre-mRNA processing, or aspects of mRNA metabolism. We also describe how adenosine-to-inosine editing influences SINE function and how ongoing retrotransposition is countered by the body's defense mechanisms. Copyright © 2016, American Association for the Advancement of Science.

  20. Dietary methanol regulates human gene activity.

    Directory of Open Access Journals (Sweden)

    Anastasia V Shindyapina

    Full Text Available Methanol (MeOH is considered to be a poison in humans because of the alcohol dehydrogenase (ADH-mediated conversion of MeOH to formaldehyde (FA, which is toxic. Our recent genome-wide analysis of the mouse brain demonstrated that an increase in endogenous MeOH after ADH inhibition led to a significant increase in the plasma MeOH concentration and a modification of mRNA synthesis. These findings suggest endogenous MeOH involvement in homeostasis regulation by controlling mRNA levels. Here, we demonstrate directly that study volunteers displayed increasing concentrations of MeOH and FA in their blood plasma when consuming citrus pectin, ethanol and red wine. A microarray analysis of white blood cells (WBC from volunteers after pectin intake showed various responses for 30 significantly differentially regulated mRNAs, most of which were somehow involved in the pathogenesis of Alzheimer's disease (AD. There was also a decreased synthesis of hemoglobin mRNA, HBA and HBB, the presence of which in WBC RNA was not a result of red blood cells contamination because erythrocyte-specific marker genes were not significantly expressed. A qRT-PCR analysis of volunteer WBCs after pectin and red wine intake confirmed the complicated relationship between the plasma MeOH content and the mRNA accumulation of both genes that were previously identified, namely, GAPDH and SNX27, and genes revealed in this study, including MME, SORL1, DDIT4, HBA and HBB. We hypothesized that human plasma MeOH has an impact on the WBC mRNA levels of genes involved in cell signaling.

  1. Gene up-regulation in response to predator kairomones in the water flea, Daphnia pulex

    Directory of Open Access Journals (Sweden)

    Okada Yasukazu

    2010-04-01

    Full Text Available Abstract Background Numerous cases of predator-induced polyphenisms, in which alternate phenotypes are produced in response to extrinsic stimuli, have been reported in aquatic taxa to date. The genus Daphnia (Branchiopoda, Cladocera provides a model experimental system for the study of the developmental mechanisms and evolutionary processes associated with predator-induced polyphenisms. In D. pulex, juveniles form neckteeth in response to predatory kairomones released by Chaoborus larvae (Insecta, Diptera. Results Previous studies suggest that the timing of the sensitivity to kairomones in D. pulex can generally be divided into the embryonic and postembryonic developmental periods. We therefore examined which of the genes in the embryonic and first-instar juvenile stages exhibit different expression levels in the presence or absence of predator kairomones. Employing a candidate gene approach and identifying differentially-expressed genes revealed that the morphogenetic factors, Hox3, extradenticle and escargot, were up-regulated by kairomones in the postembryonic stage and may potentially be responsible for defense morph formation. In addition, the juvenile hormone pathway genes, JHAMT and Met, and the insulin signaling pathway genes, InR and IRS-1, were up-regulated in the first-instar stage. It is well known that these hormonal pathways are involved in physiological regulation following morphogenesis in many insect species. During the embryonic stage when morphotypes were determined, one of the novel genes identified by differential display was up-regulated, suggesting that this gene may be related to morphotype determination. Biological functions of the up-regulated genes are discussed in the context of defense morph formation. Conclusions It is suggested that, following the reception of kairomone signals, the identified genes are involved in a series of defensive phenotypic alterations and the production of a defensive phenotype.

  2. A tale with a Twist: a developmental gene with potential relevance for metabolic dysfunction and inflammation in adipose tissue

    Directory of Open Access Journals (Sweden)

    Anca Dana Dobrian

    2012-08-01

    Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.

  3. Studying gene regulation in methanogenic archaea.

    Science.gov (United States)

    Rother, Michael; Sattler, Christian; Stock, Tilmann

    2011-01-01

    Methanogenic archaea are a unique group of strictly anaerobic microorganisms characterized by their ability, and dependence, to convert simple C1 and C2 compounds to methane for growth. The major models for studying the biology of methanogens are members of the Methanococcus and Methanosarcina species. Recent development of sophisticated tools for molecular analysis and for genetic manipulation allows investigating not only their metabolism but also their cell cycle, and their interaction with the environment in great detail. One aspect of such analyses is assessment and dissection of methanoarchaeal gene regulation, for which, at present, only a handful of cases have been investigated thoroughly, partly due to the great methodological effort required. However, it becomes more and more evident that many new regulatory paradigms can be unraveled in this unique archaeal group. Here, we report both molecular and physiological/genetic methods to assess gene regulation in Methanococcus maripaludis and Methanosarcina acetivorans, which should, however, be applicable for other methanogens as well. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

    Science.gov (United States)

    Blume, B; Grierson, D

    1997-10-01

    The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

  5. Regulation of root hair initiation and expansin gene expression in Arabidopsis

    Science.gov (United States)

    Cho, Hyung-Taeg; Cosgrove, Daniel J.

    2002-01-01

    The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

  6. Identification, characterization and developmental expression of Halloween genes encoding P450 enzymes mediating ecdysone biosynthesis in the tobacco hornworm, Manduca sexta

    DEFF Research Database (Denmark)

    Rewitz, Kim; Rybczynski, Robert; Warren, James T.

    2006-01-01

    this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...

  7. Endogenous Methanol Regulates Mammalian Gene Activity

    Science.gov (United States)

    Komarova, Tatiana V.; Petrunia, Igor V.; Shindyapina, Anastasia V.; Silachev, Denis N.; Sheshukova, Ekaterina V.; Kiryanov, Gleb I.; Dorokhov, Yuri L.

    2014-01-01

    We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH) converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP) and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis. PMID:24587296

  8. Endogenous methanol regulates mammalian gene activity.

    Directory of Open Access Journals (Sweden)

    Tatiana V Komarova

    Full Text Available We recently showed that methanol emitted by wounded plants might function as a signaling molecule for plant-to-plant and plant-to-animal communications. In mammals, methanol is considered a poison because the enzyme alcohol dehydrogenase (ADH converts methanol into toxic formaldehyde. However, the detection of methanol in the blood and exhaled air of healthy volunteers suggests that methanol may be a chemical with specific functions rather than a metabolic waste product. Using a genome-wide analysis of the mouse brain, we demonstrated that an increase in blood methanol concentration led to a change in the accumulation of mRNAs from genes primarily involved in detoxification processes and regulation of the alcohol/aldehyde dehydrogenases gene cluster. To test the role of ADH in the maintenance of low methanol concentration in the plasma, we used the specific ADH inhibitor 4-methylpyrazole (4-MP and showed that intraperitoneal administration of 4-MP resulted in a significant increase in the plasma methanol, ethanol and formaldehyde concentrations. Removal of the intestine significantly decreased the rate of methanol addition to the plasma and suggested that the gut flora may be involved in the endogenous production of methanol. ADH in the liver was identified as the main enzyme for metabolizing methanol because an increase in the methanol and ethanol contents in the liver homogenate was observed after 4-MP administration into the portal vein. Liver mRNA quantification showed changes in the accumulation of mRNAs from genes involved in cell signalling and detoxification processes. We hypothesized that endogenous methanol acts as a regulator of homeostasis by controlling the mRNA synthesis.

  9. Streptomyces sporulation - Genes and regulators involved in bacterial cell differentiation

    OpenAIRE

    Larsson, Jessica

    2010-01-01

    Streptomycetes are Gram-positive bacteria with a complex developmental life cycle. They form spores on specialized cells called aerial hyphae, and this sporulation involves alterations in growth, morphogenesis and cell cycle processes like cell division and chromosome segregation. Understanding the developmental mechanisms that streptomycetes have evolved for regulating for example cell division is of general interest in bacterial cell biology. It can also be valuable in the design of new dru...

  10. Redox regulation of photosynthetic gene expression.

    Science.gov (United States)

    Queval, Guillaume; Foyer, Christine H

    2012-12-19

    Redox chemistry and redox regulation are central to the operation of photosynthesis and respiration. However, the roles of different oxidants and antioxidants in the regulation of photosynthetic or respiratory gene expression remain poorly understood. Leaf transcriptome profiles of a range of Arabidopsis thaliana genotypes that are deficient in either hydrogen peroxide processing enzymes or in low molecular weight antioxidant were therefore compared to determine how different antioxidant systems that process hydrogen peroxide influence transcripts encoding proteins targeted to the chloroplasts or mitochondria. Less than 10 per cent overlap was observed in the transcriptome patterns of leaves that are deficient in either photorespiratory (catalase (cat)2) or chloroplastic (thylakoid ascorbate peroxidase (tapx)) hydrogen peroxide processing. Transcripts encoding photosystem II (PSII) repair cycle components were lower in glutathione-deficient leaves, as were the thylakoid NAD(P)H (nicotinamide adenine dinucleotide (phosphate)) dehydrogenases (NDH) mRNAs. Some thylakoid NDH mRNAs were also less abundant in tAPX-deficient and ascorbate-deficient leaves. Transcripts encoding the external and internal respiratory NDHs were increased by low glutathione and low ascorbate. Regulation of transcripts encoding specific components of the photosynthetic and respiratory electron transport chains by hydrogen peroxide, ascorbate and glutathione may serve to balance non-cyclic and cyclic electron flow pathways in relation to oxidant production and reductant availability.

  11. Gene expression analysis in human osteoblasts exposed to dexamethasone identifies altered developmental pathways as putative drivers of osteoporosis

    Directory of Open Access Journals (Sweden)

    Sadlier Denise M

    2007-02-01

    Full Text Available Abstract Background Osteoporosis, a disease of decreased bone mineral density represents a significant and growing burden in the western world. Aging population structure and therapeutic use of glucocorticoids have contributed in no small way to the increase in the incidence of this disease. Despite substantial investigative efforts over the last number of years the exact molecular mechanism underpinning the initiation and progression of osteoporosis remain to be elucidated. This has meant that no significant advances in therapeutic strategies have emerged, with joint replacement surgery being the mainstay of treatment. Methods In this study we have used an integrated genomics profiling and computational biology based strategy to identify the key osteoblast genes and gene clusters whose expression is altered in response to dexamethasone exposure. Primary human osteoblasts were exposed to dexamethasone in vitro and microarray based transcriptome profiling completed. Results These studies identified approximately 500 osteoblast genes whose expression was altered. Functional characterization of the transcriptome identified developmental networks as being reactivated with 106 development associated genes found to be differentially regulated. Pathway reconstruction revealed coordinate alteration of members of the WNT signaling pathway, including frizzled-2, frizzled-7, DKK1 and WNT5B, whose differential expression in this setting was confirmed by real time PCR. Conclusion The WNT pathway is a key regulator of skeletogenesis as well as differentiation of bone cells. Reactivation of this pathway may lead to altered osteoblast activity resulting in decreased bone mineral density, the pathological hallmark of osteoporosis. The data herein lend weight to the hypothesis that alterations in developmental pathways drive the initiation and progression of osteoporosis.

  12. MicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother

    Directory of Open Access Journals (Sweden)

    Mohammed Alsaweed

    2015-10-01

    Full Text Available Human milk (HM is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance.

  13. Transcriptional regulation of genes involved in terpenoid índole alkaloid production in Catharanthus roseus seedlings

    Directory of Open Access Journals (Sweden)

    Pedro J. Rocha

    2002-07-01

    Full Text Available Catharanthus roseus (L. G Don is a medicinal plant that produces a variety of terpenoid indole alkaloids (TIAs, some of which display pharmacological activity. C. roseus plants and cell cultures have been used to elucidate the TIAs biosynthetic pathway. A considerable number or enzymes have also been characterised, and their respective genes cloned. TIAs production in C. roseus plant and cell cultures is highly regulated at transcriptional-, develop-mental-, and environmental-level. Studies into TIAs biosynthetic gene regulation have been carried out using cell cultures. However, regulation in plants is almost unknown. Here, biosynthetic genes idc, strl, d4h and dat expres-sion levels are qualitatively examined in a developmental series of C. roseus seedlings. The effect of water- and light-stress and methyl jasmonate (MeJa and acetyl salicylic acid (ASA elicitation is also examined. Comparison between seedlings and cell cultures strongly suggests that TIAs biosynthetic gene transcriptional regulation is different in C.roseus plants and cell cultures.

  14. GCN5 Regulates FGF Signaling and Activates Selective MYC Target Genes during Early Embryoid Body Differentiation

    Directory of Open Access Journals (Sweden)

    Li Wang

    2018-01-01

    Full Text Available Precise control of gene expression during development is orchestrated by transcription factors and co-regulators including chromatin modifiers. How particular chromatin-modifying enzymes affect specific developmental processes is not well defined. Here, we report that GCN5, a histone acetyltransferase essential for embryonic development, is required for proper expression of multiple genes encoding components of the fibroblast growth factor (FGF signaling pathway in early embryoid bodies (EBs. Gcn5−/− EBs display deficient activation of ERK and p38, mislocalization of cytoskeletal components, and compromised capacity to differentiate toward mesodermal lineage. Genomic analyses identified seven genes as putative direct targets of GCN5 during early differentiation, four of which are cMYC targets. These findings established a link between GCN5 and the FGF signaling pathway and highlighted specific GCN5-MYC partnerships in gene regulation during early differentiation.

  15. A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

    Science.gov (United States)

    Kück, Ulrich

    2005-10-01

    Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

  16. Transcription regulation of sex-biased genes during ontogeny in the malaria vector Anopheles gambiae.

    Directory of Open Access Journals (Sweden)

    Kalle Magnusson

    Full Text Available In Anopheles gambiae, sex-regulated genes are responsible for controlling gender dimorphism and are therefore crucial in determining the ability of female mosquitoes to transmit human malaria. The identification and functional characterization of these genes will shed light on the sexual development and maturation of mosquitoes and provide useful targets for genetic control measures aimed at reducing mosquito fertility and/or distorting the sex ratio.We conducted a genome wide transcriptional analysis of sex-regulated genes from early developmental stages through adulthood combined with functional screening of novel gonadal genes. Our results demonstrate that the male-biased genes undergo a major transcription turnover starting from larval stages to adulthood. The male biased genes at the adult stage include a significant high number of unique sequences compared to the rest of the genome. This is in contrast to female-biased genes that are much more conserved and are mainly activated during late developmental stages.The high frequency of unique sequences would indicate that male-biased genes evolve more rapidly than the rest of the genome. This finding is particularly intriguing because A. gambiae is a strictly female monogamous species suggesting that driving forces in addition to sperm competition must account for the rapid evolution of male-biased genes. We have also identified and functionally characterized a number of previously unknown A. gambiae testis- and ovary-specific genes. Two of these genes, zero population growth and a suppressor of defective silencing 3 domain of the histone deacetylase co-repressor complex, were shown to play a key role in gonad development.

  17. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes

    Science.gov (United States)

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

    2018-01-01

    Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203

  18. The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.

    Science.gov (United States)

    Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas

    2018-04-01

    The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.

  19. Timing is everything: Reiterative Wnt, BMP and RA signaling regulate developmental competence during endoderm organogenesis.

    Science.gov (United States)

    Rankin, Scott A; McCracken, Kyle W; Luedeke, David M; Han, Lu; Wells, James M; Shannon, John M; Zorn, Aaron M

    2018-02-01

    A small number of signaling pathways are used repeatedly during organogenesis, and they can have drastically different effects on the same population of cells depending on the embryonic stage. How cellular competence changes over developmental time is not well understood. Here we used Xenopus, mouse, and human pluripotent stem cells to investigate how the temporal sequence of Wnt, BMP, and retinoic acid (RA) signals regulates endoderm developmental competence and organ induction, focusing on respiratory fate. While Nkx2-1+ lung fate is not induced until late somitogenesis stages, here we show that lung competence is restricted by the gastrula stage as a result of Wnt and BMP-dependent anterior-posterior (A-P) patterning. These early Wnt and BMP signals make posterior endoderm refractory to subsequent RA/Wnt/BMP-dependent lung induction. We further mapped how RA modulates the response to Wnt and BMP in a temporal specific manner. In the gastrula RA promotes posterior identity, however in early somite stages of development RA regulates respiratory versus pharyngeal potential in anterior endoderm and midgut versus hindgut potential in posterior endoderm. Together our data suggest a dynamic and conserved response of vertebrate endoderm during organogenesis, wherein early Wnt/BMP/RA impacts how cells respond to later Wnt/BMP/RA signals, illustrating how reiterative combinatorial signaling can regulate both developmental competence and subsequent fate specification. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED

    NARCIS (Netherlands)

    SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH

    Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from

  1. Mechanisms for the environmental regulation of gene expression

    Indian Academy of Sciences (India)

    2005-01-07

    Jan 7, 2005 ... The environment can play a significant role in the production of phenotypes. However, the developmental mechanisms by which the environmental agents effect normal development are just becoming known. At least three paths have been found through which the environment can modify gene activity.

  2. Regulation of C. elegans L4 cuticle collagen genes by the heterochronic protein LIN-29.

    Science.gov (United States)

    Abete-Luzi, Patricia; Eisenmann, David M

    2018-05-01

    The cuticle, the outer covering of the nematode C. elegans, is synthesized five times during the worm's life by the underlying hypodermis. Cuticle collagens, the major cuticle component, are encoded by a large family of col genes and, interestingly, many of these genes express predominantly at a single developmental stage. This temporal preference motivated us to investigate the mechanisms underlying col gene expression and here we focus on a subset of col genes expressed in the L4 stage. We identified minimal promoter regions of <300 bp for col-38, col-49, and col-63. In these regions, we predicted cis-regulatory sequences and evaluated their function in vivo via mutagenesis of a col-38p::yfp reporter. We used RNAi to study the requirement for candidate transcription regulators ELT-1 and ELT-3, LIN-29, and the LIN-29 co-factor MAB-10, and found LIN-29 to be necessary for the expression of four L4-specific genes (col-38, col-49, col-63, and col-138). Temporal misexpression of LIN-29 was also sufficient to activate these genes at a different developmental stage. The LIN-29 DNA-binding domain bound the col-38, col-49, and col-63 minimal promoters in vitro. For col-38 we showed that the LIN-29 sites necessary for reporter expression in vivo are also bound in vitro: this is the first identification of specific binding sites for LIN-29 necessary for in vivo target gene expression. © 2018 Wiley Periodicals, Inc.

  3. NF-Y recruits both transcription activator and repressor to modulate tissue- and developmental stage-specific expression of human γ-globin gene.

    Directory of Open Access Journals (Sweden)

    Xingguo Zhu

    Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.

  4. Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

    Science.gov (United States)

    Sundararajan, Vignesh; Civetta, Alberto

    2011-01-01

    Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

  5. Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

    Directory of Open Access Journals (Sweden)

    Vanessa C McFadden

    2017-02-01

    Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

  6. Identification and transcription profiling of trypsin in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation, blood feeding, and permethrin exposure.

    Science.gov (United States)

    Zhao, Liming; Chen, Jian; Becnel, James J; Kline, Daniel L; Clark, Gary G; Linthicum, Kenneth J

    2011-05-01

    The cDNA of a trypsin gene from Aedes (Ochlerotatus) taeniorhynchus (Weidemann) was cloned and sequenced. The full-length mRNA sequence (890 bp) for trypsin from Ae. taeniorhynchus (AetTryp1) was obtained, which encodes an open reading frame of 765 bp (i.e., 255 amino acids). To detect whether AetTryp is developmentally regulated, a quantitative real-time polymerase chain reaction was used to examine AetTrypl mRNA expression levels in different developmental stages of Ae. taeniorhynchus. AetTryp1 was expressed at low levels in egg, larval, and pupal stages, but was differentially expressed in adult Ae. taeniorhynchus, with highest levels found in 5-d-old female adults when compared with teneral adults. In addition, AetTryp1 mRNA expression differed between sexes, with expression levels much lower in males. However, in both males and females, there was a significant increase in AetTryp1 transcription levels as age increased and peaked in 5-d-old adults. AetTrypl expressed in 5-d-old female Ae. taeniorhynchus significantly increased after 30 min postblood feeding compared with the control. The AetTryp1 mRNA expression in 5-d-old female Ae. taeniorhynchus was affected by different concentrations of permethrin.

  7. Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

    Science.gov (United States)

    Stiles, Kari A; Van Volkenburgh, Elizabeth

    2002-07-01

    Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

  8. Global developmental gene expression and pathway analysis of normal brain development and mouse models of human neuronal migration defects.

    Directory of Open Access Journals (Sweden)

    Tiziano Pramparo

    2011-03-01

    Full Text Available Heterozygous LIS1 mutations are the most common cause of human lissencephaly, a human neuronal migration defect, and DCX mutations are the most common cause of X-linked lissencephaly. LIS1 is part of a protein complex including NDEL1 and 14-3-3ε that regulates dynein motor function and microtubule dynamics, while DCX stabilizes microtubules and cooperates with LIS1 during neuronal migration and neurogenesis. Targeted gene mutations of Lis1, Dcx, Ywhae (coding for 14-3-3ε, and Ndel1 lead to neuronal migration defects in mouse and provide models of human lissencephaly, as well as aid the study of related neuro-developmental diseases. Here we investigated the developing brain of these four mutants and wild-type mice using expression microarrays, bioinformatic analyses, and in vivo/in vitro experiments to address whether mutations in different members of the LIS1 neuronal migration complex lead to similar and/or distinct global gene expression alterations. Consistent with the overall successful development of the mutant brains, unsupervised clustering and co-expression analysis suggested that cell cycle and synaptogenesis genes are similarly expressed and co-regulated in WT and mutant brains in a time-dependent fashion. By contrast, focused co-expression analysis in the Lis1 and Ndel1 mutants uncovered substantial differences in the correlation among pathways. Differential expression analysis revealed that cell cycle, cell adhesion, and cytoskeleton organization pathways are commonly altered in all mutants, while synaptogenesis, cell morphology, and inflammation/immune response are specifically altered in one or more mutants. We found several commonly dysregulated genes located within pathogenic deletion/duplication regions, which represent novel candidates of human mental retardation and neurocognitive disabilities. Our analysis suggests that gene expression and pathway analysis in mouse models of a similar disorder or within a common pathway can

  9. Dissecting specific and global transcriptional regulation of bacterial gene expression

    NARCIS (Netherlands)

    Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe

    Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an

  10. Using gene expression noise to understand gene regulation

    NARCIS (Netherlands)

    Munsky, B.; Neuert, G.; van Oudenaarden, A.

    2012-01-01

    Phenotypic variation is ubiquitous in biology and is often traceable to underlying genetic and environmental variation. However, even genetically identical cells in identical environments display variable phenotypes. Stochastic gene expression, or gene expression "noise," has been suggested as a

  11. Developmental and feedforward control of the expression of folate biosynthesis genes in tomato fruit

    Science.gov (United States)

    Little is known about how plants regulate their folate content, including whether the expression of folate biosynthesis genes is orchestrated during development or modulated by folate levels. Nor is much known about how folate levels impact the expression of other genes. These points were addressed ...

  12. Global identification of bursicon-regulated genes in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Beerntsen Brenda

    2008-09-01

    Full Text Available Abstract Background Bursicon is a heterodimer neuropeptide responsible for regulating cuticle sclerotization and wing expansion in several insect species. Recent studies indicate that the action of bursicon is mediated by a specific G protein-coupled receptor DLGR2 and the cAMP/PKA signaling pathway. However, little is known regarding the genes that are regulated by bursicon. The identification of bursicon-regulated genes is the focus of this investigation. Results We used DNA microarray analysis to identify bursicon-regulated genes in neck-ligated flies (Drosophila melanogaster that received recombinant bursicon (r-bursicon. Fifty four genes were found to be regulated by bursicon 1 h post r-bursicon injection, 52 being up-regulated and 2 down-regulated while 33 genes were influenced by r-bursicon 3 h post-injection (24 up-regulated and 9 down-regulated genes. Analysis of these genes by inference from the fly database http://flybase.bio.indiana.edu revealed that these genes encode proteins with diverse functions, including cell signaling, gene transcription, DNA/RNA binding, ion trafficking, proteolysis-peptidolysis, metabolism, cytoskeleton formation, immune response and cell-adhesion. Twenty eight genes randomly selected from the microarray-identified list were verified by real time PCR (qPCR which supported the microarray data. Temporal response studies of 13 identified and verified genes by qPCR revealed that the temporal expression patterns of these genes are consistent with the microarray data. Conclusion Using r-bursicon, we identified 87 genes that are regulated by bursicon, 30 of which have no previously known function. Most importantly, all genes randomly selected from the microarray-identified list were verified by real time PCR. Temporal analysis of 13 verified genes revealed that the expression of these genes was indeed induced by bursicon and correlated well with the cuticle sclerotization process. The composite data suggest that

  13. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  14. IGF-Regulated Genes in Prostate Cancer

    National Research Council Canada - National Science Library

    Roberts, Charles

    2003-01-01

    We hypothesized that genes that are differentially expressed as a result of the decreased IGF-I receptor gene expression seen in metastatic prostate cancer contribute to prostate cancer progression...

  15. IGF-Regulated Genes in Prostate Cancer

    National Research Council Canada - National Science Library

    Roberts, Charles T., Jr

    2005-01-01

    We hypothesized that genes that are differentially expressed as a result of the decreased IGF-I receptor gene expression seen in metastatic prostate cancer contribute to prostate cancer progression...

  16. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  17. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  18. Developmental Deltamethrin Exposure Causes Persistent Changes in Dopaminergic Gene Expression, Neurochemistry, and Locomotor Activity in Zebrafish.

    Science.gov (United States)

    Kung, Tiffany S; Richardson, Jason R; Cooper, Keith R; White, Lori A

    2015-08-01

    Pyrethroids are commonly used insecticides that are considered to pose little risk to human health. However, there is an increasing concern that children are more susceptible to the adverse effects of pesticides. We used the zebrafish model to test the hypothesis that developmental exposure to low doses of the pyrethroid deltamethrin results in persistent alterations in dopaminergic gene expression, neurochemistry, and locomotor activity. Zebrafish embryos were treated with deltamethrin (0.25-0.50 μg/l), at concentrations below the LOAEL, during the embryonic period [3-72 h postfertilization (hpf)], after which transferred to fresh water until the larval stage (2-weeks postfertilization). Deltamethrin exposure resulted in decreased transcript levels of the D1 dopamine (DA) receptor (drd1) and increased levels of tyrosine hydroxylase at 72 hpf. The reduction in drd1 transcripts persisted to the larval stage and was associated with decreased D2 dopamine receptor transcripts. Larval fish, exposed developmentally to deltamethrin, had increased levels of homovanillic acid, a DA metabolite. Since the DA system is involved in locomotor activity, we measured the swim activity of larval fish following a transition to darkness. Developmental exposure to deltamethrin significantly increased larval swim activity which was attenuated by concomitant knockdown of the DA transporter. Acute exposure to methylphenidate, a DA transporter inhibitor, increased swim activity in control larva, while reducing swim activity in larva developmentally exposed to deltamethrin. Developmental exposure to deltamethrin causes locomotor deficits in larval zebrafish, which is likely mediated by dopaminergic dysfunction. This highlights the need to understand the persistent effects of low-dose neurotoxicant exposure during development. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Identification of conserved drought stress responsive gene-network across tissues and developmental stages in rice.

    Science.gov (United States)

    Smita, Shuchi; Katiyar, Amit; Pandey, Dev Mani; Chinnusamy, Viswanathan; Archak, Sunil; Bansal, Kailash Chander

    2013-01-01

    Identification of genes that are coexpressed across various tissues and environmental stresses is biologically interesting, since they may play coordinated role in similar biological processes. Genes with correlated expression patterns can be best identified by using coexpression network analysis of transcriptome data. In the present study, we analyzed the temporal-spatial coordination of gene expression in root, leaf and panicle of rice under drought stress and constructed network using WGCNA and Cytoscape. Total of 2199 differentially expressed genes (DEGs) were identified in at least three or more tissues, wherein 88 genes have coordinated expression profile among all the six tissues under drought stress. These 88 highly coordinated genes were further subjected to module identification in the coexpression network. Based on chief topological properties we identified 18 hub genes such as ABC transporter, ATP-binding protein, dehydrin, protein phosphatase 2C, LTPL153 - Protease inhibitor, phosphatidylethanolaminebinding protein, lactose permease-related, NADP-dependent malic enzyme, etc. Motif enrichment analysis showed the presence of ABRE cis-elements in the promoters of > 62% of the coordinately expressed genes. Our results suggest that drought stress mediated upregulated gene expression was coordinated through an ABA-dependent signaling pathway across tissues, at least for the subset of genes identified in this study, while down regulation appears to be regulated by tissue specific pathways in rice.

