WorldWideScience

Sample records for dependent open-circuit voltage

  1. A high open-circuit voltage gallium nitride betavoltaic microbattery

    International Nuclear Information System (INIS)

    Cheng, Zaijun; Chen, Xuyuan; San, Haisheng; Feng, Zhihong; Liu, Bo

    2012-01-01

    A high open-circuit voltage betavoltaic microbattery based on a gallium nitride (GaN) p–i–n homojunction is demonstrated. As a beta-absorbing layer, the low electron concentration of the n-type GaN layer is achieved by the process of Fe compensation doping. Under the irradiation of a planar solid 63 Ni source with activity of 0.5 mCi, the open-circuit voltage of the fabricated microbattery with 2 × 2 mm 2 area reaches as much as 1.64 V, which is the record value reported for betavoltaic batteries with 63 Ni source, the short-circuit current was measured as 568 pA and the conversion effective of 0.98% was obtained. The experimental results suggest that GaN is a high-potential candidate for developing the betavoltaic microbattery. (paper)

  2. Symmetry-Breaking Charge Transfer in a Zinc Chlorodipyrrin Acceptor for High Open Circuit Voltage Organic Photovoltaics

    KAUST Repository

    Bartynski, Andrew N.; Gruber, Mark; Das, Saptaparna; Rangan, Sylvie; Mollinger, Sonya; Trinh, Cong; Bradforth, Stephen E.; Vandewal, Koen; Salleo, Alberto; Bartynski, Robert A.; Bruetting, Wolfgang; Thompson, Mark E.

    2015-01-01

    © 2015 American Chemical Society. Low open-circuit voltages significantly limit the power conversion efficiency of organic photovoltaic devices. Typical strategies to enhance the open-circuit voltage involve tuning the HOMO and LUMO positions

  3. Single-nanowire, low-bandgap hot carrier solar cells with tunable open-circuit voltage

    Science.gov (United States)

    Limpert, Steven; Burke, Adam; Chen, I.-Ju; Anttu, Nicklas; Lehmann, Sebastian; Fahlvik, Sofia; Bremner, Stephen; Conibeer, Gavin; Thelander, Claes; Pistol, Mats-Erik; Linke, Heiner

    2017-10-01

    Compared to traditional pn-junction photovoltaics, hot carrier solar cells offer potentially higher efficiency by extracting work from the kinetic energy of photogenerated ‘hot carriers’ before they cool to the lattice temperature. Hot carrier solar cells have been demonstrated in high-bandgap ferroelectric insulators and GaAs/AlGaAs heterostructures, but so far not in low-bandgap materials, where the potential efficiency gain is highest. Recently, a high open-circuit voltage was demonstrated in an illuminated wurtzite InAs nanowire with a low bandgap of 0.39 eV, and was interpreted in terms of a photothermoelectric effect. Here, we point out that this device is a hot carrier solar cell and discuss its performance in those terms. In the demonstrated devices, InP heterostructures are used as energy filters in order to thermoelectrically harvest the energy of hot electrons photogenerated in InAs absorber segments. The obtained photovoltage depends on the heterostructure design of the energy filter and is therefore tunable. By using a high-resistance, thermionic barrier, an open-circuit voltage is obtained that is in excess of the Shockley-Queisser limit. These results provide generalizable insight into how to realize high voltage hot carrier solar cells in low-bandgap materials, and therefore are a step towards the demonstration of higher efficiency hot carrier solar cells.

  4. Electrothermal Feedback and Absorption-Induced Open-Circuit-Voltage Turnover in Solar Cells

    Science.gov (United States)

    Ullbrich, Sascha; Fischer, Axel; Tang, Zheng; Ávila, Jorge; Bolink, Henk J.; Reineke, Sebastian; Vandewal, Koen

    2018-05-01

    Solar panels easily heat up upon intense solar radiation due to excess energy dissipation of the absorbed photons or by nonradiative recombination of charge carriers. Still, photoinduced self-heating is often ignored when characterizing lab-sized samples. For light-intensity-dependent measurements of the open-circuit voltage (Suns-VO C ), allowing us to characterize the recombination mechanism, sample heating is often not considered, although almost 100% of the absorbed energy is converted into heat. Here, we show that the frequently observed stagnation or even decrease in VOC at increasingly high light intensities can be explained by considering an effective electrothermal feedback between the recombination current and the open-circuit voltage. Our analytical model fully explains the experimental data for various solar-cell technologies, comprising conventional inorganic semiconductors as well as organic and perovskite materials. Furthermore, the model can be exploited to determine the ideality factor, the effective gap, and the temperature rise from a single Suns-VOC measurement at ambient conditions.

  5. Polymer solar cells with enhanced open-circuit voltage and efficiency

    Science.gov (United States)

    Chen, Hsiang-Yu; Hou, Jianhui; Zhang, Shaoqing; Liang, Yongye; Yang, Guanwen; Yang, Yang; Yu, Luping; Wu, Yue; Li, Gang

    2009-11-01

    Following the development of the bulk heterojunction structure, recent years have seen a dramatic improvement in the efficiency of polymer solar cells. Maximizing the open-circuit voltage in a low-bandgap polymer is one of the critical factors towards enabling high-efficiency solar cells. Study of the relation between open-circuit voltage and the energy levels of the donor/acceptor in bulk heterojunction polymer solar cells has stimulated interest in modifying the open-circuit voltage by tuning the energy levels of polymers. Here, we show that the open-circuit voltage of polymer solar cells constructed based on the structure of a low-bandgap polymer, PBDTTT, can be tuned, step by step, using different functional groups, to achieve values as high as 0.76 V. This increased open-circuit voltage combined with a high short-circuit current density results in a polymer solar cell with a power conversion efficiency as high as 6.77%, as certified by the National Renewable Energy Laboratory.

  6. Dependence of open-circuit voltage of SnO2-nSi solar cells; SnO2-nSi taiyo denchi no sanka ondo menhoi izonsei

    Energy Technology Data Exchange (ETDEWEB)

    Shinoda, S; Shimizu, A; Yano, K; Kasuga, M [Yamanashi University, Yamanashi (Japan). Faculty of Engineering

    1997-11-25

    Although metal(or semiconductor)-semiconductor solar cells, SnO2-nSi solar cell for example, are superior in cost and efficiency, its barrier height and open-circuit voltage V(oc) are lower than those of p-n junctions. To improve these defects, study was made on the dependence of V(oc) on oxidation temperature and surface orientation using various solar cells prepared from (100)Si and (111)Si under various oxidation conditions. As a result, the density of surface states increases with a decrease in oxidation temperature of Si substrates, resulting in an increase in diode factor and V(oc). In this case, since oxide films are extremely thin and contribution of non-terminated bonds is large in the initial oxidation stage, the quantity of dangling bonds is larger in (100) plane than (111) plane, resulting in an increase in diode factor and V(oc). Since the surface energy level (the degree of electrons dominated by acceptor-like surface state from this level to the top of a valence band) of (100) Si is lower than that of (111) Si, the effective barrier height and V(oc) increase. 28 refs., 6 figs., 2 tabs.

  7. Open circuit voltage-decay behavior in amorphous p-i-n solar due to injection

    Science.gov (United States)

    Smrity, Manu; Dhariwal, S. R.

    2018-05-01

    The paper deals with the basic recombination processes at the dangling bond and the band tail states at various levels of injection, expressed in terms of short-circuit current density and their role in the behavior of amorphous solar cells. As the level of injection increases the fill factor decreases whereas the open circuit voltage increases very slowly, showing a saturation tendency. Calculations have been done for two values of tail state densities and shows that with an increase in tail state densities both, the fill factor and open circuit voltage decreases, results an overall degradation of the solar cell.

  8. Stacking Orientation Mediation of Pentacene and Derivatives for High Open-Circuit Voltage Organic Solar Cells.

    Science.gov (United States)

    Chou, Chi-Ta; Lin, Chien-Hung; Tai, Yian; Liu, Chin-Hsin J; Chen, Li-Chyong; Chen, Kuei-Hsien

    2012-05-03

    In this Letter, we investigated the effect of the molecular stacking orientation on the open circuit voltage (VOC) of pentacene-based organic solar cells. Two functionalized pentacenes, namely, 6,13-diphenyl-pentacene (DP-penta) and 6,13-dibiphenyl-4-yl-pentacene (DB-penta), were utilized. Different molecular stacking orientations of the pentacene derivatives from the pristine pentacene were identified by angle-dependent near-edge X-ray absorption fine structure measurements. It is concluded that pentacene molecules stand up on the substrate surface, while both functionalized pentacenes lie down. A significant increase of the VOC from 0.28 to 0.83 V can be achieved upon the utilization of functionalized pentacene, owing to the modulation of molecular stacking orientation, which induced a vacuum-level shift.

  9. Elucidating the interplay between dark current coupling and open circuit voltage in organic photovoltaics

    KAUST Repository

    Erwin, Patrick; Thompson, Mark E.

    2011-01-01

    made with the structure indium tin oxide/copper phthalocyanine (200 Å)/PDI (200 Å)/bathocuproine (100 Å)/aluminum (1000 Å). We found that PDIs with larger substituents produced higher open circuit voltages (VOC's) despite the donor acceptor interface

  10. Battery open-circuit voltage estimation by a method of statistical analysis

    NARCIS (Netherlands)

    Snihir, Iryna; Rey, William; Verbitskiy, Evgeny; Belfadhel-Ayeb, Afifa; Notten, Peter H.L.

    2006-01-01

    The basic task of a battery management system (BMS) is the optimal utilization of the stored energy and minimization of degradation effects. It is critical for a BMS that the state-of-charge (SoC) be accurately determined. Open-circuit voltage (OCV) is directly related to the state-of-charge of the

  11. The open-circuit voltage in microcrystalline silicon solar cells of different degrees of crystallinity

    International Nuclear Information System (INIS)

    Nath, Madhumita; Roca i Cabarrocas, P.; Johnson, E.V.; Abramov, A.; Chatterjee, P.

    2008-01-01

    We have used a detailed electrical-optical computer model (ASDMP) in conjunction with the experimental characterization of microcrystalline silicon thin-film solar cells of different degrees of crystallinity (but having identical P- and N-layers) to understand the observed decrease of the open-circuit voltage with increasing crystalline fraction. In order to model all aspects of the experimental current density-voltage and quantum efficiency characteristics of cells having low (∼ 75%) and high (over 90%) crystalline fraction, we had to assume both a higher mobility gap defect density and a lower band gap for the more crystallized material. The former fact is widely known to bring down the open-circuit voltage. Our calculations also reveal that the proximity of the quasi-Fermi levels to the energy bands in the cell based on highly crystallized (and assumed to have a lower band gap) microcrystalline silicon results in higher free and trapped carrier densities in this device. The trapped hole population is particularly high at and close to the P/I interface on account of the higher inherent defect density in this region and the fact that the hole quasi-Fermi level is close to the valence band edge here. This fact results in a strong interface field, a collapse of the field in the volume, and hence a lower open-circuit voltage. Thus a combination of higher mobility gap defects and a lower band gap is probably the reason for the lower open-circuit voltage in cells based on highly crystallized microcrystalline silicon

  12. Demonstration of a High Open-Circuit Voltage GaN Betavoltaic Microbattery

    International Nuclear Information System (INIS)

    Cheng Zai-Jun; San Hai-Sheng; Chen Xu-Yuan; Liu Bo; Feng Zhi-Hong

    2011-01-01

    A high open-circuit voltage betavoltaic microbattery based on a GaN p-i-n diode is demonstrated. Under the irradiation of a 4×4 mm 2 planar solid 63 Ni source with an activity of 2 mCi, the open-circuit voltage V oc of the fabricated single 2×2mm 2 cell reaches as high as 1.62 V, the short-circuit current density J sc is measured to be 16nA/cm 2 . The microbattery has a fill factor of 55%, and the energy conversion efficiency of beta radiation into electricity reaches to 1.13%. The results suggest that GaN is a highly promising potential candidate for long-life betavoltaic microbatteries used as power supplies for microelectromechanical system devices. (cross-disciplinary physics and related areas of science and technology)

  13. Driving CZTS to the SQ Limit: Solving the Open Circuit Voltage Problem

    Energy Technology Data Exchange (ETDEWEB)

    Haight, Richard A. [IBM Research, Yorktown, NY (United States). Thomas J. Watson Research Center; McCandless, Brian E. [Univ. of Delaware, Newark, DE (United States); Kummel, Andrew C. [Univ. of California, San Diego, CA (United States); Gordon, Roy G. [Harvard Univ., Cambridge, MA (United States)

    2016-12-15

    A key objective of this 3 year research effort was to reduce the open circuit voltage (Voc) deficit, defined as the difference between the absorber band gap and the measured Voc to below 475mV from values at the beginning of this work of 630-730mV. To achieve this reduction, along with the attendant goals of higher Voc and efficiency, detailed studies into the fundamental understanding of existing limitations were undertaken.

  14. The effect of a defective BSF layer on solar cell open circuit voltage. [Back Surface Field

    Science.gov (United States)

    Weizer, V. G.

    1985-01-01

    A straightforward analysis of special limiting cases has permitted the determination of the range of possible open circuit voltage losses due to a defective BSF (back surface field) layer. An important result of the analysis is the finding that it is possible to have a fully effective BSF region, regardless of the spatial distribution of the defective areas, as long as the total defective area is reduced below certain limits. Distributed defects were found to be much more harmful than lumped defects.

  15. Molecular understanding of the open-circuit voltage of polymer: Fullerene solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Shunsuke; Orimo, Akiko; Benten, Hiroaki; Ito, Shinzaburo [Department of Polymer Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Nishikyo, Kyoto (Japan); Ohkita, Hideo [Japan Science and Technology Agency (JST), PRESTO, Saitama (Japan); Department of Polymer Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Nishikyo, Kyoto (Japan)

    2012-02-15

    The origin of open-circuit voltage (V{sub OC}) was studied for polymer solar cells based on a blend of poly(3-hexylthiophene) (P3HT) and seven fullerene derivatives with different LUMO energy levels and side chains. The temperature dependence of J-V characteristics was analyzed by an equivalent circuit model. As a result, V{sub OC} increased with the decrease in the saturation current density J{sub 0} of the device. Furthermore, J{sub 0} was dependent on the activation energy E{sub A} for J{sub 0}, which is related to the HOMO-LUMO energy gap between P3HT and fullerene. Interestingly, the pre-exponential term J{sub 00} for J{sub 0} was larger for pristine fullerenes than for substituted fullerene derivatives, suggesting that the electronic coupling between molecules also has substantial impact on V{sub OC}. This is probably because the recombination is non-diffusion-limited reaction depending on electron transfer at the P3HT/fullerene interface. In summary, the origin of V{sub OC} is ascribed not only to the relative HOMO-LUMO energy gap but also to the electronic couplings between fullerene/fullerene and polymer/fullerene. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  16. Thermocleavable Materials for Polymer Solar Cells with High Open Circuit Voltage-A Comparative Study

    DEFF Research Database (Denmark)

    Tromholt, Thomas; Gevorgyan, Suren; Jørgensen, Mikkel

    2009-01-01

    The search for polymer solar cells giving a high open circuit voltage was conducted through a comparative study of four types of bulk-heterojunction solar cells employing different photoactive layers. As electron donors the thermo-cleavable polymer poly-(3-(2-methylhexyloxycarbonyl)dithiophene) (P3......MHOCT) and unsubstituted polythiophene (PT) were used, the latter of which results from thermo cleaving the former at 310 °C. As reference, P3HT solar cells were built in parallel. As electron acceptors, either PCBM or bis-[60]PCBM were used. In excess of 300 solar cells were produced under as identical...... conditions as possible, varying only the material combination of the photo active layer. It was observed that on replacing PCBM with bis[60]PCBM, the open circuit voltage on average increased by 100 mV for P3MHOCT and 200 mV for PT solar cells. Open circuit voltages approaching 1 V were observed for the PT:bis...

  17. Reduced voltage losses yield 10% efficient fullerene free organic solar cells with >1 V open circuit voltages

    KAUST Repository

    Baran, D.; Kirchartz, T.; Wheeler, S.; Dimitrov, S.; Abdelsamie, Maged; Gorman, J.; Ashraf, Raja; Holliday, S.; Wadsworth, A.; Gasparini, N.; Kaienburg, P.; Yan, H.; Amassian, Aram; Brabec, C. J.; Durrant, J. R.; McCulloch, Iain

    2016-01-01

    of high recombination losses, which empirically limit the open-circuit voltage (Voc) to typically less than 1 V. Here we show that this empirical limit can be overcome using non-fullerene acceptors blended with the low band gap polymer PffBT4T-2DT leading

  18. Effect of recombination on the open-circuit voltage of a silicon solar cell

    Science.gov (United States)

    Von Roos, O.; Landsberg, P. T.

    1985-01-01

    A theoretical study of the influence of band-band Auger, band-trap Auger, and the ordinary Shockley-Read-Hall mechanism for carrier recombination on the open-circuit voltage VOC of a solar cell is presented. Under reasonable assumptions for the magnitude of rate constants and realistic values for trap densities, surface recombination velocities and band-gap narrowing, the maximum VOC for typical back surface field solar cells is found to lie in the range between 0.61 and 0.72 V independent of base width.

  19. Lifetime measurements by open circuit voltage decay in GaAs and InP diodes

    International Nuclear Information System (INIS)

    Bhimnathwala, H.G.; Tyagi, S.D.; Bothra, S.; Ghandhi, S.K.; Borrego, J.M.

    1990-01-01

    Minority carrier lifetimes in the base of solar cells made in GaAs and InP are measured by open circuit voltage decay method. This paper describes the measurement technique and the conditions under which the minority carrier lifetimes can be measured. Minority carrier lifetimes ranging from 1.6 to 34 ns in InP of different doping concentrations are measured. A minority carrier lifetime of 6 ns was measured in n-type GaAs which agrees well with the lifetime of 5.7 ns measured by transient microwave reflection

  20. Safety of wet welding with increased open circuit voltages up to 150 V d.c

    International Nuclear Information System (INIS)

    Schmidt, K.; Kozig, G.; Ross, J.A.S.; Green, H.L.

    1991-01-01

    An experimental test programme was performed to demonstrate that wet welding with open circuit voltages up to 150 V d.c. would not result in dangerous situations for the diver induced by electric shock. Sea water, fresh water, different types of diving suits and some worst case situations, resulting from a disregard of good working practice were considered to be test parameters. In sea water a diver will not be endangered by corresponding electric potentials if good working practice is adopted. This was demonstrated even for worst case conditions, e.g. water leakage into the dry suit, accidental positioning to the diver between torch and work piece (stretched arm) and partial removal of coating from the welding rod. The fresh water tests demonstrated higher voltages on the diver but well below accepted threshold limit values. The term 'fresh water' should be critically considered, however, the test results relate only to the water conductivity studied. (orig.) With 30 figs [de

  1. Interface band gap narrowing behind open circuit voltage losses in Cu2ZnSnS4 solar cells

    DEFF Research Database (Denmark)

    Crovetto, Andrea; Palsgaard, Mattias Lau Nøhr; Gunst, Tue

    2017-01-01

    We present evidence that bandgap narrowing at the heterointerface may be a major cause of the large open circuit voltage deficit of Cu2ZnSnS4/CdS solar cells. Bandgap narrowing is caused by surface states that extend the Cu2ZnSnS4valence band into the forbidden gap. Those surface states...... are consistently found in Cu2ZnSnS4, but not in Cu2ZnSnSe4, by first-principles calculations. They do not simply arise from defects at surfaces but are an intrinsic feature of Cu2ZnSnS4 surfaces. By including those states in a device model, the outcome of previously published temperature-dependent open circuit...... voltage measurements on Cu2ZnSnS4 solar cells can be reproduced quantitatively without necessarily assuming a cliff-like conduction band offset with the CdS buffer layer. Our first-principles calculations indicate that Zn-based alternative buffer layers are advantageous due to the ability of...

  2. Open circuit voltage durability study and model of catalyst coated membranes at different humidification levels

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sumit; Fowler, Michael W.; Simon, Leonardo C. [Department of Chemical Engineering, University of Waterloo, 200 University Avenue West, Waterloo, Ontario (Canada); Abouatallah, Rami; Beydokhti, Natasha [Hydrogenics Corporation, 5985 McLaughlin Road, Mississauga, Ontario (Canada)

    2010-11-01

    Fuel cell material durability is an area of extensive research today. Chemical degradation of the ionomer membrane is one important degradation mechanism leading to overall failure of fuel cells. This study examined the effects of relative humidity on the chemical degradation of the membrane during open circuit voltage testing. Five Gore trademark PRIMEA {sup registered} series 5510 catalyst coated membranes were degraded at 100%, 75%, 50%, and 20% RH. Open circuit potential and cumulative fluoride release were monitored over time. Additionally scanning electron microscopy images were taken at end of the test. The results showed that with decreasing RH fluoride release rate increased as did performance degradation. This was attributed to an increase in gas crossover with a decrease in RH. Further, it is also shown that interruptions in testing may heavily influence cumulative fluoride release measurements where frequent stoppages in testing will cause fluoride release to be underestimated. SEM analysis shows that degradation occurred in the ionomer layer close to the cathode catalyst. A chemical degradation model of the ionomer membrane was used to model the results. The model was able to predict fluoride release trends, including the effects of interruptions, showing that changes in gas crossover with RH could explain the experimental results. (author)

  3. Correlation between the Open-Circuit Voltage and Charge Transfer State Energy in Organic Photovoltaic Cells.

    Science.gov (United States)

    Zou, Yunlong; Holmes, Russell J

    2015-08-26

    In order to further improve the performance of organic photovoltaic cells (OPVs), it is essential to better understand the factors that limit the open-circuit voltage (VOC). Previous work has sought to correlate the value of VOC in donor-acceptor (D-A) OPVs to the interface energy level offset (EDA). In this work, measurements of electroluminescence are used to extract the charge transfer (CT) state energy for multiple small molecule D-A pairings. The CT state as measured from electroluminescence is found to show better correlation to the maximum VOC than EDA. The difference between EDA and the CT state energy is attributed to the Coulombic binding energy of the CT state. This correlation is demonstrated explicitly by inserting an insulating spacer layer between the donor and acceptor materials, reducing the binding energy of the CT state and increasing the measured VOC. These results demonstrate a direct correlation between maximum VOC and CT state energy.

  4. Elucidating the interplay between dark current coupling and open circuit voltage in organic photovoltaics

    KAUST Repository

    Erwin, Patrick

    2011-01-01

    A short series of alkyl substituted perylenediimides (PDIs) with varying steric bulk are used to demonstrate the relationship between molecular structure, materials properties, and performance characteristics in organic photovoltaics. Devices were made with the structure indium tin oxide/copper phthalocyanine (200 Å)/PDI (200 Å)/bathocuproine (100 Å)/aluminum (1000 Å). We found that PDIs with larger substituents produced higher open circuit voltages (VOC\\'s) despite the donor acceptor interface gap (Δ EDA) remaining unchanged. Additionally, series resistance was increased simultaneously with VOC the effect of reducing short circuit current, making the addition of steric bulk a tradeoff that needs to be balanced to optimize power conversion efficiency. © 2011 American Institute of Physics.

  5. The importance of band tail recombination on current collection and open-circuit voltage in CZTSSe solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Moore, James E. [Naval Research Laboratory, Washington, DC 20375 (United States); Purdue University, West Lafayette, Indiana 47907 (United States); Hages, Charles J. [Purdue University, West Lafayette, Indiana 47907 (United States); Helmholtz-Zentrum Berlin für Materialien und Energie, Hahn-Meitner-Platz 1, 14109 Berlin (Germany); Agrawal, Rakesh; Lundstrom, Mark S.; Gray, Jeffery L. [Purdue University, West Lafayette, Indiana 47907 (United States)

    2016-07-11

    Cu{sub 2}ZnSn(S,Se){sub 4} (CZTSSe) solar cells typically exhibit high short-circuit current density (J{sub sc}), but have reduced cell efficiencies relative to other thin film technologies due to a deficit in the open-circuit voltage (V{sub oc}), which prevent these devices from becoming commercially competitive. Recent research has attributed the low V{sub oc} in CZTSSe devices to small scale disorder that creates band tail states within the absorber band gap, but the physical processes responsible for this V{sub oc} reduction have not been elucidated. In this paper, we show that carrier recombination through non-mobile band tail states has a strong voltage dependence and is a significant performance-limiting factor, and including these effects in simulation allows us to simultaneously explain the V{sub oc} deficit, reduced fill factor, and voltage-dependent quantum efficiency with a self-consistent set of material parameters. Comparisons of numerical simulations to measured data show that reasonable values for the band tail parameters (characteristic energy, capture rate) can account for the observed low V{sub oc}, high J{sub sc}, and voltage dependent collection efficiency. These results provide additional evidence that the presence of band tail states accounts for the low efficiencies of CZTSSe solar cells and further demonstrates that recombination through non-mobile band tail states is the dominant efficiency limiting mechanism.

  6. Influence of a MoOx interlayer on the open-circuit voltage in organic photovoltaic cells

    Science.gov (United States)

    Zou, Yunlong; Holmes, Russell J.

    2013-07-01

    Metal-oxides have been used as interlayers at the anode-organic interface in organic photovoltaic cells (OPVs) to increase the open-circuit voltage (VOC). We examine the role of MoOx in determining the maximum VOC in a planar heterojunction OPV and find that the interlayer strongly affects the temperature dependence of VOC. Boron subphthalocyanine chloride (SubPc)-C60 OPVs that contain no interlayer show a maximum VOC of 1.2 V at low temperature, while those with MoOx show no saturation, reaching VOC > 1.4 V. We propose that the MoOx-SubPc interface forms a Schottky junction that provides an additional contribution to VOC at low temperature.

  7. Influence of different open circuit voltage tests on state of charge online estimation for lithium-ion batteries

    International Nuclear Information System (INIS)

    Zheng, Fangdan; Xing, Yinjiao; Jiang, Jiuchun; Sun, Bingxiang; Kim, Jonghoon; Pecht, Michael

    2016-01-01

    Highlights: • Two common tests for observing battery open circuit voltage performance are compared. • The temperature dependency of the OCV-SOC relationship is investigated. • Two estimators are evaluated in terms of accuracy and robustness for estimating battery SOC. • The incremental OCV test is better to predetermine the OCV-SOCs for SOC online estimation. - Abstract: Battery state of charge (SOC) estimation is a crucial function of battery management systems (BMSs), since accurate estimated SOC is critical to ensure the safety and reliability of electric vehicles. A widely used technique for SOC estimation is based on online inference of battery open circuit voltage (OCV). Low-current OCV and incremental OCV tests are two common methods to observe the OCV-SOC relationship, which is an important element of the SOC estimation technique. In this paper, two OCV tests are run at three different temperatures and based on which, two SOC estimators are compared and evaluated in terms of tracking accuracy, convergence time, and robustness for online estimating battery SOC. The temperature dependency of the OCV-SOC relationship is investigated and its influence on SOC estimation results is discussed. In addition, four dynamic tests are presented, one for estimator parameter identification and the other three for estimator performance evaluation. The comparison results show that estimator 2 (based on the incremental OCV test) has higher tracking accuracy and is more robust against varied loading conditions and different initial values of SOC than estimator 1 (based on the low-current OCV test) with regard to ambient temperature. Therefore, the incremental OCV test is recommended for predetermining the OCV-SOCs for battery SOC online estimation in BMSs.

  8. An Adaptive Estimation Scheme for Open-Circuit Voltage of Power Lithium-Ion Battery

    Directory of Open Access Journals (Sweden)

    Yun Zhang

    2013-01-01

    Full Text Available Open-circuit voltage (OCV is one of the most important parameters in determining state of charge (SoC of power battery. The direct measurement of it is costly and time consuming. This paper describes an adaptive scheme that can be used to derive OCV of the power battery. The scheme only uses the measurable input (terminal current and the measurable output (terminal voltage signals of the battery system and is simple enough to enable online implement. Firstly an equivalent circuit model is employed to describe the polarization characteristic and the dynamic behavior of the lithium-ion battery; the state-space representation of the electrical performance for the battery is obtained based on the equivalent circuit model. Then the implementation procedure of the adaptive scheme is given; also the asymptotic convergence of the observer error and the boundedness of all the parameter estimates are proven. Finally, experiments are carried out, and the effectiveness of the adaptive estimation scheme is validated by the experimental results.

  9. Origin of Reduced Open-Circuit Voltage in Highly Efficient Small-Molecule-Based Solar Cells upon Solvent Vapor Annealing.

    Science.gov (United States)

    Deng, Wanyuan; Gao, Ke; Yan, Jun; Liang, Quanbin; Xie, Yuan; He, Zhicai; Wu, Hongbin; Peng, Xiaobin; Cao, Yong

    2018-03-07

    In this study, we demonstrate that remarkably reduced open-circuit voltage in highly efficient organic solar cells (OSCs) from a blend of phenyl-C 61 -butyric acid methyl ester and a recently developed conjugated small molecule (DPPEZnP-THD) upon solvent vapor annealing (SVA) is due to two independent sources: increased radiative recombination and increased nonradiative recombination. Through the measurements of electroluminescence due to the emission of the charge-transfer state and photovoltaic external quantum efficiency measurement, we can quantify that the open-circuit voltage losses in a device with SVA due to the radiative recombination and nonradiative recombination are 0.23 and 0.31 V, respectively, which are 0.04 and 0.07 V higher than those of the as-cast device. Despite of the reduced open-circuit voltage, the device with SVA exhibited enhanced dissociation of charge-transfer excitons, leading to an improved short-circuit current density and a remarkable power conversion efficiency (PCE) of 9.41%, one of the best for solution-processed OSCs based on small-molecule donor materials. Our study also clearly shows that removing the nonradiative recombination pathways and/or suppressing energetic disorder in the active layer would result in more long-lived charge carriers and enhanced open-circuit voltage, which are prerequisites for further improving the PCE.

  10. Interface Modification of Dye-sensitized Solar Cells with Pivalic Acid to Enhance the Open-circuit Voltage

    KAUST Repository

    Li, Xin

    2009-01-01

    Pivalic acid (PVA) was used as a new coadsorbent to dye-sensitized solar cells (DSCs) to modify the interface between the TiO2 films and electrolyte. The addition of PVA improved the light-to-electricity conversion efficiency of devices by 8% by enhancing the open-circuit voltage. Copyright © 2009 The Chemical Society of Japan.

  11. Microstructural and Electronic Origins of Open-Circuit Voltage Tuning in Organic Solar Cells Based on Ternary Blends

    KAUST Repository

    Mollinger, Sonya A.

    2015-09-22

    © 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. Organic ternary heterojunction photovoltaic blends are sometimes observed to undergo a gradual evolution in open-circuit voltage (Voc) with increasing amounts of a second donor or an acceptor. The Voc is strongly correlated with the energy of the charge transfer state in the blend, but this value depends on both local and mesoscopic orders. In this work, the behavior of Voc in the presence of a wide range of interfacial electronic states is investigated. The key charge transfer state interfaces responsible for Voc in several model systems with varying morphology are identified. Systems consisting of one donor with two fullerene molecules and of one acceptor with a donor polymer of varying regio-regularity are used. The effects from the changing energetic disorder in the material and from the variation due to a law of simple mixtures are quantified. It has been found that populating the higher-energy charge transfer states is not responsible for the observed change in Voc upon the addition of a third component. Aggregating polymers and miscible fullerenes are compared, and it has been concluded that in both cases charge delocalization, aggregation, and local polarization effects shift the lowest-energy charge transfer state distribution. The open-circuit voltage evolution and charge transfer state interfaces in ternary organic photovoltaic blends are investigated using several model systems. The changes in subgap spectra from energetic disorder and increased population of higher energy states are analyzed and the lowest charge transfer state distribution is observed to shift due to local aggregation and delocalization effects.

  12. Microstructural and Electronic Origins of Open-Circuit Voltage Tuning in Organic Solar Cells Based on Ternary Blends

    KAUST Repository

    Mollinger, Sonya A.; Vandewal, Koen; Salleo, Alberto

    2015-01-01

    © 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. Organic ternary heterojunction photovoltaic blends are sometimes observed to undergo a gradual evolution in open-circuit voltage (Voc) with increasing amounts of a second donor or an acceptor. The Voc is strongly correlated with the energy of the charge transfer state in the blend, but this value depends on both local and mesoscopic orders. In this work, the behavior of Voc in the presence of a wide range of interfacial electronic states is investigated. The key charge transfer state interfaces responsible for Voc in several model systems with varying morphology are identified. Systems consisting of one donor with two fullerene molecules and of one acceptor with a donor polymer of varying regio-regularity are used. The effects from the changing energetic disorder in the material and from the variation due to a law of simple mixtures are quantified. It has been found that populating the higher-energy charge transfer states is not responsible for the observed change in Voc upon the addition of a third component. Aggregating polymers and miscible fullerenes are compared, and it has been concluded that in both cases charge delocalization, aggregation, and local polarization effects shift the lowest-energy charge transfer state distribution. The open-circuit voltage evolution and charge transfer state interfaces in ternary organic photovoltaic blends are investigated using several model systems. The changes in subgap spectra from energetic disorder and increased population of higher energy states are analyzed and the lowest charge transfer state distribution is observed to shift due to local aggregation and delocalization effects.

  13. Ultra high open circuit voltage (>1 V) of poly-3-hexylthiophene based organic solar cells with concentrated light

    DEFF Research Database (Denmark)

    Tromholt, Thomas; Madsen, Morten Vesterager; Krebs, Frederik C

    2013-01-01

    to 2000 solar intensities of these photoactive blends. Comparison of solar cells based on five different fullerene derivatives shows that at both short circuit and open circuit conditions, recombination remains unchanged up to 50 suns. Determination of Voc at 2000 suns demonstrated that the same......One approach to increasing polymer solar cell efficiency is to blend poly-(3-hexyl-thiophene) with poorly electron accepting fullerene derivatives to obtain higher open circuit voltage (Voc). In this letter concentrated light is used to study the electrical properties of cell operation at up...

  14. Symmetry-Breaking Charge Transfer in a Zinc Chlorodipyrrin Acceptor for High Open Circuit Voltage Organic Photovoltaics

    KAUST Repository

    Bartynski, Andrew N.

    2015-04-29

    © 2015 American Chemical Society. Low open-circuit voltages significantly limit the power conversion efficiency of organic photovoltaic devices. Typical strategies to enhance the open-circuit voltage involve tuning the HOMO and LUMO positions of the donor (D) and acceptor (A), respectively, to increase the interfacial energy gap or to tailor the donor or acceptor structure at the D/A interface. Here, we present an alternative approach to improve the open-circuit voltage through the use of a zinc chlorodipyrrin, ZCl [bis(dodecachloro-5-mesityldipyrrinato)zinc], as an acceptor, which undergoes symmetry-breaking charge transfer (CT) at the donor/acceptor interface. DBP/ZCl cells exhibit open-circuit voltages of 1.33 V compared to 0.88 V for analogous tetraphenyldibenzoperyflanthrene (DBP)/C60-based devices. Charge transfer state energies measured by Fourier-transform photocurrent spectroscopy and electroluminescence show that C60 forms a CT state of 1.45 ± 0.05 eV in a DBP/C60-based organic photovoltaic device, while ZCl as acceptor gives a CT state energy of 1.70 ± 0.05 eV in the corresponding device structure. In the ZCl device this results in an energetic loss between ECT and qVOC of 0.37 eV, substantially less than the 0.6 eV typically observed for organic systems and equal to the recombination losses seen in high-efficiency Si and GaAs devices. The substantial increase in open-circuit voltage and reduction in recombination losses for devices utilizing ZCl demonstrate the great promise of symmetry-breaking charge transfer in organic photovoltaic devices.

  15. Experimental investigation of open circuit voltage during start-up process of HT-PEMFC

    International Nuclear Information System (INIS)

    Abdul Rasheed, Raj Kamal; Chan, Siew Hwa

    2015-01-01

    Highlights: • OCV reduces non-linearly with temperature under constant power input. • The reduction gradient of OCV is observed to be non-linear with time. • Nernst equation is less accurate for HT-PEMFC start-up models. - Abstract: This paper investigates the open circuit voltage (OCV) during the warm-up process of a high temperature proton exchange membrane fuel cell (HT-PEMFC) from 140 °C to the desired temperature of 180 °C, where the temperature increases with time. The heating strategy involves the external heating of the fuel cell with constant heat input rate. The commonly used Nernst equation, to predict the OCV of the fuel cell, is usually used in transient start-up models. Thus, this papers highlights the limitations of using the Nernst equation where the temperature increases transiently with time. A polybenzimidazole-based HTPEM single cell was set up and the OCV was measured under constant heating power supplied by an external source. A parametric study was done by varying the external heating power and the effect on the OCV was observed. The results showed that the OCV reduces non-linearly with respect to temperature, when the fuel cell is subjected to a constant heating power. This behaviour is clearly in contrast with the Nernst equation, which considers the temperature as steady state. For effective comparison, the OCV was also measured under steady state temperatures, showing an almost constant reduction gradient of ∼ −2.3×10 −4 V/°C. However, the behaviour under a constant heating power show curvilinear reduction of the OCV as the temperature increases. In addition, as the external heating power is increased, the degree of curvature of the OCV profile is greater. Thus, the results clearly indicate that the accuracy of using the Nernst equation in transient thermal start-up models can be improved, by considering a non linear behaviour, as shown in this paper.

  16. Recombination in polymer:Fullerene solar cells with open-circuit voltages approaching and exceeding 1.0 V

    KAUST Repository

    Hoke, Eric T.

    2012-09-14

    Polymer:fullerene solar cells are demonstrated with power conversion efficiencies over 7% with blends of PBDTTPD and PC 61 BM. These devices achieve open-circuit voltages ( V oc ) of 0.945 V and internal quantum efficiencies of 88%, making them an ideal candidate for the large bandgap junction in tandem solar cells. V oc \\'s above 1.0 V are obtained when the polymer is blended with multiadduct fullerenes; however, the photocurrent and fill factor are greatly reduced. In PBDTTPD blends with multiadduct fullerene ICBA, fullerene emission is observed in the photoluminescence and electroluminescence spectra, indicating that excitons are recombining on ICBA. Voltage-dependent, steady state and time-resolved photoluminescence measurements indicate that energy transfer occurs from PBDTTPD to ICBA and that back hole transfer from ICBA to PBDTTPD is inefficient. By analyzing the absorption and emission spectra from fullerene and charge transfer excitons, we estimate a driving free energy of -0.14 ± 0.06 eV is required for efficient hole transfer. These results suggest that the driving force for hole transfer may be too small for efficient current generation in polymer:fullerene solar cells with V oc values above 1.0 V and that non-fullerene acceptor materials with large optical gaps ( > 1.7 eV) may be required to achieve both near unity internal quantum efficiencies and values of V oc exceeding 1.0 V. © 2013 WILEY-VCH Verlag GmbH and Co.

  17. Recombination in polymer:Fullerene solar cells with open-circuit voltages approaching and exceeding 1.0 V

    KAUST Repository

    Hoke, Eric T.; Vandewal, Koen; Bartelt, Jonathan A.; Mateker, William R.; Douglas, Jessica D.; Noriega, Rodrigo; Graham, Kenneth; Frechet, Jean; Salleo, Alberto; McGehee, Michael D.

    2012-01-01

    Polymer:fullerene solar cells are demonstrated with power conversion efficiencies over 7% with blends of PBDTTPD and PC 61 BM. These devices achieve open-circuit voltages ( V oc ) of 0.945 V and internal quantum efficiencies of 88%, making them an ideal candidate for the large bandgap junction in tandem solar cells. V oc 's above 1.0 V are obtained when the polymer is blended with multiadduct fullerenes; however, the photocurrent and fill factor are greatly reduced. In PBDTTPD blends with multiadduct fullerene ICBA, fullerene emission is observed in the photoluminescence and electroluminescence spectra, indicating that excitons are recombining on ICBA. Voltage-dependent, steady state and time-resolved photoluminescence measurements indicate that energy transfer occurs from PBDTTPD to ICBA and that back hole transfer from ICBA to PBDTTPD is inefficient. By analyzing the absorption and emission spectra from fullerene and charge transfer excitons, we estimate a driving free energy of -0.14 ± 0.06 eV is required for efficient hole transfer. These results suggest that the driving force for hole transfer may be too small for efficient current generation in polymer:fullerene solar cells with V oc values above 1.0 V and that non-fullerene acceptor materials with large optical gaps ( > 1.7 eV) may be required to achieve both near unity internal quantum efficiencies and values of V oc exceeding 1.0 V. © 2013 WILEY-VCH Verlag GmbH and Co.

  18. The effect of diffusion induced lattice stress on the open-circuit voltage in silicon solar cells

    Science.gov (United States)

    Weizer, V. G.; Godlewski, M. P.

    1984-01-01

    It is demonstrated that diffusion induced stresses in low resistivity silicon solar cells can significantly reduce both the open-circuit voltage and collection efficiency. The degradation mechanism involves stress induced changes in both the minority carrier mobility and the diffusion length. Thermal recovery characteristics indicate that the stresses are relieved at higher temperatures by divacancy flow (silicon self diffusion). The level of residual stress in as-fabricated cells was found to be negligible in the cells tested.