  20. Gravity regulated genes in Arabidopsis thaliana (GENARA experiment)

    Science.gov (United States)

    Boucheron-Dubuisson, Elodie; Carnero-D&íaz, Eugénie; Medina, Francisco Javier; Gasset, Gilbert; Pereda-Loth, Veronica; Graziana, Annick; Mazars, Christian; Le Disquet, Isabelle; Eche, Brigitte; Grat, Sabine; Gauquelin-Koch, Guillemette

    2012-07-01

    In higher plants, post-embryonic development is possible through the expression of a set of genes constituting the morphogenetic program that contribute to the production of tissues and organs during the whole plant life cycle. Plant development is mainly controlled by internal factors such as phytohormones, as well as by environmental factors, among which gravity plays a key role (gravi-morphogenetic program). The GENARA space experiment has been designed with the goal of contributing to a better understanding of this gravi-morphogenetic program through the identification and characterization of some gravity regulated proteins (GR proteins) by using quantitative proteomic methods, and through the study of the impact of plant hormones on the expression of this program. Among plant hormones, auxin is the major regulator of organogenesis. In fact, it affects numerous plant developmental processes, e.g. cell division and elongation, autumnal loss of leaves, and the formation of buds, roots, flowers and fruits. Furthermore, it also plays a key role in the mechanisms of different tropisms (including gravitropism) that modulate fundamental features of plant growth. The expression of significant genes involved in auxin transport and in auxin signal perception in root cells is being studied in space-grown seedlings and compared with the corresponding ground controls. This experiment was scheduled to be performed in The European Modular Cultivation System (EMCS), a new facility for plant cultivation and Plant Molecular Biology studies, at ISS. However only one aspect of this experiment was flown and concerns the qualitative and quantitative changes in membrane proteins supposed to be mainly associated with cell signaling and has been called GENARA A. The second part dealing with the function of auxin in the gravi-morphogenetic program and the alterations induced by microgravity will be studied through mutants affected on biosynthesis, transport or perception of auxin in a

  1. An oscillopathic approach to developmental dyslexia: From genes to speech processing.

    Science.gov (United States)

    Jiménez-Bravo, Miguel; Marrero, Victoria; Benítez-Burraco, Antonio

    2017-06-30

    Developmental dyslexia is a heterogeneous condition entailing problems with reading and spelling. Several genes have been linked or associated to the disease, many of which contribute to the development and function of brain areas important for auditory and phonological processing. Nonetheless, a clear link between genes, the brain, and the symptoms of dyslexia is still pending. The goal of this paper is contributing to bridge this gap. With this aim, we have focused on how the dyslexic brain fails to process speech sounds and reading cues. We have adopted an oscillatory perspective, according to which dyslexia may result from a deficient integration of different brain rhythms during reading/spellings tasks. Moreover, we show that some candidate genes for this condition are related to brain rhythms. This fresh approach is expected to provide a better understanding of the aetiology and the clinical presentation of developmental dyslexia, but also to achieve an earlier and more accurate diagnosis of the disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

    Science.gov (United States)

    Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro

    2009-01-01

    Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

  3. HPRT deficiency coordinately dysregulates canonical Wnt and presenilin-1 signaling: a neuro-developmental regulatory role for a housekeeping gene?

    Directory of Open Access Journals (Sweden)

    Tae Hyuk Kang

    2011-01-01

    Full Text Available We have used microarray-based methods of global gene expression together with quantitative PCR and Western blot analysis to identify dysregulation of genes and aberrant cellular processes in human fibroblasts and in SH-SY5Y neuroblastoma cells made HPRT-deficient by transduction with a retrovirus stably expressing an shRNA targeted against HPRT. Analysis of the microarray expression data by Gene ontology (GO and Gene Set Enrichment Analysis (GSEA as well as significant pathway analysis by GeneSpring GX10 and Panther Classification System reveal that HPRT deficiency is accompanied by aberrations in a variety of pathways known to regulate neurogenesis or to be implicated in neurodegenerative disease, including the canonical Wnt/β-catenin and the Alzheimer's disease/presenilin signaling pathways. Dysregulation of the Wnt/β-catenin pathway is confirmed by Western blot demonstration of cytosolic sequestration of β-catenin during in vitro differentiation of the SH-SY5Y cells toward the neuronal phenotype. We also demonstrate that two key transcription factor genes known to be regulated by Wnt signaling and to be vital for the generation and function of dopaminergic neurons; i.e., Lmx1a and Engrailed 1, are down-regulated in the HPRT knockdown SH-SY5Y cells. In addition to the Wnt signaling aberration, we found that expression of presenilin-1 shows severely aberrant expression in HPRT-deficient SH-SY5Y cells, reflected by marked deficiency of the 23 kDa C-terminal fragment of presenilin-1 in knockdown cells. Western blot analysis of primary fibroblast cultures from two LND patients also shows dysregulated presenilin-1 expression, including aberrant proteolytic processing of presenilin-1. These demonstrations of dysregulated Wnt signaling and presenilin-1 expression together with impaired expression of dopaminergic transcription factors reveal broad pleitropic neuro-regulatory defects played by HPRT expression and suggest new directions for

  4. Genetic investigation of ocular developmental genes in 52 patients with anophthalmia/microphthalmia.

    Science.gov (United States)

    Vidya, Nair Gopinathan; Rajkumar, Sankaranarayanan; Vasavada, Abhay R

    2018-06-01

    Mutation in eye developmental genes has been reported to cause anophthalmia and microphthalmia. However, in India, especially in the Western Indian population, such reports are scarce. Hence, the present study aims to investigate mutations in 15 ocular developmental genes in patients with anophthalmia and microphthalmia in the western region of India. Genomic DNA was isolated from the blood of 52 individuals affected with microphthalmia and anophthalmia, and 50 healthy normal controls. Polymerase chain reaction (PCR) was carried out for 15 genes including BMP4, CRYBA4, FOXE3, GDF6, GJA3, GJA8, MITF, OTX2, PAX6, PITX3, RAX, SIX3, SIX6, SOX2, and VSX2 using gene-specific primers spanning the exon-intron boundaries and part of a promoter region. The amplified PCR products were purified and then subjected to Sanger's bi-directional sequencing. Nucleotide variations were examined using a basic local alignment search tool (BLAST). Bi-directional sequencing identified 8 novel and 14 known variations. Out of this, the variations GJA3-c.92T>A; p.Ile31Asn, SOX2-c.542C>A; p.Pro181Gln and SOX2-c.541_542delinsGA; p.Pro181Glu were found to be deleterious by in silico analysis. The GJA3-p.Ile31Asn mutation was identified in a patient with bilateral microphthalmia, microcornea, and membranous cataract. The SOX2-p.Pro181Gln and SOX2-p.Pro181Glu mutations were identified in patients with isolated bilateral microphthalmia and microphthalmia with microcornea, respectively. A novel nondeleterious missense variation was identified in the GJA8 gene in a patient with anophthalmia. These results support the crucial role of GJA3 and SOX2 in eye development and indicate a detailed functional study to understand the molecular mechanisms underlying the disease pathology.

  5. Prostate Cancer Epigenetics: A Review on Gene Regulation

    Directory of Open Access Journals (Sweden)

    Lena Diaw

    2007-01-01

    Full Text Available Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play important roles either independently or by interaction in tumor initiation and progression. This review will discuss the genes associated with epigenetic alterations in prostate cancer progression: their regulation and importance as possible markers for the disease.

  6. Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury

    Directory of Open Access Journals (Sweden)

    Westerdahl Ann-Charlotte

    2010-06-01

    Full Text Available Abstract Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper

  7. Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury.

    Science.gov (United States)

    Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole

    2010-06-09

    Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be

  8. Prediction of epigenetically regulated genes in breast cancer cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loss, Leandro A; Sadanandam, Anguraj; Durinck, Steffen; Nautiyal, Shivani; Flaucher, Diane; Carlton, Victoria EH; Moorhead, Martin; Lu, Yontao; Gray, Joe W; Faham, Malek; Spellman, Paul; Parvin, Bahram

    2010-05-04

    Methylation of CpG islands within the DNA promoter regions is one mechanism that leads to aberrant gene expression in cancer. In particular, the abnormal methylation of CpG islands may silence associated genes. Therefore, using high-throughput microarrays to measure CpG island methylation will lead to better understanding of tumor pathobiology and progression, while revealing potentially new biomarkers. We have examined a recently developed high-throughput technology for measuring genome-wide methylation patterns called mTACL. Here, we propose a computational pipeline for integrating gene expression and CpG island methylation profles to identify epigenetically regulated genes for a panel of 45 breast cancer cell lines, which is widely used in the Integrative Cancer Biology Program (ICBP). The pipeline (i) reduces the dimensionality of the methylation data, (ii) associates the reduced methylation data with gene expression data, and (iii) ranks methylation-expression associations according to their epigenetic regulation. Dimensionality reduction is performed in two steps: (i) methylation sites are grouped across the genome to identify regions of interest, and (ii) methylation profles are clustered within each region. Associations between the clustered methylation and the gene expression data sets generate candidate matches within a fxed neighborhood around each gene. Finally, the methylation-expression associations are ranked through a logistic regression, and their significance is quantified through permutation analysis. Our two-step dimensionality reduction compressed 90% of the original data, reducing 137,688 methylation sites to 14,505 clusters. Methylation-expression associations produced 18,312 correspondences, which were used to further analyze epigenetic regulation. Logistic regression was used to identify 58 genes from these correspondences that showed a statistically signifcant negative correlation between methylation profles and gene expression in the

  9. Scriptaid and 5-aza-2'deoxycytidine enhanced expression of pluripotent genes and in vitro developmental competence in interspecies Black-footed cat cloned embryos

    Science.gov (United States)

    Gómez, M. C.; Biancardi, M.N.; Jenkins, J.A.; Dumas, C.; Galiguis, J.; Wang, G.; Earle Pope, C.

    2012-01-01

    Somatic cell nuclear transfer offers the possibility of preserving endangered species including the black-footed cat, which is threatened with extinction. The effectiveness and efficiency of somatic cell nuclear transfer (SCNT) depends on a variety of factors, but 'inappropriate epigenetic reprogramming of the transplanted nucleus is the primary cause of the developmental failure of cloned embryos. Abnormal epigenetic events such as DNA methylation and histone modifications during SCNT perturb the expression of imprinted and pluripotent-related genes that, consequently, may result in foetal and neonatal abnormalities. We have demonstrated that pregnancies can be established after transfer of black-footed cat cloned embryos into domestic cat recipients, but none of the implanted embryos developed to term and the foetal failure has been associated to aberrant reprogramming in cloned embryos. There is growing evidence that modifying the epigenetic pattern of the chromatin template of both donor cells and reconstructed embryos with a combination of inhibitors of histone deacetylases and DNA methyltransferases results in enhanced gene reactivation and improved in vitro and in vivo developmental competence. Epigenetic modifications of the chromatin template of black-footed cat donor cells and reconstructed embryos with epigenetic-modifying compounds enhanced in vitro development, and regulated the expression of pluripotent genes, but these epigenetic modifications did not improve in vivo developmental competence.

  10. Pyrosequencing of Haliotis diversicolor transcriptomes: insights into early developmental molluscan gene expression.

    Directory of Open Access Journals (Sweden)

    Zi-Xia Huang

    Full Text Available BACKGROUND: The abalone Haliotis diversicolor is a good model for study of the settlement and metamorphosis, which are widespread marine ecological phenomena. However, information on the global gene backgrounds and gene expression profiles for the early development of abalones is lacking. METHODOLOGY/PRINCIPAL FINDINGS: In this study, eight non-normalized and multiplex barcode-labeled transcriptomes were sequenced using a 454 GS system to cover the early developmental stages of the abalone H. diversicolor. The assembly generated 35,415 unigenes, of which 7,566 were assigned GO terms. A global gene expression profile containing 636 scaffolds/contigs was constructed and was proven reliable using qPCR evaluation. It indicated that there may be existing dramatic phase transitions. Bioprocesses were proposed, including the 'lock system' in mature eggs, the collagen shells of the trochophore larvae and the development of chambered extracellular matrix (ECM structures within the earliest postlarvae. CONCLUSION: This study globally details the first 454 sequencing data for larval stages of H. diversicolor. A basic analysis of the larval transcriptomes and cluster of the gene expression profile indicates that each stage possesses a batch of specific genes that are indispensable during embryonic development, especially during the two-cell, trochophore and early postlarval stages. These data will provide a fundamental resource for future physiological works on abalones, revealing the mechanisms of settlement and metamorphosis at the molecular level.

  11. Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

    Science.gov (United States)

    Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

    2018-06-01

    Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

  12. Regulation of Life Cycle Checkpoints and Developmental Activation of Infective Larvae in Strongyloides stercoralis by Dafachronic Acid.

    Directory of Open Access Journals (Sweden)

    Mennatallah M Y Albarqi

    2016-01-01

    Full Text Available The complex life cycle of the parasitic nematode Strongyloides stercoralis leads to either developmental arrest of infectious third-stage larvae (iL3 or growth to reproductive adults. In the free-living nematode Caenorhabditis elegans, analogous determination between dauer arrest and reproductive growth is governed by dafachronic acids (DAs, a class of steroid hormones that are ligands for the nuclear hormone receptor DAF-12. Biosynthesis of DAs requires the cytochrome P450 (CYP DAF-9. We tested the hypothesis that DAs also regulate S. stercoralis development via DAF-12 signaling at three points. First, we found that 1 μM Δ7-DA stimulated 100% of post-parasitic first-stage larvae (L1s to develop to free-living adults instead of iL3 at 37°C, while 69.4±12.0% (SD of post-parasitic L1s developed to iL3 in controls. Second, we found that 1 μM Δ7-DA prevented post-free-living iL3 arrest and stimulated 85.2±16.9% of larvae to develop to free-living rhabditiform third- and fourth-stages, compared to 0% in the control. This induction required 24-48 hours of Δ7-DA exposure. Third, we found that the CYP inhibitor ketoconazole prevented iL3 feeding in host-like conditions, with only 5.6±2.9% of iL3 feeding in 40 μM ketoconazole, compared to 98.8±0.4% in the positive control. This inhibition was partially rescued by Δ7-DA, with 71.2±16.4% of iL3 feeding in 400 nM Δ7-DA and 35 μM ketoconazole, providing the first evidence of endogenous DA production in S. stercoralis. We then characterized the 26 CYP-encoding genes in S. stercoralis and identified a homolog with sequence and developmental regulation similar to DAF-9. Overall, these data demonstrate that DAF-12 signaling regulates S. stercoralis development, showing that in the post-parasitic generation, loss of DAF-12 signaling favors iL3 arrest, while increased DAF-12 signaling favors reproductive development; that in the post-free-living generation, absence of DAF-12 signaling is crucial for

  13. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae

    Directory of Open Access Journals (Sweden)

    Seong Hwan Park

    2013-01-01

    Full Text Available Identifying species of insects used to estimate postmortem interval (PMI is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science.

  14. Using the Developmental Gene Bicoid to Identify Species of Forensically Important Blowflies (Diptera: Calliphoridae)

    Science.gov (United States)

    Park, Seong Hwan; Park, Chung Hyun; Zhang, Yong; Piao, Huguo; Chung, Ukhee; Kim, Seong Yoon; Ko, Kwang Soo; Yi, Cheong-Ho; Jo, Tae-Ho; Hwang, Juck-Joon

    2013-01-01

    Identifying species of insects used to estimate postmortem interval (PMI) is a major subject in forensic entomology. Because forensic insect specimens are morphologically uniform and are obtained at various developmental stages, DNA markers are greatly needed. To develop new autosomal DNA markers to identify species, partial genomic sequences of the bicoid (bcd) genes, containing the homeobox and its flanking sequences, from 12 blowfly species (Aldrichina grahami, Calliphora vicina, Calliphora lata, Triceratopyga calliphoroides, Chrysomya megacephala, Chrysomya pinguis, Phormia regina, Lucilia ampullacea, Lucilia caesar, Lucilia illustris, Hemipyrellia ligurriens and Lucilia sericata; Calliphoridae: Diptera) were determined and analyzed. This study first sequenced the ten blowfly species other than C. vicina and L. sericata. Based on the bcd sequences of these 12 blowfly species, a phylogenetic tree was constructed that discriminates the subfamilies of Calliphoridae (Luciliinae, Chrysomyinae, and Calliphorinae) and most blowfly species. Even partial genomic sequences of about 500 bp can distinguish most blowfly species. The short intron 2 and coding sequences downstream of the bcd homeobox in exon 3 could be utilized to develop DNA markers for forensic applications. These gene sequences are important in the evolution of insect developmental biology and are potentially useful for identifying insect species in forensic science. PMID:23586044

  15. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    Science.gov (United States)

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution

  16. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    Science.gov (United States)

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  17. Expression profiling of genes regulated by TGF-beta: Differential regulation in normal and tumour cells

    Directory of Open Access Journals (Sweden)

    Takahashi Takashi

    2007-04-01

    Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.

  18. Prostate Cancer Epigenetics: A Review on Gene Regulation

    OpenAIRE

    Diaw, Lena; Woodson, Karen; Gillespie, John W.

    2007-01-01

    Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play ...

  19. Evolutionary history of the recruitment of conserved developmental genes in association to the formation and diversification of a novel trait

    Directory of Open Access Journals (Sweden)

    Shirai Leila T

    2012-02-01

    Full Text Available Abstract Background The origin and modification of novel traits are important aspects of biological diversification. Studies combining concepts and approaches of developmental genetics and evolutionary biology have uncovered many examples of the recruitment, or co-option, of genes conserved across lineages for the formation of novel, lineage-restricted traits. However, little is known about the evolutionary history of the recruitment of those genes, and of the relationship between them -for example, whether the co-option involves whole or parts of existing networks, or whether it occurs by redeployment of individual genes with de novo rewiring. We use a model novel trait, color pattern elements on butterfly wings called eyespots, to explore these questions. Eyespots have greatly diversified under natural and sexual selection, and their formation involves genetic circuitries shared across insects. Results We investigated the evolutionary history of the recruitment and co-recruitment of four conserved transcription regulators to the larval wing disc region where circular pattern elements develop. The co-localization of Antennapedia, Notch, Distal-less, and Spalt with presumptive (eyespot organizers was examined in 13 butterfly species, providing the largest comparative dataset available for the system. We found variation between families, between subfamilies, and between tribes. Phylogenetic reconstructions by parsimony and maximum likelihood methods revealed an unambiguous evolutionary history only for Antennapedia, with a resolved single origin of eyespot-associated expression, and many homoplastic events for Notch, Distal-less, and Spalt. The flexibility in the (co-recruitment of the targeted genes includes cases where different gene combinations are associated with morphologically similar eyespots, as well as cases where identical protein combinations are associated with very different phenotypes. Conclusions The evolutionary history of gene

  20. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

    2017-01-01

    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  1. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

    2017-01-01

    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  2. Pharmacogenomics genes show varying perceptibility to microRNA regulation

    DEFF Research Database (Denmark)

    Rukov, Jakob Lewin; Vinther, Jeppe; Shomron, Noam

    2011-01-01

    The aim of pharmacogenomics is to identify individual differences in genome and transcriptome composition and their effect on drug efficacy. MicroRNAs (miRNAs) are short noncoding RNAs that negatively regulate expression of the majority of animal genes, including many genes involved in drug...

  3. Changes in gravitational force affect gene expression in developing organ systems at different developmental times

    Directory of Open Access Journals (Sweden)

    Moorman Stephen J

    2005-05-01

    Full Text Available Abstract Background Little is known about the affect of microgravity on gene expression, particularly in vivo during embryonic development. Using transgenic zebrafish that express the gfp gene under the influence of a β-actin promoter, we examined the affect of simulated-microgravity on GFP expression in the heart, notochord, eye, somites, and rohon beard neurons. We exposed transgenic zebrafish to simulated-microgravity for different durations at a variety of developmental times in an attempt to determine periods of susceptibility for the different developing organ systems. Results The developing heart had a period of maximum susceptibility between 32 and 56 hours after fertilization when there was an approximately 30% increase in gene expression. The notochord, eye, somites, and rohon beard neurons all showed periods of susceptibility occurring between 24 and 72 hours after fertilization. In addition, the notochord showed a second period of susceptibility between 8 and 32 hours after fertilization. Interestingly, all organs appeared to be recovering by 80 hours after fertilization despite continued exposure to simulated-microgravity. Conclusion These results support the idea that exposure to microgravity can cause changes in gene expression in a variety of developing organ systems in live embryos and that there are periods of maximum susceptibility to the effects.

  4. Abscisic acid induction of vacuolar H+-ATPase activity in mesembryanthemum crystallinum is developmentally regulated

    Science.gov (United States)

    Barkla; Vera-Estrella; Maldonado-Gama; Pantoja

    1999-07-01

    Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways.

  5. Regulation of human protein S gene (PROS1) transcription

    NARCIS (Netherlands)

    Wolf, Cornelia de

    2006-01-01

    This thesis describes the investigation of the transcriptional regulation of the gene for anticoagulant plasma Protein S, PROS1. Protein S is a cofactor for Protein C in the Protein C anticoagulant pathway. The coagulation cascade is negatively regulated by this pathway through inactivation of

  6. Expression analysis of genes implicated in meiotic resumption in vivo and developmental competence

    NARCIS (Netherlands)

    Algriany, O.A.

    2007-01-01

    This thesis investigated the gene expression in bovine oocytes during meiotic resumption, at 6 h post LH surge, coinciding with germinal vesicle breakdown, which was supposed to give a picture of the major cell cycle regulation changes, cytoskeleton rearrangement and chromosome alignment.

  7. Detection of genes regulated by Lmx1b during limb dorsalization.

    Science.gov (United States)

    Feenstra, Jennifer M; Kanaya, Kohei; Pira, Charmaine U; Hoffman, Sarah E; Eppey, Richard J; Oberg, Kerby C

    2012-05-01

    Lmx1b is a homeodomain transcription factor that regulates dorsal identity during limb development. Lmx1b knockout (KO) mice develop distal ventral-ventral limbs. Although induction of Lmx1b is linked to Wnt7a expression in the dorsal limb ectoderm, the downstream targets of Lmx1b that accomplish limb dorsalization are unknown. To identify genes targeted by Lmx1b, we compared gene arrays from Lmx1b KO and wild type mouse limbs during limb dorsalization, i.e., 11.5, 12.5, and 13.5 days post coitum. We identified 54 target genes that were differentially expressed in all three stages. Several skeletal targets, including Emx2, Matrilin1 and Matrilin4, demonstrated a loss of scapular expression in the Lmx1b KO mice, supporting a role for Lmx1b in scapula development. Furthermore, the relative abundance of extracellular matrix-related soft tissue targets regulated by Lmx1b, such as collagens and proteoglycans, suggests a mechanism that includes changes in the extracellular matrix composition to accomplish limb dorsalization. Our study provides the most comprehensive characterization of genes regulated by Lmx1b during limb development to-date and provides targets for further investigation. © 2012 The Authors. Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  8. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  9. The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

    Science.gov (United States)

    Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

    2018-05-01

    Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  11. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    International Nuclear Information System (INIS)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.

    2008-01-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

  12. Regulation of developmental and environmental signaling by interaction between microtubules and membranes in plant cells

    Directory of Open Access Journals (Sweden)

    Qun Zhang

    2015-12-01

    Full Text Available ABSTRACT Cell division and expansion require the ordered arrangement of microtubules, which are subject to spatial and temporal modifications by developmental and environmental factors. Understanding how signals translate to changes in cortical microtubule organization is of fundamental importance. A defining feature of the cortical microtubule array is its association with the plasma membrane; modules of the plasma membrane are thought to play important roles in the mediation of microtubule organization. In this review, we highlight advances in research on the regulation of cortical microtubule organization by membrane-associated and membrane-tethered proteins and lipids in response to phytohormones and stress. The transmembrane kinase receptor Rho-like guanosine triphosphatase, phospholipase D, phosphatidic acid, and phosphoinositides are discussed with a focus on their roles in microtubule organization.

  13. Developmental expression of “germline”- and “sex determination”-related genes in the ctenophore Mnemiopsis leidyi

    Directory of Open Access Journals (Sweden)

    Adam M. Reitzel

    2016-08-01

    Full Text Available Abstract Background An essential developmental pathway in sexually reproducing animals is the specification of germ cells and the differentiation of mature gametes, sperm and oocytes. The “germline” genes vasa, nanos and piwi are commonly identified in primordial germ cells, suggesting a molecular signature for the germline throughout animals. However, these genes are also expressed in a diverse set of somatic stem cells throughout the animal kingdom leaving open significant questions for whether they are required for germline specification. Similarly, members of the Dmrt gene family are essential components regulating sex determination and differentiation in bilaterian animals, but the functions of these transcription factors, including potential roles in sex determination, in early diverging animals remain unknown. The phylogenetic position of ctenophores and the genome sequence of the lobate Mnemiopsis leidyi motivated us to determine the compliment of these gene families in this species and determine expression patterns during development. Results Our phylogenetic analyses of the vasa, piwi and nanos gene families show that Mnemiopsis has multiple genes in each family with multiple lineage-specific paralogs. Expression domains of Mnemiopsis nanos, vasa and piwi, during embryogenesis from fertilization to the cydippid stage, were diverse, with little overlapping expression and no or little expression in what we think are the germ cells or gametogenic regions. piwi paralogs in Mnemiopsis had distinct expression domains in the ectoderm during development. We observed overlapping expression domains in the apical organ and tentacle apparatus of the cydippid for a subset of “germline genes,” which are areas of high cell proliferation, suggesting that these genes are involved with “stem cell” specification and maintenance. Similarly, the five Dmrt genes show diverse non-overlapping expression domains, with no clear evidence for

  14. Gene regulation by MAP kinase cascades

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Petersen, Klaus; Petersen, Morten

    2009-01-01

    Mitogen-activated protein kinase (MAPK) cascades are signaling modules that transduce extracellular stimuli to a range of cellular responses. Research in yeast and metazoans has shown that MAPK-mediated phosphorylation directly or indirectly regulates the activity of transcription factors. Plant ...

  15. Nitrogen assimilation system in maize is regulated by developmental and tissue-specific mechanisms

    KAUST Repository

    Plett, Darren

    2016-08-10

    Key message: We found metabolites, enzyme activities and enzyme transcript abundances vary significantly across the maize lifecycle, but weak correlation exists between the three groups. We identified putative genes regulating nitrate assimilation. Abstract: Progress in improving nitrogen (N) use efficiency (NUE) of crop plants has been hampered by the complexity of the N uptake and utilisation systems. To understand this complexity we measured the activities of seven enzymes and ten metabolites related to N metabolism in the leaf and root tissues of Gaspe Flint maize plants grown in 0.5 or 2.5 mM NO3 − throughout the lifecycle. The amino acids had remarkably similar profiles across the lifecycle except for transient responses, which only appeared in the leaves for aspartate or in the roots for asparagine, serine and glycine. The activities of the enzymes for N assimilation were also coordinated to a certain degree, most noticeably with a peak in root activity late in the lifecycle, but with wide variation in the activity levels over the course of development. We analysed the transcriptional data for gene sets encoding the measured enzymes and found that, unlike the enzyme activities, transcript levels of the corresponding genes did not exhibit the same coordination across the lifecycle and were only weakly correlated with the levels of various amino acids or individual enzyme activities. We identified gene sets which were correlated with the enzyme activity profiles, including seven genes located within previously known quantitative trait loci for enzyme activities and hypothesise that these genes are important for the regulation of enzyme activities. This work provides insights into the complexity of the N assimilation system throughout development and identifies candidate regulatory genes, which warrant further investigation in efforts to improve NUE in crop plants. © 2016, Springer Science+Business Media Dordrecht.

  16. Nitrogen assimilation system in maize is regulated by developmental and tissue-specific mechanisms

    KAUST Repository

    Plett, Darren; Holtham, Luke; Baumann, Ute; Kalashyan, Elena; Francis, Karen; Enju, Akiko; Toubia, John; Roessner, Ute; Bacic, Antony; Rafalski, Antoni; Dhugga, Kanwarpal S.; Tester, Mark A.; Garnett, Trevor; Kaiser, Brent N.

    2016-01-01

    Key message: We found metabolites, enzyme activities and enzyme transcript abundances vary significantly across the maize lifecycle, but weak correlation exists between the three groups. We identified putative genes regulating nitrate assimilation. Abstract: Progress in improving nitrogen (N) use efficiency (NUE) of crop plants has been hampered by the complexity of the N uptake and utilisation systems. To understand this complexity we measured the activities of seven enzymes and ten metabolites related to N metabolism in the leaf and root tissues of Gaspe Flint maize plants grown in 0.5 or 2.5 mM NO3 − throughout the lifecycle. The amino acids had remarkably similar profiles across the lifecycle except for transient responses, which only appeared in the leaves for aspartate or in the roots for asparagine, serine and glycine. The activities of the enzymes for N assimilation were also coordinated to a certain degree, most noticeably with a peak in root activity late in the lifecycle, but with wide variation in the activity levels over the course of development. We analysed the transcriptional data for gene sets encoding the measured enzymes and found that, unlike the enzyme activities, transcript levels of the corresponding genes did not exhibit the same coordination across the lifecycle and were only weakly correlated with the levels of various amino acids or individual enzyme activities. We identified gene sets which were correlated with the enzyme activity profiles, including seven genes located within previously known quantitative trait loci for enzyme activities and hypothesise that these genes are important for the regulation of enzyme activities. This work provides insights into the complexity of the N assimilation system throughout development and identifies candidate regulatory genes, which warrant further investigation in efforts to improve NUE in crop plants. © 2016, Springer Science+Business Media Dordrecht.

  17. Glucose Regulates the Expression of the Apolipoprotein A5 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey; Jakel, Heidelinde; Moitrot, Emmanuelle; Rommens, Corinne; Pennacchio, Len A.; Fruchart-Najib, Jamila; Fruchart, Jean-Charles

    2008-04-07

    The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter. We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.

  18. RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

    Science.gov (United States)

    Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

    2017-05-01

    To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p  0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

  19. Apoplastic and intracellular plant sugars regulate developmental transitions in witches' broom disease of cacao.

    Science.gov (United States)

    Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

    2015-03-01

    Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao

    Science.gov (United States)

    Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães

    2015-01-01

    Witches’ broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant–fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. PMID:25540440

  1. Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle

    International Nuclear Information System (INIS)

    Sherman, S.J.

    1985-01-01

    The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel

  2. Analysis of a lin-42/period Null Allele Implicates All Three Isoforms in Regulation of Caenorhabditis elegans Molting and Developmental Timing

    Directory of Open Access Journals (Sweden)

    Theresa L. B. Edelman

    2016-12-01

    Full Text Available The Caenorhabditis elegans heterochronic gene pathway regulates the relative timing of events during postembryonic development. lin-42, the worm homolog of the circadian clock gene, period, is a critical element of this pathway. lin-42 function has been defined by a set of hypomorphic alleles that cause precocious phenotypes, in which later developmental events, such as the terminal differentiation of hypodermal cells, occur too early. A subset of alleles also reveals a significant role for lin-42 in molting; larval stages are lengthened and ecdysis often fails in these mutant animals. lin-42 is a complex locus, encoding overlapping and nonoverlapping isoforms. Although existing alleles that affect subsets of isoforms have illuminated important and distinct roles for this gene in developmental timing, molting, and the decision to enter the alternative dauer state, it is essential to have a null allele to understand all of the roles of lin-42 and its individual isoforms. To remedy this problem and discover the null phenotype, we engineered an allele that deletes the entire lin-42 protein-coding region. lin-42 null mutants are homozygously viable, but have more severe phenotypes than observed in previously characterized hypomorphic alleles. We also provide additional evidence for this conclusion by using the null allele as a base for reintroducing different isoforms, showing that each isoform can provide heterochronic and molting pathway activities. Transcript levels of the nonoverlapping isoforms appear to be under coordinate temporal regulation, despite being driven by independent promoters. The lin-42 null allele will continue to be an important tool for dissecting the functions of lin-42 in molting and developmental timing.