  19. Guanidinium: A Route to Enhanced Carrier Lifetime and Open-Circuit Voltage in Hybrid Perovskite Solar Cells.

    Science.gov (United States)

    De Marco, Nicholas; Zhou, Huanping; Chen, Qi; Sun, Pengyu; Liu, Zonghao; Meng, Lei; Yao, En-Ping; Liu, Yongsheng; Schiffer, Andy; Yang, Yang

    2016-02-10

    Hybrid perovskites have shown astonishing power conversion efficiencies owed to their remarkable absorber characteristics including long carrier lifetimes, and a relatively substantial defect tolerance for solution-processed polycrystalline films. However, nonradiative charge carrier recombination at grain boundaries limits open circuit voltages and consequent performance improvements of perovskite solar cells. Here we address such recombination pathways and demonstrate a passivation effect through guanidinium-based additives to achieve extraordinarily enhanced carrier lifetimes and higher obtainable open circuit voltages. Time-resolved photoluminescence measurements yield carrier lifetimes in guanidinium-based films an order of magnitude greater than pure-methylammonium counterparts, giving rise to higher device open circuit voltages and power conversion efficiencies exceeding 17%. A reduction in defect activation energy of over 30% calculated via admittance spectroscopy and confocal fluorescence intensity mapping indicates successful passivation of recombination/trap centers at grain boundaries. We speculate that guanidinium ions serve to suppress formation of iodide vacancies and passivate under-coordinated iodine species at grain boundaries and within the bulk through their hydrogen bonding capability. These results present a simple method for suppressing nonradiative carrier loss in hybrid perovskites to further improve performances toward highly efficient solar cells.

  20. Effect of nano-imprinting on open-circuit voltage of organic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Emah, J.B.; Curry, R.J.; Silva, S.R.P. [Surrey Univ., Guildford (United Kingdom). Advanced Technology Inst.

    2010-07-01

    The open-circuit voltage (V{sub oc}) of solar cells with non-Ohmic contacts are determined by the work function difference of the electrodes. For Ohmic contacts the V{sub oc} is governed by the LUMO and HOMO levels of the acceptor and donor, respectively, which pin the Fermi levels of the cathode and anode. We present a case where the V{sub oc} of a single layer device using poly (3-hexylthiopene-2,5-diyl) (P3HT) as the photoactive material between a nanoimprinted poly poly (3,4-ethylenedioxythiophene) poly (styrene sulfonate)(PEDOT:PSS) and Al electrode decreases due to patterning. The reverse is shown to be the case when [6,6]-phenyl-C{sub 61}-butyric acid ester (PCBM) is introduced to form a bulk heterojunction (BHJ). In both scenarios, there is an increase in the short-circuit current, attributed to an extended optical path length within the photoactive layer and enhanced charge extraction through the increased surface area. The patterned BHJ devices show a 28% and 40% increase in the power conversion efficiency when imprinted with 727 nm and 340 nm periodic patterns respectively. ATR-FTIR investigations of the interfacial PEDOT:PSS film following patterning reveals the presence of PDMS residue which is supported by consideration of the effect on single layer P3HT and P3HT:PCBM blend device performance. UPS measurements demonstrate a reduction in the work function of the interfacial PEDOT:OSS layer by {proportional_to}0.5 eV following nanoimprinting which may originate from chemical modification by the PDMS residue or interfacial dipole formation. XPS spectrum of the imprinted PEDOT:PSS also shows a chemical shift in the 0(1s) core-level towards higher binding energy signifying interaction of the PDMS stamp residue with the PSS dominated surface of PEDOT:PSS. This led to significant improvement in the V{sub oc} and ultimately, the PCE. (orig.)

  1. Study of the Contributions of Donor and Acceptor Photoexcitations to Open Circuit Voltage in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Douglas Yeboah

    2017-10-01

    Full Text Available One of the key parameters in determining the power conversion efficiency (PCE of bulk heterojunction (BHJ organic solar cells (OSCs is the open circuit voltage . The processes of exciting the donor and acceptor materials individually in a BHJ OSC are investigated and are found to produce two different expressions for . Using the contributions of electron and hole quasi-Fermi levels and charge carrier concentrations, the two different expressions are derived as functions of the energetics of the donor and acceptor materials and the photo-generated charge carrier concentrations, and calculated for a set of donor-acceptor blends. The simultaneous excitation of both the donor and acceptor materials is also considered and the corresponding , which is different from the above two, is derived. The calculated from the photoexcitation of the donor is found to be somewhat comparable with that obtained from the photoexcitation of the acceptor in most combinations of the donor and acceptor materials considered here. It is also found that the calculated from the simultaneous excitations of donor and acceptor in BHJ OSCs is also comparable with the other two . All three thus derived produce similar results and agree reasonably well with the measured values. All three depend linearly on the concentration of the photoexcited charge carriers and hence incident light intensity, which agrees with experimental results. The outcomes of this study are expected to help in finding materials that may produce higher and hence enhanced PCE in BHJ OSCs.

  2. Reduced voltage losses yield 10% efficient fullerene free organic solar cells with >1 V open circuit voltages

    KAUST Repository

    Baran, D.

    2016-11-09

    Optimization of the energy levels at the donor-acceptor interface of organic solar cells has driven their efficiencies to above 10%. However, further improvements towards efficiencies comparable with inorganic solar cells remain challenging because of high recombination losses, which empirically limit the open-circuit voltage (Voc) to typically less than 1 V. Here we show that this empirical limit can be overcome using non-fullerene acceptors blended with the low band gap polymer PffBT4T-2DT leading to efficiencies approaching 10% (9.95%). We achieve Voc up to 1.12 V, which corresponds to a loss of only Eg/q - Voc = 0.5 ± 0.01 V between the optical bandgap Eg of the polymer and Voc. This high Voc is shown to be associated with the achievement of remarkably low non-geminate and non-radiative recombination losses in these devices. Suppression of non-radiative recombination implies high external electroluminescence quantum efficiencies which are orders of magnitude higher than those of equivalent devices employing fullerene acceptors. Using the balance between reduced recombination losses and good photocurrent generation efficiencies achieved experimentally as a baseline for simulations of the efficiency potential of organic solar cells, we estimate that efficiencies of up to 20% are achievable if band gaps and fill factors are further optimized. © The Royal Society of Chemistry 2016.

  3. Improved open-circuit voltage in Cu(In,Ga)Se2 solar cells with high work function transparent electrodes

    International Nuclear Information System (INIS)

    Jäger, Timo; Romanyuk, Yaroslav E.; Bissig, Benjamin; Pianezzi, Fabian; Nishiwaki, Shiro; Reinhard, Patrick; Steinhauser, Jérôme; Tiwari, Ayodhya N.; Schwenk, Johannes

    2015-01-01

    Hydrogenated indium oxide (IOH) is implemented as transparent front contact in Cu(In,Ga)Se 2 (CIGS) solar cells, leading to an open circuit voltage V OC enhanced by ∼20 mV as compared to reference devices with ZnO:Al (AZO) electrodes. This effect is reproducible in a wide range of contact sheet resistances corresponding to various IOH thicknesses. We present the detailed electrical characterization of glass/Mo/CIGS/CdS/intrinsic ZnO (i-ZnO)/transparent conductive oxide (TCO) with different IOH/AZO ratios in the front TCO contact in order to identify possible reasons for the enhanced V OC . Temperature and illumination intensity-dependent current-voltage measurements indicate that the dominant recombination path does not change when AZO is replaced by IOH, and it is mainly limited to recombination in the space charge region and at the junction interface of the solar cell. The main finding is that the introduction of even a 5 nm-thin IOH layer at the i-ZnO/TCO interface already results in a step-like increase in V OC . Two possible explanations are proposed and verified by one-dimensional simulations using the SCAPS software. First, a higher work function of IOH as compared to AZO is simulated to yield an V OC increase by 21 mV. Second, a lower defect density in the i-ZnO layer as a result of the reduced sputter damage during milder sputter-deposition of IOH can also add to a maximum enhanced V OC of 25 mV. Our results demonstrate that the proper choice of the front TCO contact can reduce the parasitic recombination and boost the efficiency of CIGS cells with improved corrosion stability

  4. Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

    KAUST Repository

    Graham, Kenneth; Erwin, Patrick; Nordlund, Dennis; Vandewal, Koen; Li, Ruipeng; Ngongang Ndjawa, Guy Olivier; Hoke, Eric T.; Salleo, Alberto; Thompson, Mark E.; McGehee, Michael D.; Amassian, Aram

    2013-01-01

    The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

    KAUST Repository

    Graham, Kenneth

    2013-07-30

    The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Correlation between LUMO offset of donor/acceptor molecules to an open circuit voltage in bulk heterojunction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Mola, Genene Tessema, E-mail: mola@ukzn.ac.za [School of. Chemistry and Physics, University of Kwazulu-Natal, Pietermaritzburg Campus, Private Bag X01, Scottsville 3209 (South Africa); Abera, Newayemedhin [Addis Ababa University, Department of Physics, P.O. BOX 1176, Addis Ababa (Ethiopia)

    2014-07-15

    The correlation between the open circuit voltage and the LUMO offset of the donor and acceptor polymers in the bulkheterojunction solar cell was studied for three different thiophene derivatives. The HOMO levels of all the polymers in this investigation were chosen to be similar which results in close values of ΔE{sub DA}=E{sub HOMO}{sup D}−E{sub LUMO}{sup A}. However, the measured V{sub oc} was found to be increasing with decreasing value of the LUMO offset that exists between the donor polymer and fullerene.

  7. Influence of MoOx interlayer on the maximum achievable open-circuit voltage in organic photovoltaic cells

    Science.gov (United States)

    Zou, Yunlong; Holmes, Russell

    2013-03-01

    Transition metal oxides including molybdenum oxide (MoOx) are characterized by large work functions and deep energy levels relative to the organic semiconductors used in photovoltaic cells (OPVs). These materials have been used in OPVs as interlayers between the indium-tin-oxide anode and the active layers to increase the open-circuit voltage (VOC) and power conversion efficiency. We examine the role of MoOx in determining the maximum achievable VOC in planar heterojunction OPVs based on the donor-acceptor pairing of boron subphthalocyanine chloride (SubPc) and C60. While causing minor changes in VOC at room temperature, the inclusion of MoOx significantly changes the temperature dependence of VOC. Devices containing no interlayer show a maximum VOC\\ of 1.2 V, while devices containing MoOx show no saturation in VOC, reaching a value of >1.4 V at 110 K. We propose that the MoOx-SubPc interface forms a dissociating Schottky junction that provides an additional contribution to VOC at low temperature. Separate measurements of photoluminescence confirm that excitons in SubPc can be quenched by MoOx. Charge transfer at this interface is by hole extraction from SubPc to MoOx, and this mechanism favors donors with a deep highest occupied molecular orbital (HOMO) energy level. Consistent with this expectation, the temperature dependence of VOC for devices constructed using a donor with a shallower HOMO level, e.g. copper phthalocyanine, is independent of the presence of MoOx.

  8. Study on Factors for Accurate Open Circuit Voltage Characterizations in Mn-Type Li-Ion Batteries

    Directory of Open Access Journals (Sweden)

    Natthawuth Somakettarin

    2017-03-01

    Full Text Available Open circuit voltage (OCV of lithium batteries has been of interest since the battery management system (BMS requires an accurate knowledge of the voltage characteristics of any Li-ion batteries. This article presents an OCV characteristic for lithium manganese oxide (LMO batteries under several experimental operating conditions, and discusses factors for accurate OCV determination. A test system is developed for OCV characterization based on the OCV pulse test method. Various factors for the OCV behavior, such as resting period, step-size of the pulse test, testing current amplitude, hysteresis phenomena, and terminal voltage relationship, are investigated and evaluated. To this end, a general OCV model based on state of charge (SOC tracking is developed and validated with satisfactory results.

  9. Polypyrrole: FeOx·ZnO nanoparticle solar cells with breakthrough open-circuit voltage prepared from relatively stable liquid dispersions

    KAUST Repository

    Zong, Baoyu

    2014-01-01

    Organic hybrid solar cells with a large open-circuit voltage, up to above that of 1.5 V standard battery voltage, were demonstrated using blends of polypyrrole: Fe2O3·ZnO nanoparticles as active-layers. The cell active-layers were readily coated in open air from relatively stable liquid dark-color polypyrrole-based dispersions, which were synthesized using appropriate surfactants during the in situ polymerization of pyrrole with FeCl3 or both H2O2 and FeCl3 as the oxidizers. The performance of the cells depends largely on the synthesized blend phase, which is determined by the surfactants, oxidizers, as well as the reactant ratio. Only the solar cells fabricated from the stable dispersions can produce both a high open-circuit voltage (>1.0 V) and short-circuit current (up to 7.5 mA cm-2) due to the relatively uniform porous network nanomorphology and higher shunt to series resistance ratio of the active-layers. The cells also display a relatively high power-conversion efficiency of up to ∼3.8%. This journal is

  10. State of charge estimation of lithium-ion batteries using the open-circuit voltage at various ambient temperatures

    International Nuclear Information System (INIS)

    Xing, Yinjiao; He, Wei; Pecht, Michael; Tsui, Kwok Leung

    2014-01-01

    Highlights: • An offline OCV–SOC–temperature table was established to infer battery SOC. • A temperature-based model was developed to estimate SOC at different temperatures. • The algorithm for SOC estimation was verified by dynamic current load. • The robustness of the approach was validated by different initial SOC values. - Abstract: Ambient temperature is a significant factor that influences the accuracy of battery SOC estimation, which is critical for remaining driving range prediction of electric vehicles (EVs) and optimal charge/discharge control of batteries. A widely used method to estimate SOC is based on an online inference of open-circuit voltage (OCV). However, the fact that the OCV–SOC is dependent on ambient temperature can result in errors in battery SOC estimation. To address this problem, this paper presents an SOC estimation approach based on a temperature-based model incorporated with an OCV–SOC–temperature table. The unscented Kalman filtering (UKF) was applied to tune the model parameters at each sampling step to cope with various uncertainties arising from the operation environment, cell-to-cell variation, and modeling inaccuracy. Two dynamic tests, the dynamic stress test (DST) and the federal urban driving schedule (FUDS), were used to test batteries at different temperatures. Then, DST was used to identify the model parameters while FUDS was used to validate the performance of the SOC estimation. The estimation was made covering the major working range from 25% to 85% SOC. The results indicated that our method can provide accurate SOC estimation with smaller root mean squared errors than the method that does not take into account ambient temperature. Thus, our approach is effective and accurate when battery operates at different ambient temperatures. Since the developed method takes into account the temperature factor as well as the complexity of the model, it could be effectively applied in battery management systems for

  11. Development of Thin Film Amorphous Silicon Tandem Junction Based Photocathodes Providing High Open-Circuit Voltages for Hydrogen Production

    Directory of Open Access Journals (Sweden)

    F. Urbain

    2014-01-01

    Full Text Available Hydrogenated amorphous silicon thin film tandem solar cells (a-Si:H/a-Si:H have been developed with focus on high open-circuit voltages for the direct application as photocathodes in photoelectrochemical water splitting devices. By temperature variation during deposition of the intrinsic a-Si:H absorber layers the band gap energy of a-Si:H absorber layers, correlating with the hydrogen content of the material, can be adjusted and combined in a way that a-Si:H/a-Si:H tandem solar cells provide open-circuit voltages up to 1.87 V. The applicability of the tandem solar cells as photocathodes was investigated in a photoelectrochemical cell (PEC measurement set-up. With platinum as a catalyst, the a-Si:H/a-Si:H based photocathodes exhibit a high photocurrent onset potential of 1.76 V versus the reversible hydrogen electrode (RHE and a photocurrent of 5.3 mA/cm2 at 0 V versus RHE (under halogen lamp illumination. Our results provide evidence that a direct application of thin film silicon based photocathodes fulfills the main thermodynamic requirements to generate hydrogen. Furthermore, the presented approach may provide an efficient and low-cost route to solar hydrogen production.

  12. Energy-level alignment and open-circuit voltage at graphene/polymer interfaces: theory and experiment

    Science.gov (United States)

    Noori, Keian; Konios, Dimitrios; Stylianakis, Minas M.; Kymakis, Emmanuel; Giustino, Feliciano

    2016-03-01

    Functionalized graphene promises to become a key component of novel solar cell architectures, owing to its versatile ability to act either as transparent conductor, electron acceptor, or buffer layer. In spite of this promise, the solar energy conversion efficiency of graphene-based devices falls short of the performance of competing solution-processable photovoltaic technologies. Here we address the question of the maximum achievable open-circuit voltage of all-organic graphene: polymer solar cells using a combined theoretical/experimental approach, going from the atomic scale level to the device level. Our calculations on very large atomistic models of the graphene/polymer interface indicate that the ideal open-circuit voltage approaches one volt, and that epoxide functional groups can have a dramatic effect on the photovoltage. Our predictions are confirmed by direct measurements on complete devices where we control the concentration of functional groups via chemical reduction. Our findings indicate that the selective removal of epoxide groups and the use of ultradisperse polymers are key to achieving graphene solar cells with improved energy conversion efficiency.

  13. Prediction Model and Principle of End-of-Life Threshold for Lithium Ion Batteries Based on Open Circuit Voltage Drifts

    International Nuclear Information System (INIS)

    Cui, Yingzhi; Yang, Jie; Du, Chunyu; Zuo, Pengjian; Gao, Yunzhi; Cheng, Xinqun; Ma, Yulin; Yin, Geping

    2017-01-01

    Highlights: •Open circuit voltage evolution over ageing of lithium ion batteries is deciphered. •The mechanism responsible for the end-of-life (EOL) threshold is elaborated. •A new prediction model of EOL threshold with improved accuracy is developed. •This EOL prediction model is promising for the applications in electric vehicles. -- Abstract: The end-of-life (EOL) of a lithium ion battery (LIB) is defined as the time point when the LIB can no longer provide sufficient power or energy to accomplish its intended function. Generally, the EOL occurs abruptly when the degradation of a LIB reaches the threshold. Therefore, current prediction methods of EOL by extrapolating the early degradation behavior often result in significant errors. To address this problem, this paper analyzes the reason for the EOL threshold of a LIB with shallow depth of discharge. It is found that the sudden appearance of EOL threshold results from the drift of open circuit voltage (OCV) at the end of both shallow depth and full discharges. Further, a new EOL threshold prediction model with highly improved accuracy is developed based on the OCV drifts and their evolution mechanism, which can effectively avoid the misjudgment of EOL threshold. The accuracy of this EOL threshold prediction model is verified by comparing with experimental results. The EOL threshold prediction model can be applied to other battery chemistry systems and its possible application in electric vehicles is finally discussed.

  14. Comparative Study of Online Open Circuit Voltage Estimation Techniques for State of Charge Estimation of Lithium-Ion Batteries

    Directory of Open Access Journals (Sweden)

    Hicham Chaoui

    2017-04-01

    Full Text Available Online estimation techniques are extensively used to determine the parameters of various uncertain dynamic systems. In this paper, online estimation of the open-circuit voltage (OCV of lithium-ion batteries is proposed by two different adaptive filtering methods (i.e., recursive least square, RLS, and least mean square, LMS, along with an adaptive observer. The proposed techniques use the battery’s terminal voltage and current to estimate the OCV, which is correlated to the state of charge (SOC. Experimental results highlight the effectiveness of the proposed methods in online estimation at different charge/discharge conditions and temperatures. The comparative study illustrates the advantages and limitations of each online estimation method.

  15. Enhanced Open-Circuit Voltage in Colloidal Quantum Dot Photovoltaics via Reactivity-Controlled Solution-Phase Ligand Exchange

    KAUST Repository

    Jo, Jea Woong; Kim, Younghoon; Choi, Jongmin; de Arquer, F. Pelayo Garcí a; Walters, Grant; Sun, Bin; Ouellette, Olivier; Kim, Junghwan; Proppe, Andrew H.; Quintero-Bermudez, Rafael; Fan, James; Xu, Jixian; Tan, Chih Shan; Voznyy, Oleksandr; Sargent, Edward H.

    2017-01-01

    The energy disorder that arises from colloidal quantum dot (CQD) polydispersity limits the open-circuit voltage (VOC) and efficiency of CQD photovoltaics. This energy broadening is significantly deteriorated today during CQD ligand exchange and film assembly. Here, a new solution-phase ligand exchange that, via judicious incorporation of reactivity-engineered additives, provides improved monodispersity in final CQD films is reported. It has been found that increasing the concentration of the less reactive species prevents CQD fusion and etching. As a result, CQD solar cells with a VOC of 0.7 V (vs 0.61 V for the control) for CQD films with exciton peak at 1.28 eV and a power conversion efficiency of 10.9% (vs 10.1% for the control) is achieved.

  16. Enhanced Open-Circuit Voltage in Colloidal Quantum Dot Photovoltaics via Reactivity-Controlled Solution-Phase Ligand Exchange

    KAUST Repository

    Jo, Jea Woong

    2017-10-09

    The energy disorder that arises from colloidal quantum dot (CQD) polydispersity limits the open-circuit voltage (VOC) and efficiency of CQD photovoltaics. This energy broadening is significantly deteriorated today during CQD ligand exchange and film assembly. Here, a new solution-phase ligand exchange that, via judicious incorporation of reactivity-engineered additives, provides improved monodispersity in final CQD films is reported. It has been found that increasing the concentration of the less reactive species prevents CQD fusion and etching. As a result, CQD solar cells with a VOC of 0.7 V (vs 0.61 V for the control) for CQD films with exciton peak at 1.28 eV and a power conversion efficiency of 10.9% (vs 10.1% for the control) is achieved.

  17. Enhanced Open-Circuit Voltage in Visible Quantum Dot Photovoltaics by Engineering of Carrier-Collecting Electrodes

    KAUST Repository

    Wang, Xihua

    2011-10-26

    Colloidal quantum dots (CQDs) enable multijunction solar cells using a single material programmed using the quantum size effect. Here we report the systematic engineering of 1.6 eV PbS CQD solar cells, optimal as the front cell responsible for visible-wavelength harvesting in tandem photovoltaics. We rationally optimize each of the device\\'s collecting electrodes-the heterointerface with electron-accepting TiO2 and the deep-work-function hole-collecting MoO3 for ohmic contact-for maximum efficiency. We report an open-circuit voltage of 0.70 V, the highest observed in a colloidal quantum dot solar cell operating at room temperature. We report an AM1.5 solar power conversion efficiency of 3.5%, the highest observed in >1.5 eV bandgap CQD PV device. © 2011 American Chemical Society.

  18. Effect of solar-cell junction geometry on open-circuit voltage

    Science.gov (United States)

    Weizer, V. G.; Godlewski, M. P.

    1985-01-01

    Simple analytical models have been found that adequately describe the voltage behavior of both the stripe junction and dot junction grating cells as a function of junction area. While the voltage in the former case is found to be insensitive to junction area reduction, significant voltage increases are shown to be possible for the dot junction cell. With regard to cells in which the junction area has been increased in a quest for better performance, it was found that (1) texturation does not affect the average saturation current density J0, indicating that the texturation process is equivalent to a simple extension of junction area by a factor of square root of 3 and (2) the vertical junction cell geometry produces a sizable decrease in J0 that, unfortunately, is more than offset by the effects of attendant areal increases.

  19. Numerical Study on Open-Circuit Voltage of Single Layer Organic Solar Cells with Schottky Contacts: Effects of Molecular Energy Levels, Temperature and Thickness

    International Nuclear Information System (INIS)

    Rong-Hua, Li; Ying-Quan, Peng; Chao-Zhu, Ma; Run-Sheng, Wang; Hong-Wei, Xie; Ying, Wang; Wei-Min, Meng

    2010-01-01

    We numerically investigate the effects of the exciton generation rate G, temperature T, the active layer thickness d and the position of LUMO level E L related to the cathode work function W c at a given energy gap on the open-circuit voltage V oc of single layer organic solar cells with Schottky contact. It is demonstrated that open-circuit voltage increases concomitantly with the decreasing cathode work function W c for given anode work functions and exciton generation rates. In the case of given cathode and anode work functions, the open-circuit voltage first increases with the exciton generation rate and then reaches a saturation value, which equals to the built-in voltage. Additionally, it is worth noting that a significant improvement to V oc could be made by selecting an organic material which has a relative high LUMO level (low |E L | value). However, V oc decreases as the temperature increases, and the decreasing rate reduces with the enhancement of exciton generation rate. Our study also shows that it is of no benefit to improve the open-circuit voltage by increasing the device thickness because of an enhanced charge recombination in thicker devices. (cross-disciplinary physics and related areas of science and technology)

  20. Achieving 12.8% Efficiency by Simultaneously Improving Open-Circuit Voltage and Short-Circuit Current Density in Tandem Organic Solar Cells.

    Science.gov (United States)

    Qin, Yunpeng; Chen, Yu; Cui, Yong; Zhang, Shaoqing; Yao, Huifeng; Huang, Jiang; Li, Wanning; Zheng, Zhong; Hou, Jianhui

    2017-06-01

    Tandem organic solar cells (TOSCs), which integrate multiple organic photovoltaic layers with complementary absorption in series, have been proved to be a strong contender in organic photovoltaic depending on their advantages in harvesting a greater part of the solar spectrum and more efficient photon utilization than traditional single-junction organic solar cells. However, simultaneously improving open circuit voltage (V oc ) and short current density (J sc ) is a still particularly tricky issue for highly efficient TOSCs. In this work, by employing the low-bandgap nonfullerene acceptor, IEICO, into the rear cell to extend absorption, and meanwhile introducing PBDD4T-2F into the front cell for improving V oc , an impressive efficiency of 12.8% has been achieved in well-designed TOSC. This result is also one of the highest efficiencies reported in state-of-the-art organic solar cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Relationship between open-circuit voltage in Cu(In,Ga)Se2 solar cell and peak position of (220/204) preferred orientation near its absorber surface

    International Nuclear Information System (INIS)

    Chantana, J.; Minemoto, T.; Watanabe, T.; Teraji, S.; Kawamura, K.

    2013-01-01

    Cu(In,Ga)Se 2 (CIGS) absorbers with various Ga/III, Ga/(In+Ga), profiles are prepared by the so-called “multi-layer precursor method” using multi-layer co-evaporation of material sources. It is revealed that open-circuit voltage (V OC ) of CIGS solar cell is primarily dependent on averaged Ga/III near the surface of its absorber. This averaged Ga/III is well predicted by peak position of (220/204) preferred orientation of CIGS film near its surface investigated by glancing-incidence X-ray diffraction with 0.1° incident angle. Finally, the peak position of (220/204) preferred orientation is proposed as a measure of V OC before solar cell fabrication

  2. Formation of a p-n heterojunction on GaP photocathodes for H-2 production providing an open-circuit voltage of 710 mV

    DEFF Research Database (Denmark)

    Malizia, Mauro; Seger, Brian; Chorkendorff, Ib

    2014-01-01

    Photocatalytic water splitting for the sustainable production of hydrogen using a two-photon tandem device requires careful optimization of the semiconductors used as photon absorbers. In this work we show how the open-circuit voltage of photocathodes for the hydrogen evolution reaction based on ...

  3. Current Matching in Multifold DBP/C70 Organic Solar Cells With Open-Circuit Voltages of up to 6.44 V

    DEFF Research Database (Denmark)

    Ahmadpour, Mehrad; Liu, Yiming; Rubahn, Horst-Günter

    2017-01-01

    In this paper, we demonstrate a novel method for achieving high open-circuit voltages (Voc) in organic solar cells based on tetraphenyldibenzoperiflanthen (DBP) as donor and fullerene (C70) as acceptor molecules, by fabrication of multifold bilayer single cells stacked on top of each other...

  4. Molecular design of novel fullerene-based acceptors for enhancing the open circuit voltage in polymer solar cells

    Science.gov (United States)

    Tajbakhsh, Mahmood; Kariminasab, Mohaddeseh; Ganji, Masoud Darvish; Alinezhad, Heshmatollah

    2017-12-01

    Organic solar cells, especially bulk hetero-junction polymer solar cells (PSCs), are the most successful structures for applications in renewable energy. The dramatic improvement in the performance of PSCs has increased demand for new conjugated polymer donors and fullerene derivative acceptors. In the present study, quantum chemical calculations were performed for several representative fullerene derivatives in order to determine their frontier orbital energy levels and electronic structures, thereby helping to enhance their performance in PSC devices. We found correlations between the theoretical lowest unoccupied molecular orbital levels and electrophilicity index of various fullerenes with the experimental open circuit voltage of photovoltaic devices according to the poly(3-hexylthiophene) (P3HT):fullerene blend. The correlations between the structure and descriptors may facilitate screening of the best fullerene acceptor for the P3HT donor. Thus, we considered fullerenes with new functional groups and we predicted the output factors for the corresponding P3HT:fullerene blend devices. The results showed that fullerene derivatives based on thieno-o-quinodimethane-C60 with a methoxy group will have enhanced photovoltaic properties. Our results may facilitate the design of new fullerenes and the development of favorable acceptors for use in photovoltaic applications.

  5. Simultaneous improvement in short circuit current, open circuit voltage, and fill factor of polymer solar cells through ternary strategy.

    Science.gov (United States)

    An, Qiaoshi; Zhang, Fujun; Li, Lingliang; Wang, Jian; Sun, Qianqian; Zhang, Jian; Tang, Weihua; Deng, Zhenbo

    2015-02-18

    We present a smart strategy to simultaneously increase the short circuit current (Jsc), the open circuit voltage (Voc), and the fill factor (FF) of polymer solar cells (PSCs). A two-dimensional conjugated small molecule photovoltaic material (SMPV1), as the second electron donor, was doped into the blend system of poly(3-hexylthiophene) (P3HT) and [6,6]-phenyl-C71-butyric acid methyl (PC71BM) to form ternary PSCs. The ternary PSCs with 5 wt % SMPV1 doping ratio in donors achieve 4.06% champion power conversion efficiency (PCE), corresponding to about 21.2% enhancement compared with the 3.35% PCE of P3HT:PC71BM-based PSCs. The underlying mechanism on performance improvement of ternary PSCs can be summarized as (i) harvesting more photons in the longer wavelength region to increase Jsc; (ii) obtaining the lower mixed highest occupied molecular orbital (HOMO) energy level by incorporating SMPV1 to increase Voc; (iii) forming the better charge carrier transport channels through the cascade energy level structure and optimizing phase separation of donor/acceptor materials to increase Jsc and FF.

  6. Trifluoromethyl-Substituted Large Band-Gap Polytriphenylamines for Polymer Solar Cells with High Open-Circuit Voltages

    Directory of Open Access Journals (Sweden)

    Shuwang Yi

    2018-01-01

    Full Text Available Two large band-gap polymers (PTPACF and PTPA2CF based on polytriphenylamine derivatives with the introduction of electron-withdrawing trifluoromethyl groups were designed and prepared by Suzuki polycondensation reaction. The chemical structures, thermal, optical and electrochemical properties were characterized in detail. From the UV-visible absorption spectra, the PTPACF and PTPA2CF showed the optical band gaps of 2.01 and 2.07 eV, respectively. The cyclic voltammetry (CV measurement displayed the deep highest occupied molecular orbital (HOMO energy levels of −5.33 and −5.38 eV for PTPACF and PTPA2CF, respectively. The hole mobilities, determined by field-effect transistor characterization, were 2.5 × 10−3 and 1.1 × 10−3 cm2 V−1 S−1 for PTPACF and PTPA2CF, respectively. The polymer solar cells (PSCs were tested under the conventional device structure of ITO/PEDOT:PSS/polymer:PC71BM/PFN/Al. All of the PSCs showed the high open circuit voltages (Vocs with the values approaching 1 V. The PTPACF and PTPA2CF based PSCs gave the power conversion efficiencies (PCEs of 3.24% and 2.40%, respectively. Hence, it is a reliable methodology to develop high-performance large band-gap polymer donors with high Vocs through the feasible side-chain modification.

  7. Unraveling the High Open Circuit Voltage and High Performance of Integrated Perovskite/Organic Bulk-Heterojunction Solar Cells.

    Science.gov (United States)

    Dong, Shiqi; Liu, Yongsheng; Hong, Ziruo; Yao, Enping; Sun, Pengyu; Meng, Lei; Lin, Yuze; Huang, Jinsong; Li, Gang; Yang, Yang

    2017-08-09

    We have demonstrated high-performance integrated perovskite/bulk-heterojunction (BHJ) solar cells due to the low carrier recombination velocity, high open circuit voltage (V OC ), and increased light absorption ability in near-infrared (NIR) region of integrated devices. In particular, we find that the V OC of the integrated devices is dominated by (or pinned to) the perovskite cells, not the organic photovoltaic cells. A Quasi-Fermi Level Pinning Model was proposed to understand the working mechanism and the origin of the V OC of the integrated perovskite/BHJ solar cell, which following that of the perovskite solar cell and is much higher than that of the low bandgap polymer based organic BHJ solar cell. Evidence for the model was enhanced by examining the charge carrier behavior and photovoltaic behavior of the integrated devices under illumination of monochromatic light-emitting diodes at different characteristic wavelength. This finding shall pave an interesting possibility for integrated photovoltaic devices to harvest low energy photons in NIR region and further improve the current density without sacrificing V OC , thus providing new opportunities and significant implications for future industry applications of this kind of integrated solar cells.

  8. Diphenylphenoxy-Thiophene-PDI Dimers as Acceptors for OPV Applications with Open Circuit Voltage Approaching 1 Volt

    Directory of Open Access Journals (Sweden)

    Caterina Stenta

    2018-03-01

    Full Text Available Two new perylenediimides (PDIs have been developed for use as electron acceptors in solution-processed bulk heterojunction solar cells. The compounds were designed to exhibit maximal solubility in organic solvents, and reduced aggregation in the solid state. In order to achieve this, diphenylphenoxy groups were used to functionalize a monomeric PDI core, and two PDI dimers were bridged with either one or two thiophene units. In photovoltaic devices prepared using PDI dimers and a monomer in conjunction with PTB7, it was found that the formation of crystalline domains in either the acceptor or donor was completely suppressed. Atomic force microscopy, X-ray diffraction, charge carrier mobility measurements and recombination kinetics studies all suggest that the lack of crystallinity in the active layer induces a significant drop in electron mobility. Significant surface recombination losses associated with a lack of segregation in the material were also identified as a significant loss mechanism. Finally, the monomeric PDI was found to have sub-optimum LUMO energy matching the cathode contact, thus limiting charge carrier extraction. Despite these setbacks, all PDIs produced high open circuit voltages, reaching almost 1 V in one particular case.

  9. Investigation of the open-circuit voltage in wide-bandgap InGaP-host InP quantum dot intermediate-band solar cells

    Science.gov (United States)

    Aihara, Taketo; Tayagaki, Takeshi; Nagato, Yuki; Okano, Yoshinobu; Sugaya, Takeyoshi

    2018-04-01

    To analyze the open-circuit voltage (V oc) in intermediate-band solar cells, we investigated the current-voltage characteristics in wide-bandgap InGaP-based InP quantum dot (QD) solar cells. From the temperature dependence of the current-voltage curves, we show that the V oc in InP QD solar cells increases with decreasing temperature. We use a simple diode model to extract V oc at the zero-temperature limit, V 0, and the temperature coefficient C of the solar cells. Our results show that, while the C of InP QD solar cells is slightly larger than that of the reference InGaP solar cells, V 0 significantly decreases and coincides with the bandgap energy of the InP QDs rather than that of the InGaP host. This V 0 indicates that the V oc reduction in the InP QD solar cells is primarily caused by the breaking of the Fermi energy separation between the QDs and the host semiconductor in intermediate-band solar cells, rather than by enhanced carrier recombination.

  10. Planar Perovskite Solar Cells with High Open-Circuit Voltage Containing a Supramolecular Iron Complex as Hole Transport Material Dopant.

    Science.gov (United States)

    Saygili, Yasemin; Turren-Cruz, Silver-Hamill; Olthof, Selina; Saes, Bartholomeus Wilhelmus Henricus; Pehlivan, Ilknur Bayrak; Saliba, Michael; Meerholz, Klaus; Edvinsson, Tomas; Zakeeruddin, Shaik M; Grätzel, Michael; Correa-Baena, Juan-Pablo; Hagfeldt, Anders; Freitag, Marina; Tress, Wolfgang

    2018-04-26

    In perovskite solar cells (PSCs), the most commonly used hole transport material (HTM) is spiro-OMeTAD, which is typically doped by metalorganic complexes, for example, based on Co, to improve charge transport properties and thereby enhance the photovoltaic performance of the device. In this study, we report a new hemicage-structured iron complex, 1,3,5-tris(5'-methyl-2,2'-bipyridin-5-yl)ethylbenzene Fe(III)-tris(bis(trifluoromethylsulfonyl)imide), as a p-type dopant for spiro-OMeTAD. The formal redox potential of this compound was measured as 1.29 V vs. the standard hydrogen electrode, which is slightly (20 mV) more positive than that of the commercial cobalt dopant FK209. Photoelectron spectroscopy measurements confirm that the iron complex acts as an efficient p-dopant, as evidenced in an increase of the spiro-OMeTAD work function. When fabricating planar PSCs with the HTM spiro-OMeTAD doped by 5 mol % of the iron complex, a power conversion efficiency of 19.5 % (AM 1.5G, 100 mW cm -2 ) is achieved, compared to 19.3 % for reference devices with FK209. Open circuit voltages exceeding 1.2 V at 1 sun and reaching 1.27 V at 3 suns indicate that recombination at the perovskite/HTM interface is low when employing this iron complex. This work contributes to recent endeavors to reduce recombination losses in perovskite solar cells. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Building mechanism for a high open-circuit voltage in an all-solution-processed tandem polymer solar cell.

    Science.gov (United States)

    Kong, Jaemin; Lee, Jongjin; Kim, Geunjin; Kang, Hongkyu; Choi, Youna; Lee, Kwanghee

    2012-08-14

    Additional post-processing techniques, such as post-thermal annealing and UV illumination, were found to be required to obtain desirable values of the cell parameters in a tandem polymer solar cell incorporated with solution-processed basic n-type titanium sub-oxide (TiO(x))/acidic p-type poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) (PEDOT:PSS) interlayers. Subsequent to the fabrication of the tandem polymer solar cells, the open-circuit voltage (V(OC)) of the cells exhibited half of the expected value. Only after the application of the post-treatments, the V(OC) of a tandem cell increased from the initial half-cell value (∼0.6 V) to its full-cell value (∼1.2 V). The selective light-biased incident photon-to-current efficiency (IPCE) measurements indicated that the initial V(OC) originated from the back subcell and that the application of the post-processing treatments revived the front subcell, such that the net photocurrent of the tandem cell was finally governed by a recombination process of holes from the back subcell and electrons from the front subcell. Based on our experimental results, we suggest that a V(OC) enhancement could be ascribed to two types of subsequent junction formations at the interface between the TiO(x) and PEDOT:PSS interlayers: an 'ion-mediated dipole junction', resulting from the electro-kinetic migration of cationic ions in the interlayers during post-thermal annealing in the presence of a low-work-function metal cathode, and a 'photoinduced Schottky junction', formed by increasing the charge carrier density in the n-type TiO(x) interlayer during UV illumination process. The two junctions separately contributed to the formation of a recombination junction through which the electrons in TiO(x) and the holes in PEDOT:PSS were able to recombine without substantial voltage drops.

  12. Controlled Conjugated Backbone Twisting for an Increased Open-Circuit Voltage while Having a High Short-Circuit Current in Poly(hexylthiophene) Derivatives

    KAUST Repository

    Ko, Sangwon

    2012-03-21

    Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone-due to an increase in the polymer ionization potential-while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2′:5′,2′′- terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C 71-butyric acid methyl ester (PC 71BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current. © 2012 American

  13. Controlled conjugated backbone twisting for an increased open-circuit voltage while having a high short-circuit current in poly(hexylthiophene) derivatives.

    Science.gov (United States)

    Ko, Sangwon; Hoke, Eric T; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D; Brédas, Jean-Luc; Salleo, Alberto; Bao, Zhenan

    2012-03-21

    Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone--due to an increase in the polymer ionization potential--while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2':5',2''-terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C(71)-butyric acid methyl ester (PC(71)BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current.

  14. Leakage Current Induced by Energetic Disorder in Organic Bulk Heterojunction Solar Cells: Comprehending the Ultrahigh Loss of Open-Circuit Voltage at Low Temperatures

    Science.gov (United States)

    Yang, Wenchao; Luo, Yongsong; Guo, Pengfei; Sun, Haibin; Yao, Yao

    2017-04-01

    The open-circuit voltage (Voc ) of organic solar cells generally approaches its maximum obtainable values as the temperature decreases. However, recent experiments have revealed that the Voc may suffer from an ultrahigh loss at low temperatures. In order to verify this explanation and investigate the impacts of energetic disorder on the temperature-dependent behaviors of the Voc in general, we calculate the Voc-T plots with the drift-diffusion method under various device working parameters. With the disorder being incorporated into the device model by considering the disorder-suppressed (temperature-dependent) charge-carrier mobilities, it is found that the ultrahigh Voc losses cannot be reproduced under the Onsager-Braun-type charge generation rate. With the charge generation rate being constant or weakly dependent on temperature, for nonselective contacts, the Voc reduces drastically at low temperatures, while for selective contacts, the Voc increases monotonically with decreasing temperature. With higher carrier mobilities or smaller device thicknesses, the ultrahigh loss occurs at lower temperatures. The mechanism is that, since the disorder-suppressed charge mobilities give rise to both low charge-extraction efficiency and small bimolecular recombination rate, plenty of charge carriers can be extracted from the wrong electrode and can form a large leakage current, which counteracts the majority-carrier current and reduces the Voc at low temperatures. Our results thus highlight the essential role of charge-carrier kinetics, except for the charge-filling effect, on dominating the disorder-induced Voc losses.

  15. Enhancing the open-circuit voltage of dye-sensitized solar cells: coadsorbents and alternative redox couples[Dissertation 4066

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Z.