  3. Intrinsic limits to gene regulation by global crosstalk

    Science.gov (United States)

    Friedlander, Tamar; Prizak, Roshan; Guet, Călin C.; Barton, Nicholas H.; Tkačik, Gašper

    2016-01-01

    Gene regulation relies on the specificity of transcription factor (TF)–DNA interactions. Limited specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to noncognate TF–DNA interactions or remains erroneously inactive. As each TF can have numerous interactions with noncognate cis-regulatory elements, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyse the effects of global crosstalk on gene regulation. We find that crosstalk presents a significant challenge for organisms with low-specificity TFs, such as metazoans. Crosstalk is not easily mitigated by known regulatory schemes acting at equilibrium, including variants of cooperativity and combinatorial regulation. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. PMID:27489144

  4. Characterization of cucurbita maxima phloem serpin-1 (CmPS-1). A developmentally regulated elastase inhibitor.

    Science.gov (United States)

    Yoo, B C; Aoki, K; Xiang, Y; Campbell, L R; Hull, R J; Xoconostle-Cázares, B; Monzer, J; Lee, J Y; Ullman, D E; Lucas, W J

    2000-11-10

    We report on the molecular, biochemical, and functional characterization of Cucurbita maxima phloem serpin-1 (CmPS-1), a novel 42-kDa serine proteinase inhibitor that is developmentally regulated and has anti-elastase properties. CmPS-1 was purified to near homogeneity from C. maxima (pumpkin) phloem exudate and, based on microsequence analysis, the cDNA encoding CmPS-1 was cloned. The association rate constant (k(a)) of phloem-purified and recombinant His(6)-tagged CmPS-1 for elastase was 3.5 +/- 1.6 x 10(5) and 2.7 +/- 0.4 x 10(5) m(-)(1) s(-)(1), respectively. The fraction of complex-forming CmPS-1, X(inh), was estimated at 79%. CmPS-1 displayed no detectable inhibitory properties against chymotrypsin, trypsin, or thrombin. The elastase cleavage sites within the reactive center loop of CmPS-1 were determined to be Val(347)-Gly(348) and Val(350)-Ser(351) with a 3:2 molar ratio. In vivo feeding assays conducted with the piercing-sucking aphid, Myzus persicae, established a close correlation between the developmentally regulated increase in CmPS-1 within the phloem sap and the reduced ability of these insects to survive and reproduce on C. maxima. However, in vitro feeding experiments, using purified phloem CmPS-1, failed to demonstrate a direct effect on aphid survival. Likely roles of this novel phloem serpin in defense against insects/pathogens are discussed.

  5. Elucidation of functional markers from Aspergillus nidulans developmental regulator FlbB and their phylogenetic distribution.

    Directory of Open Access Journals (Sweden)

    Marc S Cortese

    Full Text Available Aspergillus nidulans is a filamentous fungus widely used as a model for biotechnological and clinical research. It is also used as a platform for the study of basic eukaryotic developmental processes. Previous studies identified and partially characterized a set of proteins controlling cellular transformations in this ascomycete. Among these proteins, the bZip type transcription factor FlbB is a key regulator of reproduction, stress responses and cell-death. Our aim here was the prediction, through various bioinformatic methods, of key functional residues and motifs within FlbB in order to inform the design of future laboratory experiments and further the understanding of the molecular mechanisms that control fungal development. A dataset of FlbB orthologs and those of its key interaction partner FlbE was assembled from 40 members of the Pezizomycotina. Unique features were identified in each of the three structural domains of FlbB. The N-terminal region encoded a bZip transcription factor domain with a novel histidine-containing DNA binding motif while the dimerization determinants exhibited two distinct profiles that segregated by class. The C-terminal region of FlbB showed high similarity with the AP-1 family of stress response regulators but with variable patterns of conserved cysteines that segregated by class and order. Motif conservation analysis revealed that nine FlbB orthologs belonging to the Eurotiales order contained a motif in the central region that could mediate interaction with FlbE. The key residues and motifs identified here provide a basis for the design of follow-up experimental investigations. Additionally, the presence or absence of these residues and motifs among the FlbB orthologs could help explain the differences in the developmental programs among fungal species as well as define putative complementation groups that could serve to extend known functional characterizations to other species.

  6. Interpersonal Stress Regulation and the Development of Anxiety Disorders: An Attachment-Based Developmental Framework

    Science.gov (United States)

    Nolte, Tobias; Guiney, Jo; Fonagy, Peter; Mayes, Linda C.; Luyten, Patrick

    2011-01-01

    Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the etiology and maintenance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework. The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety, and activation of the attachment system. This interplay directly affects the development of social–cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualized as the key organizer of a complex interplay between genetic, environmental, and epigenetic contributions to the development of anxiety disorders – a multifactorial etiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterized by hyperactivation strategies in the face of anxiety. The cumulative allostatic load and subsequent “wear and tear” effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments are outlined. PMID

  7. Interpersonal stress regulation and the development of anxiety disorders: an attachment-based developmental framework

    Directory of Open Access Journals (Sweden)

    Tobias eNolte

    2011-09-01

    Full Text Available Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the aetiology and maintainance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework.The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety and activation of the attachment system. This interplay directly affects the development of social cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualised as the key organiser of a complex interplay between genetic, environmental and epigentic contributions to the development of anxiety disorders – a multifactorial aetiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterised by hyperactivation strategies in the face of anxiety.In the model, the cumulative allostatic load and subsequent wear and tear effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments

  8. Post-transcriptional regulation of gene expression in Yersinia species

    Directory of Open Access Journals (Sweden)

    Chelsea A Schiano

    2012-11-01

    Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.

  9. The NSL Complex Regulates Housekeeping Genes in Drosophila

    Science.gov (United States)

    Raja, Sunil Jayaramaiah; Holz, Herbert; Luscombe, Nicholas M.; Manke, Thomas; Akhtar, Asifa

    2012-01-01

    MOF is the major histone H4 lysine 16-specific (H4K16) acetyltransferase in mammals and Drosophila. In flies, it is involved in the regulation of X-chromosomal and autosomal genes as part of the MSL and the NSL complexes, respectively. While the function of the MSL complex as a dosage compensation regulator is fairly well understood, the role of the NSL complex in gene regulation is still poorly characterized. Here we report a comprehensive ChIP–seq analysis of four NSL complex members (NSL1, NSL3, MBD-R2, and MCRS2) throughout the Drosophila melanogaster genome. Strikingly, the majority (85.5%) of NSL-bound genes are constitutively expressed across different cell types. We find that an increased abundance of the histone modifications H4K16ac, H3K4me2, H3K4me3, and H3K9ac in gene promoter regions is characteristic of NSL-targeted genes. Furthermore, we show that these genes have a well-defined nucleosome free region and broad transcription initiation patterns. Finally, by performing ChIP–seq analyses of RNA polymerase II (Pol II) in NSL1- and NSL3-depleted cells, we demonstrate that both NSL proteins are required for efficient recruitment of Pol II to NSL target gene promoters. The observed Pol II reduction coincides with compromised binding of TBP and TFIIB to target promoters, indicating that the NSL complex is required for optimal recruitment of the pre-initiation complex on target genes. Moreover, genes that undergo the most dramatic loss of Pol II upon NSL knockdowns tend to be enriched in DNA Replication–related Element (DRE). Taken together, our findings show that the MOF-containing NSL complex acts as a major regulator of housekeeping genes in flies by modulating initiation of Pol II transcription. PMID:22723752

  10. Genome-Wide Analysis of the Expression of WRKY Family Genes in Different Developmental Stages of Wild Strawberry (Fragaria vesca Fruit.

    Directory of Open Access Journals (Sweden)

    Heying Zhou

    Full Text Available WRKY proteins play important regulatory roles in plant developmental processes such as senescence, trichome initiation and embryo morphogenesis. In strawberry, only FaWRKY1 (Fragaria × ananassa has been characterized, leaving numerous WRKY genes to be identified and their function characterized. The publication of the draft genome sequence of the strawberry genome allowed us to conduct a genome-wide search for WRKY proteins in Fragaria vesca, and to compare the identified proteins with their homologs in model plants. Fifty-nine FvWRKY genes were identified and annotated from the F. vesca genome. Detailed analysis, including gene classification, annotation, phylogenetic evaluation, conserved motif determination and expression profiling, based on RNA-seq data, were performed on all members of the family. Additionally, the expression patterns of the WRKY genes in different fruit developmental stages were further investigated using qRT-PCR, to provide a foundation for further comparative genomics and functional studies of this important class of transcriptional regulators in strawberry.

  11. The axon guidance receptor gene ROBO1 is a candidate gene for developmental dyslexia.

    Directory of Open Access Journals (Sweden)

    Katariina Hannula-Jouppi

    2005-10-01

    Full Text Available Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples, the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

  12. The Axon Guidance Receptor Gene ROBO1 Is a Candidate Gene for Developmental Dyslexia.

    Directory of Open Access Journals (Sweden)

    2005-10-01

    Full Text Available Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples, the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

  13. Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

    Science.gov (United States)

    Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi

    2017-10-01

    Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Molecular diagnosis of patients with epilepsy and developmental delay using a customized panel of epilepsy genes.

    Directory of Open Access Journals (Sweden)

    Laura Ortega-Moreno

    Full Text Available Pediatric epilepsies are a group of disorders with a broad phenotypic spectrum that are associated with great genetic heterogeneity, thus making sequential single-gene testing an impractical basis for diagnostic strategy. The advent of next-generation sequencing has increased the success rate of epilepsy diagnosis, and targeted resequencing using genetic panels is the a most cost-effective choice. We report the results found in a group of 87 patients with epilepsy and developmental delay using targeted next generation sequencing (custom-designed Haloplex panel. Using this gene panel, we were able to identify disease-causing variants in 17 out of 87 (19.5% analyzed patients, all found in known epilepsy-associated genes (KCNQ2, CDKL5, STXBP1, SCN1A, PCDH19, POLG, SLC2A1, ARX, ALG13, CHD2, SYNGAP1, and GRIN1. Twelve of 18 variants arose de novo and 6 were novel. The highest yield was found in patients with onset in the first years of life, especially in patients classified as having early-onset epileptic encephalopathy. Knowledge of the underlying genetic cause provides essential information on prognosis and could be used to avoid unnecessary studies, which may result in a greater diagnostic cost-effectiveness.

  15. Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.

    Science.gov (United States)

    Huang, Tao; Ma, Liqun; Krimm, Robin F

    2015-09-15

    The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

    Science.gov (United States)

    Huang, Tao; Ma, Liqun; Krimm, Robin F

    2015-01-01

    The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

  17. Altered cortical expression of GABA-related genes in schizophrenia: illness progression vs developmental disturbance.

    Science.gov (United States)

    Hoftman, Gil D; Volk, David W; Bazmi, H Holly; Li, Siyu; Sampson, Allan R; Lewis, David A

    2015-01-01

    Schizophrenia is a neurodevelopmental disorder with altered expression of GABA-related genes in the prefrontal cortex (PFC). However, whether these gene expression abnormalities reflect disturbances in postnatal developmental processes before clinical onset or arise as a consequence of clinical illness remains unclear. Expression levels for 7 GABA-related transcripts (vesicular GABA transporter [vGAT], GABA membrane transporter [GAT1], GABAA receptor subunit α1 [GABRA1] [novel in human and monkey cohorts], glutamic acid decarboxylase 67 [GAD67], parvalbumin, calretinin, and somatostatin [previously reported in human cohort, but not in monkey cohort]) were quantified in the PFC from 42 matched pairs of schizophrenia and comparison subjects and from 49 rhesus monkeys ranging in age from 1 week postnatal to adulthood. Levels of vGAT and GABRA1, but not of GAT1, messenger RNAs (mRNAs) were lower in the PFC of the schizophrenia subjects. As previously reported, levels of GAD67, parvalbumin, and somatostatin, but not of calretinin, mRNAs were also lower in these subjects. Neither illness duration nor age accounted for the levels of the transcripts with altered expression in schizophrenia. In monkey PFC, developmental changes in expression levels of many of these transcripts were in the opposite direction of the changes observed in schizophrenia. For example, mRNA levels for vGAT, GABRA1, GAD67, and parvalbumin all increased with age. Together with published reports, these findings support the interpretation that the altered expression of GABA-related transcripts in schizophrenia reflects a blunting of normal postnatal development changes, but they cannot exclude a decline during the early stages of clinical illness. © The Author 2013. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  18. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  19. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    Science.gov (United States)

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  20. Social Regulation of Gene Expression in Threespine Sticklebacks.

    Directory of Open Access Journals (Sweden)

    Anna K Greenwood

    Full Text Available Identifying genes that are differentially expressed in response to social interactions is informative for understanding the molecular basis of social behavior. To address this question, we described changes in gene expression as a result of differences in the extent of social interactions. We housed threespine stickleback (Gasterosteus aculeatus females in either group conditions or individually for one week, then measured levels of gene expression in three brain regions using RNA-sequencing. We found that numerous genes in the hindbrain/cerebellum had altered expression in response to group or individual housing. However, relatively few genes were differentially expressed in either the diencephalon or telencephalon. The list of genes upregulated in fish from social groups included many genes related to neural development and cell adhesion as well as genes with functions in sensory signaling, stress, and social and reproductive behavior. The list of genes expressed at higher levels in individually-housed fish included several genes previously identified as regulated by social interactions in other animals. The identified genes are interesting targets for future research on the molecular mechanisms of normal social interactions.

  1. Untangling the Contributions of Sex-Specific Gene Regulation and X-Chromosome Dosage to Sex-Biased Gene Expression in Caenorhabditis elegans

    Science.gov (United States)

    Kramer, Maxwell; Rao, Prashant; Ercan, Sevinc

    2016-01-01

    Dosage compensation mechanisms equalize the level of X chromosome expression between sexes. Yet the X chromosome is often enriched for genes exhibiting sex-biased, i.e., imbalanced expression. The relationship between X chromosome dosage compensation and sex-biased gene expression remains largely unexplored. Most studies determine sex-biased gene expression without distinguishing between contributions from X chromosome copy number (dose) and the animal’s sex. Here, we uncoupled X chromosome dose from sex-specific gene regulation in Caenorhabditis elegans to determine the effect of each on X expression. In early embryogenesis, when dosage compensation is not yet fully active, X chromosome dose drives the hermaphrodite-biased expression of many X-linked genes, including several genes that were shown to be responsible for hermaphrodite fate. A similar effect is seen in the C. elegans germline, where X chromosome dose contributes to higher hermaphrodite X expression, suggesting that lack of dosage compensation in the germline may have a role in supporting higher expression of X chromosomal genes with female-biased functions in the gonad. In the soma, dosage compensation effectively balances X expression between the sexes. As a result, somatic sex-biased expression is almost entirely due to sex-specific gene regulation. These results suggest that lack of dosage compensation in different tissues and developmental stages allow X chromosome copy number to contribute to sex-biased gene expression and function. PMID:27356611

  2. Targeting developmental regulators of zebrafish exocrine pancreas as a therapeutic approach in human pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Nelson S. Yee

    2012-02-01

    Histone deacetylases (HDACs and RNA polymerase III (POLR3 play vital roles in fundamental cellular processes, and deregulation of these enzymes has been implicated in malignant transformation. Hdacs and Polr3 are required for exocrine pancreatic epithelial proliferation during morphogenesis in zebrafish. We aim to test the hypothesis that Hdacs and Polr3 cooperatively control exocrine pancreatic growth, and combined inhibition of HDACs and POLR3 produces enhanced growth suppression in pancreatic cancer. In zebrafish larvae, combination of a Hdac inhibitor (Trichostatin A and an inhibitor of Polr3 (ML-60218 synergistically prohibited the expansion of exocrine pancreas. In human pancreatic adenocarcinoma cells, combination of the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA and ML-60218 produced augmented suppression of colony formation and proliferation, and induction of cell cycle arrest and apoptotic cell death. The enhanced cytotoxicity was associated with supra-additive upregulation of the pro-apoptotic regulator BAX and the cyclin-dependent kinase inhibitor p21CDKN1A. tRNAs have been shown to have pro-proliferative and anti-apoptotic roles, and SAHA-stimulated expression of tRNAs was reversed by ML-60218. These findings demonstrate that chemically targeting developmental regulators of exocrine pancreas can be translated into an approach with potential impact on therapeutic response in pancreatic cancer, and suggest that counteracting the pro-malignant side effect of HDAC inhibitors can enhance their anti-tumor activity.

  3. On the developmental and environmental regulation of secondary metabolism in Vaccinium spp. berries

    Directory of Open Access Journals (Sweden)

    Katja eKarppinen

    2016-05-01

    Full Text Available Secondary metabolites have important defense and signaling roles, and they contribute to the overall quality of developing and ripening fruits. Blueberries, bilberries, cranberries and other Vaccinium berries are fleshy berry fruits recognized for the high levels of bioactive compounds, especially anthocyanin pigments. Besides anthocyanins and other products of the phenylpropanoid and flavonoid pathways, these berries also contain other metabolites of interest, such as carotenoid derivatives, vitamins and flavor compounds. Recently, new information has been achieved on the mechanisms related with developmental, environmental and genetic factors involved in the regulation of secondary metabolism in Vaccinium fruits. Especially light conditions and temperature are demonstrated to have a prominent role on the composition of phenolic compounds. The present review focuses on the studies on mechanisms associated with the regulation of key secondary metabolites, mainly phenolic compounds, in Vaccinium berries. The advances in the research concerning biosynthesis of phenolic compounds in Vaccinium species, including specific studies with mutant genotypes in addition to controlled and field experiments on the genotype x environment (GxE interaction, are discussed. The recently published Vaccinium transcriptome and genome databases provide new tools for the studies on the metabolic routes.

  4. Inferring Gene Regulatory Networks Using Conditional Regulation Pattern to Guide Candidate Genes.

    Directory of Open Access Journals (Sweden)

    Fei Xiao

    Full Text Available Combining path consistency (PC algorithms with conditional mutual information (CMI are widely used in reconstruction of gene regulatory networks. CMI has many advantages over Pearson correlation coefficient in measuring non-linear dependence to infer gene regulatory networks. It can also discriminate the direct regulations from indirect ones. However, it is still a challenge to select the conditional genes in an optimal way, which affects the performance and computation complexity of the PC algorithm. In this study, we develop a novel conditional mutual information-based algorithm, namely RPNI (Regulation Pattern based Network Inference, to infer gene regulatory networks. For conditional gene selection, we define the co-regulation pattern, indirect-regulation pattern and mixture-regulation pattern as three candidate patterns to guide the selection of candidate genes. To demonstrate the potential of our algorithm, we apply it to gene expression data from DREAM challenge. Experimental results show that RPNI outperforms existing conditional mutual information-based methods in both accuracy and time complexity for different sizes of gene samples. Furthermore, the robustness of our algorithm is demonstrated by noisy interference analysis using different types of noise.

  5. Mig-6 regulates endometrial genes involved in cell cycle and progesterone signaling

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Jung-Yoon; Kim, Tae Hoon; Lee, Jae Hee [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Dunwoodie, Sally L. [Developmental and Stem Cell Biology Division, Victor Chang Cardiac Research Institute, Darlinghurst, New South Wales 2010 (Australia); St. Vincent' s Clinical School and the School of Biotechnology and Biomolecular Sciences, University of New South Wales, Kensington, New South Wales 2033 (Australia); Ku, Bon Jeong, E-mail: bonjeong@cnu.ac.kr [Department of Internal Medicine, Chungnam National University School of Medicine, Daejeon (Korea, Republic of); Jeong, Jae-Wook, E-mail: JaeWook.Jeong@hc.msu.edu [Department of Obstetrics, Gynecology & Reproductive Biology, Michigan State University, Grand Rapids, MI (United States); Department of Women' s Health, Spectrum Health System, Grand Rapids, MI (United States)

    2015-07-10

    Mitogen inducible gene 6 (Mig-6) is an important mediator of progesterone (P4) signaling to inhibit estrogen (E2) signaling in the uterus. Ablation of Mig-6 in the murine uterus leads to the development of endometrial hyperplasia and E2-induced endometrial cancer. To identify the molecular pathways regulated by Mig-6, we performed microarray analysis on the uterus of ovariectomized Mig-6{sup f/f} and PGR{sup cre/+}Mig-6{sup f/f} (Mig-6{sup d/d}) mice treated with vehicle or P4 for 6 h. The results revealed that 772 transcripts were significantly regulated in the Mig-6{sup d/d} uterus treated with vehicle as compared with Mig-6{sup f/f} mice. The pathway analysis showed that Mig-6 suppressed the expression of gene-related cell cycle regulation in the absence of ovarian steroid hormone. The epithelium of Mig-6{sup d/d} mice showed a significant increase in the number of proliferative cells compared to Mig-6{sup f/f} mice. This microarray analysis also revealed that 324 genes are regulated by P4 as well as Mig-6. Cited2, the developmentally important transcription factor, was identified as being regulated by the P4-Mig-6 axis. To determine the role of Cited2 in the uterus, we used the mice with Cited2 that were conditionally ablated in progesterone receptor-positive cells (PGR{sup cre/+}Cited2{sup f/f}; Cited2{sup d/d}). Ablation of Cited2 in the uterus resulted in a significant reduction in the ability of the uterus to undergo a hormonally induced decidual reaction. Identification and analysis of these responsive genes will help define the role of P4 as well as Mig-6 in regulating uterine biology. - Highlights: • We identify Mig-6- and P4-regulated uterine genes by microarray analysis. • Mig-6 suppresses cell cycle progression and epithelial cell proliferation in uterus. • We identify the Mig-6 dependent induced genes by P4. • Cited2 plays an important role for decidualization as a P4 and Mig-6 target gene.

  6. The dynamic landscape of gene regulation during Bombyx mori oogenesis.

    Science.gov (United States)

    Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze

    2017-09-11

    Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.

  7. CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.

    Science.gov (United States)

    Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A

    2012-07-01

    Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

  8. Endogenous TasiRNAs mediate non-cell autonomous effects on gene regulation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Rebecca Schwab

    Full Text Available BACKGROUND: Different classes of small RNAs (sRNAs refine the expression of numerous genes in higher eukaryotes by directing protein partners to complementary nucleic acids, where they mediate gene silencing. Plants encode a unique class of sRNAs, called trans-acting small interfering RNAs (tasiRNAs, which post-transcriptionally regulate protein-coding transcripts, as do microRNAs (miRNAs, and both sRNA classes control development through their targets. TasiRNA biogenesis requires multiple components of the siRNA pathway and also miRNAs. But while 21mer siRNAs originating from transgenes can mediate silencing across several cell layers, miRNA action seems spatially restricted to the producing or closely surrounding cells. PRINCIPAL FINDINGS: We have previously described the isolation of a genetrap reporter line for TAS3a, the major locus producing AUXIN RESPONS FACTOR (ARF-regulating tasiRNAs in the Arabidopsis shoot. Its activity is limited to the adaxial (upper side of leaf primordia, thus spatially isolated from ARF-activities, which are located in the abaxial (lower side. We show here by in situ hybridization and reporter fusions that the silencing activities of ARF-regulating tasiRNAs are indeed manifested non-cell autonomously to spatially control ARF activities. CONCLUSIONS/SIGNIFICANCE: Endogenous tasiRNAs are thus mediators of a mobile developmental signal and might provide effective gene silencing at a distance beyond the reach of most miRNAs.

  9. PHF6 regulates phenotypic plasticity through chromatin organization within lineage-specific genes.

    Science.gov (United States)

    Soto-Feliciano, Yadira M; Bartlebaugh, Jordan M E; Liu, Yunpeng; Sánchez-Rivera, Francisco J; Bhutkar, Arjun; Weintraub, Abraham S; Buenrostro, Jason D; Cheng, Christine S; Regev, Aviv; Jacks, Tyler E; Young, Richard A; Hemann, Michael T

    2017-05-15

    Developmental and lineage plasticity have been observed in numerous malignancies and have been correlated with tumor progression and drug resistance. However, little is known about the molecular mechanisms that enable such plasticity to occur. Here, we describe the function of the plant homeodomain finger protein 6 (PHF6) in leukemia and define its role in regulating chromatin accessibility to lineage-specific transcription factors. We show that loss of Phf6 in B-cell leukemia results in systematic changes in gene expression via alteration of the chromatin landscape at the transcriptional start sites of B-cell- and T-cell-specific factors. Additionally, Phf6 KO cells show significant down-regulation of genes involved in the development and function of normal B cells, show up-regulation of genes involved in T-cell signaling, and give rise to mixed-lineage lymphoma in vivo. Engagement of divergent transcriptional programs results in phenotypic plasticity that leads to altered disease presentation in vivo, tolerance of aberrant oncogenic signaling, and differential sensitivity to frontline and targeted therapies. These findings suggest that active maintenance of a precise chromatin landscape is essential for sustaining proper leukemia cell identity and that loss of a single factor (PHF6) can cause focal changes in chromatin accessibility and nucleosome positioning that render cells susceptible to lineage transition. © 2017 Soto-Feliciano et al.; Published by Cold Spring Harbor Laboratory Press.

  10. DAG1, no gene for RNA regulation?

    Science.gov (United States)

    Brancaccio, Andrea

    2012-04-10

    DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  12. Epigenetic regulation on the gene expression signature in esophagus adenocarcinoma.

    Science.gov (United States)

    Xi, Ting; Zhang, Guizhi

    2017-02-01

    Understanding the molecular mechanisms represents an important step in the development of diagnostic and therapeutic measures of esophagus adenocarcinoma (NOS). The objective of this study is to identify the epigenetic regulation on gene expression in NOS, shedding light on the molecular mechanisms of NOS. In this study, 78 patients with NOS were included and the data of mRNA, miRNA and DNA methylation of were downloaded from The Cancer Genome Atlas (TCGA). Differential analysis between NOS and controls was performed in terms of gene expression, miRNA expression, and DNA methylation. Bioinformatic analysis was followed to explore the regulation mechanisms of miRNA and DNA methylationon gene expression. Totally, up to 1320 differentially expressed genes (DEGs) and 32 differentially expressed miRNAs were identified. 240 DEGs that were not only the target genes but also negatively correlated with the screened differentially expressed miRNAs. 101 DEGs were found to be highlymethylated in CpG islands. Then, 8 differentially methylated genes (DMGs) were selected, which showed down-regulated expression in NOS. Among of these genes, 6 genes including ADHFE1, DPP6, GRIA4, CNKSR2, RPS6KA6 and ZNF135 were target genes of differentially expressed miRNAs (hsa-mir-335, hsa-mir-18a, hsa-mir-93, hsa-mir-106b and hsa-mir-21). The identified altered miRNA, genes and DNA methylation site may be applied as biomarkers for diagnosis and prognosis of NOS. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. Abscisic Acid Induction of Vacuolar H+-ATPase Activity in Mesembryanthemum crystallinum Is Developmentally Regulated1

    Science.gov (United States)

    Barkla, Bronwyn J.; Vera-Estrella, Rosario; Maldonado-Gama, Minerva; Pantoja, Omar

    1999-01-01

    Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways. PMID:10398716

  14. Regulation of gene expression in Escherichia coli and its bacteriophage

    International Nuclear Information System (INIS)

    Higgins, C.F.

    1986-01-01

    This chapter reviews the study of prokaryotic gene expression beginning with a look at the regulation of the lactose operon and the mechanism of attenuation in the tryptophan operon to the more recent development of recombinant DNA technology. The chapter deals almost entirely with escherichia coli and its bacteriophage. The only experimental technique which the authors explore in some detail is the construction and use of gene and operon fusions which have revolutionized the study of gene expression. Various mechanisms by which E. Coli regulate the cellular levels of individual messenger-RNA species are described. Translational regulation of the cellular levels of messenger-RNA include signals encoded within the messenger-RNA molecule itself and regulatory molecules which interact with the messenger-RNA and alter it translational efficiency

  15. Gene profile analysis of osteoblast genes differentially regulated by histone deacetylase inhibitors

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2007-10-01

    Full Text Available Abstract Background Osteoblast differentiation requires the coordinated stepwise expression of multiple genes. Histone deacetylase inhibitors (HDIs accelerate the osteoblast differentiation process by blocking the activity of histone deacetylases (HDACs, which alter gene expression by modifying chromatin structure. We previously demonstrated that HDIs and HDAC3 shRNAs accelerate matrix mineralization and the expression of osteoblast maturation genes (e.g. alkaline phosphatase, osteocalcin. Identifying other genes that are differentially regulated by HDIs might identify new pathways that contribute to osteoblast differentiation. Results To identify other osteoblast genes that are altered early by HDIs, we incubated MC3T3-E1 preosteoblasts with HDIs (trichostatin A, MS-275, or valproic acid for 18 hours in osteogenic conditions. The promotion of osteoblast differentiation by HDIs in this experiment was confirmed by osteogenic assays. Gene expression profiles relative to vehicle-treated cells were assessed by microarray analysis with Affymetrix GeneChip 430 2.0 arrays. The regulation of several genes by HDIs in MC3T3-E1 cells and primary osteoblasts was verified by quantitative real-time PCR. Nine genes were differentially regulated by at least two-fold after exposure to each of the three HDIs and six were verified by PCR in osteoblasts. Four of the verified genes (solute carrier family 9 isoform 3 regulator 1 (Slc9a3r1, sorbitol dehydrogenase 1, a kinase anchor protein, and glutathione S-transferase alpha 4 were induced. Two genes (proteasome subunit, beta type 10 and adaptor-related protein complex AP-4 sigma 1 were suppressed. We also identified eight growth factors and growth factor receptor genes that are significantly altered by each of the HDIs, including Frizzled related proteins 1 and 4, which modulate the Wnt signaling pathway. Conclusion This study identifies osteoblast genes that are regulated early by HDIs and indicates pathways that

  16. Effects of Larval Density on Gene Regulation in Caenorhabditis elegans During Routine L1 Synchronization.

    Science.gov (United States)

    Chan, Io Long; Rando, Oliver J; Conine, Colin C

    2018-05-04

    Bleaching gravid C. elegans followed by a short period of starvation of the L1 larvae is a routine method performed by worm researchers for generating synchronous populations for experiments. During the process of investigating dietary effects on gene regulation in L1 stage worms by single-worm RNA-Seq, we found that the density of resuspended L1 larvae affects expression of many mRNAs. Specifically, a number of genes related to metabolism and signaling are highly expressed in worms arrested at low density, but are repressed at higher arrest densities. We generated a GFP reporter strain based on one of the most density-dependent genes in our dataset - lips-15 - and confirmed that this reporter was expressed specifically in worms arrested at relatively low density. Finally, we show that conditioned media from high density L1 cultures was able to downregulate lips-15 even in L1 animals arrested at low density, and experiments using daf-22 mutant animals demonstrated that this effect is not mediated by the ascaroside family of signaling pheromones. Together, our data implicate a soluble signaling molecule in density sensing by L1 stage C. elegans , and provide guidance for design of experiments focused on early developmental gene regulation. Copyright © 2018 Chan et al.

  17. Cloning-free regulated monitoring of reporter and gene expression

    Directory of Open Access Journals (Sweden)

    Demirkaya Omer

    2009-03-01

    Full Text Available Abstract Background The majority of the promoters, their regulatory elements, and their variations in the human genome remain unknown. Reporter gene technology for transcriptional activity is a widely used tool for the study of promoter structure, gene regulation, and signaling pathways. Construction of transcriptional reporter vectors, including use of cis-acting sequences, requires cloning and time-demanding manipulations, particularly with introduced mutations. Results In this report, we describe a cloning-free strategy to generate transcriptionally-controllable linear reporter constructs. This approach was applied in common transcriptional models of inflammatory response and the interferon system. In addition, it was used to delineate minimal transcriptional activity of selected ribosomal protein promoters. The approach was tested for conversion of genes into TetO-inducible/repressible expression cassettes. Conclusion The simple introduction and tuning of any transcriptional control in the linear DNA product renders promoter activation and regulated gene studies simple and versatile.

  18. Every which way – nanos gene regulation in echinoderms

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M.

    2014-01-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio, binds to and changes the fate of several known transcripts. We summarize here the documented functions of nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way. PMID:24376110

  19. CB1 cannabinoid receptor expression in the striatum: Association with corticostriatal circuits and developmental regulation

    Directory of Open Access Journals (Sweden)

    Vincent eVan Waes

    2012-03-01

    Full Text Available Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains. We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25 and then progressively decreases towards adolescent (P40 and adult (P70 levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors receive inputs from cortical regions with higher expression (medial prefrontal cortex. In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important.

  20. Developmental and sex-specific differences in expression of neuropeptides derived from allatotropin gene in the silkmoth Bombyx mori.

    Science.gov (United States)

    Bednár, Branislav; Roller, Ladislav; Čižmár, Daniel; Mitrová, Diana; Žitňan, Dušan

    2017-05-01

    Allatotropin (AT) and related neuropeptides are widespread bioactive molecules that regulate development, food intake and muscle contractions in insects and other invertebrates. In moths, alternative splicing of the at gene generates three mRNA precursors encoding AT with different combinations of three structurally similar AT-like peptides (ATLI-III). We used in situ hybridization and immunohistochemistry to map the differential expression of these transcripts during the postembryonic development of Bombyx mori. Transcript encoding AT alone was expressed in numerous neurons of the central nervous system and frontal ganglion, whereas transcripts encoding AT with ATLs were produced by smaller specific subgroups of neurons in larval stages. Metamorphosis was associated with considerable developmental changes and sex-specific differences in the expression of all transcripts. The most notable was the appearance of AT/ATL transcripts (1) in the brain lateral neurosecretory cells producing prothoracicotropic hormone; (2) in the male-specific cluster of about 20 neurons in the posterior region of the terminal abdominal ganglion; (3) in the female-specific medial neurons in the abdominal ganglia AG2-7. Immunohistochemical staining showed that these neurons produced a mixture of various neuropeptides and innervated diverse peripheral organs. Our data suggest that AT/ATL neuropeptides are involved in multiple stage- and sex-specific functions during the development of B. mori.

  1. In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.

    Directory of Open Access Journals (Sweden)

    Juan Du

    Full Text Available Hedgehog (Hh signaling is highly conserved in all metazoan animals and plays critical roles in many developmental processes. Dysregulation of the Hh signaling cascade has been implicated in many diseases, including cancer. Although key components of the Hh pathway have been identified, significant gaps remain in our understanding of the regulation of individual Hh signaling molecules. Here, we report the identification of novel regulators of the Hh pathway, obtained from an in vivo RNA interference (RNAi screen in Drosophila. By selectively targeting critical genes functioning in post-translational modification systems utilizing ubiquitin (Ub and Ub-like proteins, we identify two novel genes (dUba3 and dUbc12 that negatively regulate Hh signaling activity. We provide in vivo and in vitro evidence illustrating that dUba3 and dUbc12 are essential components of the neddylation pathway; they function in an enzyme cascade to conjugate the ubiquitin-like NEDD8 modifier to Cullin proteins. Neddylation activates the Cullin-containing ubiquitin ligase complex, which in turn promotes the degradation of Cubitus interruptus (Ci, the downstream transcription factor of the Hh pathway. Our study reveals a conserved molecular mechanism of the neddylation pathway in Drosophila and sheds light on the complex post-translational regulations in Hh signaling.

  2. WAFs lead molting retardation of naupliar stages with down-regulated expression profiles of chitin metabolic pathway and related genes in the copepod Tigriopus japonicus.

    Science.gov (United States)

    Hwang, Dae-Sik; Lee, Min-Chul; Kyung, Do-Hyun; Kim, Hui-Su; Han, Jeonghoon; Kim, Il-Chan; Puthumana, Jayesh; Lee, Jae-Seong

    2017-03-01

    Oil pollution is considered being disastrous to marine organisms and ecosystems. As molting is critical in the developmental process of arthropods in general and copepods, in particular, the impact will be adverse if the target of spilled oil is on molting. Thus, we investigated the harmful effects of water accommodated fractions (WAFs) of crude oil with an emphasis on inhibition of chitin metabolic pathways related genes and developmental retardation in the copepod Tigriopus japonicus. Also, we analysed the ontology and domain of chitin metabolic pathway genes and mRNA expression patterns of developmental stage-specific genes. Further, the developmental retardation followed by transcriptional modulations in nuclear receptor genes (NR) and chitin metabolic pathway-related genes were observed in the WAFs-exposed T. japonicus. As a result, the developmental time was found significantly (P<0.05) delayed in response to 40% WAFs in comparison with that of control. Moreover, the NR gene, HR3 and chitinases (CHT9 and CHT10) were up-regulated in N4-5 stages, while chitin synthase genes (CHS-1, CHS-2-1, and CHS-2-2) down-regulated in response to WAFs. In brief, a high concentration of WAFs repressed nuclear receptor genes but elicited activation of some of the transcription factors at low concentration of WAFs, resulting in suppression of chitin synthesis. Thus, we suggest that WAF can lead molting retardation of naupliar stages in T. japonicus through down-regulations of chitin metabolism. These findings will provide a better understanding of the mode of action of chitin biosynthesis associated with molting mechanism in WAF-exposed T. japonicus. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Developmental and functional expression of miRNA-stability related genes in the nervous system.

    Science.gov (United States)

    de Sousa, Érica; Walter, Lais Takata; Higa, Guilherme Shigueto Vilar; Casado, Otávio Augusto Nocera; Kihara, Alexandre Hiroaki

    2013-01-01

    In the nervous system, control of gene expression by microRNAs (miRNAs) has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We first detected two genes in the retina that have been associated to miRNA stability, XRN2 and PAPD4. These genes are highly expressed during retinal development, however with distinct subcellular localization. We investigated whether these proteins are regulated during specific phases of the cell cycle. Combined analyses of nuclei position in neuroblastic layer and labeling using anti-cyclin D1 revealed that both proteins do not accumulate in S or M phases of the cell cycle, being poorly expressed in progenitor cells. Indeed, XRN2 and PAPD4 were observed mainly after neuronal differentiation, since low expression was also observed in astrocytes, endothelial and microglial cells. XRN2 and PAPD4 are expressed in a wide variety of neurons, including horizontal, amacrine and ganglion cells. To evaluate the functional role of both genes, we carried out experiments addressed to the retinal adaptation in response to different ambient light conditions. PAPD4 is upregulated after 3 and 24 hours of dark- adaptation, revealing that accumulation of this protein is governed by ambient light levels. Indeed, the fast and functional regulation of PAPD4 was not related to changes in gene expression, disclosing that control of protein levels occurs by post-transcriptional mechanisms. Furthermore, we were able to quantify changes in PAPD4 in specific amacrine cells after dark -adaptation, suggesting for circuitry-related roles in visual perception. In summary, in this study we first described the

  4. Developmental and growth defects in mice with combined deficiency of CK2 catalytic genes.

    Science.gov (United States)

    Landesman-Bollag, Esther; Belkina, Anna; Hovey, Beth; Connors, Edward; Cox, Charles; Seldin, David C

    2011-10-01

    The CK2 α and α' catalytic gene products have overlapping biochemical activity, but in vivo, their functions are very different. Deletion of both alleles of CK2α leads to mid-gestational embryonic lethality, while deletion of both alleles of CK2α' does not interfere with viability or development of embryos; however, adult CK2α'-/-males are infertile. To further elucidate developmental roles of CK2, and analyze functional overlap between the two catalytic genes, mice with combined knockouts were bred. Mice bearing any two CK2 catalytic alleles were phenotypically normal. However, inheritance of a single CK2α allele, without either CK2α' allele, resulted in partial embryonic lethality. Such mice that survived through embryogenesis were smaller at birth than littermate controls, and weighed less throughout life. However, their cardiac function and lifespan were normal. Fibroblasts derived from CK2α+/-CK2α'-/- embryos grew poorly in culture. These experiments demonstrate that combined loss of one CK2α allele and both CK2α' alleles leads to unique abnormalities of growth and development.

  5. Toward epigenetic and gene regulation models of specific language impairment: looking for links among growth, genes, and impairments

    Directory of Open Access Journals (Sweden)

    Rice Mabel L

    2012-11-01

    Full Text Available Abstract Children with specific language impairment (SLI are thought to have an inherited form of language impairment that spares other developmental domains. SLI shows strong heritability and recent linkage and association studies have replicated results for candidate genes. Regulatory regions of the genes may be involved. Behavioral growth models of language development of children with SLI reveal that the onset of language is delayed, and the growth trajectories of children with SLI parallel those of younger children without SLI. The rate of language acquisition decelerates in the pre-adolescent period, resulting in immature language levels for the children with SLI that persist into adolescence and beyond. Recent genetic and epigenetic discoveries and models relevant to language impairment are reviewed. T cell regulation of onset, acceleration, and deceleration signaling are described as potential conceptual parallels to the growth timing elements of language acquisition and impairment. A growth signaling disruption (GSD hypothesis is proposed for SLI, which posits that faulty timing mechanisms at the cellular level, intrinsic to neurocortical functioning essential for language onset and growth regulation, are at the core of the growth outcomes of SLI. The GSD highlights the need to document and account for growth patterns over childhood and suggests needed directions for future investigation.

  6. Characterization of transcriptome in the Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) and gene expression analysis during developmental stages.

    Science.gov (United States)

    Tang, Pei-An; Wu, Hai-Jing; Xue, Hao; Ju, Xing-Rong; Song, Wei; Zhang, Qi-Lin; Yuan, Ming-Long

    2017-07-30

    The Indian meal moth Plodia interpunctella (Lepidoptera: Pyralidae) is a worldwide pest that causes serious damage to stored foods. Although many efforts have been conducted on this species due to its economic importance, the study of genetic basis of development, behavior and insecticide resistance has been greatly hampered due to lack of genomic information. In this study, we used high throughput sequencing platform to perform a de novo transcriptome assembly and tag-based digital gene expression profiling (DGE) analyses across four different developmental stages of P. interpunctella (egg, third-instar larvae, pupae and adult). We obtained approximate 9gigabyte (GB) of clean data and recovered 84,938 unigenes, including 37,602 clusters and 47,336 singletons. These unigenes were annotated using BLAST against the non-redundant protein databases and then functionally classified based on Gene Ontology (GO), Clusters of Orthologous Groups (COG), and Kyoto Encyclopedia of Genes and Genomes databases (KEGG). A large number of differentially expressed genes were identified by pairwise comparisons among different developmental stages. Gene expression profiles dramatically changed between developmental stage transitions. Some of these differentially expressed genes were related to digestion and cuticularization. Quantitative real-time PCR results of six randomly selected genes conformed the findings in the DGEs. Furthermore, we identified over 8000 microsatellite markers and 97,648 single nucleotide polymorphisms which will be useful for population genetics studies of P. interpunctella. This transcriptomic information provided insight into the developmental basis of P. interpunctella and will be helpful for establishing integrated management strategies and developing new targets of insecticides for this serious pest. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Science.gov (United States)

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  8. Gravity-regulated gene expression in Arabidopsis thaliana

    Science.gov (United States)

    Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

    Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

  9. Clustering gene expression regulators: new approach to disease subtyping.

    Directory of Open Access Journals (Sweden)

    Mikhail Pyatnitskiy

    Full Text Available One of the main challenges in modern medicine is to stratify different patient groups in terms of underlying disease molecular mechanisms as to develop more personalized approach to therapy. Here we propose novel method for disease subtyping based on analysis of activated expression regulators on a sample-by-sample basis. Our approach relies on Sub-Network Enrichment Analysis algorithm (SNEA which identifies gene subnetworks with significant concordant changes in expression between two conditions. Subnetwork consists of central regulator and downstream genes connected by relations extracted from global literature-extracted regulation database. Regulators found in each patient separately are clustered together and assigned activity scores which are used for final patients grouping. We show that our approach performs well compared to other related methods and at the same time provides researchers with complementary level of understanding of pathway-level biology behind a disease by identification of significant expression regulators. We have observed the reasonable grouping of neuromuscular disorders (triggered by structural damage vs triggered by unknown mechanisms, that was not revealed using standard expression profile clustering. For another experiment we were able to suggest the clusters of regulators, responsible for colorectal carcinoma vs adenoma discrimination and identify frequently genetically changed regulators that could be of specific importance for the individual characteristics of cancer development. Proposed approach can be regarded as biologically meaningful feature selection, reducing tens of thousands of genes down to dozens of clusters of regulators. Obtained clusters of regulators make possible to generate valuable biological hypotheses about molecular mechanisms related to a clinical outcome for individual patient.

  10. The evolution of Msx gene function: expression and regulation of a sea urchin Msx class homeobox gene.

    Science.gov (United States)

    Dobias, S L; Ma, L; Wu, H; Bell, J R; Maxson, R

    1997-01-01

    Msx- class homeobox genes, characterized by a distinct and highly conserved homeodomain, have been identified in a wide variety of metazoans from vertebrates to coelenterates. Although there is evidence that they participate in inductive tissue interactions that underlie vertebrate organogenesis, including those that pattern the neural crest, there is little information about their function in simple deuterostomes. Both to learn more about the ancient function of Msx genes, and to shed light on the evolution of developmental mechanisms within the lineage that gave rise to vertebrates, we have isolated and characterized Msx genes from ascidians and echinoderms. Here we describe the sequence and expression of a sea urchin (Strongylocentrotus purpouratus) Msx gene whose homeodomain is very similar to that of vertebrate Msx2. This gene, designated SpMsx, is first expressed in blastula stage embryos, apparently in a non-localized manner. Subsequently, during the early phases of gastrulation, SpMsx transcripts are expressed intensely in the invaginating archenteron and secondary mesenchyme, and at reduced levels in the ectoderm. In the latter part of gastrulation, SpMsx transcripts are concentrated in the oral ectoderm and gut, and continue to be expressed at those sites through the remainder of embryonic development. That vertebrate Msx genes are regulated by inductive tissue interactions and growth factors suggested to us that the restriction of SpMsx gene expression to the oral ectoderm and derivatives of the vegetal plate might similarly be regulated by the series of signaling events that pattern these embryonic territories. As a first test of this hypothesis, we examined the influence of exogastrulation and cell-dissociation on SpMsx gene expression. In experimentally-induced exogastrulae, SpMsx transcripts were distributed normally in the oral ectoderm, evaginated gut, and secondary mesenchyme. However, when embryos were dissociated into their component cells, Sp

  11. Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms

    Science.gov (United States)

    Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F

    2017-01-01

    Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging–genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging–genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging–genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of ‘biologically at-risk’ children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach. PMID:28045463

  12. Neurogenetics of developmental dyslexia: from genes to behavior through brain neuroimaging and cognitive and sensorial mechanisms.

    Science.gov (United States)

    Mascheretti, S; De Luca, A; Trezzi, V; Peruzzo, D; Nordio, A; Marino, C; Arrigoni, F

    2017-01-03

    Developmental dyslexia (DD) is a complex neurodevelopmental deficit characterized by impaired reading acquisition, in spite of adequate neurological and sensorial conditions, educational opportunities and normal intelligence. Despite the successful characterization of DD-susceptibility genes, we are far from understanding the molecular etiological pathways underlying the development of reading (dis)ability. By focusing mainly on clinical phenotypes, the molecular genetics approach has yielded mixed results. More optimally reduced measures of functioning, that is, intermediate phenotypes (IPs), represent a target for researching disease-associated genetic variants and for elucidating the underlying mechanisms. Imaging data provide a viable IP for complex neurobehavioral disorders and have been extensively used to investigate both morphological, structural and functional brain abnormalities in DD. Performing joint genetic and neuroimaging studies in humans is an emerging strategy to link DD-candidate genes to the brain structure and function. A limited number of studies has already pursued the imaging-genetics integration in DD. However, the results are still not sufficient to unravel the complexity of the reading circuit due to heterogeneous study design and data processing. Here, we propose an interdisciplinary, multilevel, imaging-genetic approach to disentangle the pathways from genes to behavior. As the presence of putative functional genetic variants has been provided and as genetic associations with specific cognitive/sensorial mechanisms have been reported, new hypothesis-driven imaging-genetic studies must gain momentum. This approach would lead to the optimization of diagnostic criteria and to the early identification of 'biologically at-risk' children, supporting the definition of adequate and well-timed prevention strategies and the implementation of novel, specific remediation approach.

  13. Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression.

    Science.gov (United States)

    Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha

    2013-05-01

    Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.

  14. cDREM: inferring dynamic combinatorial gene regulation.

    Science.gov (United States)

    Wise, Aaron; Bar-Joseph, Ziv

    2015-04-01

    Genes are often combinatorially regulated by multiple transcription factors (TFs). Such combinatorial regulation plays an important role in development and facilitates the ability of cells to respond to different stresses. While a number of approaches have utilized sequence and ChIP-based datasets to study combinational regulation, these have often ignored the combinational logic and the dynamics associated with such regulation. Here we present cDREM, a new method for reconstructing dynamic models of combinatorial regulation. cDREM integrates time series gene expression data with (static) protein interaction data. The method is based on a hidden Markov model and utilizes the sparse group Lasso to identify small subsets of combinatorially active TFs, their time of activation, and the logical function they implement. We tested cDREM on yeast and human data sets. Using yeast we show that the predicted combinatorial sets agree with other high throughput genomic datasets and improve upon prior methods developed to infer combinatorial regulation. Applying cDREM to study human response to flu, we were able to identify several combinatorial TF sets, some of which were known to regulate immune response while others represent novel combinations of important TFs.

  15. Conservation of gene co-regulation in prokaryotes and eukaryotes.

    NARCIS (Netherlands)

    Snel, B.; Bork, P.; Huynen, M.A.

    2002-01-01

    We raise some issues in detecting the conservation (or absence thereof) of co-regulation using gene order; how we think the variations in the cellular network in various species can be studied; and how to determine and interpret the higher order structure in networks of functional relations.

  16. Insulin and IGF receptors are developmentally regulated in the chick embry eye lens

    International Nuclear Information System (INIS)

    Bassas, L.; Zelenka, P.S.; Serrano, J.; de Pablo, F.

    1987-01-01

    The authors have previously reported that insulin-like growth factor (IGF) receptors appear to predominate over insulin receptors in early stages of embryogenesis in the chick (days 2-3 whole embryo membranes). Overall, [ 125 I]IGF and II binding to specific receptors was maximal when the rate of brain growth is highest. In the present study they used the embryonic chick lens, a well-defined tissue composed of a single type of cell, to analyze whether changes of insulin and IGFI binding are correlated with changes in growth rate and differentiation state of the cells. They show that both insulin receptors and IGF receptors are present in the lens epithelial cells, and that each type is distinctly regulated throughout development. While there is a direct correlation between IFG-binding capability and growth rate of the cells, there is less relation to differentiation status and embryo age. Insulin receptors, by contrast, appear to be mostly related to the differentiated state of cells, decreasing sharply in fibers, irrespective of their developmental age

  17. Developmentally Regulated Production of meso-Zeaxanthin in Chicken Retinal Pigment Epithelium/Choroid and Retina.

    Science.gov (United States)

    Gorusupudi, Aruna; Shyam, Rajalekshmy; Li, Binxing; Vachali, Preejith; Subhani, Yumna K; Nelson, Kelly; Bernstein, Paul S

    2016-04-01

    meso-Zeaxanthin is a carotenoid that is rarely encountered in nature outside of the vertebrate eye. It is not a constituent of a normal human diet, yet this carotenoid comprises one-third of the primate macular pigment. In the current study, we undertook a systematic approach to biochemically characterize the production of meso-zeaxanthin in the vertebrate eye. Fertilized White Leghorn chicken eggs were analyzed for the presence of carotenoids during development. Yolk, liver, brain, serum, retina, and RPE/choroid were isolated, and carotenoids were extracted. The samples were analyzed on C-30 or chiral HPLC columns to determine the carotenoid composition. Lutein and zeaxanthin were found in all studied nonocular tissues, but no meso-zeaxanthin was ever detected. Among the ocular tissues, the presence of meso-zeaxanthin was consistently observed starting at embryonic day 17 (E17) in the RPE/choroid, several days before its consistent detection in the retina. If RPE/choroid of an embryo was devoid of meso-zeaxanthin, the corresponding retina was always negative as well. This is the first report of developmentally regulated synthesis of meso-zeaxanthin in a vertebrate system. Our observations suggest that the RPE/choroid is the primary site of meso-zeaxanthin synthesis. Identification of meso-zeaxanthin isomerase enzyme in the developing chicken embryo will facilitate our ability to determine the biochemical mechanisms responsible for production of this unique carotenoid in other higher vertebrates, such as humans.

  18. Decoding options and accuracy of translation of developmentally regulated UUA codon in Streptomyces: bioinformatic analysis.

    Science.gov (United States)

    Rokytskyy, Ihor; Koshla, Oksana; Fedorenko, Victor; Ostash, Bohdan

    2016-01-01

    The gene bldA for leucyl [Formula: see text] is known for almost 30 years as a key regulator of morphogenesis and secondary metabolism in genus Streptomyces. Codon UUA is the rarest one in Streptomyces genomes and is present exclusively in genes with auxiliary functions. Delayed accumulation of translation-competent [Formula: see text] is believed to confine the expression of UUA-containing transcripts to stationary phase. Implicit to the regulatory function of UUA codon is the assumption about high accuracy of its translation, e.g. the latter should not occur in the absence of cognate [Formula: see text]. However, a growing body of facts points to the possibility of mistranslation of UUA-containing transcripts in the bldA-deficient mutants. It is not known what type of near-cognate tRNA(s) may decode UUA in the absence of cognate tRNA in Streptomyces, and whether UUA possesses certain inherent properties (such as increased/decreased accuracy of decoding) that would favor its use for regulatory purposes. Here we took bioinformatic approach to address these questions. We catalogued the entire complement of tRNA genes from several relevant Streptomyces and identified genes for posttranscriptional modifications of tRNA that might be involved in UUA decoding by cognate and near-cognate tRNAs. Based on tRNA gene content in Streptomyces genomes, we propose possible scenarios of UUA codon mistranslation. UUA is not associated with an increased rate of missense errors as compared to other leucyl codons, contrasting general belief that low-abundant codons are more error-prone than the high-abundant ones.

  19. Regulation of Cell and Gene Therapy Medicinal Products in Taiwan.

    Science.gov (United States)

    Lin, Yi-Chu; Wang, Po-Yu; Tsai, Shih-Chih; Lin, Chien-Liang; Tai, Hsuen-Yung; Lo, Chi-Fang; Wu, Shiow-Ing; Chiang, Yu-Mei; Liu, Li-Ling

    2015-01-01

    Owing to the rapid and mature development of emerging biotechnology in the fields of cell culture, cell preservation, and recombinant DNA technology, more and more cell or gene medicinal therapy products have been approved for marketing, to treat serious diseases which have been challenging to treat with current medical practice or medicine. This chapter will briefly introduce the Taiwan Food and Drug Administration (TFDA) and elaborate regulation of cell and gene therapy medicinal products in Taiwan, including regulatory history evolution, current regulatory framework, application and review procedures, and relevant jurisdictional issues. Under the promise of quality, safety, and efficacy of medicinal products, it is expected the regulation and environment will be more flexible, streamlining the process of the marketing approval of new emerging cell or gene therapy medicinal products and providing diverse treatment options for physicians and patients.

  20. The cell cycle-regulated genes of Schizosaccharomyces pombe.

    Science.gov (United States)

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve; Futcher, Bruce; Leatherwood, Janet

    2005-07-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know.

  1. The Cell Cycle–Regulated Genes of Schizosaccharomyces pombe

    Science.gov (United States)

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve

    2005-01-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know. PMID:15966770

  2. Hox gene regulation in the central nervous system of Drosophila

    Directory of Open Access Journals (Sweden)

    Maheshwar eGummalla

    2014-04-01

    Full Text Available Hox genes specify the structures that form along the anteroposterior (AP axis of bilateria. Within the genome, they often form clusters where, remarkably enough, their position within the clusters reflects the relative positions of the structures they specify along the AP axis. This correspondence between genomic organization and gene expression pattern has been conserved through evolution and provides a unique opportunity to study how chromosomal context affects gene regulation. In Drosophila, a general rule, often called posterior dominance, states that Hox genes specifying more posterior structures repress the expression of more anterior Hox genes. This rule explains the apparent spatial complementarity of Hox gene expression patterns in Drosophila. Here we review a noticeable exception to this rule where the more-posteriorly expressed Abd-B hox gene fails to repress the more-anterior abd-A gene in cells of the central nervous system (CNS. While Abd-B is required to repress ectopic expression of abd-A in the posterior epidermis, abd-A repression in the posterior CNS is accomplished by a different mechanism that involves a large 92kb long non-coding RNA (lncRNA encoded by the intergenic region separating abd-A and Abd-B (the iab8ncRNA. Dissection of this lncRNA revealed that abd-A is repressed by the lncRNA using two redundant mechanisms. The 1st mechanism is mediated by a microRNA (mir-iab-8 encoded by intronic sequence within the large iab8-ncRNA. Meanwhile, the second mechanism seems to involve transcriptional interference by the long iab-8 ncRNA on the abd-A promoter. Recent work demonstrating CNS-specific regulation of genes by ncRNAs in Drosophila, seem to highlight a potential role for the iab-8-ncRNA in the evolution of the Drosophila hox complexes

  3. The cell cycle-regulated genes of Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Anna Oliva

    2005-07-01

    Full Text Available Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast. The 750 genes with the most significant oscillations were identified and analyzed. There were two broad waves of cell cycle transcription, one in early/mid G2 phase, and the other near the G2/M transition. The early/mid G2 wave included many genes involved in ribosome biogenesis, possibly explaining the cell cycle oscillation in protein synthesis in S. pombe. The G2/M wave included at least three distinctly regulated clusters of genes: one large cluster including mitosis, mitotic exit, and cell separation functions, one small cluster dedicated to DNA replication, and another small cluster dedicated to cytokinesis and division. S. pombe cell cycle genes have relatively long, complex promoters containing groups of multiple DNA sequence motifs, often of two, three, or more different kinds. Many of the genes, transcription factors, and regulatory mechanisms are conserved between S. pombe and S. cerevisiae. Finally, we found preliminary evidence for a nearly genome-wide oscillation in gene expression: 2,000 or more genes undergo slight oscillations in expression as a function of the cell cycle, although whether this is adaptive, or incidental to other events in the cell, such as chromatin condensation, we do not know.

  4. The human oxytocin gene promoter is regulated by estrogens.

    Science.gov (United States)

    Richard, S; Zingg, H H

    1990-04-15

    Gonadal steroids affect brain function primarily by altering the expression of specific genes, yet the specific mechanisms by which neuronal target genes undergo such regulation are unknown. Recent evidence suggests that the expression of the neuropeptide gene for oxytocin (OT) is modulated by estrogens. We therefore examined the possibility that this regulation occurred via a direct interaction of the estrogen-receptor complex with cis-acting elements flanking the OT gene. DNA-mediated gene transfer experiments were performed using Neuro-2a neuroblastoma cells and chimeric plasmids containing portions of the human OT gene 5'-glanking region linked to the chloramphenicol acetyltransferase gene. We identified a 19-base pair region located at -164 to -146 upstream of the transcription start site which is capable of conferring estrogen responsiveness to the homologous as well as to a heterologous promoter. The hormonal response is strictly dependent on the presence of intracellular estrogen receptors, since estrogen induced stimulation occurred only in Neuro-2a cells co-transfected with an expression vector for the human estrogen receptor. The identified region contains a novel imperfect palindrome (GGTGACCTTGACC) with sequence similarity to other estrogen response elements (EREs). To define cis-acting elements that function in synergism with the ERE, sequences 3' to the ERE were deleted, including the CCAAT box, two additional motifs corresponding to the right half of the ERE palindrome (TGACC), as well as a CTGCTAA heptamer similar to the "elegans box" found in Caenorhabditis elegans. Interestingly, optimal function of the identified ERE was fully independent of these elements and only required a short promoter region (-49 to +36). Our studies define a molecular mechanism by which estrogens can directly modulate OT gene expression. However, only a subset of OT neurons are capable of binding estrogens, therefore, direct action of estrogens on the OT gene may be

  5. Comparative Transcriptome Analysis Reveal Candidate Genes Potentially Involved in Regulation of Primocane Apex Rooting in Raspberry (Rubus spp.).