    2008-04-15

    In February 2008, the oil price easily exceeded US dollar 100 per barrel due to the weak US dollar and the imbalance between the increasing demands and deficient supplies. People are paying more and more attention to seek for alternative energy sources that would suffice the modern society in the following high-oil-price era. The work in this thesis is associated with some fundamental research in one of the solutions to the energy shortage, photovoltaics. Particularly, the dye-sensitized solar cell was taken as the system where the effects of coadsorbents and alternative couples to the classic iodide/iodine redox were studied and rationalized. The first chapter was a general introduction to the photovoltaics and dye-sensitized solar cells, such as the operating principles and the characteristics of the dye cell. In Chapter 2, we specified all the experimental issues, including the chemicals, materials, film preparation, characterization techniques and data analysis. A short part was also dedicated to the basics of the photovoltaics. We studied the electronic effect of the scattering particles in our devices in Chapter 3. These particles were of 400 nm in diameter and always put on top of the nanotransparent layer to increase the light harvesting of the devices. It was found that the particles gave a small dark current but under illumination, they made a significant contribution to the total photocurrent. Photovoltage and photocurrent transient decay measurements performed under bias illumination showed that the density of electronic states of the light scattering layer was two times smaller than that of a transparent nanoparticle layer. From Chapter 4 to Chapter 7, we systematically studied the function of the coadsorbents. Application of an {omega}-guannidino carboxylic acid was found to increase the open-circuit voltage of the device by 50 mV. Coadsorbents with similar structures were then employed with an amphiphilic ruthenium sensitizer, Z-907, to scrutinize

  16. Improved open-circuit voltage in Cu(In,Ga)Se{sub 2} solar cells with high work function transparent electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Jäger, Timo, E-mail: timo.jaeger@empa.ch; Romanyuk, Yaroslav E.; Bissig, Benjamin; Pianezzi, Fabian; Nishiwaki, Shiro; Reinhard, Patrick; Steinhauser, Jérôme; Tiwari, Ayodhya N. [Empa—Swiss Federal Laboratories for Materials Science and Technology, Laboratory for Thin Films and Photovoltaics, Überlandstrasse 129, 8600 Dübendorf (Switzerland); Schwenk, Johannes [Empa—Swiss Federal Laboratories for Materials Science and Technology, Laboratory for Nanoscale Materials Science, Überlandstrasse 129, 8600 Dübendorf (Switzerland)

    2015-06-14

    Hydrogenated indium oxide (IOH) is implemented as transparent front contact in Cu(In,Ga)Se{sub 2} (CIGS) solar cells, leading to an open circuit voltage V{sub OC} enhanced by ∼20 mV as compared to reference devices with ZnO:Al (AZO) electrodes. This effect is reproducible in a wide range of contact sheet resistances corresponding to various IOH thicknesses. We present the detailed electrical characterization of glass/Mo/CIGS/CdS/intrinsic ZnO (i-ZnO)/transparent conductive oxide (TCO) with different IOH/AZO ratios in the front TCO contact in order to identify possible reasons for the enhanced V{sub OC}. Temperature and illumination intensity-dependent current-voltage measurements indicate that the dominant recombination path does not change when AZO is replaced by IOH, and it is mainly limited to recombination in the space charge region and at the junction interface of the solar cell. The main finding is that the introduction of even a 5 nm-thin IOH layer at the i-ZnO/TCO interface already results in a step-like increase in V{sub OC}. Two possible explanations are proposed and verified by one-dimensional simulations using the SCAPS software. First, a higher work function of IOH as compared to AZO is simulated to yield an V{sub OC} increase by 21 mV. Second, a lower defect density in the i-ZnO layer as a result of the reduced sputter damage during milder sputter-deposition of IOH can also add to a maximum enhanced V{sub OC} of 25 mV. Our results demonstrate that the proper choice of the front TCO contact can reduce the parasitic recombination and boost the efficiency of CIGS cells with improved corrosion stability.

  17. Probing the Energy Level Alignment and the Correlation with Open-Circuit Voltage in Solution-Processed Polymeric Bulk Heterojunction Photovoltaic Devices.

    Science.gov (United States)

    Yang, Qing-Dan; Li, Ho-Wa; Cheng, Yuanhang; Guan, Zhiqiang; Liu, Taili; Ng, Tsz-Wai; Lee, Chun-Sing; Tsang, Sai-Wing

    2016-03-23

    Energy level alignment at the organic donor and acceptor interface is a key to determine the photovoltaic performance in organic solar cells, but direct probing of such energy alignment is still challenging especially for solution-processed bulk heterojunction (BHJ) thin films. Here we report a systematic investigation on probing the energy level alignment with different approaches in five commonly used polymer:[6,6]-phenyl-C71-butyric acid methyl ester (PCBM) BHJ systems. We find that by tuning the weight ratio of polymer to PCBM the electronic features from both polymer and PCBM can be obtained by photoemission spectroscopy. Using this approach, we find that some of the BHJ blends simply follow vacuum level alignment, but others show strong energy level shifting as a result of Fermi level pinning. Independently, by measuring the temperature-dependent open-circuit voltage (VOC), we find that the effective energy gap (Eeff), the energy difference between the highest occupied molecular orbital of the polymer donor (EHOMO-D) and lowest unoccupied molecular orbital of the PCBM acceptor (ELUMO-A), obtained by photoemission spectroscopy in all polymer:PCBM blends has an excellent agreement with the extrapolated VOC at 0 K. Consequently, the photovoltage loss of various organic BHJ photovoltaic devices at room temperature is in a range of 0.3-0.6 V. It is believed that the demonstrated direct measurement approach of the energy level alignment in solution-processed organic BHJ will bring deeper insight into the origin of the VOC and the corresponding photovoltage loss mechanism in organic photovoltaic cells.

  18. High performance of PbSe/PbS core/shell quantum dot heterojunction solar cells: short circuit current enhancement without the loss of open circuit voltage by shell thickness control.

    Science.gov (United States)

    Choi, Hyekyoung; Song, Jung Hoon; Jang, Jihoon; Mai, Xuan Dung; Kim, Sungwoo; Jeong, Sohee

    2015-11-07

    We fabricated heterojunction solar cells with PbSe/PbS core shell quantum dots and studied the precisely controlled PbS shell thickness dependency in terms of optical properties, electronic structure, and solar cell performances. When the PbS shell thickness increases, the short circuit current density (JSC) increases from 6.4 to 11.8 mA cm(-2) and the fill factor (FF) enhances from 30 to 49% while the open circuit voltage (VOC) remains unchanged at 0.46 V even with the decreased effective band gap. We found that the Fermi level and the valence band maximum level remain unchanged in both the PbSe core and PbSe/PbS core/shell with a less than 1 nm thick PbS shell as probed via ultraviolet photoelectron spectroscopy (UPS). The PbS shell reduces their surface trap density as confirmed by relative quantum yield measurements. Consequently, PbS shell formation on the PbSe core mitigates the trade-off relationship between the open circuit voltage and the short circuit current density. Finally, under the optimized conditions, the PbSe core with a 0.9 nm thick shell yielded a power conversion efficiency of 6.5% under AM 1.5.

  19. An open circuit voltage equation enabling separation of cathode and anode polarization resistances of ceria electrolyte based solid oxide fuel cells

    Science.gov (United States)

    Zhang, Yanxiang; Chen, Yu; Yan, Mufu

    2017-07-01

    The open circuit voltage (OCV) of solid oxide fuel cells is generally overestimated by the Nernst equation and the Wagner equation, due to the polarization losses at electrodes. Considering both the electronic conduction of electrolyte and the electrode polarization losses, we express the OCV as an implicit function of the characteristic oxygen pressure of electrolyte (p* [atm], at which the electronic and ionic conductivities are the same), and the relative polarization resistance of electrodes (rc = Rc/Ri and ra = Ra/Ri, where Ri/c/a [Ωcm2] denotes the ionic resistance of electrolyte, and the polarization resistances of cathode and anode, respectively). This equation approaches to the Wagner equation when the electrodes are highly active (rc and ra → 0), and approaches to the Nernst equation when the electrolyte is a purely ionic conductor (p* → 0). For the fuel cells whose OCV is well below the prediction of the Wagner equation, for example with thin doped ceria electrolyte, it is demonstrated that the combination of OCV and impedance spectroscopy measurements allows the determination of p*, Rc and Ra. This equation can serve as a simple yet powerful tool to study the internal losses in the cell under open circuit condition.

  20. Effect of dislocations on the open-circuit voltage, short-circuit current and efficiency of heteroepitaxial indium phosphide solar cells

    Science.gov (United States)

    Jain, Raj K.; Flood, Dennis J.

    1990-01-01

    Excellent radiation resistance of indium phosphide solar cells makes them a promising candidate for space power applications, but the present high cost of starting substrates may inhibit their large scale use. Thin film indium phosphide cells grown on Si or GaAs substrates have exhibited low efficiencies, because of the generation and propagation of large number of dislocations. Dislocation densities were calculated and its influence on the open circuit voltage, short circuit current, and efficiency of heteroepitaxial indium phosphide cells was studied using the PC-1D. Dislocations act as predominant recombination centers and are required to be controlled by proper transition layers and improved growth techniques. It is shown that heteroepitaxial grown cells could achieve efficiencies in excess of 18 percent AMO by controlling the number of dislocations. The effect of emitter thickness and surface recombination velocity on the cell performance parameters vs. dislocation density is also studied.

  1. Detection Method for Soft Internal Short Circuit in Lithium-Ion Battery Pack by Extracting Open Circuit Voltage of Faulted Cell

    Directory of Open Access Journals (Sweden)

    Minhwan Seo

    2018-06-01

    Full Text Available Early detection of internal short circuit which is main cause of thermal runaway in a lithium-ion battery is necessary to ensure battery safety for users. As a promising fault index, internal short circuit resistance can directly represent degree of the fault because it describes self-discharge phenomenon caused by the internal short circuit clearly. However, when voltages of individual cells in a lithium-ion battery pack are not provided, the effect of internal short circuit in the battery pack is not readily observed in whole terminal voltage of the pack, leading to difficulty in estimating accurate internal short circuit resistance. In this paper, estimating the resistance with the whole terminal voltages and the load currents of the pack, a detection method for the soft internal short circuit in the pack is proposed. Open circuit voltage of a faulted cell in the pack is extracted to reflect the self-discharge phenomenon obviously; this process yields accurate estimates of the resistance. The proposed method is verified with various soft short conditions in both simulations and experiments. The error of estimated resistance does not exceed 31.2% in the experiment, thereby enabling the battery management system to detect the internal short circuit early.

  2. Improve the open-circuit voltage of ZnO solar cells with inserting ZnS layers by two ways

    International Nuclear Information System (INIS)

    Sun, Yunfei; Yang, Jinghai; Yang, Lili; Cao, Jian; Gao, Ming; Zhang, Zhiqiang; Wang, Zhe; Song, Hang

    2013-01-01

    ZnS NPs layers were deposited on ZnO NRs by two different ways. One is spin coating; the other is successive ionic layer adsorption and reaction (SILAR) method. The ZnO NRs/ZnS NPs composites were verified by X-ray diffraction, X-ray photoelectron spectroscopy, and UV–visible spectrophotometer; their morphologies and thicknesses were examined by scanning electron microscopic and transmission electron microscopic images. The CdS quantum dot sensitized solar cells (QDSSCs) were constructed using ZnO NRs/ZnS NPs composites as photoanode and their photovoltaic characteristic was studied by J–V curves. The results indicated that the way of SILAR is more beneficial for retarding the back transfer of electrons to CdS and electrolyte than spin coating method. The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method. When ZnS NPs layer was deposited for 10 times on ZnO NRs, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. - Graphical abstract: When ZnO nanorods were deposited by ZnS for 10 times, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. Highlights: ► ZnS layers were deposited with two different ways. ► The way of SILAR is more beneficial for retarding the back transfer of electrons. ► The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method

  3. Improve the open-circuit voltage of ZnO solar cells with inserting ZnS layers by two ways

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Yunfei [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100049 (China); Yang, Jinghai, E-mail: jhyang1@jlnu.edu.cn [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Yang, Lili; Cao, Jian [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Gao, Ming [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China); Graduate School of the Chinese Academy of Sciences, Beijing 100049 (China); Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Zhang, Zhiqiang; Wang, Zhe [Institute of Condensed State Physics, Jilin Normal University, Siping 136000 (China); Song, Hang [State Key Laboratory of Luminescence and Applications, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, Changchun 130033 (China)

    2013-04-15

    ZnS NPs layers were deposited on ZnO NRs by two different ways. One is spin coating; the other is successive ionic layer adsorption and reaction (SILAR) method. The ZnO NRs/ZnS NPs composites were verified by X-ray diffraction, X-ray photoelectron spectroscopy, and UV–visible spectrophotometer; their morphologies and thicknesses were examined by scanning electron microscopic and transmission electron microscopic images. The CdS quantum dot sensitized solar cells (QDSSCs) were constructed using ZnO NRs/ZnS NPs composites as photoanode and their photovoltaic characteristic was studied by J–V curves. The results indicated that the way of SILAR is more beneficial for retarding the back transfer of electrons to CdS and electrolyte than spin coating method. The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method. When ZnS NPs layer was deposited for 10 times on ZnO NRs, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. - Graphical abstract: When ZnO nanorods were deposited by ZnS for 10 times, the conversion efficiency of QDSSC shows ∼3.3 folds increments of as-synthesized ZnO solar cell. Highlights: ► ZnS layers were deposited with two different ways. ► The way of SILAR is more beneficial for retarding the back transfer of electrons. ► The open-circuit voltage increased to 0.59 V by introducing a ZnS layer through SILAR method.

  4. Measurement of the open-circuit voltage of individual subcells in a dual-junction solar cell

    Czech Academy of Sciences Publication Activity Database

    Holovský, Jakub; Bonnet-Eymard, M.; Bugnon, G.; Cuony, P.; Despeisse, M.; Ballif, C.

    2012-01-01

    Roč. 2, č. 2 (2012), s. 164-168 ISSN 2156-3381 R&D Projects: GA MŠk(CZ) 7E09057 EU Projects: European Commission(XE) 214134 - N2P Institutional research plan: CEZ:AV0Z10100521 Keywords : current-voltage characteristics * photovoltaic cells * solar energy Subject RIV: BM - Solid Matter Physics ; Magnetism

  5. Measurement of the open circuit voltage of individual sub-cells in a dual-junction solar cell

    Czech Academy of Sciences Publication Activity Database

    Holovský, Jakub; Bonnet-Eymard, M.; Bugnon, G.; Cuony, P.; Despeisse, M.; Ballif, C.

    2012-01-01

    Roč. 2, č. 2 (2012), s. 164-168 ISSN 2156-3381 R&D Projects: GA MŠk(CZ) 7E09057 EU Projects: European Commission(XE) 214134 - N2P Institutional research plan: CEZ:AV0Z10100521 Keywords : current-voltage characteristics * photovoltaic cells * solar energy Subject RIV: BM - Solid Matter Physics ; Magnetism http://ieeexplore.ieee.org/lpdocs/epic03/wrapper.htm?arnumber=6150992

  6. Relationship between open-circuit voltage in Cu(In,Ga)Se{sub 2} solar cell and peak position of (220/204) preferred orientation near its absorber surface

    Energy Technology Data Exchange (ETDEWEB)

    Chantana, J., E-mail: jakapan@fc.ritsumei.ac.jp; Minemoto, T. [Department of Electrical and Electronic Engineering, Ritsumeikan University, 1-1-1 Nojihigashi, Kusatsu, Shiga 525-8577 (Japan); Watanabe, T.; Teraji, S.; Kawamura, K. [Environment and Energy Research Center, Nitto Denko Corporation, 2-8 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2013-11-25

    Cu(In,Ga)Se{sub 2} (CIGS) absorbers with various Ga/III, Ga/(In+Ga), profiles are prepared by the so-called “multi-layer precursor method” using multi-layer co-evaporation of material sources. It is revealed that open-circuit voltage (V{sub OC}) of CIGS solar cell is primarily dependent on averaged Ga/III near the surface of its absorber. This averaged Ga/III is well predicted by peak position of (220/204) preferred orientation of CIGS film near its surface investigated by glancing-incidence X-ray diffraction with 0.1° incident angle. Finally, the peak position of (220/204) preferred orientation is proposed as a measure of V{sub OC} before solar cell fabrication.

  7. An Experimental Determination of the Quasi-Rest Potential of Copper Indium Disulfide Utilizing the Novel Open-Circuit Voltage Transient

    Science.gov (United States)

    Newell, Michael Jason

    Environmental sustainability requires resource management that takes future generations into account. The present generation has witnessed changes across the planet, unprecedented in human history and disrupting communities and cities around the world, due to shifting global climate. This is primarily the result of fossil fuels, which powered modern civilization but dramatically increased levels of CO2 and other greenhouse gases, and may be the least sustainable aspect of human civilization. Chapter 1 justifies the research from an environmental perspective and provides initial research parameters. Thin film photovoltaic (PV) modules are reported the most sustainable among energy production technologies currently available. Electrodeposited PV layers offer significant improvement to sustainability metrics over current thin film production methods, at reduced cost, but have rarely been demonstrated on an industrial scale. Quasi-rest potential (QRP) ultimately led to large-scale, electrodeposited thin film CdTe modules. An in-situ material characterization technique that allows adjustment of the deposition voltage (Vdep) to match the exact experimental conditions, QRP enabled precise control of deposit stoichiometry and crystallinity. Chapter 2 discusses theory and literature regarding QRP, and introduces the open-circuit voltage transient (Voc T), developed by the present research for analyzing QRP as a function of both Vdep and time. VocT data from a CdTe ethylene glycol bath matches details and speculations from the literature. Although predicted to have wide applicability, experimental QRP data have never been published for compounds unrelated to CdTe. Chapter 3 discusses VocTs performed in pursuit of electrodeposited CuInS2, demonstrating functionality as a QRP scan in a variety of ethylene glycol solutions. Stoichiometries of deposited films were improved by using the V ocT to determine appropriate plating voltages. VocTs enabled QRP, in-situ rest potential (EM

  8. Offset energies at organic semiconductor heterojunctions and their influence on the open-circuit voltage of thin-film solar cells

    Science.gov (United States)

    Rand, Barry P.; Burk, Diana P.; Forrest, Stephen R.

    2007-03-01

    Organic semiconductor heterojunction (HJ) energy level offsets are modeled using a combination of Marcus theory for electron transfer, and generalized Shockley theory of the dark current density vs voltage (J-V) characteristics. This model is used to fit the J-V characteristics of several donor-acceptor combinations commonly used in thin film organic photovoltaic cells. In combination with measurements of the energetics of donor-acceptor junctions, the model predicts tradeoffs between the junction open-circuit voltage (VOC) and short-circuit current density (JSC) . The VOC is found to increase with light intensity and inversely with temperature for 14 donor-acceptor HJ materials pairs. In particular, we find that VOC reaches a maximum at low temperature (˜175K) for many of the heterojunctions studied. The maximum value of VOC is a function of the difference between the donor ionization potential and acceptor electron affinity, minus the binding energy of the dissociated, geminate electron-hole pair: a general relationship that has implications on the charge transfer mechanism at organic heterojunctions. The fundamental understanding provided by this model leads us to infer that the maximum power conversion efficiency of double heterostructure organic photovoltaic cells can be as high as 12%. When combined with mixed layers to increase photocurrent and stacked cells to increase VOC , efficiencies approaching 16% are within reach.

  9. Electron-deficient N-alkyloyl derivatives of thieno[3,4-c]pyrrole-4,6-dione yield efficient polymer solar cells with open-circuit voltages > 1 v

    KAUST Repository

    Warnan, Julien; Cabanetos, Clement; Bude, Romain; El Labban, Abdulrahman; LI, LIANG; Beaujuge, Pierre

    2014-01-01

    Poly(benzo[1,2-b:4,5-b′]dithiophene-thieno[3,4-c]pyrrole-4,6-dione) (PBDTTPD) polymer donors yield some of the highest open-circuit voltages (V OC, ca. 0.9 V) and fill factors (FF, ca. 70%) in conventional bulk-heterojunction (BHJ) solar cells

  10. Online model-based estimation of state-of-charge and open-circuit voltage of lithium-ion batteries in electric vehicles

    International Nuclear Information System (INIS)

    He, Hongwen; Zhang, Xiaowei; Xiong, Rui; Xu, Yongli; Guo, Hongqiang

    2012-01-01

    This paper presents a method to estimate the state-of-charge (SOC) of a lithium-ion battery, based on an online identification of its open-circuit voltage (OCV), according to the battery’s intrinsic relationship between the SOC and the OCV for application in electric vehicles. Firstly an equivalent circuit model with n RC networks is employed modeling the polarization characteristic and the dynamic behavior of the lithium-ion battery, the corresponding equations are built to describe its electric behavior and a recursive function is deduced for the online identification of the OCV, which is implemented by a recursive least squares (RLS) algorithm with an optimal forgetting factor. The models with different RC networks are evaluated based on the terminal voltage comparisons between the model-based simulation and the experiment. Then the OCV-SOC lookup table is built based on the experimental data performed by a linear interpolation of the battery voltages at the same SOC during two consecutive discharge and charge cycles. Finally a verifying experiment is carried out based on nine Urban Dynamometer Driving Schedules. It indicates that the proposed method can ensure an acceptable accuracy of SOC estimation for online application with a maximum error being less than 5.0%. -- Highlights: ► An equivalent circuit model with n RC networks is built for lithium-ion batteries. ► A recursive function is deduced for the online estimation of the model parameters like OCV and R O . ► The relationship between SOC and OCV is built with a linear interpolation method by experiments. ► The experiments show the online model-based SOC estimation is reasonable with enough accuracy.

  11. Open-Circuit Voltage in Organic Solar Cells: The Impacts of Donor Semicrystallinity and Coexistence of Multiple Interfacial Charge-Transfer Bands

    KAUST Repository

    Ngongang Ndjawa, Guy Olivier; Graham, Kenneth; Mollinger, Sonya; Wu, Di M.; Hanifi, David; Prasanna, Rohit; Rose, Bradley Daniel; Dey, Sukumar; Yu, Liyang; Bredas, Jean-Luc; McGehee, Michael D.; Salleo, Alberto; Amassian, Aram

    2017-01-01

    In organic solar cells (OSCs), the energy of the charge-transfer (CT) complexes at the donor-acceptor interface, E , determines the maximum open-circuit voltage (V ). The coexistence of phases with different degrees of order in the donor or the acceptor, as in blends of semi-crystalline donors and fullerenes in bulk heterojunction layers, influences the distribution of CT states and the V enormously. Yet, the question of how structural heterogeneities alter CT states and the V is seldom addressed systematically. In this work, we combine experimental measurements of vacuum-deposited rubrene/C bilayer OSCs, with varying microstructure and texture, with density functional theory calculations to determine how relative molecular orientations and extents of structural order influence E and V . We find that varying the microstructure of rubrene gives rise to CT bands with varying energies. The CT band that originates from crystalline rubrene lies up to ≈0.4 eV lower in energy compared to the one that arises from amorphous rubrene. These low-lying CT states contribute strongly to V losses and result mainly from hole delocalization in aggregated rubrene. This work points to the importance of realizing interfacial structural control that prevents the formation of low E configurations and maximizes V .

  12. Fine Tuning of Open-Circuit Voltage by Chlorination in Thieno[3,4- b ]thiophene–Benzodithiophene Terpolymers toward Enhanced Solar Energy Conversion

    Energy Technology Data Exchange (ETDEWEB)

    Qu, Shiwei; Wang, Huan; Mo, Daize; Chao, Pengjie; Yang, Zhen; Li, Longji; Tian, Leilei; Chen, Wei [Materials; Institute; He, Feng

    2017-06-22

    A new family of thieno[3,4-b]thiophene benzodithiophene terpolymers (PBTClx) have been designed and synthesized, in which the chlorine/fluorine content has been adjusted and optimized. As the content of chlorine is increased in polymers, the twist angle between the donor and acceptor is increased, which leads to a diminishment in the planarity and conjugation. As a result, the UV vis absorption is continuous blue-shifted, and the band gap increases from 1.57 to 2.04 eV when the chlorinated moieties increased from 0 to 100%. The highest occupied molecular orbital (HOMO) levels of those polymers are decreased by increasing the content of chlorinated moiety, which opens a window to constantly modify the V-oc values and eventually meets a balance point for optimized solar energy conversion. The highest power conversion efficiency of 8.31% is obtained by using PBTCl25 as the donor and PC71BM as the acceptor in polymer solar cells (PSCs), in which the Voc increased from 0.79 to 0.82 V after 25% chlorinated monomer involved in copolymerization. Herein, the chlorine replacement could be a good method to further pump the solar conversion by increasing the open circuit voltage without reducing other factors of the polymer solar cells.

  13. Simultaneous Increase in Open-Circuit Voltage and Efficiency of Fullerene-Free Solar Cells through Chlorinated Thieno[3,4- b ]thiophene Polymer Donor

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Huan [Department; Chao, Pengjie [Department; Chen, Hui [Department; Mu, Zhao [Department; Chen, Wei [Materials; Institute; He, Feng [Department

    2017-08-09

    The chlorinated polymer, PBTCl, has been found to be an efficient donor in nonfullerene polymer solar cells (PSCs), which showed a blue-shifted absorbance compared to that of its fluorine analogue (PTB7-th) and resulted in more complementary light absorption with a nonfullerene acceptor, such as ITIC. Meanwhile, chlorine substitution lowered the HOMO level of PBTCl, which increased the open-circuit voltage of the corresponding polymer-based devices. The 2D GIWAXS analysis illustrated that the PBTCl/ITIC blend film exhibited a “face-on” orientation and scattering features of both PBTCl and ITIC, suggesting that the blend of PBTCl and ITIC was phase-separated and formed individual crystalline domains of the donor and acceptor, which promoted charge transfer in the bicontinuous film and eventually elevated the solar energy conversion efficiency. The PBTCl-based nonfullerene PSC exhibited a maximum PCE of 7.57% with a Voc of 0.91 V, which was an approximately 13% increasing in the PCE compared to that of the fluorine-analogue-based device.

  14. Finding the lost open-circuit voltage in polymer solar cells by UV-ozone treatment of the nickel acetate anode buffer layer.

    Science.gov (United States)

    Wang, Fuzhi; Sun, Gang; Li, Cong; Liu, Jiyan; Hu, Siqian; Zheng, Hua; Tan, Zhan'ao; Li, Yongfang

    2014-06-25

    Efficient polymer solar cells (PSCs) with enhanced open-circuit voltage (Voc) are fabricated by introducing solution-processed and UV-ozone (UVO)-treated nickel acetate (O-NiAc) as an anode buffer layer. According to X-ray photoelectron spectroscopy data, NiAc partially decomposed to NiOOH during the UVO treatment. NiOOH is a dipole species, which leads to an increase in the work function (as confirmed by ultraviolet photoemission spectroscopy), thus benefitting the formation of ohmic contact between the anode and photoactive layer and leading to increased Voc. In addition, the UVO treatment improves the wettability between the substrate and solvent of the active layer, which facilitates the formation of an upper photoactive layer with better morphology. Further, the O-NiAc layer can decrease the series resistance (Rs) and increase the parallel resistance (Rp) of the devices, inducing enhanced Voc in comparison with the as-prepared NiAc-buffered control devices without UVO treatment. For PSCs based on the P3HT:PCBM system, Voc increases from 0.50 to 0.60 V after the NiAc buffer layer undergoes UVO treatment. Similarly, in the P3HT:ICBA system, the Voc value of the device with a UVO-treated NiAc buffer layer increases from 0.78 to 0.88 V, showing an enhanced power conversion efficiency of 6.64%.

  15. Open-Circuit Voltage in Organic Solar Cells: The Impacts of Donor Semicrystallinity and Coexistence of Multiple Interfacial Charge-Transfer Bands

    KAUST Repository

    Ngongang Ndjawa, Guy Olivier

    2017-01-16

    In organic solar cells (OSCs), the energy of the charge-transfer (CT) complexes at the donor-acceptor interface, E , determines the maximum open-circuit voltage (V ). The coexistence of phases with different degrees of order in the donor or the acceptor, as in blends of semi-crystalline donors and fullerenes in bulk heterojunction layers, influences the distribution of CT states and the V enormously. Yet, the question of how structural heterogeneities alter CT states and the V is seldom addressed systematically. In this work, we combine experimental measurements of vacuum-deposited rubrene/C bilayer OSCs, with varying microstructure and texture, with density functional theory calculations to determine how relative molecular orientations and extents of structural order influence E and V . We find that varying the microstructure of rubrene gives rise to CT bands with varying energies. The CT band that originates from crystalline rubrene lies up to ≈0.4 eV lower in energy compared to the one that arises from amorphous rubrene. These low-lying CT states contribute strongly to V losses and result mainly from hole delocalization in aggregated rubrene. This work points to the importance of realizing interfacial structural control that prevents the formation of low E configurations and maximizes V .

  16. Online Estimation of Model Parameters and State of Charge of LiFePO4 Batteries Using a Novel Open-Circuit Voltage at Various Ambient Temperatures

    Directory of Open Access Journals (Sweden)

    Fei Feng

    2015-04-01

    Full Text Available This study describes an online estimation of the model parameters and state of charge (SOC of lithium iron phosphate batteries in electric vehicles. A widely used SOC estimator is based on the dynamic battery model with predeterminate parameters. However, model parameter variances that follow with their varied operation temperatures can result in errors in estimating battery SOC. To address this problem, a battery online parameter estimator is presented based on an equivalent circuit model using an adaptive joint extended Kalman filter algorithm. Simulations based on actual data are established to verify accuracy and stability in the regression of model parameters. Experiments are also performed to prove that the proposed estimator exhibits good reliability and adaptability under different loading profiles with various temperatures. In addition, open-circuit voltage (OCV is used to estimate SOC in the proposed algorithm. However, the OCV based on the proposed online identification includes a part of concentration polarization and hysteresis, which is defined as parametric identification-based OCV (OCVPI. Considering the temperature factor, a novel OCV–SOC relationship map is established by using OCVPI under various temperatures. Finally, a validating experiment is conducted based on the consecutive loading profiles. Results indicate that our method is effective and adaptable when a battery operates at different ambient temperatures.

  17. An Open-Circuit Voltage and Power Conversion Efficiency Study of Fullerene Ternary Organic Solar Cells Based on Oligomer/Oligomer and Oligomer/Polymer.

    Science.gov (United States)

    Zhang, Guichuan; Zhou, Cheng; Sun, Chen; Jia, Xiaoe; Xu, Baomin; Ying, Lei; Huang, Fei; Cao, Yong

    2017-07-01

    Variations in the open-circuit voltage (V oc ) of ternary organic solar cells are systematically investigated. The initial study of these devices consists of two electron-donating oligomers, S2 (two units) and S7 (seven units), and the electron-accepting [6,6]-phenyl C71 butyric acid methyl ester (PC 71 BM) and reveals that the V oc is continuously tunable due to the changing energy of the charge transfer state (E ct ) of the active layers. Further investigation suggests that V oc is also continuously tunable upon change in E ct in a ternary blend system that consists of S2 and its corresponding polymer (P11):PC 71 BM. It is interesting to note that higher power conversion efficiencies can be obtained for both S2:S7:PC 71 BM and S2:P11:PC 71 BM ternary systems compared with their binary systems, which can be ascribed to an improved V oc due to the higher E ct and an improved fill factor due to the improved film morphology upon the incorporation of S2. These findings provide a new guideline for the future design of conjugated polymers for achieving higher performance of ternary organic solar cells. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Thieno[3,4-c]Pyrrole-4,6-Dione-Based Polymer Acceptors for High Open-Circuit Voltage All-Polymer Solar Cells

    KAUST Repository

    Liu, Shengjian

    2017-04-20

    While polymer acceptors are promising fullerene alternatives in the fabrication of efficient bulk heterojunction (BHJ) solar cells, the range of efficient material systems relevant to the “all-polymer” BHJ concept remains narrow, and currently limits the perspectives to meet the 10% efficiency threshold in all-polymer solar cells. This report examines two polymer acceptor analogs composed of thieno[3,4-c]pyrrole-4,6-dione (TPD) and 3,4-difluorothiophene ([2F]T) motifs, and their BHJ solar cell performance pattern with a low-bandgap polymer donor commonly used with fullerenes (PBDT-TS1; taken as a model system). In this material set, the introduction of a third electron-deficient motif, namely 2,1,3-benzothiadiazole (BT), is shown to (i) significantly narrow the optical gap (Eopt) of the corresponding polymer (by ≈0.2 eV) and (ii) improve the electron mobility of the polymer by over two orders of magnitude in BHJ solar cells. In turn, the narrow-gap P2TPDBT[2F]T analog (Eopt = 1.7 eV) used as fullerene alternative yields high open-circuit voltages (VOC) of ≈1.0 V, notable short-circuit current values (JSC) of ≈11.0 mA cm−2, and power conversion efficiencies (PCEs) nearing 5% in all-polymer BHJ solar cells. P2TPDBT[2F]T paves the way to a new, promising class of polymer acceptor candidates.

  19. Enhancement of open-circuit voltage on organic photovoltaic devices by Al-doped TiO{sub 2} modifying layer produced by sol–gel method

    Energy Technology Data Exchange (ETDEWEB)

    Valaski, R.; Arantes, C.; Senna, C.A.; Carôzo, Victor; Achete, C.A. [Materials Metrology Division, Instituto Nacional de Metrologia, Qualidade e Tecnologia, Xerém, Duque de Caxias 25250-020, RJ (Brazil); Cremona, M., E-mail: cremona@fis.puc-rio.br [Materials Metrology Division, Instituto Nacional de Metrologia, Qualidade e Tecnologia, Xerém, Duque de Caxias 25250-020, RJ (Brazil); Physics Department, Pontifícia Universidade Católica do Rio de Janeiro, Rio de Janeiro 22453-970, RJ (Brazil)

    2014-12-01

    Sol–gel method has shown several advantages for oxide synthesis, such as lower cost production, coating large areas, lower processing temperatures and ease insertion of doping materials. Therefore, it is attractive for production of intermediate and electrode modifying layers in organic optoelectronic devices. Herein, spin-coated aluminum-doped titanium dioxide (AlTiO{sub 2}) thin films were produced by sol–gel method onto glass and fluorine-doped tin oxide (FTO) substrates, using different Al-dopant concentrations and post-done annealing temperatures. Electrical measurements were performed in order to investigate the improvement of the TiO{sub 2} resistivity. Additionally, structural, compositional, morphological, optical and electrical properties of the optimal AlTiO{sub 2} modifying layers onto FTO substrates were probed by different techniques, and compared with those obtained from the undoped thin films produced under similar conditions. Organic photovoltaic devices (OPVs) with the structure FTO/AlTiO{sub 2}(30 nm)/C{sub 60}(50 nm)/CuPc(50 nm)/Al with an Al concentration of 0.03 M in AlTiO{sub 2} layer were produced. The insertion of AlTiO{sub 2} thin films improved the short-circuit current density (J{sub sc}) as well as the open circuit voltage (V{sub oc}) in comparison with non-modified electrode FTO based devices. This behavior is discussed in terms of induced interface phenomena as dipole formation induced by Al. - Highlights: • Easy and cheap solution-process for AlTiO{sub 2} modification of FTO electrode for OPVs • Electrical, structural and optical characterization of TiO{sub 2} layers with Al-dopant • Improvement of Voc and Jsc of inverted OPVs with AlTiO{sub 2} modified electrode.

  20. Enhancement of open-circuit voltage on organic photovoltaic devices by Al-doped TiO2 modifying layer produced by sol–gel method

    International Nuclear Information System (INIS)

    Valaski, R.; Arantes, C.; Senna, C.A.; Carôzo, Victor; Achete, C.A.; Cremona, M.

    2014-01-01

    Sol–gel method has shown several advantages for oxide synthesis, such as lower cost production, coating large areas, lower processing temperatures and ease insertion of doping materials. Therefore, it is attractive for production of intermediate and electrode modifying layers in organic optoelectronic devices. Herein, spin-coated aluminum-doped titanium dioxide (AlTiO 2 ) thin films were produced by sol–gel method onto glass and fluorine-doped tin oxide (FTO) substrates, using different Al-dopant concentrations and post-done annealing temperatures. Electrical measurements were performed in order to investigate the improvement of the TiO 2 resistivity. Additionally, structural, compositional, morphological, optical and electrical properties of the optimal AlTiO 2 modifying layers onto FTO substrates were probed by different techniques, and compared with those obtained from the undoped thin films produced under similar conditions. Organic photovoltaic devices (OPVs) with the structure FTO/AlTiO 2 (30 nm)/C 60 (50 nm)/CuPc(50 nm)/Al with an Al concentration of 0.03 M in AlTiO 2 layer were produced. The insertion of AlTiO 2 thin films improved the short-circuit current density (J sc ) as well as the open circuit voltage (V oc ) in comparison with non-modified electrode FTO based devices. This behavior is discussed in terms of induced interface phenomena as dipole formation induced by Al. - Highlights: • Easy and cheap solution-process for AlTiO 2 modification of FTO electrode for OPVs • Electrical, structural and optical characterization of TiO 2 layers with Al-dopant • Improvement of Voc and Jsc of inverted OPVs with AlTiO 2 modified electrode

  1. A novel modeling methodology of open circuit voltage hysteresis for LiFePO4 batteries based on an adaptive discrete Preisach model

    International Nuclear Information System (INIS)

    Zhu, Letao; Sun, Zechang; Dai, Haifeng; Wei, Xuezhe

    2015-01-01

    Highlights: • An adaptive discrete Preisach model (ADPM) of OCV–SOC hysteresis is proposed. • The measured current is used to adjust the weight vector in the proposed ADPM. • A deformation algorithm of ADPM is developed for the accidental current errors. • The performance of ADPM under uncertainty of measured current is investigated. • The performance of ADPM under uncertainty of OCV is investigated. - Abstract: The relationship of open circuit voltage (OCV) versus state of charge (SOC) is critical for many techniques such as accurate battery modeling and reliable SOC estimation. However, the hysteresis existing in OCV–SOC curves of lithium-ion batteries complicates this relationship especially for lithium iron phosphate (LiFePO 4 ) batteries which exhibit a very flat OCV–SOC hysteretic feature. This paper aims at modeling the OCV–SOC hysteresis for LiFePO 4 batteries. The modeling approach is a novel adaptive discrete Preisach model (ADPM) based on the classic Preisach model and the least mean square (LMS) theory. To enhance the performance, the ADPM uses the measured current at each time step to adjust the weight vector. This method significantly decreases the errors (<1%) between the model predicted SOC and the true SOC acquired from experiments. A deformation algorithm of ADPM is further proposed to guarantee the performance even when large errors appear in the measured current. For further applications of the proposed ADPM such as SOC estimation, the robust performance of ADPM is also discussed when considering OCV input errors and measurement current errors. The results show that the maximum SOC calculation errors are about 6% and 5% respectively against uncertain OCV input and measured current which indicate the enormous potential of ADPM in battery management systems

  2. Enhancement of open-circuit voltage and the fill factor in CdTe nanocrystal solar cells by using interface materials

    International Nuclear Information System (INIS)

    Zhu, Jiaoyan; Yang, Yuehua; Gao, Yuping; Qin, Donghuan; Wu, Hongbin; Huang, Wenbo; Hou, Lintao

    2014-01-01

    Interface states influence the operation of nanocrystal (NC) solar cell carrier transport, recombination and energetic mechanisms. In a typical CdTe NC solar cell with a normal structure of a ITO/p-CdTe NCs/n-acceptor (or without)/Al configuration, the contact between the ITO and CdTe is a non-ohm contact due to a different work function (for an ITO, the value is ∼4.7 eV, while for CdTe NCs, the value is ∼5.3 eV), which results in an energetic barrier at the ITO/CdTe interface and decreases the performance of the NC solar cells. This work investigates how interface materials (including Au, MoO x and C 60 ) affect the performance of NC solar cells. It is found that devices with interface materials have shown higher V oc than those without interface materials. For the case in which we used Au as an interface, we obtained a high open-circuit voltage of 0.65 V, coupled with a high fill factor (62%); this resulted in a higher energy conversion efficiency (ECE) of 5.3%, which showed a 30% increase in the ECE compared with those without the interlayer. The capacitance measurements indicate that the increased V oc in the case in which Au was used as the interface is likely due to good ohm contact between the Au’s and the CdTe NCs’ thin film, which decreases the energetic barrier at the ITO/CdTe interface. (paper)

  3. Efficient Planar Structured Perovskite Solar Cells with Enhanced Open-Circuit Voltage and Suppressed Charge Recombination Based on a Slow Grown Perovskite Layer from Lead Acetate Precursor.

    Science.gov (United States)

    Li, Cong; Guo, Qiang; Wang, Zhibin; Bai, Yiming; Liu, Lin; Wang, Fuzhi; Zhou, Erjun; Hayat, Tasawar; Alsaedi, Ahmed; Tan, Zhan'ao

    2017-12-06

    For planar structured organic-inorganic hybrid perovskite solar cells (PerSCs) with the poly(3,4-ethylenedioxythiophene:polystyrene sulfonate) (PEDOT:PSS) hole transport layer, the open-circuit voltage (V oc ) of the device is limited to be about 1.0 V, resulting in inferior performance in comparison with TiO 2 -based planar counterparts. Therefore, increasing V oc of the PEDOT:PSS-based planar device is an important way to enhance the efficiency of the PerSCs. Herein, we demonstrate a novel approach for perovskite film formation and the film is formed by slow growth from lead acetate precursor via a one-step spin-coating process without the thermal annealing (TA) process. Because the perovskite layer grows slowly and naturally, high-quality perovskite film can be achieved with larger crystalline particles, less defects, and smoother surface morphology. Ultraviolet absorption, X-ray diffraction, scanning electron microscopy, steady-state fluorescence spectroscopy (photoluminescence), and time-resolved fluorescence spectroscopy are used to clarify the crystallinity, morphology, and internal defects of perovskite thin films. The power conversion efficiency of p-i-n PerSCs based on slow-grown film (16.33%) shows greatly enhanced performance compared to that of the control device based on traditional thermally annealed perovskite film (14.33%). Furthermore, the V oc of the slow-growing device reaches 1.12 V, which is 0.1 V higher than that of the TA device. These findings indicate that slow growth of the perovskite layer from lead acetate precursor is a promising approach to achieve high-quality perovskite film for high-performance PerSCs.