    Science.gov (United States)

    Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi

    2017-01-01

    Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.

  6. Hormonal regulation and developmental role of Krüppel homolog 1, a repressor of metamorphosis, in the silkworm Bombyx mori.

    Science.gov (United States)

    Kayukawa, Takumi; Murata, Mika; Kobayashi, Isao; Muramatsu, Daisuke; Okada, Chieko; Uchino, Keiro; Sezutsu, Hideki; Kiuchi, Makoto; Tamura, Toshiki; Hiruma, Kiyoshi; Ishikawa, Yukio; Shinoda, Tetsuro

    2014-04-01

    Juvenile hormone (JH) has an ability to repress the precocious metamorphosis of insects during their larval development. Krüppel homolog 1 (Kr-h1) is an early JH-inducible gene that mediates this action of JH; however, the fine hormonal regulation of Kr-h1 and the molecular mechanism underlying its antimetamorphic effect are little understood. In this study, we attempted to elucidate the hormonal regulation and developmental role of Kr-h1. We found that the expression of Kr-h1 in the epidermis of penultimate-instar larvae of the silkworm Bombyx mori was induced by JH secreted by the corpora allata (CA), whereas the CA were not involved in the transient induction of Kr-h1 at the prepupal stage. Tissue culture experiments suggested that the transient peak of Kr-h1 at the prepupal stage is likely to be induced cooperatively by JH derived from gland(s) other than the CA and the prepupal surge of ecdysteroid, although involvement of unknown factor(s) could not be ruled out. To elucidate the developmental role of Kr-h1, we generated transgenic silkworms overexpressing Kr-h1. The transgenic silkworms grew normally until the spinning stage, but their development was arrested at the prepupal stage. The transgenic silkworms from which the CA were removed in the penultimate instar did not undergo precocious pupation or larval-larval molt but fell into prepupal arrest. This result demonstrated that Kr-h1 is indeed involved in the repression of metamorphosis but that Kr-h1 alone is incapable of implementing normal larval molt. Moreover, the expression profiles and hormonal responses of early ecdysone-inducible genes (E74, E75, and Broad) in transgenic silkworms suggested that Kr-h1 is not involved in the JH-dependent modulation of these genes, which is associated with the control of metamorphosis. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  8. Association of Forced Vital Capacity with the Developmental Gene NCOR2.

    Directory of Open Access Journals (Sweden)

    Cosetta Minelli

    to a role of vitamin A metabolism in the regulation of FVC. Our findings also support SERPINE2, a COPD gene with weak previous evidence of association with FVC, and suggest WNT16 as a further promising candidate.

  9. Developmental Transcriptome Analysis and Identification of Genes Involved in Larval Metamorphosis of the Razor Clam, Sinonovacula constricta.

    Science.gov (United States)

    Niu, Donghong; Wang, Fei; Xie, Shumei; Sun, Fanyue; Wang, Ze; Peng, Maoxiao; Li, Jiale

    2016-04-01

    The razor clam Sinonovacula constricta is an important commercial species. The deficiency of developmental transcriptomic data is becoming the bottleneck of further researches on the mechanisms underlying settlement and metamorphosis in early development. In this study, de novo transcriptome sequencing was performed for S. constricta at different early developmental stages by using Illumina HiSeq 2000 paired-end (PE) sequencing technology. A total of 112,209,077 PE clean reads were generated. De novo assembly generated 249,795 contigs with an average length of 585 bp. Gene annotation resulted in the identification of 22,870 unigene hits against the NCBI database. Eight unique sequences related to metamorphosis were identified and analyzed using real-time PCR. The razor clam reference transcriptome would provide useful information on early developmental and metamorphosis mechanisms and could be used in the genetic breeding of shellfish.

  10. Drosha regulates gene expression independently of RNA cleavage function

    DEFF Research Database (Denmark)

    Gromak, Natalia; Dienstbier, Martin; Macias, Sara

    2013-01-01

    Drosha is the main RNase III-like enzyme involved in the process of microRNA (miRNA) biogenesis in the nucleus. Using whole-genome ChIP-on-chip analysis, we demonstrate that, in addition to miRNA sequences, Drosha specifically binds promoter-proximal regions of many human genes in a transcription......-dependent manner. This binding is not associated with miRNA production or RNA cleavage. Drosha knockdown in HeLa cells downregulated nascent gene transcription, resulting in a reduction of polyadenylated mRNA produced from these gene regions. Furthermore, we show that this function of Drosha is dependent on its N......-terminal protein-interaction domain, which associates with the RNA-binding protein CBP80 and RNA Polymerase II. Consequently, we uncover a previously unsuspected RNA cleavage-independent function of Drosha in the regulation of human gene expression....

  11. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, Ru-Lan [Department of Physical Medicine and Rehabilitation, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Physical Medicine and Rehabilitation, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Su, Chien-Tien [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Shiue, Horng-Sheng [Department of Chinese Medicine, Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taoyuan, Taiwan (China); Chen, Wei-Jen; Huang, Shiau-Rung [School of Public Health, College of Public Health, Taipei Medical University, Taipei, Taiwan (China); Lin, Ying-Chin [Department of Family Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Department of Health Examination, Wan Fang Hospital, Taipei Medical University, Taipei, Taiwan (China); Division of Family Medicine, School of Medicine, Taipei Medical University, Taipei, Taiwan (China); Lin, Ming-I; Mu, Shu-Chi [Department of Pediatrics, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chen, Ray-Jade [Department of Digestive Surgery, Taipei Medical University Hospital, Taipei, Taiwan (China); Hsueh, Yu-Mei, E-mail: ymhsueh@tmu.edu.tw [Department of Family Medicine, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Public Health, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (China)

    2017-04-15

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA

  12. Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

    International Nuclear Information System (INIS)

    Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

    2017-01-01

    Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT

  13. Cell wall composition and lignin biosynthetic gene expression along a developmental gradient in an Australian sugarcane cultivar

    Directory of Open Access Journals (Sweden)

    William P. Bewg

    2017-12-01

    Full Text Available Sugarcane bagasse is an abundant source of lignocellulosic material for bioethanol production. Utilisation of bagasse for biofuel production would be environmentally and economically beneficial, but the recalcitrance of lignin continues to provide a challenge. Further understanding of lignin production in specific cultivars will provide a basis for modification of genomes for the production of phenotypes with improved processing characteristics. Here we evaluated the expression profile of lignin biosynthetic genes and the cell wall composition along a developmental gradient in KQ228 sugarcane. The expression levels of nine lignin biosynthesis genes were quantified in five stem sections of increasing maturity and in root tissue. Two distinct expression patterns were seen. The first saw highest gene expression in the youngest tissue, with expression decreasing as tissue matured. The second pattern saw little to no change in transcription levels across the developmental gradient. Cell wall compositional analysis of the stem sections showed total lignin content to be significantly higher in more mature tissue than in the youngest section assessed. There were no changes in structural carbohydrates across developmental sections. These gene expression and cell wall compositional patterns can be used, along with other work in grasses, to inform biotechnological approaches to crop improvement for lignocellulosic biofuel production.

  14. KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

    Science.gov (United States)

    Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang

    2016-01-01

    The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

  15. A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships.

    Science.gov (United States)

    Pucci, Ferdinando; Venneri, Mary Anna; Biziato, Daniela; Nonis, Alessandro; Moi, Davide; Sica, Antonio; Di Serio, Clelia; Naldini, Luigi; De Palma, Michele

    2009-07-23

    We previously showed that Tie2-expressing monocytes (TEMs) have nonredundant proangiogenic activity in tumors. Here, we compared the gene expression profile of tumor-infiltrating TEMs with that of tumor-associated macrophages (TAMs), spleen-derived Gr1(+)Cd11b(+) neutrophils/myeloid-derived suppressor cells, circulating "inflammatory" and "resident" monocytes, and tumor-derived endothelial cells (ECs) by quantitative polymerase chain reaction-based gene arrays. TEMs sharply differed from ECs and Gr1(+)Cd11b(+) cells but were highly related to TAMs. Nevertheless, several genes were differentially expressed between TEMs and TAMs, highlighting a TEM signature consistent with enhanced proangiogenic/tissue-remodeling activity and lower proinflammatory activity. We validated these findings in models of oncogenesis and transgenic mice expressing a microRNA-regulated Tie2-GFP reporter. Remarkably, resident monocytes and TEMs on one hand, and inflammatory monocytes and TAMs on the other hand, expressed coordinated gene expression profiles, suggesting that the 2 blood monocyte subsets are committed to distinct extravascular fates in the tumor microenvironment. We further showed that a prominent proportion of embryonic/fetal macrophages, which participate in tissue morphogenesis, expressed distinguishing TEM genes. It is tempting to speculate that Tie2(+) embryonic/fetal macrophages, resident blood monocytes, and tumor-infiltrating TEMs represent distinct developmental stages of a TEM lineage committed to execute physiologic proangiogenic and tissue-remodeling programs, which can be co-opted by tumors.

  16. Brucella abortus: pathogenicity and gene regulation of virulence

    Directory of Open Access Journals (Sweden)

    Olga Rivas-Solano

    2015-06-01

    Full Text Available Brucella abortus is a zoonotic intracellular facultative pathogen belonging to the subdivision α2 of class Proteobacteria. It causes a worldwide distributed zoonotic disease called brucellosis. The main symptoms are abortion and sterility in cattle, as well as an undulant febrile condition in humans. In endemic regions like Central America, brucellosis has a high socioeconomic impact. A basic research project was recently conducted at the ITCR with the purpose of studying gene regulation of virulence, structure and immunogenicity in B. abortus. The present review was written as part of this project. B. abortus virulence seems to be determined by its ability to invade, survive and replicate inside professional and non-professional phagocytes. It reaches its intracellular replicative niche without the activation of host antimicrobial mechanisms of innate immunity. It also has gene regulation mechanisms for a rapid adaptation to an intracellular environment such as the two-component signal transduction system BvrR/BvrS and the quorum sensing regulator called Vjbr, as well as other transcription factors. All of them integrate a complex gene regulation network.

  17. RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

    Directory of Open Access Journals (Sweden)

    Johanna Meier-Soelch

    2018-04-01

    Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

  18. Developmental and functional expression of miRNA-stability related genes in the nervous system.

    Directory of Open Access Journals (Sweden)

    Érica de Sousa

    Full Text Available In the nervous system, control of gene expression by microRNAs (miRNAs has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We first detected two genes in the retina that have been associated to miRNA stability, XRN2 and PAPD4. These genes are highly expressed during retinal development, however with distinct subcellular localization. We investigated whether these proteins are regulated during specific phases of the cell cycle. Combined analyses of nuclei position in neuroblastic layer and labeling using anti-cyclin D1 revealed that both proteins do not accumulate in S or M phases of the cell cycle, being poorly expressed in progenitor cells. Indeed, XRN2 and PAPD4 were observed mainly after neuronal differentiation, since low expression was also observed in astrocytes, endothelial and microglial cells. XRN2 and PAPD4 are expressed in a wide variety of neurons, including horizontal, amacrine and ganglion cells. To evaluate the functional role of both genes, we carried out experiments addressed to the retinal adaptation in response to different ambient light conditions. PAPD4 is upregulated after 3 and 24 hours of dark- adaptation, revealing that accumulation of this protein is governed by ambient light levels. Indeed, the fast and functional regulation of PAPD4 was not related to changes in gene expression, disclosing that control of protein levels occurs by post-transcriptional mechanisms. Furthermore, we were able to quantify changes in PAPD4 in specific amacrine cells after dark -adaptation, suggesting for circuitry-related roles in visual perception. In summary, in this study we

  19. Local and global responses in complex gene regulation networks

    Science.gov (United States)

    Tsuchiya, Masa; Selvarajoo, Kumar; Piras, Vincent; Tomita, Masaru; Giuliani, Alessandro

    2009-04-01

    An exacerbated sensitivity to apparently minor stimuli and a general resilience of the entire system stay together side-by-side in biological systems. This apparent paradox can be explained by the consideration of biological systems as very strongly interconnected network systems. Some nodes of these networks, thanks to their peculiar location in the network architecture, are responsible for the sensitivity aspects, while the large degree of interconnection is at the basis of the resilience properties of the system. One relevant feature of the high degree of connectivity of gene regulation networks is the emergence of collective ordered phenomena influencing the entire genome and not only a specific portion of transcripts. The great majority of existing gene regulation models give the impression of purely local ‘hard-wired’ mechanisms disregarding the emergence of global ordered behavior encompassing thousands of genes while the general, genome wide, aspects are less known. Here we address, on a data analysis perspective, the discrimination between local and global scale regulations, this goal was achieved by means of the examination of two biological systems: innate immune response in macrophages and oscillating growth dynamics in yeast. Our aim was to reconcile the ‘hard-wired’ local view of gene regulation with a global continuous and scalable one borrowed from statistical physics. This reconciliation is based on the network paradigm in which the local ‘hard-wired’ activities correspond to the activation of specific crucial nodes in the regulation network, while the scalable continuous responses can be equated to the collective oscillations of the network after a perturbation.

  20. Intrinsic limits to gene regulation by global crosstalk

    Science.gov (United States)

    Friedlander, Tamar; Prizak, Roshan; Guet, Calin; Barton, Nicholas H.; Tkacik, Gasper

    Gene activity is mediated by the specificity of binding interactions between special proteins, called transcription factors, and short regulatory sequences on the DNA, where different protein species preferentially bind different DNA targets. Limited interaction specificity may lead to crosstalk: a regulatory state in which a gene is either incorrectly activated due to spurious interactions or remains erroneously inactive. Since each protein can potentially interact with numerous DNA targets, crosstalk is inherently a global problem, yet has previously not been studied as such. We construct a theoretical framework to analyze the effects of global crosstalk on gene regulation, using statistical mechanics. We find that crosstalk in regulatory interactions puts fundamental limits on the reliability of gene regulation that are not easily mitigated by tuning proteins concentrations or by complex regulatory schemes proposed in the literature. Our results suggest that crosstalk imposes a previously unexplored global constraint on the functioning and evolution of regulatory networks, which is qualitatively distinct from the known constraints that act at the level of individual gene regulatory elements. The research leading to these results has received funding from the People Programme (Marie Curie Actions) of the European Union's Seventh Framework Programme (FP7/2007-2013) under REA Grant agreement Nr. 291734 (T.F.) and ERC Grant Nr. 250152 (N.B.).

  1. Regulation of the cytochrome P450 2A genes

    International Nuclear Information System (INIS)

    Su Ting; Ding Xinxin

    2004-01-01

    Cytochrome P450 monooxygenases of the CYP2A subfamily play important roles in xenobiotic disposition in the liver and in metabolic activation in extrahepatic tissues. Many of the CYP2A transcripts and enzymes are inducible by xenobiotic compounds, and the expression of at least some of the CYP2A genes is influenced by physiological status, such as circadian rhythm, and pathological conditions, such as inflammation, microbial infection, and tumorigenesis. Variability in the expression of the CYP2A genes, which differs by species, animal strain, gender, and organ, may alter the risks of chemical toxicity for numerous compounds that are CYP2A substrates. The mechanistic bases of these variabilities are generally not well understood. However, recent studies have yielded interesting findings in several areas, such as the role of nuclear factor 1 in the tissue-selective expression of CYP2A genes in the olfactory mucosa (OM); the roles of constitutive androstane receptor, pregnane X receptor (PXR), and possibly, peroxisome proliferator-activated receptors in transcriptional regulation of the Cyp2a5 gene; and the involvement of heterogeneous nuclear ribonucleoprotein A1 in pyrazole-induced stabilization of CYP2A5 mRNA. The aims of this minireview are to summarize current knowledge of the regulation of the CYP2A genes in rodents and humans, and to stimulate further mechanistic studies that will ultimately improve our ability to determine, and to understand, these variabilities in humans

  2. Let-7b regulates the expression of the growth hormone receptor gene in deletion-type dwarf chickens.

    Science.gov (United States)

    Lin, Shumao; Li, Hongmei; Mu, Heping; Luo, Wen; Li, Ying; Jia, Xinzheng; Wang, Sibing; Jia, Xiaolu; Nie, Qinghua; Li, Yugu; Zhang, Xiquan

    2012-07-10

    A deletion mutation in the growth hormone receptor (GHR) gene results in the inhibition of skeletal muscle growth and fat deposition in dwarf chickens. We used microarray techniques to determine microRNA (miRNA) and mRNA expression profiles of GHR in the skeletal muscles of 14-day-old embryos as well as 7-week-old deletion-type dwarf and normal-type chickens. Our aim was to elucidate the miRNA regulation of GHR expression with respect to growth inhibition and fat deposition. At the same developmental stages, different expression profiles in skeletal muscles of dwarf and normal chickens occurred for four miRNAs (miR-1623, miR-181b, let-7b, and miR-128). At different developmental stages, there was a significant difference in the expression profiles of a greater number of miRNAs. Eleven miRNAs were up-regulated and 18 down-regulated in the 7-week-old dwarf chickens when compared with profiles in 14-day-old embryos. In 7-week-old normal chickens, seven miRNAs were up-regulated and nine down-regulated compared with those in 14-day-old embryos. In skeletal muscles, 22 genes were up-regulated and 33 down-regulated in 14-day-old embryos compared with 7-week-old dwarf chickens. Sixty-five mRNAs were up-regulated and 108 down-regulated in 14-day-old embryos as compared with 7-week-old normal chickens. Thirty-four differentially expressed miRNAs were grouped into 18 categories based on overlapping seed and target sequences. Only let-7b was found to be complementary to its target in the 3' untranslated region of GHR, and was able to inhibit its expression. Kyoto Encyclopedia of Genes and Genomes pathway analysis and quantitative polymerase chain reactions indicated there were three main signaling pathways regulating skeletal muscle growth and fat deposition of chickens. These were influenced by let-7b-regulated GHR. Suppression of the cytokine signaling 3 (SOCS3) gene was found to be involved in the signaling pathway of adipocytokines. There is a critical miRNA, let-7b

  3. cGMP and NHR signaling co-regulate expression of insulin-like peptides and developmental activation of infective larvae in Strongyloides stercoralis.

    Directory of Open Access Journals (Sweden)

    Jonathan D Stoltzfus

    2014-07-01

    Full Text Available The infectious form of the parasitic nematode Strongyloides stercoralis is a developmentally arrested third-stage larva (L3i, which is morphologically similar to the developmentally arrested dauer larva in the free-living nematode Caenorhabditis elegans. We hypothesize that the molecular pathways regulating C. elegans dauer development also control L3i arrest and activation in S. stercoralis. This study aimed to determine the factors that regulate L3i activation, with a focus on G protein-coupled receptor-mediated regulation of cyclic guanosine monophosphate (cGMP pathway signaling, including its modulation of the insulin/IGF-1-like signaling (IIS pathway. We found that application of the membrane-permeable cGMP analog 8-bromo-cGMP potently activated development of S. stercoralis L3i, as measured by resumption of feeding, with 85.1 ± 2.2% of L3i feeding in 200 µM 8-bromo-cGMP in comparison to 0.6 ± 0.3% in the buffer diluent. Utilizing RNAseq, we examined L3i stimulated with DMEM, 8-bromo-cGMP, or the DAF-12 nuclear hormone receptor (NHR ligand Δ7-dafachronic acid (DA--a signaling pathway downstream of IIS in C. elegans. L3i stimulated with 8-bromo-cGMP up-regulated transcripts of the putative agonistic insulin-like peptide (ILP -encoding genes Ss-ilp-1 (20-fold and Ss-ilp-6 (11-fold in comparison to controls without stimulation. Surprisingly, we found that Δ7-DA similarly modulated transcript levels of ILP-encoding genes. Using the phosphatidylinositol-4,5-bisphosphate 3-kinase inhibitor LY294002, we demonstrated that 400 nM Δ7-DA-mediated activation (93.3 ± 1.1% L3i feeding can be blocked using this IIS inhibitor at 100 µM (7.6 ± 1.6% L3i feeding. To determine the tissues where promoters of ILP-encoding genes are active, we expressed promoter::egfp reporter constructs in transgenic S. stercoralis post-free-living larvae. Ss-ilp-1 and Ss-ilp-6 promoters are active in the hypodermis and neurons and the Ss-ilp-7 promoter is active in the

  4. Past climate change on Sky Islands drives novelty in a core developmental gene network and its phenotype.

    Science.gov (United States)

    Favé, Marie-Julie; Johnson, Robert A; Cover, Stefan; Handschuh, Stephan; Metscher, Brian D; Müller, Gerd B; Gopalan, Shyamalika; Abouheif, Ehab

    2015-09-04

    A fundamental and enduring problem in evolutionary biology is to understand how populations differentiate in the wild, yet little is known about what role organismal development plays in this process. Organismal development integrates environmental inputs with the action of gene regulatory networks to generate the phenotype. Core developmental gene networks have been highly conserved for millions of years across all animals, and therefore, organismal development may bias variation available for selection to work on. Biased variation may facilitate repeatable phenotypic responses when exposed to similar environmental inputs and ecological changes. To gain a more complete understanding of population differentiation in the wild, we integrated evolutionary developmental biology with population genetics, morphology, paleoecology and ecology. This integration was made possible by studying how populations of the ant species Monomorium emersoni respond to climatic and ecological changes across five 'Sky Islands' in Arizona, which are mountain ranges separated by vast 'seas' of desert. Sky Islands represent a replicated natural experiment allowing us to determine how repeatable is the response of M. emersoni populations to climate and ecological changes at the phenotypic, developmental, and gene network levels. We show that a core developmental gene network and its phenotype has kept pace with ecological and climate change on each Sky Island over the last ~90,000 years before present (BP). This response has produced two types of evolutionary change within an ant species: one type is unpredictable and contingent on the pattern of isolation of Sky lsland populations by climate warming, resulting in slight changes in gene expression, organ growth, and morphology. The other type is predictable and deterministic, resulting in the repeated evolution of a novel wingless queen phenotype and its underlying gene network in response to habitat changes induced by climate warming. Our

  5. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Directory of Open Access Journals (Sweden)

    Catherine Cukras

    Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  6. Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

    Science.gov (United States)

    Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

    2012-01-01

    Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

  7. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  8. Comparative genomics identification of a novel set of temporally regulated hedgehog target genes in the retina.

    Science.gov (United States)

    McNeill, Brian; Perez-Iratxeta, Carol; Mazerolle, Chantal; Furimsky, Marosh; Mishina, Yuji; Andrade-Navarro, Miguel A; Wallace, Valerie A

    2012-03-01

    The hedgehog (Hh) signaling pathway is involved in numerous developmental and adult processes with many links to cancer. In vertebrates, the activity of the Hh pathway is mediated primarily through three Gli transcription factors (Gli1, 2 and 3) that can serve as transcriptional activators or repressors. The identification of Gli target genes is essential for the understanding of the Hh-mediated processes. We used a comparative genomics approach using the mouse and human genomes to identify 390 genes that contained conserved Gli binding sites. RT-qPCR validation of 46 target genes in E14.5 and P0.5 retinal explants revealed that Hh pathway activation resulted in the modulation of 30 of these targets, 25 of which demonstrated a temporal regulation. Further validation revealed that the expression of Bok, FoxA1, Sox8 and Wnt7a was dependent upon Sonic Hh (Shh) signaling in the retina and their regulation is under positive and negative controls by Gli2 and Gli3, respectively. We also show using chromatin immunoprecipitation that Gli2 binds to the Sox8 promoter, suggesting that Sox8 is an Hh-dependent direct target of Gli2. Finally, we demonstrate that the Hh pathway also modulates the expression of Sox9 and Sox10, which together with Sox8 make up the SoxE group. Previously, it has been shown that Hh and SoxE group genes promote Müller glial cell development in the retina. Our data are consistent with the possibility for a role of SoxE group genes downstream of Hh signaling on Müller cell development. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  9. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Energy Technology Data Exchange (ETDEWEB)

    Lichtensteiger, W; Faass, O; Ceccatelli, R; Schlumpf, M [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology

    2004-09-15

    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  10. Developmental exposure to PBDE 99 and PCB affects estrogen sensitivity of target genes in rat brain regions and female sexual behavior

    Energy Technology Data Exchange (ETDEWEB)

    Lichtensteiger, W.; Faass, O.; Ceccatelli, R.; Schlumpf, M. [Zurich Univ. (Switzerland). Inst. of Pharmacology and Toxicology

    2004-09-15

    We recently reported effects of PBDE99 (2,2',4,4'5-pentabromoBDE) on sexual differentiation processes in rat reproductive organs and central nervous system. These studies were prompted by reports on an increase of PBDE levels in human milk, an indicator of the body burden of pregnant women and of potential exposure of the nursing infant, during the last decade. Even higher human adipose tissue and milk levels were reported for North America. PBDE99 is present in human and animal samples and exhibits developmental neurotoxicity in mice. The developing brain is subject to the organizing action of estradiol locally formed from circulating testosterone, and thus represents a target for endocrine active chemicals. One molecular mechanism by which chemicals may interfere with sexual brain differentiation, may be a change in the expression of sex hormone (estrogen)-regulated genes. Such effects may manifest themselves in mRNA expression levels, or in the sensitivity of the genes to estrogen. In order to detect alterations of the latter, more subtle parameter, we have conducted experiments in developmentally chemical-exposed rat offspring that were gonadectomized in adulthood and injected with a challenge dose of estradiol. Effects of PBDE99 were compared with those of a commercial PCB mixture, Aroclor 1254, which had previously been found to influence sexual brain differentiation. We analyzed the expression of estrogen-regulated genes in ventromedial hypothalamus (VMH) and medial preoptic area (MPO), two brain regions that are part of a network involved in the integration of environmental cues, sexual behavior and gonadal function. Since prominent changes were observed in VMH which is particularly important for female sexual behavior, the study was completed by a behavioral analysis.

  11. Using riboswitches to regulate gene expression and define gene function in mycobacteria.

    Science.gov (United States)

    Van Vlack, Erik R; Seeliger, Jessica C

    2015-01-01

    Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

  12. Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells.

    Science.gov (United States)

    Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen

    2010-10-01

    Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

    Directory of Open Access Journals (Sweden)

    Kamila Maliszewska-Olejniczak

    2015-07-01

    Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium

  14. Genes regulated by AoXlnR, the xylanolytic and cellulolytic transcriptional regulator, in Aspergillus oryzae.

    Science.gov (United States)

    Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo

    2009-11-01

    XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.

  15. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  16. Statistical modelling of transcript profiles of differentially regulated genes

    Directory of Open Access Journals (Sweden)

    Sergeant Martin J

    2008-07-01

    Full Text Available Abstract Background The vast quantities of gene expression profiling data produced in microarray studies, and the more precise quantitative PCR, are often not statistically analysed to their full potential. Previous studies have summarised gene expression profiles using simple descriptive statistics, basic analysis of variance (ANOVA and the clustering of genes based on simple models fitted to their expression profiles over time. We report the novel application of statistical non-linear regression modelling techniques to describe the shapes of expression profiles for the fungus Agaricus bisporus, quantified by PCR, and for E. coli and Rattus norvegicus, using microarray technology. The use of parametric non-linear regression models provides a more precise description of expression profiles, reducing the "noise" of the raw data to produce a clear "signal" given by the fitted curve, and describing each profile with a small number of biologically interpretable parameters. This approach then allows the direct comparison and clustering of the shapes of response patterns between genes and potentially enables a greater exploration and interpretation of the biological processes driving gene expression. Results Quantitative reverse transcriptase PCR-derived time-course data of genes were modelled. "Split-line" or "broken-stick" regression identified the initial time of gene up-regulation, enabling the classification of genes into those with primary and secondary responses. Five-day profiles were modelled using the biologically-oriented, critical exponential curve, y(t = A + (B + CtRt + ε. This non-linear regression approach allowed the expression patterns for different genes to be compared in terms of curve shape, time of maximal transcript level and the decline and asymptotic response levels. Three distinct regulatory patterns were identified for the five genes studied. Applying the regression modelling approach to microarray-derived time course data

  17. Expression of cartilage developmental genes in Hoxc8- and Hoxd4-transgenic mice.

    Directory of Open Access Journals (Sweden)

    Claudia Kruger

    2010-02-01

    Full Text Available Hox genes encode transcription factors, which regulate skeletal patterning and chondrocyte differentiation during the development of cartilage, the precursor to mature bone. Overexpression of the homeobox transcription factors Hoxc8 and Hoxd4 causes severe cartilage defects due to delay in cartilage maturation. Matrix metalloproteinases (MMPs, bone morphogenetic proteins (BMPs and fibroblastic growth factors (FGFs are known to play important roles in skeletal development and endochondral bone formation and remodeling. In order to investigate whether these molecules are aberrantly expressed in Hoxc8- and/or Hoxd4-transgenic cartilage, we performed quantitative RT-PCR on chondrocytes from Hox-transgenic mice. Gene expression levels of Bmp4, Fgf8, Fgf10, Mmp9, Mmp13, Nos3, Timp3, Wnt3a and Wnt5a were altered in Hoxc8-transgenic chondrocytes, and Fgfr3, Ihh, Mmp8, and Wnt3a expression levels were altered in Hoxd4-transgenic chondrocytes, respectively. Notably, Wnt3a expression was elevated in Hoxc8- and reduced in Hoxd4-transgenic cartilage. These results suggest that both transcription factors affect cartilage maturation through different molecular mechanisms, and provide the basis for future studies into the role of these genes and possible interactions in pathogenesis of cartilage defects in Hoxc8- and Hoxd4-transgenic mice.

  18. Every which way--nanos gene regulation in echinoderms.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2014-03-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio binds to and changes the fate of several known transcripts. We summarize here the documented functions of Nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way. Copyright © 2013 Wiley Periodicals, Inc.