  4. Effects of the charge-transfer reorganization energy on the open-circuit voltage in small-molecular bilayer organic photovoltaic devices: comparison of the influence of deposition rates of the donor.

    Science.gov (United States)

    Lee, Chih-Chien; Su, Wei-Cheng; Chang, Wen-Chang

    2016-05-14

    The theoretical maximum of open-circuit voltage (VOC) of organic photovoltaic (OPV) devices has yet to be determined, and its origin remains debated. Here, we demonstrate that VOC of small-molecule OPV devices can be improved by controlling the deposition rate of a donor without changing the interfacial energy gap at the donor/acceptor interface. The measurement of external quantum efficiency and electroluminescence spectra facilitates the observation of the existence of charge transfer (CT) states. A simplified approach by reusing the reciprocity relationship for obtaining the properties of the CT states is proposed without introducing complex techniques. We compare experimental and fitting results and propose that reorganization energy is the primary factor in determining VOC instead of either the CT energy or electronic coupling term in bilayer OPV devices. Atomic force microscopy images indicate a weak molecular aggregation when a higher deposition rate is used. The results of temperature-dependent measurements suggest the importance of molecular stacking for the CT properties.

  5. Design and flight performance evaluation of the Mariners 6, 7, and 9 short-circuit current, open-circuit voltage transducers

    Science.gov (United States)

    Patterson, R. E.

    1973-01-01

    The purpose of the short-circuit voltage transducer is to provide engineering data to aid the evaluation of array performance during flight. The design, fabrication, calibration, and in-flight performance of the transducers onboard the Mariner 6, 7 and 9 spacecrafts are described. No significant differences were observed in the in-flight electrical performance of the three transducers. The transducers did experience significant losses due to coverslides or adhesive darkening, increased surface reflection, or spectral shifts within coverslide assembly. Mariner 6, 7 and 9 transducers showed non-cell current degradations of 3-1/2%, 3%, and 4%, respectively at Mars encounter and 6%, 3%, and 4-12%, respectively at end of mission. Mariner 9 solar Array Test 2 showed 3-12% current degradation while the transducer showed 4-12% degradation.

  6. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  7. Electron-deficient N-alkyloyl derivatives of thieno[3,4-c]pyrrole-4,6-dione yield efficient polymer solar cells with open-circuit voltages > 1 v

    KAUST Repository

    Warnan, Julien

    2014-05-13

    Poly(benzo[1,2-b:4,5-b′]dithiophene-thieno[3,4-c]pyrrole-4,6-dione) (PBDTTPD) polymer donors yield some of the highest open-circuit voltages (V OC, ca. 0.9 V) and fill factors (FF, ca. 70%) in conventional bulk-heterojunction (BHJ) solar cells with PCBM acceptors. Recent work has shown that the incorporation of ring substituents into the side chains of the BDT motifs in PBDTTPD can induce subtle variations in material properties, resulting in an increase of the BHJ device VOC to ∼1 V. In this contribution, we report on the synthesis of N-alkyloyl-substituted TPD motifs (TPD(CO)) and show that the electron-deficient motifs can further lower both the polymer LUMO and HOMO levels, yielding device VOC > 1 V (up to ca. 1.1 V) in BHJ solar cells with PCBM. Despite the high VOC achieved (i.e., low polymer HOMO), BHJ devices cast from TPD(CO)-based polymer donors can reach power conversion efficiencies (PCEs) of up to 6.7%, making these promising systems for use in the high-band-gap cell of tandem solar cells. © 2014 American Chemical Society.

  8. Rational Design of High-Performance Wide-Bandgap (≈2 eV) Polymer Semiconductors as Electron Donors in Organic Photovoltaics Exhibiting High Open Circuit Voltages (≈1 V).

    Science.gov (United States)

    Chochos, Christos L; Katsouras, Athanasios; Gasparini, Nicola; Koulogiannis, Chrysanthos; Ameri, Tayebeh; Brabec, Christoph J; Avgeropoulos, Apostolos

    2017-01-01

    Systematic optimization of the chemical structure of wide-bandgap (≈2.0 eV) "donor-acceptor" copolymers consisting of indacenodithiophene or indacenodithieno[3,2-b]thiophene as the electron-rich unit and thieno[3,4-c]pyrrole-4,6-dione as the electron-deficient moiety in terms of alkyl side chain engineering and distance of the electron-rich and electron-deficient monomers within the repeat unit of the polymer chain results in high-performance electron donor materials for organic photovoltaics. Specifically, preliminary results demonstrate extremely high open circuit voltages (V oc s) of ≈1.0 V, reasonable short circuit current density (J sc ) of around 11 mA cm -2 , and moderate fill factors resulting in efficiencies close to 6%. All the devices are fabricated in an inverted architecture with the photoactive layer processed by doctor blade equipment, showing the compatibility with roll-to-roll large-scale manufacturing processes. From the correlation of the chemical structure-optoelectronic properties-photovoltaic performance, a rational guide toward further optimization of the chemical structure in this family of copolymers, has been achieved. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Photovoltaic Small Molecules of TPA(FxBT-T-Cz)3: Tuning Open-Circuit Voltage over 1.0 V for Their Organic Solar Cells by Increasing Fluorine Substitution.

    Science.gov (United States)

    Wang, Qiong; Duan, Linrui; Tao, Qiang; Peng, Wenhong; Chen, Jianhua; Tan, Hua; Yang, Renqiang; Zhu, Weiguo

    2016-11-09

    To simultaneously improve both open-circuit voltage (V oc ) and short-circuit current density (J sc ) for organic solar cells, a novel D(A-π-Ar) 3 type of photovoltaic small molecules of TPA(F x BT-T-3Cz) 3 was designed and synthesized, which contain central triphenylamine (TPA), terminal carbazole (Cz), armed fluorine-substituted benzothiadiazole (F x BT, where x = 1 or 2), and bridged thiophene (T) units. A narrowed ultraviolet-visible absorption and a decreasing highest occupied molecular orbital energy level were observed from TPA(F 1 BT-T-3Cz) 3 to TPA(F 2 BT-T-3Cz) 3 with increasing fluorine substitution. However, the TPA(F 2 BT-T-3Cz) 3 /PC 71 BM-based solar devices showed a rising V oc of 1.01 V and an enhanced J sc of 10.84 mA cm -2 as well as a comparable power conversion efficiency of 4.81% in comparison to the TPA(F 1 BT-T-3Cz) 3 /PC 71 BM-based devices. Furthermore, in comparison to the parent TPA(BT-T-3Cz) 3 molecule without fluorine substitution, the fluorine-substituted TPA(F x BT-T-3Cz) 3 molecules exhibited significantly incremental V oc and J sc values in their bulk heterojunction organic solar cells, owing to fluorine incorporation in the electron-deficient benzothiadiazole unit.

  10. Protection Scheme for Modular Multilevel Converters under Diode Open-Circuit Faults

    DEFF Research Database (Denmark)

    Deng, Fujin; Zhu, Rongwu; Liu, Dong

    2018-01-01

    devices. The diode open-circuit fault in the submodule (SM) is an important issue for the MMC, which would affect the performance of the MMC and disrupt the operation of the MMC. This paper analyzes the impact of diode open-circuit failures in the SMs on the performance of the MMC and proposes...... a protection scheme for the MMC under diode open-circuit faults. The proposed protection scheme not only can effectively eliminate the possible caused high voltage due to the diode open-circuit fault but also can quickly detect the faulty SMs, which effectively avoids the destruction and protects the MMC....... The proposed protection scheme is verified with a downscale MMC prototype in the laboratory. The results confirm the effectiveness of the proposed protection scheme for the MMC under diode open-circuit faults....

  11. Tester Detects Steady-Short Or Intermittent-Open Circuits

    Science.gov (United States)

    Anderson, Bobby L.

    1990-01-01

    Momentary open circuits or steady short circuits trigger buzzer. Simple, portable, lightweight testing circuit sounds long-duration alarm when it detects steady short circuit or momentary open circuit in coaxial cable or other two-conductor transmission line. Tester sensitive to discontinuities lasting 10 microseconds or longer. Used extensively for detecting intermittent open shorts in accelerometer and extensometer cables. Also used as ordinary buzzer-type continuity checker to detect steady short or open circuits.

  12. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  13. Voltage Dependence of a Neuromodulator-Activated Ionic Current123

    Science.gov (United States)

    2016-01-01

    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  14. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  15. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Science.gov (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  16. Open circuit mouthpiece ventilation: Concise clinical review

    Directory of Open Access Journals (Sweden)

    G. Garuti

    2014-07-01

    Full Text Available In 2013 new “mouthpiece ventilation” modes are being introduced to commercially available portable ventilators. Despite this, there is little knowledge of how to use noninvasive intermittent positive pressure ventilation (NIV as opposed to bi-level positive airway pressure (PAP and both have almost exclusively been reported to have been used via nasal or oro-nasal interfaces rather than via a simple mouthpiece.Non-invasive ventilation is often reported as failing because of airway secretion encumbrance, because of hypercapnia due to inadequate bi-level PAP settings, or poor interface tolerance. The latter can be caused by factors such as excessive pressure on the face from poor fit, excessive oral air leak, anxiety, claustrophobia, and patient-ventilator dys-synchrony. Thus, the interface plays a crucial role in tolerance and effectiveness. Interfaces that cover the nose and/or nose and mouth (oro-nasal are the most commonly used but are more likely to cause skin breakdown and claustrophobia. Most associated drawbacks can be avoided by using mouthpiece NIV. Open-circuit mouthpiece NIV is being used by large populations in some centers for daytime ventilatory support and complements nocturnal NIV via “mask” interfaces for nocturnal ventilatory support. Mouthpiece NIV is also being used for sleep with the mouthpiece fixed in place by a lip-covering flange. Small 15 and 22 mm angled mouthpieces and straw-type mouthpieces are the most commonly used.NIV via mouthpiece is being used as an effective alternative to ventilatory support via tracheostomy tube (TMV and is associated with a reduced risk of pneumonias and other respiratory complications. Its use facilitates “air-stacking” to improve cough, speech, and pulmonary compliance, all of which better maintain quality of life for patients with neuromuscular diseases (NMDs than the invasive alternatives. Considering these benefits and the new availability of mouthpiece

  17. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  18. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

    Science.gov (United States)

    Cui, Jianmin

    2016-01-01

    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  19. Voltage-Dependent Gating of hERG Potassium Channels

    Science.gov (United States)

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  20. Induced voltage due to time-dependent magnetisation textures

    International Nuclear Information System (INIS)

    Kudtarkar, Santosh Kumar; Dhadwal, Renu

    2010-01-01

    We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

  1. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

    Science.gov (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

    2014-07-01

    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  2. Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji

    2016-01-01

    We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

  3. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

    Science.gov (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

    2014-03-01

    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  4. Chemical Detection using Electrically Open Circuits having no Electrical Connections

    Science.gov (United States)

    Woodward, Stanley E.; Olgesby, Donald M.; Taylor, Bryant D.; Shams, Qamar A.

    2008-01-01

    This paper presents investigations to date on chemical detection using a recently developed method for designing, powering and interrogating sensors as electrically open circuits having no electrical connections. In lieu of having each sensor from a closed circuit with multiple electrically connected components, an electrically conductive geometric pattern that is powered using oscillating magnetic fields and capable of storing an electric field and a magnetic field without the need of a closed circuit or electrical connections is used. When electrically active, the patterns respond with their own magnetic field whose frequency, amplitude and bandwidth can be correlated with the magnitude of the physical quantities being measured. Preliminary experimental results of using two different detection approaches will be presented. In one method, a thin film of a reactant is deposited on the surface of the open-circuit sensor. Exposure to a specific targeted reactant shifts the resonant frequency of the sensor. In the second method, a coating of conductive material is placed on a thin non-conductive plastic sheet that is placed over the surface of the sensor. There is no physical contact between the sensor and the electrically conductive material. When the conductive material is exposed to a targeted reactant, a chemical reaction occurs that renders the material non-conductive. The change in the material s electrical resistance within the magnetic field of the sensor alters the sensor s response bandwidth and amplitude, allowing detection of the reaction without having the reactants in physical contact with the sensor.

  5. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  6. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

    Science.gov (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

    2016-11-17

    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  7. Magnetic field effects on the open circuit potential of ferromagnetic electrodes in corroding solutions.

    Science.gov (United States)

    Dass, Amala; Counsil, Joseph A; Gao, Xuerong; Leventis, Nicholas

    2005-06-02

    Magnetic fields shift the open circuit potential (OCP) of ferromagnetic electrodes (Fe, Co, and Ni) in corroding solutions. The OCP changes we observe (a) follow the series Fe>Co>Ni; (b) increase with the magnetic flux density; (c) reach a maximum with disk electrodes approximately 1 mm in diameter; and (d) depend on the orientation of the electrode. We report that when the surface of the electrode is oriented parallel (theta = 90 degrees) or perpendicular (theta = 0 degrees) to the magnetic field, the open circuit potential moves in opposite directions (positive and negative, respectively) with the largest changes occurring when the electrode surface is parallel to the magnetic field. Nonconvective sleeve electrodes produce the same behavior. The overall experimental evidence suggests that the magnetic field changes the OCP by modifying the surface concentrations of the paramagnetic participants in the corrosion process of the ferromagnetic electrode by species in solution; this in turn is accomplished by imposing a field-gradient driven mode of mass transfer upon paramagnetic species in solution (magnetophoresis). Simulations of the magnetic field around the ferromagnetic electrode at the two extreme orientations considered here show that in one case (theta = 90 degrees) field gradients actually repel, while in the other case (theta = 0 degrees) they attract paramagnetic species in the vicinity of the electrode.

  8. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

    Science.gov (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

    2012-01-01

    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  9. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta

    2017-06-01

    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  10. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

    Science.gov (United States)

    Gupta, Rajeev; Ghosh, Subhendu

    2017-06-01

    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  11. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  12. On the Predictions of Carbon Deposition on the Nickel Anode of a SOFC and Its Impact on Open-Circuit Conditions

    KAUST Repository

    Lee, W. Y.

    2012-12-04

    Previous thermodynamic analyses of carbon formation in SOFCs assumed that graphite could be used to represent the properties of carbon formed in the anode. It is generally observed, however, that catalytically grown carbon nanofibers (CNF) are more likely to form in the SOFC anode with nickel catalysts. The energetic and entropic properties of CNF are different from those of graphite.We compare equilibrium results based on thermochemical properties for graphite, to new results based on a previously reported value of an empirically determined Gibbs free energy for carbon fibers grown on a nickel support (with fitted values of H°CNF = 54.46 kJ/mol and S°CNF = 68.90 J/mol/K for a nickel crystal size of 5.4 nm). There is little difference in predictions of carbon formation under open-circuit conditions between the two carbon types for methane mixtures, with graphite predicted to form at lower temperatures than CNF. There is a much bigger difference in predictions for methanol mixtures, especially at low steam-carbon ratios. The differences for propane are even more pronounced, and the improved predictions assuming CNF are in closer agreement with past observations.We show a strong dependence of CNF formation and "coking threshold" on nickel crystallite size, supporting previous reports that the nickel particle size is a dominating parameter for controlling filament growth. If both carbon types are included in the calculations, only the thermodynamically favored form (i.e., the type having the lowest formation energy) exists. Predicted Nernst potentials are more-or-less independent of the carbon type and in agreement with measured open-circuit voltages. © 2012 The Electrochemical Society.

  13. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones

    Science.gov (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A

    2012-01-01

    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  14. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification

    OpenAIRE

    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo

    2013-01-01

    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  15. Resonant magnetoelectric response of composite cantilevers: Theory of short vs. open circuit operation and layer sequence effects

    Directory of Open Access Journals (Sweden)

    Matthias C. Krantz

    2015-11-01

    Full Text Available The magnetoelectric effect in layered composite cantilevers consisting of strain coupled layers of magnetostrictive (MS, piezoelectric (PE, and substrate materials is investigated for magnetic field excitation at bending resonance. Analytic theories are derived for the transverse magnetoelectric (ME response in short and open circuit operation for three different layer sequences and results presented and discussed for the FeCoBSi-AlN-Si and the FeCoBSi-PZT-Si composite systems. Response optimized PE-MS layer thickness ratios are found to greatly change with operation mode shifting from near equal MS and PE layer thicknesses in the open circuit mode to near vanishing PE layer thicknesses in short circuit operation for all layer sequences. In addition the substrate layer thickness is found to differently affect the open and short circuit ME response producing shifts and reversal between ME response maxima depending on layer sequence. The observed rich ME response behavior for different layer thicknesses, sequences, operating modes, and PE materials can be explained by common neutral plane effects and different elastic compliance effects in short and open circuit operation.

  16. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-07-05

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  17. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

    Science.gov (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

    2016-01-01

    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  18. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee

    2009-03-01

    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  19. Detection of Two-Level Inverter Open-Circuit Fault Using a Combined DWT-NN Approach

    Directory of Open Access Journals (Sweden)

    Bilal Djamel Eddine Cherif

    2018-01-01

    Full Text Available Three-phase static converters with voltage structure are widely used in many industrial systems. In order to prevent the propagation of the fault to other components of the system and ensure continuity of service in the event of a failure of the converter, efficient and rapid methods of detection and localization must be implemented. This paper work addresses a diagnostic technique based on the discrete wavelet transform (DWT algorithm and the approach of neural network (NN, for the detection of an inverter IGBT open-circuit switch fault. To illustrate the merits of the technique and validate the results, experimental tests are conducted using a built voltage inverter fed induction motor. The inverter is controlled by the SVM control strategy.

  20. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

    Science.gov (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

    2018-01-01

    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  1. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels.

    Science.gov (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin

    2017-08-01

    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  2. Tuning open-circuit voltage in organic solar cells by magnesium modified Alq3

    OpenAIRE

    Chou, Chi-Ta; Lin, Chien-Hung; Wu, Meng-Hsiu; Cheng, Tzu-Wei; Lee, Jiun-Haw; Liu, Chin-Hsin J.; Tai, Yian; Chattopadhyay, Surojit; Wang, Juen-Kai; Chen, Kuei-Hsien; Chen, Li-Chyong

    2011-01-01

    The low molecular weight tris-(8-hydroxyquinoline) aluminum (Alq3) has been incorporated with magnesium (Mg) that altered the nature of its opto-electronic characteristics. The lowering of the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) in Mg:Alq3, compared to pure Alq3, creates a stronger field (exceeding the exciton binding energy) at the donor-acceptor junction to dissociate the photo-generated exciton and also provides a low barrier for electro...

  3. Tuning open-circuit voltage in organic solar cells by magnesium modified Alq3

    Science.gov (United States)

    Chou, Chi-Ta; Lin, Chien-Hung; Wu, Meng-Hsiu; Cheng, Tzu-Wei; Lee, Jiun-Haw; Liu, Chin-Hsin J.; Tai, Yian; Chattopadhyay, Surojit; Wang, Juen-Kai; Chen, Kuei-Hsien; Chen, Li-Chyong

    2011-01-01

    The low molecular weight tris-(8-hydroxyquinoline) aluminum (Alq3) has been incorporated with magnesium (Mg) that altered the nature of its opto-electronic characteristics. The lowering of the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) in Mg:Alq3, compared to pure Alq3, creates a stronger field (exceeding the exciton binding energy) at the donor-acceptor junction to dissociate the photo-generated exciton and also provides a low barrier for electron transport across the device. In an electron-only device (described in the text), a current enhancement in excess of 103, with respect to pure Alq3, could be observed at 10 V applied bias. Optimized Mg:Alq3 layer, when introduced in the photovoltaic device, improves the power conversion efficiencies significantly to 0.15% compared to the pure Alq3 device. The improvement in the photovoltaic performance has been attributed to the superior exciton dissociation and carrier transport. PMID:22087050

  4. Online Open Circuit Fault Diagnosis for Rail Transit Traction Converter Based on Object-Oriented Colored Petri Net Topology Reasoning

    Directory of Open Access Journals (Sweden)

    Lei Wang

    2016-01-01

    Full Text Available For online open circuit fault diagnosis of the traction converter in rail transit vehicles, conventional approaches depend heavily on component parameters and circuit layouts. For better universality and less parameter sensitivity during the diagnosis, this paper proposes a novel topology analysis approach to diagnose switching device open circuit failures. During the diagnosis, the topology is analyzed with fault reasoning mechanism, which is based on object-oriented Petri net (OOCPN. The OOCPN model takes in digitalized current inputs as fault signatures, and dynamical transitions between discrete switching states of a circuit with broken device are symbolized with the dynamical transitions of colored tokens in OOCPN. Such transitions simulate natural reasoning process of an expert’s brain during diagnosis. The dependence on component parameters and on circuit layouts is finally eliminated by such circuit topology reasoning process. In the last part, the proposed online reasoning and diagnosis process is exemplified with the case of a certain switching device failure in the power circuit of traction converter.

  5. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

    Science.gov (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

    2018-04-01

    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  6. The Fault Detection, Localization, and Tolerant Operation of Modular Multilevel Converters with an Insulated Gate Bipolar Transistor (IGBT Open Circuit Fault

    Directory of Open Access Journals (Sweden)

    Wei Li

    2018-04-01

    Full Text Available Reliability is one of the critical issues for a modular multilevel converter (MMC since it consists of a large number of series-connected power electronics submodules (SMs. In this paper, a complete control strategy including fault detection, localization, and tolerant operation is proposed for the MMC under an insulated gate bipolar transistor (IGBT open circuit fault. According to the output characteristics of the SM with the open-circuit fault of IGBT, a fault detection method based on the circulating current and output current observation is used. In order to further precisely locate the position of the faulty SM, a fault localization method based on the SM capacitor voltage observation is developed. After the faulty SM is isolated, the continuous operation of the converter is ensured by adopting the fault-tolerant strategy based on the use of redundant modules. To verify the proposed fault detection, fault localization, and fault-tolerant operation strategies, a 900 kVA MMC system under the conditions of an IGBT open circuit is developed in the Matlab/Simulink platform. The capabilities of rapid detection, precise positioning, and fault-tolerant operation of the investigated detection and control algorithms are also demonstrated.

  7. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

    OpenAIRE

    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

    2000-01-01

    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  8. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2014-01-01

    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  9. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae

    2017-08-01

    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  10. Solar cell degradation under open circuit condition in out-doors-in desert region

    Directory of Open Access Journals (Sweden)

    M. Boussaid

    Full Text Available The reliability of solar cells is an important parameter in the design of photovoltaic systems and particularly for cost estimation. Solar cell degradation is the result of various operating conditions; temperature is one of most important factors. Installed PV modules in desert regions are subjected to various temperature changes with significant gradient leading to accelerated degradation. In the present work, we demonstrate the influence of open-circuit condition on the degradation of PV modules. The experiment is carried out in the desert region of ADRAR (southern Algeria using two modules IJISEL of single-crystal silicon. A continuous monitoring allows analysis of both performances of modules for duration of 330 days. The module in open-circuit condition reaches higher temperature means than the module in charging condition; therefore, it undergoes a higher degradation. By simulation, we found that the life of a PV module (whose power output is close to 50% in a condition of an open-circuit in the desert region could be reduced to 4 years, and that has a significant impact on economy. Keywords: WEIBULL, Photovoltaic, Degradation, Open-circuit, Single-crystal, Silicon

  11. An open circuit balance respirometer for bioenergetic studies of fish growth

    NARCIS (Netherlands)

    Hogendoorn, H.; Korlaar, van F.; Bosch, H.

    1981-01-01

    A description is given of an open circuit balance respirometer for bioenergetic studies of fish growth using indirect calorimetry. The installation was designed to enable the determination of gas and matter balances of fish, including air breathing species, during prolonged experimental periods.

  12. Effects of a parallel resistor on electrical characteristics of a piezoelectric transformer in open-circuit transient state.

    Science.gov (United States)

    Chang, Kuo-Tsai

    2007-01-01

    This paper investigates electrical transient characteristics of a Rosen-type piezoelectric transformer (PT), including maximum voltages, time constants, energy losses and average powers, and their improvements immediately after turning OFF. A parallel resistor connected to both input terminals of the PT is needed to improve the transient characteristics. An equivalent circuit for the PT is first given. Then, an open-circuit voltage, involving a direct current (DC) component and an alternating current (AC) component, and its related energy losses are derived from the equivalent circuit with initial conditions. Moreover, an AC power control system, including a DC-to-AC resonant inverter, a control switch and electronic instruments, is constructed to determine the electrical characteristics of the OFF transient state. Furthermore, the effects of the parallel resistor on the transient characteristics at different parallel resistances are measured. The advantages of adding the parallel resistor also are discussed. From the measured results, the DC time constant is greatly decreased from 9 to 0.04 ms by a 10 k(omega) parallel resistance under open output.

  13. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika

    2006-01-01

    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  14. Monitoring operating temperature and supply voltage in achieving high system dependability

    NARCIS (Netherlands)

    Khan, M.A.; Kerkhoff, Hans G.

    2013-01-01

    System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

  15. Substrate bias voltage and deposition temperature dependence on ...

    Indian Academy of Sciences (India)

    Thin films or a coating of any sort prior to its application into real world has to be studied for the dependence of ..... For line focusing, incident beam mask was employed with ..... org/content/avs/journal/jvst/11/4/10.1116/1.1312732. Thornton J A ...

  16. Low voltage initiation of damaging arcs between electrical contacts

    International Nuclear Information System (INIS)

    Cuthrell, R.E.

    1975-07-01

    Metallic arcs were found to precede the firm contacting of electrical contacts which were closed without bounce. When the open-circuit voltages were below the ionization potential, the initiation of these arcs was found to depend on the presence of asperities on the surfaces and on asperity contracting, melting, and pinching off by magnetic forces. The arc is thought to be initiated inductively when the molten metallic asperity contact is pinched off, and the electrode damage is similar to that produced by the arcing of opening contacts. Arcing could not be produced for exceptionally smooth surfaces, or, for rough surfaces when the open-circuit potential was below the melting voltages of the electrode metals. In order to prevent damage to contact surfaces by melting or arcing, it is suggested that test potentials be limited to below the melting voltages, that the current be limited, the test circuits be designed to prevent inductively generated high voltage transients, and the contact surfaces be very smooth. In order to facilitate arc initiation in arc welding applications, it is suggested that the surfaces of electrodes and work pieces be roughened. (U.S.)

  17. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

    Science.gov (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

    2018-04-01

    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  18. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

    Science.gov (United States)

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

    2016-11-14

    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  19. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten

    2002-01-01

    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  20. Wireless Sensing System Using Open-circuit, Electrically-conductive Spiral-trace Sensor

    Science.gov (United States)

    Woodard, Stanley E. (Inventor); Taylor, Bryant D. (Inventor)

    2013-01-01

    A wireless sensing system includes a sensor made from an electrical conductor shaped to form an open-circuit, electrically-conductive spiral trace having inductance and capacitance. In the presence of a time-varying magnetic field, the sensor resonates to generate a harmonic response having a frequency, amplitude and bandwidth. A magnetic field response recorder wirelessly transmits the time-varying magnetic field to the sensor and wirelessly detects the sensor's response frequency, amplitude and bandwidth.

  1. A hybrid analytical model for open-circuit field calculation of multilayer interior permanent magnet machines

    Science.gov (United States)

    Zhang, Zhen; Xia, Changliang; Yan, Yan; Geng, Qiang; Shi, Tingna

    2017-08-01

    Due to the complicated rotor structure and nonlinear saturation of rotor bridges, it is difficult to build a fast and accurate analytical field calculation model for multilayer interior permanent magnet (IPM) machines. In this paper, a hybrid analytical model suitable for the open-circuit field calculation of multilayer IPM machines is proposed by coupling the magnetic equivalent circuit (MEC) method and the subdomain technique. In the proposed analytical model, the rotor magnetic field is calculated by the MEC method based on the Kirchhoff's law, while the field in the stator slot, slot opening and air-gap is calculated by subdomain technique based on the Maxwell's equation. To solve the whole field distribution of the multilayer IPM machines, the coupled boundary conditions on the rotor surface are deduced for the coupling of the rotor MEC and the analytical field distribution of the stator slot, slot opening and air-gap. The hybrid analytical model can be used to calculate the open-circuit air-gap field distribution, back electromotive force (EMF) and cogging torque of multilayer IPM machines. Compared with finite element analysis (FEA), it has the advantages of faster modeling, less computation source occupying and shorter time consuming, and meanwhile achieves the approximate accuracy. The analytical model is helpful and applicable for the open-circuit field calculation of multilayer IPM machines with any size and pole/slot number combination.

  2. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  3. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

    Science.gov (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

    2015-03-01

    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  4. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine.

    Science.gov (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R

    2003-03-01

    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  5. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.

    1984-01-01

    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  6. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

    Science.gov (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

    1988-08-01

    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  7. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

    Science.gov (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris

    2016-01-01

    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  8. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu

    2009-01-01

    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  9. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

    Science.gov (United States)

    White, William E.

    2013-01-01

    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  10. A hybrid analytical model for open-circuit field calculation of multilayer interior permanent magnet machines

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zhen [School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China); Xia, Changliang [School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China); Tianjin Engineering Center of Electric Machine System Design and Control, Tianjin 300387 (China); Yan, Yan, E-mail: yanyan@tju.edu.cn [School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China); Geng, Qiang [Tianjin Engineering Center of Electric Machine System Design and Control, Tianjin 300387 (China); Shi, Tingna [School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China)

    2017-08-01

    Highlights: • A hybrid analytical model is developed for field calculation of multilayer IPM machines. • The rotor magnetic field is calculated by the magnetic equivalent circuit method. • The field in the stator and air-gap is calculated by subdomain technique. • The magnetic scalar potential on rotor surface is modeled as trapezoidal distribution. - Abstract: Due to the complicated rotor structure and nonlinear saturation of rotor bridges, it is difficult to build a fast and accurate analytical field calculation model for multilayer interior permanent magnet (IPM) machines. In this paper, a hybrid analytical model suitable for the open-circuit field calculation of multilayer IPM machines is proposed by coupling the magnetic equivalent circuit (MEC) method and the subdomain technique. In the proposed analytical model, the rotor magnetic field is calculated by the MEC method based on the Kirchhoff’s law, while the field in the stator slot, slot opening and air-gap is calculated by subdomain technique based on the Maxwell’s equation. To solve the whole field distribution of the multilayer IPM machines, the coupled boundary conditions on the rotor surface are deduced for the coupling of the rotor MEC and the analytical field distribution of the stator slot, slot opening and air-gap. The hybrid analytical model can be used to calculate the open-circuit air-gap field distribution, back electromotive force (EMF) and cogging torque of multilayer IPM machines. Compared with finite element analysis (FEA), it has the advantages of faster modeling, less computation source occupying and shorter time consuming, and meanwhile achieves the approximate accuracy. The analytical model is helpful and applicable for the open-circuit field calculation of multilayer IPM machines with any size and pole/slot number combination.

  11. Detection of Single Pt Nanoparticle Collisions by Open-Circuit Potential Changes at Ag Ultramicroelectrode

    International Nuclear Information System (INIS)

    Mun, Seon Kyu; Shin, Changhwan; Kwon, Seong Jung

    2016-01-01

    Single platinum (Pt) nanoparticle (NP) collisions were investigated with open-circuit potential (OCP) using a silver (Ag) ultramicroelectrode (UME). The Ag UME showed higher sensitivity to single Pt NP detection by the OCP method than gold (Au) UME. The detection of ⁓2 nm radius Pt NP collisions was carried out successfully using Ag UME. The magnitude of the potential step and collision frequency for the single Pt NP collision on Ag UME was investigated and compared with those of the previous work done on Au UME.

  12. Designing an Electro-Hydraulic Control Module for an Open-Circuit Variable Displacement Pump

    DEFF Research Database (Denmark)

    Pedersen, Henrik Clemmensen; Andersen, Torben Ole; Hansen, Michael Rygaard

    2005-01-01

    , in the form of an electric control signal, under varying working conditions, when having access to engine speed and actual pump pressure. The paper presents a model of both the pump and the control module, along with design considerations on which linear controllers are developed for a worst point......This paper deals with the problem of designing an electric control module for a Sauer-Danfoss Series 45 H-frame open circuit axial piston pump. The purpose of the electric control module is to replace the existing hydro-mechanical (LS) regulator, and enable the pump to follow a reference pressure...

  13. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.

    2015-01-01

    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  14. Josephson tunneling current in the presence of a time-dependent voltage

    International Nuclear Information System (INIS)

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  15. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

    Science.gov (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

    2018-02-21

    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  16. Induced Voltage in an Open Wire

    Science.gov (United States)

    Morawetz, K.; Gilbert, M.; Trupp, A.

    2017-07-01

    A puzzle arising from Faraday's law has been considered and solved concerning the question which voltage will be induced in an open wire with a time-varying homogeneous magnetic field. In contrast to closed wires where the voltage is determined by the time variance of the magnetic field and the enclosed area, in an open wire we have to integrate the electric field along the wire. It is found that the longitudinal electric field with respect to the wave vector contributes with 1/3 and the transverse field with 2/3 to the induced voltage. In order to find the electric fields the sources of the magnetic fields are necessary to know. The representation of a spatially homogeneous and time-varying magnetic field implies unavoidably a certain symmetry point or symmetry line which depend on the geometry of the source. As a consequence the induced voltage of an open wire is found to be the area covered with respect to this symmetry line or point perpendicular to the magnetic field. This in turn allows to find the symmetry points of a magnetic field source by measuring the voltage of an open wire placed with different angles in the magnetic field. We present exactly solvable models of the Maxwell equations for a symmetry point and for a symmetry line, respectively. The results are applicable to open circuit problems like corrosion and for astrophysical applications.

  17. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen

    2016-05-01

    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  18. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  19. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.

    2002-01-01

    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  20. Shaping charge excitations in chiral edge states with a time-dependent gate voltage

    Science.gov (United States)

    Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

    2018-02-01

    We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

  1. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B

    2001-01-01

    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  2. Photoelectrochemical Complexes of Fucoxanthin-Chlorophyll Protein for Bio-Photovoltaic Conversion with a High Open-Circuit Photovoltage.

    Science.gov (United States)

    Zhang, Tianning; Liu, Cheng; Dong, Wenjing; Wang, Wenda; Sun, Yan; Chen, Xin; Yang, Chunhong; Dai, Ning

    2017-12-05

    Open-circuit photovoltage (V oc ) is among the critical parameters for achieving an efficient light-to-charge conversion in existing solar photovoltaic devices. Natural photosynthesis exploits light-harvesting chlorophyll (Chl) protein complexes to transfer sunlight energy efficiently. We describe the exploitation of photosynthetic fucoxanthin-chlorophyll protein (FCP) complexes for realizing photoelectrochemical cells with a high V oc . An antenna-dependent photocurrent response and a V oc up to 0.72 V are observed and demonstrated in the bio-photovoltaic devices fabricated with photosynthetic FCP complexes and TiO 2 nanostructures. Such high V oc is determined by fucoxanthin in FCP complexes, and is rarely found in photoelectrochemical cells with other natural light-harvesting antenna. We think that the FCP-based bio-photovoltaic conversion will provide an opportunity to fabricate environmental benign photoelectrochemical cells with high V oc , and also help improve the understanding of the essential physics behind the light-to-charge conversion in photosynthetic complexes. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun

    2012-04-01

    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  4. The effect of Cr buffer layer thickness on voltage generation of thin-film thermoelectric modules

    International Nuclear Information System (INIS)

    Mizoshiri, Mizue; Mikami, Masashi; Ozaki, Kimihiro

    2013-01-01

    The effect of Cr buffer layer thickness on the open-circuit voltage generated by thin-film thermoelectric modules of Bi 0.5 Sb 1.5 Te 3 (p-type) and Bi 2 Te 2.7 Se 0.3 (n-type) materials was investigated. A Cr buffer layer, whose thickness generally needs to be optimized to improve adhesion depending on the substrate surface condition, such as roughness, was deposited between thermoelectric thin films and glass substrates. When the Cr buffer layer was 1 nm thick, the Seebeck coefficients and electrical conductivity of 1 µm thermoelectric thin films with the buffer layers were approximately equal to those of the thermoelectric films without the buffer layers. When the thickness of the Cr buffer layer was 1 µm, the same as the thermoelectric films, the Seebeck coefficients of the bilayer films were reduced by an electrical current flowing inside the Cr buffer layer and the generation of Cr 2 Te 3 . The open-circuit voltage of the thin-film thermoelectric modules decreased with an increase in the thickness of the Cr buffer layer, which was primarily induced by the electrical current flow. The reduction caused by the Cr 2 Te 3 generation was less than 10% of the total voltage generation of the modules without the Cr buffer layers. The voltage generation of thin-film thermoelectric modules could be controlled by the Cr buffer layer thickness. (paper)

  5. Utilization of the heat of mixing in open-circuit throttle refrigerators

    International Nuclear Information System (INIS)

    Zhakharov, N.D.; Anikeev, G.N.; Grezin, A.K.

    1986-01-01

    Open-circuit throttle refrigerators based on gas mixtures operate, as a rule, according to a single-stream scheme. The refrigerating effect is determined by the isothermal throttling effect of the mixture in the cylinder under the conditions at the inlet to the cryogenic unit. The authors use the heat of mixing of the cryogenic mixtures to increase the available refrigerating effect. Data are presented on mixtures of nitrogen and Freon-13; the thermodynamic properties of these compounds have been investigated experimentally over a wide range of parameters. It was found that in the case of correct selection of the scheme and complex optimization of the parameters, two-stream throttle refrigerators exceed the single-stream throttle refrigerators by at least a factor of 1.5 with respect to relative useful energy. With account taken of the design, technological, and operational parameters, that which is most promising is the scheme with mixing of the components in reverse flow

  6. Open Circuit Potential Study of Stainless Steel in Environment Containing Marine Sulphate-Reducing Bacteria

    International Nuclear Information System (INIS)

    Fathul Karim Sahrani; Madzlan Abd. Aziz; Zaharah Ibrahim; Adibah Yahya

    2008-01-01

    The corrosion potential of AISI 304 stainless steel coupons influenced by sulphate-reducing bacteria (SRB) has been studied. Pure colony of SRB was isolated from the Malaysia Marine and Heavy Engineering, Pasir Gudang, Johor. Open circuit potential measurements were carried out in variable types of culturing solutions with SRB1, SRB2, combination of SRB1 and SRB2 and without SRBs inoculated. Results showed that the corrosion potential, E oc increased in the presence of SRBs (in pure and mixed culture) compared to that of control. EDS analysis showed the strong peak of sulphur in coupon containing SRB cultures compared to the control. ESEM data showed that the high density cell of SRBs were associated with corroding sections of surface steel comparing with non-corroding sections for coupons immersed in VMNI medium containing SRBs. (author)

  7. Open circuit potential monitored digital photocorrosion of GaAs/AlGaAs quantum well microstructures

    Science.gov (United States)

    Aithal, Srivatsa; Dubowski, Jan J.

    2018-04-01

    Nanostructuring of semiconductor wafers with an atomic level depth resolution is a challenging task, primarily due to the limited availability of instruments for in situ monitoring of such processes. Conventional digital etching relies on calibration procedures and cumbersome diagnostics applied between or at the end of etching cycles. We have developed a photoluminescence (PL) based process for monitoring in situ digital photocorrosion (DPC) of GaAs/AlGaAs microstructures at rates below 0.2 nm per cycle. In this communication, we demonstrate that DPC of GaAs/AlGaAs microstructures could be monitored with open circuit potential (OCP) measured between the photocorroding surface of a microstructure and an Ag/AgCl reference electrode installed in the sample chamber. The excellent correlation between the position of both PL and OCP maxima indicates that the DPC process could be monitored in situ for materials that do not necessarily exhibit measurable PL emission.

  8. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  9. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia

    2016-01-01

    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  10. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    Science.gov (United States)

    Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.

    2016-03-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

  11. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    International Nuclear Information System (INIS)

    Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L

    2016-01-01

    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

  12. Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

    Science.gov (United States)

    Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

    2010-01-01

    In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

  13. Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

    Science.gov (United States)

    Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

    2013-01-01

    Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

  14. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles

    Science.gov (United States)

    Shirokov, Roman E.

    2018-01-01

    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  15. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.

    2006-01-01

    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  16. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: tcchang@mail.phys.nsysu.edu.tw [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)

    2014-03-31

    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  17. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

    Science.gov (United States)

    Vaccaro, S. R.

    2011-09-01

    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  18. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  19. Open-circuit fault detection and tolerant operation for a parallel-connected SAB DC-DC converter

    DEFF Research Database (Denmark)

    Park, Kiwoo; Chen, Zhe

    2014-01-01

    This paper presents an open-circuit fault detection method and its tolerant control strategy for a Parallel-Connected Single Active Bridge (PCSAB) dc-dc converter. The structural and operational characteristics of the PCSAB converter lead to several advantages especially for high power applicatio...

  20. Other origins for the fluorescence modulation of single dye molecules in open-circuit and short-circuit devices.

    Science.gov (United States)

    Teguh, Jefri S; Kurniawan, Michael; Wu, Xiangyang; Sum, Tze Chien; Yeow, Edwin K L

    2013-01-07

    Fluorescence intensity modulation of single Atto647N dye molecules in a short-circuit device and a defective device, caused by damaging an open-circuit device, is due to a variation in the excitation light focus as a result of the formation of an alternating electric current.