  19. Obestatin enhances in vitro generation of pancreatic islets through regulation of developmental pathways.

    Directory of Open Access Journals (Sweden)

    Alessandra Baragli

    Full Text Available Availability of large amounts of in vitro generated β-cells may support replacement therapy in diabetes. However, methods to obtain β-cells from stem/progenitor cells are limited by inefficient endocrine differentiation. We have recently shown that the ghrelin gene product obestatin displays beneficial effects on pancreatic β-cell survival and function. Obestatin prevents β-cell apoptosis, preserves β-cell mass and stimulates insulin secretion in vitro and in vivo, in both normal and diabetic conditions. In the present study, we investigated whether obestatin may promote in vitro β-cell generation from mouse pancreatic islet-derived precursor cells. Treatment of cultured islets of Langerhans with obestatin (i enriched cells expressing the mesenchymal/neuronal marker nestin, which is associated with pancreatic precursors; (ii increased cell survival and reduced apoptosis during precursor selection; (iii promoted the generation of islet-like cell clusters (ICCs with increased insulin gene expression and C-peptide secretion. Furthermore, obestatin modulated the expression of fibroblast growth factor receptors (FGFRs, Notch receptors and neurogenin 3 (Ngn3 during islet-derived precursor cell selection and endocrine differentiation. These results indicate that obestatin improves the generation of functional β-cells/ICCs in vitro, suggesting implications for cell-based replacement therapy in diabetes. Moreover, obestatin may play a role in regulating pathways involved in pancreas development and regeneration.

  20. Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

    Science.gov (United States)

    Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

    2014-01-01

    Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

  1. Pseudogenes regulate parental gene expression via ceRNA network.

    Science.gov (United States)

    An, Yang; Furber, Kendra L; Ji, Shaoping

    2017-01-01

    The concept of competitive endogenous RNA (ceRNA) was first proposed by Salmena and colleagues. Evidence suggests that pseudogene RNAs can act as a 'sponge' through competitive binding of common miRNA, releasing or attenuating repression through sequestering miRNAs away from parental mRNA. In theory, ceRNAs refer to all transcripts such as mRNA, tRNA, rRNA, long non-coding RNA, pseudogene RNA and circular RNA, because all of them may become the targets of miRNA depending on spatiotemporal situation. As binding of miRNA to the target RNA is not 100% complementary, it is possible that one miRNA can bind to multiple target RNAs and vice versa. All RNAs crosstalk through competitively binding to miRNAvia miRNA response elements (MREs) contained within the RNA sequences, thus forming a complex regulatory network. The ratio of a subset of miRNAs to the corresponding number of MREs determines repression strength on a given mRNA translation or stability. An increase in pseudogene RNA level can sequester miRNA and release repression on the parental gene, leading to an increase in parental gene expression. A massive number of transcripts constitute a complicated network that regulates each other through this proposed mechanism, though some regulatory significance may be mild or even undetectable. It is possible that the regulation of gene and pseudogene expression occurring in this manor involves all RNAs bearing common MREs. In this review, we will primarily discuss how pseudogene transcripts regulate expression of parental genes via ceRNA network and biological significance of regulation. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  2. Mining disease genes using integrated protein-protein interaction and gene-gene co-regulation information.

    Science.gov (United States)

    Li, Jin; Wang, Limei; Guo, Maozu; Zhang, Ruijie; Dai, Qiguo; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Xuan, Ping; Zhang, Mingming

    2015-01-01

    In humans, despite the rapid increase in disease-associated gene discovery, a large proportion of disease-associated genes are still unknown. Many network-based approaches have been used to prioritize disease genes. Many networks, such as the protein-protein interaction (PPI), KEGG, and gene co-expression networks, have been used. Expression quantitative trait loci (eQTLs) have been successfully applied for the determination of genes associated with several diseases. In this study, we constructed an eQTL-based gene-gene co-regulation network (GGCRN) and used it to mine for disease genes. We adopted the random walk with restart (RWR) algorithm to mine for genes associated with Alzheimer disease. Compared to the Human Protein Reference Database (HPRD) PPI network alone, the integrated HPRD PPI and GGCRN networks provided faster convergence and revealed new disease-related genes. Therefore, using the RWR algorithm for integrated PPI and GGCRN is an effective method for disease-associated gene mining.

  3. Transcriptional regulation of genes related to progesterone production.

    Science.gov (United States)

    Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru

    2015-01-01

    Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production.

  4. Globalisation reaches gene regulation: the case for vertebrate limb development.

    Science.gov (United States)

    Zuniga, Aimée

    2005-08-01

    Analysis of key regulators of vertebrate limb development has revealed that the cis-regulatory regions controlling their expression are often located several hundred kilobases upstream of the transcription units. These far up- or down-stream cis-regulatory regions tend to reside within rather large, functionally and structurally unrelated genes. Molecular analysis is beginning to reveal the complexity of these large genomic landscapes, which control the co-expression of clusters of diverse genes by this novel type of long-range and globally acting cis-regulatory region. An increasing number of spontaneous mutations in vertebrates, including humans, are being discovered inactivating or altering such global control regions. Thereby, the functions of a seemingly distant but essential gene are disrupted rather than the closest.

  5. Regulation of vesicular trafficking by Parkinson's disease-associated genes

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Inoshita

    2015-10-01

    Full Text Available The regulatory mechanisms that control intracellular vesicular trafficking play important roles in cellular function and viability. Neurons have specific vesicular trafficking systems for synaptic vesicle formation, release and recycling. Synaptic vesicular trafficking impairments induce neuronal dysfunction and physiological and behavioral disorders. Parkinson's disease (PD is an age-dependent neurodegenerative disorder characterized by dopamine depletion and loss of dopamine neurons in the midbrain. The molecular mechanism responsible for the neurodegeneration that occurs during PD is still not understood; however, recent functional analyses of familial PD causative genes suggest that a number of PD causative genes regulate intracellular vesicular trafficking, including synaptic vesicular dynamics. This review focuses on recent insights regarding the functions of PD causative genes, their relationship with vesicular trafficking and how mutations associated with PD affect vesicular dynamics and neuronal survival.

  6. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  7. Dynamic regulation of mRNA and miRNA associated with the developmental stages of skin pigmentation in Japanese ornamental carp.

    Science.gov (United States)

    Tian, Xue; Pang, Xiaolei; Wang, Liangyan; Li, Mengrong; Dong, Chuanju; Ma, Xiao; Wang, Lei; Song, Dongying; Feng, Jianxin; Xu, Peng; Li, Xuejun

    2018-04-20

    The Japanese ornamental carp (Cyprinus carpio var. Koi) is famous for multifarious colors and patterns, making it commonly culture and trade across the world. Although functional genes and inheritance of color traits have been commonly studied, seldom attentions were focused on the genetic regulation during the developmental process of pigmentation. To better understand the mechanism of skin color development, we observed the morphogenesis of pigment cells during the post-embryonic stages and analysed the temporal expression pattern of mRNAs/miRNAs profiles in four distinct developmental stages. 59 and 103 differentially expressed genes/miRNAs (DEGs/DEMs) associated with pigmentation and skin were identified, including pax7, mitf, tyr, tyrp1, etc., and the highest DEGs were detected at 11 days post hatching (dph). In addition, the functional characteristics of mRNAs/miRNAs associated with pteridine and carotenoid pathway were also examined. Furthermore, 65 miRNA-mRNA interaction pairs related to pigmentation, pteridines and carotenoids metabolism were detected between different stages. Interestingly, the largest pairs appeared in the transition from 11 dph to 48 dph, which had the similar trend with DEGs further manifesting the importance of 11 dph. This study produced a comprehensive programme of DEGs/DEMs during color development, which will provide resources to understand the regulation mechanism in color formation. The understanding of genetic basis in color formation might promote the production and breeding of the Koi carp. Copyright © 2017. Published by Elsevier B.V.

  8. Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2015-07-01

    Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

  9. Reconstructing a Network of Stress-Response Regulators via Dynamic System Modeling of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Wei-Sheng Wu

    2008-01-01

    Full Text Available Unicellular organisms such as yeasts have evolved mechanisms to respond to environmental stresses by rapidly reorganizing the gene expression program. Although many stress-response genes in yeast have been discovered by DNA microarrays, the stress-response transcription factors (TFs that regulate these stress-response genes remain to be investigated. In this study, we use a dynamic system model of gene regulation to describe the mechanism of how TFs may control a gene’s expression. Then, based on the dynamic system model, we develop the Stress Regulator Identification Algorithm (SRIA to identify stress-response TFs for six kinds of stresses. We identified some general stress-response TFs that respond to various stresses and some specific stress-response TFs that respond to one specifi c stress. The biological significance of our findings is validated by the literature. We found that a small number of TFs is probably suffi cient to control a wide variety of expression patterns in yeast under different stresses. Two implications can be inferred from this observation. First, the response mechanisms to different stresses may have a bow-tie structure. Second, there may be regulatory cross-talks among different stress responses. In conclusion, this study proposes a network of stress-response regulators and the details of their actions.

  10. Developmental consequences of early parenting experiences: self-recognition and self-regulation in three cultural communities.

    Science.gov (United States)

    Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira

    2004-01-01

    This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.

  11. MTA3 regulates CGB5 and Snail genes in trophoblast

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

    2013-04-19

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  12. MTA3 regulates CGB5 and Snail genes in trophoblast

    International Nuclear Information System (INIS)

    Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

    2013-01-01

    Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

  13. De novo deletion of HOXB gene cluster in a patient with failure to thrive, developmental delay, gastroesophageal reflux and bronchiectasis.

    Science.gov (United States)

    Pajusalu, Sander; Reimand, Tiia; Uibo, Oivi; Vasar, Maire; Talvik, Inga; Zilina, Olga; Tammur, Pille; Õunap, Katrin

    2015-01-01

    We report a female patient with a complex phenotype consisting of failure to thrive, developmental delay, congenital bronchiectasis, gastroesophageal reflux and bilateral inguinal hernias. Chromosomal microarray analysis revealed a 230 kilobase deletion in chromosomal region 17q21.32 (arr[hg19] 17q21.32(46 550 362-46 784 039)×1) encompassing only 9 genes - HOXB1 to HOXB9. The deletion was not found in her mother or father. This is the first report of a patient with a HOXB gene cluster deletion involving only HOXB1 to HOXB9 genes. By comparing our case to previously reported five patients with larger chromosomal aberrations involving the HOXB gene cluster, we can suppose that HOXB gene cluster deletions are responsible for growth retardation, developmental delay, and specific facial dysmorphic features. Also, we suppose that bilateral inguinal hernias, tracheo-esophageal abnormalities, and lung malformations represent features with incomplete penetrance. Interestingly, previously published knock-out mice with targeted heterozygous deletion comparable to our patient did not show phenotypic alterations. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...

  15. Post-transcriptional trafficking and regulation of neuronal gene expression.

    Science.gov (United States)

    Goldie, Belinda J; Cairns, Murray J

    2012-02-01

    Intracellular messenger RNA (mRNA) traffic and translation must be highly regulated, both temporally and spatially, within eukaryotic cells to support the complex functional partitioning. This capacity is essential in neurons because it provides a mechanism for rapid input-restricted activity-dependent protein synthesis in individual dendritic spines. While this feature is thought to be important for synaptic plasticity, the structures and mechanisms that support this capability are largely unknown. Certainly specialized RNA binding proteins and binding elements in the 3' untranslated region (UTR) of translationally regulated mRNA are important, but the subtlety and complexity of this system suggests that an intermediate "specificity" component is also involved. Small non-coding microRNA (miRNA) are essential for CNS development and may fulfill this role by acting as the guide strand for mediating complex patterns of post-transcriptional regulation. In this review we examine post-synaptic gene regulation, mRNA trafficking and the emerging role of post-transcriptional gene silencing in synaptic plasticity.

  16. Developmentally Sensitive Interaction Effects of Genes and the Social Environment on Total and Subcortical Brain Volumes.

    Science.gov (United States)

    Richards, Jennifer S; Arias Vásquez, Alejandro; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Buitelaar, Jan K; Hartman, Catharina A

    2016-01-01

    Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD). Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE) in interindividual variability of total gray matter (GM), caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312) and without ADHD (N = 437) from N = 402 families (age M = 17.00, SD = 3.60). GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation) as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.

  17. Developmentally Sensitive Interaction Effects of Genes and the Social Environment on Total and Subcortical Brain Volumes.

    Directory of Open Access Journals (Sweden)

    Jennifer S Richards

    Full Text Available Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD. Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE in interindividual variability of total gray matter (GM, caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312 and without ADHD (N = 437 from N = 402 families (age M = 17.00, SD = 3.60. GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.

  18. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  19. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  20. Co-regulation of a large and rapidly evolving repertoire of odorant receptor genes

    Directory of Open Access Journals (Sweden)

    Lane Robert P

    2007-09-01

    Full Text Available Abstract The olfactory system meets niche- and species-specific demands by an accelerated evolution of its odorant receptor repertoires. In this review, we describe evolutionary processes that have shaped olfactory and vomeronasal receptor gene families in vertebrate genomes. We emphasize three important periods in the evolution of the olfactory system evident by comparative genomics: the adaptation to land in amphibian ancestors, the decline of olfaction in primates, and the delineation of putative pheromone receptors concurrent with rodent speciation. The rapid evolution of odorant receptor genes, the sheer size of the repertoire, as well as their wide distribution in the genome, presents a developmental challenge: how are these ever-changing odorant receptor repertoires coordinated within the olfactory system? A central organizing principle in olfaction is the specialization of sensory neurons resulting from each sensory neuron expressing only ~one odorant receptor allele. In this review, we also discuss this mutually exclusive expression of odorant receptor genes. We have considered several models to account for co-regulation of odorant receptor repertoires, as well as discussed a new hypothesis that invokes important epigenetic properties of the system.

  1. Precise regulation of gene expression dynamics favors complex promoter architectures.

    Directory of Open Access Journals (Sweden)

    Dirk Müller

    2009-01-01

    Full Text Available Promoters process signals through recruitment of transcription factors and RNA polymerase, and dynamic changes in promoter activity constitute a major noise source in gene expression. However, it is barely understood how complex promoter architectures determine key features of promoter dynamics. Here, we employ prototypical promoters of yeast ribosomal protein genes as well as simplified versions thereof to analyze the relations among promoter design, complexity, and function. These promoters combine the action of a general regulatory factor with that of specific transcription factors, a common motif of many eukaryotic promoters. By comprehensively analyzing stationary and dynamic promoter properties, this model-based approach enables us to pinpoint the structural characteristics underlying the observed behavior. Functional tradeoffs impose constraints on the promoter architecture of ribosomal protein genes. We find that a stable scaffold in the natural design results in low transcriptional noise and strong co-regulation of target genes in the presence of gene silencing. This configuration also exhibits superior shut-off properties, and it can serve as a tunable switch in living cells. Model validation with independent experimental data suggests that the models are sufficiently realistic. When combined, our results offer a mechanistic explanation for why specific factors are associated with low protein noise in vivo. Many of these findings hold for a broad range of model parameters and likely apply to other eukaryotic promoters of similar structure.

  2. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

    Science.gov (United States)

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

    2015-11-01

    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  3. CEP genes regulate root and shoot development in response to environmental cues and are specific to seed plants.

    Science.gov (United States)

    Delay, Christina; Imin, Nijat; Djordjevic, Michael A

    2013-12-01

    The manifestation of repetitive developmental programmes during plant growth can be adjusted in response to various environmental cues. During root development, this means being able to precisely control root growth and lateral root development. Small signalling peptides have been found to play roles in many aspects of root development. One member of the CEP (C-TERMINALLY ENCODED PEPTIDE) gene family has been shown to arrest root growth. Here we report that CEP genes are widespread among seed plants but are not present in land plants that lack true branching roots or root vasculature. We have identified 10 additional CEP genes in Arabidopsis. Expression analysis revealed that CEP genes are regulated by environmental cues such as nitrogen limitation, increased salt levels, increased osmotic strength, and increased CO2 levels in both roots and shoots. Analysis of synthetic CEP variants showed that both peptide sequence and modifications of key amino acids affect CEP biological activity. Analysis of several CEP over-expression lines revealed distinct roles for CEP genes in root and shoot development. A cep3 knockout mutant showed increased root and shoot growth under a range of abiotic stress, nutrient, and light conditions. We demonstrate that CEPs are negative regulators of root development, slowing primary root growth and reducing lateral root formation. We propose that CEPs are negative regulators that mediate environmental influences on plant development.

  4. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  5. Gene Regulation, Modulation, and Their Applications in Gene Expression Data Analysis

    Directory of Open Access Journals (Sweden)

    Mario Flores

    2013-01-01

    Full Text Available Common microarray and next-generation sequencing data analysis concentrate on tumor subtype classification, marker detection, and transcriptional regulation discovery during biological processes by exploring the correlated gene expression patterns and their shared functions. Genetic regulatory network (GRN based approaches have been employed in many large studies in order to scrutinize for dysregulation and potential treatment controls. In addition to gene regulation and network construction, the concept of the network modulator that has significant systemic impact has been proposed, and detection algorithms have been developed in past years. Here we provide a unified mathematic description of these methods, followed with a brief survey of these modulator identification algorithms. As an early attempt to extend the concept to new RNA regulation mechanism, competitive endogenous RNA (ceRNA, into a modulator framework, we provide two applications to illustrate the network construction, modulation effect, and the preliminary finding from these networks. Those methods we surveyed and developed are used to dissect the regulated network under different modulators. Not limit to these, the concept of “modulation” can adapt to various biological mechanisms to discover the novel gene regulation mechanisms.

  6. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Science.gov (United States)

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  7. Regulation of gene expression in mammalian cells following ionizing radiation

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, S.W

    1991-01-01

    Mammalian cells use a variety of mechanisms to control the expression of new gene transcrips elicited in response to ionizing radiation. Damage-induced proteins have been found which contain DNA binding sites located within the promoter regions of SV40 and human thymidine kinase genes. DNA binding proteins as well as proteins which bind to specific DNA lesions (e.g., XIP bp 175 binds specifically to X-ray-damaged DNA) may play a role in the initial recognition of DNA damage and may initiate DNA repair processes, along with new transcription. Mammalian gene expression after DNA damage is also regulated via the stabilization of preexisting mRNA transcripts. Stabilized mRNA transcripts are translated into protein products not previously present in the cell due to undefined posttranscriptional modifications. Thus far, the only example of mRNA stabilization following X-irradiation is the immediate induction of tissue-type plasminogen activator. Mammalian cells synthesize new mRNA transcripts indirect response to DNA damage. Using cDNA cloning, Northern RNA blotting and nuclear run-on techniques, the levels of a variety of known and previously unknown genes dramatically increase following X-irradiation. These genes/proteins now include; a) DNA binding transcripts factors, such as the UV-responsive element binding factors, ionizing radiation-induced DNA-binding proteins, and XIP bP 175; b) proto-oncogenes, such as c-fos, c-jun, and c-myc; c) several growth-related genes, (e.g., the gadd genes, protein kinase C, IL-1, and thymidine kinase); and d) a variety of other genes, including proteases, tumor necrosis factor-alpha, and DT diaphorase. Mammalian cells respond to X-irradiation by eliciting a very complex series of events resulting in the appearance of new genes and proteins. These gene products may affect DNA repair, adaptive responses, apoptosis, SOS-type mutagenic response, and/or carcinogenesis. (J.P.N.)

  8. Thyroid Hormone Receptor α Controls Developmental Timing and Regulates the Rate and Coordination of Tissue-Specific Metamorphosis in Xenopus tropicalis.

    Science.gov (United States)

    Wen, Luan; Shibata, Yuki; Su, Dan; Fu, Liezhen; Luu, Nga; Shi, Yun-Bo

    2017-06-01

    Thyroid hormone (T3) receptors (TRs) mediate the effects of T3 on organ metabolism and animal development. There are two TR genes, TRα and TRβ, in all vertebrates. During animal development, TRα expression is activated earlier than zygotic T3 synthesis and secretion into the plasma, implicating a developmental role of TRα both in the presence and absence of T3. Using T3-dependent amphibian metamorphosis as a model, we previously proposed a dual-function model for TRs, in particular TRα, during development. That is, unliganded TR represses the expression of T3-inducible genes during premetamorphosis to ensure proper animal growth and prevent premature metamorphosis, whereas during metamorphosis, liganded TR activates target gene transcription to promote the transformation of the tadpole into a frog. To determine if TRα has such a dual function, we generated homozygous TRα-knockout animal lines. We show that, indeed, TRα knockout affects both premetamorphic animal development and metamorphosis. Surprisingly, we observed that TRα is not essential for amphibian metamorphosis, given that homozygous knockout animals complete metamorphosis within a similar time period after fertilization as their wild-type siblings. On the other hand, the timing of metamorphosis for different organs is altered by the knockout; limb metamorphosis occurs earlier, whereas intestinal metamorphosis is completed later than in wild-type siblings. Thus, our studies have demonstrated a critical role of endogenous TRα, not only in regulating both the timing and rate of metamorphosis, but also in coordinating temporal metamorphosis of different organs.

  9. DMPD: Interferon gene regulation: not all roads lead to Tolls. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16095970 Interferon gene regulation: not all roads lead to Tolls. Jefferies CA, Fit...zgerald KA. Trends Mol Med. 2005 Sep;11(9):403-11. (.png) (.svg) (.html) (.csml) Show Interferon gene regulation: not all roads... lead to Tolls. PubmedID 16095970 Title Interferon gene regulation: not all roads lead to

  10. Developmental pathway genes and neural plasticity underlying emotional learning and stress-related disorders.

    Science.gov (United States)

    Maheu, Marissa E; Ressler, Kerry J

    2017-09-01

    The manipulation of neural plasticity as a means of intervening in the onset and progression of stress-related disorders retains its appeal for many researchers, despite our limited success in translating such interventions from the laboratory to the clinic. Given the challenges of identifying individual genetic variants that confer increased risk for illnesses like depression and post-traumatic stress disorder, some have turned their attention instead to focusing on so-called "master regulators" of plasticity that may provide a means of controlling these potentially impaired processes in psychiatric illnesses. The mammalian homolog of Tailless (TLX), Wnt, and the homeoprotein Otx2 have all been proposed to constitute master regulators of different forms of plasticity which have, in turn, each been implicated in learning and stress-related disorders. In the present review, we provide an overview of the changing distribution of these genes and their roles both during development and in the adult brain. We further discuss how their distinct expression profiles provide clues as to their function, and may inform their suitability as candidate drug targets in the treatment of psychiatric disorders. © 2017 Maheu and Ressler; Published by Cold Spring Harbor Laboratory Press.

  11. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    International Nuclear Information System (INIS)

    Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria

    2014-01-01

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  12. Regulation of gene expression and pain states by epigenetic mechanisms.

    Science.gov (United States)

    Géranton, Sandrine M; Tochiki, Keri K

    2015-01-01

    The induction of inflammatory or neuropathic pain states is known to involve molecular activity in the spinal superficial dorsal horn and dorsal root ganglia, including intracellular signaling events which lead to changes in gene expression. These changes ultimately cause alterations in macromolecular synthesis, synaptic transmission, and structural architecture which support central sensitization, a process required for the establishment of long-term pain states. Epigenetic mechanisms are essential for long-term synaptic plasticity and modulation of gene expression. This is because epigenetic modifications are known to regulate gene transcription by aiding the physical relaxation or condensation of chromatin. These processes are therefore potential regulators of the molecular changes underlying permanent pain states. A handful of studies have emerged in the field of pain epigenetics; however, the field is still very much in its infancy. This chapter draws upon other specialities which have extensively investigated epigenetic mechanisms, such as learning and memory and oncology. After defining epigenetics as well as the recent field of "neuroepigenetics" and the main molecular mechanisms involved, this chapter describes the role of these mechanisms in the synaptic plasticity seen in learning and memory, and address those epigenetic mechanisms that have been linked with the development of acute and prolonged pain states. Finally, the idea that long-lasting epigenetic modifications could contribute to the transition from acute to chronic pain states by supporting maladaptive molecular changes is discussed. © 2015 Elsevier Inc. All rights reserved.

  13. Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools

    Energy Technology Data Exchange (ETDEWEB)

    Laganà, Alessandro [Department of Molecular Virology, Immunology and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH (United States); Shasha, Dennis [Courant Institute of Mathematical Sciences, New York University, New York, NY (United States); Croce, Carlo Maria [Department of Molecular Virology, Immunology and Medical Genetics, Comprehensive Cancer Center, The Ohio State University, Columbus, OH (United States)

    2014-12-11

    The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.

  14. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Directory of Open Access Journals (Sweden)

    Ram Prakash Gupta

    2017-11-01

    Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

  15. Regulation of the Drosophila Enhancer of split and invected-engrailed gene complexes by sister chromatid cohesion proteins.

    Directory of Open Access Journals (Sweden)

    Cheri A Schaaf

    2009-07-01

    Full Text Available The cohesin protein complex was first recognized for holding sister chromatids together and ensuring proper chromosome segregation. Cohesin also regulates gene expression, but the mechanisms are unknown. Cohesin associates preferentially with active genes, and is generally absent from regions in which histone H3 is methylated by the Enhancer of zeste [E(z] Polycomb group silencing protein. Here we show that transcription is hypersensitive to cohesin levels in two exceptional cases where cohesin and the E(z-mediated histone methylation simultaneously coat the entire Enhancer of split and invected-engrailed gene complexes in cells derived from Drosophila central nervous system. These gene complexes are modestly transcribed, and produce seven of the twelve transcripts that increase the most with cohesin knockdown genome-wide. Cohesin mutations alter eye development in the same manner as increased Enhancer of split activity, suggesting that similar regulation occurs in vivo. We propose that cohesin helps restrain transcription of these gene complexes, and that deregulation of similarly cohesin-hypersensitive genes may underlie developmental deficits in Cornelia de Lange syndrome.

  16. Transcriptional regulation of the grape cytochrome P450 monooxygenase gene CYP736B expression in response to Xylella fastidiosa infection

    Directory of Open Access Journals (Sweden)

    Walker M Andrew

    2010-07-01

    Full Text Available Abstract Background Plant cytochrome P450 monooxygenases (CYP mediate synthesis and metabolism of many physiologically important primary and secondary compounds that are related to plant defense against a range of pathogenic microbes and insects. To determine if cytochrome P450 monooxygenases are involved in defense response to Xylella fastidiosa (Xf infection, we investigated expression and regulatory mechanisms of the cytochrome P450 monooxygenase CYP736B gene in both disease resistant and susceptible grapevines. Results Cloning of genomic DNA and cDNA revealed that the CYP736B gene was composed of two exons and one intron with GT as a donor site and AG as an acceptor site. CYP736B transcript was up-regulated in PD-resistant plants and down-regulated in PD-susceptible plants 6 weeks after Xf inoculation. However, CYP736B expression was very low in stem tissues at all evaluated time points. 5'RACE and 3'RACE sequence analyses revealed that there were three candidate transcription start sites (TSS in the upstream region and three candidate polyadenylation (PolyA sites in the downstream region of CYP736B. Usage frequencies of each transcription initiation site and each polyadenylation site varied depending on plant genotype, developmental stage, tissue, and treatment. These results demonstrate that expression of CYP736B is regulated developmentally and in response to Xf infection at both transcriptional and post-transcriptional levels. Multiple transcription start and polyadenylation sites contribute to regulation of CYP736B expression. Conclusions This report provides evidence that the cytochrome P450 monooxygenase CYP736B gene is involved in defense response at a specific stage of Xf infection in grapevines; multiple transcription initiation and polyadenylation sites exist for CYP736B in grapevine; and coordinative and selective use of transcription initiation and polyadenylation sites play an important role in regulation of CYP736B expression

  17. Developmentally regulated GTP-binding protein 2 is required for stabilization of Rac1-positive membrane tubules.

    Science.gov (United States)

    Mani, Muralidharan; Lee, Unn Hwa; Yoon, Nal Ae; Yoon, Eun Hye; Lee, Byung Ju; Cho, Wha Ja; Park, Jeong Woo

    2017-11-04

    Previously we have reported that developmentally regulated GTP-binding protein 2 (DRG2) localizes on Rab5 endosomes and plays an important role in transferrin (Tfn) recycling. We here identified DRG2 as a key regulator of membrane tubule stability. At 30 min after Tfn treatment, DRG2 localized to membrane tubules which were enriched with phosphatidylinositol 4-monophosphate [PI(4)P] and did not contain Rab5. DRG2 interacted with Rac1 more strongly with GTP-bound Rac1 and tubular localization of DRG2 depended on Rac1 activity. DRG2 depletion led to destabilization of membrane tubules, while ectopic expression of DRG2 rescued the stability of the membrane tubules in DRG2-depleted cells. Our results reveal a novel mechanism for regulation of membrane tubule stability mediated by DRG2. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. VE-Cadherin–Mediated Epigenetic Regulation of Endothelial Gene Expression

    Science.gov (United States)

    Morini, Marco F.; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I.; Conze, Lei L.; O’Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P.

    2018-01-01

    levels of claudin-5 and VE-PTP. Conclusions: These data extend the knowledge of polycomb-mediated regulation of gene expression to endothelial cell differentiation and vessel maturation. The identified mechanism opens novel therapeutic opportunities to modulate endothelial gene expression and induce vascular normalization through pharmacological inhibition of the polycomb-mediated repression system. PMID:29233846

  19. VE-Cadherin-Mediated Epigenetic Regulation of Endothelial Gene Expression.

    Science.gov (United States)

    Morini, Marco F; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I; Conze, Lei L; O'Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P; Dejana, Elisabetta; Taddei, Andrea

    2018-01-19

    data extend the knowledge of polycomb-mediated regulation of gene expression to endothelial cell differentiation and vessel maturation. The identified mechanism opens novel therapeutic opportunities to modulate endothelial gene expression and induce vascular normalization through pharmacological inhibition of the polycomb-mediated repression system. © 2017 The Authors.

  20. Gene regulation and noise reduction by coupling of stochastic processes

    Science.gov (United States)

    Ramos, Alexandre F.; Hornos, José Eduardo M.; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  1. Gene regulation and noise reduction by coupling of stochastic processes.

    Science.gov (United States)

    Ramos, Alexandre F; Hornos, José Eduardo M; Reinitz, John

    2015-02-01

    Here we characterize the low-noise regime of a stochastic model for a negative self-regulating binary gene. The model has two stochastic variables, the protein number and the state of the gene. Each state of the gene behaves as a protein source governed by a Poisson process. The coupling between the two gene states depends on protein number. This fact has a very important implication: There exist protein production regimes characterized by sub-Poissonian noise because of negative covariance between the two stochastic variables of the model. Hence the protein numbers obey a probability distribution that has a peak that is sharper than those of the two coupled Poisson processes that are combined to produce it. Biochemically, the noise reduction in protein number occurs when the switching of the genetic state is more rapid than protein synthesis or degradation. We consider the chemical reaction rates necessary for Poisson and sub-Poisson processes in prokaryotes and eucaryotes. Our results suggest that the coupling of multiple stochastic processes in a negative covariance regime might be a widespread mechanism for noise reduction.

  2. Identification of developmentally regulated PCP-responsive non-coding RNA, prt6, in the rat thalamus.

    Directory of Open Access Journals (Sweden)

    Hironao Takebayashi

    Full Text Available Schizophrenia and similar psychoses induced by NMDA-type glutamate receptor antagonists, such as phencyclidine (PCP and ketamine, usually develop after adolescence. Moreover, adult-type behavioral disturbance following NMDA receptor antagonist application in rodents is observed after a critical period at around 3 postnatal weeks. These observations suggest that the schizophrenic symptoms caused by and psychotomimetic effects of NMDA antagonists require the maturation of certain brain neuron circuits and molecular networks, which differentially respond to NMDA receptor antagonists across adolescence and the critical period. From this viewpoint, we have identified a novel developmentally regulated phencyclidine-responsive transcript from the rat thalamus, designated as prt6, as a candidate molecule involved in the above schizophrenia-related systems using a DNA microarray technique. The transcript is a non-coding RNA that includes sequences of at least two microRNAs, miR132 and miR212, and is expressed strongly in the brain and testis, with trace or non-detectable levels in the spleen, heart, liver, kidney, lung and skeletal muscle, as revealed by Northern blot analysis. The systemic administration of PCP (7.5 mg/kg, subcutaneously (s.c. significantly elevated the expression of prt6 mRNA in the thalamus at postnatal days (PD 32 and 50, but not at PD 8, 13, 20, or 24 as compared to saline-treated controls. At PD 50, another NMDA receptor antagonist, dizocilpine (0.5 mg/kg, s.c., and a schizophrenomimetic dopamine agonist, methamphetamine (4.8 mg/kg, s.c., mimicked a significant increase in the levels of thalamic prt6 mRNAs, while a D2 dopmamine receptor antagonist, haloperidol, partly inhibited the increasing influence of PCP on thalamic prt6 expression without its own effects. These data indicate that prt6 may be involved in the pathophysiology of the onset of drug-induced schizophrenia-like symptoms and schizophrenia through the possible

  3. Thermodynamics-based models of transcriptional regulation with gene sequence.

    Science.gov (United States)

    Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

    2015-12-01

    Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

  4. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    Science.gov (United States)

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  5. Regulation of K-Cl cotransport: from function to genes.

    Science.gov (United States)

    Adragna, N C; Di Fulvio, M; Lauf, P K

    2004-10-01

    cotransporter and the cytoskeleton appears to depend on the cellular origin and experimental conditions. Pathophysiologically, K-Cl COT is altered in sickle cell anemia and neuropathies, and it has also been proposed to play a role in blood pressure control. Four closely related human genes code for KCCs (KCC1-4). Although considerable information is accumulating on tissue distribution, function and pathologies associated with the different isoforms, little is known about the genetic regulation of the KCC genes in terms of transcriptional and post-transcriptional regulation. A few reports indicate that the NO/cGMP/PKG signaling pathway regulates KCC1 and KCC3 mRNA expression in VSMCs at the post-transcriptional level. However, the detailed mechanisms of post-transcriptional regulation of KCC genes and of regulation of KCC2 and KCC4 mRNA expression are unknown. The K-Cl COT field is expected to expand further over the next decades, as new isoforms and/or regulatory pathways are discovered and its implication in health and disease is revealed.

  6. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Directory of Open Access Journals (Sweden)

    Shutao Zhang

    Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  7. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Science.gov (United States)

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  8. Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

    Science.gov (United States)

    Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

    2016-05-01

    The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  10. Nitrogen regulates chitinase gene expression in a marine bacterium

    DEFF Research Database (Denmark)

    Delpin, Marina; Goodman, A.E.

    2009-01-01

    Ammonium concentration and nitrogen source regulate promoter activity and use for the transcription of chiA, the major chitinase gene of Pseudoalteromonas sp. S91 and S91CX, an S91 transposon lacZ fusion mutant. The activity of chiA was quantified by beta-galactosidase assay of S91CX cultures con...... GlcNAc, transcription initiated from two putative sigma(54)-dependent promoters and (3) glt, transcription initiated from all three putative promoters. The ISME Journal (2009) 3, 1064-1069; doi:10.1038/ismej.2009.49; published online 14 May 2009...

  11. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  12. Gene prediction and RFX transcriptional regulation analysis using comparative genomics

    OpenAIRE

    Chu, Jeffrey Shih Chieh

    2011-01-01

    Regulatory Factor X (RFX) is a family of transcription factors (TF) that is conserved in all metazoans, in some fungi, and in only a few single-cellular organisms. Seven members are found in mammals, nine in fishes, three in fruit flies, and a single member in nematodes and fungi. RFX is involved in many different roles in humans, but a particular function that is conserved in many metazoans is its regulation of ciliogenesis. Probing over 150 genomes for the presence of RFX and ciliary genes ...

  13. Every which way – nanos gene regulation in echinoderms

    OpenAIRE

    Oulhen, Nathalie; Wessel, Gary M.

    2014-01-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio, binds to and changes the fate of several known transcripts. We summarize here the documented functions of nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos ...

  14. Parental Influences on Children's Self-Regulation of Energy Intake: Insights from Developmental Literature on Emotion Regulation

    Directory of Open Access Journals (Sweden)

    Leslie A. Frankel

    2012-01-01

    Full Text Available The following article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to children's behavior, assistance in helping children self-regulate, and motivating children through rewards and punishments. Additionally, sources of variation in parental influences on regulation are examined, including parenting style, child temperament, and child-parent attachment security. Parallels in the nature of parents' role in socializing children's regulation of emotions and energy intake are examined. Implications for future research are discussed.

  15. Developmental Changes In Pain And Spinal Immune Gene Expression After Radicular Trauma In The Rat

    Directory of Open Access Journals (Sweden)

    Gordon Alfred Barr

    2016-12-01

    Full Text Available Neuropathic pain is an example of chronic pain that develops after nerve injury and is less frequent in infants and children than in adults. Likewise, in animal models of neuropathic pain, allodynia and hyperalgesia are non-existent or attenuated in the infant, with a switch during development by which acute nerve injury transitions to chronic pain. Concomitant with the delay in neuropathic pain, there is a parallel delay in the ability of nerve injury to activate the immune system. Models of neuropathic pain in the infant have used various ligation methods and find that neuropathic pain does not occur under after postnatal day 21-28 (PN21-PN28, linked to activation of immune processes and developmental regulation of anti-inflammatory cytokines. We applied a model of neuropathic pain in the adult using a transient compression of the cervical nerve or nerve root in infant rats (injured at 10, 14, 21 or 28 days of age to define transition periods during which injury results in no change in thermal and mechanical pain sensitivity or in short term changes in pain. There was little to no hyperalgesia when the injury was imposed at PN10, but significant thermal hyperalgesia and mechanical allodynia one day after compression injury when performed at PN14, 21 or 28. Thermal withdrawal latencies return to near baseline by 7 days post-surgery (PS7 when the injuries were at PN14, and lasted up to 14 days when imposed at PN28. There was mechanical allodynia following nerve injury at 7 or 14 days after injury at PN14. Measurements of mRNA from spinal cord at 1, 7 and 14 days post-injury at PN14, 21, and 28 showed that both the magnitude and duration of elevated immune markers and chemokines/cytokines were greater in the older animals, corresponding to the development of hyperalgesia. Thus we confirm the late onset of neuropathic pain but found no evidence of emergent hyperalgesia if the injury was before PN21/28. This may be due to the use of a transient

  16. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

    OpenAIRE

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

  17. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

  18. Selection and validation of reference genes for quantitative gene expression analyses in various tissues and seeds at different developmental stages in Bixa orellana L.

    Science.gov (United States)

    Moreira, Viviane S; Soares, Virgínia L F; Silva, Raner J S; Sousa, Aurizangela O; Otoni, Wagner C; Costa, Marcio G C

    2018-05-01

    Bixa orellana L., popularly known as annatto, produces several secondary metabolites of pharmaceutical and industrial interest, including bixin, whose molecular basis of biosynthesis remain to be determined. Gene expression analysis by quantitative real-time PCR (qPCR) is an important tool to advance such knowledge. However, correct interpretation of qPCR data requires the use of suitable reference genes in order to reduce experimental variations. In the present study, we have selected four different candidates for reference genes in B. orellana , coding for 40S ribosomal protein S9 (RPS9), histone H4 (H4), 60S ribosomal protein L38 (RPL38) and 18S ribosomal RNA (18SrRNA). Their expression stabilities in different tissues (e.g. flower buds, flowers, leaves and seeds at different developmental stages) were analyzed using five statistical tools (NormFinder, geNorm, BestKeeper, ΔCt method and RefFinder). The results indicated that RPL38 is the most stable gene in different tissues and stages of seed development and 18SrRNA is the most unstable among the analyzed genes. In order to validate the candidate reference genes, we have analyzed the relative expression of a target gene coding for carotenoid cleavage dioxygenase 1 (CCD1) using the stable RPL38 and the least stable gene, 18SrRNA , for normalization of the qPCR data. The results demonstrated significant differences in the interpretation of the CCD1 gene expression data, depending on the reference gene used, reinforcing the importance of the correct selection of reference genes for normalization.

  19. Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

    Science.gov (United States)

    Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

    2012-03-01

    The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

  20. Myeloid translocation genes differentially regulate colorectal cancer programs

    Science.gov (United States)

    Parang, Bobak; Bradley, Amber M.; Mittal, Mukul K.; Short, Sarah P.; Thompson, Joshua J.; Barrett, Caitlyn W.; Naik, Rishi D.; Bilotta, Anthony J.; Washington, Mary K.; Revetta, Frank L.; Smith, Jesse J.; Chen, Xi; Wilson, Keith T.; Hiebert, Scott W.; Williams, Christopher S.

    2016-01-01

    Myeloid translocation genes (MTGs), originally identified as chromosomal translocations in acute myelogenous leukemia, are transcriptional corepressors that regulate hematopoietic stem cell programs. Analysis of The Cancer Genome Atlas (TCGA) database revealed that MTGs were mutated in epithelial malignancy and suggested that loss of function might promote tumorigenesis. Genetic deletion of MTGR1 and MTG16 in the mouse has revealed unexpected and unique roles within the intestinal epithelium. Mtgr1−/− mice have progressive depletion of all intestinal secretory cells, and Mtg16−/− mice have a decrease in goblet cells. Furthermore, both Mtgr1−/− and Mtg16−/− mice have increased intestinal epithelial cell proliferation. We thus hypothesized that loss of MTGR1 or MTG16 would modify Apc1638/+-dependent intestinal tumorigenesis. Mtgr1−/− mice, but not Mtg16−/− mice, had a 10-fold increase in tumor multiplicity. This was associated with more advanced dysplasia, including progression to invasive adenocarcinoma, and augmented intratumoral proliferation. Analysis of ChIP-seq datasets for MTGR1 and MTG16 targets indicated that MTGR1 can regulate Wnt and Notch signaling. In support of this, immunohistochemistry and gene expression analysis revealed that both Wnt and Notch signaling pathways were hyperactive in Mtgr1−/− tumors. Furthermore, in human colorectal cancer (CRC) samples MTGR1 was downregulated at both the transcript and protein level. Overall our data indicates that MTGR1 has a context dependent effect on intestinal tumorigenesis. PMID:27270437

  1. Insights into the regulation of human CNV-miRNAs from the view of their target genes

    Directory of Open Access Journals (Sweden)

    Wu Xudong

    2012-12-01

    Full Text Available Abstract Background microRNAs (miRNAs represent a class of small (typically 22 nucleotides in length non-coding RNAs that can degrade their target mRNAs or block their translation. Recent research showed that copy number alterations of miRNAs and their target genes are highly prevalent in cancers; however, the evolutionary and biological functions of naturally existing copy number variable miRNAs (CNV-miRNAs among individuals have not been studied extensively throughout the genome. Results In this study, we comprehensively analyzed the properties of genes regulated by CNV-miRNAs, and found that CNV-miRNAs tend to target a higher average number of genes and prefer to synergistically regulate the same genes; further, the targets of CNV-miRNAs tend to have higher variability of expression within and between populations. Finally, we found the targets of CNV-miRNAs are more likely to be differentially expressed among tissues and developmental stages, and participate in a wide range of cellular responses. Conclusions Our analyses of CNV-miRNAs provide new insights into the impact of copy number variations on miRNA-mediated post-transcriptional networks. The deeper interpretation of patterns of gene expression variation and the functional characterization of CNV-miRNAs will help to broaden the current understanding of the molecular basis of human phenotypic diversity.

  2. Tracking developmentally regulated post-synthetic processing of homogalacturonan and chitin using reciprocal oligosaccharide probes

    DEFF Research Database (Denmark)

    Mravec, Jozef; Kračun, Stjepan K.; Rydahl, Maja G.

    2014-01-01

    Polysaccharides are major components of extracellular matrices and are often extensively modified post-synthetically to suit local requirements and developmental programmes. However, our current understanding of the spatiotemporal dynamics and functional significance of these modifications is lim...... and animal systems. We demonstrated their potential for providing new biological insights by using them to study homogalacturonan processing during Arabidopsis thaliana root cap development and by analyzing sites of chitosan deposition in fungal cell walls and arthropod exoskeletons....

  3. Divergent RNA Localisation Patterns of Maternal Genes Regulating Embryonic Patterning in the Butterfly Pararge aegeria.

    Directory of Open Access Journals (Sweden)

    Jean-Michel Carter

    Full Text Available The maternal effect genes responsible for patterning the embryo along the antero-posterior (AP axis are broadly conserved in insects. The precise function of these maternal effect genes is the result of the localisation of their mRNA in the oocyte. The main developmental mechanisms involved have been elucidated in Drosophila melanogaster, but recent studies have shown that other insect orders often diverge in RNA localisation patterns. A recent study has shown that in the butterfly Pararge aegeria the distinction between blastodermal embryonic (i.e. germ band and extra-embryonic tissue (i.e. serosa is already specified in the oocyte during oogenesis in the ovariole, long before blastoderm cellularisation. To examine the extent by which a female butterfly specifies and patterns the AP axis within the region fated to be the germ band, and whether she specifies a germ plasm, we performed in situ hybridisation experiments on oocytes in P. aegeria ovarioles and on early embryos. RNA localisation of the following key maternal effect genes were investigated: caudal (cad, orthodenticle (otd, hunchback (hb and four nanos (nos paralogs, as well as TDRD7 a gene containing a key functional domain (OST-HTH/LOTUS shared with oskar. TDRD7 was mainly confined to the follicle cells, whilst hb was exclusively zygotically transcribed. RNA of some of the nos paralogs, otd and cad revealed complex localisation patterns within the cortical region prefiguring the germ band (i.e. germ cortex. Rather interestingly, otd was localised within and outside the anterior of the germ cortex. Transcripts of nos-O formed a distinct granular ring in the middle of the germ cortex possibly prefiguring the region where germline stem cells form. These butterfly RNA localisation patterns are highly divergent with respect to other insects, highlighting the diverse ways in which different insect orders maternally regulate early embryogenesis of their offspring.

  4. Divergent RNA Localisation Patterns of Maternal Genes Regulating Embryonic Patterning in the Butterfly Pararge aegeria

    Science.gov (United States)

    Carter, Jean-Michel; Gibbs, Melanie; Breuker, Casper J.

    2015-01-01

    The maternal effect genes responsible for patterning the embryo along the antero-posterior (AP) axis are broadly conserved in insects. The precise function of these maternal effect genes is the result of the localisation of their mRNA in the oocyte. The main developmental mechanisms involved have been elucidated in Drosophila melanogaster, but recent studies have shown that other insect orders often diverge in RNA localisation patterns. A recent study has shown that in the butterfly Pararge aegeria the distinction between blastodermal embryonic (i.e. germ band) and extra-embryonic tissue (i.e. serosa) is already specified in the oocyte during oogenesis in the ovariole, long before blastoderm cellularisation. To examine the extent by which a female butterfly specifies and patterns the AP axis within the region fated to be the germ band, and whether she specifies a germ plasm, we performed in situ hybridisation experiments on oocytes in P. aegeria ovarioles and on early embryos. RNA localisation of the following key maternal effect genes were investigated: caudal (cad), orthodenticle (otd), hunchback (hb) and four nanos (nos) paralogs, as well as TDRD7 a gene containing a key functional domain (OST-HTH/LOTUS) shared with oskar. TDRD7 was mainly confined to the follicle cells, whilst hb was exclusively zygotically transcribed. RNA of some of the nos paralogs, otd and cad revealed complex localisation patterns within the cortical region prefiguring the germ band (i.e. germ cortex). Rather interestingly, otd was localised within and outside the anterior of the germ cortex. Transcripts of nos-O formed a distinct granular ring in the middle of the germ cortex possibly prefiguring the region where germline stem cells form. These butterfly RNA localisation patterns are highly divergent with respect to other insects, highlighting the diverse ways in which different insect orders maternally regulate early embryogenesis of their offspring. PMID:26633019

  5. Regulation of Corticosteroidogenic Genes by MicroRNAs

    Directory of Open Access Journals (Sweden)

    Stacy Robertson

    2017-01-01

    Full Text Available The loss of normal regulation of corticosteroid secretion is important in the development of cardiovascular disease. We previously showed that microRNAs regulate the terminal stages of corticosteroid biosynthesis. Here, we assess microRNA regulation across the whole corticosteroid pathway. Knockdown of microRNA using Dicer1 siRNA in H295R adrenocortical cells increased levels of CYP11A1, CYP21A1, and CYP17A1 mRNA and the secretion of cortisol, corticosterone, 11-deoxycorticosterone, 18-hydroxycorticosterone, and aldosterone. Bioinformatic analysis of genes involved in corticosteroid biosynthesis or metabolism identified many putative microRNA-binding sites, and some were selected for further study. Manipulation of individual microRNA levels demonstrated a direct effect of miR-125a-5p and miR-125b-5p on CYP11B2 and of miR-320a-3p levels on CYP11A1 and CYP17A1 mRNA. Finally, comparison of microRNA expression profiles from human aldosterone-producing adenoma and normal adrenal tissue showed levels of various microRNAs, including miR-125a-5p to be significantly different. This study demonstrates that corticosteroidogenesis is regulated at multiple points by several microRNAs and that certain of these microRNAs are differentially expressed in tumorous adrenal tissue, which may contribute to dysregulation of corticosteroid secretion. These findings provide new insights into the regulation of corticosteroid production and have implications for understanding the pathology of disease states where abnormal hormone secretion is a feature.

  6. The Evolution of gene regulation research in Lactococcus lactis.

    Science.gov (United States)

    Kok, Jan; van Gijtenbeek, Lieke A; de Jong, Anne; van der Meulen, Sjoerd B; Solopova, Ana; Kuipers, Oscar P

    2017-08-01

    Lactococcus lactis is a major microbe. This lactic acid bacterium (LAB) is used worldwide in the production of safe, healthy, tasteful and nutritious milk fermentation products. Its huge industrial importance has led to an explosion of research on the organism, particularly since the early 1970s. The upsurge in the research on L. lactis coincided not accidentally with the advent of recombinant DNA technology in these years. The development of methods to take out and re-introduce DNA in L. lactis, to clone genes and to mutate the chromosome in a targeted way, to control (over)expression of proteins and, ultimately, the availability of the nucleotide sequence of its genome and the use of that information in transcriptomics and proteomics research have enabled to peek deep into the functioning of the organism. Among many other things, this has provided an unprecedented view of the major gene regulatory pathways involved in nitrogen and carbon metabolism and their overlap, and has led to the blossoming of the field of L. lactis systems biology. All of these advances have made L. lactis the paradigm of the LAB. This review will deal with the exciting path along which the research on the genetics of and gene regulation in L. lactis has trodden. © FEMS 2017.

  7. Androgens regulate gene expression in avian skeletal muscles.

    Directory of Open Access Journals (Sweden)

    Matthew J Fuxjager

    Full Text Available Circulating androgens in adult reproductively active male vertebrates influence a diversity of organ systems and thus are considered costly. Recently, we obtained evidence that androgen receptors (AR are expressed in several skeletal muscles of three passeriform birds, the golden-collared manakin (Manacus vitellinus, zebra finch (Taenopygia guttata, and ochre-bellied flycatcher (Mionectes oleagieus. Because skeletal muscles that control wing movement make up the bulk of a bird's body mass, evidence for widespread effects of androgen action on these muscles would greatly expand the functional impact of androgens beyond their well-characterized effects on relatively discrete targets throughout the avian body. To investigate this issue, we use quantitative PCR (qPCR to determine if androgens alter gene mRNA expression patterns in wing musculature of wild golden-collared manakins and captive zebra finches. In manakins, the androgen testosterone (T up-regulated expression of parvalbumin (PV and insulin-like growth factor I (IGF-I, two genes whose products enhance cellular Ca(2+ cycling and hypertrophy of skeletal muscle fibers. In T-treated zebra finches, the anti-androgen flutamide blunted PV and IGF-I expression. These results suggest that certain transcriptional effects of androgen action via AR are conserved in passerine skeletal muscle tissue. When we examined wing muscles of manakins, zebra finches and ochre-bellied flycatchers, we found that expression of PV and IGF-I varied across species and in a manner consistent with a function for AR-dependent gene regulation. Together, these findings imply that androgens have the potential to act on avian muscle in a way that may enhance the physicality required for successful reproduction.

  8. Parental influences on children's self-regulation of energy intake: Insights from developmental literature on emotion regulation

    Science.gov (United States)

    This article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to childre...

  9. Non-uniform distribution pattern for differentially expressed genes of transgenic rice Huahui 1 at different developmental stages and environments.

    Directory of Open Access Journals (Sweden)

    Zhi Liu

    Full Text Available DNA microarray analysis is an effective method to detect unintended effects by detecting differentially expressed genes (DEG in safety assessment of genetically modified (GM crops. With the aim to reveal the distribution of DEG of GM crops under different conditions, we performed DNA microarray analysis using transgenic rice Huahui 1 (HH1 and its non-transgenic parent Minghui 63 (MH63 at different developmental stages and environmental conditions. Considerable DEG were selected in each group of HH1 under different conditions. For each group of HH1, the number of DEG was different; however, considerable common DEG were shared between different groups of HH1. These findings suggested that both DEG and common DEG were adequate for investigation of unintended effects. Furthermore, a number of significantly changed pathways were found in all groups of HH1, indicating genetic modification caused everlasting changes to plants. To our knowledge, our study for the first time provided the non-uniformly distributed pattern for DEG of GM crops at different developmental stages and environments. Our result also suggested that DEG selected in GM plants at specific developmental stage and environment could act as useful clues for further evaluation of unintended effects of GM plants.

  10. Developmental and visual input-dependent regulation of the CB1 cannabinoid receptor in the mouse visual cortex.

    Directory of Open Access Journals (Sweden)

    Taisuke Yoneda

    Full Text Available The mammalian visual system exhibits significant experience-induced plasticity in the early postnatal period. While physiological studies have revealed the contribution of the CB1 cannabinoid receptor (CB1 to developmental plasticity in the primary visual cortex (V1, it remains unknown whether the expression and localization of CB1 is regulated during development or by visual experience. To explore a possible role of the endocannabinoid system in visual cortical plasticity, we examined the expression of CB1 in the visual cortex of mice. We found intense CB1 immunoreactivity in layers II/III and VI. CB1 mainly localized at vesicular GABA transporter-positive inhibitory nerve terminals. The amount of CB1 protein increased throughout development, and the specific laminar pattern of CB1 appeared at P20 and remained until adulthood. Dark rearing from birth to P30 decreased the amount of CB1 protein in V1 and altered the synaptic localization of CB1 in the deep layer. Dark rearing until P50, however, did not influence the expression of CB1. Brief monocular deprivation for 2 days upregulated the localization of CB1 at inhibitory nerve terminals in the deep layer. Taken together, the expression and the localization of CB1 are developmentally regulated, and both parameters are influenced by visual experience.

  11. Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide

    Directory of Open Access Journals (Sweden)

    Dacheng Liang

    2014-12-01

    Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.

  12. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Developmental gene regulatory networks in sea urchins and what we can learn from them [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Megan L. Martik

    2016-02-01

    Full Text Available Sea urchin embryos begin zygotic transcription shortly after the egg is fertilized.  Throughout the cleavage stages a series of transcription factors are activated and, along with signaling through a number of pathways, at least 15 different cell types are specified by the beginning of gastrulation.  Experimentally, perturbation of contributing transcription factors, signals and receptors and their molecular consequences enabled the assembly of an extensive gene regulatory network model.  That effort, pioneered and led by Eric Davidson and his laboratory, with many additional insights provided by other laboratories, provided the sea urchin community with a valuable resource.  Here we describe the approaches used to enable the assembly of an advanced gene regulatory network model describing molecular diversification during early development.  We then provide examples to show how a relatively advanced authenticated network can be used as a tool for discovery of how diverse developmental mechanisms are controlled and work.

  14. Sub-circuits of a gene regulatory network control a developmental epithelial-mesenchymal transition.

    Science.gov (United States)

    Saunders, Lindsay R; McClay, David R

    2014-04-01

    Epithelial-mesenchymal transition (EMT) is a fundamental cell state change that transforms epithelial to mesenchymal cells during embryonic development, adult tissue repair and cancer metastasis. EMT includes a complex series of intermediate cell state changes including remodeling of the basement membrane, apical constriction, epithelial de-adhesion, directed motility, loss of apical-basal polarity, and acquisition of mesenchymal adhesion and polarity. Transcriptional regulatory state changes must ultimately coordinate the timing and execution of these cell biological processes. A well-characterized gene regulatory network (GRN) in the sea urchin embryo was used to identify the transcription factors that control five distinct cell changes during EMT. Single transcription factors were perturbed and the consequences followed with in vivo time-lapse imaging or immunostaining assays. The data show that five different sub-circuits of the GRN control five distinct cell biological activities, each part of the complex EMT process. Thirteen transcription factors (TFs) expressed specifically in pre-EMT cells were required for EMT. Three TFs highest in the GRN specified and activated EMT (alx1, ets1, tbr) and the 10 TFs downstream of those (tel, erg, hex, tgif, snail, twist, foxn2/3, dri, foxb, foxo) were also required for EMT. No single TF functioned in all five sub-circuits, indicating that there is no EMT master regulator. Instead, the resulting sub-circuit topologies suggest EMT requires multiple simultaneous regulatory mechanisms: forward cascades, parallel inputs and positive-feedback lock downs. The interconnected and overlapping nature of the sub-circuits provides one explanation for the seamless orchestration by the embryo of cell state changes leading to successful EMT.

  15. Dynamical Processes in Ageing, Gene Regulation and Communication

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss

    is that unstable activation and stable repression is a requirement for the motif to produce oscillations. The last part of this thesis studies the emergence of communication networks. In this study we constructed a simple e-mail game. E-mails from two session with 16 players, who had never met before, showed how......My thesis consists of three parts. The first part covers ageing phenomena. In the first project I measured the mobility of two DNA repair proteins. Contrasting diffusion coefficients from literature I was able to classify DNA repair protein into either "scanners" or "responders". In a second...... project we constructed a mathematical model and showed that if DNA damage is primarily caused by geno-toxic agents, it would be advantageous for cells to have a fragile DNA repair mechanism. The second part of my Ph.D. thesis covers gene regulation. In the first project we show how RNA polymerase can...

  16. PRODORIC2: the bacterial gene regulation database in 2018

    Science.gov (United States)

    Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter

    2018-01-01

    Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200

  17. The impact of gene expression variation on the robustness and evolvability of a developmental gene regulatory network.

    Directory of Open Access Journals (Sweden)

    David A Garfield

    2013-10-01

    Full Text Available Regulatory interactions buffer development against genetic and environmental perturbations, but adaptation requires phenotypes to change. We investigated the relationship between robustness and evolvability within the gene regulatory network underlying development of the larval skeleton in the sea urchin Strongylocentrotus purpuratus. We find extensive variation in gene expression in this network throughout development in a natural population, some of which has a heritable genetic basis. Switch-like regulatory interactions predominate during early development, buffer expression variation, and may promote the accumulation of cryptic genetic variation affecting early stages. Regulatory interactions during later development are typically more sensitive (linear, allowing variation in expression to affect downstream target genes. Variation in skeletal morphology is associated primarily with expression variation of a few, primarily structural, genes at terminal positions within the network. These results indicate that the position and properties of gene interactions within a network can have important evolutionary consequences independent of their immediate regulatory role.

  18. Regulation, overexpression, and target gene identification of Potato Homeobox 15 (POTH15) – a class-I KNOX gene in potato

    Science.gov (United States)

    Mahajan, Ameya S.; Kondhare, Kirtikumar R.; Rajabhoj, Mohit P.; Kumar, Amit; Ghate, Tejashree; Ravindran, Nevedha; Habib, Farhat; Siddappa, Sundaresha; Banerjee, Anjan K.

    2016-01-01

    Potato Homeobox 15 (POTH15) is a KNOX-I (Knotted1-like homeobox) family gene in potato that is orthologous to Shoot Meristemless (STM) in Arabidopsis. Despite numerous reports on KNOX genes from different species, studies in potato are limited. Here, we describe photoperiodic regulation of POTH15, its overexpression phenotype, and identification of its potential targets in potato (Solanum tuberosum ssp. andigena). qRT-PCR analysis showed a higher abundance of POTH15 mRNA in shoot tips and stolons under tuber-inducing short-day conditions. POTH15 promoter activity was detected in apical and axillary meristems, stolon tips, tuber eyes, and meristems of tuber sprouts, indicating its role in meristem maintenance and leaf development. POTH15 overexpression altered multiple morphological traits including leaf and stem development, leaflet number, and number of nodes and branches. In particular, the rachis of the leaf was completely reduced and leaves appeared as a bouquet of leaflets. Comparative transcriptomic analysis of 35S::GUS and two POTH15 overexpression lines identified more than 6000 differentially expressed genes, including 2014 common genes between the two overexpression lines. Functional analysis of these genes revealed their involvement in responses to hormones, biotic/abiotic stresses, transcription regulation, and signal transduction. qRT-PCR of selected candidate target genes validated their differential expression in both overexpression lines. Out of 200 randomly chosen POTH15 targets, 173 were found to have at least one tandem TGAC core motif, characteristic of KNOX interaction, within 3.0kb in the upstream sequence of the transcription start site. Overall, this study provides insights to the role of POTH15 in controlling diverse developmental processes in potato. PMID:27217546

  19. Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

    Science.gov (United States)

    Cheniany, Monireh; Ganjeali, Ali

    2016-12-01

    Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

  20. A Knockout Screen of ApiAP2 Genes Reveals Networks of Interacting Transcriptional Regulators Controlling the Plasmodium Life Cycle.