  1. 77 FR 37862 - Open-Circuit Self-Contained Breathing Apparatus Remaining Service-Life Indicator Performance...

    Science.gov (United States)

    2012-06-25

    .... Executive Order 13211 (Actions Concerning Regulations That Significantly Affect Energy Supply, Distribution... obstructive pulmonary disease, silicosis, neurological disorders, and cancer. Open-circuit self-contained... result in an annual effect on the economy of $100 million or more. E. Unfunded Mandates Reform Act of...

  2. Photoluminescence and Photoconductivity to Assess Maximum Open-Circuit Voltage and Carrier Transport in Hybrid Perovskites and Other Photovoltaic Materials.

    Science.gov (United States)

    Braly, Ian L; Stoddard, Ryan J; Rajagopal, Adharsh; Jen, Alex K-Y; Hillhouse, Hugh W

    2018-06-06

    Photovoltaic (PV) device development is much more expensive and time consuming than the development of the absorber layer alone. This perspective focuses on two methods that can be used to rapidly assess and develop PV absorber materials independent of device development. The absorber material properties of quasi-Fermi level splitting and carrier diffusion length under steady effective one-Sun illumination are indicators of a material's ability to achieve high VOC and JSC. These two material properties can be rapidly and simultaneously assessed with steady-state absolute intensity photoluminescence and photoconductivity measurements. As a result, these methods are extremely useful for predicting the quality and stability of PV materials prior to PV device development. Here, we summarize the methods, discuss their strengths and weaknesses, and compare photoluminescence and photoconductivity results with device performance for four hybrid perovskite compositions of various bandgaps (1.35 to 1.82 eV), CISe, CIGSe, and CZTSe.

  3. The impact of ultra-thin titania interlayers on open circuit voltage and carrier lifetime in thin film solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Moerman, David; Colbert, Adam E.; Ginger, David S., E-mail: ginger@chem.washington.edu [Department of Chemistry, University of Washington, Seattle, Washington 98195 (United States); Kim, Hyungchul; Graham, Samuel, E-mail: sgraham@gatech.edu [School of Mechanical Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States)

    2016-03-14

    We study the effects of modifying indium tin oxide electrodes with ultrathin titania (TiO{sub 2}) layers grown via plasma-enhanced atomic layer deposition (PE-ALD). We find an optimal thickness of PE-ALD-grown titania by tracking performance, which initially increases, peaks, and eventually decreases with increasing TiO{sub 2} thickness. We use scanning Kelvin probe microscopy (SKPM) to measure both the local work function and its distribution as a function of TiO{sub 2} thickness. We find that the variance in contact potential difference across the surface of the film is related to either the amorphous or anatase TiO{sub 2} form. Finally, we use local SKPM recombination rate experiments, supported by bulk transient photovoltage and charge extraction measurements. We show that the optimum TiO{sub 2} thickness is the one for which the carrier lifetime is the longest and the charge carrier density is the highest, when the TiO{sub 2} is amorphous, in agreement with the device measurements.

  4. The impact of ultra-thin titania interlayers on open circuit voltage and carrier lifetime in thin film solar cells

    International Nuclear Information System (INIS)

    Moerman, David; Colbert, Adam E.; Ginger, David S.; Kim, Hyungchul; Graham, Samuel

    2016-01-01

    We study the effects of modifying indium tin oxide electrodes with ultrathin titania (TiO_2) layers grown via plasma-enhanced atomic layer deposition (PE-ALD). We find an optimal thickness of PE-ALD-grown titania by tracking performance, which initially increases, peaks, and eventually decreases with increasing TiO_2 thickness. We use scanning Kelvin probe microscopy (SKPM) to measure both the local work function and its distribution as a function of TiO_2 thickness. We find that the variance in contact potential difference across the surface of the film is related to either the amorphous or anatase TiO_2 form. Finally, we use local SKPM recombination rate experiments, supported by bulk transient photovoltage and charge extraction measurements. We show that the optimum TiO_2 thickness is the one for which the carrier lifetime is the longest and the charge carrier density is the highest, when the TiO_2 is amorphous, in agreement with the device measurements.

  5. Anthracene-containing wide-band-gap conjugated polymers for high-open-circuit-voltage polymer solar cells.

    Science.gov (United States)

    Gong, Xue; Li, Cuihong; Lu, Zhen; Li, Guangwu; Mei, Qiang; Fang, Tao; Bo, Zhishan

    2013-07-25

    The synthesis, characterization, and photophysical and photovoltaic properties of two anthracene-containing wide-band-gap donor and acceptor (D-A) alternating conjugated polymers (P1 and P2) are described. These two polymers absorb in the range of 300-600 nm with a band gap of about 2.12 eV. Polymer solar cells with P1:PC71 BM as the active layer demonstrate a power conversion efficiency (PCE) of 2.23% with a high Voc of 0.96 V, a Jsc of 4.4 mA cm(-2) , and a comparable fill factor (FF) of 0.53 under simulated solar illumination of AM 1.5 G (100 mW cm(-2) ). In addition, P2:PC71 BM blend-based solar cells exhibit a PCE of 1.42% with a comparable Voc of 0.89 V, a Jsc of 3.0 mA cm(-2) , and an FF of 0.53. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Cloning and functional expression of a plant voltage-dependent chloride channel.

    Science.gov (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

    1996-01-01

    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  7. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    International Nuclear Information System (INIS)

    Miah, M. Idrish

    2008-01-01

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

  8. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail: m.miah@griffith.edu.au

    2008-10-15

    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

  9. Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

    International Nuclear Information System (INIS)

    Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing

    2010-01-01

    The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

  10. Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

    International Nuclear Information System (INIS)

    Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.

    1993-01-01

    The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

  11. Electrochemical Immunoassay Using Open Circuit Potential Detection Labeled by Platinum Nanoparticles

    Directory of Open Access Journals (Sweden)

    Kanokwan Charoenkitamorn

    2018-02-01

    Full Text Available In this work, a simple electrochemical immunoassay based on platinum nanoparticles (PtNPs using open circuit potential (OCP detection was developed. The detection of human chorionic gonadotropin hormone (hCG as a model analyte, was demonstrated by direct electrical detection of PtNPs in hydrazine solution using OCP measurement without any application of either potential or current to the system. Disposable screen-printed carbon electrodes (SPCEs were utilized for the development of our immunosensor, which required a sample volume as small as 2 μL. After preparation of a sandwich-type immunosystem, hydrazine solution was dropped on the electrode’s surface, which was followed immediately by electrical detection using OCP. The change of the OCP signal originated from electrocatalytic oxidation of the hydrazine on PtNPs. Under the optimal conditions of a pH of 6.0 and a hydrazine concentration of 1 mM, a detection limit of 0.28 ng mL−1 and a linearity of 0–10 ng mL−1 were obtained. The PtNP-based OCP method is a simpler electrochemical detection procedure than those obtained from other electrochemical methods and has an acceptable sensitivity and reproducibility. The simplicity of the detection procedure and the cost-effectiveness of the disposable SPCE illustrate the attractive benefits of this sensor. Moreover, it could be applied to a simplified and miniaturized diagnostic system with minimal user manipulation.

  12. Copper and brass aged at open circuit potential in slightly alkaline solutions

    International Nuclear Information System (INIS)

    Procaccini, R.; Vazquez, M.; Cere, S.

    2009-01-01

    Surface oxide films were grown on 99.99% copper and brass (copper-zinc alloy, Cu77Zn21Al2) in 0.1 mol L -1 borax solution at open circuit potential and were characterized using various experimental techniques. The composition of the passive films formed in situ on the different materials was studied using differential reflectance spectroscopy. The thickness of the oxide layers on copper and brass was compared by chronopotentiometric curves and potentiodynamic reductions. The electrical properties of each oxide were analyzed by means of electrochemical impedance spectroscopy. Their influence on the oxygen reduction reaction was also investigated using voltammetry hydrodynamic tools such as the rotating disk electrode. The results show that the incorporation of Zn to Cu in brass changes the composition and the thickness of the surface film. The films grown on brass tend to be thicker but less resistive and Zn compounds incorporate to the film. This is supported by results from reflectance and impedance spectroscopy. The kinetics of oxygen reduction is strongly inhibited on oxidized electrodes, particularly in the case of brass. The global number of exchanged electrons remains close to four and seems to be independent of the presence of surface oxides.

  13. Wireless Open-Circuit In-Plane Strain and Displacement Sensor Requiring No Electrical Connections

    Science.gov (United States)

    Woodard, Stanley E. (Inventor)

    2014-01-01

    A wireless in-plane strain and displacement sensor includes an electrical conductor fixedly coupled to a substrate subject to strain conditions. The electrical conductor is shaped between its ends for storage of an electric field and a magnetic field, and remains electrically unconnected to define an unconnected open-circuit having inductance and capacitance. In the presence of a time-varying magnetic field, the electrical conductor so-shaped resonates to generate harmonic electric and magnetic field responses. The sensor also includes at least one electrically unconnected electrode having an end and a free portion extending from the end thereof. The end of each electrode is fixedly coupled to the substrate and the free portion thereof remains unencumbered and spaced apart from a portion of the electrical conductor so-shaped. More specifically, at least some of the free portion is disposed at a location lying within the magnetic field response generated by the electrical conductor. A motion guidance structure is slidingly engaged with each electrode's free portion in order to maintain each free portion parallel to the electrical conductor so-shaped.

  14. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail: ilbilgedokme@gazi.edu.tr; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)

    2007-04-30

    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  15. rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

    International Nuclear Information System (INIS)

    Hebboul, S.E.; Garland, J.C.

    1993-01-01

    We have measured the rf-bias-current dependence of the ν/2 subharmonic spectral response of planar 300x300 Nb-Au-Nb proximity-coupled Josephson-junction arrays. The ν/2 subharmonic voltage spectrum was examined at two rf-bias frequencies, ν/ν c ∼1.4, 2.0 (ν c ∼120 MHz), and in applied magnetic fields corresponding to f=0,1/2 flux quantum per plaquette. The measurements were compared to analytical predictions for an rf-biased asymmetric superconducting quantum interference device with non-negligble loop inductance and large rf-bias-current amplitudes, based on the resistively shunted Josephson-junction model. Reasonable agreement was found between experiment and theory, suggesting that a possible origin for the observed subharmonic behavior in arrays involves an interplay between array plaquette inductances and junction critical-current variations

  16. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice.

    Science.gov (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf

    2006-03-01

    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  17. Film size-dependent voltage-modulated magnetism in multiferroic heterostructures

    Science.gov (United States)

    Hu, J.-M.; Shu, L.; Li, Z.; Gao, Y.; Shen, Y.; Lin, Y. H.; Chen, L. Q.; Nan, C. W.

    2014-01-01

    The electric-voltage-modulated magnetism in multiferroic heterostructures, also known as the converse magnetoelectric (ME) coupling, has drawn increasing research interest recently owing to its great potential applications in future low-power, high-speed electronic and/or spintronic devices, such as magnetic memory and computer logic. In this article, based on combined theoretical analysis and experimental demonstration, we investigate the film size dependence of such converse ME coupling in multiferroic magnetic/ferroelectric heterostructures, as well as exploring the interaction between two relating coupling mechanisms that are the interfacial strain and possibly the charge effects. We also briefly discuss some issues for the next step and describe new device prototypes that can be enabled by this technology. PMID:24421375

  18. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz

    2003-09-01

    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  19. Open-circuit respirometry: real-time, laboratory-based systems.

    Science.gov (United States)

    Ward, Susan A

    2018-05-04

    This review explores the conceptual and technological factors integral to the development of laboratory-based, automated real-time open-circuit mixing-chamber and breath-by-breath (B × B) gas-exchange systems, together with considerations of assumptions and limitations. Advances in sensor technology, signal analysis, and digital computation led to the emergence of these technologies in the mid-20th century, at a time when investigators were beginning to recognise the interpretational advantages of nonsteady-state physiological-system interrogation in understanding the aetiology of exercise (in)tolerance in health, sport, and disease. Key milestones include the 'Auchincloss' description of an off-line system to estimate alveolar O 2 uptake B × B during exercise. This was followed by the first descriptions of real-time automated O 2 uptake and CO 2 output B × B measurement by Beaver and colleagues and by Linnarsson and Lindborg, and mixing-chamber measurement by Wilmore and colleagues. Challenges to both approaches soon emerged: e.g., the influence of mixing-chamber washout kinetics on mixed-expired gas concentration determination, and B × B alignment of gas-concentration signals with respired flow. The challenging algorithmic and technical refinements required for gas-exchange estimation at the alveolar level have also been extensively explored. In conclusion, while the technology (both hardware and software) underpinning real-time automated gas-exchange measurement has progressively advanced, there are still concerns regarding accuracy especially under the challenging conditions of changing metabolic rate.

  20. The high voltage homopolar generator

    Science.gov (United States)

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  1. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Science.gov (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie

    2014-01-01

    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  2. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  3. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva

    2017-05-01

    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  4. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  5. Conductance of single-atom platinum contacts: Voltage dependence of the conductance histogram

    DEFF Research Database (Denmark)

    Nielsen, S.K.; Noat, Y.; Brandbyge, Mads

    2003-01-01

    The conductance of a single-atom contact is sensitive to the coupling of this contact atom to the atoms in the leads. Notably for the transition metals this gives rise to a considerable spread in the observed conductance values. The mean conductance value and spread can be obtained from the first...... peak in conductance histograms recorded from a large set of contact-breaking cycles. In contrast to the monovalent metals, this mean value for Pt depends strongly on the applied voltage bias and other experimental conditions and values ranging from about 1 G(0) to 2.5 G(0) (G(0)=2e(2)/h) have been...... reported. We find that at low bias the first peak in the conductance histogram is centered around 1.5 G(0). However, as the bias increases past 300 mV the peak shifts to 1.8 G(0). Here we show that this bias dependence is due to a geometric effect where monatomic chains are replaced by single-atom contacts...

  6. Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

    Energy Technology Data Exchange (ETDEWEB)

    Arora, N D

    1987-05-01

    A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

  7. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2001-01-01

    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  8. Damage Detection Response Characteristics of Open Circuit Resonant (SansEC) Sensors

    Science.gov (United States)

    Dudley, Kenneth L.; Szatkowski, George N.; Smith, Laura J.; Koppen, Sandra V.; Ely, Jay J.; Nguyen, Truong X.; Wang, Chuantong; Ticatch, Larry A.; Mielnik, John J.

    2013-01-01

    The capability to assess the current or future state of the health of an aircraft to improve safety, availability, and reliability while reducing maintenance costs has been a continuous goal for decades. Many companies, commercial entities, and academic institutions have become interested in Integrated Vehicle Health Management (IVHM) and a growing effort of research into "smart" vehicle sensing systems has emerged. Methods to detect damage to aircraft materials and structures have historically relied on visual inspection during pre-flight or post-flight operations by flight and ground crews. More quantitative non-destructive investigations with various instruments and sensors have traditionally been performed when the aircraft is out of operational service during major scheduled maintenance. Through the use of reliable sensors coupled with data monitoring, data mining, and data analysis techniques, the health state of a vehicle can be detected in-situ. NASA Langley Research Center (LaRC) is developing a composite aircraft skin damage detection method and system based on open circuit SansEC (Sans Electric Connection) sensor technology. Composite materials are increasingly used in modern aircraft for reducing weight, improving fuel efficiency, and enhancing the overall design, performance, and manufacturability of airborne vehicles. Materials such as fiberglass reinforced composites (FRC) and carbon-fiber-reinforced polymers (CFRP) are being used to great advantage in airframes, wings, engine nacelles, turbine blades, fairings, fuselage structures, empennage structures, control surfaces and aircraft skins. SansEC sensor technology is a new technical framework for designing, powering, and interrogating sensors to detect various types of damage in composite materials. The source cause of the in-service damage (lightning strike, impact damage, material fatigue, etc.) to the aircraft composite is not relevant. The sensor will detect damage independent of the cause

  9. Reducing burn-in voltage loss in polymer solar cells by increasing the polymer crystallinity

    KAUST Repository

    Heumueller, Thomas

    2014-08-01

    In order to commercialize polymer solar cells, the fast initial performance losses present in many high efficiency materials will have to be managed. This burn-in degradation is caused by light-induced traps and its characteristics depend on which polymer is used. We show that the light-induced traps are in the bulk of the active layer and we find a direct correlation between their presence and the open-circuit voltage loss in devices made with amorphous polymers. Solar cells made with crystalline polymers do not show characteristic open circuit voltage losses, even though light-induced traps are also present in these devices. This indicates that crystalline materials are more resistant against the influence of traps on device performance. Recent work on crystalline materials has shown there is an energetic driving force for charge carriers to leave amorphous, mixed regions of bulk heterojunctions, and charges are dominantly transported in pure, ordered phases. This energetic landscape allows efficient charge generation as well as extraction and also may benefit the stability against light-induced traps. This journal is © the Partner Organisations 2014.

  10. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A

    2010-01-01

    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  11. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA.

    Science.gov (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy

    2004-10-01

    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  12. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    International Nuclear Information System (INIS)

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  13. Frequency and voltage dependent electrical responses of poly(triarylamine thin film-based organic Schottky diode

    Directory of Open Access Journals (Sweden)

    Mohamad Khairul Anuar

    2017-01-01

    Full Text Available A metal-organic-metal (MOM type Schottky diode based on poly (triarylamine (PTAA thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f and capacitance-voltage (C-V-f characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit. Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz but decreases at high frequency (1 – 10 kHz. The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV−1cm−2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC signal.

  14. Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

    Science.gov (United States)

    Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

    2017-11-01

    A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

  15. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.

    1994-01-01

    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  16. Temperature Dependences of Torque Generation and Membrane Voltage in the Bacterial Flagellar Motor

    Science.gov (United States)

    Inoue, Yuichi; Baker, Matthew A.B.; Fukuoka, Hajime; Takahashi, Hiroto; Berry, Richard M.; Ishijima, Akihiko

    2013-01-01

    In their natural habitats bacteria are frequently exposed to sudden changes in temperature that have been shown to affect their swimming. With our believed to be new methods of rapid temperature control for single-molecule microscopy, we measured here the thermal response of the Na+-driven chimeric motor expressed in Escherichia coli cells. Motor torque at low load (0.35 μm bead) increased linearly with temperature, twofold between 15°C and 40°C, and torque at high load (1.0 μm bead) was independent of temperature, as reported for the H+-driven motor. Single cell membrane voltages were measured by fluorescence imaging and these were almost constant (∼120 mV) over the same temperature range. When the motor was heated above 40°C for 1–2 min the torque at high load dropped reversibly, recovering upon cooling below 40°C. This response was repeatable over as many as 10 heating cycles. Both increases and decreases in torque showed stepwise torque changes with unitary size ∼150 pN nm, close to the torque of a single stator at room temperature (∼180 pN nm), indicating that dynamic stator dissociation occurs at high temperature, with rebinding upon cooling. Our results suggest that the temperature-dependent assembly of stators is a general feature of flagellar motors. PMID:24359752

  17. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation.

    Science.gov (United States)

    Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L

    1993-03-01

    The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.

  18. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    International Nuclear Information System (INIS)

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  19. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

    Science.gov (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

    2012-01-01

    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  20. Effects of gamma irradiation on voltage-dependant NA+ and K+ currents in N1E-115 cells

    International Nuclear Information System (INIS)

    Diserbo, M.; Barbier, M.; Quignard, J.F.

    1998-01-01

    Effects of 15 Gy gamma irradiation on voltage-dependent Na + and K + currents in differentiated N1E-115 cells are studied by using whole cell recording. Only, we observed an activation of Na + currents at a lower threshold. (authors)

  1. Fault-Tolerant Control of ANPC Three-Level Inverter Based on Order-Reduction Optimal Control Strategy under Multi-Device Open-Circuit Fault.

    Science.gov (United States)

    Xu, Shi-Zhou; Wang, Chun-Jie; Lin, Fang-Li; Li, Shi-Xiang

    2017-10-31

    The multi-device open-circuit fault is a common fault of ANPC (Active Neutral-Point Clamped) three-level inverter and effect the operation stability of the whole system. To improve the operation stability, this paper summarized the main solutions currently firstly and analyzed all the possible states of multi-device open-circuit fault. Secondly, an order-reduction optimal control strategy was proposed under multi-device open-circuit fault to realize fault-tolerant control based on the topology and control requirement of ANPC three-level inverter and operation stability. This control strategy can solve the faults with different operation states, and can works in order-reduction state under specific open-circuit faults with specific combined devices, which sacrifices the control quality to obtain the stability priority control. Finally, the simulation and experiment proved the effectiveness of the proposed strategy.

  2. Bias voltage dependence of a flux-sensitive Al/GaAs/Al (SNS) interferometer

    DEFF Research Database (Denmark)

    Kutchinsky, Jonatan; Taboryski, Rafael Jozef; Hansen, Jørn Bindslev

    1999-01-01

    bias voltage the fabricated interferometers typically exhibit 3% sinusoidal modulation of the conductance as a function of a magnetic field applied perpendicular to the loop. The conductance modulation is caused by resonant Andreev states in the normal GaAs region of the device. With increasing bias...... voltage of the order of a few microvolts the device is driven out of resonance and the conductance oscillations are extinguished. However, at higher bias voltage corresponding to the superconducting energy gap of Al (178 mu V) the conductance oscillations reappear but with reduced amplitude...

  3. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia

    2011-02-01

    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  4. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Science.gov (United States)

    Dharia, Sameera; Rabbitt, Richard D

    2011-02-28

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  5. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation

    OpenAIRE

    Dharia, Sameera; Rabbitt, Richard D.

    2011-01-01

    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  6. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  7. Voltage-probe-position dependence and magnetic-flux contribution to the measured voltage in ac transport measurements: which measuring circuit determines the real losses?

    International Nuclear Information System (INIS)

    Pe, T.; McDonald, J.; Clem, J.R.

    1995-01-01

    The voltage V ab measured between two voltage taps a and b during magnetic flux transport in a type-II superconductor carrying current I is the sum of two contributions, the line integral from a to b of the electric field along an arbitrary path C s through the superconductor and a term proportional to the time rate of change of magnetic flux through the area bounded by the path C s and the measuring circuit leads. When the current I(t) is oscillating with time t, the apparent ac loss (the time average of the product IV ab ) depends upon the measuring circuit used. Only when the measuring-circuit leads are brought out far from the surface does the apparent power dissipation approach the real (or true) ac loss associated with the length of sample probed. Calculations showing comparisons between the apparent and real ac losses in a flat strip of rectangular cross section will be presented, showing the behavior as a function of the measuring-circuit dimensions. Corresponding calculations also are presented for a sample of elliptical cross section

  8. Bias voltage dependence of magnetic tunnel junctions comprising amorphous ferromagnetic CoFeSiB layer with double barriers

    International Nuclear Information System (INIS)

    Yim, H.I.; Lee, S.Y.; Hwang, J.Y.; Rhee, J.R.; Chun, B.S.; Wang, K.L.; Kim, Y.K.; Kim, T.W.; Lee, S.S.; Hwang, D.G.

    2008-01-01

    Double-barrier magnetic tunnel junctions (DMTJs) with and without an amorphous ferromagnetic material such as CoFeSiB 10, CoFe 5/CoFeSiB 5, and CoFe 10 (nm) were prepared and compared to investigate the bias voltage dependence of the tunneling magnetoresistance (TMR) ratio. Typical DMTJ structures were Ta 45/Ru 9.5/IrMn 10/CoFe 7/AlO x /free layer 10/AlO x /CoFe 7/IrMn 10/Ru 60 (in nanometers). The interlayer coupling field and the normalized TMR ratios at the applied voltages of +0.4 and -0.4 V of the amorphous CoFeSiB free-layer DMTJ offer lower and higher values than that of the polycrystalline CoFe free-layer DMTJ, respectively. An amorphous ferromagnetic CoFeSiB layer improves the interface roughness of the free layer/tunnel barrier and, as a result, the interlayer coupling field and bias voltage dependence of the TMR ratio are suppressed at a given voltage. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  9. Bias voltage dependence of tunneling magnetoresistance in granular C60–Co films with current-perpendicular-to-plane geometry

    International Nuclear Information System (INIS)

    Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki

    2012-01-01

    Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.

  10. Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

    International Nuclear Information System (INIS)

    Jia Yun-Peng; Zhao Bao; Wu Yu; Zhou Xuan; Li Zhe; Tan Jian; Yang Fei

    2015-01-01

    The temperature dependences of forward voltage drop (V F ) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (E C -0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested V F results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. (paper)

  11. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle

    2012-01-01

    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  12. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav

    2006-01-01

    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  13. NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

    Science.gov (United States)

    Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

    2018-01-01

    Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

    Science.gov (United States)

    Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

    2017-08-01

    This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

  15. Current-voltage curve of sodium channels and concentration dependence of sodium permeability in frog skin

    DEFF Research Database (Denmark)

    Fuchs, W; Larsen, Erik Hviid; Lindemann, B

    1977-01-01

    1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...

  16. E-cigarettes: voltage- and concentration-dependent loss in human lung adenocarcinoma viability.

    Science.gov (United States)

    Otręba, Michał; Kośmider, Leon; Knysak, Jakub; Warncke, Jared D; Sobczak, Andrzej

    2018-04-17

    E-cigarettes are used by millions of people despite the fact that the harmful effect of aerosol emitted from these products to the human organism is still not clear. In this paper, toxicity of vapor generated using different solutions and battery output voltage on A549 cells viability is presented. The obtained EC 50 values for commercially available propylene glycol/glycerol solution 1:1 e-liquids based on 3.2 V (0.127%), 4.0 V (0.112%) and 4.8 V (0.038%) were about 1.5-4.5 times higher than in tobacco smoke (0.0086%). Furthermore, it was shown that the increase of battery output voltage decreased A549 cell viability. In addition, commercially available extracts were more cytotoxic than laboratory made extracts. Owing to the expansiveness of e-cigarettes, it is very important to estimate their impact on public health. Our results not only confirm less cytotoxicity of e-liquid aerosol than cigarette smoke, but also demonstrate that solutions used in e-liquids and, for the first time, battery output voltage have a significant impact on cytotoxicity of e-cigarette vapor. Thus, the results of this study are very important for the current and future legal regulations on e-cigarettes. Copyright © 2018 John Wiley & Sons, Ltd.

  17. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

    Science.gov (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A

    1999-07-01

    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  18. Size-dependent dynamic stability analysis of microbeams actuated by piezoelectric voltage based on strain gradient elasticity theory

    Energy Technology Data Exchange (ETDEWEB)

    Sahmani, Saeid; Bahrami, Mohsen [Amirkabir University of Technology, Tehran (Iran, Islamic Republic of)

    2015-01-15

    In the current paper, dynamic stability analysis of microbeams subjected to piezoelectric voltage is presented in which the microbeam is integrated with piezoelectric layers on the lower and upper surfaces. Both of the flutter and divergence instabilities of microbeams with clamped-clamped and clamped-free boundary conditions are predicted corresponding to various values of applied voltage. To take size effect into account, the classical Timoshenko beam theory in conjunction with strain gradient elasticity theory is utilized to develop nonclassical beam model containing three additional internal length scale parameters. By using Hamilton's principle, the higher-order governing differential equations and associated boundary conditions are derived. Afterward, generalized differential quadrature method is employed to discretize the size-dependent governing differential equations along with clamped-clamped and clamped-free end supports. The critical piezoelectric voltages corresponding to various values dimensionless length scale parameter are evaluated and compared with those predicted by the classical beam theory. It is revealed that in the case of clamped-free boundary conditions, the both of flutter and divergence instabilities occur. However, for the clamped-clamped microbeams, only divergence instability takes place.

  19. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries.

    Science.gov (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W

    2016-02-01

    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  20. Angular dependence of SiO2 etch rate at various bias voltages in a high density CHF3 plasma

    International Nuclear Information System (INIS)

    Lee, Gyeo-Re; Hwang, Sung-Wook; Min, Jae-Ho; Moon, Sang Heup

    2002-01-01

    The dependence of the SiO 2 etch rate on the angle of ions incident on the substrate surface was studied over a bias voltage range from -20 to -600 V in a high-density CHF 3 plasma using a Faraday cage to control the ion incident angle. The effect of the bottom plane on the sidewall etching was also examined. Differences in the characteristics of the etch rate as a function of the ion angle were observed for different bias voltage regions. When the absolute value of the bias voltage was smaller than 200 V, the normalized etch rate (NER) defined as the etch rate normalized by the rate on the horizontal surface, changed following a cosine curve with respect to the ion incident angle, defined as the angle between the ion direction and the normal of the substrate surface. When the magnitude of the bias voltage was larger than 200 V, the NER was deviated to higher values from those given by a cosine curve at ion angles between 30 deg. and 70 deg. , and then drastically decreased at angles higher than 70 deg. until a net deposition was observed at angles near 90 deg. . The characteristic etch-rate patterns at ion angles below 70 deg. were determined by the ion energy transferred to the surface, which affected the SiO 2 etch rate and, simultaneously, the rate of removal of a fluorocarbon polymer film formed on the substrate surface. At high ion angles, particles emitted from the bottom plane contributed to polymer formation on and affected the etching characteristics of the substrate

  1. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz

    2012-10-01

    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  2. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.

    1986-01-01

    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  3. Temperature dependence of current–voltage characteristics of Au/n ...

    Indian Academy of Sciences (India)

    Unknown

    2000-05-05

    May 5, 2000 ... factor with temperature has been explained considering lateral inhomogeneities in the Schottky barrier height ... The dependence of SBH on temperature can give ... effect in MS contacts, Tung has modeled the influence.

  4. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore.

    Science.gov (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A

    2017-05-01

    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  5. Modeling and interpretation of electrical impedance spectra of dye solar cells operated under open-circuit conditions

    International Nuclear Information System (INIS)

    Kern, R.; Sastrawan, R.; Ferber, J.; Stangl, R.; Luther, J.

    2002-01-01

    Electrical impedance spectroscopy (EIS) was applied in order to investigate electrochemical nanocrystalline TiO 2 dye solar cells (DSC). Typically, three characteristic frequency peaks were observed in the spectra. These frequency peaks could be explained by variations of cell parameters and by comparison with intensity-modulated photovoltage spectroscopy (IMVS). It was shown that the low-frequency peak (in the mHz range) corresponds to the Nernstian diffusion within the electrolyte, while the middle-frequency peak (in the 10-100 Hz range) reflects the properties of the photoinjected electrons within the TiO 2 . The high-frequency peak (in the kHz range) corresponds to the charge-transfer at the platinum counter electrode. For a detailed analysis of the spectra, a model was developed which allows the evaluation of EIS spectra, measured under bias illumination and under open-circuit conditions. The influence of cell parameters such as the TiO 2 layer thickness, cell thickness, charge-transfer resistance of the platinum counter electrode, and the lifetime of the photoinjected electrons, on the impedance spectra was studied both experimentally and theoretically. Finally, it is shown that EIS is a measurement method suited well for the investigation of the long-term stability of DSC, as changes of the inner cell parameters can be revealed

  6. Transport characteristics of n-ZnO/p-Si heterojunction as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Djiokap, S.R. Tankio, E-mail: stive.tankiodjiokap@nmmu.ac.za; Urgessa, Z.N.; Mbulanga, C.M.; Venter, A.; Botha, J.R.

    2016-01-01

    Zinc oxide (ZnO) nanorods have been synthesized by a two-step chemical bath deposition process on silicon substrates having different dopant densities and orientations. Scanning electron microscopy and X-ray diffraction analysis reveal that the orientation of the Si substrate does not affect the orientation, distribution or crystallinity of the nanostructures. The electrical properties of the ZnO/Si heterojunction are also investigated by current–voltage (I–V) measurements. The ideality factor is found to be 2.6 at 295 K, indicating that complex current transport mechanisms are at play. Temperature dependent I–V characteristics have been used to determine the dominant transport mechanism. The experimental results suggest that in the low bias region the current is dominated by a trap assisted multi-step tunneling process.

  7. Study of the Dependency on Magnetic Field and Bias Voltage of an AC-Biased TES Microcalorimeter

    Science.gov (United States)

    Gottardi, L.; Bruijn, M.; denHartog, R.; Hoevers, H.; deKorte, P.; vanderKuur, J.; Linderman, M.; Adams, J.; Bailey, C.; Bandler, S.; hide

    2012-01-01

    At SRON we are studying the performance of a Goddard Space Flight Center single pixel TES microcalorimeter operated in an AC bias configuration. For x-ray photons at 6 keV the pixel shows an x-ray energy resolution Delta E(sub FWHM) = 3.7 eV, which is about a factor 2 worse than the energy resolution observed in an identical DC-biased pixel. In order to better understand the reasons for this discrepancy we characterized the detector as a function of temperature, bias working point and applied perpendicular magnetic field. A strong periodic dependency of the detector noise on the TES AC bias voltage is measured. We discuss the results in the framework of the recently observed weak-link behaviour of a TES microcalorimeter.

  8. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    OpenAIRE

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  9. Open Circuit Resonant (SansEC) Sensor Technology for Lightning Mitigation and Damage Detection and Diagnosis for Composite Aircraft Applications

    Science.gov (United States)

    Szatkowski, George N.; Dudley, Kenneth L.; Smith, Laura J.; Wang, Chuantong; Ticatch, Larry A.

    2014-01-01

    Traditional methods to protect composite aircraft from lightning strike damage rely on a conductive layer embedded on or within the surface of the aircraft composite skin. This method is effective at preventing major direct effect damage and minimizes indirect effects to aircraft systems from lightning strike attachment, but provides no additional benefit for the added parasitic weight from the conductive layer. When a known lightning strike occurs, the points of attachment and detachment on the aircraft surface are visually inspected and checked for damage by maintenance personnel to ensure continued safe flight operations. A new multi-functional lightning strike protection (LSP) method has been developed to provide aircraft lightning strike protection, damage detection and diagnosis for composite aircraft surfaces. The method incorporates a SansEC sensor array on the aircraft exterior surfaces forming a "Smart skin" surface for aircraft lightning zones certified to withstand strikes up to 100 kiloamperes peak current. SansEC sensors are open-circuit devices comprised of conductive trace spiral patterns sans (without) electrical connections. The SansEC sensor is an electromagnetic resonator having specific resonant parameters (frequency, amplitude, bandwidth & phase) which when electromagnetically coupled with a composite substrate will indicate the electrical impedance of the composite through a change in its resonant response. Any measureable shift in the resonant characteristics can be an indication of damage to the composite caused by a lightning strike or from other means. The SansEC sensor method is intended to diagnose damage for both in-situ health monitoring or ground inspections. In this paper, the theoretical mathematical framework is established for the use of open circuit sensors to perform damage detection and diagnosis on carbon fiber composites. Both computational and experimental analyses were conducted to validate this new method and system for

  10. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua [Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 and Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States); NRE, 202 Nuclear Science Building, University of Florida, P.O. Box 118300, Gainesville, Florida 32611-8300 and Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); ViewRay Inc., 2 Thermo Fisher Way, Oakwood Village, Ohio 44146 (United States); Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States)

    2010-02-15

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm{sup 3} and a diode of surface area 0.64 mm{sup 2}. The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm{sup 2} field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a {+-}0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping

  11. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    International Nuclear Information System (INIS)

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua

    2010-01-01

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm 3 and a diode of surface area 0.64 mm 2 . The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm 2 field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a ±0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping parameter between in

  12. Characterization of bacterial and archaeal communities in air-cathode microbial fuel cells, open circuit and sealed-off reactors

    KAUST Repository

    Chehab, Noura A.

    2013-06-18

    A large percentage of organic fuel consumed in a microbial fuel cell (MFC) is lost as a result of oxygen transfer through the cathode. In order to understand how this oxygen transfer affects the microbial community structure, reactors were operated in duplicate using three configurations: closed circuit (CC; with current generation), open circuit (OC; no current generation), and sealed off cathodes (SO; no current, with a solid plate placed across the cathode). Most (98 %) of the chemical oxygen demand (COD) was removed during power production in the CC reactor (maximum of 640 ± 10 mW/m 2), with a low percent of substrate converted to current (coulombic efficiency of 26.5 ± 2.1 %). Sealing the cathode reduced COD removal to 7 %, but with an open cathode, there was nearly as much COD removal by the OC reactor (94.5 %) as the CC reactor. Oxygen transfer into the reactor substantially affected the composition of the microbial communities. Based on analysis of the biofilms using 16S rRNA gene pyrosequencing, microbes most similar to Geobacter were predominant on the anodes in the CC MFC (72 % of sequences), but the most abundant bacteria were Azoarcus (42 to 47 %) in the OC reactor, and Dechloromonas (17 %) in the SO reactor. Hydrogenotrophic methanogens were most predominant, with sequences most similar to Methanobacterium in the CC and SO reactor, and Methanocorpusculum in the OC reactors. These results show that oxygen leakage through the cathode substantially alters the bacterial anode communities, and that hydrogenotrophic methanogens predominate despite high concentrations of acetate. The predominant methanogens in the CC reactor most closely resembled those in the SO reactor, demonstrating that oxygen leakage alters methanogenic as well as general bacterial communities. © 2013 Springer-Verlag Berlin Heidelberg.

  13. Effects of mass airflow rate through an open-circuit gas quantification system when measuring carbon emissions.

    Science.gov (United States)

    Gunter, Stacey A; Bradford, James A; Moffet, Corey A

    2017-01-01

    Methane (CH) and carbon dioxide (CO) represent 11 and 81%, respectively, of all anthropogenic greenhouse gas emissions. Agricultural CH emissions account for approximately 43% of all anthropogenic CH emissions. Most agricultural CH emissions are attributed to enteric fermentation within ruminant livestock; hence, the heightened interest in quantifying and mitigating this source. The automated, open-circuit gas quantification system (GQS; GreenFeed, C-Lock, Inc., Rapid City, SD) evaluated here can be placed in a pasture with grazing cattle and can measure their CH and CO emissions with spot sampling. However, improper management of the GQS can have an erroneous effect on emission estimates. One factor affecting the quality of emission estimates is the airflow rates through the GQS to ensure a complete capture of the breath cloud emitted by the animal. It is hypothesized that at lower airflow rates this cloud will be incompletely captured. To evaluate the effect of airflow rate through the GQS on emission estimates, a data set was evaluated with 758 CO and CH emission estimates with a range in airflows of 10.7 to 36.6 L/s. When airflow through the GQS was between 26.0 and 36.6 L/s, CO and CH emission estimates were not affected ( = 0.14 and 0.05, respectively). When airflow rates were less than 26.0 L/s, CO and CH emission estimates were lower and decreased as airflow rate decreased ( emissions are underestimated. Maintaining mass airflow through a GQS at rates greater than 26 L/s is important for producing high quality CO and CH emission estimates.

  14. Characterization of bacterial and archaeal communities in air-cathode microbial fuel cells, open circuit and sealed-off reactors

    KAUST Repository

    Chehab, Noura A.; Li, Dong; Amy, Gary L.; Logan, Bruce E.; Saikaly, Pascal

    2013-01-01

    A large percentage of organic fuel consumed in a microbial fuel cell (MFC) is lost as a result of oxygen transfer through the cathode. In order to understand how this oxygen transfer affects the microbial community structure, reactors were operated in duplicate using three configurations: closed circuit (CC; with current generation), open circuit (OC; no current generation), and sealed off cathodes (SO; no current, with a solid plate placed across the cathode). Most (98 %) of the chemical oxygen demand (COD) was removed during power production in the CC reactor (maximum of 640 ± 10 mW/m 2), with a low percent of substrate converted to current (coulombic efficiency of 26.5 ± 2.1 %). Sealing the cathode reduced COD removal to 7 %, but with an open cathode, there was nearly as much COD removal by the OC reactor (94.5 %) as the CC reactor. Oxygen transfer into the reactor substantially affected the composition of the microbial communities. Based on analysis of the biofilms using 16S rRNA gene pyrosequencing, microbes most similar to Geobacter were predominant on the anodes in the CC MFC (72 % of sequences), but the most abundant bacteria were Azoarcus (42 to 47 %) in the OC reactor, and Dechloromonas (17 %) in the SO reactor. Hydrogenotrophic methanogens were most predominant, with sequences most similar to Methanobacterium in the CC and SO reactor, and Methanocorpusculum in the OC reactors. These results show that oxygen leakage through the cathode substantially alters the bacterial anode communities, and that hydrogenotrophic methanogens predominate despite high concentrations of acetate. The predominant methanogens in the CC reactor most closely resembled those in the SO reactor, demonstrating that oxygen leakage alters methanogenic as well as general bacterial communities. © 2013 Springer-Verlag Berlin Heidelberg.

  15. Down-regulation of voltage-dependent sodium channels initiated by sodium influx in developing neurons

    International Nuclear Information System (INIS)

    Dargent, B.; Couraud, F.

    1990-01-01

    To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro

  16. Cell-type-dependent action potentials and voltage-gated currents in mouse fungiform taste buds.

    Science.gov (United States)

    Kimura, Kenji; Ohtubo, Yoshitaka; Tateno, Katsumi; Takeuchi, Keita; Kumazawa, Takashi; Yoshii, Kiyonori

    2014-01-01

    Taste receptor cells fire action potentials in response to taste substances to trigger non-exocytotic neurotransmitter release in type II cells and exocytotic release in type III cells. We investigated possible differences between these action potentials fired by mouse taste receptor cells using in situ whole-cell recordings, and subsequently we identified their cell types immunologically with cell-type markers, an IP3 receptor (IP3 R3) for type II cells and a SNARE protein (SNAP-25) for type III cells. Cells not immunoreactive to these antibodies were examined as non-IRCs. Here, we show that type II cells and type III cells fire action potentials using different ionic mechanisms, and that non-IRCs also fire action potentials with either of the ionic mechanisms. The width of action potentials was significantly narrower and their afterhyperpolarization was deeper in type III cells than in type II cells. Na(+) current density was similar in type II cells and type III cells, but it was significantly smaller in non-IRCs than in the others. Although outwardly rectifying current density was similar between type II cells and type III cells, tetraethylammonium (TEA) preferentially suppressed the density in type III cells and the majority of non-IRCs. Our mathematical model revealed that the shape of action potentials depended on the ratio of TEA-sensitive current density and TEA-insensitive current one. The action potentials of type II cells and type III cells under physiological conditions are discussed. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  17. Thermally-induced voltage alteration for integrated circuit analysis

    Energy Technology Data Exchange (ETDEWEB)

    Cole, E.I. Jr.

    2000-06-20

    A thermally-induced voltage alteration (TIVA) apparatus and method are disclosed for analyzing an integrated circuit (IC) either from a device side of the IC or through the IC substrate to locate any open-circuit or short-circuit defects therein. The TIVA apparatus uses constant-current biasing of the IC while scanning a focused laser beam over electrical conductors (i.e. a patterned metallization) in the IC to produce localized heating of the conductors. This localized heating produces a thermoelectric potential due to the Seebeck effect in any conductors with open-circuit defects and a resistance change in any conductors with short-circuit defects, both of which alter the power demand by the IC and thereby change the voltage of a source or power supply providing the constant-current biasing. By measuring the change in the supply voltage and the position of the focused and scanned laser beam over time, any open-circuit or short-circuit defects in the IC can be located and imaged. The TIVA apparatus can be formed in part from a scanning optical microscope, and has applications for qualification testing or failure analysis of ICs.

  18. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon.

    Science.gov (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin

    2013-09-01

    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  19. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents

    Science.gov (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.

    2011-01-01

    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  20. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  1. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters

    2017-12-01

    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  2. Thieno[3,4-c]Pyrrole-4,6-Dione-Based Polymer Acceptors for High Open-Circuit Voltage All-Polymer Solar Cells

    KAUST Repository

    Liu, Shengjian; Song, Xin; Thomas, Simil; Kan, Zhipeng; Cruciani, Federico; Laquai, Fré dé ric; Bredas, Jean-Luc; Beaujuge, Pierre

    2017-01-01

    limits the perspectives to meet the 10% efficiency threshold in all-polymer solar cells. This report examines two polymer acceptor analogs composed of thieno[3,4-c]pyrrole-4,6-dione (TPD) and 3,4-difluorothiophene ([2F]T) motifs, and their BHJ solar cell

  3. Strategies to reduce the open-circuit voltage deficit in Cu2ZnSn(S,Se)4 thin film solar cells

    Science.gov (United States)

    Kim, Jekyung; Shin, Byungha

    2017-09-01

    Cu2ZnSn(S,Se)4 thin film solar cell has attracted significant attention in thin film solar cell technologies considering its low-cost, non-toxicity, and earth-abundance. However, the highest efficiency still remains at 12.6%, far below the theoretical efficiency of Shockley-Queisser (SQ) limit of around 30%. The limitation behind such shortcoming in the device performance was reported to stem primarily from a high V oc deficit compared to other thin film solar cell technologies such as CdTe or Cu(In,Ga)Se2 (CIGS), whose origins are attributed to the prevalence of band tailing from cation disordering as well as to the high recombination at the interfaces. In this report, systematic studies on the causes of a high V oc deficit and associated remarkable approaches to achieve high V oc have been reviewed, provided with a guidance on the future direction of CZTSSe research in resolving the high V oc deficit issue. [Figure not available: see fulltext.

  4. Controlled Conjugated Backbone Twisting for an Increased Open-Circuit Voltage while Having a High Short-Circuit Current in Poly(hexylthiophene) Derivatives

    KAUST Repository

    Ko, Sangwon; Hoke, Eric T.; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D.; Bré das, Jean-Luc; Salleo, Alberto; Bao, Zhenan

    2012-01-01

    and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone-due to an increase in the polymer ionization potential-while the short-circuit current decreased

  5. Polypyrrole: FeOx·ZnO nanoparticle solar cells with breakthrough open-circuit voltage prepared from relatively stable liquid dispersions

    KAUST Repository

    Zong, Baoyu; Ho, Pin; Zhang, Zhiguo; Ng, Gingmeng; Yao, Kui; Guo, Zaibing

    2014-01-01

    in open air from relatively stable liquid dark-color polypyrrole-based dispersions, which were synthesized using appropriate surfactants during the in situ polymerization of pyrrole with FeCl3 or both H2O2 and FeCl3 as the oxidizers. The performance

  6. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia

    2015-01-01

    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  7. Annealing-temperature-dependent voltage-sign reversal in all-oxide spin Seebeck devices using RuO2

    Science.gov (United States)

    Kirihara, Akihiro; Ishida, Masahiko; Yuge, Ryota; Ihara, Kazuki; Iwasaki, Yuma; Sawada, Ryohto; Someya, Hiroko; Iguchi, Ryo; Uchida, Ken-ichi; Saitoh, Eiji; Yorozu, Shinichi

    2018-04-01

    Thermoelectric converters based on the spin Seebeck effect (SSE) have attracted great attention due to their potential to offer novel applications such as energy harvesting and heat-flow sensing. For converting a SSE-induced spin current into an electric current, a transition metal film such as Pt, which exhibits large inverse spin-Hall effect (ISHE), has been typically used. In this work, we show an all-oxide SSE device using ruthenium oxide (RuO2) as a conductive film. We found that both the sign and magnitude of the SSE-induced ISHE voltage V appearing in the RuO2 film changes depending on the post annealing temperature, and that the magnitude can become larger than that of a standard SSE device using Pt. The similar sign change was also observed in Hall-resistance measurements of the RuO2 films. X-ray absorption fine structure (XAFS) spectra of as-deposited and annealed RuO2 revealed that the annealing process substantially improved the long-range crystalline order in RuO2. This suggests that change in the crystalline order may modify the dominant ISHE mechanism or electronic states in RuO2, leading to the sign reversal of V as well as the Hall coefficient. Our result demonstrates that RuO2 is an interesting material not only as a practical ISHE film but also as a testbed to study physics of spin-to-charge converters that depend on their crystalline order.

  8. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel.

    Science.gov (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou

    2012-01-01

    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  9. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M

    1993-01-01

    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  10. The irradiance and temperature dependent mathematical model for estimation of photovoltaic panel performances

    International Nuclear Information System (INIS)

    Barukčić, M.; Ćorluka, V.; Miklošević, K.

    2015-01-01

    Highlights: • The temperature and irradiance dependent model for the I–V curve estimation is presented. • The purely mathematical model based on the analysis of the I–V curve shape is presented. • The model includes the Gompertz function with temperature and irradiance dependent parameters. • The input data are extracted from the data sheet I–V curves. - Abstract: The temperature and irradiance dependent mathematical model for photovoltaic panel performances estimation is proposed in the paper. The base of the model is the mathematical function of the photovoltaic panel current–voltage curve. The model of the current–voltage curve is based on the sigmoid function with temperature and irradiance dependent parameters. The temperature and irradiance dependencies of the parameters are proposed in the form of analytic functions. The constant parameters are involved in the analytical functions. The constant parameters need to be estimated to get the temperature and irradiance dependent current–voltage curve. The mathematical model contains 12 constant parameters and they are estimated by using the evolutionary algorithm. The optimization problem is defined for this purpose. The optimization problem objective function is based on estimated and extracted (measured) current and voltage values. The current and voltage values are extracted from current–voltage curves given in datasheet of the photovoltaic panels. The new procedure for estimation of open circuit voltage value at any temperature and irradiance is proposed in the model. The performance of the proposed mathematical model is presented for three different photovoltaic panel technologies. The simulation results indicate that the proposed mathematical model is acceptable for estimation of temperature and irradiance dependent current–voltage curve and photovoltaic panel performances within temperature and irradiance ranges

  11. Subcell Light Current-Voltage Characterization of Irradiated Multijunction Solar Cell

    Directory of Open Access Journals (Sweden)

    Walker Don

    2017-01-01

    Full Text Available The degradation of individual subcell J-V parameters, such as short circuit current, open circuit voltage, fill factor, and power of a GaInP/GaInAs/Ge triple junction solar cell by 1 MeV electrons were derived utilizing the spectral reciprocity relation between electroluminescence and external quantum efficiency. After exposure to a fluence of 1 × 1015 1 MeV electrons, it was observed that up to 67% of the voltage loss is from the middle, GaInAs subcell. Also, the dark saturation current of the Ge and GaInAs subcells increased but a simultaneous decrease in ideality factor caused a reduction of the open circuit voltage. The reduced ideality factor further indicates a change in the primary recombination mechanism.

  12. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels.

    Science.gov (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio

    2010-09-15

    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  13. Dependences of the geometrical parameters of cell community on stimulation voltage and frequency in chick embryonic cardiomyocytes

    Science.gov (United States)

    Fujii, Koki; Nomura, Fumimasa; Kaneko, Tomoyuki

    2018-03-01

    To investigate the optimal conditions for electrical stimulation, communities of lined-up chick embryonic cardiomyocytes were evaluated in terms of their threshold voltage for pacing (PVMin) and the half-maximum paced frequency (PF50), with a focus on the following factors: (1) the orientation of the major axis of cell communities to the electric field (EF) direction as the external factor; (2) the number of cells in a cell community, the length of the cell community, and the mean length of cells comprising the community as the internal factors. Firstly, PVMin decreased with increasing length of the cell network oriented parallel to the EF. PVMin was approximately 0.041 ± 0.025 V/mm when the community was sufficiently long. On the other hand, PVMin in the orthogonal orientation was constant at 1.7 ± 0.047 V/mm with no dependence on the length of the cell network. Secondly, we found that PF50 increased with increasing length of the cell network or the number of cells in the network; the PF50 values were 2.03 ± 0.05 and 3.39 ± 0.05 Hz when the respective cell network lengths were 100 µm (n = 43) and more than 300 µm (n = 6) and the cells were oriented parallel to the EF. These findings indicate that it is important to suppress ventricular fibrillation with minimal efficient stimulation by considering the EF direction with respect to the orientation of cardiomyocytes. Furthermore, expanded cells showed the loss of ability to respond to stimulation at higher frequencies. Cardiomyocytes combined with seeded fibroblasts as a cell network at a low density are a possible model of a ventricular remodeling heart.

  14. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1.

    Science.gov (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S

    2017-06-02

    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  16. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy.

    Science.gov (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda

    2015-12-25

    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Irreversible magnetic-field dependence of ferromagnetic resonance and inverse spin Hall effect voltage in CoFeB/Pt bilayer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang-Il [Department of Materials Science and Engineering, Korea University, Seoul, 136-713 (Korea, Republic of); Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Seo, Min-Su [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Choi, Yeon Suk, E-mail: ychoi@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of); Park, Seung-Young, E-mail: parksy@kbsi.re.kr [Spin Engineering Physics Team, Division of Scientific Instrumentation, Korea Basic Science Institute, Daejeon, 305-806 (Korea, Republic of)

    2017-01-01

    Magnetic field (H) sweeping direction dependences of the mixed voltage V{sub mix} induced by the inverse-spin Hall effect(ISHE) and spin-rectified effect (SRE) in a CoFeB (5 nm)/Pt (10 nm) bilayer structure are investigated using the ferromagnetic resonance in the TE mode cavities and coplanar waveguide methods. Conventionally, the magnitude of ISHE voltage V{sub ISH} (symmetric) excluding the SRE (antisymmetric component) was unavoidably separated from the fitting curve of V{sub mix} (a sum of a symmetric and an antisymmetric part) for one direction of H-source. By studying the ratio of the two voltage parts with the bi-directional H sweeping, the optimized V{sub ISH} (no SRE condition) value which also include a well-defined spin Hall angle can be obtained via the linear response relation of ISHE and SRE components. - Highlights: • Hysteretic behavior of ferromagnetic resonance spectra in the CoFeB/Pt sample. • Hysteretic behavior of inverse-spin Hall effect voltage in the CoFeB/Pt sample. • Proportion of inverse spin-Hall effect voltage can be determined by the cavity mode. • The hysteretic behavior arise from the unsaturated magnetization limit. • The well-defined spin Hall angle which consider a hysteresis can be obtained.

  18. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    Science.gov (United States)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  19. Discrimination Voltage and Overdrive Bias Dependent Performance Evaluation of Passively Quenched SiC Single-Photon-Counting Avalanche Photodiodes

    International Nuclear Information System (INIS)

    Liu Fei; Yang Sen; Zhou Dong; Lu Hai; Zhang Rong; Zheng You-Dou

    2015-01-01

    In many critical civil and emerging military applications, low-level UV detection, sometimes at single photon level, is highly desired. In this work, a mesa-type 4H-SiC UV avalanche photodiode (APD) is designed and fabricated, which exhibits low leakage current and high avalanche gain. When studied by using a passive quenching circuit, the APD exhibits self-quenching characteristics due to its high differential resistance in the avalanche region. The single photon detection efficiency and dark count rate of the APD are evaluated as functions of discrimination voltage and over-drive voltage. The optimized operation conditions of the single photon counting APD are discussed. (paper)

  20. In situ monitoring the effects of a magnetic field on the open-circuit corrosion states of iron in acidic and neutral solutions

    International Nuclear Information System (INIS)

    Lu Zhanpeng; Yang Wu

    2008-01-01

    The effects of a 0.4 T horizontal magnetic field (HMF) on the open-circuit corrosion states of iron in static aqueous solutions are studied by in situ monitoring the responses of two electrochemical parameters to the applied magnetic field, i.e. the open-circuit potential (OCP) and the current under potentiostatic polarization. The applied magnetic field makes the OCP shift in the noble direction. Withdrawing the magnetic field causes a negative shift of the OCP in acidic solutions, but it does not cause any significant change of OCP in neutral solutions. Imposing a magnetic field induces a cathodic current for iron that was previously potentiostatically polarized at the OCP without magnetic field. Withdrawing the magnetic field induces an anodic current for iron that was previously potentiostatically polarized at the OCP with the magnetic field. The magnetic field effect is more significant in the acid solutions than in the salt solutions. The magnetic field effects on the oxygen reduction and on the activation-controlled iron dissolution reaction are found to be insignificant. The magnetic field effect on the hydrogen reduction reaction on iron in acidic solutions is demonstrated. Results show the possibility that a magnetic field would affect the hydrogen evolution by enhancing the electron-transfer process that has been categorized in the classical electrochemistry kinetics to be the rate-determining process. The memory effect of the magnetic field on the electrochemical reaction is identified and discussed

  1. A robust predictive current controller for healthy and open-circuit faulty conditions of five-phase BLDC drives applicable for wind generators and electric vehicles

    International Nuclear Information System (INIS)

    Salehi Arashloo, Ramin; Salehifar, Mehdi; Romeral, Luis; Sala, Vicent

    2015-01-01

    Highlights: • Model predictive deadbeat control of generator stator phase currents. • Fault tolerant control of five-phase BLDC generator. • Control of stator phase currents under normal and open-circuit faulty conditions. • MATLAB simulation and experimental verification of proposed control method. • Verification of robustness and fast respond of proposed controlling method. - Abstract: Fault tolerant control of five-phase brushless direct current (BLDC) machines is gaining more importance in high-safety applications such as offshore wind generators and automotive industries. In many applications, traditional controllers (such as PI controllers) are used to control the stator currents under faulty conditions. These controllers have good performance with dc signals. However, in the case of missing one or two of the phases, appropriate reference currents of these machines have oscillatory dynamics both in phase- and synchronous-reference frames. Non-constant nature of these reference values requires the implication of fast current controllers. In this paper, model predictive deadbeat controllers are proposed to control the stator currents of five-phase BLDC machines under normal and faulty conditions. Open circuit fault is considered for both one and two stator phases, and the behaviour of proposed controlling method is evaluated. This evaluation is generally focused on first, sensitivity of proposed controlling method and second, its speed in following reference current values under transient states. Proposed method is simulated and is verified experimentally on a five-phase BLDC drive

  2. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin

    2015-01-01

    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  3. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav

    2007-01-01

    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  4. Analysis of the photo voltage decay /PVD/ method for measuring minority carrier lifetimes in P-N junction solar cells

    Science.gov (United States)

    Von Roos, O.

    1981-01-01

    The photo voltage decay (PVD) method for the measurement of minority carrier lifetimes in P-N junction solar cells with cell thickness comparable to or even less than the minority carrier diffusion length is examined. The method involves the generation of free carriers in the quasi-neutral bulk material by flashes of light and the monitoring of the subsequent decay of the induced open-circuit voltages as the carriers recombine, which is dependent on minority carrier recombination lifetime. It is shown that the voltage versus time curve for an ordinary solar cell (N(+)-P junction) is proportional to the inverse minority carrier lifetime plus a factor expressing the ratio of diffusion length to cell thickness. In the case of an ideal back-surface-field cell (N(+)-P-P(+) junction) however, the slope is directly proportional to the inverse minority carrier lifetime. It is noted that since most BSF cells are not ideal, possessing a sizable back surface recombination velocity, the PVD measurements must be treated with caution and supplemented with other nonstationary methods.

  5. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R

    2006-01-01

    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  6. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons.

    Science.gov (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne

    2010-10-01

    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  7. The recombination correction and the dependence of the response of plane parallel chambers on the polarizing voltage in pulsed electron and photon beams

    International Nuclear Information System (INIS)

    Roos, M.; Derikum, K.

    2000-01-01

    Based on an experimental investigation of the recombination effect in plane parallel chambers, a relation is deduced that allows the correction to be calculated from the electrode spacing and from the dose per pulse. It is shown that the uncertainties caused by the application of the Boag formula for volume recombination (recommended in the International Code of Practice TRS-381) amount to not more than about 0.1% for conventional beams. Calculated recombinations are compared with experimental results concerning the dependence of the response of various commercial plane parallel chambers on the polarizing voltage. Since it cannot be excluded that particular chambers collect a non-negligible amount of charge from regions outside the designated collecting volume or that the effective polarizing voltage is reduced by poor contacts, it seems advisable to experimentally check the chambers before use and before application of the analytical relations. (author)

  8. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    Directory of Open Access Journals (Sweden)

    S. Demirezen

    Full Text Available In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε′, ε′, tanδ, electric modulus (M′ and M″ and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε′, ε′, tanδ, M′, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε′, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε′ and ε″ values at low frequencies may be attributed to the Maxwell–Wagner and space charge polarization. The high values of ε′ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M′ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M′ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε′, ε″, tanδ, M′, M″ and ac electric conductivity (σac is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization. Keywords: Thin films, Electrical properties, Interface/interphase

  9. Subnanometer Ga 2 O 3 Tunnelling Layer by Atomic Layer Deposition to Achieve 1.1 V Open-Circuit Potential in Dye-Sensitized Solar Cells

    KAUST Repository

    Chandiran, Aravind Kumar

    2012-08-08

    Herein, we present the first use of a gallium oxide tunnelling layer to significantly reduce electron recombination in dye-sensitized solar cells (DSC). The subnanometer coating is achieved using atomic layer deposition (ALD) and leading to a new DSC record open-circuit potential of 1.1 V with state-of-the-art organic D-π-A sensitizer and cobalt redox mediator. After ALD of only a few angstroms of Ga 2O 3, the electron back reaction is reduced by more than an order of magnitude, while charge collection efficiency and fill factor are increased by 30% and 15%, respectively. The photogenerated exciton separation processes of electron injection into the TiO 2 conduction band and the hole injection into the electrolyte are characterized in detail. © 2012 American Chemical Society.

  10. Subnanometer Ga2O3 tunnelling layer by atomic layer deposition to achieve 1.1 V open-circuit potential in dye-sensitized solar cells.

    Science.gov (United States)

    Chandiran, Aravind Kumar; Tetreault, Nicolas; Humphry-Baker, Robin; Kessler, Florian; Baranoff, Etienne; Yi, Chenyi; Nazeeruddin, Mohammad Khaja; Grätzel, Michael

    2012-08-08

    Herein, we present the first use of a gallium oxide tunnelling layer to significantly reduce electron recombination in dye-sensitized solar cells (DSC). The subnanometer coating is achieved using atomic layer deposition (ALD) and leading to a new DSC record open-circuit potential of 1.1 V with state-of-the-art organic D-π-A sensitizer and cobalt redox mediator. After ALD of only a few angstroms of Ga(2)O(3), the electron back reaction is reduced by more than an order of magnitude, while charge collection efficiency and fill factor are increased by 30% and 15%, respectively. The photogenerated exciton separation processes of electron injection into the TiO(2) conduction band and the hole injection into the electrolyte are characterized in detail.

  11. Open circuit V-I characteristics of a coreless ironless electric generator for low density wind power generation

    Science.gov (United States)

    Razali, Akhtar; Rahman, Fadhlur; Azlan, Syaiful; Razali Hanipah, Mohd; Azri Hizami, Mohd

    2018-04-01

    Cogging is an attraction of magnetism between permanent magnets and soft ironcore lamination in a conventional electric ironcore generator. The presence of cog in the generator is seen somehow restricted the application of the generator in an application where low rotational torque is required. Cog torque requires an additional input power to overcome, hence became one of the power loss sources. With the increasing of power output, the cogging is also proportionally increased. This leads to the increasing of the supplied power of the driver motor to overcome the cog. Therefore, this research is embarked to study fundamentally about the possibility of removing ironcore lamination in an electric generator. This research deals with removal of ironcore lamination in electric generator to eliminate cog torque. A confinement technique is proposed to confine and focus magnetic flux by introducing opposing permanent magnets arrangement. The concept is then fabricated and experimentally validated to qualify its no-load characteristics. The rotational torque and power output are measured and efficiency is then analyzed. Results indicated that the generator produced RMS voltage of 416VAC at rotational speed of 1762 RPM. Torque required to rotate the generator was at 2Nm for various rotational speed. The generator has shown 30% lesser rotational torque compared to the conventional ironcore type generator due to the absent of cogging torque in the system. Lesser rotational torque required to rotate has made this type of generator has a potential to be used for low wind density wind turbine application.

  12. Modeling on oxide dependent 2DEG sheet charge density and threshold voltage in AlGaN/GaN MOSHEMT

    Science.gov (United States)

    Panda, J.; Jena, K.; Swain, R.; Lenka, T. R.

    2016-04-01

    We have developed a physics based analytical model for the calculation of threshold voltage, two dimensional electron gas (2DEG) density and surface potential for AlGaN/GaN metal oxide semiconductor high electron mobility transistors (MOSHEMT). The developed model includes important parameters like polarization charge density at oxide/AlGaN and AlGaN/GaN interfaces, interfacial defect oxide charges and donor charges at the surface of the AlGaN barrier. The effects of two different gate oxides (Al2O3 and HfO2) are compared for the performance evaluation of the proposed MOSHEMT. The MOSHEMTs with Al2O3 dielectric have an advantage of significant increase in 2DEG up to 1.2 × 1013 cm-2 with an increase in oxide thickness up to 10 nm as compared to HfO2 dielectric MOSHEMT. The surface potential for HfO2 based device decreases from 2 to -1.6 eV within 10 nm of oxide thickness whereas for the Al2O3 based device a sharp transition of surface potential occurs from 2.8 to -8.3 eV. The variation in oxide thickness and gate metal work function of the proposed MOSHEMT shifts the threshold voltage from negative to positive realizing the enhanced mode operation. Further to validate the model, the device is simulated in Silvaco Technology Computer Aided Design (TCAD) showing good agreement with the proposed model results. The accuracy of the developed calculations of the proposed model can be used to develop a complete physics based 2DEG sheet charge density and threshold voltage model for GaN MOSHEMT devices for performance analysis.

  13. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target.

    Science.gov (United States)

    Thorpe, Andrew J; Offord, James

    2010-07-01

    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  14. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  15. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  16. Achieving consistent image quality and overall radiation dose reduction for coronary CT angiography with body mass index-dependent tube voltage and tube current selection

    International Nuclear Information System (INIS)

    Wang, G.; Gao, J.; Zhao, S.; Sun, X.; Chen, X.; Cui, X.

    2014-01-01

    Aim: To develop a quantitative body mass index (BMI)-dependent tube voltage and tube current selection method for obtaining consistent image quality and overall dose reduction in computed tomography coronary angiography (CTCA). Methods and materials: The images of 190 consecutive patients (group A) who underwent CTCA with fixed protocols (100 kV/193 mAs for 100 patients with a BMI of <27 and 120 kV/175 mAs for 90 patients with a BMI of >27) were retrospectively analysed and reconstructed with an adaptive statistical iterative reconstruction (ASIR) algorithm at 50% blending. Image noise was measured and the relationship to BMI was studied to establish BMI-dependent tube current for obtaining CTCA images with user-specified image noise. One hundred additional cardiac patients (group B) were examined using prospective triggering with the BMI-dependent tube voltage/current. CTCA image-quality score, image noise, and effective dose from groups B and C (subgroup of A of 100 patients examined with prospective triggering only) were obtained and compared. Results: There was a linear relationship between image noise and BMI in group A. Using a BMI-dependent tube current in group B, an average CTCA image noise of 27.7 HU (target 28 HU) and 31.7 HU (target 33 HU) was obtained for the subgroups of patients with BMIs of >27 and of <27, respectively, and was independent of patient BMI. There was no difference between image-quality scores between groups B and C (4.52 versus 4.60, p > 0.05). The average effective dose for group B (2.56 mSv) was 42% lower than group C (4.38 mSv; p < 0.01). Conclusion: BMI-dependent tube voltage/current selection in CTCA provides an individualized protocol that generates consistent image quality and helps to reduce overall patient radiation dose. - Highlights: • BMI-dependent kVp and mA selection method may be established in CCTA. • BMI-dependent kVp and mA enables consistent CCTA image quality. • Overall dose reduction of 40% can

  17. Frequency and voltage dependence dielectric properties, ac electrical conductivity and electric modulus profiles in Al/Co{sub 3}O{sub 4}-PVA/p-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Bilkan, Çiğdem, E-mail: cigdembilkan@gmail.com [Department of Physics, Faculty of Sciences, The University of Çankırı Karatekin, 18100 Çankırı (Turkey); Azizian-Kalandaragh, Yashar [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of); Altındal, Şemsettin [Department of Physics, Faculty of Sciences, The University of Gazi, 06500 Ankara (Turkey); Shokrani-Havigh, Roya [Department of Physics, Faculty of Science, The University of Mohaghegh Ardabili, Ardabil (Iran, Islamic Republic of)

    2016-11-01

    In this research a simple microwave-assisted method have been used for preparation of cobalt oxide nanostructures. The as-prepared sample has been investigated by UV–vis spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM). On the other hand, frequency and voltage dependence of both the real and imaginary parts of dielectric constants (ε′, ε″) and electric modulus (M′ and M″), loss tangent (tanδ), and ac electrical conductivity (σ{sub ac}) values of Al/Co{sub 3}O{sub 4}-PVA/p-Si structures were obtained in the wide range of frequency and voltage using capacitance (C) and conductance (G/ω) data at room temperature. The values of ε′, ε″ and tanδ were found to decrease with increasing frequency almost for each applied bias voltage, but the changes in these parameters become more effective in the depletion region at low frequencies due to the charges at surface states and their relaxation time and polarization effect. While the value of σ is almost constant at low frequency, increases almost as exponentially at high frequency which are corresponding to σ{sub dc} and σ{sub ac}, respectively. The M′ and M″ have low values at low frequencies region and then an increase with frequency due to short-range mobility of charge carriers. While the value of M′ increase with increasing frequency, the value of M″ shows two peak and the peaks positions shifts to higher frequency with increasing applied voltage due to the decrease of the polarization and N{sub ss} effects with increasing frequency.

  18. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  19. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  20. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Science.gov (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar

    2014-01-01

    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  1. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  2. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons.

    Science.gov (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M

    2011-04-18

    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  3. Temperature Dependency and Alpha Response of Semi-Insulating GaAs Schottky Radiation Detector at Low Bias Voltage

    International Nuclear Information System (INIS)

    Kang, Sang Mook; Ha, Jang Ho; Park, Se Hwan; Kim, Han Soo; Kim, Yong Kyun

    2009-01-01

    The last decade has seen a growing interest in semiconductor radiation detectors operated at room or nearly room temperature. Great efforts have been invested in the development of radiation detectors based on semi-insulating (SI) GaAs. The main reasons are as follows: (i) high resistance against radiation damage; (ii) it possesses a good energy resolution, which relates to its active volume; (iii) such a detector also exhibits fast signal rise times, which results from a high mobility and drift velocity of charge carriers; (iv) its large band gap energy allows a SI GaAs detector to operate at room temperature. Other important features are a good technology base and low production and operating costs. An alpha particle monitoring method for the detection of Pu-238 and U-235 is becoming important in homeland security. Alpha measurement in a vacuum is known to provide a good resolution sufficient to separate an isotope abundance in nuclear materials. However, in order to apply it to a high radiation field like a spent fuel treatment facility, a nuclear material loading and unloading process in a vacuum is one of the great disadvantages. Therefore, the main technical issue is to develop a detector for alpha detection at air condition and low power operation for integration type device. In this study we fabricated GaAs Schottky detector by using semi-insulating (SI) wafer and measured current-voltage characteristic curve and alpha response with 5.5 MeV Am-241 source

  4. Bias voltage dependence of molecular orientation of dialkyl ketone and fatty acid alkyl ester at the liquid–graphite interface

    Energy Technology Data Exchange (ETDEWEB)

    Hibino, Masahiro, E-mail: hibino@mmm.muroran-it.ac.jp [Department of Applied Sciences, Muroran Institute of Technology, 27-1 Mizumoto-cho, Muroran 050-8585 (Japan); Tsuchiya, Hiroshi [Department of Applied Physics, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan)

    2014-10-30

    Graphical abstract: - Highlights: • Self-assembled monolayers (SAMs) of 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) were formed on a graphite surface at the liquid–solid interface. • Orientations of the molecules in SAMs on the substrate were studied by scanning tunneling microscopy. • A perpendicular carbon skeleton-plane orientation with the CO pointing up on the surface is favorable for a substrate with negative charge and vice versa. - Abstract: Molecular orientations of self-assembled 18-pentatriacontanone (as ketone) and stearyl stearate (as ester) monolayers adsorbed on a graphite surface were studied by scanning tunneling microscopy (STM) at the liquid–solid interface. At a positive sample bias, the central areas of the dialkyl ketone and fatty acid alkyl ester molecules in the STM images appeared as two bright regions on both sides of a dim spot and a bright region on one side of a dim spot, whereas at a negative sample bias, the areas appeared dim. This contrast variation indicates that a perpendicular carbon skeleton-plane orientation with the CO pointing down on the surface is favorable for a substrate with positive charge and vice versa because of the greater electronegativity of the oxygen atom. Upon the bias voltage reversal, the delay time for the STM image contrast change in the region was observed on a time scale of minutes. The difference between the delay time lengths for the direction of bias polarity change indicates that the perpendicular configuration with CO pointing up is more stable than that with CO pointing down. These results indicate that the use of an electric field along a direction vertical to the monolayer on the substrate provides control over the orientations of the molecules between two stable states at the liquid–solid interface.

  5. Localized accumulation of cytosolic calcium near the fused sperm is associated with the calcium- and voltage-dependent block of sperm entry in the sea urchin egg.

    Science.gov (United States)

    Ivonnet, Pedro I; Mohri, Tatsuma; McCulloh, David H

    2017-10-01

    Interaction of the sperm and egg depolarizes the egg membrane, allowing the sperm to enter; however, if the egg membrane is not allowed to depolarize from its resting potential (e.g., by voltage-clamp), the sperm will not enter. Previous studies demonstrated that sperm entry into sea urchin eggs that are voltage-clamped at negative membrane potentials is regulated both by the egg's membrane potential and a voltage-dependent influx of calcium into the egg. In these cases, electrical or cytoplasmic continuity (sperm-egg membrane fusion) occurs at negative membrane potentials, but subsequent loss of cytoplasmic continuity results in failure of sperm entry (unfusion). The work presented herein examined where, in relation to the sperm, and when, in relation to the sperm-induced electrophysiological events, the egg's calcium influx occurs, and how these events relate to successful or failed sperm entry. When sperm entered the egg, elevation of intracellular calcium concentration ([Ca 2+ ] i ) began near the fused sperm on average 5.9 s after sperm-egg membrane fusion. Conversely, when sperm failed to enter the egg, [Ca 2+ ] i elevated near the site of sperm-egg fusion on average 0.7 s after sperm-egg membrane fusion, which is significantly earlier than in eggs for which sperm entered. Therefore, the accumulation of calcium near the site of sperm-egg fusion is spatially and temporally consistent with the mechanism that may be responsible for loss of cytoplasmic continuity and failure of sperm entry. © 2017 Wiley Periodicals, Inc.

  6. Bias-voltage dependence of perpendicular spin-transfer torque in asymmetric MgO-based magnetic tunnel junctions

    KAUST Repository

    Oh, Se Chung; Park, Seung Young; Manchon, Aurelien; Chshiev, Mairbek; Han, Jae Ho; Lee, Hyun Woo; Lee, Jang Eun; Nam, Kyung Tae; Jo, Younghun; Kong, Yo Chan; Dieny, Bernard; Lee, Kyung Jin

    2009-01-01

    Spin-transfer torque (STT) allows the electrical control of magnetic states in nanostructures. The STT in magnetic tunnel junctions (MTJs) is of particular importance owing to its potential for device applications. It has been demonstrated that the MTJ has a sizable perpendicular STT (, field-like torque), which substantially affects STT-driven magnetization dynamics. In contrast to symmetric MTJs where the bias dependence of is quadratic, it is theoretically predicted that the symmetry breaking of the system causes an extra linear bias dependence. Here, we report experimental results that are consistent with the predicted linear bias dependence in asymmetric MTJs. The linear contribution is quite significant and its sign changes from positive to negative as the asymmetry is modified. This result opens a way to design the bias dependence of the field-like term, which is useful for device applications by allowing, in particular, the suppression of the abnormal switching-back phenomena. © 2009 Macmillan Publishers Limited. All rights reserved.

  7. Bias-voltage dependence of perpendicular spin-transfer torque in asymmetric MgO-based magnetic tunnel junctions

    KAUST Repository

    Oh, Se Chung

    2009-10-25

    Spin-transfer torque (STT) allows the electrical control of magnetic states in nanostructures. The STT in magnetic tunnel junctions (MTJs) is of particular importance owing to its potential for device applications. It has been demonstrated that the MTJ has a sizable perpendicular STT (, field-like torque), which substantially affects STT-driven magnetization dynamics. In contrast to symmetric MTJs where the bias dependence of is quadratic, it is theoretically predicted that the symmetry breaking of the system causes an extra linear bias dependence. Here, we report experimental results that are consistent with the predicted linear bias dependence in asymmetric MTJs. The linear contribution is quite significant and its sign changes from positive to negative as the asymmetry is modified. This result opens a way to design the bias dependence of the field-like term, which is useful for device applications by allowing, in particular, the suppression of the abnormal switching-back phenomena. © 2009 Macmillan Publishers Limited. All rights reserved.

  8. Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

    Directory of Open Access Journals (Sweden)

    Salvador Valle-Reyes

    2018-05-01

    Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

  9. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition.

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F; Zhang, Ruli; Koshiya, Naohiro; Smith, Jeffrey C

    2016-01-01

    The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property.

  10. Voltage-Dependent Rhythmogenic Property of Respiratory Pre-Bötzinger Complex Glutamatergic, Dbx1-Derived, and Somatostatin-Expressing Neuron Populations Revealed by Graded Optogenetic Inhibition123

    Science.gov (United States)

    Koizumi, Hidehiko; Mosher, Bryan; Tariq, Mohammad F.; Zhang, Ruli

    2016-01-01

    Abstract The rhythm of breathing in mammals, originating within the brainstem pre-Bötzinger complex (pre-BötC), is presumed to be generated by glutamatergic neurons, but this has not been directly demonstrated. Additionally, developmental expression of the transcription factor Dbx1 or expression of the neuropeptide somatostatin (Sst), has been proposed as a marker for the rhythmogenic pre-BötC glutamatergic neurons, but it is unknown whether these other two phenotypically defined neuronal populations are functionally equivalent to glutamatergic neurons with regard to rhythm generation. To address these problems, we comparatively investigated, by optogenetic approaches, the roles of pre-BötC glutamatergic, Dbx1-derived, and Sst-expressing neurons in respiratory rhythm generation in neonatal transgenic mouse medullary slices in vitro and also more intact adult perfused brainstem-spinal cord preparations in situ. We established three different triple-transgenic mouse lines with Cre-driven Archaerhodopsin-3 (Arch) expression selectively in glutamatergic, Dbx1-derived, or Sst-expressing neurons for targeted photoinhibition. In each line, we identified subpopulations of rhythmically active, Arch-expressing pre-BötC inspiratory neurons by whole-cell recordings in medullary slice preparations in vitro, and established that Arch-mediated hyperpolarization of these inspiratory neurons was laser power dependent with equal efficacy. By site- and population-specific graded photoinhibition, we then demonstrated that inspiratory frequency was reduced by each population with the same neuronal voltage-dependent frequency control mechanism in each state of the respiratory network examined. We infer that enough of the rhythmogenic pre-BötC glutamatergic neurons also have the Dbx1 and Sst expression phenotypes, and thus all three phenotypes share the same voltage-dependent frequency control property. PMID:27275007

  11. Efficiency Evaluation of Five-Phase Outer-Rotor Fault-Tolerant BLDC Drives under Healthy and Open-Circuit Faulty Conditions

    Directory of Open Access Journals (Sweden)

    ARASHLOO, R. S.

    2014-05-01

    Full Text Available Fault tolerant motor drives are an interesting subject for many applications such as automotive industries and wind power generation. Among different configurations of these systems, five-phase BLDC drives are gaining more importance which is because of their compactness and high efficiency. Due to replacement of field windings by permanent magnets in their rotor structure, the main sources of power losses in these drives are iron (core losses, copper (winding losses, and inverter unit (semiconductor losses. Although low amplitude of power losses in five-phase BLDC drives is an important aspect for many applications, but their efficiency under faulty conditions is not considered in previous studies. In this paper, the efficiency of an outer-rotor five phase BLDC drive is evaluated under normal and different faulty conditions. Open-circuit fault is considered for one, two adjacent and two non-adjacent faulty phases. Iron core losses are calculated via FEM simulations in Flux-Cedrat software, and moreover, inverter losses and winding copper losses are simulated in MATLAB� environment. Experimental evaluations are conducted to evaluate the efficiency of the entire BLDC drive which verifies the theoretical developments.

  12. Simultaneous NOx and hydrocarbon emissions control for lean-burn engines using low-temperature solid oxide fuel cell at open circuit.

    Science.gov (United States)

    Huang, Ta-Jen; Hsu, Sheng-Hsiang; Wu, Chung-Ying

    2012-02-21

    The high fuel efficiency of lean-burn engines is associated with high temperature and excess oxygen during combustion and thus is associated with high-concentration NO(x) emission. This work reveals that very high concentration of NO(x) in the exhaust can be reduced and hydrocarbons (HCs) can be simultaneously oxidized using a low-temperature solid oxide fuel cell (SOFC). An SOFC unit is constructed with Ni-YSZ as the anode, YSZ as the electrolyte, and La(0.6)Sr(0.4)CoO(3) (LSC)-Ce(0.9)Gd(0.1)O(1.95) as the cathode, with or without adding vanadium to LSC. SOFC operation at 450 °C and open circuit can effectively treat NO(x) over the cathode at a very high concentration in the simulated exhaust. Higher NO(x) concentration up to 5000 ppm can result in a larger NO(x) to N(2) rate. Moreover, a higher oxygen concentration promotes NO conversion. Complete oxidation of HCs can be achieved by adding silver to the LSC current collecting layer. The SOFC-based emissions control system can treat NO(x) and HCs simultaneously, and can be operated without consuming the anode fuel (a reductant) at near the engine exhaust temperature to eliminate the need for reductant refilling and extra heating.

  13. Possible central nervous system oxygen toxicity seizures among US recreational air or enriched air nitrox open circuit diving fatalities 2004-2013.

    Science.gov (United States)

    Buzzacott, P; Denoble, P J

    2017-01-01

    The first diver certification programme for recreational 'enriched air nitrox' (EAN) diving was released in 1985. Concerns were expressed that many EAN divers might suffer central nervous system (CNS) oxygen toxicity seizures and drown. US fatalities on open-circuit scuba occurring between 2004-2013, where the breathing gas was either air or EAN, were identified. Causes of death and preceding circumstances were examined by a medical examiner experienced in diving autopsies. Case notes were searched for witnessed seizures at elevated partial pressures of oxygen. The dataset comprised 344 air divers (86%) and 55 divers breathing EAN (14%). EAN divers' fatal dives were deeper than air divers' (28 msw vs 18 msw, p < 0.0001). Despite this, of the 249 cases where a cause of death was established, only three EAN divers were considered to have possibly died following CNS oxygen toxicity seizures at depth (ppO2 132, 142 and 193 kPa). The analysis of recreational diving fatalities in the US over 10 years found just one death likely from CNS oxygen toxicity among EAN divers. A further two possible, although unlikely, cases were also found. Fears of commonplace CNS oxygen toxicity seizures while EAN diving have not apparently been realized.

  14. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise.

    Science.gov (United States)

    Gupta, Rajeev

    2017-09-02

    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li

    2009-05-01

    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  16. Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

    International Nuclear Information System (INIS)

    Sen, A.K.; Bhattacharya, S.

    2006-12-01

    In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

  17. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  18. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok

    2013-01-01

    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  19. Stimulation of Na+-alanine cotransport activates a voltage-dependent conductance in single proximal tubule cells isolated from frog kidney

    Science.gov (United States)

    Robson, L; Hunter, M

    1999-01-01

    The swelling induced by Na+-alanine cotransport in proximal tubule cells of the frog kidney is followed by regulatory volume decrease (RVD). This RVD is inhibited by gadolinium (Gd3+), an inhibitor of stretch-activated channels, but is independent of extracellular Ca2+. In this study, the whole cell patch clamp technique was utilized to examine the effect of Na+-alanine cotransport on two previously identified volume- and Gd3+-sensitive conductances. One conductance is voltage dependent and anion selective (GVD) whilst the other is voltage independent and cation selective (GVI). Addition of 5 mM L-alanine to the bathing solution increased the whole cell conductance and gave a positive (depolarizing) shift in the reversal potential (Vrev, equivalent to the membrane potential in current-clamped cells) consistent with activation of Na+-alanine cotransport. Vrev shifted from -36 ± 4·9 to +12·9 ± 4·2 mV (n= 15). In the presence of alanine, the total whole cell conductance had several components including the cotransporter conductance and GVD and GVI. These conductances were separated using Gd3+, which inhibits both GVD and GVI, and the time dependency of GVD. Of these two volume-sensitive conductances, L-alanine elicited a specific increase in GVD, whereas GVI was unaffected. The L-alanine-induced activation of GVD was significantly reduced when cells were incubated in a hypertonic bathing solution. In summary, in single proximal tubule cells isolated from frog kidney, on stimulation of Na+-alanine cotransport GVD is activated, while GVI is unaffected. Taken with other evidence, this suggests that GVD is activated by cell swelling, consequent upon alanine entry, and may play a role as an anion efflux pathway during alanine-induced volume regulation. PMID:10226159

  20. Large time-dependent coercivity and resistivity modification under sustained voltage application in a Pt/Co/AlOx/Pt junction.

    NARCIS (Netherlands)

    Brink, van den A.; van der Heijden, M.A.J.; Swagten, H.J.M.; Koopmans, B.

    2015-01-01

    The coercivity and resistivity of a Pt/Co/AlOx/Pt junction are measured under sustained voltage application. High bias voltages of either polarity are determined to cause a strongly enhanced, reversible coercivity modification compared to low voltages. Time-resolved measurements show a logarithmic

  1. Investigation of p-n-junctions in n-InP based on voltage dependence of differential capacity

    International Nuclear Information System (INIS)

    Agaev, Ja.; Atabaev, Kh.; Gazakov, O.; Sadykov, K.B.

    1976-01-01

    The barrier capacity of alloyed p-n transitions on n-InP crystals grown by the crystallization method has been investigated. The transitions have been obtained by fusing In + 3 - 10% Zn. Step-by-step distribution of the impurity concentration in the space charge layer takes place in the alloyed diodes under investigation. The coefficient characterizing the impurity distribution in the space charge layer has been determined. The well-expressed dependence of I/C 2 =f/u) observed both at a room temperature and at the temperature of liquid nitrogen indicates that the density of ground carriers in the p-n regions are constant at a definite distance from the p-n transition. The main parameters of p-n transitions have been determined

  2. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: cihima@inje.ac.kr [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: parkws@kangwon.ac.kr [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)

    2015-06-15

    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  3. Suppression of the high-frequency disturbances in low-voltage circuits caused by disconnector operation in high-voltage open-air substations

    Energy Technology Data Exchange (ETDEWEB)

    Savic, M.S.

    1986-07-01

    The switching off and on of small capacitive currents charging busbar capacitances, connection conductors and open circuit breakers with disconnectors causes high-frequency transients in high-voltage networks. In low voltage circuits, these transient processes induce dangerous overvoltages for the electronic equipment in the substation. A modified construction of the disconnector with a damping resistor was investigated. Digital simulation of the transient process in a high-voltage network during the arcing period between the disconnector contacts with and without damping resistor were performed. A significant decrease of the arcing duration and the decrease of the electromagnetic field magnitude in the vicinity of the operating disconnector were noticed. In the low voltage circuit protected with the surge arrester, the overvoltage magnitude was not affected by the damping resistor due to the arrester protection effect.

  4. Design and experimental investigation of a low-voltage thermoelectric energy harvesting system for wireless sensor nodes

    International Nuclear Information System (INIS)

    Guan, Mingjie; Wang, Kunpeng; Xu, Dazheng; Liao, Wei-Hsin

    2017-01-01

    Highlights: • A thermoelectric energy harvesting system for wireless sensor nodes is designed. • An ultra-low voltage self-startup is implemented. • Maximum power point tracking and low power designs are applied for high efficiency. • Efficiency of 44.2–75.4% is obtained with open-circuit voltage of 84–400 mV. • System efficiency is higher than the commercial BQ25504 converter. - Abstract: A thermoelectric energy harvesting system designed to harvest tens of microwatts to several milliwatts from low-voltage thermoelectric generators is presented in this paper. The proposed system is based-on a two-stage boost scheme with self-startup ability. A maximum power point tracking technique based on the open-circuit voltage is adopted in the boost converter for high efficiency. Experimental results indicate that the proposed system can harvest thermoelectric energy and run a microcontroller unit and a wireless sensor node under low input voltage and power with high efficiency. The harvest system and wireless sensor node can be self-powered with minimum thermoelectric open-circuit voltage as 62 mV and input power of 84 μW. With a self-startup scheme, the proposed system can self-start with a 20 mV input voltage. Low power designs are applied in the system to reduce the quiescent dissipation power. It results in better performance considering the conversion efficiency and self-startup ability compared to commercial boost systems used for thermal energy harvesting.

  5. High voltage wide range marx generator design and construction

    International Nuclear Information System (INIS)

    Thompson, J.E.

    1976-01-01

    A wide range, long pulse, Marx generator has been designed and constructed for the purpose of exciting a thermionic electron gun utilized for quasi-cw gas laser medium ionization. The Marx generator has been specifically designed to operate over a voltage range variable from 100 kV to 200 kV into a resistive load of between 83 kΩ and open circuit. This wide operating range, both in voltage and load impedance, was obtained using interstage coupling capacitors to assure overvoltage and subsequent breakdown of the three element spark gap switches used. This paper will discuss the motivation and specific application for the Marx generator and will present the relevant design procedure with particular emphasis on the interstage coupling and triggering techniques employed. Experimental data regarding the measured Marx generator performance will also be presented

  6. Temperature dependent current-voltage characteristics of Au/n-Si Schottky barrier diodes and the effect of transition metal oxides as an interface layer

    Science.gov (United States)

    Mahato, Somnath; Puigdollers, Joaquim

    2018-02-01

    Temperature dependent current-voltage (I‒V) characteristics of Au/n-type silicon (n-Si) Schottky barrier diodes have been investigated. Three transition metal oxides (TMO) are used as an interface layer between gold and silicon. The basic Schottky diode parameters such as ideality factor (n), barrier height (ϕb 0) and series resistance (Rs) are calculated and successfully explained by the thermionic emission (TE) theory. It has been found that ideality factor decreased and barrier height increased with increased of temperature. The conventional Richardson plot of ln(I0/T2) vs. 1000/T is determined the activation energy (Ea) and Richardson constant (A*). Whereas value of 'A*' is much smaller than the known theoretical value of n-type Si. The temperature dependent I-V characteristics obtained the mean value of barrier height (ϕb 0 bar) and standard deviation (σs) from the linear plot of ϕap vs. 1000/T. From the modified Richardson plot of ln(I0/T2) ˗ (qσ)2/2(kT)2 vs. 1000/T gives Richardson constant and homogeneous barrier height of Schottky diodes. Main observation in this present work is the barrier height and ideality factor shows a considerable change but the series resistance value exhibits negligible change due to TMO as an interface layer.

  7. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  8. Transport characteristics of Pd Schottky barrier diodes on epitaxial n-GaSb as determined from temperature dependent current–voltage measurements

    Energy Technology Data Exchange (ETDEWEB)

    Venter, A., E-mail: andre.venter@nmmu.ac.za [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Murape, D.M.; Botha, J.R. [Department of Physics, Nelson Mandela Metropolitan University, P.O. Box 77000, Port Elizabeth 6031 (South Africa); Auret, F.D. [Department of Physics, University of the Pretoria, Lynnwood Road, Pretoria 0002 (South Africa)

    2015-01-01

    The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ{sub b} vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ{sub b,mean} assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact.

  9. Transport characteristics of Pd Schottky barrier diodes on epitaxial n-GaSb as determined from temperature dependent current–voltage measurements

    International Nuclear Information System (INIS)

    Venter, A.; Murape, D.M.; Botha, J.R.; Auret, F.D.

    2015-01-01

    The temperature dependent transport characteristics of Pd/n-GaSb:Te Schottky contacts with low and saturating reverse current are investigated by means of current–voltage measurements between 80 K and 320 K. The apparent barrier height and ideality factor increase with a decrease in temperature. Neither thermionic nor thermionic field emission can explain the low temperature characteristics of these diodes. Instead, evidence is presented for barrier inhomogeneity across the metal/semiconductor contact. A plot of the barrier height, ϕ b vs. 1/2kT revealed a double Gaussian distribution for the barrier height with ϕ b,mean assuming values of 0.59 eV ± 0.07 (80–140 K) and 0.25 eV ± 0.12 (140–320 K) respectively. - Highlights: • Transport characteristics of Pd/epitaxial n-GaSb:Te SBDs are studied by means of I-V-T measurements. • SBDs have remarkably low and saturating reverse current – of the lowest ever reported for GaSb. • Transport behaviour is explained by considering electronic states present on the GaSb surface. • Evidence is presented for barrier inhomogeneity across the metal-semiconductor contact

  10. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain.

    Science.gov (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping

    2015-05-01

    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Temperature and voltage dependence of barrier height and ideality factor in Au/0.07 graphene-doped PVA/n-Si structures

    Science.gov (United States)

    Altındal Yerişkin, S.; Balbaşı, M.; Demirezen, S.

    2017-04-01

    In this study, Au/0.07 graphene-doped PVA/n-Si structures were fabricated and current conduction mechanism in these structures were investigated in the temperature range of 80-380 K through forward bias current-voltage ( I- V) measurements. Main electrical parameters were extracted from I-V data. Zero-bias barrier height (\\overline{Φ}_{B0}) and ideality factor (n) were found strong functions of temperature and their values ranged from 0.234 eV and 4.98 (at 80 K) to 0.882 eV and 1.15 (at 380 K), respectively. Φ ap versus q/2k T plot was drawn to obtain an evidence of a Gaussian distribution of the barrier heights (BHs) and it revealed two distinct linear regions with different slopes and intercepts. The mean values of BH ( Φ Bo) and zero-bias standard deviation (σ s ) were obtained from the intercept and slope of the linear regions of this plot as 1.30 eV and 0.16 V for the first region (280-380 K) and 0.74 eV and 0.085 V for the second region (80-240 K), respectively. Thus, the values of \\overline{Φ}_{B0} and effective Richardson constant ( A*) were also found from the intercept and slope of the modified Richardson plot [ln( I s /T 2) - q 2 σ o 2 /2k 2 T 2 vs q/ kT] as 1.31 eV and 130 A/cm2 K2 for the first region and 0.76 eV and 922 A/cm2 K2 for the second region, respectively. The value of A* for the first region was very close to the theoretical value for n-Si (112 A/cm2 K2). The energy density distribution profile of surface states (Nss) was also extracted from the forward bias I-V data by taking into account voltage dependent effective BH (Φe) and n.

  12. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer.

    Science.gov (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie

    2018-05-01

    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  14. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons.

    Science.gov (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl

    2017-03-01

    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  15. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  16. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension.

    Science.gov (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H

    2012-10-01

    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  17. Voltage Controlled Dynamic Demand Response

    DEFF Research Database (Denmark)

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  18. Imaging responses of on-site CsI and Gd2O2S flat-panel detectors: Dependence on the tube voltage

    Science.gov (United States)

    Jeon, Hosang; Chung, Myung Jin; Youn, Seungman; Nam, Jiho; Lee, Jayoung; Park, Dahl; Kim, Wontaek; Ki, Yongkan; Kim, Ho Kyung

    2015-07-01

    One of the emerging issues in radiography is low-dose imaging to minimize patient's exposure. The scintillating materials employed in most indirect flat-panel detectors show a drastic change of X-ray photon absorption efficiency around their K-edge energies that consequently affects image quality. Using various tube voltages, we investigated the imaging performance of most popular scintillators: cesium iodide (CsI) and gadolinium oxysulfide (Gd2O2S). The integrated detective quantum efficiencies (iDQE) of four detectors installed in the same hospital were evaluated according to the standardized procedure IEC 62220-1 at tube voltages of 40 - 120 kVp. The iDQE values of the Gd2O2S detectors were normalized by those of CsI detectors to exclude the effects of image postprocessing. The contrast-to-noise ratios (CNR) were also evaluated by using an anthropomorphic chest phantom. The iDQE of the CsI detector outperformed that of the Gd2O2S detector over all tube voltages. Moreover, we noted that the iDQE of the Gd2O2S detectors quickly rolled off with decreasing tube voltage under 70 kVp. The CNRs of the two scintillators were similar at 120 kVp. At 60 kVp, however, the CNR of Gd2O2S was about half that of CsI. Compared to the Gd2O2S detectors, variations in the DQE performance of the CsI detectors were relatively immune to variations in the applied tube voltages. Therefore, we claim that Gd2O2S detectors are inappropriate for use in low-tube-voltage imaging (e.g., extremities and pediatrics) with low patient exposure.

  19. High-field quench behavior and dependence of hot spot temperature on quench detection voltage threshold in a Bi2Sr2CaCu2Ox coil

    International Nuclear Information System (INIS)

    Shen, Tengming; Ye, Liyang; Turrioni, Daniele; Li, Pei

    2015-01-01

    Small insert solenoids have been built using a multifilamentary Ag/Bi 2 Sr 2 CaCu 2 O x round wire insulated with a mullite sleeve (∼100 μm in thickness) and characterized in background fields to explore the quench behaviors and limits of Bi 2 Sr 2 CaCu 2 O x superconducting magnets, with an emphasis on assessing the impact of slow normal zone propagation on quench detection. Using heaters of various lengths to initiate a small normal zone, a coil was quenched safely more than 70 times without degradation, with the maximum coil temperature reaching 280 K. Coils withstood a resistive voltage of tens of mV for seconds without quenching, showing the high stability of these coils and suggesting that the quench detection voltage should be greater than 50 mV in order not to falsely trigger protection. The hot spot temperature for the resistive voltage of the normal zone to reach 100 mV increased from ∼40–∼80 K while increasing the operating wire current density J o from 89 A mm −2 to 354 A mm −2 , whereas for the voltage to reach 1 V, it increased from ∼60–∼140 K. This shows the increasing negative impact of slow normal zone propagation on quench detection with increasing J o and the need to limit the quench detection voltage to <1 V. These measurements, coupled with an analytical quench model, were used to assess the impact of the maximum allowable detection voltage and temperature upon quench detection on the quench protection, assuming a limit of the hot spot temperature to <300 K. (paper)

  20. Serially Connected Micro Amorphous Silicon Solar Cells for Compact High-Voltage Sources

    Directory of Open Access Journals (Sweden)

    Jiyoon Nam

    2016-01-01

    Full Text Available We demonstrate a compact amorphous silicon (a-Si solar module to be used as high-voltage power supply. In comparison with the organic solar module, the main advantages of the a-Si solar module are its compatibility with photolithography techniques and relatively high power conversion efficiency. The open circuit voltage of a-Si solar cells can be easily controlled by serially interconnecting a-Si solar cells. Moreover, the a-Si solar module can be easily patterned by photolithography in any desired shapes with high areal densities. Using the photolithographic technique, we fabricate a compact a-Si solar module with noticeable photovoltaic characteristics as compared with the reported values for high-voltage power supplies.

  1. Balancing High Open Circuit Voltage over 1.0 V and High Short Circuit Current in Benzodithiophene-Based Polymer Solar Cells with Low Energy Loss: A Synergistic Effect of Fluorination and Alkylthiolation

    DEFF Research Database (Denmark)

    Du, Zhengkun; Bao, Xichang; Li, Yonghai

    2018-01-01

    Based on the most recently significant progress within the last one year in organic photovoltaic research from either alkylthiolation or fluorination on benzo[1,2-b: 4,5-b'] dithiophene moiety for high efficiency polymer solar cells (PSCs), two novel simultaneously fluorinated and alkylthiolated ...

  2. Phenothiazine-based small-molecule organic solar cells with power conversion efficiency over 7% and open circuit voltage of about 1.0 V using solvent vapor annealing.

    Science.gov (United States)

    Rout, Yogajivan; Misra, Rajneesh; Singhal, Rahul; Biswas, Subhayan; Sharma, Ganesh D

    2018-02-28

    We have used two unsymmetrical small molecules, named phenothiazine 1 and 2 with a D-A-D-π-D configuration, where phenothiazine is used as a central unit, triphenylamine is used as a terminal unit and TCBD and cyclohexa-2,5-diene-1,4-diylidene-expanded TCBD are used as an acceptor between the phenothiazine and triphenylamine units, as a small molecule donor along with PC 71 BM as an acceptor for solution processed bulk heterojunction solar cells. The variation of acceptors in the phenothiazine derivatives makes an exciting change in the photophysical and electrochemical properties, hole mobility and therefore photovoltaic performance. The optimized device based on phenothiazine 2 exhibited a high power conversion efficiency of 7.35% (J sc = 11.98 mA cm -2 , V oc = 0.99 V and FF = 0.62), while the device based on phenothiazine 1 showed a low PCE of 4.81% (J sc = 8.73 mA cm -2 , V oc = 0.95 V and FF = 0.58) after solvent vapour annealing (SVA) treatment. The higher value of power conversion efficiency of the 2 based devices irrespective of the processing conditions may be related to the broader absorption and lower band gap of 2 as compared to 1. The improvement in the SVA treated active layer may be related to the enhanced crystallinity, molecular ordering and aggregation and shorter π-π stacking distance of the small molecule donors.

  3. Kinetics of Ca2+- and ATP-dependent, voltage-controlled anion conductance in the plasma membrane of mesophyll cells of Pisum sativum

    NARCIS (Netherlands)

    Elzenga, J.T.M.; van Volkenburgh, E.

    Whole-cell patch-clamp techniques were used to measure anion currents through the plasma membrane of protoplasts of mesophyll cells of expanding pea (Pisum sativum L.) leaves. Voltage-induced changes of the currents could be modelled with single exponential activation and deactivation kinetics. The

  4. The temperature dependence of the characteristics of crystalline-silicon-based heterojunction solar cells

    Science.gov (United States)

    Sachenko, A. V.; Kryuchenko, Yu. V.; Kostylyov, V. P.; Korkishko, R. M.; Sokolovskyi, I. O.; Abramov, A. S.; Abolmasov, S. N.; Andronikov, D. A.; Bobyl', A. V.; Panaiotti, I. E.; Terukov, E. I.; Titov, A. S.; Shvarts, M. Z.

    2016-03-01

    Temperature dependences of the photovoltaic characteristics of ( p)a-Si/( i)a-Si:H/( n)c-Si singlecrystalline- silicon based heterojunction-with-intrinsic-thin-layer (HIT) solar cells have been measured in a temperature range of 80-420 K. The open-circuit voltage ( V OC), fill factor ( FF) of the current-voltage ( I-U) characteristic, and maximum output power ( P max) reach limiting values in the interval of 200-250 K on the background of monotonic growth in the short-circuit current ( I SC) in a temperature range of 80-400 K. At temperatures below this interval, the V OC, FF, and P max values exhibit a decrease. It is theoretically justified that a decrease in the photovoltaic energy conversion characteristics of solar cells observed on heating from 250 to 400 K is related to exponential growth in the intrinsic conductivity. At temperatures below 200 K, the I-U curve shape exhibits a change that is accompanied by a drop in V OC. Possible factors that account for the decrease in V OC, FF, and P max are considered.

  5. The sea anemone Bunodosoma caissarum toxin BcIII modulates the sodium current kinetics of rat dorsal root ganglia neurons and is displaced in a voltage-dependent manner.

    Science.gov (United States)

    Salceda, Emilio; López, Omar; Zaharenko, André J; Garateix, Anoland; Soto, Enrique

    2010-03-01

    Sea anemone toxins bind to site 3 of the sodium channels, which is partially formed by the extracellular linker connecting S3 and S4 segments of domain IV, slowing down the inactivation process. In this work we have characterized the actions of BcIII, a sea anemone polypeptide toxin isolated from Bunodosoma caissarum, on neuronal sodium currents using the patch clamp technique. Neurons of the dorsal root ganglia of Wistar rats (P5-9) in primary culture were used for this study (n=65). The main effects of BcIII were a concentration-dependent increase in the sodium current inactivation time course (IC(50)=2.8 microM) as well as an increase in the current peak amplitude. BcIII did not modify the voltage at which 50% of the channels are activated or inactivated, nor the reversal potential of sodium current. BcIII shows a voltage-dependent action. A progressive acceleration of sodium current fast inactivation with longer conditioning pulses was observed, which was steeper as more depolarizing were the prepulses. The same was observed for other two anemone toxins (CgNa, from Condylactis gigantea and ATX-II, from Anemonia viridis). These results suggest that the binding affinity of sea anemone toxins may be reduced in a voltage-dependent manner, as has been described for alpha-scorpion toxins. (c) 2009 Elsevier Inc. All rights reserved.

  6. Bulk Heterojunction Organic Solar Cell Area-Dependent Parameter Fluctuation

    Directory of Open Access Journals (Sweden)

    A. J. Trindade

    2017-01-01

    Full Text Available Organic solar cell efficiency is known to be active area dependent and is usually a problem in the upscale factor for market applications. In this work, a detailed study of organic photovoltaic devices with active layer based on poly(3-hexylthiophene (P3HT and 1-(3-methoxycarbonyl-propyl-1-phenyl-(6,6C61 (PCBM is made, evaluating the effect of the change on the active area from 10−2 to 4 cm4. The device structure was kept simple in order to allow the understanding of the physical effects involved. Device figures of merit were extracted from the equivalent circuit using a genetic-based algorithm, and their relationship with the active area was compared. It is observed that the efficiency drops significantly with the active area increase (as the fill factor while the parallel and series resistance, adjusted to the active area, seems to be relatively constant and increases linearly, respectively. The short circuit current and the generated photocurrent also drop significantly with the active area increase. The open circuit voltage does not show major changes. These results are discussed considering the main influences for the observed efficiency data. Particularly, as the basic circuit model seems to fail to explain the macroscopic results, the behavior can be related with the enlargement of defect interaction.

  7. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels

    Science.gov (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro

    2004-01-01

    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  8. Comment on 'Temperature dependence of the current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions'

    Energy Technology Data Exchange (ETDEWEB)

    Pipinys, P; Rimeika, A [Department of Physics, Vilnius Pedagogical University, Studentu 39, LT-08106 Vilnius (Lithuania)], E-mail: ftfdekanas@vpu.lt

    2008-02-27

    Current-voltage characteristics of Sn/PANI/p-Si/Al heterojunctions, measured in the temperature range 140-280 K by Kaya et al (2007 J. Phys.: Condens. Matter 19 406205), are reinterpreted in the framework of phonon-assisted tunnelling theory, as a free-charge-carrier generation mechanism in the strong electrical field. It is shown that phonon-assisted tunnelling more adequately describes the peculiarities of the variation of I-V data with temperature in PANI polymers. (comment)

  9. Substrate dependence of energy level alignment at the donor-acceptor interface in organic photovoltaic devices

    International Nuclear Information System (INIS)

    Zhou, Y.C.; Liu, Z.T.; Tang, J.X.; Lee, C.S.; Lee, S.T.

    2009-01-01

    The interface energy level alignment between copper phthalocyanine (CuPC) and fullerene (C60), the widely studied donor-acceptor pair in organic photovoltaics (OPVs), on indium-tin oxide (ITO) and Mg substrate was investigated. The CuPC/C60 interface formed on ITO shows a nearly common vacuum level, but a dipole and band bending exist, resulting in a 0.8 eV band offset at the same interface on Mg. This observation indicates that the energy difference between the highest occupied molecular orbital of CuPC and the lowest unoccupied molecular orbital of C60, which dictates the open circuit voltage of the CuPC/C60 OPV, can be tuned by the work function of the substrate. Furthermore, the substrate effect on the energy alignment at the donor/acceptor interface can satisfactorily explain that a device with an anode of a smaller work function can provide a higher open circuit voltage.

  10. Angular dependence of Si3N4 etch rates and the etch selectivity of SiO2 to Si3N4 at different bias voltages in a high-density C4F8 plasma

    International Nuclear Information System (INIS)

    Lee, Jin-Kwan; Lee, Gyeo-Re; Min, Jae-Ho; Moon, Sang Heup

    2007-01-01

    The dependence of Si 3 N 4 etch rates and the etch selectivity of SiO 2 to Si 3 N 4 on ion-incident angles was studied for different bias voltages in a high-density C 4 F 8 plasma. A Faraday cage and specially designed substrate holders were used to accurately control the angles of incident ions on the substrate surface. The normalized etch yield (NEY), defined as the etch yield obtained at a given ion-incident angle normalized to that obtained on a horizontal surface, was unaffected by the bias voltage in Si 3 N 4 etching, but it increased with the bias voltage in SiO 2 etching in the range of -100 to -300 V. The NEY changed showing a maximum with an increase in the ion-incident angle in the etching of both substrates. In the Si 3 N 4 etching, a maximum NEY of 1.7 was obtained at 70 deg. in the above bias voltage range. However, an increase in the NEY at high ion-incident angles was smaller for SiO 2 than for Si 3 N 4 and, consequently, the etch selectivity of SiO 2 to Si 3 N 4 decreased with an increase in the ion-incident angle. The etch selectivity decreased to a smaller extent at high bias voltage because the NEY of SiO 2 had increased. The characteristic changes in the NEY for different substrates could be correlated with the thickness of a steady-state fluorocarbon (CF x ) film formed on the substrates

  11. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Science.gov (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  12. Voltage regulating circuit

    NARCIS (Netherlands)

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  13. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

    Science.gov (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

    2018-05-01

    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  14. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Science.gov (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

    2008-06-25

    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  15. Cell voltage versus electrode potential range in aqueous supercapacitors

    Science.gov (United States)

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

  16. Open Circuit Potential Changes upon Protonation/Deprotonation of ω-Functionalized Alkanethiols on Au: Determination of Surface pK {sub 1/2} in Aqueous and Non-Aqueous System

    Energy Technology Data Exchange (ETDEWEB)

    Yoo, Seung Ryul; Park, Kyung Soon; Jang, Jae Won; Hwang, Seong Pil [Korea Univ., Sejong (Korea, Republic of)

    2016-09-15

    The controlled assembly of functional nanomaterials has been drawing significant interest for making devices by integration of nanomaterials. The building blocks of functional nanomaterials might be confined spatially on the chemically patterned surface through both covalent and non-covalent bonds. Potentiometric measurement is affordable technique for various researchers because it requires only voltmeter and reference electrode. Moreover, it can be applied to various polar solvent such as methanol and ethanol. The open circuit potential (OCP) is measured indicating the potential difference between reference electrode and working electrode. The potential of working electrode might be affected by redox chemical reaction and charge state/separation. Our results provide the simple and affordable method to investigate pK {sub 1/2} of thin film both in aqueous phase and in non-aqueous phase, which has significant role in colloidal chemistry, nanochemistry, surface chemistry, electrochemistry, and others.

  17. Threshold voltage variation depending on single grain boundary and stored charges in an adjacent cell for vertical silicon–oxide–nitride–oxide–silicon NAND flash memory

    Science.gov (United States)

    Oh, Hyeongwan; Kim, Jiwon; Baek, Rock-Hyun; Lee, Jeong-Soo

    2018-04-01

    The effects of single grain boundary (SGB) position and stored electron charges in an adjacent cell in silicon–oxide–nitride–oxide–silicon (SONOS) structures on the variations of threshold voltage (V th) were investigated using technology computer-aided design (TCAD) simulation. As the bit line voltage increases, the SGB position causing the maximum V th variation was shifted from the center to the source side in the channel, owing to the drain-induced grain barrier lowering effect. When the SGB is located in the spacer region, the potential interaction from both the SGB and the stored electron charges in the adjacent cell becomes significant and thus resulting in larger V th variation. In contrast, when the SGB is located at the center of the channel, the peak position of potential barrier is shifted to the center, so that the influence of the adjacent cell is diminished. As the gate length is scaled down to 20 nm, the influence of stored charges in adjacent cells becomes significant, resulting in larger V th variations.

  18. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D

    2000-01-01

    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  19. Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

    2015-07-07

    Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

  20. Temperature dependent quasi-static capacitance-voltage characterization of SiO2/β-Ga2O3 interface on different crystal orientations

    Science.gov (United States)

    Zeng, Ke; Singisetti, Uttam

    2017-09-01

    The interface trap density (Dit) of the SiO2/β-Ga2O3 interface in ( 2 ¯ 01), (010), and (001) orientations is obtained by the Hi-Lo method with the low frequency capacitance measured using the Quasi-Static Capacitance-Voltage (QSCV) technique. QSCV measurements are carried out at higher temperatures to increase the measured energy range of Dit in the bandgap. At room temperature, higher Dit is observed near the band edge for all three orientations. The measurement at higher temperatures led to an annealing effect that reduced the Dit value for all samples. Comparison with the conductance method and frequency dispersion of the capacitance suggests that the traps at the band edge are slow traps which respond to low frequency signals.

  1. Thickness dependence of the poling and current-voltage characteristics of paint films made up of lead zirconate titanate ceramic powder and epoxy resin

    Science.gov (United States)

    Egusa, Shigenori; Iwasawa, Naozumi

    1995-11-01

    A specially prepared paint made up of lead zirconate titanate (PZT) ceramic powder and epoxy resin was coated on an aluminum plate and was cured at room temperature, thus forming the paint film of 25-300 μm thickness with a PZT volume fraction of 53%. The paint film was then poled at room temperature, and the poling behavior was determined by measuring the piezoelectric activity as a function of poling field. The poling behavior shows that the piezoelectric activity obtained at a given poling field increases with an increase in the film thickness from 25 to 300 μm. The current-voltage characteristic of the paint film, on the other hand, shows that the increase in the film thickness leads not only to an increase in the magnitude of the current density at a given electric field but also to an increase in the critical electric field at which the transition from the ohmic to space-charge-limited conduction takes place. This fact indicates that the amount of the space charge of electrons injected into the paint film decreases as the film thickness increases. Furthermore, comparison of the current-voltage characteristic of the paint film with that of a pure epoxy film reveals that the space charge is accumulated largely at the interface between the PZT and epoxy phases in the paint film. On the basis of this finding, a model is developed for the poling behavior of the paint film by taking into account a possible effect of the space-charge accumulation and a broad distribution of the electric field in the PZT phase. This model is shown to give an excellent fit to the experimental data of the piezoelectric activity obtained here as a function of poling field and film thickness.

  2. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Science.gov (United States)

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  3. Analysis of bias voltage dependent spectral response in Ga0.51In0.49P/Ga0.99In0.01As/Ge triple junction solar cell

    International Nuclear Information System (INIS)

    Sogabe, Tomah; Ogura, Akio; Okada, Yoshitaka

    2014-01-01

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V bias ) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V bias for Ga 0.51 In 0.49 P/Ga 0.99 In 0.01 As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V bias measurements. The profile of SR−V bias curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell

  4. Analysis of bias voltage dependent spectral response in Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Sogabe, Tomah, E-mail: Sogabe@mbe.rcast.u-tokyo.ac.jp; Ogura, Akio; Okada, Yoshitaka [Research Center for Advanced Science and Technology (RCAST), The University of Tokyo 4-6-1 Komaba, Meguro-ku, Tokyo 153-8504 (Japan)

    2014-02-21

    Spectral response measurement plays great role in characterizing solar cell device because it directly reflects the efficiency by which the device converts the sunlight into an electrical current. Based on the spectral response results, the short circuit current of each subcell can be quantitatively determined. Although spectral response dependence on wavelength, i.e., the well-known external quantum efficiency (EQE), has been widely used in characterizing multijunction solar cell and has been well interpreted, detailed analysis of spectral response dependence on bias voltage (SR −V{sub bias}) has not been reported so far. In this work, we have performed experimental and numerical studies on the SR −V{sub bias} for Ga{sub 0.51}In{sub 0.49}P/Ga{sub 0.99}In{sub 0.01}As/Ge triple junction solar cell. Phenomenological description was given to clarify the mechanism of operation matching point variation in SR −V{sub bias} measurements. The profile of SR−V{sub bias} curve was explained in detail by solving the coupled two-diode current-voltage characteristic transcend formula for each subcell.

  5. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta

    2008-01-01

    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  6. Analysis of temperature-dependant current–voltage characteristics and extraction of series resistance in Pd/ZnO Schottky barrier diodes

    Energy Technology Data Exchange (ETDEWEB)

    Mayimele, M A, E-mail: meehleketo@gmail.com; Rensburg, J P van. Janse; Auret, F D; Diale, M

    2016-01-01

    We report on the analysis of current voltage (I–V) measurements performed on Pd/ZnO Schottky barrier diodes (SBDs) in the 80–320 K temperature range. Assuming thermionic emission (TE) theory, the forward bias I–V characteristics were analysed to extract Pd/ZnO Schottky diode parameters. Comparing Cheung’s method in the extraction of the series resistance with Ohm’s law, it was observed that at lower temperatures (T<180 K) the series resistance decreased with increasing temperature, the absolute minimum was reached near 180 K and increases linearly with temperature at high temperatures (T>200 K). The barrier height and the ideality factor decreased and increased, respectively, with decrease in temperature, attributed to the existence of barrier height inhomogeneity. Such inhomogeneity was explained based on TE with the assumption of Gaussian distribution of barrier heights with a mean barrier height of 0.99 eV and a standard deviation of 0.02 eV. A mean barrier height of 0.11 eV and Richardson constant value of 37 A cm{sup −2} K{sup −2} were determined from the modified Richardson plot that considers the Gaussian distribution of barrier heights.

  7. Macroeconomic Assessment of Voltage Sags

    Directory of Open Access Journals (Sweden)

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  8. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

    2008-01-01

    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  9. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

    Science.gov (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

    2008-11-01

    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  10. Membrane Potential-dependent Uptake of 18F-triphenylphosphonium - A New Voltage Sensor as an Imaging Agent for Detecting Burn-induced Apoptosis

    Science.gov (United States)

    Zhao, Gaofeng; Yu, Yong-Ming; Shoup, Timothy M.; Elmaleh, David R.; Bonab, Ali A.; Tompkins, Ronald G.; Fischman, Alan J.

    2014-01-01

    Background Mitochondrial dysfunction has been closely related to many pathological processes, such as cellular apoptosis. Alterations in organelle membrane potential are associated with mitochondrial dysfunction. A fluorine -18 labeled phosphonium compound: 18F-triphenylphosphonium (18F-TPP) was prepared to determine its potential use as a mitochondria-targeting radiopharmaceutical to evaluate cellular apoptosis. Methods Studies were conducted in both ex vivo cell lines and in vivo using a burned animal model. Uptake of 18F-TPP was assessed in PC-3 cells by gamma counting under the following conditions: graded levels of extra-cellular potassium concentrations, incubation with carbonyl cyanide m-chlorophenylhydrazone (CCCP) and staurosporine. Apoptosis was studied in a burn animal model using TUNEL staining and simultaneous assessment of 18F-TPP uptake by biodistribution. Results We found that stepwise membrane depolarization by potassium (K) resulted in a linear decrease in 18F-TPP uptake, with a slope of 0.62+/−0.08 and a correlation coefficient of 0.936+/−0.11. Gradually increased concentrations of CCCP lead to decreased uptakes of 18F-TPP. Staurosporine significantly decreased the uptake of 18F-TPP in PC-3 cells from 14.2+/−3.8% to 5.6+/−1.3% (P<0.001). Burn induced significant apoptosis (sham: 4.4 +/−1.8% vs. burn: 24.6+/− 6.7 %; p<0.005) and a reduced uptake of tracer in the spleens of burn injured animals as compared to sham burn controls (burn: 1.13+/−0.24% vs. sham: 3.28+/−0.67%; p<0.005). Biodistribution studies demonstrated that burn induced significant reduction in 18F-TPP uptake in spleen, heart, lung, and liver, which were associated with significantly increased apoptosis. Conclusions 18F-TPP is a promising new voltage sensor for detecting mitochondrial dysfunction and apoptosis in various tissues. PMID:24582214

  11. High voltage systems

    International Nuclear Information System (INIS)

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  12. Voltage regulator for generator

    Energy Technology Data Exchange (ETDEWEB)

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  13. Two-stage unified stretched-exponential model for time-dependence of threshold voltage shift under positive-bias-stresses in amorphous indium-gallium-zinc oxide thin-film transistors

    Science.gov (United States)

    Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In

    2017-08-01

    In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.

  14. Automatic voltage imbalance detector

    Science.gov (United States)

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  15. Voltage and partial pressure dependent defect chemistry in (La,Sr)FeO3-δ thin films investigated by chemical capacitance measurements.

    Science.gov (United States)

    Schmid, Alexander; Rupp, Ghislain M; Fleig, Jürgen

    2018-05-03

    La0.6Sr0.4FeO3-δ (LSF) thin films of different thickness were prepared by pulsed laser deposition on yttria stabilized zirconia (YSZ) and characterized by using three electrode impedance spectroscopy. Electrochemical film capacitance was analyzed in relation to oxygen partial pressure (0.25 mbar to 1 bar), DC polarization (0 m to -600 m) and temperature (500 to 650 °C). For most measurement parameters, the chemical bulk capacitance dominates the overall capacitive properties and the corresponding defect chemical state depends solely on the oxygen chemical potential inside the film, independent of atmospheric oxygen pressure and DC polarization. Thus, defect chemical properties (defect concentrations and defect formation enthalpies) could be deduced from such measurements. Comparison with LSF defect chemical bulk data from the literature showed good agreement for vacancy formation energies but suggested larger electronic defect concentrations in the films. From thickness-dependent measurements at lower oxygen chemical potentials, an additional capacitive contribution could be identified and attributed to the LSF|YSZ interface. Deviations from simple chemical capacitance models at high pressures are most probably due to defect interactions.

  16. Voltage and partial pressure dependent defect chemistry in (La,Sr)FeO3–δ thin films investigated by chemical capacitance measurements

    Science.gov (United States)

    Rupp, Ghislain M.; Fleig, Jürgen

    2018-01-01

    La0.6Sr0.4FeO3–δ (LSF) thin films of different thickness were prepared by pulsed laser deposition on yttria stabilized zirconia (YSZ) and characterized by using three electrode impedance spectroscopy. Electrochemical film capacitance was analyzed in relation to oxygen partial pressure (0.25 mbar to 1 bar), DC polarization (0 m to –600 m) and temperature (500 to 650 °C). For most measurement parameters, the chemical bulk capacitance dominates the overall capacitive properties and the corresponding defect chemical state depends solely on the oxygen chemical potential inside the film, independent of atmospheric oxygen pressure and DC polarization. Thus, defect chemical properties (defect concentrations and defect formation enthalpies) could be deduced from such measurements. Comparison with LSF defect chemical bulk data from the literature showed good agreement for vacancy formation energies but suggested larger electronic defect concentrations in the films. From thickness-dependent measurements at lower oxygen chemical potentials, an additional capacitive contribution could be identified and attributed to the LSF|YSZ interface. Deviations from simple chemical capacitance models at high pressures are most probably due to defect interactions. PMID:29671421

  17. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Directory of Open Access Journals (Sweden)

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  18. Voltage Unbalance Compensation with Smart Three-phase Loads

    DEFF Research Database (Denmark)

    Douglass, Philip; Trintis, Ionut; Munk-Nielsen, Stig

    2016-01-01

    unbalance originating in the power supply network. Two variants of the algorithm are tested: first, using phase-neutral voltage as input, second, using phase-phase voltage. The control algorithm is described, and evaluated in simulations and laboratory tests. Two metrics for quantifying voltage unbalance...... are evaluated: one metric based on the maximum deviation of RMS phaseneutral voltage from the average voltage and one metric based on negative sequence voltage. The tests show that controller that uses phase-neutral voltage as input can in most cases eliminate the deviations of phase voltage from the average...... is caused by asymmetrical loads. These results suggest that the optimal algorithm to reduce system unbalance depends on which system parameter is most important: phase-neutral voltage unbalance, phase-phase voltage unbalance, or current unbalance....

  19. Tensile stress-dependent fracture behavior and its influences on photovoltaic characteristics in flexible PbS/CdS thin-film solar cells.

    Science.gov (United States)

    Lee, Seung Min; Yeon, Deuk Ho; Mohanty, Bhaskar Chandra; Cho, Yong Soo

    2015-03-04

    Tensile stress-dependent fracture behavior of flexible PbS/CdS heterojunction thin-film solar cells on indium tin oxide-coated polyethylene terephthalate (PET) substrates is investigated in terms of the variations of fracture parameters with applied strains and their influences on photovoltaic properties. The PbS absorber layer that exhibits only mechanical cracks within the applied strain range from ∼0.67 to 1.33% is prepared by chemical bath deposition at different temperatures of 50, 70, and 90 °C. The PbS thin films prepared at 50 °C demonstrate better mechanical resistance against the applied bending strain with the highest crack initiating bending strain of ∼1.14% and the lowest saturated crack density of 0.036 μm(-1). Photovoltaic properties of the cells depend on the deposition temperature and the level of applied tensile stress. The values of short-circuit current density and fill factor are dramatically reduced above a certain level of applied strain, while open-circuit voltage is nearly maintained. The dependency of photovoltaic properties on the progress of fractures is understood as related to the reduced fracture energy and toughness, which is limitedly controllable by microstructural features of the absorber layer.

  20. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  1. An improved low-voltage ride-through performance of DFIG based wind plant using stator dynamic composite fault current limiter.

    Science.gov (United States)

    Gayen, P K; Chatterjee, D; Goswami, S K

    2016-05-01

    In this paper, an enhanced low-voltage ride-through (LVRT) performance of a grid connected doubly fed induction generator (DFIG) has been presented with the usage of stator dynamic composite fault current limiter (SDCFCL). This protection circuit comprises of a suitable series resistor-inductor combination and parallel bidirectional semiconductor switch. The SDCFCL facilitates double benefits such as reduction of rotor induced open circuit voltage due to increased value of stator total inductance and concurrent increase of rotor impedance. Both effects will limit rotor circuit over current and over voltage situation more secured way in comparison to the conventional scheme like the dynamic rotor current limiter (RCL) during any type of fault situation. The proposed concept is validated through the simulation study of the grid integrated 2.0MW DFIG. Copyright © 2016 ISA. Published by Elsevier Ltd. All rights reserved.

  2. A Novel Index for Online Voltage Stability Assessment Based on Correlation Characteristic of Voltage Profiles

    Directory of Open Access Journals (Sweden)

    M. R. Aghamohammadi

    2011-06-01

    Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.

  3. Intrinsic non-radiative voltage losses in fullerene-based organic solar cells

    Science.gov (United States)

    Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Fan, Yeli; Tropiano, Manuel; McGarry, Kathryn A.; Zeika, Olaf; Riede, Moritz K.; Douglas, Christopher J.; Barlow, Stephen; Marder, Seth R.; Neher, Dieter; Spoltore, Donato; Vandewal, Koen

    2017-06-01

    Organic solar cells demonstrate external quantum efficiencies and fill factors approaching those of conventional photovoltaic technologies. However, as compared with the optical gap of the absorber materials, their open-circuit voltage is much lower, largely due to the presence of significant non-radiative recombination. Here, we study a large data set of published and new material combinations and find that non-radiative voltage losses decrease with increasing charge-transfer-state energies. This observation is explained by considering non-radiative charge-transfer-state decay as electron transfer in the Marcus inverted regime, being facilitated by a common skeletal molecular vibrational mode. Our results suggest an intrinsic link between non-radiative voltage losses and electron-vibration coupling, indicating that these losses are unavoidable. Accordingly, the theoretical upper limit for the power conversion efficiency of single-junction organic solar cells would be reduced to about 25.5% and the optimal optical gap increases to 1.45-1.65 eV, that is, 0.2-0.3 eV higher than for technologies with minimized non-radiative voltage losses.

  4. Technological Aspects: High Voltage

    International Nuclear Information System (INIS)

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  5. Technological Aspects: High Voltage

    CERN Document Server

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  6. Stray voltage mitigation

    Energy Technology Data Exchange (ETDEWEB)

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  7. High voltage engineering

    CERN Document Server

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  8. High voltage test techniques

    CERN Document Server

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  9. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

    Directory of Open Access Journals (Sweden)

    Alicia Lundby

    2008-06-01

    Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  10. Nonlinear electrokinetics at large voltages

    Energy Technology Data Exchange (ETDEWEB)

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  11. An experimental analysis of illumination intensity and temperature dependency of photovoltaic cell parameters

    International Nuclear Information System (INIS)

    Cuce, Erdem; Cuce, Pinar Mert; Bali, Tulin

    2013-01-01

    Highlights: • R sh is rather sensitive to the variations in T c . • For higher G values, G ∗ is not affected from the variations in light intensity. • Ideality factor decreases linearly with increasing T c . • A linear decrease of R s and R sh has been observed with increasing T c . • Fill factor increases exponentially with G while it decreases linearly with T c . - Abstract: It is well known that accurate knowledge of photovoltaic cell parameters from the measured current–voltage characteristics is of vital importance for the quality control and the performance assessment of photovoltaic cells/modules. Although many attempts have been made so far for a thorough analysis of cell parameters, there are still significant discrepancies between the previously published results. In this regard, a detailed investigation of cell parameters through a comprehensive experimental and statistical work is important to elucidate the aforementioned contradictions. Therefore in the present work, effects of two main environmental factors on performance parameters of mono-crystalline and poly-crystalline silicon photovoltaic modules have been experimentally investigated. The experiments have been carried out under a calibrated solar simulator for various intensity levels and cell temperatures in the range 200–500 W/m 2 and 15–60 °C, respectively. The results indicated that light intensity has a dominant effect on current parameters. Photocurrent, short circuit current and maximum current increase linearly with increasing intensity level. A new term, solar intensity coefficient, has been defined first time to characterize the solar radiation dependency of current parameters. On the other hand, it has been observed that cell temperature has a dramatic effect on voltage parameters. Open circuit voltage and maximum voltage considerably decrease with increasing cell temperature. Temperature coefficients of voltage parameters have been calculated for each case. Shunt

  12. A FAST study of quasi-static structure ("Inverted-V") potential drops and their latitudinal dependence in the premidnight sector and ramifications for the current-voltage relationship

    Science.gov (United States)

    Dombeck, J.; Cattell, C.; McFadden, J.

    2013-09-01

    Utilizing FAST satellite electron measurements, we present the first reported investigation of the dependency on latitude of quasi-static structure ("inverted-V") potential drop magnitude (Φ). A trend of lower Φ at lower latitudes in the premidnight sector on field lines with dark foot points was observed. This trend is supported both statistically and in individual satellite crossings. The existence of two distinct peaks in occurrence probability for Φ was also observed: one between ~2 kV and 10 kV and the other at somewhat less than 1 kV. The relative occurrence of structures with Φ in the higher (>2 kV) peak is significantly reduced with decreasing latitude. This partially accounts for the statistical trend of lower potential drop magnitudes at lower latitudes. The two Φ occurrence frequency peaks correspond to two different regimes (one with eΦ/kTe ~ or > 1 and one with eΦ/kTe current-voltage relation where source electron density rather than Φ is most directly controlled by the field-aligned current density. These observations and their ramifications represent a significant step forward in the understanding of field-aligned currents, auroral acceleration, and magnetospheric-ionospheric coupling.

  13. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin.

    Science.gov (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava

    2014-04-03

    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  14. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li

    2013-01-01

    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  15. Short communication: Use of a portable, automated, open-circuit gas quantification system and the sulfur hexafluoride tracer technique for measuring enteric methane emissions in Holstein cows fed ad libitum or restricted.

    Science.gov (United States)

    Dorich, C D; Varner, R K; Pereira, A B D; Martineau, R; Soder, K J; Brito, A F

    2015-04-01

    The objective of this study was to measure enteric CH4 emissions using a new portable automated open-circuit gas quantification system (GQS) and the sulfur hexafluoride tracer technique (SF6) in midlactation Holstein cows housed in a tiestall barn. Sixteen cows averaging 176 ± 34 d in milk, 40.7 ± 6.1 kg of milk yield, and 685 ± 49 kg of body weight were randomly assigned to 1 out of 2 treatments according to a crossover design. Treatments were (1) ad libitum (adjusted daily to yield 10% orts) and (2) restricted feed intake [set to restrict feed by 10% of baseline dry matter intake (DMI)]. Each experimental period lasted 22d, with 14 d for treatment adaptation and 8d for data and sample collection. A common diet was fed to the cows as a total mixed ration and contained 40.4% corn silage, 11.2% grass-legume haylage, and 48.4% concentrate on a dry matter basis. Spot 5-min measurements using the GQS were taken twice daily with a 12-h interval between sampling and sampling times advanced 2h daily to account for diurnal variation in CH4 emissions. Canisters for the SF6 method were sampled twice daily before milking with 4 local background gas canisters inside the barn analyzed for background gas concentrations. Enteric CH4 emissions were not affected by treatments and averaged 472 and 458 g/d (standard error of the mean = 18 g/d) for ad libitum and restricted intake treatments, respectively (data not shown). The GQS appears to be a reliable method because of the relatively low coefficients of variation (ranging from 14.1 to 22.4%) for CH4 emissions and a moderate relationship (coefficient of determination = 0.42) between CH4 emissions and DMI. The SF6 resulted in large coefficients of variation (ranging from 16.0 to 111%) for CH4 emissions and a poor relationship (coefficient of determination = 0.17) between CH4 emissions and DMI, likely because of limited barn ventilation and high background gas concentration. Research with improved barn ventilation systems or

  16. A Low-Power and Low-Voltage Power Management Strategy for On-Chip Micro Solar Cells

    Directory of Open Access Journals (Sweden)

    Ismail Cevik

    2015-01-01

    Full Text Available Fundamental characteristics of on-chip micro solar cell (MSC structures were investigated in this study. Several MSC structures using different layers in three different CMOS processes were designed and fabricated. Effects of PN junction structure and process technology on solar cell performance were measured. Parameters for low-power and low-voltage implementation of power management strategy and boost converter based circuits utilizing fractional voltage maximum power point tracking (FVMPPT algorithm were determined. The FVMPPT algorithm works based on the fraction between the maximum power point operation voltage and the open circuit voltage of the solar cell structure. This ratio is typically between 0.72 and 0.78 for commercially available poly crystalline silicon solar cells that produce several watts of power under typical daylight illumination. Measurements showed that the fractional voltage ratio is much higher and fairly constant between 0.82 and 0.85 for on-chip mono crystalline silicon micro solar cell structures that produce micro watts of power. Mono crystalline silicon solar cell structures were observed to result in better power fill factor (PFF that is higher than 74% indicating a higher energy harvesting efficiency.

  17. Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

    Science.gov (United States)

    Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

    2013-11-01

    This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

  18. Origin of Non-Radiative Voltage Losses in Fullerene-Based Organic Solar Cells

    Science.gov (United States)

    Benduhn, Johannes; Tvingstedt, Kristofer; Piersimoni, Fortunato; Ullbrich, Sascha; Neher, Dieter; Spoltore, Donato; Vandewal, Koen

    The open-circuit voltage of organic solar cells (OSCs) is low as compared to the optical gap of the absorber molecules, indicating high energy losses per absorbed photon. These voltage losses arise only partly due to necessity of an electron transfer event to dissociate the excitons. A large part of these voltage losses is due to recombination of photo-generated charge carriers, including inevitable radiative recombination. In this work, we study the non-radiative recombination losses and we find that they increase when the energy difference between charge transfer (CT) state and ground state decreases. This behavior is in agreement with the \\x9Denergy gap law for non-radiative transition\\x9D, which implies that internal conversion from CT state to ground state is facilitated by skeletal molecular vibrations. This intrinsic loss mechanism, which until now has not been thoroughly considered for OSCs, is different in its nature as compared to the commonly considered inorganic photovoltaic loss mechanisms of defect, surface, and Auger recombination. As a consequence, the theoretical upper limit for the power conversion efficiency of a single junction OSC reduces by 25% as compared to the Shockley-Queisser limit for an optimal optical gap of the main absorber between (1.45-1.65) eV.

  19. Dependence of the photovoltaic performance of pseudomorphic InGaN/GaN multiple-quantum-well solar cells on the active region thickness

    Energy Technology Data Exchange (ETDEWEB)

    Mukhtarova, Anna; Valdueza-Felip, Sirona; Redaelli, Luca; Durand, Christophe; Monroy, Eva; Eymery, Joël, E-mail: joel.eymery@cea.fr [Université Grenoble Alpes, 38000 Grenoble (France); CEA-CNRS group “Nanophysique et semiconducteurs”, CEA-INAC-PHELIQS, 17 av. des Martyrs, 38054 Grenoble (France); Bougerol, Catherine [Université Grenoble Alpes, 38000 Grenoble (France); CEA-CNRS group “Nanophysique et semiconducteurs”, Institut Néel-CNRS, 25 av. des Martyrs, 38042 Grenoble (France)

    2016-04-18

    We investigate the photovoltaic performance of pseudomorphic In{sub 0.1}Ga{sub 0.9}N/GaN multiple-quantum well (MQW) solar cells as a function of the total active region thickness. An increase in the number of wells from 5 to 40 improves the short-circuit current and the open-circuit voltage, resulting in a 10-fold enhancement of the overall conversion efficiency. Further increasing the number of wells leads to carrier collection losses due to an incomplete depletion of the active region. Capacitance-voltage measurements point to a hole diffusion length of 48 nm in the MQW region.

  20. Composition-dependent phase separation effects of organic solar cells using P3HT:PCBM as active layer and chromium oxide as hole transporting layer

    International Nuclear Information System (INIS)

    Qin Pingli; Fang Guojia; Sun Nanhai; Fan Xi; Zheng Qiao; Chen Fei; Wan Jiawei; Zhao Xingzhong

    2011-01-01

    Phase separation of the poly(3-hexylthiophene) (P3HT) and [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) active layer (ATL) was investigated by varying their relative ratio in the organic solar cells (OSCs). With the help of the UV/visible spectrophotometer, optical microscopy and scanning electron microscope, we found that the cluster of PCBM at the interface or surface was affected by Al cathode, the composition of the blends and thermal annealing. The disc-like shape crystals of PCBM substituted for the needle-like ones at higher PCBM compositions at the ATL/Al interface, which led to stronger contacts and bigger contact area. It could make short circuit current density increase, but may affect the blend morphology and result in parallel resistance and open circuit voltage decreased with the PCBM ratio increasing from 40 to 60%. The microstructure of the P3HT:PCBM ATL, determined by the composition dependent phase separation, supported the optimized performance of the OSCs with the composition of 40-50% PCBM.

  1. based dynamic voltage restorer

    African Journals Online (AJOL)

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  2. Charge carrier transport in Cu(In,Ga)Se2 thin-film solar-cells studied by electron beam induced current and temperature and illumination dependent current voltage analysis

    International Nuclear Information System (INIS)

    Nichterwitz, Melanie

    2012-01-01

    This work contributes to the understanding of generation dependent charge-carrier transport properties in Cu(In,Ga)Se 2 (CIGSe)/ CdS/ ZnO solar cells and a consistent model for the electronic band diagram of the heterojunction region of the device is developed. Cross section electron-beam induced current (EBIC) and temperature and illumination dependent current voltage (IV) measurements are performed on CIGSe solar cells with varying absorber layer compositions and CdS thickness. For a better understanding of possibilities and limitations of EBIC measurements applied on CIGSe solar cells, detailed numerical simulations of cross section EBIC profiles for varying electron beam and solar cell parameters are performed and compared to profiles obtained from an analytical description. Especially the effects of high injection conditions are considered. Even though the collection function of the solar cell is not independent of the generation function of the electron beam, the local electron diffusion length in CIGSe can still be extracted. Grain specific values ranging from (480±70) nm to (2.3±0.2) μm are determined for a CuInSe 2 absorber layer and a value of (2.8±0.3) μm for CIGSe with a Ga-content of 0.3. There are several models discussed in literature to explain generation dependent charge carrier transport, all assuming a high acceptor density either located in the CIGSe layer close to the CIGSe/CdS interface (p + layer), within the CdS layer or at the CdS/ZnO interface. In all models, a change in charge carrier collection properties is caused by a generation dependent occupation probability of the acceptor type defect state and the resulting potential distribution throughout the device. Numerical simulations of EBIC and IV data are performed with parameters according to these models. The model that explains the experimental data best is that of a p + layer at the CIGSe/CdS interface and acceptor type defect states at the CdS/ZnO interface. The p + layer leads

  3. High voltage engineering fundamentals

    CERN Document Server

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  4. The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of α2δ subunits is key to trafficking voltage-gated Ca2+ channels

    Science.gov (United States)

    Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.

    2005-01-01

    All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813

  5. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle.

    Science.gov (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S

    2011-08-01

    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Low-voltage gyrotrons

    International Nuclear Information System (INIS)

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  7. Low voltage electron beam accelerators

    International Nuclear Information System (INIS)

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  8. Low voltage electron beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  9. Current-voltage analysis of the record-efficiency CuGaSe2 solar cell: Application of the current separation method and the interface recombination model

    International Nuclear Information System (INIS)

    Saad, M.; Kasis, A.

    2011-01-01

    Current-voltage (j-V) characteristics of the record-efficiency CuGaSe 2 solar cell measured under several illumination levels are analyzed using a two-diode equation for a more accurate description of cell behavior. The contribution of each diode to the total cell j-V characteristic under illumination was estimated using the current separation method presented recently. This is performed in an effort to identify the distinctive features of this record-efficiency cell which have led to the up-to-date highest open circuit voltage of V o c = 946 mV and fill factor of FF = 66.5% for CuGaSe 2 solar cells. Furthermore, the interface recombination component of the cell current under illumination is quantitatively discussed applying the interface recombination model presented earlier. (author)

  10. Multi-objective optimization of distributed generation with voltage ...

    African Journals Online (AJOL)

    DR OKE

    1*Department of Electrical Engineering, Kamla Nehru Institute of Technology Sultanpurr, ... of DG in distribution systems for different voltage dependent load models and .... The evaluation of the objective function depends only on location, size ...

  11. Device for monitoring cell voltage

    Science.gov (United States)

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  12. Photorechargeable High Voltage Redox Battery Enabled by Ta3 N5 and GaN/Si Dual-Photoelectrode.

    Science.gov (United States)

    Cheng, Qingmei; Fan, Weiqiang; He, Yumin; Ma, Peiyan; Vanka, Srinivas; Fan, Shizhao; Mi, Zetian; Wang, Dunwei

    2017-07-01

    Solar rechargeable battery combines the advantages of photoelectrochemical devices and batteries and has emerged as an attractive alternative to artificial photosynthesis for large-scale solar energy harvesting and storage. Due to the low photovoltages by the photoelectrodes, however, most previous demonstrations of unassisted photocharge have been realized on systems with low open circuit potentials (5 mA cm -2 ). The photoelectrode system makes it possible to operate a 1.2 V alkaline anthraquinone/ferrocyanide redox battery with a high ideal solar-to-chemical conversion efficiency of 3.0% without externally applied potentials. Importantly, the photocharged battery is successfully discharged with a high voltage output. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. High frequency breakdown voltage

    International Nuclear Information System (INIS)

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  14. Comparative Study of Fault Diagnostic Methods in Voltage Source Inverter Fed Three Phase Induction Motor Drive

    Science.gov (United States)

    Dhumale, R. B.; Lokhande, S. D.

    2017-05-01

    Three phase Pulse Width Modulation inverter plays vital role in industrial applications. The performance of inverter demeans as several types of faults take place in it. The widely used switching devices in power electronics are Insulated Gate Bipolar Transistors (IGBTs) and Metal Oxide Field Effect Transistors (MOSFET). The IGBTs faults are broadly classified as base or collector open circuit fault, misfiring fault and short circuit fault. To develop consistency and performance of inverter, knowledge of fault mode is extremely important. This paper presents the comparative study of IGBTs fault diagnosis. Experimental set up is implemented for data acquisition under various faulty and healthy conditions. Recent methods are executed using MATLAB-Simulink and compared using key parameters like average accuracy, fault detection time, implementation efforts, threshold dependency, and detection parameter, resistivity against noise and load dependency.

  15. Intermediate state trapping of a voltage sensor

    DEFF Research Database (Denmark)

    Lacroix, Jérôme J; Pless, Stephan Alexander; Maragliano, Luca

    2012-01-01

    Voltage sensor domains (VSDs) regulate ion channels and enzymes by undergoing conformational changes depending on membrane electrical signals. The molecular mechanisms underlying the VSD transitions are not fully understood. Here, we show that some mutations of I241 in the S1 segment of the Shaker...... Kv channel positively shift the voltage dependence of the VSD movement and alter the functional coupling between VSD and pore domains. Among the I241 mutants, I241W immobilized the VSD movement during activation and deactivation, approximately halfway between the resting and active states......, and drastically shifted the voltage activation of the ionic conductance. This phenotype, which is consistent with a stabilization of an intermediate VSD conformation by the I241W mutation, was diminished by the charge-conserving R2K mutation but not by the charge-neutralizing R2Q mutation. Interestingly, most...

  16. Wind Power Plant Voltage Stability Evaluation: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Muljadi, E.; Zhang, Y. C.

    2014-09-01

    Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

  17. Digital voltage discriminator

    International Nuclear Information System (INIS)

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  18. High-voltage picoamperemeter

    Energy Technology Data Exchange (ETDEWEB)

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  19. Geomagnetism and Induced Voltage

    Science.gov (United States)

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  20. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  1. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. This is followed by treatment of the technical and economic problems arising in three phase-extra high voltage transmission. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating, and reactive power and stability problems.

  2. Technical and economic considerations of extra high voltage power transmission

    Energy Technology Data Exchange (ETDEWEB)

    Kahnt, R

    1966-09-01

    The reasons for the employment of higher transmission voltages are listed and the points decisive for the selection of three phase ac or dc systems are reviewed. The technical and economic problems arising in three phase extra high voltage transmission are discussed. These include selection of voltage, economical design of power lines, insulation problems, power supply dependability, equipment rating and reactive power and stability problems.

  3. CONTRIBUTIONS OF INTRACELLULAR IONS TO Kv CHANNEL VOLTAGE SENSOR DYNAMICS.

    Directory of Open Access Journals (Sweden)

    Samuel eGoodchild

    2012-06-01

    Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

  4. Fault diagnosis and fault-tolerant finite control set-model predictive control of a multiphase voltage-source inverter supplying BLDC motor.

    Science.gov (United States)

    Salehifar, Mehdi; Moreno-Equilaz, Manuel

    2016-01-01

    Due to its fault tolerance, a multiphase brushless direct current (BLDC) motor can meet high reliability demand for application in electric vehicles. The voltage-source inverter (VSI) supplying the motor is subjected to open circuit faults. Therefore, it is necessary to design a fault-tolerant (FT) control algorithm with an embedded fault diagnosis (FD) block. In this paper, finite control set-model predictive control (FCS-MPC) is developed to implement the fault-tolerant control algorithm of a five-phase BLDC motor. The developed control method is fast, simple, and flexible. A FD method based on available information from the control block is proposed; this method is simple, robust to common transients in motor and able to localize multiple open circuit faults. The proposed FD and FT control algorithm are embedded in a five-phase BLDC motor drive. In order to validate the theory presented, simulation and experimental results are conducted on a five-phase two-level VSI supplying a five-phase BLDC motor. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  5. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  6. The harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter.

    OpenAIRE

    ПАНЧЕНКО, В В

    2015-01-01

    The author investigates a rectifier unit constructed on the basis of cascade connection of the main non-controlled m-pulse rectifier and PWM voltage booster converter. The research presents the analysis of the harmonic composition of the output voltage of a rectifier unit with a PWM voltage booster converter on completely controlled keys. The dependence of the relative harmonic amplitude on the commutation corner is defined. The estimation of a rectifier unit electromagnetic compatibility wit...

  7. Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

    Science.gov (United States)

    Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-07-15

    A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

    Science.gov (United States)

    Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-01-01

    A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

  9. Cathodic voltage-controlled electrical stimulation of titanium for prevention of methicillin-resistant Staphylococcus aureus and Acinetobacter baumannii biofilm infections.

    Science.gov (United States)

    Canty, Mary; Luke-Marshall, Nicole; Campagnari, Anthony; Ehrensberger, Mark

    2017-01-15

    Antibiotic resistance of bacterial biofilms limits available treatment methods for implant-associated orthopaedic infections. This study evaluated the effects of applying cathodic voltage-controlled electrical stimulations (CVCES) of -1.5V and -1.8V (vs. Ag/AgCl) to coupons of commercially pure titanium (cpTi) incubated in cultures of methicillin-resistant Staphylococcus aureus (MRSA) and Acinetobacter baumannii (A. baumannii) as a method of preventing bacterial attachment. Stimulations were applied for 2, 4, and 8h and coupon-associated and planktonic colony-forming units (CFU) were enumerated following stimulation. Compared to open circuit potential (OCP) controls, CVCES for 4h at -1.8V significantly reduced coupon-associated MRSA CFU by 99.9% (1.30×10 4 vs. 4.45×10 7 , p=0.047) and A. baumannii coupon-associated CFU by 99.9% (1.64×10 4 vs. 5.93×10 7 , p=0.001) and reduced planktonic CFU below detectable levels for both strains. CVCES at -1.8V for 8h also reduced coupon-associated and planktonic CFU below detectable levels for each strain. CVCES at -1.5V for 4 and 8h, and -1.8V for 2h did not result in clinically relevant reductions. For 4 and 8h stimulations, the current density was significantly higher for -1.8V than -1.5V, an effect directly related to the rate of water and oxygen reduction on the cpTi surface. This significantly increased the pH, a suspected influence in decreased CFU viability. The voltage-dependent electrochemical properties of cpTi likely contribute to the observed antimicrobial effects of CVCES. This study revealed that CVCES of titanium could prevent coupon-associated and planktonic CFU of Gram-positive MRSA and Gram-negative A. baumannii from reaching detectable levels in a magnitude-dependent and time-dependent manner. Periprosthetic joint infection is a devastating outcome of total joint arthroplasty and has led to increased patient morbidity and rising healthcare costs. Current treatments are limited by the growing prevalence of

  10. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain

    Directory of Open Access Journals (Sweden)

    Yukiko eMishina

    2014-09-01

    Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  11. Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.

    Science.gov (United States)

    Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas

    2014-01-01

    Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.

  12. Voltage Quench Dynamics of a Kondo System.

    Science.gov (United States)

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  13. Influence of Voltage on Main Characteristics of Electric Lighting Lamps

    Directory of Open Access Journals (Sweden)

    V. B. Kozlovskaya

    2009-01-01

    Full Text Available An analysis and systemization of data on influence of voltage value on main lighting engineering, electric and economic characteristics of incandescent lamps, gaseous-discharge lamps of low and high pressure have been made in the paper.Analytical and graphical dependences have been obtained that ensure to evaluate quantitative changes of corresponding lamp characteristics at voltage deviation from nominal value.

  14. Mechanism of voltage-gated channel formation in lipid membranes.

    Science.gov (United States)

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  16. High Voltage Charge Pump

    KAUST Repository

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  17. High Voltage Seismic Generator

    Science.gov (United States)

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  18. Increased voltage photovoltaic cell

    Science.gov (United States)

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  19. Crystalline orientation dependent photoresponse and heterogeneous behaviors of grain boundaries in perovskite solar cells

    Science.gov (United States)

    Jiang, Chuanpeng; Zhang, Pengpeng

    2018-02-01

    Using photoconductive atomic force microscopy and Kelvin probe force microscopy, we characterize the local electrical properties of grains and grain boundaries of organic-inorganic hybrid perovskite (CH3NH3PbI3) thin films on top of a poly(3,4-ethylenedioxythiophene)-polystyrene sulfonate (PEDOT:PSS)/ITO substrate. Three discrete photoconductivity levels are identified among perovskite grains, likely corresponding to the crystal orientation of each grain. Local J-V curves recorded on these grains further suggest an anti-correlation behavior between the short circuit current (JSC) and open circuit voltage (VOC). This phenomenon can be attributed to diffusion-limited surface recombination at the non-selective perovskite-tip contact, where a higher carrier mobility established in the perovskite grain results in an enhanced surface recombination and thus a lower VOC. In addition, the photoresponse of perovskite films displays a pronounced heterogeneity across the grain boundaries, with the boundaries formed between grains of the same photoconductivity level displaying even enhanced photocurrent and open circuit voltage compared to those of the adjacent grain interiors. These observations highlight the significance of controlling the microstructure of perovskite thin films, which will be a necessary route for further improving the efficiency of perovskite solar cells.

  20. Suppressing voltage transients in high voltage power supplies

    International Nuclear Information System (INIS)

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  1. PLZT light transmittance memory driven with an asymmetric voltage pulse

    International Nuclear Information System (INIS)

    Inoue, Kazuhiko; Morita, Takeshi

    2010-01-01

    PLZT is a ferroelectric electro-optic material, which has been operated with a constant voltage supply to keep a certain optical property. In this study, we propose an optical transmittance memory effect by controlling the domain conditions. The keypoint is to use an asymmetric voltage pulse. In the positive direction, a sufficiently-large voltage is applied to align the polarization directions. After this operation, a relatively small light transmittance is memorized even after removing the electric field. On the other hand, in the negative direction, the amplitude of the voltage is adjusted to the coercive electric field. In this condition, the domain structure is almost the same as the depolarization state. With this voltage supply, the maximum light transmittance can be kept after removing the electric field. Using these voltage operations, the PLZT can obtain two light transmittance states depending on the domain structure. This memory effect should be useful for innovative optical scanners or shutters in the future.

  2. Benchmarking of Voltage Sag Generators

    DEFF Research Database (Denmark)

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  3. Charge-pump voltage converter

    Science.gov (United States)

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  4. Voltage breakdown on niobium and copper surfaces

    International Nuclear Information System (INIS)

    Werner, G.R.; Padamsee, H.; Betzwieser, J.C.; Liu, Y.G.; Rubin, K.H.R.; Shipman, J.E.; Ying, L.T.

    2003-01-01

    Experiments have shown that voltage breakdown in superconducting niobium RF cavities is in many ways similar to voltage breakdown on niobium cathodes in DC voltage gaps; most striking are the distinctive starburst patterns and craters that mark the site of voltage breakdown in both superconducting cavities and DC vacuum gaps. Therefore, we can learn much about RF breakdown from simpler, faster DC experiments. We have direct evidence, in the form of before'' and ''after'' pictures, that breakdown events caused by high surface electric fields occur with high probability at contaminant particles on surfaces. Although the pre-breakdown behavior (field emission) seems to depend mostly on the contaminant particles present and little on the substrate, the breakdown event itself is greatly affected by the substrate-niobium, heavily oxidized niobium, electropolished copper, and diamond-machined copper cathodes lead to different kinds of breakdown events. By studying DC voltage breakdown we hope to learn more details about the processes involved in the transition from field emission to catastrophic arcing and the cratering of the surface; as well as learning how to prevent breakdown, we would like to learn how to cause breakdown, which could be important when ''processing'' cavities to reduce field emission. (author)

  5. Transient voltage sharing in series-coupled high voltage switches

    Directory of Open Access Journals (Sweden)

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  6. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    DEFF Research Database (Denmark)

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  7. Sensing voltage across lipid membranes

    Science.gov (United States)

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  8. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    Directory of Open Access Journals (Sweden)

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  9. Molecular mechanism of voltage sensing in voltage-gated proton channels

    Science.gov (United States)

    Rebolledo, Santiago; Perez, Marta E.

    2013-01-01

    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  10. Radiation effects on residual voltage of polyethylene films

    International Nuclear Information System (INIS)

    Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.

    1986-01-01

    It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)

  11. Voltage current characteristics of type III superconductors

    International Nuclear Information System (INIS)

    Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

    1980-01-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

  12. Voltage current characteristics of type III superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

  13. High voltage isolation transformer

    Science.gov (United States)

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  14. Current and Voltage Conveyors in Current- and Voltage-Mode Precision Full-Wave Rectifiers

    Directory of Open Access Journals (Sweden)

    J. Koton

    2011-04-01

    Full Text Available In this paper new versatile precision full-wave rectifiers using current and/or voltage conveyors as active elements and two diodes are presented. The performance of these circuit solutions is analysed and compared to the opamp based precision rectifier. To analyze the behavior of the functional blocks, the frequency dependent RMS error and DC transient value are evaluated for different values of input voltage amplitudes. Furthermore, experimental results are given that show the feasibilities of the conveyor based rectifiers superior to the corresponding operational amplifier based topology.

  15. Temporary over voltages in the high voltage networks

    International Nuclear Information System (INIS)

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  16. Strongly emissive perovskite nanocrystal inks for high-voltage solar cells

    Science.gov (United States)

    Akkerman, Quinten A.; Gandini, Marina; di Stasio, Francesco; Rastogi, Prachi; Palazon, Francisco; Bertoni, Giovanni; Ball, James M.; Prato, Mirko; Petrozza, Annamaria; Manna, Liberato

    2016-12-01

    Lead halide perovskite semiconductors have recently gained wide interest following their successful embodiment in solid-state photovoltaic devices with impressive power-conversion efficiencies, while offering a relatively simple and low-cost processability. Although the primary optoelectronic properties of these materials have already met the requirement for high-efficiency optoelectronic technologies, industrial scale-up requires more robust processing methods, as well as solvents that are less toxic than the ones that have been commonly used so successfully on the lab-scale. Here we report a fast, room-temperature synthesis of inks based on CsPbBr3 perovskite nanocrystals using short, low-boiling-point ligands and environmentally friendly solvents. Requiring no lengthy post-synthesis treatments, the inks are directly used to fabricate films of high optoelectronic quality, exhibiting photoluminescence quantum yields higher than 30% and an amplified spontaneous emission threshold as low as 1.5 μJ cm-2. Finally, we demonstrate the fabrication of perovskite nanocrystal-based solar cells, with open-circuit voltages as high as 1.5 V.

  17. Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

    2016-03-07

    We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

  18. Tandem Solar Cells Using GaAs Nanowires on Si: Design, Fabrication, and Observation of Voltage Addition.

    Science.gov (United States)

    Yao, Maoqing; Cong, Sen; Arab, Shermin; Huang, Ningfeng; Povinelli, Michelle L; Cronin, Stephen B; Dapkus, P Daniel; Zhou, Chongwu

    2015-11-11

    Multijunction solar cells provide us a viable approach to achieve efficiencies higher than the Shockley-Queisser limit. Due to their unique optical, electrical, and crystallographic features, semiconductor nanowires are good candidates to achieve monolithic integration of solar cell materials that are not lattice-matched. Here, we report the first realization of nanowire-on-Si tandem cells with the observation of voltage addition of the GaAs nanowire top cell and the Si bottom cell with an open circuit voltage of 0.956 V and an efficiency of 11.4%. Our simulation showed that the current-matching condition plays an important role in the overall efficiency. Furthermore, we characterized GaAs nanowire arrays grown on lattice-mismatched Si substrates and estimated the carrier density using photoluminescence. A low-resistance connecting junction was obtained using n(+)-GaAs/p(+)-Si heterojunction. Finally, we demonstrated tandem solar cells based on top GaAs nanowire array solar cells grown on bottom planar Si solar cells. The reported nanowire-on-Si tandem cell opens up great opportunities for high-efficiency, low-cost multijunction solar cells.

  19. Computer controlled high voltage system

    Energy Technology Data Exchange (ETDEWEB)

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  20. A Voltage Quality Detection Method

    DEFF Research Database (Denmark)

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  1. Stabilization of Voltage Parameters of Induction Generator Excited by a Voltage Inverter

    Directory of Open Access Journals (Sweden)

    Padalko D.A.

    2017-12-01

    Full Text Available The article reveals the operational aspects of induction generator. Methods for stabilization of induction generator (IG parameters under inverter excitation are investigated. The study was carried out using mathematical description and simulation modeling in MATLAB Simulink. The paper provides analysis of causes of generated voltage amplitude and frequency displacement when the loading condition and the rate vary. Due to the parametric resonance nature of IG self-excitation, the author introduces the expression that allows estimating the capacitor capacitance required to maintain the generation process, depending on the rotor speed of electric machine, load nature and rate. Based on the studies, it was proved that it is possible to stabilize the IG voltage parameters by maintaining the magnetizing circuit inductance Lm at the constant level., and realizing a control law close to U/f = const. The study proves that using the inverter together with the voltage regulator allows ensuring the quality of electricity corresponding to modern standards. The necessity of problem solving of the required quality of the voltage by the harmonic component for the exciter - inverter with PWM is shown. The prospects of the power generation system based on induction machine (IM with a semiconductor frequency converter, which serves as an adjustable supplier of capacitive current for IM for autonomous objects, are substantiated. The use of semiconductor frequency converters makes it possible to provide high stability of the output voltage parameters and good speed of the mechatronic generation system with an asynchronous machine.

  2. Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

    Science.gov (United States)

    Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

    2018-05-07

    Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

  3. Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

    Science.gov (United States)

    Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

    2017-08-29

    Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

  4. Equilibrium fluctuation relations for voltage coupling in membrane proteins.

    Science.gov (United States)

    Kim, Ilsoo; Warshel, Arieh

    2015-11-01

    A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

  5. Transient voltage oscillations in coils

    International Nuclear Information System (INIS)

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  6. Grafting voltage and pharmacological sensitivity in potassium channels.

    Science.gov (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

    2016-08-01

    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  7. Thermal voltage noise in layered superconductors

    International Nuclear Information System (INIS)

    Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

    1995-01-01

    Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

  8. Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

    Science.gov (United States)

    Teverovsky, Alexander

    2016-01-01

    Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.

  9. New method for determining avalanche breakdown voltage of silicon photomultipliers

    International Nuclear Information System (INIS)

    Chirikov-Zorin, I.

    2017-01-01

    The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

  10. Voltage quantization by ballistic vortices in two-dimensional superconductors

    International Nuclear Information System (INIS)

    Orlando, T.P.; Delin, K.A.

    1991-01-01

    The voltage generated by moving ballistic vortices with a mass m ν in a two-dimensional superconducting ring is quantized, and this quantization depends on the amount of charge enclosed by the ring. The quantization of the voltage is the dual to flux quantization in a superconductor, and is a manifestation of the Aharonov-Casher effect. The quantization is obtained by applying the Bohr-Sommerfeld criterion to the canonical momentum of the ballistic vortices. The results of this quantization condition can also be used to understand the persistent voltage predicted by van Wees for an array of Josephson junctions

  11. Voltage fluctuations in granular superconductors in the perpendicular configuration

    International Nuclear Information System (INIS)

    Gerashchenko, O V

    2003-01-01

    The spectral density of voltage fluctuations in granular YBa 2 Cu 3 O 7-δ superconductors in the perpendicular configuration has been studied in the flux flow mode. It has been found that, in this case, the 1/f-voltage noise observed depends weakly on temperature and is associated with motion of a magnetic flux in the superconductor. A comparison of the data obtained with the results of previous measurements in parallel configuration has shown that voltage noise is produced by a single common source, which is presumably associated with self-organization of the critical state in granular superconductors

  12. A utility piezoelectric energy harvester with low frequency and high-output voltage: Theoretical model, experimental verification and energy storage

    Directory of Open Access Journals (Sweden)

    Guangyi Zhang

    2016-09-01

    Full Text Available In this paper, a utility piezoelectric energy harvester with low frequency and high-output voltage is presented. Firstly, the harvester’s three theoretical models are presented, namely the static model, the quasi static model and the dynamic vibration model. By analyzing the influence of the mass ratio of the mass block to the beam on output characteristics of the harvester, we compare the quasi static model and the dynamic vibration model and then define their applicable ranges. Secondly, simulation and experiments are done to verify the models, using the harvester with PZT-5H piezoelectric material, which are proved to be consistent with each other. The experimental results show that the output open-circuit voltage and the output power can reach up to 86.36V and 27.5mW respectively. The experiments are conducted when this harvester system is excited by the first modal frequency (58.90Hz with the acceleration 10m/s2. In this low frequency vibration case, it is easy to capture the energy in the daily environment. In addition, LTC 3588-1 chip (Linear Technology Corporation is used as the medium energy circuit to transfer charges from the PZT-5H electrode to the 0.22F 5V super capacitor and ML621 rechargeable button battery. For this super-capacitor, it takes about 100min for the capacitor voltage to rise from 0V to 3.6V. For this button battery, it takes about 200min to increase the battery voltage from 2.5V to 3.48V.

  13. Imaging Voltage in Genetically Defined Neuronal Subpopulations with a Cre Recombinase-Targeted Hybrid Voltage Sensor.

    Science.gov (United States)

    Bayguinov, Peter O; Ma, Yihe; Gao, Yu; Zhao, Xinyu; Jackson, Meyer B

    2017-09-20

    Genetically encoded voltage indicators create an opportunity to monitor electrical activity in defined sets of neurons as they participate in the complex patterns of coordinated electrical activity that underlie nervous system function. Taking full advantage of genetically encoded voltage indicators requires a generalized strategy for targeting the probe to genetically defined populations of cells. To this end, we have generated a mouse line with an optimized hybrid voltage sensor (hVOS) probe within a locus designed for efficient Cre recombinase-dependent expression. Crossing this mouse with Cre drivers generated double transgenics expressing hVOS probe in GABAergic, parvalbumin, and calretinin interneurons, as well as hilar mossy cells, new adult-born neurons, and recently active neurons. In each case, imaging in brain slices from male or female animals revealed electrically evoked optical signals from multiple individual neurons in single trials. These imaging experiments revealed action potentials, dynamic aspects of dendritic integration, and trial-to-trial fluctuations in response latency. The rapid time response of hVOS imaging revealed action potentials with high temporal fidelity, and enabled accurate measurements of spike half-widths characteristic of each cell type. Simultaneous recording of rapid voltage changes in multiple neurons with a common genetic signature offers a powerful approach to the study of neural circuit function and the investigation of how neural networks encode, process, and store information. SIGNIFICANCE STATEMENT Genetically encoded voltage indicators hold great promise in the study of neural circuitry, but realizing their full potential depends on targeting the sensor to distinct cell types. Here we present a new mouse line that expresses a hybrid optical voltage sensor under the control of Cre recombinase. Crossing this line with Cre drivers generated double-transgenic mice, which express this sensor in targeted cell types. In

  14. LOFT voltage insertion calibaration program

    International Nuclear Information System (INIS)

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  15. Power-MOSFET Voltage Regulator

    Science.gov (United States)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  16. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    Science.gov (United States)

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  17. Moderately nonlinear diffuse-charge dynamics under an ac voltage

    Science.gov (United States)

    Stout, Robert F.; Khair, Aditya S.

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  18. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C

    2003-09-01

    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  19. Modular High Voltage Power Supply

    Energy Technology Data Exchange (ETDEWEB)

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  20. Reliability criteria for voltage stability

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.