    Science.gov (United States)

    Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver

    2017-01-11

    A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  2. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.

    Science.gov (United States)

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

    2015-01-01

    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  3. An excited state underlies gene regulation of a transcriptional riboswitch

    Science.gov (United States)

    Zhao, Bo; Guffy, Sharon L.; Williams, Benfeard; Zhang, Qi

    2017-01-01

    Riboswitches control gene expression through ligand-dependent structural rearrangements of the sensing aptamer domain. However, we found that the Bacillus cereus fluoride riboswitch aptamer adopts identical tertiary structures in solution with and without ligand. Using chemical exchange saturation transfer (CEST) NMR spectroscopy, we revealed that the structured ligand-free aptamer transiently accesses a low-populated (~1%) and short-lived (~3 ms) excited conformational state that unravels a conserved ‘linchpin’ base pair to signal transcription termination. Upon fluoride binding, this highly localized fleeting process is allosterically suppressed to activate transcription. We demonstrated that this mechanism confers effective fluoride-dependent gene activation over a wide range of transcription rates, which is essential for robust toxicity response across diverse cellular conditions. These results unveil a novel switching mechanism that employs ligand-dependent suppression of an aptamer excited state to coordinate regulatory conformational transitions rather than adopting distinct aptamer ground-state tertiary architectures, exemplifying a new mode of ligand-dependent RNA regulation. PMID:28719589

  4. Coenzyme Recognition and Gene Regulation by a Flavin Mononucleotide Riboswitch

    Energy Technology Data Exchange (ETDEWEB)

    Serganov, A.; Huang, L; Patel, D

    2009-01-01

    The biosynthesis of several protein cofactors is subject to feedback regulation by riboswitches. Flavin mononucleotide (FMN)-specific riboswitches also known as RFN elements, direct expression of bacterial genes involved in the biosynthesis and transport of riboflavin (vitamin B2) and related compounds. Here we present the crystal structures of the Fusobacterium nucleatum riboswitch bound to FMN, riboflavin and antibiotic roseoflavin. The FMN riboswitch structure, centred on an FMN-bound six-stem junction, does not fold by collinear stacking of adjacent helices, typical for folding of large RNAs. Rather, it adopts a butterfly-like scaffold, stapled together by opposingly directed but nearly identically folded peripheral domains. FMN is positioned asymmetrically within the junctional site and is specifically bound to RNA through interactions with the isoalloxazine ring chromophore and direct and Mg{sup 2+}-mediated contacts with the phosphate moiety. Our structural data, complemented by binding and footprinting experiments, imply a largely pre-folded tertiary RNA architecture and FMN recognition mediated by conformational transitions within the junctional binding pocket. The inherent plasticity of the FMN-binding pocket and the availability of large openings make the riboswitch an attractive target for structure-based design of FMN-like antimicrobial compounds. Our studies also explain the effects of spontaneous and antibiotic-induced deregulatory mutations and provided molecular insights into FMN-based control of gene expression in normal and riboflavin-overproducing bacterial strains.

  5. Stimuli-Regulated Smart Polymeric Systems for Gene Therapy

    Directory of Open Access Journals (Sweden)

    Ansuja Pulickal Mathew

    2017-04-01

    Full Text Available The physiological condition of the human body is a composite of different environments, each with its own parameters that may differ under normal, as well as diseased conditions. These environmental conditions include factors, such as pH, temperature and enzymes that are specific to a type of cell, tissue or organ or a pathological state, such as inflammation, cancer or infection. These conditions can act as specific triggers or stimuli for the efficient release of therapeutics at their destination by overcoming many physiological and biological barriers. The efficacy of conventional treatment modalities can be enhanced, side effects decreased and patient compliance improved by using stimuli-responsive material that respond to these triggers at the target site. These stimuli or triggers can be physical, chemical or biological and can be internal or external in nature. Many smart/intelligent stimuli-responsive therapeutic gene carriers have been developed that can respond to either internal stimuli, which may be normally present, overexpressed or present in decreased levels, owing to a disease, or to stimuli that are applied externally, such as magnetic fields. This review focuses on the effects of various internal stimuli, such as temperature, pH, redox potential, enzymes, osmotic activity and other biomolecules that are present in the body, on modulating gene expression by using stimuli-regulated smart polymeric carriers.

  6. Epigenetic Regulation of Inflammatory Gene Expression in Macrophages by Selenium

    Science.gov (United States)

    Narayan, Vivek; Ravindra, Kodihalli C.; Liao, Chang; Kaushal, Naveen; Carlson, Bradley A.; Prabhu, K. Sandeep

    2014-01-01

    Acetylation of histone and non-histone proteins by histone acetyltransferases plays a pivotal role in the expression of pro-inflammatory genes. Given the importance of dietary selenium in mitigating inflammation, we hypothesized that selenium supplementation may regulate inflammatory gene expression at the epigenetic level. The effect of selenium towards histone acetylation was examined in both in vitro and in vivo models of inflammation by chromatin immunoprecipitation (ChIP) assays and immunoblotting. Our results indicated that selenium supplementation, as selenite, decreased acetylation of histone H4 at K12 and K16 in COX-2 and TNF promoters, and of the p65 subunit of the redox sensitive transcription factor NFκB in primary and immortalized macrophages. On the other hand, selenomethionine had a much weaker effect. Selenite treatment of HIV-1 infected human monocytes also significantly decreased the acetylation of H4 at K12 and K16 on the HIV-1 promoter, supporting the downregulation of proviral expression by selenium. A similar decrease in histone acetylation was also seen in the colonic extracts of mice treated with dextran sodium sulfate that correlated well with the levels of selenium in the diet. Bone marrow-derived macrophages from Trspfl/flCreLysM mice that lack expression of selenoproteins in macrophages confirmed the important role of selenoproteins in the inhibition of histone H4 acetylation. Our studies suggest that the ability of selenoproteins to skew the metabolism of arachidonic acid to contribute, in part, to their ability to inhibit histone acetylation. In summary, our studies suggest a new role for selenoproteins in the epigenetic modulation of pro-inflammatory genes. PMID:25458528

  7. TiGER: a database for tissue-specific gene expression and regulation.

    Science.gov (United States)

    Liu, Xiong; Yu, Xueping; Zack, Donald J; Zhu, Heng; Qian, Jiang

    2008-06-09

    Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation). The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM) detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  8. TiGER: A database for tissue-specific gene expression and regulation

    Directory of Open Access Journals (Sweden)

    Zack Donald J

    2008-06-01

    Full Text Available Abstract Background Understanding how genes are expressed and regulated in different tissues is a fundamental and challenging question. However, most of currently available biological databases do not focus on tissue-specific gene regulation. Results The recent development of computational methods for tissue-specific combinational gene regulation, based on transcription factor binding sites, enables us to perform a large-scale analysis of tissue-specific gene regulation in human tissues. The results are stored in a web database called TiGER (Tissue-specific Gene Expression and Regulation. The database contains three types of data including tissue-specific gene expression profiles, combinatorial gene regulations, and cis-regulatory module (CRM detections. At present the database contains expression profiles for 19,526 UniGene genes, combinatorial regulations for 7,341 transcription factor pairs and 6,232 putative CRMs for 2,130 RefSeq genes. Conclusion We have developed and made publicly available a database, TiGER, which summarizes and provides large scale data sets for tissue-specific gene expression and regulation in a variety of human tissues. This resource is available at 1.

  9. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  10. Regulation of gene expression in vertebrate skeletal muscle

    Energy Technology Data Exchange (ETDEWEB)

    Carvajal, Jaime J., E-mail: jaime.carvajal@icr.ac.uk; Rigby, Peter W.J., E-mail: peter.rigby@icr.ac.uk

    2010-11-01

    During embryonic development the integration of numerous synergistic signalling pathways turns a single cell into a multicellular organism with specialized cell types and highly structured, organized tissues. To achieve this, cells must grow, proliferate, differentiate and die according to their spatiotemporal position. Unravelling the mechanisms by which a cell adopts the correct fate in response to its local environment remains one of the fundamental goals of biological research. In vertebrates skeletal myogenesis is coordinated by the activation of the myogenic regulatory factors (MRFs) in response to signals that are interpreted by their associated regulatory elements in different precursor cells during development. The MRFs trigger a cascade of transcription factors and downstream structural genes, ultimately resulting in the generation of one of the fundamental histotypes. In this review we discuss the regulation of the different MRFs in relation to their position in the myogenic cascade, the changes in the general transcriptional machinery during muscle differentiation and the emerging importance of miRNA regulation in skeletal myogenesis.

  11. A novel ecdysone receptor mediates steroid-regulated developmental events during the mid-third instar of Drosophila.

    Directory of Open Access Journals (Sweden)

    Benjamin F B Costantino

    2008-06-01

    Full Text Available The larval salivary gland of Drosophila melanogaster synthesizes and secretes glue glycoproteins that cement developing animals to a solid surface during metamorphosis. The steroid hormone 20-hydroxyecdysone (20E is an essential signaling molecule that modulates most of the physiological functions of the larval gland. At the end of larval development, it is known that 20E--signaling through a nuclear receptor heterodimer consisting of EcR and USP--induces the early and late puffing cascade of the polytene chromosomes and causes the exocytosis of stored glue granules into the lumen of the gland. It has also been reported that an earlier pulse of hormone induces the temporally and spatially specific transcriptional activation of the glue genes; however, the receptor responsible for triggering this response has not been characterized. Here we show that the coordinated expression of the glue genes midway through the third instar is mediated by 20E acting to induce genes of the Broad Complex (BRC through a receptor that is not an EcR/USP heterodimer. This result is novel because it demonstrates for the first time that at least some 20E-mediated, mid-larval, developmental responses are controlled by an uncharacterized receptor that does not contain an RXR-like component.

  12. Gene networks underlying convergent and pleiotropic phenotypes in a large and systematically-phenotyped cohort with heterogeneous developmental disorders.

    Science.gov (United States)

    Andrews, Tallulah; Meader, Stephen; Vulto-van Silfhout, Anneke; Taylor, Avigail; Steinberg, Julia; Hehir-Kwa, Jayne; Pfundt, Rolph; de Leeuw, Nicole; de Vries, Bert B A; Webber, Caleb

    2015-03-01

    Readily-accessible and standardised capture of genotypic variation has revolutionised our understanding of the genetic contribution to disease. Unfortunately, the corresponding systematic capture of patient phenotypic variation needed to fully interpret the impact of genetic variation has lagged far behind. Exploiting deep and systematic phenotyping of a cohort of 197 patients presenting with heterogeneous developmental disorders and whose genomes harbour de novo CNVs, we systematically applied a range of commonly-used functional genomics approaches to identify the underlying molecular perturbations and their phenotypic impact. Grouping patients into 408 non-exclusive patient-phenotype groups, we identified a functional association amongst the genes disrupted in 209 (51%) groups. We find evidence for a significant number of molecular interactions amongst the association-contributing genes, including a single highly-interconnected network disrupted in 20% of patients with intellectual disability, and show using microcephaly how these molecular networks can be used as baits to identify additional members whose genes are variant in other patients with the same phenotype. Exploiting the systematic phenotyping of this cohort, we observe phenotypic concordance amongst patients whose variant genes contribute to the same functional association but note that (i) this relationship shows significant variation across the different approaches used to infer a commonly perturbed molecular pathway, and (ii) that the phenotypic similarities detected amongst patients who share the same inferred pathway perturbation result from these patients sharing many distinct phenotypes, rather than sharing a more specific phenotype, inferring that these pathways are best characterized by their pleiotropic effects.

  13. Gene expression analysis of zebrafish melanocytes, iridophores, and retinal pigmented epithelium reveals indicators of biological function and developmental origin.

    Directory of Open Access Journals (Sweden)

    Charles W Higdon

    Full Text Available In order to facilitate understanding of pigment cell biology, we developed a method to concomitantly purify melanocytes, iridophores, and retinal pigmented epithelium from zebrafish, and analyzed their transcriptomes. Comparing expression data from these cell types and whole embryos allowed us to reveal gene expression co-enrichment in melanocytes and retinal pigmented epithelium, as well as in melanocytes and iridophores. We found 214 genes co-enriched in melanocytes and retinal pigmented epithelium, indicating the shared functions of melanin-producing cells. We found 62 genes significantly co-enriched in melanocytes and iridophores, illustrative of their shared developmental origins from the neural crest. This is also the first analysis of the iridophore transcriptome. Gene expression analysis for iridophores revealed extensive enrichment of specific enzymes to coordinate production of their guanine-based reflective pigment. We speculate the coordinated upregulation of specific enzymes from several metabolic pathways recycles the rate-limiting substrate for purine synthesis, phosphoribosyl pyrophosphate, thus constituting a guanine cycle. The purification procedure and expression analysis described here, along with the accompanying transcriptome-wide expression data, provide the first mRNA sequencing data for multiple purified zebrafish pigment cell types, and will be a useful resource for further studies of pigment cell biology.

  14. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  15. Orthogonal Cas9 proteins for RNA-guided gene regulation and editing

    Science.gov (United States)

    Church, George M.; Esvelt, Kevin; Mali, Prashant

    2017-03-07

    Methods of modulating expression of a target nucleic acid in a cell are provided including use of multiple orthogonal Cas9 proteins to simultaneously and independently regulate corresponding genes or simultaneously and independently edit corresponding genes.

  16. Developmental wiring of specific neurons is regulated by RET-1/Nogo-A in Caenorhabditis elegans

    DEFF Research Database (Denmark)

    Torpe, Nanna; Nørgaard, Steffen; Høye, Anette M.

    2017-01-01

    Nogo-A is a membrane-bound protein that functions to inhibit neuronal migration, adhesion, and neurite outgrowth during development. In the mature nervous system, Nogo-A stabilizes neuronal wiring to inhibit neuronal plasticity and regeneration after injury. Here, we show that RET-1, the sole Nog...... present a previously unidentified function for RET-1 in the nervous system of C. elegans.......-A homolog in Caenorhabditis elegans, is required to control developmental wiring of a specific subset of neurons. In ret-1 deletion mutant animals, specific ventral nerve cord axons are misguided where they fail to respect the ventral midline boundary. We found that ret-1 is expressed in multiple neurons...

  17. Effect of ovary induction on bread wheat anther culture: ovary genotype and developmental stage, and candidate gene association.

    Directory of Open Access Journals (Sweden)

    Ana María Castillo

    2015-06-01

    Full Text Available Ovary pre-conditioned medium and ovary co-culture increased the efficiency of green doubled haploid plant production in bread wheat anther culture. The positive effect of this medium led to a 6- and 11-fold increase in the numbers of embryos and green plants, respectively, having a greater effect on a medium-low responding cultivar. Ovary genotype and developmental stage significantly affected microspore embryogenesis. By he use of Caramba ovaries it was possible to reach a 2-fold increase in the number of embryos and green plants, and to decrease the rate of albinism. Mature ovaries from flowers containing microspores at a late binucleate stage raised the number of embryos and green plants by 25% and 46% as compared to immature ovaries (excised from flowers with microspores at a mid-late uninucleate stage. The highest numbers of embryos and green plants were produced when using mature Caramba ovaries. Ovaries from Galeón, Tigre and Kilopondio cultivars successfully induced microspore embryogenesis at the same rate as Caramba ovaries. Moreover, Tigre ovaries raised the percentage of spontaneous chromosome doubling up to 71%. Attempts were made to identify molecular mechanisms associated to the inductive effect of the ovaries on microspore embryogenesis. The genes TAA1b, FLA26 and WALI6 associated to wheat microspore embryogenesis, the CGL1 gene involved in glycan biosynthesis or degradation, and the FER gene involved in the ovary signalling process were expressed and/or induced at different rates during ovary culture. The expression pattern of FLA26 and FER could be related to the differences between genotypes and developmental stages in the inductive effect of the ovary. Our results open opportunities for new approaches to increase bread wheat doubled haploid production by anther culture, and to identify the functional components of the ovary inductive effect on microspore embryogenesis.

  18. Signaling pathways in PACAP regulation of VIP gene expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Falktoft, B.; Georg, B.; Fahrenkrug, J.

    2009-01-01

    Ganglia expressing the neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) innervate vasoactive intestinal peptide (VIP) containing neurons suggesting a role of PACAP in regulating VIP expression. Human NB-1 neuroblastoma cells were applied to study PACAP regulated VIP gene...... in PACAP regulation of the FOS and VIP gene expressions suggest for the first time a role of FOS in PACAP-induced VIP gene expression in human NB-1 neuroblastoma cells. (C) 2009 Elsevier Ltd. All rights reserved Udgivelsesdato: 2009/10...

  19. A study of the role of the FOXP2 and CNTNAP2 genes in persistent developmental stuttering.

    Science.gov (United States)

    Han, Tae-Un; Park, John; Domingues, Carlos F; Moretti-Ferreira, Danilo; Paris, Emily; Sainz, Eduardo; Gutierrez, Joanne; Drayna, Dennis

    2014-09-01

    A number of speech disorders including stuttering have been shown to have important genetic contributions, as indicated by high heritability estimates from twin and other studies. We studied the potential contribution to stuttering from variants in the FOXP2 gene, which have previously been associated with developmental verbal dyspraxia, and from variants in the CNTNAP2 gene, which have been associated with specific language impairment (SLI). DNA sequence analysis of these two genes in a group of 602 unrelated cases, all with familial persistent developmental stuttering, revealed no excess of potentially deleterious coding sequence variants in the cases compared to a matched group of 487 well characterized neurologically normal controls. This was compared to the distribution of variants in the GNPTAB, GNPTG, and NAGPA genes which have previously been associated with persistent stuttering. Using an expanded subject data set, we again found that NAGPA showed significantly different mutation frequencies in North Americans of European descent (p=0.0091) and a significant difference existed in the mutation frequency of GNPTAB in Brazilians (p=0.00050). No significant differences in mutation frequency in the FOXP2 and CNTNAP2 genes were observed between cases and controls. To examine the pattern of expression of these five genes in the human brain, real time quantitative reverse transcription PCR was performed on RNA purified from 27 different human brain regions. The expression patterns of FOXP2 and CNTNAP2 were generally different from those of GNPTAB, GNPTG and NAPGA in terms of relatively lower expression in the cerebellum. This study provides an improved estimate of the contribution of mutations in GNPTAB, GNPTG and NAGPA to persistent stuttering, and suggests that variants in FOXP2 and CNTNAP2 are not involved in the genesis of familial persistent stuttering. This, together with the different brain expression patterns of GNPTAB, GNPTG, and NAGPA compared to that of

  20. Developmental programming of energy balance regulation: Is physical activity more "programmable" than food intake

    Science.gov (United States)

    Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mecha...

  1. Self-regulation underlies temperament and personality : An integrative developmental framework

    NARCIS (Netherlands)

    Denissen, J.J.A.; van Aken, M.A.G.; Penke, L.; Wood, D.

    2013-01-01

    In this article, we present an integrative perspective on temperament and personality development. Personality and temperament are conceptualized as regulatory systems that start as physiological reactivity to environmental features early in life, but are increasingly supplemented by regulation

  2. Gene regulation and genetics in neurochemistry, past to future.

    Science.gov (United States)

    Barger, Steven W

    2016-10-01

    Ask any neuroscientist to name the most profound discoveries in the field in the past 60 years, and at or near the top of the list will be a phenomenon or technique related to genes and their expression. Indeed, our understanding of genetics and gene regulation has ushered in whole new systems of knowledge and new empirical approaches, many of which could not have even been imagined prior to the molecular biology boon of recent decades. Neurochemistry, in the classic sense, intersects with these concepts in the manifestation of neuropeptides, obviously dependent upon the central dogma (the established rules by which DNA sequence is eventually converted into protein primary structure) not only for their conformation but also for their levels and locales of expression. But, expanding these considerations to non-peptide neurotransmitters illustrates how gene regulatory events impact neurochemistry in a much broader sense, extending beyond the neurochemicals that translate electrical signals into chemical ones in the synapse, to also include every aspect of neural development, structure, function, and pathology. From the beginning, the mutability - yet relative stability - of genes and their expression patterns were recognized as potential substrates for some of the most intriguing phenomena in neurobiology - those instances of plasticity required for learning and memory. Near-heretical speculation was offered in the idea that perhaps the very sequence of the genome was altered to encode memories. A fascinating component of the intervening progress includes evidence that the central dogma is not nearly as rigid and consistent as we once thought. And this mutability extends to the potential to manipulate that code for both experimental and clinical purposes. Astonishing progress has been made in the molecular biology of neurochemistry during the 60 years since this journal debuted. Many of the gains in conceptual understanding have been driven by methodological

  3. Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.

    Science.gov (United States)

    Huang, Huiyan; Zhu, Yong; Eliot, Melissa N; Knopik, Valerie S; McGeary, John E; Carskadon, Mary A; Hart, Anne C

    2017-06-01

    We aimed to test a combined approach to identify conserved genes regulating sleep and to explore the association between DNA methylation and sleep length. We identified candidate genes associated with shorter versus longer sleep duration in college students based on DNA methylation using Illumina Infinium HumanMethylation450 BeadChip arrays. Orthologous genes in Caenorhabditis elegans were identified, and we examined whether their loss of function affected C. elegans sleep. For genes whose perturbation affected C. elegans sleep, we subsequently undertook a small pilot study to re-examine DNA methylation in an independent set of human participants with shorter versus longer sleep durations. Eighty-seven out of 485,577 CpG sites had significant differential methylation in young adults with shorter versus longer sleep duration, corresponding to 52 candidate genes. We identified 34 C. elegans orthologs, including NPY/flp-18 and flp-21, which are known to affect sleep. Loss of five additional genes alters developmentally timed C. elegans sleep (B4GALT6/bre-4, DOCK180/ced-5, GNB2L1/rack-1, PTPRN2/ida-1, ZFYVE28/lst-2). For one of these genes, ZFYVE28 (also known as hLst2), the pilot replication study again found decreased DNA methylation associated with shorter sleep duration at the same two CpG sites in the first intron of ZFYVE28. Using an approach that combines human epigenetics and C. elegans sleep studies, we identified five genes that play previously unidentified roles in C. elegans sleep. We suggest sleep duration in humans may be associated with differential DNA methylation at specific sites and that the conserved genes identified here likely play roles in C. elegans sleep and in other species. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  4. Additional file 10: Figure S3. of Uncovering co-expression gene network modules regulating fruit acidity in diverse apples

    OpenAIRE

    Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Zhong, Gan-Yuan; Xu, Kenong

    2015-01-01

    Other regulators from modules Turquoise and Brown and their assigned tight clusters. Elements and their contents, formats and messages are same as those noted in Fig. 8a. (A) Regulator M239684 and Cluster 41 of 68 genes. (B) Regulator M239684 and Cluster 5 of 14 genes. (C) Regulator M239684 and Cluster 7 of 14 genes. (D) Regulator M753318 and Cluster 23 of 11 genes. (E) Regulator M753318 and Cluster 32 of 11 genes. (F) Regulator M175481 and Cluster 2 of 16 genes. (G) Regulator M134341 and Cl...

  5. Sex Differences in Drosophila Somatic Gene Expression: Variation and Regulation by doublesex

    Directory of Open Access Journals (Sweden)

    Michelle N. Arbeitman

    2016-07-01

    Full Text Available Sex differences in gene expression have been widely studied in Drosophila melanogaster. Sex differences vary across strains, but many molecular studies focus on only a single strain, or on genes that show sexually dimorphic expression in many strains. How extensive variability is and whether this variability occurs among genes regulated by sex determination hierarchy terminal transcription factors is unknown. To address these questions, we examine differences in sexually dimorphic gene expression between two strains in Drosophila adult head tissues. We also examine gene expression in doublesex (dsx mutant strains to determine which sex-differentially expressed genes are regulated by DSX, and the mode by which DSX regulates expression. We find substantial variation in sex-differential expression. The sets of genes with sexually dimorphic expression in each strain show little overlap. The prevalence of different DSX regulatory modes also varies between the two strains. Neither the patterns of DSX DNA occupancy, nor mode of DSX regulation explain why some genes show consistent sex-differential expression across strains. We find that the genes identified as regulated by DSX in this study are enriched with known sites of DSX DNA occupancy. Finally, we find that sex-differentially expressed genes and genes regulated by DSX are highly enriched on the fourth chromosome. These results provide insights into a more complete pool of potential DSX targets, as well as revealing the molecular flexibility of DSX regulation.

  6. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. The Tlx gene regulates the timing of neurogenesis in the cortex.

    Science.gov (United States)

    Roy, Kristine; Kuznicki, Kathleen; Wu, Qiang; Sun, Zhuoxin; Bock, Dagmar; Schutz, Gunther; Vranich, Nancy; Monaghan, A Paula

    2004-09-22

    The tailless (tlx) gene is a forebrain-restricted transcription factor. Tlx mutant animals exhibit a reduction in the size of the cerebral hemispheres and associated structures (Monaghan et al., 1997). Superficial cortical layers are specifically reduced, whereas deep layers are relatively unaltered (Land and Monaghan, 2003). To determine whether the adult laminar phenotype has a developmental etiology and whether it is associated with a change in proliferation/differentiation decisions, we examined the cell cycle and neurogenesis in the embryonic cortex. We found that there is a temporal and regional requirement for the Tlx protein in progenitor cells (PCs). Neurons prematurely differentiate at all rostrocaudal levels up to mid-neurogenesis in mutant animals. Heterozygote animals have an intermediate phenotype indicating there is a threshold requirement for Tlx in early cortical neurogenesis. Our studies indicate that PCs in the ventricular zone are sensitive to loss of Tlx in caudal regions only; however, PCs in the subventricular zone are altered at all rostrocaudal levels in tlx-deficient animals. Furthermore, we found that the cell cycle is shorter from embryonic day 9.5 in tlx-/- embryos. At mid-neurogenesis, the PC population becomes depleted, and late PCs have a longer cell cycle in tlx-deficient animals. Consequently, later generated structures, such as upper cortical layers, the dentate gyrus, and the olfactory bulbs, are severely reduced. These studies indicate that tlx is an essential intrinsic regulator in the decision to proliferate or differentiate in the developing forebrain.

  8. Coordinate gene regulation by fimbriae-induced signal transduction

    DEFF Research Database (Denmark)

    Schembri, Mark; Klemm, Per

    2001-01-01

    whether fimbriae expression can affect expression of other genes, Analysis of gene expression in two E.coli strains, differing in the fim locus, indicated the flu gene to be affected. The flu gene encodes the antigen 43 (Ag43) surface protein, specifically involved in bacterial aggregation...

  9. Identification, developmental expression and regulation of the Xenopus ortholog of human FANCG/XRCC9.

    Science.gov (United States)

    Stone, Stacie; Sobeck, Alexandra; van Kogelenberg, Margriet; de Graaf, Bendert; Joenje, Hans; Christian, Jan; Hoatlin, Maureen E

    2007-07-01

    Fanconi anemia (FA) is associated with variable developmental abnormalities, bone marrow failure and cancer susceptibility. FANCG/XRCC9 is member of the FA core complex, a group of proteins that control the monoubiquitylation of FANCD2, an event that plays a critical role in maintaining genomic stability. Here we report the identification of the Xenopus laevis ortholog of human FANCG (xFANCG), its expression during development, and its molecular interactions with a partner protein, xFANCA. The xFANCG protein sequence is 47% similar to its human ortholog, with highest conservation in the two putative N-terminal leucine zippers and the tetratricopeptide repeat (TPR) motifs. xFANCG is maternally and zygotically transcribed. Prior to the midblastula stage, a single xFANCG transcript is observed but two additional alternatively spliced mRNAs are detected after the midblastula transition. One of the variants is predicted to encode a novel isoform of xFANCG lacking exon 2. The mutual association between FANCG and FANCA required for their nuclear import is conserved in Xenopus egg extracts. Our data demonstrate that interactions between FANCA and FANCG occur at the earliest stage of vertebrate development and raise the possibility that functionally different isoforms of xFANCG may play a role in early development.

  10. Developmental and Functional Expression of miRNA-Stability Related Genes in the Nervous System

    OpenAIRE

    de Sousa, ?rica; Walter, Lais Takata; Higa, Guilherme Shigueto Vilar; Casado, Ot?vio Augusto Nocera; Kihara, Alexandre Hiroaki

    2013-01-01

    In the nervous system, control of gene expression by microRNAs (miRNAs) has been investigated in fundamental processes, such as development and adaptation to ambient demands. The action of these short nucleotide sequences on specific genes depends on intracellular concentration, which in turn reflects the balance of biosynthesis and degradation. Whereas mechanisms underlying miRNA biogenesis has been investigated in recent studies, little is known about miRNA-stability related proteins. We fi...

  11. Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

    Science.gov (United States)

    Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N

    2013-10-01

    Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

  12. Developmental Trends in Self-Regulation among Low-Income Toddlers

    Science.gov (United States)

    Raikes, H. Abigail; Robinson, JoAnn L.; Bradley, Robert H.; Raikes, Helen H.; Ayoub, Catherine C.

    2007-01-01

    The attainment of self-regulatory skills during the toddler years is an understudied issue, especially among low-income children. The present study used growth modeling to examine the change over time and the final status in children's abilities to self-regulate, in a sample of 2,441 low-income children aged 14 to 36 months. Positive growth in…

  13. Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

    Science.gov (United States)

    Eickelberg, Garrett J; Fisher, Alison J

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

  14. MicroRNAs in Amoebozoa: deep sequencing of the small RNA population in the social amoeba Dictyostelium discoideum reveals developmentally regulated microRNAs.

    Science.gov (United States)

    Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik

    2012-10-01

    The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced.