WorldWideScience

Sample records for dependent developmental shifts

  1. Linking Social Change and Developmental Change: Shifting Pathways of Human Development

    Science.gov (United States)

    Greenfield, Patricia M.

    2009-01-01

    P. M. Greenfield's new theory of social change and human development aims to show how changing sociodemographic ecologies alter cultural values and learning environments and thereby shift developmental pathways. Worldwide sociodemographic trends include movement from rural residence, informal education at home, subsistence economy, and…

  2. Blue and red shifted temperature dependence of implicit phonon shifts in graphene

    Science.gov (United States)

    Mann, Sarita; Jindal, V. K.

    2017-07-01

    We have calculated the implicit shift for various modes of frequency in a pure graphene sheet. Thermal expansion and Grüneisen parameter which are required for implicit shift calculation have already been studied and reported. For this calculation, phonon frequencies are obtained using force constants derived from dynamical matrix calculated using VASP code where the density functional perturbation theory (DFPT) is used in interface with phonopy software. The implicit phonon shift shows an unusual behavior as compared to the bulk materials. The frequency shift is large negative (red shift) for ZA and ZO modes and the value of negative shift increases with increase in temperature. On the other hand, blue shift arises for all other longitudinal and transverse modes with a similar trend of increase with increase in temperature. The q dependence of phonon shifts has also been studied. Such simultaneous red and blue shifts in transverse or out plane modes and surface modes, respectively leads to speculation of surface softening in out of plane direction in preference to surface melting.

  3. Developmental Delay’ Reconsidered: The Critical Role of Age-Dependent, Co-variant Development

    Directory of Open Access Journals (Sweden)

    Yonata Levy

    2018-04-01

    Full Text Available In memory of Annette Karmiloff-Smith.This paper reviews recent neurobiological research reporting structural co-variance and temporal dependencies in age-dependent gene expression, parameters of cortical maturation, long range connectivity and interaction of the biological network with the environment. This research suggests that age by size trajectories of brain structures relate to functional properties more than absolute sizes. In line with these findings, recent behavioral studies of typically developing children whose language development was delayed reported long term consequences of such delays. As for neurodevelopmental disorders, disrupted developmental timing and slow acquisitional pace are hallmarks of these populations. It is argued that these behavioral and neuro-biological results highlight the need to commit to a developmental model which will reflect the fact that temporal dependencies overseeing structural co-variance among developmental components are major regulatory factors of typical development of the brain/mind network. Consequently, the concept of ‘developmental delay’ in developmental theorizing needs to be reconsidered.

  4. Comparison of shifting attention function in 7-13-years-old children with fluent speech and developmental stuttering

    Directory of Open Access Journals (Sweden)

    Kowsar Esfandeh

    2014-04-01

    Full Text Available Background and Aim: Attention has causal role in speech and language processing. Studies are limited about relation between attention and language development. As a result, the purpose of this study was to investigate the difference shifting attention function in children with developmental stuttering and fluent speech.Methods: Thirty children who stutter (21 boys and 9 girls and thirty children who did not stutter (21 boys and 9 girls were evaluated. Shifting attention function was investigated using Wisconsin card sorting test. The data were analyzed via Kolmogorov-Smirnov, independent t, and Mann-Whitney U-tests.Results: Between group analysis showed significant differences for all of the indexes in Wisconsin card sorting test . The number of categories completed in children who stutter was significantly less than that control group (p<0.05. But preservative errors, total errors, total tries, time of test performance and try for first pattern in children who stutter was more than in the control group and data differences were significant for all of the indexes (p<0.05.Conclusion: The findings of this study show that children with and without stuttering are different in shifting attention function and children who stutter have weaker function in shifting attention. The findings were linked to emerging theoretical frameworks of stuttering development and that were taken to suggest a possible role for attention processes in developmental stuttering.

  5. Task Switching and Shifting between Stopping and Going: Developmental Change in between-Trial Control Adjustments

    Science.gov (United States)

    Huizing, Mariette; van der Molen, Maurits W.

    2011-01-01

    This study set out to investigate developmental differences in the ability to switch between choice tasks and to shift between Go/NoGo and choice tasks. Three age groups (7-year-olds, 11-year-olds, and young adults) were asked to consider the shape or color of a bivalued target stimulus. The participants performed a switch task in which a cue…

  6. Discrimination, developmental science, and the law: addressing dramatic shifts in civil rights jurisprudence.

    Science.gov (United States)

    Levesque, Roger J R

    2014-01-01

    The civil rights movement fostered dramatic shifts in legal responses to discrimination based on race, gender, and a host of other group characteristics. The legal system now evinces yet another dramatic shift, as it moves from considering difference to focusing on neutrality, from efforts that seek to counter subjugation to those that adopt a "color-blind" approach. The shifting approach already has reached laws regulating responses to the group that spurred massive civil rights reform: minority youth. The shift requires a different body of empirical evidence to address it and a new look at equality jurisprudence. This article notes the need to turn to the current understanding of prejudice and discrimination for guidance, and uses, as illustration, developmental science to shed light on the development, manifestation, and alleviation of invidious discrimination. Using that understanding, the analysis details how the legal system can benefit from that research and better address discrimination in light of dramatic changes in law. The article articulates the need to address discrimination by recognizing and enlisting the law's inculcative powers through multiple sites of inculcation, ranging from families, schools, health and justice systems to religious and community groups. The discussion concludes with brief suggestions for reform benefiting from understandings of prejudice and its expression. (c) 2014 APA, all rights reserved.

  7. Developmental psychopathology: a paradigm shift or just a relabeling?

    Science.gov (United States)

    Rutter, Michael

    2013-11-01

    Developmental psychopathology is described as a conceptual approach that involves a set of research methods that capitalize on developmental and psychopathological variations to ask questions about mechanisms and processes. Achievements are described in relation to attachment and attachment disorders, autism, schizophrenia, childhood antecedents of adult psychopathology, testing for environmental mediation of risk effects, gene-environment interplay, intellectual and language functioning, effects of mentally ill parents on the children, stress and vulnerability to depression, ethnicity and schizophrenia, and drug response. Continuities and discontinuities over the course of development are discussed in relation to attention-deficit/hyperactivity disorder, antisocial behavior, eating disorders, substance abuse and dependency, pharmacological and behavioral addictions, and a range of other disorders. Research challenges are considered in relation to spectrum concepts, the adolescent development of a female preponderance for depression, the mechanisms involved in age differences in response to drugs and to lateralized brain injury, the processing of experiences, the biological embedding of experiences, individual differences in response to environmental hazards, nature-nurture integration, and brain plasticity.

  8. Pay Attention!: Sluggish Multisensory Attentional Shifting as a Core Deficit in Developmental Dyslexia.

    Science.gov (United States)

    Krause, Margaret B

    2015-11-01

    The aim of this review is to provide a background on the neurocognitive aspects of the reading process and review neuroscientific studies of individuals with developmental dyslexia, which provide evidence for amodal processing deficits. Hari, Renvall, and Tanskanen (2001) propose amodal sluggish attentional shifting (SAS) as a causal factor for temporal processing deficits in dyslexia. Undergirding this theory is the notion that when dyslexics are faced with rapid sequences of stimuli, their automatic attentional systems fail to disengage efficiently, which leads to difficulty when moving from one item to the next (Lallier et al., ). This results in atypical perception of rapid stimulus sequences. Until recently, the SAS theory, particularly the examination of amodal attentional deficits, was studied solely through the use of behavioural measures (Facoetti et al., ; Facoetti, Lorusso, Cattaneo, Galli, & Molteni, ). This paper examines evidence within the literature that provides a basis for further exploration of amodal SAS as an underlying deficit in developmental dyslexia. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Species invasion shifts the importance of predator dependence.

    Science.gov (United States)

    Griffen, Blaine D; Delaney, David G

    2007-12-01

    The strength of interference between foraging individuals can influence per capita consumption rates, with important consequences for predator and prey populations and system stability. Here we demonstrate how the replacement of a previously established invader, the predatory crab Carcinus maenas, by the recently invading predatory crab Hemigrapsus sanguineus shifts predation from a species that experiences strong predator interference (strong predator dependence) to one that experiences weak predator interference (weak predator dependence). We demonstrate using field experiments that differences in the strength of predator dependence persist for these species both when they forage on a single focal prey species only (the mussel Mytilus edulis) and when they forage more broadly across the entire prey community. This shift in predator dependence with species replacement may be altering the biomass across trophic levels, consistent with theoretical predictions, as we show that H. sanguineus populations are much larger than C. maenas populations throughout their invaded ranges. Our study highlights that predator dependence may differ among predator species and demonstrates that different predatory impacts of two conspicuous invasive predators may be explained at least in part by different strengths of predator dependence.

  10. Compensating amplitude-dependent tune-shift without driving fourth-order resonances

    Science.gov (United States)

    Ögren, J.; Ziemann, V.

    2017-10-01

    If octupoles are used in a ring to correct the amplitude-dependent tune-shift one normally tries to avoid that the octupoles drive additional resonances. Here we consider the optimum placement of octupoles that only affects the amplitude-dependent tune-shift, but does not drive fourth-order resonances. The simplest way turns out to place three equally powered octupoles with 60 ° phase advance between adjacent magnets. Using two such octupole triplets separated by a suitable phase advance cancels all fourth-order resonance driving terms and forms a double triplet we call a six-pack. Using three six-packs at places with different ratios of the beta functions allows to independently control all amplitude-dependent tune-shift terms without exciting additional fourth-order resonances in first order of the octupole excitation.

  11. A Developmental Shift from Positive to Negative Connectivity in Human Amygdala-Prefrontal Circuitry

    Science.gov (United States)

    Gee, Dylan G.; Humphreys, Kathryn L.; Flannery, Jessica; Goff, Bonnie; Telzer, Eva H.; Shapiro, Mor; Hare, Todd A.; Bookheimer, Susan Y.; Tottenham, Nim

    2013-01-01

    Recent human imaging and animal studies highlight the importance of frontoamygdala circuitry in the regulation of emotional behavior and its disruption in anxiety-related disorders. While tracing studies have suggested changes in amygdala-cortical connectivity through the adolescent period in rodents, less is known about the reciprocal connections within this circuitry across human development, when these circuits are being fine-tuned and substantial changes in emotional control are observed. The present study examined developmental changes in amygdala-prefrontal circuitry across the ages of 4 to 22 years using task-based functional magnetic resonance imaging (fMRI). Results suggest positive amygdala-prefrontal connectivity in early childhood that switches to negative functional connectivity during the transition to adolescence. Amygdala-mPFC functional connectivity was significantly positive (greater than zero) among participants younger than ten, whereas functional connectivity was significantly negative (less than zero) among participants ten years and older, over and above the effect of amygdala reactivity. The developmental switch in functional connectivity was paralleled by a steady decline in amygdala reactivity. Moreover, the valence switch might explain age-related improvement in task performance and a developmentally normative decline in anxiety. Initial positive connectivity followed by a valence shift to negative connectivity provides a neurobiological basis for regulatory development and may present novel insight into a more general process of developing regulatory connections. PMID:23467374

  12. Developmental plasticity: re-conceiving the genotype.

    Science.gov (United States)

    Sultan, Sonia E

    2017-10-06

    In recent decades, the phenotype of an organism (i.e. its traits and behaviour) has been studied as the outcome of a developmental 'programme' coded in its genotype. This deterministic view is implicit in the Modern Synthesis approach to adaptive evolution as a sorting process among genetic variants. Studies of developmental pathways have revealed that genotypes are in fact differently expressed depending on environmental conditions. Accordingly, the genotype can be understood as a repertoire of potential developmental outcomes or norm of reaction. Reconceiving the genotype as an environmental response repertoire rather than a fixed developmental programme leads to three critical evolutionary insights. First, plastic responses to specific conditions often comprise functionally appropriate trait adjustments, resulting in an individual-level, developmental mode of adaptive variation. Second, because genotypes are differently expressed depending on the environment, the genetic diversity available to natural selection is itself environmentally contingent. Finally, environmental influences on development can extend across multiple generations via cytoplasmic and epigenetic factors transmitted to progeny individuals, altering their responses to their own, immediate environmental conditions and, in some cases, leading to inherited but non-genetic adaptations. Together, these insights suggest a more nuanced understanding of the genotype and its evolutionary role, as well as a shift in research focus to investigating the complex developmental interactions among genotypes, environments and previous environments.

  13. On the counting rate-dependent amplitude shifts in proportional counters

    International Nuclear Information System (INIS)

    Mahesh, K.

    1976-01-01

    The presence of a positive ion cloud near the anode wire, which has been believed to be the cause of the observed counting rate-dependent peak shifts in proportional counters, does not explain various exhibited features of these shifts. The possibility of other mechanisms involved is, therefore, examined. The columnar recombination of primary ions in the counter is considered to explain the origin of the shifts and their observed features. (Auth.)

  14. Pressure-dependent {sup 13}C chemical shifts in proteins: origins and applications

    Energy Technology Data Exchange (ETDEWEB)

    Wilton, David J. [University of Sheffield, Department of Molecular Biology and Biotechnology (United Kingdom); Kitahara, Ryo [Ritsumeikan University, College of Pharmaceutical Sciences (Japan); Akasaka, Kazuyuki [Kinki University, Department of Biotechnological Science, School of Biology-Oriented Science and Technology (Japan); Williamson, Mike P. [University of Sheffield, Department of Molecular Biology and Biotechnology (United Kingdom)], E-mail: m.williamson@sheffield.ac.uk

    2009-05-15

    Pressure-dependent {sup 13}C chemical shifts have been measured for aliphatic carbons in barnase and Protein G. Up to 200 MPa (2 kbar), most shift changes are linear, demonstrating pressure-independent compressibilities. CH{sub 3}, CH{sub 2} and CH carbon shifts change on average by +0.23, -0.09 and -0.18 ppm, respectively, due to a combination of bond shortening and changes in bond angles, the latter matching one explanation for the {gamma}-gauche effect. In addition, there is a residue-specific component, arising from both local compression and conformational change. To assess the relative magnitudes of these effects, residue-specific shift changes for protein G were converted into structural restraints and used to calculate the change in structure with pressure, using a genetic algorithm to convert shift changes into dihedral angle restraints. The results demonstrate that residual {sup 13}C{alpha} shifts are dominated by dihedral angle changes and can be used to calculate structural change, whereas {sup 13}C{beta} shifts retain significant dependence on local compression, making them less useful as structural restraints.

  15. Temperature dependence of 1H NMR chemical shifts and its influence on estimated metabolite concentrations.

    Science.gov (United States)

    Wermter, Felizitas C; Mitschke, Nico; Bock, Christian; Dreher, Wolfgang

    2017-12-01

    Temperature dependent chemical shifts of important brain metabolites measured by localised 1 H MRS were investigated to test how the use of incorrect prior knowledge on chemical shifts impairs the quantification of metabolite concentrations. Phantom measurements on solutions containing 11 metabolites were performed on a 7 T scanner between 1 and 43 °C. The temperature dependence of the chemical shift differences was fitted by a linear model. Spectra were simulated for different temperatures and analysed by the AQSES program (jMRUI 5.2) using model functions with chemical shift values for 37 °C. Large differences in the temperature dependence of the chemical shift differences were determined with a maximum slope of about ±7.5 × 10 -4  ppm/K. For 32-40 °C, only minor quantification errors resulted from using incorrect chemical shifts, with the exception of Cr and PCr. For 1-10 °C considerable quantification errors occurred if the temperature dependence of the chemical shifts was neglected. If 1 H MRS measurements are not performed at 37 °C, for which the published chemical shift values have been determined, the temperature dependence of chemical shifts should be considered to avoid systematic quantification errors, particularly for measurements on animal models at lower temperatures.

  16. Body position-dependent shift in odor percept present only for perithreshold odors.

    Science.gov (United States)

    Lundström, Johan N; Boyle, Julie A; Jones-Gotman, Marilyn

    2008-01-01

    We recently demonstrated that a supine position causes a decrease in olfactory sensitivity compared with an upright position. We pursued that initial finding in 3 separate experiments in which we explored the extent of, and mechanism underlying, this phenomenon. In Experiment 1, we replicated the decrease in olfactory sensitivity when in a supine compared with an upright position. In Experiment 2, we measured body position-dependent shifts in physiological variables and sniff measures while smelling suprathreshold odorants and performing a perithreshold odor intensity discrimination task. Olfactory performances were reduced while supine. However, no relationships between the shift in olfactory performances and either the physiological variables or sniff measures were found. In Experiment 3, we determined that there were no position-dependent shifts in ability to discriminate or identify suprathreshold odors or rate them for pleasantness, intensity, or familiarity. However, a drop in scores was observed, and performance was slowed, on a cognitive skill while supine. These results demonstrate a body position-dependent shift in olfactory sensitivity only for perithreshold odors that appears to be mediated by cognitive rather than physiological factors. Implications for olfactory imaging studies are discussed.

  17. The South African developmental landscape: restricted potentials or expansive, complex adaptive opportunities?

    Directory of Open Access Journals (Sweden)

    C J Burman

    2013-07-01

    Full Text Available This article argues that the South African developmental landscape is currently locked into an overly technical, path dependent paradigm that is unlikely to be capable of embracing the complex challenges identified by the recent National Development Plan. The article explores the internal logic of the existing path dependent, technical condition from the perspective of complexity, in the context of the Department of Science and Technology’s Fifth Grand Challenge and “continuous change”. It is argued that drawing ideas from complexity into future developmental trajectories can add value to the National Development Plan: Vision 2030, but to do so will require dynamic mind-set shifts across multiple developmental scales and interfaces if new approaches to managing development that embraces complexity, rather than denies it, is to emerge. Keywords: development; complexity; path dependency; epistemological vigilance; sense-making; National Development Plan Disciplines: Complexity Studies; Transdisciplinary studies; Management studies; Public management; Political studies; Economics; Development Studies

  18. Observation of Broadband Time-Dependent Rabi Shifting in Microplasmas

    International Nuclear Information System (INIS)

    Compton, Ryan; Filin, Alex; Romanov, Dmitri A.; Levis, Robert J.

    2009-01-01

    Coherent broadband radiation in the form of Rabi sidebands is observed when a ps probe laser propagates through a weakly ionized, electronically excited microplasma generated in the focus of an intense pump beam. The sidebands arise from the interaction of the probe beam with pairs of excited states of a constituent neutral atom via the probe-induced Rabi oscillation. Sideband shifting of >90 meV from the probe carrier frequency results in an effective bandwidth of 200 meV. The sidebands are controlled by the intensity and temporal profile of the probe pulse; with amplitude and shift in agreement with the predictions of a time-dependent generalized Rabi cycling model.

  19. Developmentally dependent and different roles of fatty acids OMEGA-6 and OMEGA-3

    DEFF Research Database (Denmark)

    Mourek, J; Mourek, J

    2011-01-01

    The developmentally-dependent differences in the biological significances and effects of PUFA-OMEGA-6 (namely of arachidonic acid) and PUFA-OMEGA-3 (namely of docosahexaenoic acid) are discussed. The clinical results as well as developmental experiences are indicating a hypothesis of the evolution...... that created mutual relationship between those two substances (with immunological basis and following recuperation). The anti-inflammatory actions of PUFA-OMEGA-3 are the most visible (and significant) contrasts as compared with the large affects of namely arachidonic acid and its metabolites....

  20. Sensitivity of hiPSC-derived neural stem cells (NSC) to Pyrroloquinoline quinone depends on their developmental stage.

    Science.gov (United States)

    Augustyniak, J; Lenart, J; Zychowicz, M; Lipka, G; Gaj, P; Kolanowska, M; Stepien, P P; Buzanska, L

    2017-12-01

    Pyrroloquinoline quinone (PQQ) is a factor influencing on the mitochondrial biogenesis. In this study the PQQ effect on viability, total cell number, antioxidant capacity, mitochondrial biogenesis and differentiation potential was investigated in human induced Pluripotent Stem Cells (iPSC) - derived: neural stem cells (NSC), early neural progenitors (eNP) and neural progenitors (NP). Here we demonstrated that sensitivity to PQQ is dependent upon its dose and neural stage of development. Induction of the mitochondrial biogenesis by PQQ at three stages of neural differentiation was evaluated at mtDNA, mRNA and protein level. Changes in NRF1, TFAM and PPARGC1A gene expression were observed at all developmental stages, but only at eNP were correlated with the statistically significant increase in the mtDNA copy numbers and enhancement of SDHA, COX-1 protein level. Thus, the "developmental window" of eNP for PQQ-evoked mitochondrial biogenesis is proposed. This effect was independent of high antioxidant capacity of PQQ, which was confirmed in all tested cell populations, regardless of the stage of hiPSC neural differentiation. Furthermore, a strong induction of GFAP, with down regulation of MAP2 gene expression upon PQQ treatment was observed. This indicates a possibility of shifting the balance of cell differentiation in the favor of astroglia, but more research is needed at this point. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Spin-dependent Goos–Hänchen shift and spin beam splitter in gate-controllable ferromagnetic graphene

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Y. [School of Physics and Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Liu, Y., E-mail: stslyl@mail.sysu.edu.cn [School of Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Wang, B., E-mail: wangbiao@mail.sysu.edu.cn [School of Physics and Engineering, Sun Yat-sen University, Guangzhou 510275 (China)

    2014-03-15

    The transmission and Goos–Hänchen (GH) shift for charge carriers in gate-controllable ferromagnetic graphene induced by ferromagnetic insulator are investigated theoretically. Numerical results demonstrate that spin-up and spin-down electrons exhibit remarkably different transmission and GH shifts. The spin-dependent GH shifts directly demonstrate the spin beam splitting effect, which can be controlled by the voltage of gate. We attribute the spin beam splitting effect to the combination of tunneling through potential barrier and Zeeman interaction from the magnetic field and the exchange proximity interaction between the ferromagnetic insulator and graphene. In view of the spin beam splitting effect and the spin-dependent GH shifts, the gate-controllable ferromagnetic graphene might be utilized to design spin beam splitter.

  2. Spin-dependent Goos–Hänchen shift and spin beam splitter in gate-controllable ferromagnetic graphene

    International Nuclear Information System (INIS)

    Wang, Y.; Liu, Y.; Wang, B.

    2014-01-01

    The transmission and Goos–Hänchen (GH) shift for charge carriers in gate-controllable ferromagnetic graphene induced by ferromagnetic insulator are investigated theoretically. Numerical results demonstrate that spin-up and spin-down electrons exhibit remarkably different transmission and GH shifts. The spin-dependent GH shifts directly demonstrate the spin beam splitting effect, which can be controlled by the voltage of gate. We attribute the spin beam splitting effect to the combination of tunneling through potential barrier and Zeeman interaction from the magnetic field and the exchange proximity interaction between the ferromagnetic insulator and graphene. In view of the spin beam splitting effect and the spin-dependent GH shifts, the gate-controllable ferromagnetic graphene might be utilized to design spin beam splitter

  3. Silver Nanoparticles Incite Size and Dose-Dependent Developmental Phenotypes and Nanotoxicity in Zebrafish Embryos

    Science.gov (United States)

    Browning, Lauren M.; Lee, Kerry J.; Nallathamby, Prakash D.; Xu, Xiao-Hong Nancy

    2013-01-01

    Nanomaterials possess distinctive physicochemical properties and promise a wide range of applications, from advanced technology to leading-edge medicine. However, their effects on living organisms remain largely unknown. Here we report that the purified silver nanoparticles (Ag NPs, 97 ± 13 nm) incite specific developmental stage embryonic phenotypes and nanotoxicity in a dose-dependent manner, upon acute exposure of given-stage embryos to the NPs (0–24 pM) for only 2 h. The critical concentrations of the NPs that cause 50% of embryos develop normally for cleavage, early-gastrula, early-segmentation, late-segmentation, and hatching stage zebrafish embryos are 3.5, 4, 6, 6, and 8 pM, respectively, showing that the earlier developmental stage embryos are much more sensitive to the effects of the NPs than the later stage. Interestingly, distinctive phenotypes (head abnormality and no eyes) are observed only in cleavage and early-gastrula stage embryos treated with the NPs, showing the stage-specific effects of the NPs. By comparing with our study of the smaller Ag NPs (13.1 ± 2.5 nm), we found that the embryonic phenotypes strikingly depend upon the sizes of Ag NPs and embryonic developmental stages. These notable findings suggest that the Ag NPs are unlike any conventional chemicals or ions. They can potentially enable target specific study and therapy for early embryonic development in size, stage, dose, and exposure-duration dependent manners. PMID:24024906

  4. Silver nanoparticles incite size- and dose-dependent developmental phenotypes and nanotoxicity in zebrafish embryos.

    Science.gov (United States)

    Browning, Lauren M; Lee, Kerry J; Nallathamby, Prakash D; Xu, Xiao-Hong Nancy

    2013-10-21

    Nanomaterials possess distinctive physicochemical properties and promise a wide range of applications, from advanced technology to leading-edge medicine. However, their effects on living organisms remain largely unknown. Here we report that the purified silver nanoparticles (Ag NPs) (97 ± 13 nm) incite specific developmental stage embryonic phenotypes and nanotoxicity in a dose-dependent manner, upon acute exposure of given stage embryos to the NPs (0-24 pM) for only 2 h. The critical concentrations of the NPs that cause 50% of embryos to develop normally for cleavage, early gastrula, early segmentation, late segmentation, and hatching stage zebrafish embryos are 3.5, 4, 6, 6, and 8 pM, respectively, showing that the earlier developmental stage embryos are much more sensitive to the effects of the NPs than the later stage embryos. Interestingly, distinctive phenotypes (head abnormality and no eyes) are observed only in cleavage and early gastrula stage embryos treated with the NPs, showing the stage-specific effects of the NPs. By comparing these Ag NPs with smaller Ag NPs (13.1 ± 2.5 nm), we found that the embryonic phenotypes strikingly depend upon the sizes of Ag NPs and embryonic developmental stages. These notable findings suggest that the Ag NPs are unlike any conventional chemicals or ions. They can potentially enable target-specific study and therapy for early embryonic development in size-, stage-, dose-, and exposure duration-dependent manners.

  5. Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna.

    Science.gov (United States)

    Ku, Hui-Yu; Sun, Y Henry

    2017-07-01

    Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields.

  6. Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

    Science.gov (United States)

    Stiles, Kari A; Van Volkenburgh, Elizabeth

    2002-07-01

    Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

  7. The effect of developmental nutrition on life span and fecundity depends on the adult reproductive environment in Drosophila melanogaster

    NARCIS (Netherlands)

    May, C.M.; Doroszuk, A.; Zwaan, B.J.

    2015-01-01

    Both developmental nutrition and adult nutrition affect life-history traits; however, little is known about whether the effect of developmental nutrition depends on the adult environment experienced. We used the fruit fly to determine whether life-history traits, particularly life span and

  8. Smoking addiction: the shift from head to hands: Approach bias towards smoking-related cues in low-dependent versus dependent smokers.

    Science.gov (United States)

    Detandt, Sandrine; Bazan, Ariane; Quertemont, Etienne; Verbanck, Paul

    2017-07-01

    The dual process theory is central to several models of addiction, implying both an increase of stimulus salience and deficits in inhibitory control. Our major aim is to provide behavioral evidence for an approach bias tendency in smokers and more specifically during smoking cue exposure. The second aim is to examine whether this bias differs in low-dependent versus dependent smokers. Thirty-two smokers (17 low dependent and 15 dependent; cut-off FTND of 4) and 28 non-smokers performed a modified Go/NoGo task using tobacco-related words and neutral words as stimuli. Smokers generally made more mistakes and tended to be faster for smoking-related cues specifically. Low dependents acknowledged more their dependency in declarative questionnaires while making more errors and being slower specifically on smoking cues; dependent smokers were less prone to indicate their addiction, but were faster and accurate when it came to picking the smoking cues. These results suggest that a shift has operated from a mental preoccupation with smoking in the low-dependent group, to smoking as a motor habit in our dependent group. This finding invites experts to rethink smoking addiction in the light of this crucial moment, namely, the shift "from head to hands".

  9. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  10. Origin of the Size-Dependent Stokes Shift in CsPbBr3 Perovskite Nanocrystals.

    Science.gov (United States)

    Brennan, Michael C; Herr, John E; Nguyen-Beck, Triet S; Zinna, Jessica; Draguta, Sergiu; Rouvimov, Sergei; Parkhill, John; Kuno, Masaru

    2017-09-06

    The origin of the size-dependent Stokes shift in CsPbBr 3 nanocrystals (NCs) is explained for the first time. Stokes shifts range from 82 to 20 meV for NCs with effective edge lengths varying from ∼4 to 13 nm. We show that the Stokes shift is intrinsic to the NC electronic structure and does not arise from extrinsic effects such as residual ensemble size distributions, impurities, or solvent-related effects. The origin of the Stokes shift is elucidated via first-principles calculations. Corresponding theoretical modeling of the CsPbBr 3 NC density of states and band structure reveals the existence of an intrinsic confined hole state 260 to 70 meV above the valence band edge state for NCs with edge lengths from ∼2 to 5 nm. A size-dependent Stokes shift is therefore predicted and is in quantitative agreement with the experimental data. Comparison between bulk and NC calculations shows that the confined hole state is exclusive to NCs. At a broader level, the distinction between absorbing and emitting states in CsPbBr 3 is likely a general feature of other halide perovskite NCs and can be tuned via NC size to enhance applications involving these materials.

  11. Magnetic configuration dependence of the shafranov shift in the Large Helical Device

    Energy Technology Data Exchange (ETDEWEB)

    Kobuchi, T; Ida, K; Yamada, H; Yokoyama, M; Watanabe, K Y; Sakakibara, S; Yoshinuma, M [National Institute for Fusion Science, 322-6 Oroshi-Cho, Toki-City, 509-5292 (Japan)

    2006-06-15

    The dependence of the Shafranov shift on magnetic field configuration, toroidicity and central rotational transform {iota}(0) in neutral beam heated plasma has been experimentally investigated in the Large Helical Device. The toroidicity of the plasma is controlled by the quadrupole field, while the central {iota}(0) is controlled by changing the distance of the current centre of the helical coil to the plasma. It is experimentally confirmed that both the lower toroidicity and the higher {iota}(0) contribute to the reduction of the Shafranov shift as predicted by the three-dimensional equilibrium code, VMEC.

  12. Sex-Dependent Effects of Developmental Lead Exposure on the Brain

    Science.gov (United States)

    Singh, Garima; Singh, Vikrant; Sobolewski, Marissa; Cory-Slechta, Deborah A.; Schneider, Jay S.

    2018-01-01

    The role of sex as an effect modifier of developmental lead (Pb) exposure has until recently received little attention. Lead exposure in early life can affect brain development with persisting influences on cognitive and behavioral functioning, as well as, elevated risks for developing a variety of diseases and disorders in later life. Although both sexes are affected by Pb exposure, the incidence, manifestation, and severity of outcomes appears to differ in males and females. Results from epidemiologic and animal studies indicate significant effect modification by sex, however, the results are not consistent across studies. Unfortunately, only a limited number of human epidemiological studies have included both sexes in independent outcome analyses limiting our ability to draw definitive conclusions regarding sex-differentiated outcomes. Additionally, due to various methodological differences across studies, there is still not a good mechanistic understanding of the molecular effects of lead on the brain and the factors that influence differential responses to Pb based on sex. In this review, focused on prenatal and postnatal Pb exposures in humans and animal models, we discuss current literature supporting sex differences in outcomes in response to Pb exposure and explore some of the ideas regarding potential molecular mechanisms that may contribute to sex-related differences in outcomes from developmental Pb exposure. The sex-dependent variability in outcomes from developmental Pb exposure may arise from a combination of complex factors, including, but not limited to, intrinsic sex-specific molecular/genetic mechanisms and external risk factors including sex-specific responses to environmental stressors which may act through shared epigenetic pathways to influence the genome and behavioral output. PMID:29662502

  13. Sex-Dependent Effects of Developmental Lead Exposure on the Brain

    Directory of Open Access Journals (Sweden)

    Garima Singh

    2018-03-01

    Full Text Available The role of sex as an effect modifier of developmental lead (Pb exposure has until recently received little attention. Lead exposure in early life can affect brain development with persisting influences on cognitive and behavioral functioning, as well as, elevated risks for developing a variety of diseases and disorders in later life. Although both sexes are affected by Pb exposure, the incidence, manifestation, and severity of outcomes appears to differ in males and females. Results from epidemiologic and animal studies indicate significant effect modification by sex, however, the results are not consistent across studies. Unfortunately, only a limited number of human epidemiological studies have included both sexes in independent outcome analyses limiting our ability to draw definitive conclusions regarding sex-differentiated outcomes. Additionally, due to various methodological differences across studies, there is still not a good mechanistic understanding of the molecular effects of lead on the brain and the factors that influence differential responses to Pb based on sex. In this review, focused on prenatal and postnatal Pb exposures in humans and animal models, we discuss current literature supporting sex differences in outcomes in response to Pb exposure and explore some of the ideas regarding potential molecular mechanisms that may contribute to sex-related differences in outcomes from developmental Pb exposure. The sex-dependent variability in outcomes from developmental Pb exposure may arise from a combination of complex factors, including, but not limited to, intrinsic sex-specific molecular/genetic mechanisms and external risk factors including sex-specific responses to environmental stressors which may act through shared epigenetic pathways to influence the genome and behavioral output.

  14. Nicotine dependence and transitional shifts in exercise behavior among young U.S. adult smokers.

    Science.gov (United States)

    Loprinzi, Paul D; Walker, Jerome F; Cardinal, Bradley J

    2014-08-01

    The aim of this study is to examine the association between nicotine dependence and longitudinal exercise transitional shift patterns among young U.S. adult daily smokers. Data from the 2003-2005 National Youth Smoking Cessation Survey was used, which is a longitudinal study over a two year period. Participants included 1168 US adult daily smokers (18-24years). Nicotine dependence was assessed using the modified Fagerstrom Test for Nicotine Dependence. Four transitional shift patterns were created based on meeting current exercise guidelines; stable inactive (inactive across time), activity relapsers (starts out active and then becomes inactive), activity adopters (inactive and then becomes active), and stable active (active across time). After adjustments, for every 1-unit increase in baseline nicotine dependence, participants had 16% (OR=1.16, p=0.01) greater odds of being in the stable inactive group compared to the stable active group. Nicotine dependence appears to play an important role in shaping longitudinal exercise patterns among young U.S. adult smokers. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Critical thermal limits affected differently by developmental and adult thermal fluctuations

    DEFF Research Database (Denmark)

    Salachan, Paul Vinu; Sørensen, Jesper Givskov

    2017-01-01

    the developmental and adult life stages. For developmental acclimation, we found mildly detrimental effects of high amplitude fluctuations for critical thermal minima, while the critical thermal maxima showed a beneficial response to higher amplitude fluctuations. For adult acclimation involving shifts between...... fluctuating and constant regimes, cold tolerance was shown to be dictated by developmental temperature conditions irrespective of the adult treatments, while the acquired heat tolerance was readily lost when flies developed at fluctuating temperature were shifted to a constant regime as adults. Interestingly......, we also found that effect of fluctuations at any life stage was gradually lost with prolonged adult maintenance suggesting a more prominent effect of fluctuations during developmental compared to adult acclimation in Drosophila melanogaster....

  16. Wavefield dependency on virtual shifts in the source location

    KAUST Repository

    Alkhalifah, Tariq

    2011-02-14

    The wavefield dependence on a virtual shift in the source location can provide information helpful in velocity estimation and interpolation. However, the second-order partial differential equation (PDE) that relates changes in the wavefield form (or shape) to lateral perturbations in the source location depends explicitly on lateral derivatives of the velocity field. For velocity models that include lateral velocity discontinuities this is problematic as such derivatives in their classical definition do not exist. As a result, I derive perturbation partial differential wave equations that are independent of direct velocity derivatives and thus, provide possibilities for wavefield shape extrapolation in complex media. These PDEs have the same structure as the wave equation with a source function that depends on the background (original source) wavefield. The solutions of the perturbation equations provide the coefficients of a Taylor\\'s series type expansion for the wavefield. The new formulas introduce changes to the background wavefield only in the presence of lateral velocity variation or in general terms velocity variations in the perturbation direction. The accuracy of the representation, as demonstrated on the Marmousi model, is generally good. © 2011 European Association of Geoscientists & Engineers.

  17. Orientation-dependent surface core-level shifts and chemical shifts on clean and H 2S-covered GaAs

    Science.gov (United States)

    Ranke, W.; Finster, J.; Kuhr, H. J.

    1987-08-01

    Photoelectron spectra of the As 3d and Ga 3d core levels were studied in situ on a cylindrically shaped GaAs single crystal for the six inequivalent orientations (001), (113), (111), (110), (11¯1) and (11¯3). On the clean surface, prepared by molecular beam epitaxy (MBE), surface core levels are shifted by 0.25 to 0.55 eV towards smaller binding energy (BE) for As 3d and -0.25 to -0.35 eV towards higher BE for Ga, depending on orientation. Additional As causes As 3d contributions shifted between -0.45 and -0.7 eV towards higher BE. The position and intensity of them is influenced by H 2S adsorption. At 150 K, H 2S adsorbs preferentially on As sites. As chemical shifts appear at -0.6 to -0.9 eV towards higher BE. Simultaneously, As accumulation occurs on all orientations with the exception of (110). High temperature adsorption (550 K, 720 K) influences mainly the Ga 3d peaks. Two peaks shifted by about -0.45 and -0.8 eV towards higher Be were found which are attributed to Ga atoms with one or two sulfur ligands, respectively. At 720 K, also As depletion is observed. The compatibility of surface core-level positions and intensities with recent structural models for the (111) and (11¯1) surfaces is discussed.

  18. Frequency dependence of p-mode frequency shifts induced by magnetic activity in Kepler solar-like stars

    Science.gov (United States)

    Salabert, D.; Régulo, C.; Pérez Hernández, F.; García, R. A.

    2018-04-01

    The variations of the frequencies of the low-degree acoustic oscillations in the Sun induced by magnetic activity show a dependence on radial order. The frequency shifts are observed to increase towards higher-order modes to reach a maximum of about 0.8 μHz over the 11-yr solar cycle. A comparable frequency dependence is also measured in two other main sequence solar-like stars, the F-star HD 49933, and the young 1 Gyr-old solar analog KIC 10644253, although with different amplitudes of the shifts of about 2 μHz and 0.5 μHz, respectively. Our objective here is to extend this analysis to stars with different masses, metallicities, and evolutionary stages. From an initial set of 87 Kepler solar-like oscillating stars with known individual p-mode frequencies, we identify five stars showing frequency shifts that can be considered reliable using selection criteria based on Monte Carlo simulations and on the photospheric magnetic activity proxy Sph. The frequency dependence of the frequency shifts of four of these stars could be measured for the l = 0 and l = 1 modes individually. Given the quality of the data, the results could indicate that a physical source of perturbation different from that in the Sun is dominating in this sample of solar-like stars.

  19. Concentration and size dependence of peak wavelength shift on quantum dots in colloidal suspension

    Science.gov (United States)

    Rinehart, Benjamin S.; Cao, Caroline G. L.

    2016-08-01

    Quantum dots (QDs) are semiconductor nanocrystals that have significant advantages over organic fluorophores, including their extremely narrow Gaussian emission bands and broad absorption bands. Thus, QDs have a wide range of potential applications, such as in quantum computing, photovoltaic cells, biological sensing, and electronics. For these applications, aliasing provides a detrimental effect on signal identification efficiency. This can be avoided through characterization of the QD fluorescence signals. Characterization of the emissivity of CdTe QDs as a function of concentration (1 to 10 mg/ml aqueous) was conducted on 12 commercially available CdTe QDs (emission peaks 550 to 730 nm). The samples were excited by a 50-mW 405-nm laser with emission collected via a free-space CCD spectrometer. All QDs showed a redshift effect as concentration increased. On average, the CdTe QDs exhibited a maximum shift of +35.6 nm at 10 mg/ml and a minimum shift of +27.24 nm at 1 mg/ml, indicating a concentration dependence for shift magnitude. The concentration-dependent redshift function can be used to predict emission response as QD concentration is changed in a complex system.

  20. Borderline personality disorder and the emerging field of developmental neuroscience.

    Science.gov (United States)

    Crowell, Sheila E; Kaufman, Erin A

    2016-10-01

    Over the past 2 decades there has been a dramatic shift in understanding of personality disorders, such as borderline personality disorder (BPD). What was historically viewed as an entrenched pattern of antagonistic, interpersonally dependent, and uncorrectable conduct is now seen as the outcome of complex-yet modifiable-developmental processes. The borderline label, which once inspired such harsh opprobrium in clinical communities that early diagnosis was considered taboo, is now increasingly applied to adolescents who are receiving effective treatment and desisting from a borderline trajectory. Research examining the developmental origins and early manifestations of BPD is increasing rapidly, making it an appropriate time to take stock of current developmental research and articulate an agenda for the future. We identify 4 challenges that continue to impede innovative research on borderline personality development: (a) inadequate attention to continuity and discontinuity across development, (b) medical and diagnostic systems that localize personality pathology within the individual, (c) the lingering belief that biological research is antithetical to contextual/interpersonal understandings of psychopathology (and vice versa), and (d) reluctance to reach across disciplinary and developmental boundaries to identify creative paradigms and foster innovative discovery. In order to overcome these challenges, we propose an approach to future research on adolescent borderline pathology that integrates developmental psychopathology, social and affective neuroscience, and personality theory perspectives. This intersection-the developmental neuroscience of personality pathology-offers theoretical and methodological advantages over disciplinary isolation and is fertile ground for generating novel hypotheses on the development and prevention of BPD. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  1. K-Cl Cotransporter 2-mediated Cl- Extrusion Determines Developmental Stage-dependent Impact of Propofol Anesthesia on Dendritic Spines.

    Science.gov (United States)

    Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia-Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo

    2017-05-01

    General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABAA)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABAA)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. The KCC2-dependent developmental increase in the efficacy of GABAA-mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

  2. Illuminating light-dependent color shifts in core and veneer layers of dental all-ceramics

    Science.gov (United States)

    Lee, Yong-Keun; Cha, Hyun-Suk; Yu, Bin

    2014-09-01

    The color of an object is perceived differently depending on the ambient light conditions. Since dental all-ceramic restorations are fabricated by building up several layers to reproduce the tooth shade, the optical properties of each layer should be optimized for successful shade reproduction. This study aimed to determine the separate contributions of the color shifts in each of the core and veneer layers of all-ceramics by switching the illuminating lights on the color shifts of layered ceramics. Specimens of seven kinds of core ceramics and the corresponding veneer ceramics for each core were fabricated with a layered thickness of 1.5 mm. A sintering ceramic was used as a reference core material. The Commission Internationale de l'Eclairage (CIE) color coordinates of core, veneer, and layered specimens were measured with a spectroradiometer under the CIE illuminant D65 (daylight), A (incandescent lamp), and F9 (fluorescent lamp) simulating lights. Color shifts of the layered specimens were primarily determined by the CIE a* shifts (D65 to A switch) or by the CIE b* shifts (D65 to F9 switch) of the veneer layer. The color coordinates shifts in the constituent layers differentially influenced those of the layered specimens by the kind of switched lights. Therefore, the optical properties of the constituent layers of all-ceramics should be controlled to reflect these findings.

  3. Stress Induces a Shift Towards Striatum-Dependent Stimulus-Response Learning via the Mineralocorticoid Receptor

    NARCIS (Netherlands)

    Vogel, S.; Klumpers, F.; Navarro Schröder, T.; Oplaat, K.T.; Krugers, H.J.; Oitzl, M.S.; Joëls, M.; Doeller, C.F.; Fernández, G.

    2017-01-01

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this

  4. Stress induces a shift towards striatum-dependent stimulus-response learning via the mineralocorticoid receptor

    NARCIS (Netherlands)

    Vogel, S.; Klumpers, F.; Navarro Schröder, T.; Oplaat, K.T.; Krugers, H.J.; Oitzl, M.S.; Joëls, M.; Doeller, C.F.; Fernandez, G.

    2017-01-01

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this

  5. Stress Induces a Shift Towards Striatum-Dependent Stimulus-Response Learning via the Mineralocorticoid Receptor

    NARCIS (Netherlands)

    Vogel, Susanne; Klumpers, Floris; Schroeder, Tobias Navarro; Oplaat, Krista T.; Krugers, Harm J.; Oitzl, Melly S.; Joels, Marian; Doeller, Christian F.; Fernandez, Guillen

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this

  6. Stress Induces a Shift Towards Striatum-Dependent Stimulus-Response Learning via the Mineralocorticoid Receptor.

    Science.gov (United States)

    Vogel, Susanne; Klumpers, Floris; Schröder, Tobias Navarro; Oplaat, Krista T; Krugers, Harm J; Oitzl, Melly S; Joëls, Marian; Doeller, Christian F; Fernández, Guillén

    2017-05-01

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this shift is still unclear, previous evidence in rodents points towards cortisol interacting with the mineralocorticoid receptor (MR) to affect amygdala functioning. The amygdala is in turn assumed to orchestrate the stress-induced shift in memory processing. However, an integrative study testing these mechanisms in humans is lacking. Therefore, we combined functional neuroimaging of a spatial memory task, stress-induction, and administration of an MR-antagonist in a full-factorial, randomized, placebo-controlled between-subjects design in 101 healthy males. We demonstrate that stress-induced increases in cortisol lead to enhanced stimulus-response learning, accompanied by increased amygdala activity and connectivity to the striatum. Importantly, this shift was prevented by an acute administration of the MR-antagonist spironolactone. Our findings support a model in which the MR and the amygdala play an important role in the stress-induced shift towards habit memory systems, revealing a fundamental mechanism of adaptively allocating neural resources that may have implications for stress-related mental disorders.

  7. Age-Dependent Developmental Response to Temperature: An Examination of the Rarely Tested Phenomenon in Two Species (Gypsy Moth (Lymantria dispar and Winter Moth (Operophtera brumata

    Directory of Open Access Journals (Sweden)

    David R. Gray

    2018-04-01

    Full Text Available The pervading paradigm in insect phenology models is that the response to a given temperature does not vary within a life stage. The developmental rate functions that have been developed for general use, or for specific insects, have for the most part been temperature-dependent but not age-dependent, except where age is an ordinal variable designating the larval instar. Age dependence, where age is a continuous variable, is not often reported (or investigated, and is rarely included in phenology models. I provide a short review of the seldom-investigated phenomenon of age dependence in developmental response to temperature, and compare the derivation of the winter moth egg phenology model by Salis et al. to the derivation of another egg phenology model with age-dependent responses to temperature I discuss some probable reasons for the discrepancies (acknowledged by Salis et al. between modelled and observed developmental rates of the winter moth, and discuss the contribution that geographically robust phenology models can make to estimates of species distributions.

  8. Rationalization of Anomalous Pseudocontact Shifts and Their Solvent Dependence in a Series of C3-Symmetric Lanthanide Complexes.

    Science.gov (United States)

    Vonci, Michele; Mason, Kevin; Suturina, Elizaveta A; Frawley, Andrew T; Worswick, Steven G; Kuprov, Ilya; Parker, David; McInnes, Eric J L; Chilton, Nicholas F

    2017-10-11

    Bleaney's long-standing theory of magnetic anisotropy has been employed with some success for many decades to explain paramagnetic NMR pseudocontact shifts, and has been the subject of many subsequent approximations. Here, we present a detailed experimental and theoretical investigation accounting for the anomalous solvent dependence of NMR shifts for a series of lanthanide(III) complexes, namely [LnL 1 ] (Ln = Eu, Tb, Dy, Ho, Er, Tm, and Yb; L 1 : 1,4,7-tris[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane), taking into account the effect of subtle ligand flexibility on the electronic structure. We show that the anisotropy of the room temperature magnetic susceptibility tensor, which in turn affects the sign and magnitude of the pseudocontact chemical shift, is extremely sensitive to minimal structural changes in the first coordination sphere of L 1 . We show that DFT structural optimizations do not give accurate structural models, as assessed by the experimental chemical shifts, and thus we determine a magnetostructural correlation and employ this to evaluate the accurate solution structure for each [LnL 1 ]. This approach allows us to explain the counterintuitive pseudocontact shift behavior, as well as a striking solvent dependence. These results have important consequences for the analysis and design of novel magnetic resonance shift and optical emission probes that are sensitive to the local solution environment and polarity.

  9. K-Cl Cotransporter 2–mediated Cl− Extrusion Determines Developmental Stage–dependent Impact of Propofol Anesthesia on Dendritic Spines

    KAUST Repository

    Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo

    2017-01-01

    Background: General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABA A)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). Methods: In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABA A)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. Results: The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl - transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. Conclusions: The KCC2-dependent developmental increase in the efficacy of GABA A -mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

  10. K-Cl Cotransporter 2–mediated Cl− Extrusion Determines Developmental Stage–dependent Impact of Propofol Anesthesia on Dendritic Spines

    KAUST Repository

    Puskarjov, Martin

    2017-03-16

    Background: General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABA A)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). Methods: In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABA A)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. Results: The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl - transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. Conclusions: The KCC2-dependent developmental increase in the efficacy of GABA A -mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

  11. Multiplicity dependence of matrix-induced frequency shifts for atomic transitions of the group 12 metals in rare gas solids

    International Nuclear Information System (INIS)

    Laursen, S.L.; Cartland, H.E.

    1991-01-01

    Atomic resonances of the group 12 metal atoms, Hg, Cd, and Zn, undergo frequency shifts from the gas phase atomic line when trapped in rare gas matrices of Ar, Kr, and Xe at 12 K. As expected, the shifts are approximately linear in polarizability of the rare gas, but the slope of this line depends on whether the transition in question is 1 P 1 left-arrow 1 S 0 or 3 P 1 left-arrow 1 S 0 . Thus the matrix-induced frequency shift is dependent on the singlet or triplet nature of the excited state as well as on the matrix material. This dependence on multiplicity is discussed in terms of interactions between the excited-state atomic orbitals and the matrix. The results are compared to matrix studies of other metals and to related gas-phase work on diatomic van der Waals complexes of group 12 metals with rare gases

  12. Developmental Programming of Adult Disease: Reprogramming by Melatonin?

    OpenAIRE

    Tain, You-Lin; Huang, Li-Tung; Hsu, Chien-Ning

    2017-01-01

    Adult-onset chronic non-communicable diseases (NCDs) can originate from early life through so-called the “developmental origins of health and disease” (DOHaD) or “developmental programming”. The DOHaD concept offers the “reprogramming” strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evi...

  13. Violent Victimization and Perpetration during Adolescence: Developmental Stage Dependent Ecological Models

    Science.gov (United States)

    Matjasko, Jennifer L.; Needham, Belinda L.; Grunden, Leslie N.; Farb, Amy Feldman

    2010-01-01

    Using a variant of the ecological-transactional model and developmental theories of delinquency on a nationally representative sample of adolescents, the current study explored the ecological predictors of violent victimization, perpetration, and both for three different developmental stages during adolescence. We examined the relative influence…

  14. Hyperoxia-induced developmental plasticity of the hypoxic ventilatory response in neonatal rats: contributions of glutamate-dependent and PDGF-dependent mechanisms.

    Science.gov (United States)

    Bavis, Ryan W; DeAngelis, Kathryn J; Horowitz, Terry C; Reedich, Lisa M; March, Ryan J

    2014-01-15

    Rats reared in hyperoxia exhibit a sustained (vs. biphasic) hypoxic ventilatory response (HVR) at an earlier age than untreated, Control rats. Given the similarity between the sustained HVR obtained after chronic exposure to developmental hyperoxia and the mature HVR, it was hypothesized that hyperoxia-induced plasticity and normal maturation share common mechanisms such as enhanced glutamate and nitric oxide signaling and diminished platelet-derived growth factor (PDGF) signaling. Rats reared in 21% O2 (Control) or 60% O2 (Hyperoxia) from birth until 4-5 days of age were studied after intraperitoneal injection of drugs targeting these pathways. Hyperoxia rats receiving saline showed a sustained HVR to 12% O2, but blockade of NMDA glutamate receptors (MK-801) restored the biphasic HVR typical of newborn rats. Blockade of PDGF-β receptors (imatinib) had no effect on the pattern of the HVR in Hyperoxia rats, although it attenuated ventilatory depression during the late phase of the HVR in Control rats. Neither nitric oxide synthase inhibitor used in this study (nNOS inhibitor I and l-NAME) altered the pattern of the HVR in Control or Hyperoxia rats. Drug-induced changes in the biphasic HVR were not correlated with changes in metabolic rate. Collectively, these results suggest that developmental hyperoxia hastens the transition from a biphasic to sustained HVR by upregulating glutamate-dependent mechanisms and downregulating PDGF-dependent mechanisms, similar to the changes underlying normal postnatal maturation of the biphasic HVR. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. pH-Dependent spin state population and 19F NMR chemical shift via remote ligand protonation in an iron(ii) complex.

    Science.gov (United States)

    Gaudette, Alexandra I; Thorarinsdottir, Agnes E; Harris, T David

    2017-11-30

    An Fe II complex that features a pH-dependent spin state population, by virtue of a variable ligand protonation state, is described. This behavior leads to a highly pH-dependent 19 F NMR chemical shift with a sensitivity of 13.9(5) ppm per pH unit at 37 °C, thereby demonstrating the potential utility of the complex as a 19 F chemical shift-based pH sensor.

  16. Pressure dependence of side chain 13C chemical shifts in model peptides Ac-Gly-Gly-Xxx-Ala-NH2.

    Science.gov (United States)

    Beck Erlach, Markus; Koehler, Joerg; Crusca, Edson; Munte, Claudia E; Kainosho, Masatsune; Kremer, Werner; Kalbitzer, Hans Robert

    2017-10-01

    For evaluating the pressure responses of folded as well as intrinsically unfolded proteins detectable by NMR spectroscopy the availability of data from well-defined model systems is indispensable. In this work we report the pressure dependence of 13 C chemical shifts of the side chain atoms in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH 2 (Xxx, one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of a number of nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The size of the polynomial pressure coefficients B 1 and B 2 is dependent on the type of atom and amino acid studied. For H N , N and C α the first order pressure coefficient B 1 is also correlated to the chemical shift at atmospheric pressure. The first and second order pressure coefficients of a given type of carbon atom show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure also are weakly correlated. The downfield shifts of the methyl resonances suggest that gauche conformers of the side chains are not preferred with pressure. The valine and leucine methyl groups in the model peptides were assigned using stereospecifically 13 C enriched amino acids with the pro-R carbons downfield shifted relative to the pro-S carbons.

  17. Methane spectral line widths and shifts, and dependences on physical parameters

    Science.gov (United States)

    Fox, K.; Quillen, D. T.; Jennings, D. E.; Wagner, J.; Plymate, C.

    1991-01-01

    A detailed report of the recent high-resolution spectroscopic research on widths and shifts measured for a strong infrared-active fundamental of methane is presented. They were measured in collision with several rare gases and diatomic molecules, in the vibrational-rotational fundamental near 3000/cm. These measurements were made at an ambient temperature of 294 K over a range of pressures from 100 to 700 torr. The measurements are discussed in a preliminary but detailed and quantitative manner with reference to masses, polarizabilities, and quadrupole moments. Some functional dependences on these physical parameters are considered. The present data are useful for studies of corresponding planetary spectra.

  18. Direction-dependent waist-shift-difference of Gaussian beam in a multiple-pass zigzag slab amplifier and geometrical optics compensation method.

    Science.gov (United States)

    Li, Zhaoyang; Kurita, Takashi; Miyanaga, Noriaki

    2017-10-20

    Zigzag and non-zigzag beam waist shifts in a multiple-pass zigzag slab amplifier are investigated based on the propagation of a Gaussian beam. Different incident angles in the zigzag and non-zigzag planes would introduce a direction-dependent waist-shift-difference, which distorts the beam quality in both the near- and far-fields. The theoretical model and analytical expressions of this phenomenon are presented, and intensity distributions in the two orthogonal planes are simulated and compared. A geometrical optics compensation method by a beam with 90° rotation is proposed, which not only could correct the direction-dependent waist-shift-difference but also possibly average the traditional thermally induced wavefront-distortion-difference between the horizontal and vertical beam directions.

  19. Buckling-dependent switching behaviours in shifted bilayer germanene nanoribbons: A computational study

    Science.gov (United States)

    Arjmand, T.; Tagani, M. Bagheri; Soleimani, H. Rahimpour

    2018-01-01

    Bilayer germanene nanoribbons are investigated in different stacks like buckled and flat armchair and buckled zigzag germanene nanoribbons by performing theoretical calculations using the nonequilibrium Greens function method combined with density functional theory. In these bilayer types, the current oscillates with change of interlayer distances or intra-layer overlaps and is dependent on the type of the bilayer. Band gap of AA-stacked of shifted flat bilayer armchair germanene nanoribbon oscillates by change of interlayer distance which is in contrast to buckled bilayer armchair germanene nanoribbon. So, results show the buckling makes system tend to be a semiconductor with wide band gap. Therefore, AA-stacked of shifted flat bilayer armchair germanene nanoribbon has properties between zigzag and armchair edges, the higher current under bias voltages similar to zigzag edge and also oscillations in current like buckled armchair edges. Also, it is found that HOMO-LUMO band gap strongly affects oscillation in currents and their I-V characteristic. This kind of junction improves the switching properties at low voltages around the band gap.

  20. Developmental changes in the primacy of facial cues for emotion recognition.

    Science.gov (United States)

    Leitzke, Brian T; Pollak, Seth D

    2016-04-01

    There have been long-standing differences of opinion regarding the influence of the face relative to that of contextual information on how individuals process and judge facial expressions of emotion. However, developmental changes in how individuals use such information have remained largely unexplored and could be informative in attempting to reconcile these opposing views. The current study tested for age-related differences in how individuals prioritize viewing emotional faces versus contexts when making emotion judgments. To do so, we asked 4-, 8-, and 12-year-old children as well as college students to categorize facial expressions of emotion that were presented with scenes that were either congruent or incongruent with the facial displays. During this time, we recorded participants' gaze patterns via eye tracking. College students directed their visual attention primarily to the face, regardless of contextual information. Children, however, divided their attention between both the face and the context as sources of emotional information depending on the valence of the context. These findings reveal a developmental shift in how individuals process and integrate emotional cues. (c) 2016 APA, all rights reserved).

  1. Pressure dependence of backbone chemical shifts in the model peptides Ac-Gly-Gly-Xxx-Ala-NH2.

    Science.gov (United States)

    Erlach, Markus Beck; Koehler, Joerg; Crusca, Edson; Kremer, Werner; Munte, Claudia E; Kalbitzer, Hans Robert

    2016-06-01

    For a better understanding of nuclear magnetic resonance (NMR) detected pressure responses of folded as well as unstructured proteins the availability of data from well-defined model systems are indispensable. In this work we report the pressure dependence of chemical shifts of the backbone atoms (1)H(α), (13)C(α) and (13)C' in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH2 (Xxx one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of these nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The polynomial pressure coefficients B 1 and B 2 are dependent on the type of amino acid studied. The coefficients of a given nucleus show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure are also weakly correlated.

  2. Red-Shift Effects in Surface Enhanced Raman Spectroscopy: Spectral or Intensity Dependence of the Near-Field?

    KAUST Repository

    Colas, Florent; Cottat, Maximilien; Gillibert, Raymond; Guillot, Nicolas; Djaker, Nadia; Lidgi-Guigui, Nathalie; Toury, Timothé e; Barchiesi, Dominique; Toma, Andrea; Di Fabrizio, Enzo M.; Gucciardi, Pietro Giuseppe; de la Chapelle, Marc Lamy

    2016-01-01

    Optimum amplification in Surface Enhanced Raman Scattering (SERS) from individual nanoantennas is expected when the excitation is slightly blue-shifted with respect to the Localized Surface Plasmon Resonance (LSPR), so that the LSPR peak falls in the middle between the laser and the Stokes Raman emission. Recent experiments have shown when moving the excitation from the visible to the near-infrared that this rule of thumb is no more valid. The excitation has to be red-shifted with respect to the LSPR peak, up to 80nm, to obtain highest SERS. Such discrepancy is usually attributed to a Near-Field (NF) to Far-Field (FF) spectral shift. Here we critically discuss this hypothesis for the case of gold nanocylinders. By combining multi-wavelength excitation SERS experiments with numerical calculations, we show that the red-shift of the excitation energy does not originate from a spectral shift between the extinction (FF) and the near-field distribution (NF), which is found to be not larger than 10nm. Rather, it can be accounted for by looking at the peculiar spectral dependence of the near-field intensity on the cylinders diameter, characterized by an initial increase, up to 180nm diameter, followed by a decrease and a pronounced skewness.

  3. Red-Shift Effects in Surface Enhanced Raman Spectroscopy: Spectral or Intensity Dependence of the Near-Field?

    KAUST Repository

    Colas, Florent

    2016-06-06

    Optimum amplification in Surface Enhanced Raman Scattering (SERS) from individual nanoantennas is expected when the excitation is slightly blue-shifted with respect to the Localized Surface Plasmon Resonance (LSPR), so that the LSPR peak falls in the middle between the laser and the Stokes Raman emission. Recent experiments have shown when moving the excitation from the visible to the near-infrared that this rule of thumb is no more valid. The excitation has to be red-shifted with respect to the LSPR peak, up to 80nm, to obtain highest SERS. Such discrepancy is usually attributed to a Near-Field (NF) to Far-Field (FF) spectral shift. Here we critically discuss this hypothesis for the case of gold nanocylinders. By combining multi-wavelength excitation SERS experiments with numerical calculations, we show that the red-shift of the excitation energy does not originate from a spectral shift between the extinction (FF) and the near-field distribution (NF), which is found to be not larger than 10nm. Rather, it can be accounted for by looking at the peculiar spectral dependence of the near-field intensity on the cylinders diameter, characterized by an initial increase, up to 180nm diameter, followed by a decrease and a pronounced skewness.

  4. Shifted dynamic interactions between subcortical nuclei and inferior frontal gyri during response preparation in persistent developmental stuttering.

    Science.gov (United States)

    Metzger, F Luise; Auer, Tibor; Helms, Gunther; Paulus, Walter; Frahm, Jens; Sommer, Martin; Neef, Nicole E

    2018-01-01

    Persistent developmental stuttering is associated with basal ganglia dysfunction or dopamine dysregulation. Here, we studied whole-brain functional connectivity to test how basal ganglia structures coordinate and reorganize sensorimotor brain networks in stuttering. To this end, adults who stutter and fluent speakers (control participants) performed a response anticipation paradigm in the MRI scanner. The preparation of a manual Go/No-Go response reliably produced activity in the basal ganglia and thalamus and particularly in the substantia nigra. Strikingly, in adults who stutter, substantia nigra activity correlated positively with stuttering severity. Furthermore, functional connectivity analyses yielded altered task-related network formations in adults who stutter compared to fluent speakers. Specifically, in adults who stutter, the globus pallidus and the thalamus showed increased network synchronization with the inferior frontal gyrus. This implies dynamic shifts in the response preparation-related network organization through the basal ganglia in the context of a non-speech motor task in stuttering. Here we discuss current findings in the traditional framework of how D1 and D2 receptor activity shapes focused movement selection, thereby suggesting a disproportional involvement of the direct and the indirect pathway in stuttering.

  5. Replication and robustness in developmental research.

    Science.gov (United States)

    Duncan, Greg J; Engel, Mimi; Claessens, Amy; Dowsett, Chantelle J

    2014-11-01

    Replications and robustness checks are key elements of the scientific method and a staple in many disciplines. However, leading journals in developmental psychology rarely include explicit replications of prior research conducted by different investigators, and few require authors to establish in their articles or online appendices that their key results are robust across estimation methods, data sets, and demographic subgroups. This article makes the case for prioritizing both explicit replications and, especially, within-study robustness checks in developmental psychology. It provides evidence on variation in effect sizes in developmental studies and documents strikingly different replication and robustness-checking practices in a sample of journals in developmental psychology and a sister behavioral science-applied economics. Our goal is not to show that any one behavioral science has a monopoly on best practices, but rather to show how journals from a related discipline address vital concerns of replication and generalizability shared by all social and behavioral sciences. We provide recommendations for promoting graduate training in replication and robustness-checking methods and for editorial policies that encourage these practices. Although some of our recommendations may shift the form and substance of developmental research articles, we argue that they would generate considerable scientific benefits for the field. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  6. The Comet Cometh: Evolving Developmental Systems.

    Science.gov (United States)

    Jaeger, Johannes; Laubichler, Manfred; Callebaut, Werner

    In a recent opinion piece, Denis Duboule has claimed that the increasing shift towards systems biology is driving evolutionary and developmental biology apart, and that a true reunification of these two disciplines within the framework of evolutionary developmental biology (EvoDevo) may easily take another 100 years. He identifies methodological, epistemological, and social differences as causes for this supposed separation. Our article provides a contrasting view. We argue that Duboule's prediction is based on a one-sided understanding of systems biology as a science that is only interested in functional, not evolutionary, aspects of biological processes. Instead, we propose a research program for an evolutionary systems biology, which is based on local exploration of the configuration space in evolving developmental systems. We call this approach-which is based on reverse engineering, simulation, and mathematical analysis-the natural history of configuration space. We discuss a number of illustrative examples that demonstrate the past success of local exploration, as opposed to global mapping, in different biological contexts. We argue that this pragmatic mode of inquiry can be extended and applied to the mathematical analysis of the developmental repertoire and evolutionary potential of evolving developmental mechanisms and that evolutionary systems biology so conceived provides a pragmatic epistemological framework for the EvoDevo synthesis.

  7. A study of the angular momentum dependence of the phase shift for finite range and Coulomb potentials

    International Nuclear Information System (INIS)

    Valluri, S.R.; Romo, W.J.

    1989-01-01

    The dependence of the phase shift δ l (k) on the angular momentum l is investigated. An analytic expression for the derivative of the phase shift with respect to angular momentum is derived for a class of potentials that includes complex and real potentials. The potentials behave like the finite range potential for small r and like a Coulomb potential for large r. Specific examples like the square well, the pure point charge Coulomb and a combination of a square well and the Coulomb potential are analytically treated. Possible applications are briefly indicated. (orig.)

  8. Developmental pathways from child maltreatment to adolescent marijuana dependence: Examining moderation by FKBP5

    Science.gov (United States)

    Handley, Elizabeth D.; Rogosch, Fred A.; Cicchetti, Dante

    2015-01-01

    The current study examined the prospective association between child maltreatment and the development of substance use disorder (SUD) in adolescence with the aim of investigating pathways underlying this relation, as well as genetic moderation of these developmental mechanisms. Specifically, we tested whether youth who experienced maltreatment prior to age 8 were at risk for the development of marijuana dependence in adolescence by way of a childhood externalizing pathway and a childhood internalizing pathway. Moreover, we tested whether variation in FKBP5 CATT haplotype moderated these pathways. The participants were 326 children (n=179 maltreated; n=147 nonmaltreated) assessed across two waves of data collection (childhood: ages 7–9 and adolescence: ages 15–18). Results indicated that higher levels of child externalizing symptoms significantly mediated the effect of child maltreatment on adolescent marijuana dependence symptoms for individuals with 1–2 copies of the FKBP5 CATT haplotype only. We did not find support for an internalizing pathway from child maltreatment to adolescent marijuana dependence, nor did we find evidence of moderation of the internalizing pathway by FKBP5 haplotype variation. Findings extend previous research by demonstrating that whether a maltreated child will traverse an externalizing pathway toward SUD in adolescence is dependent on FKBP5 genetic variation. PMID:26535939

  9. Energy dependence of a local equivalent potential for RGM phase shifts for 16O + 16O

    International Nuclear Information System (INIS)

    Ait-Tahar, S.; Mackintosh, R.S.; Cooper, S.G.; Wada, T.

    1993-01-01

    We have found, using the IP inversion method, the local representation of a potential that in S(l) equivalent to the RGM nonlocal potential of Wada and Horiuchi. Phase shifts corresponding to RGM calculations at laboratory energies 30, 41, 49, 59, 150, 350 and 500 MeV were inverted and the resulting local potentials compared with the local (but l-dependent) potentials obtained previously in the WKB-RGM scheme. The present l-independent potentials exhibit a smooth radial variation and show marked differences from previous results. The energy dependence arises from that of the exchange term and from the conversion of the l-dependence into an additional energy dependence. In particular, we show that the energy dependence of the volume integrals in this energy region is different from earlier WKB-RGM predictions. (orig.)

  10. Activation-Dependent Rapid Postsynaptic Clustering of Glycine Receptors in Mature Spinal Cord Neurons

    Science.gov (United States)

    Eto, Kei; Murakoshi, Hideji; Watanabe, Miho; Hirata, Hiromi; Moorhouse, Andrew J.; Ishibashi, Hitoshi

    2017-01-01

    Abstract Inhibitory synapses are established during development but continue to be generated and modulated in strength in the mature nervous system. In the spinal cord and brainstem, presynaptically released inhibitory neurotransmitter dominantly switches from GABA to glycine during normal development in vivo. While presynaptic mechanisms of the shift of inhibitory neurotransmission are well investigated, the contribution of postsynaptic neurotransmitter receptors to this shift is not fully elucidated. Synaptic clustering of glycine receptors (GlyRs) is regulated by activation-dependent depolarization in early development. However, GlyR activation induces hyperpolarization after the first postnatal week, and little is known whether and how presynaptically released glycine regulates postsynaptic receptors in a depolarization-independent manner in mature developmental stage. Here we developed spinal cord neuronal culture of rodents using chronic strychnine application to investigate whether initial activation of GlyRs in mature stage could change postsynaptic localization of GlyRs. Immunocytochemical analyses demonstrate that chronic blockade of GlyR activation until mature developmental stage resulted in smaller clusters of postsynaptic GlyRs that could be enlarged upon receptor activation for 1 h in the mature stage. Furthermore, live cell-imaging techniques show that GlyR activation decreases its lateral diffusion at synapses, and this phenomenon is dependent on PKC, but neither Ca2+ nor CaMKII activity. These results suggest that the GlyR activation can regulate receptor diffusion and cluster size at inhibitory synapses in mature stage, providing not only new insights into the postsynaptic mechanism of shifting inhibitory neurotransmission but also the inhibitory synaptic plasticity in mature nervous system. PMID:28197549

  11. Chemical shift-dependent apparent scalar couplings: An alternative concept of chemical shift monitoring in multi-dimensional NMR experiments

    International Nuclear Information System (INIS)

    Kwiatkowski, Witek; Riek, Roland

    2003-01-01

    The paper presents an alternative technique for chemical shift monitoring in a multi-dimensional NMR experiment. The monitored chemical shift is coded in the line-shape of a cross-peak through an apparent residual scalar coupling active during an established evolution period or acquisition. The size of the apparent scalar coupling is manipulated with an off-resonance radio-frequency pulse in order to correlate the size of the coupling with the position of the additional chemical shift. The strength of this concept is that chemical shift information is added without an additional evolution period and accompanying polarization transfer periods. This concept was incorporated into the three-dimensional triple-resonance experiment HNCA, adding the information of 1 H α chemical shifts. The experiment is called HNCA coded HA, since the chemical shift of 1 H α is coded in the line-shape of the cross-peak along the 13 C α dimension

  12. Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

    Science.gov (United States)

    Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

    2016-06-30

    Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage

  13. A model-dependent approach to the non-relativistic Lamb shift

    Science.gov (United States)

    Diaz-Valdes, J. F.; Bruce, S. A.

    2018-02-01

    The precise observation of the Lamb shift, between the 2s_{1/2} and 2p_{1/2} levels in hydrogen, was a genuine motivation for the development of modern quantum electrodynamics. According to Dirac theory, the 2s_{1/2} and 2p_{1/2} levels should have equal energies. However, "radiative corrections" due to the interaction between the atomic electron and the vacuum, shift the 2s_{1/2} level higher in energy by around 4.37493× 10^{-6} eV or 2π\\hbar× 1057.85 MHz relative to the 2p_{1/2} level. The measurement of Lamb and Retherford provided the stimulus for renormalization theory which has been so successful in handling troublesome divergences. The Lamb shift is still a central theme in atomic physics. W.E. Lamb was the first to see that this tiny shift, so elusive and hard to measure, would clarify in a fundamental way our thinking about particles and fields. In this article, the Lamb shift for the 2 s energy level in hydrogen is assessed for three different electron models by using the variational principle. It is then verified that this shift arises mostly from the interaction of a bound electron with the zero-point fluctuations of the free electromagnetic field (Welton's interpretation). We briefly comment on the construct validity of the proposed electron models.

  14. Pressure dependence of backbone chemical shifts in the model peptides Ac-Gly-Gly-Xxx-Ala-NH{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Erlach, Markus Beck; Koehler, Joerg [University of Regensburg, Institute of Biophysics and Physical Biochemistry and Centre of Magnetic Resonance in Chemistry and Biomedicine (Germany); Crusca, Edson [University of São Paulo, Physics Institute of São Carlos (Brazil); Kremer, Werner [University of Regensburg, Institute of Biophysics and Physical Biochemistry and Centre of Magnetic Resonance in Chemistry and Biomedicine (Germany); Munte, Claudia E. [University of São Paulo, Physics Institute of São Carlos (Brazil); Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@biologie.uni-regensburg.de [University of Regensburg, Institute of Biophysics and Physical Biochemistry and Centre of Magnetic Resonance in Chemistry and Biomedicine (Germany)

    2016-06-15

    For a better understanding of nuclear magnetic resonance (NMR) detected pressure responses of folded as well as unstructured proteins the availability of data from well-defined model systems are indispensable. In this work we report the pressure dependence of chemical shifts of the backbone atoms {sup 1}H{sup α}, {sup 13}C{sup α} and {sup 13}C′ in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH{sub 2} (Xxx one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of these nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The polynomial pressure coefficients B{sub 1} and B{sub 2} are dependent on the type of amino acid studied. The coefficients of a given nucleus show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure are also weakly correlated.Graphical Abstract.

  15. Gender Differences in Developmental Dyscalculia Depend on Diagnostic Criteria

    Science.gov (United States)

    Devine, Amy; Soltesz, Fruzsina; Nobes, Alison; Goswami, Usha; Szucs, Denes

    2013-01-01

    Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender…

  16. Developmental plasticity in vision and behavior may help guppies overcome increased turbidity.

    Science.gov (United States)

    Ehlman, Sean M; Sandkam, Benjamin A; Breden, Felix; Sih, Andrew

    2015-12-01

    Increasing turbidity in streams and rivers near human activity is cause for environmental concern, as the ability of aquatic organisms to use visual information declines. To investigate how some organisms might be able to developmentally compensate for increasing turbidity, we reared guppies (Poecilia reticulata) in either clear or turbid water. We assessed the effects of developmental treatments on adult behavior and aspects of the visual system by testing fish from both developmental treatments in turbid and clear water. We found a strong interactive effect of rearing and assay conditions: fish reared in clear water tended to decrease activity in turbid water, whereas fish reared in turbid water tended to increase activity in turbid water. Guppies from all treatments decreased activity when exposed to a predator. To measure plasticity in the visual system, we quantified treatment differences in opsin gene expression of individuals. We detected a shift from mid-wave-sensitive opsins to long wave-sensitive opsins for guppies reared in turbid water. Since long-wavelength sensitivity is important in motion detection, this shift likely allows guppies to salvage motion-detecting abilities when visual information is obscured in turbid water. Our results demonstrate the importance of developmental plasticity in responses of organisms to rapidly changing environments.

  17. Developmental plasticity and the evolution of parental effects.

    Science.gov (United States)

    Uller, Tobias

    2008-08-01

    One of the outstanding challenges for evolutionary biologists is to understand how developmental plasticity can influence the evolutionary process. Developmental plasticity frequently involves parental effects, which might enable adaptive and context-dependent transgenerational transmission of phenotypic strategies. However, parent-offspring conflict will frequently result in parental effects that are suboptimal for parents, offspring or both. The fitness consequences of parental effects at evolutionary equilibrium will depend on how conflicts can be resolved by modifications of developmental processes, suggesting that proximate studies of development can inform ultimate questions. Furthermore, recent studies of plants and animals show how studies of parental effects in an ecological context provide important insights into the origin and evolution of adaptation under variable environmental conditions.

  18. Behavioral inhibition and anxiety: The moderating roles of inhibitory control and attention shifting

    Science.gov (United States)

    White, Lauren K.; McDermott, Jennifer Martin; Degnan, Kathryn A.; Henderson, Heather A.; Fox, Nathan A.

    2013-01-01

    Behavioral inhibition (BI), a temperament identified in early childhood, is associated with social reticence in childhood and an increased risk for anxiety problems in adolescence and adulthood. However, not all behaviorally inhibited children remain reticent or develop an anxiety disorder. One possible mechanism accounting for the variability in the developmental trajectories of BI is a child’s ability to successfully recruit cognitive processes involved in the regulation of negative reactivity. However, separate cognitive processes may differentially moderate the association between BI and later anxiety problems. The goal of the current study was to examine how two cognitive processes - attention shifting and inhibitory control - laboratory assessed at 48 months of age moderated the association between 24-month BI and anxiety symptoms in the preschool years. Results revealed that high levels of attention shifting decreased the risk for anxiety symptoms in children with high levels of BI, whereas high levels of inhibitory control increased this risk for anxiety symptoms. These findings suggest that different cognitive processes may influence relative levels of risk or adaptation depending upon a child’s temperamental reactivity. PMID:21301953

  19. Optimization of a pH-shift control strategy for producing monoclonal antibodies in Chinese hamster ovary cell cultures using a pH-dependent dynamic model.

    Science.gov (United States)

    Hogiri, Tomoharu; Tamashima, Hiroshi; Nishizawa, Akitoshi; Okamoto, Masahiro

    2018-02-01

    To optimize monoclonal antibody (mAb) production in Chinese hamster ovary cell cultures, culture pH should be temporally controlled with high resolution. In this study, we propose a new pH-dependent dynamic model represented by simultaneous differential equations including a minimum of six system component, depending on pH value. All kinetic parameters in the dynamic model were estimated using an evolutionary numerical optimization (real-coded genetic algorithm) method based on experimental time-course data obtained at different pH values ranging from 6.6 to 7.2. We determined an optimal pH-shift schedule theoretically. We validated this optimal pH-shift schedule experimentally and mAb production increased by approximately 40% with this schedule. Throughout this study, it was suggested that the culture pH-shift optimization strategy using a pH-dependent dynamic model is suitable to optimize any pH-shift schedule for CHO cell lines used in mAb production projects. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Developmental plasticity of growth and digestive efficiency in dependence of early-life food availability

    Science.gov (United States)

    Kotrschal, Alexander; Szidat, Sönke; Taborsky, Barbara

    2014-01-01

    Nutrition is a potent mediator of developmental plasticity. If food is scarce, developing organisms may invest into growth to outgrow size-dependent mortality (short-term benefit) and/or into an efficient digestion system (long-term benefit). We investigated this potential trade-off, by determining the influence of food availability on juvenile body and organ growth, and on adult digestive efficiency in the cichlid fish Simochromis pleurospilus. We reared two groups of fish at constant high or low food rations, and we switched four other groups between these two rations at an early and late juvenile period. We measured juvenile growth and organ sizes at different developmental stages and determined adult digestive efficiency. Fish kept at constant, high rations grew considerably faster than low-food fish. Nevertheless, S. pleurospilus partly buffered the negative effects of low food availability by developing heavier digestive organs, and they were therefore more efficient in digesting their food as adults. Results of fish exposed to a ration switch during either the early or late juvenile period suggest (i) that the ability to show compensatory growth after early exposure to low food availability persists during the juvenile period, (ii) that digestive efficiency is influenced by varying juvenile food availability during the late juvenile phase and (iii) that the efficiency of the adult digestive system is correlated with the growth rate during a narrow time window of juvenile period. PMID:25866430

  1. Developmental differences in the structure of executive function in middle childhood and adolescence.

    Directory of Open Access Journals (Sweden)

    Fen Xu

    Full Text Available Although it has been argued that the structure of executive function (EF may change developmentally, there is little empirical research to examine this view in middle childhood and adolescence. The main objective of this study was to examine developmental changes in the component structure of EF in a large sample (N = 457 of 7-15 year olds. Participants completed batteries of tasks that measured three components of EF: updating working memory (UWM, inhibition, and shifting. Confirmatory factor analysis (CFA was used to test five alternative models in 7-9 year olds, 10-12 year olds, and 13-15 year olds. The results of CFA showed that a single-factor EF model best explained EF performance in 7-9-year-old and 10-12-year-old groups, namely unitary EF, though this single factor explained different amounts of variance at these two ages. In contrast, a three-factor model that included UWM, inhibition, and shifting best accounted for the data from 13-15 year olds, namely diverse EF. In sum, during middle childhood, putative measures of UWM, inhibition, and shifting may rely on similar underlying cognitive processes. Importantly, our findings suggest that developmental dissociations in these three EF components do not emerge until children transition into adolescence. These findings provided empirical evidence for the development of EF structure which progressed from unity to diversity during middle childhood and adolescence.

  2. Guanfacine enhances inhibitory control and attentional shifting in early abstinent cocaine-dependent individuals.

    Science.gov (United States)

    Fox, Helen; Sofuoglu, Mehmet; Sinha, Rajita

    2015-03-01

    Attenuation of adrenergic drive and cognitive enhancement, via stimulation of alpha2 pre- and post-synaptic receptors, may selectively enhance executive performance in early abstinent cocaine-dependent individuals. As these cognitive processes underpin important treatment-related behaviors, the alpha2 agonist, guanfacine HCl, may represent an effective pharmaco-therapeutic intervention. Twenty-five early abstinent cocaine-dependent individuals were administered a battery of neurocognitive tasks on entry into treatment (baseline) and again following 3 weeks of either placebo or guanfacine treatment (up to 3 mg). Tasks included: Stop Signal, Stroop, 3-Dimentional Intra-dimensional/Extra-dimensional (IDED) task, Spatial Working Memory (SWM), Paired Associates Learning (PAL), Verbal Fluency and the Rey Auditory Verbal Learning Test (RAVLT). Compared with placebo, the guanfacine group demonstrated attenuated anxiety and negative affect as well as improved performance on selective executive tests. This included fewer directional errors on the stop signal task, fewer errors on the extra-dimensional shift component of the IDED task and better attentional switching during verbal fluency. Guanfacine did not improve strategic working memory or peripheral memory. Guanfacine improves selective cognitive processes which may underlie salient treatment-related regulatory behaviors. Alpha2 agonists may therefore represent important agents for cocaine dependence. © The Author(s) 2015.

  3. Giant Lamb shift in photonic crystals

    International Nuclear Information System (INIS)

    Wang Xuehua; Kivshar, Yuri S.; Gu Benyuan

    2004-01-01

    We obtain a general result for the Lamb shift of excited states of multilevel atoms in inhomogeneous electromagnetic structures and apply it to study atomic hydrogen in inverse-opal photonic crystals. We find that the photonic-crystal environment can lead to very large values of the Lamb shift, as compared to the case of vacuum. We also suggest that the position-dependent Lamb shift should extend from a single level to a miniband for an assembly of atoms with random distribution in space, similar to the velocity-dependent Doppler effect in atomic/molecular gases

  4. Which visual functions depend on intermediate visual regions? Insights from a case of developmental visual form agnosia.

    Science.gov (United States)

    Gilaie-Dotan, Sharon

    2016-03-01

    A key question in visual neuroscience is the causal link between specific brain areas and perceptual functions; which regions are necessary for which visual functions? While the contribution of primary visual cortex and high-level visual regions to visual perception has been extensively investigated, the contribution of intermediate visual areas (e.g. V2/V3) to visual processes remains unclear. Here I review more than 20 visual functions (early, mid, and high-level) of LG, a developmental visual agnosic and prosopagnosic young adult, whose intermediate visual regions function in a significantly abnormal fashion as revealed through extensive fMRI and ERP investigations. While expectedly, some of LG's visual functions are significantly impaired, some of his visual functions are surprisingly normal (e.g. stereopsis, color, reading, biological motion). During the period of eight-year testing described here, LG trained on a perceptual learning paradigm that was successful in improving some but not all of his visual functions. Following LG's visual performance and taking into account additional findings in the field, I propose a framework for how different visual areas contribute to different visual functions, with an emphasis on intermediate visual regions. Thus, although rewiring and plasticity in the brain can occur during development to overcome and compensate for hindering developmental factors, LG's case seems to indicate that some visual functions are much less dependent on strict hierarchical flow than others, and can develop normally in spite of abnormal mid-level visual areas, thereby probably less dependent on intermediate visual regions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. The Social Pathologies of Self-Realization: A Diagnosis of the Consequences of the Shift in Individualization

    Science.gov (United States)

    Hammershoj, Lars Geer

    2009-01-01

    The aim of this article is to inquire into today's social pathologies, i.e. the negative consequences of the developmental processes of society. In a dialogue with Axel Honneth, the article asserts that a shift has occurred in individualization, a shift that implies a fundamental change in social pathologies: Social pathologies no longer derive…

  6. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Directory of Open Access Journals (Sweden)

    Ram Prakash Gupta

    2017-11-01

    Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

  7. Sources of Cognitive Inflexibility in Set-Shifting Tasks: Insights Into Developmental Theories From Adult Data.

    Science.gov (United States)

    Dick, Anthony Steven

    2012-01-01

    Two experiments examined processes underlying cognitive inflexibility in set-shifting tasks typically used to assess the development of executive function in children. Adult participants performed a Flexible Item Selection Task (FIST) that requires shifting from categorizing by one dimension (e.g., color) to categorizing by a second orthogonal dimension (e.g., shape). The experiments showed performance of the FIST involves suppression of the representation of the ignored dimension; response times for selecting a target object in an immediately-following oddity task were slower when the oddity target was the previously-ignored stimulus of the FIST. However, proactive interference from the previously relevant stimulus dimension also impaired responding. The results are discussed with respect to two prominent theories of the source of difficulty for children and adults on dimensional shifting tasks: attentional inertia and negative priming . In contrast to prior work emphasizing one over the other process, the findings indicate that difficulty in the FIST, and by extension other set-shifting tasks, can be attributed to both the need to shift away from the previously attended representation ( attentional inertia ), and the need to shift to the previously ignored representation ( negative priming ). Results are discussed in relation to theoretical explanations for cognitive inflexibility in adults and children.

  8. Fruit flies may face a nutrient-dependent life-history trade-off between secondary sexual trait quality, survival and developmental rate.

    Science.gov (United States)

    Gray, Lindsey J; Simpson, Stephen J; Polak, Michal

    2018-01-01

    Optimal life-history strategies are those that best allocate finite environmental resources to competing traits. We used the geometric framework for nutrition to evaluate life-history strategies followed by Drosophila melanogaster by measuring the condition-dependent performance of life-history traits, including the morphology of male secondary sexual characters, sex combs. We found that depending on their rearing environment flies faced different forms of trait trade-offs and accordingly followed different life-history strategies. High-energy, high-carbohydrate, low-protein diets supported development of the largest and most symmetrical sex combs, however, consistent with handicap models of sexual selection these foods were associated with reduced fly survival and developmental rate. Expressing the highest quality sex combs may have required secondary sexual trait quality to be traded-off with developmental rate, and our results indicated that flies unable to slow development died. As larval nutritional environments are predominantly determined by female oviposition substrate choice, we tested where mated female flies laid the most eggs. Mothers chose high-energy, high-protein foods associated with rapid larval development. Mothers avoided high-carbohydrate foods associated with maximal sex comb expression, showing they may avoid producing fewer 'sexy' sons in favour of producing offspring that develop rapidly. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Hue shifts produced by temporal asymmetries in chromatic signals depend on the alignment of the first and second harmonics.

    Science.gov (United States)

    Stockman, Andrew; Henning, G Bruce; West, Peter; Rider, Andrew T; Ripamonti, Caterina

    2017-08-01

    When M- or L-cone-isolating sawtooth waveforms flicker at frequencies between 4 and 13.3 Hz, there is a mean hue shift in the direction of the shallower sawtooth slope. Here, we investigate how this shift depends on the alignment of the first and second harmonics of sawtooth-like waveforms. Below 4 Hz, observers can follow hue variations caused by both harmonics, and reliably match reddish and greenish excursions. At higher frequencies, however, the hue variations appear as chromatic flicker superimposed on a steady light, the mean hue of which varies with second-harmonic alignment. Observers can match this mean hue against a variable-duty-cycle rectangular waveform and, separately, set the alignment at which the mean hue flips between reddish and greenish. The maximum hue shifts were approximately frequency independent and occurred when the peaks or troughs of the first and second harmonics roughly aligned at the visual input-consistent with the hue shift's being caused by an early instantaneous nonlinearity that saturates larger hue excursions. These predictions, however, ignore phase delays introduced within the chromatic pathway between its input and the nonlinearity that produces the hue shifts. If the nonlinearity follows the substantial filtering implied by the chromatic temporal contrast-sensitivity function, phase delays will alter the alignment of the first and second harmonics such that at the nonlinearity, the waveforms that produce the maximum hue shifts might well be those with the largest differences in rising and falling slopes-consistent with the hue shift's being caused by a central nonlinearity that limits the rate of hue change.

  10. Frequency Dependence of Helioseismic Measurements of the Center-to-Limb Effect and Flow-induced Travel-time Shifts

    Science.gov (United States)

    Chen, Ruizhu; Zhao, Junwei

    2018-02-01

    Time–distance helioseismology measures acoustic travel times to infer the structure and flow field of the solar interior; however, both the mean travel times and the travel-time shifts suffer systematic center-to-limb variations, which complicate the interpretation and inversions of the time–distance measurements. In particular, the center-to-limb variation in travel-time shifts (CtoL effect) has a significant impact on the inference of the Sun’s meridional circulation, and needs to be removed from the helioseismic measurements, although the observational properties and the physical cause of the CtoL effect have yet to be investigated. In this study, we measure the CtoL effect in the frequency domain using Doppler-velocity data from the Solar Dynamics Observatory/Helioseismic and Magnetic Imager, and study its properties as a function of disk-centric distance, travel distance, and frequency of acoustic waves. It is found that the CtoL effect has a significant frequency dependence—it reverses sign at a frequency around 5.4 mHz and reaches maximum at around 4.0 mHz before the sign reversal. The tendency of frequency dependence varies with disk-centric distance in a way that both the sign-reversal frequency and the maximum-value frequency decrease closer to the limb. The variation tendency does not change with travel distance, but the variation magnitude is approximately proportional to travel distance. For comparison, the flow-induced travel-time shifts show little frequency dependence. These observational properties provide more clues on the nature of the CtoL effect, and also possibly lead to new ways of effect-removal for a more robust determination of the deep meridional flow.

  11. Developmental Programming of Adult Disease: Reprogramming by Melatonin?

    Directory of Open Access Journals (Sweden)

    You-Lin Tain

    2017-02-01

    Full Text Available Adult-onset chronic non-communicable diseases (NCDs can originate from early life through so-called the “developmental origins of health and disease” (DOHaD or “developmental programming”. The DOHaD concept offers the “reprogramming” strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evidence support that melatonin is closely inter-related to other proposed mechanisms contributing to the developmental programming of a variety of chronic NCDs. Recent animal studies have begun to unravel the multifunctional roles of melatonin in many experimental models of developmental programming. Even though some progress has been made in research on melatonin as a reprogramming strategy to prevent DOHaD-related NCDs, future human studies should aim at filling the translational gap between animal models and clinical trials. Here, we review several key themes on the reprogramming effects of melatonin in DOHaD research. We have particularly focused on the following areas: mechanisms of developmental programming; the interrelationship between melatonin and mechanisms underlying developmental programming; pathophysiological roles of melatonin in pregnancy and fetal development; and insight provided by animal models to support melatonin as a reprogramming therapy. Rates of NCDs are increasing faster than anticipated all over the world. Hence, there is an urgent need to understand reprogramming mechanisms of melatonin and to translate experimental research into clinical practice for halting a growing list of DOHaD-related NCDs.

  12. Developmental Programming of Adult Disease: Reprogramming by Melatonin?

    Science.gov (United States)

    Tain, You-Lin; Huang, Li-Tung; Hsu, Chien-Ning

    2017-02-16

    Adult-onset chronic non-communicable diseases (NCDs) can originate from early life through so-called the "developmental origins of health and disease" (DOHaD) or "developmental programming". The DOHaD concept offers the "reprogramming" strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evidence support that melatonin is closely inter-related to other proposed mechanisms contributing to the developmental programming of a variety of chronic NCDs. Recent animal studies have begun to unravel the multifunctional roles of melatonin in many experimental models of developmental programming. Even though some progress has been made in research on melatonin as a reprogramming strategy to prevent DOHaD-related NCDs, future human studies should aim at filling the translational gap between animal models and clinical trials. Here, we review several key themes on the reprogramming effects of melatonin in DOHaD research. We have particularly focused on the following areas: mechanisms of developmental programming; the interrelationship between melatonin and mechanisms underlying developmental programming; pathophysiological roles of melatonin in pregnancy and fetal development; and insight provided by animal models to support melatonin as a reprogramming therapy. Rates of NCDs are increasing faster than anticipated all over the world. Hence, there is an urgent need to understand reprogramming mechanisms of melatonin and to translate experimental research into clinical practice for halting a growing list of DOHaD-related NCDs.

  13. Lamb shift of energy levels in quantum rings

    International Nuclear Information System (INIS)

    Kryuchkyan, G Yu; Kyriienko, O; Shelykh, I A

    2015-01-01

    We study the vacuum radiative corrections to energy levels of a confined electron in quantum rings. The calculations are provided for the Lamb shift of energy levels in a low-momentum region of virtual photons and for both one-dimensional and two-dimensional quantum rings. We show that contrary to the well known case of a hydrogen atom the value of the Lamb shift increases with the magnetic momentum quantum number m. We also investigate the dependence of the Lamb shift on magnetic flux piercing the ring and demonstrate a presence of magnetic-flux-dependent oscillations. For a one-dimensional ring the value of the shift strongly depends on the radius of the ring. It is small for semiconductor rings but can attain measurable quantities in natural organic ring-shape molecules, such as benzene, cycloalcanes and porphyrins. (paper)

  14. Developmental psychopathology: Attention Deficit Hyperactivity Disorder (ADHD

    Directory of Open Access Journals (Sweden)

    Petermann Franz

    2009-09-01

    Full Text Available Abstract Background Attention Deficit/Hyperactivity Disorder (ADHD, formerly regarded as a typical childhood disorder, is now known as a developmental disorder persisting over the lifespan. Starting in preschool-age, symptoms vary depending on the age group affected. Method According to the variability of ADHD-symptoms and the heterogeneity of comorbid psychiatric disorders, a broad review of recent studies was performed. These findings were summarized in a developmental psychopathological model, documenting relevant facts on a timeline. Results Based on a genetic disposition and a neuropsychological deregulation, there is evidence for factors which persist across the lifespan, change age-dependently, or show validity in a specific developmental phase. Qualitative changes can be found for children in preschool-age and adults. Conclusion These differences have implications for clinical practice as they can be used for prevention, diagnostic proceedings, and therapeutic intervention as well as for planning future studies. The present article is a translated and modified version of the German article "Entwicklungspsychopathologie der ADHS", published in Zeitschrift für Psychiatrie, Psychologie und Psychotherapie, 56, 2008, S. 265-274.

  15. Developmental psychopathology: Attention Deficit Hyperactivity Disorder (ADHD).

    Science.gov (United States)

    Schmidt, Sören; Petermann, Franz

    2009-09-17

    Attention Deficit/Hyperactivity Disorder (ADHD), formerly regarded as a typical childhood disorder, is now known as a developmental disorder persisting over the lifespan. Starting in preschool-age, symptoms vary depending on the age group affected. According to the variability of ADHD-symptoms and the heterogeneity of comorbid psychiatric disorders, a broad review of recent studies was performed. These findings were summarized in a developmental psychopathological model, documenting relevant facts on a timeline. Based on a genetic disposition and a neuropsychological deregulation, there is evidence for factors which persist across the lifespan, change age-dependently, or show validity in a specific developmental phase. Qualitative changes can be found for children in preschool-age and adults. These differences have implications for clinical practice as they can be used for prevention, diagnostic proceedings, and therapeutic intervention as well as for planning future studies. The present article is a translated and modified version of the German article "Entwicklungspsychopathologie der ADHS", published in Zeitschrift für Psychiatrie, Psychologie und Psychotherapie, 56, 2008, S. 265-274.

  16. From Prioritizing Objects to Prioritizing Cues: A Developmental Shift for Cognitive Control

    Science.gov (United States)

    Chevalier, Nicolas; Dauvier, Bruno; Blaye, Agnès

    2018-01-01

    Emerging cognitive control supports increasingly adaptive behaviors and predicts life success, while low cognitive control is a major risk factor during childhood. It is therefore essential to understand how it develops. The present study provides evidence for an age-related shift in the type of information that children prioritize in their…

  17. ISC1-dependent metabolic adaptation reveals an indispensable role for mitochondria in induction of nuclear genes during the diauxic shift in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kitagaki, Hiroshi; Cowart, L Ashley; Matmati, Nabil; Montefusco, David; Gandy, Jason; de Avalos, Silvia Vaena; Novgorodov, Sergei A; Zheng, Jim; Obeid, Lina M; Hannun, Yusuf A

    2009-04-17

    Growth of Saccharomyces cerevisiae following glucose depletion (the diauxic shift) depends on a profound metabolic adaptation accompanied by a global reprogramming of gene expression. In this study, we provide evidence for a heretofore unsuspected role for Isc1p in mediating this reprogramming. Initial studies revealed that yeast cells deleted in ISC1, the gene encoding inositol sphingolipid phospholipase C, which resides in mitochondria in the post-diauxic phase, showed defective aerobic respiration in the post-diauxic phase but retained normal intrinsic mitochondrial functions, including intact mitochondrial DNA, normal oxygen consumption, and normal mitochondrial polarization. Microarray analysis revealed that the Deltaisc1 strain failed to up-regulate genes required for nonfermentable carbon source metabolism during the diauxic shift, thus suggesting a mechanism for the defective supply of respiratory substrates into mitochondria in the post-diauxic phase. This defect in regulating nuclear gene induction in response to a defect in a mitochondrial enzyme raised the possibility that mitochondria may initiate diauxic shift-associated regulation of nucleus-encoded genes. This was established by demonstrating that in respiratory-deficient petite cells these genes failed to be up-regulated across the diauxic shift in a manner similar to the Deltaisc1 strain. Isc1p- and mitochondrial function-dependent genes significantly overlapped with Adr1p-, Snf1p-, and Cat8p-dependent genes, suggesting some functional link among these factors. However, the retrograde response was not activated in Deltaisc1, suggesting that the response of Deltaisc1 cannot be simply attributed to mitochondrial dysfunction. These results suggest a novel role for Isc1p in allowing the reprogramming of gene expression during the transition from anaerobic to aerobic metabolism.

  18. Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage.

    Directory of Open Access Journals (Sweden)

    Fatma Kaplan

    2011-03-01

    Full Text Available The ascarosides form a family of small molecules that have been isolated from cultures of the nematode Caenorhabditis elegans. They are often referred to as "dauer pheromones" because most of them induce formation of long-lived and highly stress resistant dauer larvae. More recent studies have shown that ascarosides serve additional functions as social signals and mating pheromones. Thus, ascarosides have multiple functions. Until now, it has been generally assumed that ascarosides are constitutively expressed during nematode development.Cultures of C. elegans were developmentally synchronized on controlled diets. Ascarosides released into the media, as well as stored internally, were quantified by LC/MS. We found that ascaroside biosynthesis and release were strongly dependent on developmental stage and diet. The male attracting pheromone was verified to be a blend of at least four ascarosides, and peak production of the two most potent mating pheromone components, ascr#3 and asc#8 immediately preceded or coincided with the temporal window for mating. The concentration of ascr#2 increased under starvation conditions and peaked during dauer formation, strongly supporting ascr#2 as the main population density signal (dauer pheromone. After dauer formation, ascaroside production largely ceased and dauer larvae did not release any ascarosides. These findings show that both total ascaroside production and the relative proportions of individual ascarosides strongly correlate with these compounds' stage-specific biological functions.Ascaroside expression changes with development and environmental conditions. This is consistent with multiple functions of these signaling molecules. Knowledge of such differential regulation will make it possible to associate ascaroside production to gene expression profiles (transcript, protein or enzyme activity and help to determine genetic pathways that control ascaroside biosynthesis. In conjunction with findings

  19. Developmental changes in organization of structural brain networks.

    Science.gov (United States)

    Khundrakpam, Budhachandra S; Reid, Andrew; Brauer, Jens; Carbonell, Felix; Lewis, John; Ameis, Stephanie; Karama, Sherif; Lee, Junki; Chen, Zhang; Das, Samir; Evans, Alan C

    2013-09-01

    Recent findings from developmental neuroimaging studies suggest that the enhancement of cognitive processes during development may be the result of a fine-tuning of the structural and functional organization of brain with maturation. However, the details regarding the developmental trajectory of large-scale structural brain networks are not yet understood. Here, we used graph theory to examine developmental changes in the organization of structural brain networks in 203 normally growing children and adolescents. Structural brain networks were constructed using interregional correlations in cortical thickness for 4 age groups (early childhood: 4.8-8.4 year; late childhood: 8.5-11.3 year; early adolescence: 11.4-14.7 year; late adolescence: 14.8-18.3 year). Late childhood showed prominent changes in topological properties, specifically a significant reduction in local efficiency, modularity, and increased global efficiency, suggesting a shift of topological organization toward a more random configuration. An increase in number and span of distribution of connector hubs was found in this age group. Finally, inter-regional connectivity analysis and graph-theoretic measures indicated early maturation of primary sensorimotor regions and protracted development of higher order association and paralimbic regions. Our finding reveals a time window of plasticity occurring during late childhood which may accommodate crucial changes during puberty and the new developmental tasks that an adolescent faces.

  20. Directional Dependence in Developmental Research

    Science.gov (United States)

    von Eye, Alexander; DeShon, Richard P.

    2012-01-01

    In this article, we discuss and propose methods that may be of use to determine direction of dependence in non-normally distributed variables. First, it is shown that standard regression analysis is unable to distinguish between explanatory and response variables. Then, skewness and kurtosis are discussed as tools to assess deviation from…

  1. The neurite growth inhibitory effects of soluble TNFα on developing sympathetic neurons are dependent on developmental age.

    Science.gov (United States)

    Nolan, Aoife M; Collins, Louise M; Wyatt, Sean L; Gutierrez, Humberto; O'Keeffe, Gerard W

    2014-01-01

    During development, the growth of neural processes is regulated by an array of cellular and molecular mechanisms which influence growth rate, direction and branching. Recently, many members of the TNF superfamily have been shown to be key regulators of neurite growth during development. The founder member of this family, TNFα can both promote and inhibit neurite growth depending on the cellular context. Specifically, transmembrane TNFα promotes neurite growth, while soluble TNFα inhibits it. While the growth promoting effects of TNFα are restricted to a defined developmental window of early postnatal development, whether the growth inhibitory effects of soluble TNFα occur throughout development is unknown. In this study we used the extensively studied, well characterised neurons of the superior cervical ganglion to show that the growth inhibitory effects of soluble TNFα are restricted to a specific period of late embryonic and early postnatal development. Furthermore, we show that this growth inhibitory effect of soluble TNFα requires NF-κB signalling at all developmental stages at which soluble TNFα inhibits neurite growth. These findings raise the possibility that increases in the amount of soluble TNFα in vivo, for example as a result of maternal inflammation, could negatively affect neurite growth in developing neurons at specific stages of development. Copyright © 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  2. Sources of Cognitive Inflexibility in Set-Shifting Tasks: Insights Into Developmental Theories From Adult Data

    OpenAIRE

    Dick, Anthony Steven

    2012-01-01

    Two experiments examined processes underlying cognitive inflexibility in set-shifting tasks typically used to assess the development of executive function in children. Adult participants performed a Flexible Item Selection Task (FIST) that requires shifting from categorizing by one dimension (e.g., color) to categorizing by a second orthogonal dimension (e.g., shape). The experiments showed performance of the FIST involves suppression of the representation of the ignored dimension; response t...

  3. Combined chemical shift changes and amino acid specific chemical shift mapping of protein-protein interactions

    Energy Technology Data Exchange (ETDEWEB)

    Schumann, Frank H.; Riepl, Hubert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Maurer, Till [Boehringer Ingelheim Pharma GmbH and Co. KG, Analytical Sciences Department (Germany); Gronwald, Wolfram [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Neidig, Klaus-Peter [Bruker BioSpin GmbH, Software Department (Germany); Kalbitzer, Hans Robert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany)], E-mail: hans-robert.kalbitzer@biologie.uni-regensburg.de

    2007-12-15

    Protein-protein interactions are often studied by chemical shift mapping using solution NMR spectroscopy. When heteronuclear data are available the interaction interface is usually predicted by combining the chemical shift changes of different nuclei to a single quantity, the combined chemical shift perturbation {delta}{delta}{sub comb}. In this paper different procedures (published and non-published) to calculate {delta}{delta}{sub comb} are examined that include a variety of different functional forms and weighting factors for each nucleus. The predictive power of all shift mapping methods depends on the magnitude of the overlap of the chemical shift distributions of interacting and non-interacting residues and the cut-off criterion used. In general, the quality of the prediction on the basis of chemical shift changes alone is rather unsatisfactory but the combination of chemical shift changes on the basis of the Hamming or the Euclidian distance can improve the result. The corrected standard deviation to zero of the combined chemical shift changes can provide a reasonable cut-off criterion. As we show combined chemical shifts can also be applied for a more reliable quantitative evaluation of titration data.

  4. Enhanced excitatory input to MCH neurons during developmental period of high food intake is mediated by GABA

    Science.gov (United States)

    Li, Ying; van den Pol, Anthony N.

    2010-01-01

    In contrast to the local axons of GABA neurons of the cortex and hippocampus, lateral hypothalamic neurons containing melanin concentrating hormone (MCH) and GABA send long axons throughout the brain and play key roles in energy homeostasis and mental status. In adults, MCH neurons maintain a hyperpolarized membrane potential and most of the synaptic input is inhibitory. In contrast, we found that developing MCH neurons received substantially more excitatory synaptic input. Based on gramicidicin-perforated patch recordings in hypothalamic slices from MCH-GFP transgenic mice, we found that GABA was the primary excitatory synaptic transmitter in embryonic and neonatal ages up to postnatal day 10. Surprisingly, glutamate assumed only a minor excitatory role, if any. GABA plays a complex role in developing MCH neurons, with its actions conditionally dependent on a number of factors. GABA depolarization could lead to an increase in spikes either independently or in summation with other depolarizing stimuli, or alternately, depending on the relative timing of other depolarizing events, could lead to shunting inhibition. The developmental shift from depolarizing to hyperpolarizing occurred later in the dendrites than in the cell body. Early GABA depolarization was based on a Cl− dependent inward current. An interesting secondary depolarization in mature neurons that followed an initial hyperpolarization was based on a bicarbonate mechanism. Thus during the early developmental period when food consumption is high, MCH neurons are more depolarized than in the adult, and an increased level of excitatory synaptic input to these orexigenic cells is mediated by GABA. PMID:19955372

  5. THE MAKING OF FAMILY VALUES: DEVELOPMENTAL IDEALISM IN GANSU, CHINA

    Science.gov (United States)

    Lai, Qing; Thornton, Arland

    2014-01-01

    This paper examines the role of developmental thinking in the making of family values. We analyze survey data collected from Gansu Province in China with regular and multilevel logit models. The results show that individuals’ endorsement of neolocal residence, self-choice marriage, gender egalitarianism, late marriage for women, and low fertility depends on the conjunction of preference for development and beliefs in its association with those family attributes, which we term developmental idealism associational evaluation. Furthermore, such impact of developmental thinking on family values holds robust in the presence of indigenous ideational forces, in this case Islamic religion. Although Islam influences family values in the opposite direction than developmental ideas do, the effect of Developmental Idealism associational evaluation does not differ significantly between Muslims and non-Muslims. PMID:25769860

  6. Developmental toxicity of engineered nanomaterials in rodents

    Energy Technology Data Exchange (ETDEWEB)

    Ema, Makoto, E-mail: ema-makoto@aist.go.jp; Gamo, Masashi; Honda, Kazumasa

    2016-05-15

    We summarized significant effects reported in the literature on the developmental toxicity of engineered nanomaterials (ENMs) in rodents. The developmental toxicity of ENMs included not only structural abnormalities, but also death, growth retardation, and behavioral and functional abnormalities. Most studies were performed on mice using an injection route of exposure. Teratogenic effects were indicated when multi-walled carbon nanotubes (MWCNTs), single-walled carbon nanotubes (SWCNTs), and TiO{sub 2}-nanoparticles were administered to mice during early gestation. Reactive oxygen species levels were increased in placentas and malformed fetuses and their placentas after prenatal exposure to MWCNTs and SWCNTs, respectively. The pre- and postnatal mortalities and growth retardation in offspring increased after prenatal exposure to ENMs. Histopathological and functional abnormalities were also induced in placentas after prenatal exposure to ENMs. Maternal exposure to ENMs induced behavioral alterations, histopathological and biochemical changes in the central nervous system, increased susceptibility to allergy, transplacental genotoxicity, and vascular, immunological, and reproductive effects in offspring. The size- and developmental stage-dependent placental transfer of ENMs was noted after maternal exposure. Silver accumulated in the visceral yolk sac after being injected with Ag-NPs during early gestation. Although currently available data has provided initial information on the potential developmental toxicity of ENMs, that on the developmental toxicity of ENMs is still very limited. Further studies using well-characterized ENMs, state-of the-art study protocols, and appropriate routes of exposure are required in order to clarify these developmental effects and provide information suitable for risk assessments of ENMs. - Highlights: • We review the developmental toxicity studies of engineered nanomaterials (ENMs). • Various developmental endpoints have been

  7. Chemical shift imaging: a review

    International Nuclear Information System (INIS)

    Brateman, L.

    1986-01-01

    Chemical shift is the phenomenon that is seen when an isotope possessing a nuclear magnetic dipole moment resonates at a spectrum of resonance frequencies in a given magnetic field. These resonance frequencies, or chemical shifts, depend on the chemical environments of particular nuclei. Mapping the spatial distribution of nuclei associated with a particular chemical shift (e.g., hydrogen nuclei associated with water molecules or with lipid groups) is called chemical shift imaging. Several techniques of proton chemical shift imaging that have been applied in vivo are presented, and their clinical findings are reported and summarized. Acquiring high-resolution spectra for large numbers of volume elements in two or three dimensions may be prohibitive because of time constraints, but other methods of imaging lipid of water distributions (i.e., selective excitation, selective saturation, or variations in conventional magnetic resonance imaging pulse sequences) can provide chemical shift information. These techniques require less time, but they lack spectral information. Since fat deposition seen by chemical shift imaging may not be demonstrated by conventional magnetic resonance imaging, certain applications of chemical shift imaging, such as in the determination of fatty liver disease, have greater diagnostic utility than conventional magnetic resonance imaging. Furthermore, edge artifacts caused by chemical shift effects can be eliminated by certain selective methods of data acquisition employed in chemical shift imaging

  8. Biomarkers of adult and developmental neurotoxicity

    International Nuclear Information System (INIS)

    Slikker, William; Bowyer, John F.

    2005-01-01

    Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations

  9. Random coil chemical shift for intrinsically disordered proteins

    DEFF Research Database (Denmark)

    Kjærgaard, Magnus; Brander, Søren; Poulsen, Flemming Martin

    2011-01-01

    . Temperature has a non-negligible effect on the (13)C random coil chemical shifts, so temperature coefficients are reported for the random coil chemical shifts to allow extrapolation to other temperatures. The pH dependence of the histidine random coil chemical shifts is investigated in a titration series......, which allows the accurate random coil chemical shifts to be obtained at any pH. By correcting the random coil chemical shifts for the effects of temperature and pH, systematic biases of the secondary chemical shifts are minimized, which will improve the reliability of detection of transient secondary...

  10. Fluorescence spectral shift of QD films with electron injection: Dependence on counterion proximity

    Science.gov (United States)

    Lu, Meilin; Li, Bo; Zhang, Yaxin; Liu, Weilong; Yang, Yanqiang; Wang, Yuxiao; Yang, Qingxin

    2017-05-01

    Due to the promising application of quantum dot (QD) films in solar cells, LEDs and environmental detectors, the fluorescence of charged QD films has achieved much attention during recent years. In this work, we observe the spectral shift of photoluminescence (PL) in charged CdSe/ZnS QD films controlled by electrochemical potential. The spectral center under negative bias changes from red-shift to blue-shift while introducing smaller inorganic counterions (potassium ions) into the electrolyte. This repeatable effect is attributed to the enhanced electron injection with smaller cations and the electronic perturbations of QD luminescence by these excess charges.

  11. Energy dependence phase shift analysis of PI4He elastic scattering and the possibility of the (PI4He) excited states existence

    International Nuclear Information System (INIS)

    Nichitiu, F.; Falomkin, I.V.; Sapozhnikov, M.G.; Shcherbakov, Yu.A.; Piragino, G.

    1981-06-01

    In the 24 MeV-260 MeV kinetic energy interval, the energy dependent phase shift analysis of π 4 He elastic scattering is done. The eneray dependence is given by the rational fraction approximants of the partial S matrix. The search for the stable S matrix zero-pole pairs in the k and √s complex plane give some proofs for the existence of the (π 4 He) excited states in the S, P and probably D partial waves. (authors)

  12. Tobacco Use among Individuals with Intellectual or Developmental Disabilities: A Brief Review

    Science.gov (United States)

    Steinberg, Marc L.; Heimlich, Laura; Williams, Jill M.

    2009-01-01

    Tobacco use is the leading preventable cause of death in the United States. Although few tobacco control efforts target individuals with intellectual and/or developmental disabilities, this population may be especially vulnerable to the deleterious effects of tobacco use and dependence. Individuals with intellectual and developmental disabilities…

  13. Young Children’s Developmental Ecologies and Kindergarten Readiness

    Science.gov (United States)

    Mollborn, Stefanie

    2016-01-01

    Children enter the crucial transition to school with sociodemographic disparities firmly established. Domain-specific research (e.g., on poverty and family structure) has shed light on these disparities, but we need broader operationalizations of children’s environments to explain them. Building on existing theory, this study articulates the concept of developmental ecology—those interrelated features of a child’s proximal environment that shape development and health. Developmental ecology links structural and demographic factors with interactional, psychological, and genetic factors. Using the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B), this study conducts latent class analyses to identify how 41 factors from three domains—namely, household resources, health risks, and ecological changes—cluster within children as four overarching developmental ecologies. Because it documents how numerous factors co-occur within children, this method allows an approximation of their lived environments. Findings illuminate powerful relationships between race/ethnicity, parental age, socioeconomic background, and nativity and a child’s developmental ecology, as well as associations between developmental ecology and kindergarten cognition, behavior, and health. Developmental ecology represents a major pathway through which demographic characteristics shape school readiness. Because specific factors have different implications depending on the ecologies in which they are embedded, findings support the usefulness of a broad ecological approach. PMID:27873222

  14. Constructivist developmental theory is needed in developmental neuroscience

    Science.gov (United States)

    Arsalidou, Marie; Pascual-Leone, Juan

    2016-12-01

    Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.

  15. Enhanced excitatory input to melanin concentrating hormone neurons during developmental period of high food intake is mediated by GABA.

    Science.gov (United States)

    Li, Ying; van den Pol, Anthony N

    2009-12-02

    In contrast to the local axons of GABA neurons of the cortex and hippocampus, lateral hypothalamic neurons containing melanin concentrating hormone (MCH) and GABA send long axons throughout the brain and play key roles in energy homeostasis and mental status. In adults, MCH neurons maintain a hyperpolarized membrane potential and most of the synaptic input is inhibitory. In contrast, we found that developing MCH neurons received substantially more excitatory synaptic input. Based on gramicidin-perforated patch recordings in hypothalamic slices from MCH-green fluorescent protein transgenic mice, we found that GABA was the primary excitatory synaptic transmitter in embryonic and neonatal ages up to postnatal day 10. Surprisingly, glutamate assumed only a minor excitatory role, if any. GABA plays a complex role in developing MCH neurons, with its actions conditionally dependent on a number of factors. GABA depolarization could lead to an increase in spikes either independently or in summation with other depolarizing stimuli, or alternately, depending on the relative timing of other depolarizing events, could lead to shunting inhibition. The developmental shift from depolarizing to hyperpolarizing occurred later in the dendrites than in the cell body. Early GABA depolarization was based on a Cl(-)-dependent inward current. An interesting secondary depolarization in mature neurons that followed an initial hyperpolarization was based on a bicarbonate mechanism. Thus during the early developmental period when food consumption is high, MCH neurons are more depolarized than in the adult, and an increased level of excitatory synaptic input to these orexigenic cells is mediated by GABA.

  16. Developmental Trajectories of Hand Movements in Typical Infants and Those at Risk of Developmental Disorders: An Observational Study of Kinematics during the First Year of Life

    Directory of Open Access Journals (Sweden)

    Lisa Ouss

    2018-02-01

    are significantly associated with age in cohorts of typical and at-risk infantsdiffer significantly at 5–6 months of age, depending on the context: relating either with an object or a person.Environmental and developmental factors shape the developmental trajectories of hand movements in different cohorts: environment for infants with VIMs; stage of development for premature infants and those with West syndrome; and both factors for infants with orality disorders.The curvature of hand movements specifically reflects atypical development in infants with West syndrome when developmental age is considered.We aimed to discriminate between typical and atypical developmental trajectory patterns of at-risk infants in an interactive setting in this observational and longitudinal study, with the assumption that hand movements (HM reflect preverbal communication and its disorders. We examined the developmental trajectories of HM in five cohorts of at-risk infants and one control cohort, followed from ages 2 to 10 months: 25 West syndrome (WS, 13 preterm birth (PB, 16 orality disorder (OD, 14 with visually impaired mothers (VIM, 7 early hospitalization (EH, and 19 typically developing infants (TD. Video-recorded data were collected in three different structured interactive contexts. Descriptors of the hand motion were used to examine the extent to which HM were associated with age and cohort. We obtained four principal results: (i the kinematics of HM (spatial use, curvature, acceleration, and velocity were significantly associated with age in all cohorts; (ii HM significantly differed at 5–6 months of age in TD infants, depending on the context; (iii environmental and developmental factors shaped the developmental trajectories of HM in different cohorts: environment for VIM, development for PB and WS, and both factors for OD and; (iv the curvatures of HM showed atypical development in WS infants when developmental age was considered. These findings support the importance

  17. Lamb shift of Rydberg atoms in a resonator

    International Nuclear Information System (INIS)

    Belov, A.A.; Lozovik, Yu.E.; Pokrovsky, V.L.

    1988-08-01

    The Lamb shift of a Rydberg atom in a cavity is shown to be enhanced with the resonance interaction of a virtual atomic transition and cavity modes. The dependence of the Lamb shift on quantum numbers and atomic number changes drastically. Shifting cavity walls and scanning the atomic beam one can vary the Lamb shift. The value of the Lamb shift in a cavity may exceed a typical magnitude of the fine structure energy. For a rough resonance tuning the Coulumb multiplet occurs to be strongly mixed and a novel classification is necessary. (author). 8 refs, 2 figs

  18. Age-Related Change in Shifting Attention between Global and Local Levels of Hierarchical Stimuli

    Science.gov (United States)

    Huizinga, Mariette; Burack, Jacob A.; Van der Molen, Maurits W.

    2010-01-01

    The focus of this study was the developmental pattern of the ability to shift attention between global and local levels of hierarchical stimuli. Children aged 7 years and 11 years and 21-year-old adults were administered a task (two experiments) that allowed for the examination of 1) the direction of attention to global or local stimulus levels;…

  19. Sleep and satisfaction in 8- and 12-h forward-rotating shift systems: Industrial employees prefer 12-h shifts.

    Science.gov (United States)

    Karhula, Kati; Härmä, Mikko; Ropponen, Annina; Hakola, Tarja; Sallinen, Mikael; Puttonen, Sampsa

    2016-01-01

    Twelve-hour shift systems have become more popular in industry. Survey data of shift length, shift rotation speed, self-rated sleep, satisfaction and perceived health were investigated for the associations among 599 predominantly male Finnish industrial employees. The studied forward-rotating shift systems were 12-h fast (12fast, DDNN------, n = 268), 8-h fast (8fast, MMEENN----, n = 161) and 8-h slow (8slow, MMMM-EEEE-NNNN, n = 170). Satisfaction with shift system differed between the groups (p effects on sleep and alertness were rare (8%) in the 12fast group (53% 8fast, 66% 8 slow, p effects of the current shift system on general health (12fast 4%, 8fast 30%, 8slow 41%, p work-life balance (12fast 8%, 8fast 52%, 8slow 63%, p effects of shift work were dependent on both shift length and shift rotation speed: employees in the 12-h rapidly forward-rotating shift system were most satisfied, perceived better work-life balance and slept better than the employees in the 8fast or especially the employees in the 8-h slowly rotating systems.

  20. Developmental pathways from child maltreatment to adolescent marijuana dependence: Examining moderation by FK506 binding protein 5 gene (FKBP5).

    Science.gov (United States)

    Handley, Elizabeth D; Rogosch, Fred A; Cicchetti, Dante

    2015-11-01

    The current study examined the prospective association between child maltreatment and the development of substance use disorder in adolescence with the aim of investigating pathways underlying this relation, as well as genetic moderation of these developmental mechanisms. Specifically, we tested whether youth who experienced maltreatment prior to age 8 were at risk for the development of marijuana dependence in adolescence by way of a childhood externalizing pathway and a childhood internalizing pathway. Moreover, we tested whether variation in FK506 binding protein 5 gene (FKBP5) CATT haplotype moderated these pathways. The participants were 326 children (n =179 maltreated; n = 147 nonmaltreated) assessed across two waves of data collection (childhood: ages 7-9 and adolescence: ages 15-18). Results indicated that higher levels of child externalizing symptoms significantly mediated the effect of child maltreatment on adolescent marijuana dependence symptoms for individuals with one or two copies of the FKBP5 CATT haplotype only. We did not find support for an internalizing pathway from child maltreatment to adolescent marijuana dependence, nor did we find evidence of moderation of the internalizing pathway by FKBP5 haplotype variation. Findings extend previous research by demonstrating that whether a maltreated child will traverse an externalizing pathway toward substance use disorder in adolescence is dependent on FKBP5 genetic variation.

  1. The phenotypic plasticity of developmental modules

    Directory of Open Access Journals (Sweden)

    Aabha I. Sharma

    2016-08-01

    Full Text Available Abstract Background Organisms develop and evolve in a modular fashion, but how individual modules interact with the environment remains poorly understood. Phenotypically plastic traits are often under selection, and studies are needed to address how traits respond to the environment in a modular fashion. In this study, tissue-specific plasticity of melanic spots was examined in the large milkweed bug, Oncopeltus fasciatus. Results Although the size of the abdominal melanic bands varied according to rearing temperatures, wing melanic bands were more robust. To explore the regulation of abdominal pigmentation plasticity, candidate genes involved in abdominal melanic spot patterning and biosynthesis of melanin were analyzed. While the knockdown of dopa decarboxylase (Ddc led to lighter pigmentation in both the wings and the abdomen, the shape of the melanic elements remained unaffected. Although the knockdown of Abdominal-B (Abd-B partially phenocopied the low-temperature phenotype, the abdominal bands were still sensitive to temperature shifts. These observations suggest that regulators downstream of Abd-B but upstream of DDC are responsible for the temperature response of the abdomen. Ablation of wings led to the regeneration of a smaller wing with reduced melanic bands that were shifted proximally. In addition, the knockdown of the Wnt signaling nuclear effector genes, armadillo 1 and armadillo 2, altered both the melanic bands and the wing shape. Thus, the pleiotropic effects of Wnt signaling may constrain the amount of plasticity in wing melanic bands. Conclusions We propose that when traits are regulated by distinct pre-patterning mechanisms, they can respond to the environment in a modular fashion, whereas when the environment impacts developmental regulators that are shared between different modules, phenotypic plasticity can manifest as a developmentally integrated system.

  2. Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.

    Science.gov (United States)

    Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina

    2015-10-01

    The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.

  3. Immersion angle dependence of the resonant-frequency shift of the quartz crystal microbalance in a liquid: effects of longitudinal wave.

    Science.gov (United States)

    Yoshimoto, Minoru; Kobirata, Satoshi; Aizawa, Hideo; Kurosawa, Shigeru

    2007-06-19

    We investigated the effects of the longitudinal wave on the immersion angle dependence of the resonant-frequency shift, deltaF, of the quartz crystal microbalance, QCM. In order to study exactly the effects, we employed the three types of cells: normal cell, cell with the glass beads and cell with sponge. The longitudinal wave exists in the normal cell. On the other hand, both the cell with the glass beads and the cell with sponge eliminate the longitudinal wave. As results, we have found that the tendencies of deltaF are the same in the three types of cells. That is, we conclude that the longitudinal wave does not have effects on the immersion angle dependence of deltaF.

  4. A developmental perspective on early-life exposure to neurotoxicants.

    Science.gov (United States)

    Bellinger, David C; Matthews-Bellinger, Julia A; Kordas, Katarzyna

    2016-09-01

    Studies of early-life neurotoxicant exposure have not been designed, analyzed, or interpreted in the context of a fully developmental perspective. The goal of this paper is to describe the key principles of a developmental perspective and to use examples from the literature to illustrate the relevance of these principles to early-life neurotoxicant exposures. Four principles are discussed: 1) the effects of early-life neurotoxicant exposure depend on a child's developmental context; 2) deficits caused by early-life exposure initiate developmental cascades that can lead to pathologies that differ from those observed initially; 3) early-life neurotoxicant exposure has intra-familial and intergenerational impacts; 4) the impacts of early-life neurotoxicant exposure influence a child's ability to respond to future insults. The first principle is supported by considerable evidence, but the other three have received much less attention. Incorporating a developmental perspective in studies of early-life neurotoxicant exposures requires prospective collection of data on a larger array of covariates than usually considered, using analytical approaches that acknowledge the transactional processes between a child and the environment and the phenomenon of developmental cascades. Consideration of early-life neurotoxicant exposure within a developmental perspective reveals that many issues remain to be explicated if we are to achieve a deep understanding of the societal health burden associated with early-life neurotoxicant exposures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. SAT in shift manager training

    International Nuclear Information System (INIS)

    Lecuyer, F.

    1995-01-01

    EDF has improved the organization of the operation shift teams with the replacement of shift supervisor in shift manager function. The shift manager is not only responsible for tasks associated to plant operation (production), but he is also responsible for safety of these tasks and for management of shift team members. A job analysis of this new job position has been performed in order to design the training programme. It resulted in a 10-month training programme that includes 8 weeks in safety-related topics and 12 weeks in soft-skills related topics. The safety related training courses are mandatory, the other courses are optional courses depending on individual trainee needs. The training also includes the development of management competencies. During the 10 month period, each trainee develops an individual project that is evaluated by NPP manager. As well, as group project is undertaken by the trainees and overseen by a steering committee. The steering committee participates in the evaluation process and provides operational experience feedback to the trainee groups and to the overall programme

  6. Developmental toxicity and oxidative stress induced by gamma irradiation in zebrafish embryos.

    Science.gov (United States)

    Hu, Miao; Hu, Nan; Ding, Dexin; Zhao, Weichao; Feng, Yongfu; Zhang, Hui; Li, Guangyue; Wang, Yongdong

    2016-11-01

    This study aimed to evaluate the biological effects of gamma irradiation on zebrafish embryos. Different doses of gamma rays (0.01, 0.05, 0.1, 0.5 and 1 Gy) were used to irradiate zebrafish embryos at three developmental stages (stage 1, 6 h post-fertilization (hpf); stage 2, 12 hpf; stage three, 24 hpf), respectively. The survival, malformation and hatching rates of the zebrafish embryos were measured at the morphological endpoint of 96 hpf. The activities of superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx) and glutathione S-transferase (GST) were assayed. Morphology analysis showed that gamma irradiation inhibited hatching and induced developmental toxicity in a dose-dependent manner. Interestingly, after irradiation the malformation rate changed not only in a dose-dependent manner but also in a developmental stage-dependent manner, indicating that the zebrafish embryos at stage 1 were more sensitive to gamma rays than those at other stages. Biochemical analysis showed that gamma irradiation modulated the activities of antioxidant enzymes in a dose-dependent manner. A linear relationship was found between GPx activity and irradiation dose in 0.1-1 Gy group, and GPx was a suitable biomarker for gamma irradiation in the dose range from 0.1 to 1 Gy. Furthermore, the activities of SOD, CAT, GR and GPx of the zebrafish embryos at stage 3 were found to be much higher than those at other stages, indicating that the zebrafish embryos at stage 3 had a greater ability to protect against gamma rays than those at other stages, and thus the activities of antioxidant enzymes changed in a developmental stage-dependent manner.

  7. Developmental toxicity and oxidative stress induced by gamma irradiation in zebrafish embryos

    International Nuclear Information System (INIS)

    Hu, Miao; Hu, Nan; Ding, Dexin; Zhao, Weichao; Feng, Yongfu; Zhang, Hui; Li, Guangyue; Wang, Yongdong

    2016-01-01

    This study aimed to evaluate the biological effects of gamma irradiation on zebrafish embryos. Different doses of gamma rays (0.01, 0.05, 0.1, 0.5 and 1 Gy) were used to irradiate zebrafish embryos at three developmental stages (stage 1, 6 h post-fertilization (hpf); stage 2, 12 hpf; stage three, 24 hpf), respectively. The survival, malformation and hatching rates of the zebrafish embryos were measured at the morphological endpoint of 96 hpf. The activities of superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx) and glutathione S-transferase (GST) were assayed. Morphology analysis showed that gamma irradiation inhibited hatching and induced developmental toxicity in a dose-dependent manner. Interestingly, after irradiation the malformation rate changed not only in a dose-dependent manner but also in a developmental stage-dependent manner, indicating that the zebrafish embryos at stage 1 were more sensitive to gamma rays than those at other stages. Biochemical analysis showed that gamma irradiation modulated the activities of antioxidant enzymes in a dose-dependent manner. A linear relationship was found between GPx activity and irradiation dose in 0.1-1 Gy group, and GPx was a suitable biomarker for gamma irradiation in the dose range from 0.1 to 1 Gy. Furthermore, the activities of SOD, CAT, GR and GPx of the zebrafish embryos at stage 3 were found to be much higher than those at other stages, indicating that the zebrafish embryos at stage 3 had a greater ability to protect against gamma rays than those at other stages, and thus the activities of antioxidant enzymes changed in a developmental stage-dependent manner. (orig.)

  8. Developmental toxicity and oxidative stress induced by gamma irradiation in zebrafish embryos

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Miao; Hu, Nan; Ding, Dexin; Zhao, Weichao; Feng, Yongfu; Zhang, Hui; Li, Guangyue; Wang, Yongdong [University of South China, Key Discipline Laboratory for National Defense for Biotechnology in Uranium Mining and Hydrometallurgy, Hengyang, Hunan Province (China)

    2016-11-15

    This study aimed to evaluate the biological effects of gamma irradiation on zebrafish embryos. Different doses of gamma rays (0.01, 0.05, 0.1, 0.5 and 1 Gy) were used to irradiate zebrafish embryos at three developmental stages (stage 1, 6 h post-fertilization (hpf); stage 2, 12 hpf; stage three, 24 hpf), respectively. The survival, malformation and hatching rates of the zebrafish embryos were measured at the morphological endpoint of 96 hpf. The activities of superoxide dismutase (SOD), catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx) and glutathione S-transferase (GST) were assayed. Morphology analysis showed that gamma irradiation inhibited hatching and induced developmental toxicity in a dose-dependent manner. Interestingly, after irradiation the malformation rate changed not only in a dose-dependent manner but also in a developmental stage-dependent manner, indicating that the zebrafish embryos at stage 1 were more sensitive to gamma rays than those at other stages. Biochemical analysis showed that gamma irradiation modulated the activities of antioxidant enzymes in a dose-dependent manner. A linear relationship was found between GPx activity and irradiation dose in 0.1-1 Gy group, and GPx was a suitable biomarker for gamma irradiation in the dose range from 0.1 to 1 Gy. Furthermore, the activities of SOD, CAT, GR and GPx of the zebrafish embryos at stage 3 were found to be much higher than those at other stages, indicating that the zebrafish embryos at stage 3 had a greater ability to protect against gamma rays than those at other stages, and thus the activities of antioxidant enzymes changed in a developmental stage-dependent manner. (orig.)

  9. Study on Flow-Shifted Region Depending on Spool Displacement in Hydraulic Servo Valve with Hybrid Lap

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Hwanghun; Yun, Sonam; Lee, Sungsoo [Korea Institute of Machinery and Materials, Daejeon (Korea, Republic of); Yang, Jooho [Pukyong Nat' l Univ., Busan (Korea, Republic of)

    2013-03-15

    This study examined the static characteristics of a spool valve with a hybrid lap between the spool land and the sleeve. The static equation for the pressure characteristics was derived from flow equations that depend on the spool displacement, and the final model was derived from q{sub a}=q{sub b}=0 because the pressure characteristics test needs to block the control port in the valve. The static equation for the flow characteristics was derived from the pressure characteristics when the control port is open (q{sub a}=q{sub b}, p{sub a}=p{sub b}). The characteristic equation in the shifted region was assumed from the proportional relationship between the pressure-flow characteristics and the spool displacement.

  10. The Role of Shifting, Updating, and Inhibition in Prospective Memory Performance in Young and Older Adults

    Science.gov (United States)

    Schnitzspahn, Katharina M.; Stahl, Christoph; Zeintl, Melanie; Kaller, Christoph P.; Kliegel, Matthias

    2013-01-01

    Prospective memory performance shows a decline in late adulthood. The present article examines the role of 3 main executive function facets (i.e., shifting, updating, and inhibition) as possible developmental mechanisms associated with these age effects. One hundred seventy-five young and 110 older adults performed a battery of cognitive tests…

  11. Lateral shifting in one dimensional chiral photonic crystal

    Energy Technology Data Exchange (ETDEWEB)

    You Yuan, E-mail: yctcyouyuan@163.com [School of Physics and Electronics, Yancheng Teachers University, Yancheng, 224002 Jiangsu (China); Chen Changyuan [School of Physics and Electronics, Yancheng Teachers University, Yancheng, 224002 Jiangsu (China)

    2012-07-01

    We report the lateral shifts of the transmitted waves in a one dimensional chiral photonic crystal by using the stationary-phase approach. It is revealed that two kinds of lateral shifts are observed due to the existence of cross coupling in chiral materials, which is different from what has been observed in previous non-chiral photonic crystals. Unlike the chiral slab, the positions of lateral shift peaks are closely related to the band edges of band gap characteristics of periodic structure and lateral shifts can be positive as well as negative. Besides, the lateral shifts show a strong dependence on the chiral factor, which varies the lateral shift peaks in both magnitudes and positions. These features are desirable for future device applications.

  12. Lateral shifting in one dimensional chiral photonic crystal

    International Nuclear Information System (INIS)

    You Yuan; Chen Changyuan

    2012-01-01

    We report the lateral shifts of the transmitted waves in a one dimensional chiral photonic crystal by using the stationary-phase approach. It is revealed that two kinds of lateral shifts are observed due to the existence of cross coupling in chiral materials, which is different from what has been observed in previous non-chiral photonic crystals. Unlike the chiral slab, the positions of lateral shift peaks are closely related to the band edges of band gap characteristics of periodic structure and lateral shifts can be positive as well as negative. Besides, the lateral shifts show a strong dependence on the chiral factor, which varies the lateral shift peaks in both magnitudes and positions. These features are desirable for future device applications.

  13. Developmental immunotoxicology of lead

    International Nuclear Information System (INIS)

    Dietert, Rodney R.; Lee, Ji-Eun; Hussain, Irshad; Piepenbrink, Michael

    2004-01-01

    The heavy metal, lead, is a known developmental immunotoxicant that has been shown to produce immune alterations in humans as well as other species. Unlike many compounds that exert adverse immune effects, lead exposure at low to moderate levels does not produce widespread loss of immune cells. In contrast, changes resulting from lead exposure are subtle at the immune cell population level but, nevertheless, can be functionally dramatic. A hallmark of lead-induced immunotoxicity is a pronounced shift in the balance in T helper cell function toward T helper 2 responses at the expense of T helper 1 functions. This bias alters the nature and range of immune responses that can be produced thereby influencing host susceptibility to various diseases. Immunotoxic responses to lead appear to differ across life stages not only quantitatively with regard to dose response, but also qualitatively in terms of the spectrum of immune alterations. Experimental studies in several lab animal species suggest the latter stages of gestation are a period of considerable sensitivity for lead-induced immunotoxicity. This review describes the basic characteristics of lead-induced immunotoxicity emphasizing experimental animal results. It also provides a framework for the consideration of toxicant exposure effects across life stages. The existence of and probable basis for developmental windows of immune hyper-susceptibility are presented. Finally, the potential for lead to serve as a perinatal risk factor for childhood asthma as well as other diseases is considered

  14. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Directory of Open Access Journals (Sweden)

    Svetlana Postnova

    Full Text Available Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8 in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  15. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Science.gov (United States)

    Postnova, Svetlana; Robinson, Peter A; Postnov, Dmitry D

    2013-01-01

    Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8) in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  16. Decisions Concerning Directional Dependence

    Science.gov (United States)

    von Eye, Alexander; DeShon, Richard P.

    2012-01-01

    In this rejoinder, von Eye and DeShon discuss the decision strategies proposed in their original article ("Directional Dependence in Developmental Research," this issue), as well as the ones proposed by the authors of the commentary (Pornprasertmanit and Little, "Determining Directional Dependency in Causal Associations," this issue). In addition,…

  17. Cryptic Genetic Variation in Evolutionary Developmental Genetics

    Directory of Open Access Journals (Sweden)

    Annalise B. Paaby

    2016-06-01

    Full Text Available Evolutionary developmental genetics has traditionally been conducted by two groups: Molecular evolutionists who emphasize divergence between species or higher taxa, and quantitative geneticists who study variation within species. Neither approach really comes to grips with the complexities of evolutionary transitions, particularly in light of the realization from genome-wide association studies that most complex traits fit an infinitesimal architecture, being influenced by thousands of loci. This paper discusses robustness, plasticity and lability, phenomena that we argue potentiate major evolutionary changes and provide a bridge between the conceptual treatments of macro- and micro-evolution. We offer cryptic genetic variation and conditional neutrality as mechanisms by which standing genetic variation can lead to developmental system drift and, sheltered within canalized processes, may facilitate developmental transitions and the evolution of novelty. Synthesis of the two dominant perspectives will require recognition that adaptation, divergence, drift and stability all depend on similar underlying quantitative genetic processes—processes that cannot be fully observed in continuously varying visible traits.

  18. Role of excited state solvent fluctuations on time-dependent fluorescence Stokes shift

    Energy Technology Data Exchange (ETDEWEB)

    Li, Tanping, E-mail: tanping@lsu.edu, E-mail: revatik@lsu.edu; Kumar, Revati, E-mail: tanping@lsu.edu, E-mail: revatik@lsu.edu [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)

    2015-11-07

    We explore the connection between the solvation dynamics of a chromophore upon photon excitation and equilibrium fluctuations of the solvent. Using molecular dynamics simulations, fluorescence Stokes shift for the tryptophan in Staphylococcus nuclease was examined using both nonequilibrium calculations and linear response theory. When the perturbed and unperturbed surfaces exhibit different solvent equilibrium fluctuations, the linear response approach on the former surface shows agreement with the nonequilibrium process. This agreement is excellent when the perturbed surface exhibits Gaussian statistics and qualitative in the case of an isomerization induced non-Gaussian statistics. However, the linear response theory on the unperturbed surface breaks down even in the presence of Gaussian fluctuations. Experiments also provide evidence of the connection between the excited state solvent fluctuations and the total fluorescence shift. These observations indicate that the equilibrium statistics on the excited state surface characterize the relaxation dynamics of the fluorescence Stokes shift. Our studies specifically analyze the Gaussian fluctuations of the solvent in the complex protein environment and further confirm the role of solvent fluctuations on the excited state surface. The results are consistent with previous investigations, found in the literature, of solutes dissolved in liquids.

  19. Position-dependent energy-level shifts of an accelerated atom in the presence of a boundary

    International Nuclear Information System (INIS)

    Zhu Zhiying; Yu Hongwei

    2010-01-01

    We consider a uniformly accelerated atom interacting with a vacuum electromagnetic field in the presence of an infinite conducting plane boundary and calculate separately the contributions of vacuum fluctuations and radiation reaction to the atomic energy-level shift. We analyze in detail the behavior of the total energy shift in three different regimes of the distance in both the low-acceleration and high-acceleration limits. Our results show that, in general, an accelerated atom does not behave as if immersed in a thermal bath at the Unruh temperature in terms of the atomic energy-level shifts, and the effect of the acceleration on the atomic energy-level shifts may in principle become appreciable in certain circumstances, although it may not be realistic for actual experimental measurements. We also examine the effects of the acceleration on the level shifts when the acceleration is of the order of the transition frequency of the atom and we find some features which differ from what was obtained in the existing literature.

  20. Reverse engineering development: Crosstalk opportunities between developmental biology and tissue engineering.

    Science.gov (United States)

    Marcucio, Ralph S; Qin, Ling; Alsberg, Eben; Boerckel, Joel D

    2017-11-01

    The fields of developmental biology and tissue engineering have been revolutionized in recent years by technological advancements, expanded understanding, and biomaterials design, leading to the emerging paradigm of "developmental" or "biomimetic" tissue engineering. While developmental biology and tissue engineering have long overlapping histories, the fields have largely diverged in recent years at the same time that crosstalk opportunities for mutual benefit are more salient than ever. In this perspective article, we will use musculoskeletal development and tissue engineering as a platform on which to discuss these emerging crosstalk opportunities and will present our opinions on the bright future of these overlapping spheres of influence. The multicellular programs that control musculoskeletal development are rapidly becoming clarified, represented by shifting paradigms in our understanding of cellular function, identity, and lineage specification during development. Simultaneously, advancements in bioartificial matrices that replicate the biochemical, microstructural, and mechanical properties of developing tissues present new tools and approaches for recapitulating development in tissue engineering. Here, we introduce concepts and experimental approaches in musculoskeletal developmental biology and biomaterials design and discuss applications in tissue engineering as well as opportunities for tissue engineering approaches to inform our understanding of fundamental biology. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:2356-2368, 2017. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  1. Emotional bias of sleep-dependent processing shifts from negative to positive with aging.

    Science.gov (United States)

    Jones, Bethany J; Schultz, Kurt S; Adams, Sydney; Baran, Bengi; Spencer, Rebecca M C

    2016-09-01

    Age-related memory decline has been proposed to result partially from impairments in memory consolidation over sleep. However, such decline may reflect a shift toward selective processing of positive information with age rather than impaired sleep-related mechanisms. In the present study, young and older adults viewed negative and neutral pictures or positive and neutral pictures and underwent a recognition test after sleep or wake. Subjective emotional reactivity and affect were also measured. Compared with waking, sleep preserved valence ratings and memory for positive but not negative pictures in older adults and negative but not positive pictures in young adults. In older adults, memory for positive pictures was associated with slow wave sleep. Furthermore, slow wave sleep predicted positive affect in older adults but was inversely related to positive affect in young adults. These relationships were strongest for older adults with high memory for positive pictures and young adults with high memory for negative pictures. Collectively, these results indicate preserved but selective sleep-dependent memory processing with healthy aging that may be biased to enhance emotional well-being. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Studies of the pH dependence of 13C shifts and carbon-carbon coupling constants of [U-13C]aspartic and -glutamic acids

    International Nuclear Information System (INIS)

    London, R.E.; Walker, T.E.; Kollman, V.H.; Matwiyoff, N.A.

    1978-01-01

    13 C NMR studies of the chemical shifts and carbon--carbon spin--spin coupling constants of 90% [U- 13 C]aspartic and -glutamic acids are reported. Effects of titration of the two carboxyl groups are separated computationally and the results compared with those for asparagine and glutamine, aspartate and glutamate containing peptides, and a series of amino-n-butyric acids. The results indicate that the carboxyl carbon shift resulting from titration of the carboxyl group is strongly dependent on its distance (number of bonds) from an amino group. Alternatively, remote methyl groups exhibit a much smaller titration induced shift than carboxyl groups in the corresponding position. Significant remote effects of pH titration on the one-bond carbon-carbon coupling are also observed, particularly for couplings involving the side-chain carboxyl carbons. These results are discussed in terms of polarization of the C--O bonds in response to titration of a remote carboxyl group. Values of 3 J/sub CC/ in asparate and glutamate indicate a strong conformational dependence. Rotamer populations predicted on the basis of the observed couplings and theoretical INDO calculations are in good agreement with values based on analysis of the 3 J/sub HH/ and 3 J/sub CH/ couplings. For a given conformation of glutamic acid, it is found that 3 J 14 is considerably smaller than 3 J 25 . This result is consistent with obsrvations on a number of other 13 C-labeled amino acids. 5 figures, 4 tables

  3. Fetal functional brain age assessed from universal developmental indices obtained from neuro-vegetative activity patterns.

    Directory of Open Access Journals (Sweden)

    Dirk Hoyer

    Full Text Available Fetal brain development involves the development of the neuro-vegetative (autonomic control that is mediated by the autonomic nervous system (ANS. Disturbances of the fetal brain development have implications for diseases in later postnatal life. In that context, the fetal functional brain age can be altered. Universal principles of developmental biology applied to patterns of autonomic control may allow a functional age assessment. The work aims at the development of a fetal autonomic brain age score (fABAS based on heart rate patterns. We analysed n = 113 recordings in quiet sleep, n = 286 in active sleep, and n = 29 in active awakeness from normals. We estimated fABAS from magnetocardiographic recordings (21.4-40.3 weeks of gestation preclassified in quiet sleep (n = 113, 63 females and active sleep (n = 286, 145 females state by cross-validated multivariate linear regression models in a cross-sectional study. According to universal system developmental principles, we included indices that address increasing fluctuation range, increasing complexity, and pattern formation (skewness, power spectral ratio VLF/LF, pNN5. The resulting models constituted fABAS. fABAS explained 66/63% (coefficient of determination R(2 of training and validation set of the variance by age in quiet, while 51/50% in active sleep. By means of a logistic regression model using fluctuation range and fetal age, quiet and active sleep were automatically reclassified (94.3/93.1% correct classifications. We did not find relevant gender differences. We conclude that functional brain age can be assessed based on universal developmental indices obtained from autonomic control patterns. fABAS reflect normal complex functional brain maturation. The presented normative data are supplemented by an explorative study of 19 fetuses compromised by intrauterine growth restriction. We observed a shift in the state distribution towards active awakeness. The lower WGA

  4. Present and future of developmental neuropsychopharmacology.

    Science.gov (United States)

    Arango, Celso

    2015-05-01

    The field of child and adolescent psychiatry has always lagged behind adult psychiatry. With recent evidence that the vast majority of mental disorders, even when they emerge in adulthood, cause abnormal neurodevelopment and resultant emphasis on prevention and early intervention, there is a need to put child psychiatry at the top of the agenda in mental health research. This should also be the case for developmental neuropsychopharmacology. The target of drug discovery should shift toward a population younger than the one that is typically included in clinical trials. This is not only a matter of trying to replicate what has been found in individuals with mature brains; it is about searching for new strategies that address developing brains while the therapeutic window for their effect is still open. At present, major concerns in developmental psychopharmacology are over-prescription rates and use of psychotropic medications for conditions with a particularly underdeveloped evidence base, as well as adverse effects, especially potentially life-shortening cardiometabolic effects and suicidal ideation. The future of research in this area should focus on the use of drugs for primary and secondary prevention that would modify abnormal brain development. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

  5. Participant Direction for People with Intellectual and Developmental Disabilities in Medicaid Home and Community Based Services Waivers

    Science.gov (United States)

    Friedman, Carli

    2018-01-01

    Participant direction allows people with intellectual and developmental disabilities (IDD) and/or their families to direct services; in doing so, participant direction shifts participants from passive recipients to active consumers. Medicaid encourages, but does not require, states to allow participant direction. The aim of this study was to…

  6. Dual Processes in Decision Making and Developmental Neuroscience: A Fuzzy-Trace Model.

    Science.gov (United States)

    Reyna, Valerie F; Brainerd, Charles J

    2011-09-01

    From Piaget to the present, traditional and dual-process theories have predicted improvement in reasoning from childhood to adulthood, and improvement has been observed. However, developmental reversals-that reasoning biases emerge with development -have also been observed in a growing list of paradigms. We explain how fuzzy-trace theory predicts both improvement and developmental reversals in reasoning and decision making. Drawing on research on logical and quantitative reasoning, as well as on risky decision making in the laboratory and in life, we illustrate how the same small set of theoretical principles apply to typical neurodevelopment, encompassing childhood, adolescence, and adulthood, and to neurological conditions such as autism and Alzheimer's disease. For example, framing effects-that risk preferences shift when the same decisions are phrases in terms of gains versus losses-emerge in early adolescence as gist-based intuition develops. In autistic individuals, who rely less on gist-based intuition and more on verbatim-based analysis, framing biases are attenuated (i.e., they outperform typically developing control subjects). In adults, simple manipulations based on fuzzy-trace theory can make framing effects appear and disappear depending on whether gist-based intuition or verbatim-based analysis is induced. These theoretical principles are summarized and integrated in a new mathematical model that specifies how dual modes of reasoning combine to produce predictable variability in performance. In particular, we show how the most popular and extensively studied model of decision making-prospect theory-can be derived from fuzzy-trace theory by combining analytical (verbatim-based) and intuitive (gist-based) processes.

  7. Dual Processes in Decision Making and Developmental Neuroscience: A Fuzzy-Trace Model

    Science.gov (United States)

    Reyna, Valerie F.; Brainerd, Charles J.

    2011-01-01

    From Piaget to the present, traditional and dual-process theories have predicted improvement in reasoning from childhood to adulthood, and improvement has been observed. However, developmental reversals—that reasoning biases emerge with development —have also been observed in a growing list of paradigms. We explain how fuzzy-trace theory predicts both improvement and developmental reversals in reasoning and decision making. Drawing on research on logical and quantitative reasoning, as well as on risky decision making in the laboratory and in life, we illustrate how the same small set of theoretical principles apply to typical neurodevelopment, encompassing childhood, adolescence, and adulthood, and to neurological conditions such as autism and Alzheimer's disease. For example, framing effects—that risk preferences shift when the same decisions are phrases in terms of gains versus losses—emerge in early adolescence as gist-based intuition develops. In autistic individuals, who rely less on gist-based intuition and more on verbatim-based analysis, framing biases are attenuated (i.e., they outperform typically developing control subjects). In adults, simple manipulations based on fuzzy-trace theory can make framing effects appear and disappear depending on whether gist-based intuition or verbatim-based analysis is induced. These theoretical principles are summarized and integrated in a new mathematical model that specifies how dual modes of reasoning combine to produce predictable variability in performance. In particular, we show how the most popular and extensively studied model of decision making—prospect theory—can be derived from fuzzy-trace theory by combining analytical (verbatim-based) and intuitive (gist-based) processes. PMID:22096268

  8. Positional shifting of HRCT findings in patients with pulmonary edema

    International Nuclear Information System (INIS)

    Kim, Young Sun; Choi, Yo Won; Jeon, Seok Chol; Park, Choong Ki; Seo, Heung Suk; Lee, Seung Rho; Hahm, Chang Kok

    2001-01-01

    To assess the value of positional shifting to a gravity-dependent area, as revealed by HRCT, in differentiating pulmonary edema (PE) from other conditions. Sixteen consecutive patients in whom plain radiographs suggested the presence of pulmonary edema but the clinical findings were indefinite underwent HRCT of the lung. For initial scanning they were in the supine position, and then in the prone position. Findings of ground-glass opacity, interlobular septal thickening and peribronchovascular interistitial thickening were analyzed in terms of the presence and degree of shifting to a gravity-dependent area, a grade of high, intermediate or low being assigned. PE was diagnosed in 8 of 16 cases, the remainder being designated as non-pulmonary edema (NPE). Ground-glass opacity was observed in all 16, while the degree of positional shifting was found to be high in ten (PE:NPE=6:4), intermediate in four (PE:NPE=2:2), and low in two (PE:NPE=0:2). There was no significant difference between the two groups (ρ > 0.05). Interlobular septal thickening was observed in all but two NPE cases; the degree of shifting was high in six (PE:NPE=6:0), intermediate in one (PE), and low in seven (PE:NPE=1:6). Shifting was significantly more prominent in PE than in NPE case (ρ <0.05). Peribronchovascular interstitial thickening was positive in all PE cases and one NPE case, with no positional shifting. Positional shifting of interlobular septal thickening to a gravity-dependent area, as demonstrated by HRCT, is the most specific indicator of pulmonary edema

  9. Complexity in pH-Dependent Ribozyme Kinetics: Dark pKa Shifts and Wavy Rate-pH Profiles.

    Science.gov (United States)

    Frankel, Erica A; Bevilacqua, Philip C

    2018-02-06

    Charged bases occur in RNA enzymes, or ribozymes, where they play key roles in catalysis. Cationic bases donate protons and perform electrostatic catalysis, while anionic bases accept protons. We previously published simulations of rate-pH profiles for ribozymes in terms of species plots for the general acid and general base that have been useful for understanding how ribozymes respond to pH. In that study, we did not consider interaction between the general acid and general base or interaction with other species on the RNA. Since that report, diverse small ribozyme classes have been discovered, many of which have charged nucleobases or metal ions in the active site that can either directly interact and participate in catalysis or indirectly interact as "influencers". Herein, we simulate experimental rate-pH profiles in terms of species plots in which reverse protonated charged nucleobases interact. These analyses uncover two surprising features of pH-dependent enzyme kinetics. (1) Cooperativity between the general acid and general base enhances population of the functional forms of a ribozyme and manifests itself as hidden or "dark" pK a shifts, real pK a shifts that accelerate the reaction but are not readily observed by standard experimental approaches, and (2) influencers favorably shift the pK a s of proton-transferring nucleobases and manifest themselves as "wavy" rate-pH profiles. We identify parallels with the protein enzyme literature, including reverse protonation and wavelike behavior, while pointing out that RNA is more prone to reverse protonation. The complexities uncovered, which arise from simple pairwise interactions, should aid deconvolution of complex rate-pH profiles for RNA and protein enzymes and suggest veiled catalytic devices for promoting catalysis that can be tested by experiment and calculation.

  10. Proton Chemical Shift Imaging of the Brain in Pediatric and Adult Developmental Stuttering.

    Science.gov (United States)

    O'Neill, Joseph; Dong, Zhengchao; Bansal, Ravi; Ivanov, Iliyan; Hao, Xuejun; Desai, Jay; Pozzi, Elena; Peterson, Bradley S

    2017-01-01

    Developmental stuttering is a neuropsychiatric condition of incompletely understood brain origin. Our recent functional magnetic resonance imaging study indicates a possible partial basis of stuttering in circuits enacting self-regulation of motor activity, attention, and emotion. To further characterize the neurophysiology of stuttering through in vivo assay of neurometabolites in suspect brain regions. Proton chemical shift imaging of the brain was performed in a case-control study of children and adults with and without stuttering. Recruitment, assessment, and magnetic resonance imaging were performed in an academic research setting. Ratios of N-acetyl-aspartate plus N-acetyl-aspartyl-glutamate (NAA) to creatine (Cr) and choline compounds (Cho) to Cr in widespread cerebral cortical, white matter, and subcortical regions were analyzed using region of interest and data-driven voxel-based approaches. Forty-seven children and adolescents aged 5 to 17 years (22 with stuttering and 25 without) and 47 adults aged 21 to 51 years (20 with stuttering and 27 without) were recruited between June 2008 and March 2013. The mean (SD) ages of those in the stuttering and control groups were 12.2 (4.2) years and 13.4 (3.2) years, respectively, for the pediatric cohort and 31.4 (7.5) years and 30.5 (9.9) years, respectively, for the adult cohort. Region of interest-based findings included lower group mean NAA:Cr ratio in stuttering than nonstuttering participants in the right inferior frontal cortex (-7.3%; P = .02), inferior frontal white matter (-11.4%; P < .001), and caudate (-10.6%; P = .04), while the Cho:Cr ratio was higher in the bilateral superior temporal cortex (left: +10.0%; P = .03 and right: +10.8%; P = .01), superior temporal white matter (left: +14.6%; P = .003 and right: +9.5%; P = .02), and thalamus (left: +11.6%; P = .002 and right: +11.1%; P = .001). False discovery rate-corrected voxel-based findings were highly consistent

  11. Systematic study of the focal shift effect in planar plasmonic slit lenses

    International Nuclear Information System (INIS)

    Hu Bin; Wang Qijie; Zhang Ying

    2012-01-01

    In this paper, we systematically studied the focal shift effect in planar plasmonic slit lenses. Through theoretical derivations and numerical simulations, we found that there is a focal length shift between the traditional design model and the finite-difference time-domain simulations. The shift is not only dependent on the Fresnel number (FN) of the lens, like traditional dielectric lenses, determined by the lens width and the designed focal length, but also on the surface plasmon polariton (SPPs) interaction on the lens surfaces, dependent on the slit numbers. We also found that the FN-induced focal shift is predominant when FN 1. An approximated theoretical model is presented to estimate the focal shift of plasmonic slit lens with FN < 1. (paper)

  12. On the energy shift the ECC cusp. Does the shift really exist?

    International Nuclear Information System (INIS)

    Sarkadi, L.; Barrachina, R.O.

    2004-01-01

    The cusplike 'electron capture to the continuum' (ECC) peak appearing in the spectrum of the forward emitted electrons in ion-atom collisions are generally thought to be a divergence. Recently Shah et al., however, claimed that 'the ECC cusp is indeed a cusp, and not a divergence smoothed by the experiment'. These authors measured the ECC cusp for collisions of 10- and 20-keV protons with H 2 and He, and found that the peak was shifted to lower velocity than its expected position. We also carried out CTMC calculations (for the case of 20-keV protons on He) by which we demonstrated that the shift really exists but its value depends on the angular window of the electron detection. (K.A.)

  13. Asymmetrical effects of adaptation to left- and right-shifting prisms depends on pre-existing attentional biases.

    Science.gov (United States)

    Goedert, Kelly M; Leblanc, Andrew; Tsai, Sen-Wei; Barrett, Anna M

    2010-09-01

    Proposals that adaptation with left-shifting prisms induces neglect-like symptoms in normal individuals rely on a dissociation between the postadaptation performance of individuals trained with left- versus right-shifting prisms (e.g., Colent, Pisella, & Rossetti, 2000). A potential problem with this evidence is that normal young adults have an a priori leftward bias (e.g., Jewell & McCourt, 2000). In Experiment 1, we compared the line bisection performance of young adults to that of aged adults, who as a group may lack a leftward bias in line bisection. Participants trained with both left- and right-shifting prisms. Consistent with our hypothesis, while young adults demonstrated aftereffects for left, but not right prisms, aged adults demonstrated reliable aftereffects for both prisms. In Experiment 2, we recruited a larger sample of young adults, some of whom were right-biased at baseline. We observed an interaction between baseline bias and prism-shift, consistent with the results of Experiment 1: Left-biased individuals showed a reduced aftereffect when training with right-shifting prisms and right-biased individuals showed a reduced aftereffect when training with left-shifting prisms. These results suggest that previous failures to find generalizable aftereffects with right-shifting prisms may be driven by participants' baseline biases rather than specific effects of the prism itself.

  14. Developmental dyscalculia is related to visuo-spatial memory and inhibition impairment☆

    Science.gov (United States)

    Szucs, Denes; Devine, Amy; Soltesz, Fruzsina; Nobes, Alison; Gabriel, Florence

    2013-01-01

    Developmental dyscalculia is thought to be a specific impairment of mathematics ability. Currently dominant cognitive neuroscience theories of developmental dyscalculia suggest that it originates from the impairment of the magnitude representation of the human brain, residing in the intraparietal sulcus, or from impaired connections between number symbols and the magnitude representation. However, behavioral research offers several alternative theories for developmental dyscalculia and neuro-imaging also suggests that impairments in developmental dyscalculia may be linked to disruptions of other functions of the intraparietal sulcus than the magnitude representation. Strikingly, the magnitude representation theory has never been explicitly contrasted with a range of alternatives in a systematic fashion. Here we have filled this gap by directly contrasting five alternative theories (magnitude representation, working memory, inhibition, attention and spatial processing) of developmental dyscalculia in 9–10-year-old primary school children. Participants were selected from a pool of 1004 children and took part in 16 tests and nine experiments. The dominant features of developmental dyscalculia are visuo-spatial working memory, visuo-spatial short-term memory and inhibitory function (interference suppression) impairment. We hypothesize that inhibition impairment is related to the disruption of central executive memory function. Potential problems of visuo-spatial processing and attentional function in developmental dyscalculia probably depend on short-term memory/working memory and inhibition impairments. The magnitude representation theory of developmental dyscalculia was not supported. PMID:23890692

  15. Shift work disorder in nurses--assessment, prevalence and related health problems.

    Directory of Open Access Journals (Sweden)

    Elisabeth Flo

    Full Text Available BACKGROUND: This study investigates the prevalence of symptoms of shift work disorder in a sample of nurses, and its association to individual, health and work variables. METHODOLOGY/PRINCIPAL FINDINGS: We investigated three different shift work disorder assessment procedures all based on current diagnostic criteria and employing symptom based questions. Crude and adjusted logistic regression analyses were performed with symptoms of shift work disorder as the dependent variable. Participants (n = 1968 reported age, gender, work schedule, commuting time, weekly work hours, children in household, number of nights and number of shifts separated by less than 11 hours worked the last year, use of bright light therapy, melatonin and sleep medication, and completed the Bergen Insomnia Scale, Epworth Sleepiness Scale, Global Sleep Assessment Questionnaire, Diurnal Scale, Revised Circadian Type Inventory, Dispositional Resilience (Hardiness Scale--Revised, Fatigue Questionnaire, questions about alcohol and caffeine consumption, as well as the Hospital Anxiety and Depression Scale. CONCLUSIONS/SIGNIFICANCE: Prevalence rates of symptoms of shift work disorder varied from 32.4-37.6% depending on the assessment method and from 4.8-44.3% depending on the work schedule. Associations were found between symptoms of shift work disorder and age, gender, circadian type, night work, number of shifts separated by less than 11 hours and number of nights worked the last year, insomnia and anxiety. The different assessment procedures yielded similar results (prevalence and logistic regression analyses. The prevalence of symptoms indicative of shift work disorder was high. We argue that three symptom-based questions used in the present study adequately assess shift work disorder in epidemiological studies.

  16. The role of developmental plasticity and epigenetics in human health.

    Science.gov (United States)

    Gluckman, Peter D; Hanson, Mark A; Low, Felicia M

    2011-03-01

    Considerable epidemiological, experimental and clinical data have amassed showing that the risk of developing disease in later life is dependent on early life conditions, mainly operating within the normative range of developmental exposures. This relationship reflects plastic responses made by the developing organism as an evolved strategy to cope with immediate or predicted circumstances, to maximize fitness in the context of the range of environments potentially faced. There is now increasing evidence, both in animals and humans, that such developmental plasticity is mediated in part by epigenetic mechanisms. However, recognition of the importance of developmental plasticity as an important factor in influencing later life health-particularly within the medical and public health communities-is low, and we argue that this indifference cannot be sustained in light of the growing understanding of developmental processes and the rapid rise in the prevalence of obesity and metabolic disease globally. Copyright © 2011 Wiley-Liss, Inc.

  17. I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.

    Science.gov (United States)

    Card, Noel A

    2017-06-01

    This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.

  18. Developmental and Individual Differences in Pure Numerical Estimation

    Science.gov (United States)

    Booth, Julie L.; Siegler, Robert S.

    2006-01-01

    The authors examined developmental and individual differences in pure numerical estimation, the type of estimation that depends solely on knowledge of numbers. Children between kindergarten and 4th grade were asked to solve 4 types of numerical estimation problems: computational, numerosity, measurement, and number line. In Experiment 1,…

  19. Inclusion for People with Developmental Disabilities: Measuring an Elusive Construct.

    Science.gov (United States)

    Neely-Barnes, Susan Louise; Elswick, Susan E

    2016-01-01

    The philosophy of inclusion for people with intellectual and developmental disabilities (IDD) has evolved over the last 50 years. Over time, inclusion research has shifted from a focus on deinstitutionalization to understanding the extent to which individuals with IDD are meaningfully involved in the community and social relationships. Yet, there has been no agreed on way to measure inclusion. Many different measurement and data collection techniques have been used in the literature. This study proposes a brief measure of inclusion that can be used with family members and on survey instruments.

  20. Shift schedule, work-family relationships, marital communication, job satisfaction and health among transport service shift workers.

    Science.gov (United States)

    Iskra-Golec, Irena; Smith, Lawrence; Wilczek-Rużyczka, Ewa; Siemiginowska, Patrycja; Wątroba, Joanna

    2017-02-21

    Existing research has documented that shiftwork consequences may depend on the shift system parameters. Fast rotating systems (1-3 shifts of the same kind in a row) and day work have been found to be less disruptive biologically and socially than slower rotating systems and afternoon and night work. The aim of this study was to compare day workers and shift workers of different systems in terms of rotation speed and shifts worked with regard to work-family and family-work positive and negative spillover, marital communication style, job satisfaction and health. Employees (N = 168) of the maintenance workshops of transportation service working different shift systems (day shift, weekly rotating 2 and 3‑shift system, and fast rotating 3-shift system) participated in the study. They completed the Work- Family Spillover Questionnaire, Marital Communication Questionnaire, Minnesota Job Satisfaction Questionnaire and the Physical Health Questionnaire (a part of the Standard Shiftwork Index). The workers of quicker rotating 3-shift systems reported significantly higher scores of family-to-work facilitation (F(3, 165) = 4.175, p = 0.007) and a higher level of constructive style of marital communication (Engagement F(3, 165) = 2.761, p = 0.044) than the workers of slower rotating 2-shift systems. There were no differences between the groups of workers with regard to health and job satisfaction. A higher level of work-family facilitation and a more constructive style of marital communication were found among the workers of faster rotating 3-shift system when compared to the workers of a slower rotating 2-shift system (afternoon, night). This may indicate that the fast rotating shift system in contrary to the slower rotating one is more friendly for the work and family domains and for the relationship between them. Int J Occup Med Environ Health 2017;30(1):121-131. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  1. Shift schedule, work–family relationships, marital communication, job satisfaction and health among transport service shift workers

    Directory of Open Access Journals (Sweden)

    Irena Iskra-Golec

    2017-02-01

    Full Text Available Objectives: Existing research has documented that shiftwork consequences may depend on the shift system parameters. Fast rotating systems (1–3 shifts of the same kind in a row and day work have been found to be less disruptive biologically and socially than slower rotating systems and afternoon and night work. The aim of this study was to compare day workers and shift workers of different systems in terms of rotation speed and shifts worked with regard to work–family and family–work positive and negative spillover, marital communication style, job satisfaction and health. Material and Methods: Employees (N = 168 of the maintenance workshops of transportation service working different shift systems (day shift, weekly rotating 2 and 3‑shift system, and fast rotating 3-shift system participated in the study. They completed the Work– Family Spillover Questionnaire, Marital Communication Questionnaire, Minnesota Job Satisfaction Questionnaire and the Physical Health Questionnaire (a part of the Standard Shiftwork Index. Results: The workers of quicker rotating 3-shift systems reported significantly higher scores of family-to-work facilitation (F(3, 165 = 4.175, p = 0.007 and a higher level of constructive style of marital communication (Engagement F(3, 165 = 2.761, p = 0.044 than the workers of slower rotating 2-shift systems. There were no differences between the groups of workers with regard to health and job satisfaction. Conclusions: A higher level of work–family facilitation and a more constructive style of marital communication were found among the workers of faster rotating 3-shift system when compared to the workers of a slower rotating 2-shift system (afternoon, night. This may indicate that the fast rotating shift system in contrary to the slower rotating one is more friendly for the work and family domains and for the relationship between them. Int J Occup Med Environ Health 2017;30(1:121–131

  2. Developmental post-natal stress can alter the effects of pre-natal stress on the adult redox balance.

    Science.gov (United States)

    Marasco, Valeria; Spencer, Karen A; Robinson, Jane; Herzyk, Pawel; Costantini, David

    2013-09-15

    Across diverse vertebrate taxa, stressful environmental conditions during development can shape phenotypic trajectories of developing individuals, which, while adaptive in the short-term, may impair health and survival in adulthood. Regardless, the long-lasting benefits or costs of early life stress are likely to depend on the conditions experienced across differing stages of development. Here, we used the Japanese quail (Coturnix coturnix japonica) to experimentally manipulate exposure to stress hormones in developing individuals. We tested the hypothesis that interactions occurring between pre- and post-natal developmental periods can induce long-term shifts on the adult oxidant phenotype in non-breeding sexually mature individuals. We showed that early life stress can induce long-term alterations in the basal antioxidant defences. The magnitude of these effects depended upon the timing of glucocorticoid exposure and upon interactions between the pre- and post-natal stressful stimuli. We also found differences among tissues with stronger effects in the erythrocytes than in the brain in which the long-term effects of glucocorticoids on antioxidant biomarkers appeared to be region-specific. Recent experimental work has demonstrated that early life exposure to stress hormones can markedly reduce adult survival (Monaghan et al., 2012). Our results suggest that long-term shifts in basal antioxidant defences might be one of the potential mechanisms driving such accelerated ageing processes and that post-natal interventions during development may be a potential tool to shape the effects induced by pre-natally glucococorticoid-exposed phenotypes. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Integrating genetic and toxicogenomic information for determining underlying susceptibility to developmental disorders.

    Science.gov (United States)

    Robinson, Joshua F; Port, Jesse A; Yu, Xiaozhong; Faustman, Elaine M

    2010-10-01

    To understand the complex etiology of developmental disorders, an understanding of both genetic and environmental risk factors is needed. Human and rodent genetic studies have identified a multitude of gene candidates for specific developmental disorders such as neural tube defects (NTDs). With the emergence of toxicogenomic-based assessments, scientists now also have the ability to compare and understand the expression of thousands of genes simultaneously across strain, time, and exposure in developmental models. Using a systems-based approach in which we are able to evaluate information from various parts and levels of the developing organism, we propose a framework for integrating genetic information with toxicogenomic-based studies to better understand gene-environmental interactions critical for developmental disorders. This approach has allowed us to characterize candidate genes in the context of variables critical for determining susceptibility such as strain, time, and exposure. Using a combination of toxicogenomic studies and complementary bioinformatic tools, we characterize NTD candidate genes during normal development by function (gene ontology), linked phenotype (disease outcome), location, and expression (temporally and strain-dependent). In addition, we show how environmental exposures (cadmium, methylmercury) can influence expression of these genes in a strain-dependent manner. Using NTDs as an example of developmental disorder, we show how simple integration of genetic information from previous studies into the standard microarray design can enhance analysis of gene-environment interactions to better define environmental exposure-disease pathways in sensitive and resistant mouse strains. © Wiley-Liss, Inc.

  4. Positive XPS binding energy shift of supported Cu{sub N}-clusters governed by initial state effects

    Energy Technology Data Exchange (ETDEWEB)

    Peters, S.; Peredkov, S. [Technische Universität Berlin, IOAP, Strasse des 17. Juni 135, 10623 Berlin (Germany); Al-Hada, M. [Department of Physics, College of Education and Linguistics, University of Amran (Yemen); Neeb, M., E-mail: matthias.neeb@helmholtz-berlin.de [Helmholtz-Zentrum Berlin, Wilhelm-Conrad-Röntgen-Campus Adlershof, Elektronenspeicherring BESSY II, Albert-Einstein-Straße 15, 12489 Berlin (Germany); Eberhardt, W. [Technische Universität Berlin, IOAP, Strasse des 17. Juni 135, 10623 Berlin (Germany); DESY, Center for Free Electron Laser Science (CFEL), Notkestr. 85, 22607 Hamburg (Germany)

    2014-01-01

    Highlights: • Size dependent initial and final state effects of mass-selected deposited clusters. • Initial state effect dominates positive XPS shift in supported Cu-clusters. • Size dependent Coulomb correlation shift in the Auger final state of Cu cluster. • Size-dependent Auger parameter analysis. • Positive XPS shift differs from negative surface core level shift in crystalline copper. - Abstract: An initial state effect is established as origin for the positive 2p core electron binding energy shift found for Cu{sub N}-clusters supported by a thin silica layer of a p-doped Si(1 0 0) wafer. Using the concept of the Auger parameter and taking into account the usually neglected Coulomb correlation shift in the Auger final state (M{sub 4,5}M{sub 4,5}) it is shown that the initial state shift is comparable to the measured XPS shift while the final state relaxation shift contributes only marginally to the binding energy shift. The cluster results differ from the negative surface core-level shift of crystalline copper which has been explained in terms of a final state relaxation effect.

  5. Impact of Night Shift and Training Development Factors on Performance of Professional Nurses in North West Bank Governmental Hospitals

    Science.gov (United States)

    Ayed, Ahmad; Thulth, Ahida Saleem; Sayej, Sumaya

    2015-01-01

    Background: Organizational factors are considered to be the cornerstone in achieving psychological and professional security at work, which in turn are positively reflected in job performance both quantitatively and qualitatively. Aim of the Study: The study aimed to assess night shift and education/training developmental factors on performance of…

  6. The Knight shift in liquid gallium confined within porous glasses and opals

    International Nuclear Information System (INIS)

    Charnaya, E V; Michel, D; Tien, C; Kumzerov, Yu A; Yaskov, D

    2003-01-01

    71 Ga nuclear magnetic resonance studies were carried out for liquid gallium embedded into porous glasses with different pore sizes and into artificial opals within the temperature range from about 320 K to complete confined gallium freezing. A general decrease in the Knight shift compared to the bulk melt depending on pore sizes was observed in contrast to theoretical predictions. Correlations between alterations in the Knight shift and pore sizes were established for particular pore geometry. It was also observed that confined geometry affects the temperature dependence of the Knight shift in liquid gallium

  7. Gender differences in developmental dyscalculia depend on diagnostic criteria.

    Science.gov (United States)

    Devine, Amy; Soltész, Fruzsina; Nobes, Alison; Goswami, Usha; Szűcs, Dénes

    2013-10-01

    Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender differences. In the current study, 1004 British primary school children completed mathematics and reading assessments. The prevalence of DD and gender ratio were estimated in this sample using different criteria. When using absolute thresholds, the prevalence of DD was the same for both genders regardless of the cutoff criteria applied, however gender differences emerged when using a mathematics-reading discrepancy definition. Correlations between mathematics performance and the control measures selected to identify a specific learning difficulty affect both prevalence estimates and whether a gender difference is in fact identified. Educational implications are discussed.

  8. Developmental dyscalculia is related to visuo-spatial memory and inhibition impairment.

    Science.gov (United States)

    Szucs, Denes; Devine, Amy; Soltesz, Fruzsina; Nobes, Alison; Gabriel, Florence

    2013-01-01

    Developmental dyscalculia is thought to be a specific impairment of mathematics ability. Currently dominant cognitive neuroscience theories of developmental dyscalculia suggest that it originates from the impairment of the magnitude representation of the human brain, residing in the intraparietal sulcus, or from impaired connections between number symbols and the magnitude representation. However, behavioral research offers several alternative theories for developmental dyscalculia and neuro-imaging also suggests that impairments in developmental dyscalculia may be linked to disruptions of other functions of the intraparietal sulcus than the magnitude representation. Strikingly, the magnitude representation theory has never been explicitly contrasted with a range of alternatives in a systematic fashion. Here we have filled this gap by directly contrasting five alternative theories (magnitude representation, working memory, inhibition, attention and spatial processing) of developmental dyscalculia in 9-10-year-old primary school children. Participants were selected from a pool of 1004 children and took part in 16 tests and nine experiments. The dominant features of developmental dyscalculia are visuo-spatial working memory, visuo-spatial short-term memory and inhibitory function (interference suppression) impairment. We hypothesize that inhibition impairment is related to the disruption of central executive memory function. Potential problems of visuo-spatial processing and attentional function in developmental dyscalculia probably depend on short-term memory/working memory and inhibition impairments. The magnitude representation theory of developmental dyscalculia was not supported. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Clinical investigation of set-shifting subtypes in anorexia nervosa.

    Science.gov (United States)

    Abbate-Daga, Giovanni; Buzzichelli, Sara; Marzola, Enrica; Amianto, Federico; Fassino, Secondo

    2014-11-30

    While evidence continues to accumulate on the relevance of cognitive inflexibility in anorexia nervosa (AN), its clinical correlates remain unclear. We aimed at examining the relationship between set-shifting and clinical variables (i.e., eating psychopathology, depression, and personality) in AN. Ninety-four individuals affected by AN and 59 healthy controls (HC) were recruited. All participants were assessed using: Eating Disorders Inventory-2 (EDI-2), Temperament and Character Inventory (TCI), Beck Depression Inventory (BDI), and Wisconsin Card Sorting Test (WCST). The AN group scored worse than HCs on set-shifting. According to their neuropsychological performances, AN patients were split into two groups corresponding to poor (N=30) and intact (N=64) set-shifting subtypes. Interoceptive awareness, impulse regulation, and maturity fears on the EDI-2 and depression on the BDI differed across all groups (HC, intact, and poor set-shifting subtype). Self-directedness on the TCI differed significantly among all groups. Cooperativeness and reward dependence differed instead only between HC and AN poor set-shifting subtype. After controlling for depression, only interoceptive awareness remained significant with reward dependence showing a trend towards statistical significance. These findings suggest that multiple clinical variables may be correlated with set-shifting performances in AN. The factors contributing to impaired cognitive inflexibility could be more complex than heretofore generally considered. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  10. High-speed test of SFQ-shift register files using PTL wiring

    International Nuclear Information System (INIS)

    Fujiwara, K.; Yamashiro, Y.; Yoshikawa, N.; Hashimoto, Y.; Yorozu, S.; Terai, H.; Fujimaki, A.

    2004-01-01

    We have been developing an SFQ shift register memory, which is one candidate to realize high-throughput and high-density superconductive memories. We have modified our memory architecture in order to adapt it to our SFQ microprocessor, CORE1. The new version of the shift register memory is composed of shift registers with non-destructive readout operation, which have an internal feedback. We have also studied the availability of passive transmission line (PTL) wiring in the memory system at high speed. The tested circuit is a 4-byte shift register file, where four kinds of wiring circuits are used between a decoder and shift registers. We have measured the dependences of the DC bias margin on the operating frequency for all wiring methods, and obtained almost the same dependences, which shows the availability of the PTL wiring in the memory system. We have used the NEC 2.5 kA/cm 2 Nb standard process and the CONNECT cell library

  11. Dirac equation, hydrogen atom spectrum and the Lamb shift in ...

    Indian Academy of Sciences (India)

    commutative spaces (DNCS or τ -space). Using this Hamiltonian we calculate the energy shift of the ground state as well the 2 P 1 / 2 , 2 S 1 / 2 levels. In all the cases, the energy shift depends on the dynamical non-commutative parameter τ .

  12. New SU(1,1) position-dependent effective mass coherent states for a generalized shifted harmonic oscillator

    International Nuclear Information System (INIS)

    Yahiaoui, Sid-Ahmed; Bentaiba, Mustapha

    2014-01-01

    A new SU(1,1) position-dependent effective mass coherent states (PDEM CS) related to the shifted harmonic oscillator (SHO) are deduced. This is accomplished by applying a similarity transformation to the generally deformed oscillator algebra (GDOA) generators for PDEM systems and a new set of operators that close the su(1,1) Lie algebra are constructed, being the PDEM CS of the basis for its unitary irreducible representation. From the Lie algebra generators, we evaluate the uncertainty relationship for a position and momentum-like operators in the PDEM CS and show that it is minimized in the sense of Barut–Girardello CS. We prove that the deduced PDEM CS preserve the same analytical form than those of Glauber states. As an illustration of our procedure, we depicted the 2D-probability density in the PDEM CS for SHO with the explicit form of the mass distribution with no singularities. (paper)

  13. Developmental trajectories in food allergy: a review.

    LENUS (Irish Health Repository)

    DunnGalvin, A

    2009-01-01

    Increasing recognition of the importance of the relationships between perceptions, emotions, behaviors and health has changed the way health and disease are portrayed and researched. A chronic condition may affect and\\/or interact with already existing normative demands and changes in socialization. Although the prevalence of food allergy and anaphylaxis have been reportedly increasing, the emotional and social impact of growing up with food allergy has received little emphasis. In this paper, we present current findings on the biopsychosocial impact of food allergy on children in order to gain insight into the food allergy experience, from the perspective of the child, teen, and parent living with food allergy, with particular attention to developmental aspects. Due to the scarcity of publications on the psychosocial dimensions of food allergy, we also draw on selected literature on children\\'s and parent\\'s experience of, and coping with chronic disease that may inform research into food allergy. To this end, we review some general developmental mechanisms that may underpin and explain normative age-graded shifts in patterns of coping across childhood and adolescence. We also highlight gaps in the literature and assess implications of current research in food allergy and other chronic diseases for intervention and prevention of negative short and long term outcomes.

  14. Probabilistic validation of protein NMR chemical shift assignments

    International Nuclear Information System (INIS)

    Dashti, Hesam; Tonelli, Marco; Lee, Woonghee; Westler, William M.; Cornilescu, Gabriel; Ulrich, Eldon L.; Markley, John L.

    2016-01-01

    Data validation plays an important role in ensuring the reliability and reproducibility of studies. NMR investigations of the functional properties, dynamics, chemical kinetics, and structures of proteins depend critically on the correctness of chemical shift assignments. We present a novel probabilistic method named ARECA for validating chemical shift assignments that relies on the nuclear Overhauser effect data. ARECA has been evaluated through its application to 26 case studies and has been shown to be complementary to, and usually more reliable than, approaches based on chemical shift databases. ARECA is available online at http://areca.nmrfam.wisc.edu/ http://areca.nmrfam.wisc.edu/

  15. Probabilistic validation of protein NMR chemical shift assignments

    Energy Technology Data Exchange (ETDEWEB)

    Dashti, Hesam [University of Wisconsin-Madison, Graduate Program in Biophysics, Biochemistry Department (United States); Tonelli, Marco; Lee, Woonghee; Westler, William M.; Cornilescu, Gabriel [University of Wisconsin-Madison, Biochemistry Department, National Magnetic Resonance Facility at Madison (United States); Ulrich, Eldon L. [University of Wisconsin-Madison, BioMagResBank, Biochemistry Department (United States); Markley, John L., E-mail: markley@nmrfam.wisc.edu, E-mail: jmarkley@wisc.edu [University of Wisconsin-Madison, Biochemistry Department, National Magnetic Resonance Facility at Madison (United States)

    2016-01-15

    Data validation plays an important role in ensuring the reliability and reproducibility of studies. NMR investigations of the functional properties, dynamics, chemical kinetics, and structures of proteins depend critically on the correctness of chemical shift assignments. We present a novel probabilistic method named ARECA for validating chemical shift assignments that relies on the nuclear Overhauser effect data. ARECA has been evaluated through its application to 26 case studies and has been shown to be complementary to, and usually more reliable than, approaches based on chemical shift databases. ARECA is available online at http://areca.nmrfam.wisc.edu/ http://areca.nmrfam.wisc.edu/.

  16. A taxometric investigation of developmental dyslexia subtypes.

    Science.gov (United States)

    O'Brien, Beth A; Wolf, Maryanne; Lovett, Maureen W

    2012-02-01

    Long-standing issues with the conceptualization, identification and subtyping of developmental dyslexia persist. This study takes an alternative approach to examine the heterogeneity of developmental dyslexia using taxometric classification techniques. These methods were used with a large sample of 671 children ages 6-8 who were diagnosed with severe reading disorders. Latent characteristics of the sample are assessed in regard to posited subtypes with phonological deficits and naming speed deficits, thus extending prior work by addressing whether these deficits embody separate classes of individuals. Findings support separate taxa of dyslexia with and without phonological deficits. Different latent structure for naming speed deficits was found depending on the definitional criterion used to define dyslexia. Non-phonologically based forms of dyslexia showed particular difficulty with naming speed and reading fluency. Copyright © 2012 John Wiley & Sons, Ltd.

  17. Learning To Breathe: Developmental Phase Transitions in Oxygen Status.

    Science.gov (United States)

    Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H

    2017-02-01

    Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. CHLORPYRIFOS DEVELOPMENTAL NEUROTOXICITY: INTERACTION WITH GLUCOCORTICOIDS IN PC12 CELLS

    Science.gov (United States)

    Slotkin, Theodore A.; Card, Jennifer; Seidler, Frederic J.

    2012-01-01

    Prenatal coexposures to glucocorticoids and organophosphate pesticides are widespread. Glucocorticoids are elevated by maternal stress and are commonly given in preterm labor; organophosphate exposures are virtually ubiquitous. We used PC12 cells undergoing neurodifferentiation in order to assess whether dexamethasone enhances the developmental neurotoxicity of chlorpyrifos, focusing on concentrations relevant to human exposures. By themselves, each agent reduced the number of cells and the combined exposure elicited a correspondingly greater effect than with either agent alone. There was no general cytotoxicity, as cell growth was actually enhanced, and again, the combined treatment evoked greater cellular hypertrophy than with the individual compounds. The effects on neurodifferentiation were more complex. Chlorpyrifos alone had a promotional effect on neuri to genesis whereas dexamethasone impaired it; combined treatment showed an overall impairment greater than that seen with dexamethasone alone. The effect of chlorpyrifos on differentiation into specific neurotransmitter phenotypes was shifted by dexamethasone. Either agent alone promoted differentiation into the dopaminergic phenotype at the expense of the cholinergic phenotype. However, in dexamethasone-primed cells, chlorpyrifos actually enhanced cholinergic neurodifferentiation instead of suppressing this phenotype. Our results indicate that developmental exposure to glucocorticoids, either in the context of stress or the therapy of preterm labor, could enhance the developmental neurotoxicity of organophosphates and potentially of other neurotoxicants, as well as producing neurobehavioral outcomes distinct from those seen with either individual agent. PMID:22796634

  19. Understanding and controlling chromaticity shift in LED devices

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Lynn; Mills, Karmann; Lamvik, Michael; Perkins, Curtis; Bobashev, Georgiy; Young, Joseph; Yaga, Robert; Johnson, Cortina

    2017-05-30

    Chromaticity shift in light-emitting diode (LED) devices arises from multiple mechanisms, and at least five different chromaticity shift modes (CSMs) have been identified to date. This paper focuses on the impacts of irreversible phosphor degradation as a cause of chromaticity shifts in LED devices. The nitride phosphors used to produce warm white LEDs are especially vulnerable to degradation due to thermal and chemical effects such as reactions with oxygen and water. As a result, LED devices utilizing these phosphors were found to undergo either a green shift or, less commonly, a red shift depending on the phosphor mix in the LED devices. These types of chromaticity shifts are classified as CSM-2 (green shift) and CSM-5 (red shift). This paper provides an overview of the kinetic processes responsible for green and red chromaticity shifts along with examples from accelerated stress testing of 6” downlights. Both CSMs appear to proceed through analogous mechanisms that are initiated at the surface of the phosphor. A green shift is produced by the surface oxidation of the nitride phosphor that changes the emission profile to lower wavelengths. As the surface oxidation reaction proceeds, reactant limitations slow the rate and bulk oxidation processes become more prevalent. We found that a red chromaticity shift arises from quenching of the green phosphor, also possibly due to surface reactions of oxygen, which shift the emission chromaticity in the red direction. In conclusion, we discuss the implications of these findings on projecting chromaticity.

  20. Shifting paradigm of maternal and perinatal death review system in Bangladesh: A real time approach to address sustainable developmental goal 3 by 2030 [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Animesh Biswas

    2017-07-01

    Full Text Available Recently, Bangladesh has made remarkable progress in reducing maternal and neonatal morality, even though the millennium developmental goal to reduce maternal and neonatal mortality was not achieved. Sustainable Developmental Goal (SDG 3 has already been set for a new target to reduce maternal and neonatal deaths by 2030. The country takes this timely initiative to introduce a maternal and perinatal death review system. This review will discuss the shifting paradigm of the maternal and perinatal death review system in Bangladesh and its challenges in reaching the SDG on time. This review uses existing literature on the maternal and perinatal death review system in Bangladesh, and other systems in similar settings, as well as reports, case studies, news, government letters and meeting minutes. Bangladesh introduced the maternal and perinatal death review system in 2010. Prior to this there was no such comprehensive death review system practiced in Bangladesh. The system was established within the government health system and has brought about positive effects and outcomes. Therefore, the Ministry of Health and Family Welfare of Bangladesh gradually scaled up the maternal and perinatal death review system nationwide in 2016 within the government health system. The present death review system highlighted real-time data use, using the district health information software(DHIS-2. Health mangers are able to take remedial action plans and implement strategies based on findings in DHIS-2. Therefore, effective utilization of data can play a pivotal role in the reduction of maternal and perinatal deaths in Bangladesh. Overall, the maternal and perinatal death review system provides a great opportunity to achieve the SDG 3 on time. However, the system needs continuous monitoring at different levels to ensure its quality and validity of information, as well as effective utilization of findings for planning and implementation under a measureable

  1. Opacity in compact extragalactic radio sources and the core shift effect

    International Nuclear Information System (INIS)

    Kovalev, Y Y; Lobanov, A P; Pushkarev, A B; Zensus, J A

    2008-01-01

    The apparent position of the 'core' in a parsec-scale radio jet (a compact, bright emitting region at the narrow end of the jet) depends on the observing frequency, owing to synchrotron self-absorption and external absorption. This dependency both provides a tool to probe physical conditions in the vicinity of the core and poses problems for astrometric studies using compact radio sources. We investigate the frequency-dependent shift of the positions of the cores (core shift) observed with very long baseline interferometry (VLBI) in parsec-scale jets. We present results for 29 selected active galactic nuclei (AGN). In these AGN, the magnitude of the measured core shift between 2.3 and 8.6 GHz reaches 1.4 mas, with a median value for the sample of 0.44 mas. We discuss related physics as well as astrometry applications and plans for further studies.

  2. Developmental neurotoxicity of pyrethroid insecticides in zebrafish embryos.

    Science.gov (United States)

    DeMicco, Amy; Cooper, Keith R; Richardson, Jason R; White, Lori A

    2010-01-01

    Pyrethroid insecticides are one of the most commonly used residential and agricultural insecticides. Based on the increased use of pyrethroids and recent studies showing that pregnant women and children are exposed to pyrethroids, there are concerns over the potential for developmental neurotoxicity. However, there have been relatively few studies on the developmental neurotoxicity of pyrethroids. In this study, we sought to investigate the developmental toxicity of six common pyrethroids, three type I compounds (permethrin, resmethrin, and bifenthrin) and three type II compounds (deltamethrin, cypermethrin, and lambda-cyhalothrin), and to determine whether zebrafish embryos may be an appropriate model for studying the developmental neurotoxicity of pyrethroids. Exposure of zebrafish embryos to pyrethroids caused a dose-dependent increase in mortality and pericardial edema, with type II compounds being the most potent. At doses approaching the LC(50), permethrin and deltamethrin caused craniofacial abnormalities. These findings are consistent with mammalian studies demonstrating that pyrethroids are mildly teratogenic at very high doses. However, at lower doses, body axis curvature and spasms were observed, which were reminiscent of the classic syndromes observed with pyrethroid toxicity. Treatment with diazepam ameliorated the spasms, while treatment with the sodium channel antagonist MS-222 ameliorated both spasms and body curvature, suggesting that pyrethroid-induced neurotoxicity is similar in zebrafish and mammals. Taken in concert, these data suggest that zebrafish may be an appropriate alternative model to study the mechanism(s) responsible for the developmental neurotoxicity of pyrethroid insecticides and aid in identification of compounds that should be further tested in mammalian systems.

  3. The Domain of Developmental Psychopathology.

    Science.gov (United States)

    Sroufe, L. Alan; Rutter, Michael

    1984-01-01

    Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)

  4. Life Span Developmental Approach

    Directory of Open Access Journals (Sweden)

    Ali Eryilmaz

    2011-03-01

    Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.

  5. Autonomous visual exploration creates developmental change in familiarity and novelty seeking behaviors

    Directory of Open Access Journals (Sweden)

    Sammy ePerone

    2013-09-01

    Full Text Available What motivates children to radically transform themselves during early development? We addressed this question in the domain of infant visual exploration. Over the first year, infants’ exploration shifts from familiarity to novelty seeking. This shift is delayed in preterm relative to term infants and is stable within individuals over the course of the first year. Laboratory tasks have shed light on the nature of this familiarity-to-novelty shift, but it is not clear what motivates the infant to change her exploratory style. We probed this by letting a Dynamic Neural Field (DNF model of visual exploration develop itself via accumulating experience in a virtual world. We then situated it in a canonical laboratory task. Much like infants, the model exhibited a familiarity-to-novelty shift. When we manipulated the initial conditions of the model, the model’s performance was developmentally delayed much like preterm infants. This delay was overcome by enhancing the model’s experience during development. We also found that the model’s performance was stable at the level of the individual. Our simulations indicate that novelty seeking emerges with no explicit motivational source via the accumulation of visual experience within a complex, dynamical exploratory system.

  6. Shift work and its association with metabolic disorders.

    Science.gov (United States)

    Brum, Maria Carlota Borba; Filho, Fábio Fernandes Dantas; Schnorr, Claudia Carolina; Bottega, Gustavo Borchardt; Rodrigues, Ticiana C

    2015-01-01

    Although the health burden of shift work has not been extensively studied, evidence suggests that it may affect the metabolic balance and cause obesity and other metabolic disorders. Sleep deprivation, circadian desynchronization and behavioral changes in diet and physical activity are among the most commonly mentioned factors in studies of the association between night work and metabolic disorders. Individual adaptation to night work depends greatly on personal factors such as family and social life, but occupational interventions may also make a positive contribution to the transition to shift work, such as exposure to bright lights during the night shift, melatonin use, shift regularity and clockwise rotation, and dietary adaptations for the metabolic needs of night workers. The evaluation of the impact of night work on health and of the mechanisms underlying this relationship can serve as a basis for intervention strategies to minimize the health burden of shift work. This review aimed to identify highlights regarding therapeutic implications following the association between night and shift work and metabolic disorders, as well as the mechanisms and pathways responsible for these relationships.

  7. Executive Functions in Developmental Dyslexia

    Directory of Open Access Journals (Sweden)

    Pamela eVarvara

    2014-03-01

    Full Text Available The present study was aimed at investigating different aspects of Executive Functions (EF in children with Developmental Dyslexia (DD.A neuropsychological battery tapping verbal fluency, spoonerism, attention, verbal shifting, short-term and working memory was used to assess 60 children with DD and 65 with typical reading abilities.Compared to their controls, children with DD showed deficits in several EF domains such as verbal categorical and phonological fluency, visual-spatial and auditory attention, spoonerism, verbal and visual short-term memory, and verbal working memory. Moreover, exploring predictive relationships between EF measures and reading, we found that spoonerism abilities better explained word and non-word reading deficits. Although to a lesser extent, auditory and visual-spatial attention also explained the increased percentage of variance related to reading deficit.EF deficits found in DD are interpreted as an expression of a deficient functioning of the Central Executive System and are discussed in the context of the recent temporal sampling theory.

  8. Developmental Transcriptome for a Facultatively Eusocial Bee, Megalopta genalis.

    Science.gov (United States)

    Jones, Beryl M; Wcislo, William T; Robinson, Gene E

    2015-08-14

    Transcriptomes provide excellent foundational resources for mechanistic and evolutionary analyses of complex traits. We present a developmental transcriptome for the facultatively eusocial bee Megalopta genalis, which represents a potential transition point in the evolution of eusociality. A de novo transcriptome assembly of Megalopta genalis was generated using paired-end Illumina sequencing and the Trinity assembler. Males and females of all life stages were aligned to this transcriptome for analysis of gene expression profiles throughout development. Gene Ontology analysis indicates that stage-specific genes are involved in ion transport, cell-cell signaling, and metabolism. A number of distinct biological processes are upregulated in each life stage, and transitions between life stages involve shifts in dominant functional processes, including shifts from transcriptional regulation in embryos to metabolism in larvae, and increased lipid metabolism in adults. We expect that this transcriptome will provide a useful resource for future analyses to better understand the molecular basis of the evolution of eusociality and, more generally, phenotypic plasticity. Copyright © 2015 Jones et al.

  9. Shift Colors

    Science.gov (United States)

    Publications & News Shift Colors Pages default Sign In NPC Logo Banner : Shift Colors Search Navy Personnel Command > Reference Library > Publications & News > Shift Colors Top Link Bar Navy Personnel Library Expand Reference Library Quick Launch Shift Colors Shift Colors Archives Mailing Address How to

  10. Towards Developmental Connectomics of the Human Brain

    Directory of Open Access Journals (Sweden)

    Miao eCao

    2016-03-01

    Full Text Available Imaging connectomics based on graph theory has become an effective and unique methodological framework for studying structural and functional connectivity patterns of the developing brain. Normal brain development is characterized by continuous and significant network evolution throughout infancy, childhood and adolescence, following specific maturational patterns. Disruption of these normal changes is associated with neuropsychiatric developmental disorders, such as autism spectrum disorders or attention-deficit hyperactivity disorder. In this review, we focused on the recent progresses regarding typical and atypical development of human brain networks from birth to early adulthood, using a connectomic approach. Specifically, by the time of birth, structural networks already exhibit adult-like organization, with global efficient small-world and modular structures, as well as hub regions and rich-clubs acting as communication backbones. During development, the structure networks are fine-tuned, with increased global integration and robustness and decreased local segregation, as well as the strengthening of the hubs. In parallel, functional networks undergo more dramatic changes during maturation, with both increased integration and segregation during development, as brain hubs shift from primary regions to high order functioning regions, and the organization of modules transitions from a local anatomical emphasis to a more distributed architecture. These findings suggest that structural networks develop earlier than functional networks; meanwhile functional networks demonstrate more dramatic maturational changes with the evolution of structural networks serving as the anatomical backbone. In this review, we also highlighted topologically disorganized characteristics in structural and functional brain networks in several major developmental neuropsychiatric disorders (e.g., autism spectrum disorders, attention-deficit hyperactivity disorder and

  11. Toward Developmental Connectomics of the Human Brain.

    Science.gov (United States)

    Cao, Miao; Huang, Hao; Peng, Yun; Dong, Qi; He, Yong

    2016-01-01

    Imaging connectomics based on graph theory has become an effective and unique methodological framework for studying structural and functional connectivity patterns of the developing brain. Normal brain development is characterized by continuous and significant network evolution throughout infancy, childhood, and adolescence, following specific maturational patterns. Disruption of these normal changes is associated with neuropsychiatric developmental disorders, such as autism spectrum disorders or attention-deficit hyperactivity disorder. In this review, we focused on the recent progresses regarding typical and atypical development of human brain networks from birth to early adulthood, using a connectomic approach. Specifically, by the time of birth, structural networks already exhibit adult-like organization, with global efficient small-world and modular structures, as well as hub regions and rich-clubs acting as communication backbones. During development, the structure networks are fine-tuned, with increased global integration and robustness and decreased local segregation, as well as the strengthening of the hubs. In parallel, functional networks undergo more dramatic changes during maturation, with both increased integration and segregation during development, as brain hubs shift from primary regions to high order functioning regions, and the organization of modules transitions from a local anatomical emphasis to a more distributed architecture. These findings suggest that structural networks develop earlier than functional networks; meanwhile functional networks demonstrate more dramatic maturational changes with the evolution of structural networks serving as the anatomical backbone. In this review, we also highlighted topologically disorganized characteristics in structural and functional brain networks in several major developmental neuropsychiatric disorders (e.g., autism spectrum disorders, attention-deficit hyperactivity disorder and developmental

  12. Toward Developmental Connectomics of the Human Brain

    Science.gov (United States)

    Cao, Miao; Huang, Hao; Peng, Yun; Dong, Qi; He, Yong

    2016-01-01

    Imaging connectomics based on graph theory has become an effective and unique methodological framework for studying structural and functional connectivity patterns of the developing brain. Normal brain development is characterized by continuous and significant network evolution throughout infancy, childhood, and adolescence, following specific maturational patterns. Disruption of these normal changes is associated with neuropsychiatric developmental disorders, such as autism spectrum disorders or attention-deficit hyperactivity disorder. In this review, we focused on the recent progresses regarding typical and atypical development of human brain networks from birth to early adulthood, using a connectomic approach. Specifically, by the time of birth, structural networks already exhibit adult-like organization, with global efficient small-world and modular structures, as well as hub regions and rich-clubs acting as communication backbones. During development, the structure networks are fine-tuned, with increased global integration and robustness and decreased local segregation, as well as the strengthening of the hubs. In parallel, functional networks undergo more dramatic changes during maturation, with both increased integration and segregation during development, as brain hubs shift from primary regions to high order functioning regions, and the organization of modules transitions from a local anatomical emphasis to a more distributed architecture. These findings suggest that structural networks develop earlier than functional networks; meanwhile functional networks demonstrate more dramatic maturational changes with the evolution of structural networks serving as the anatomical backbone. In this review, we also highlighted topologically disorganized characteristics in structural and functional brain networks in several major developmental neuropsychiatric disorders (e.g., autism spectrum disorders, attention-deficit hyperactivity disorder and developmental

  13. Developmental Toxicity of Dextromethorphan in Zebrafish Embryos/Larvae

    Science.gov (United States)

    Xu, Zheng; Williams, Frederick E.; Liu, Ming-Cheh

    2012-01-01

    Dextromethorphan is widely used in over-the-counter cough and cold medications. Its efficacy and safety for infants and young children remains to be clarified. The present study was designed to use the zebrafish as a model to investigate the potential toxicity of dextromethorphan during the embryonic and larval development. Three sets of zebrafish embryos/larvae were exposed to dextromethorphan at 24 hours post fertilization (hpf), 48 hpf, and 72 hpf, respectively, during the embryonic/larval development. Compared with the 48 and 72 hpf exposure sets, the embryos/larvae in the 24 hpf exposure set showed much higher mortality rates which increased in a dose-dependent manner. Bradycardia and reduced blood flow were observed for the embryos/larvae treated with increasing concentrations of dextromethorphan. Morphological effects of dextromethorphan exposure, including yolk sac and cardiac edema, craniofacial malformation, lordosis, non-inflated swim bladder, and missing gill, were also more frequent and severe among zebrafish embryos/larvae exposed to dextromethorphan at 24 hpf. Whether the more frequent and severe developmental toxicity of dextromethorphan observed among the embryos/larvae in the 24 hpf exposure set, as compared with the 48 and 72 hpf exposure sets, is due to the developmental expression of the Phase I and Phase II enzymes involved in the metabolism of dextromethorphan remains to be clarified. A reverse transcription-polymerase chain reaction (RT-PCR) analysis, nevertheless, revealed developmental stage-dependent expression of mRNAs encoding SULT3 ST1 and SULT3 ST3, two enzymes previously shown to be capable of sulfating dextrorphan, an active metabolite of dextromethorphan. PMID:20737414

  14. Bio-Psycho-Spiritual Modeling in Drug Dependents and Compiling of Intervention Program for Promotion of Resiliency Based on Cognitive Narratology and Positive Psychology

    Directory of Open Access Journals (Sweden)

    Ezat ollah Kordmirza Nikoozadeh

    2009-08-01

    Full Text Available Introduction: Since the past few decades, the concentration of researches on drug abuse and drugs dependency have shift from risk factor to protective factors. In the past two decades, the concept of resiliency was increasingly considered by developmental psychology. The concentration shifted from risk to resiliency originates from disadvantage in emphasizing on identification of risk factors. Method: Target population was all volunteer addicts who referred to clinics in Tehran city. The group selected based on random cluster sampling. In total 319 persons (male composed of two groups, dependent to drug (150 persons and independent to drug (169 persons were participated in research and in general, 108 questionnaires of non-addicts and 126 of addicts were analyzed. In order to determine the fit model based on assumed variables in the research, by utilizing LISREL softwar99e, initially the relation between primary fundamental variables and final endogenous variables were reviewed. In continuation, the - relations between intermediary and endogenous variables were determined. Results: The results showed the fitting of predicted model of resiliency. Conclusion: In this research the program based on bio-psycho-spiritual model for instructional intervention in order to enhance of resiliency of addict people provided.

  15. Effect of Developmental Stimulation Program on the Developmental Measures of Toddlers

    Directory of Open Access Journals (Sweden)

    Elahe Ghayebie

    2018-04-01

    Full Text Available Background: The variability in the developmental skills is reduced after the first three years of life; therefore, it is necessary to identify and manage early developmental delays. Aim: The aim of this study was to investigate the effect of developmental stimulation program on the developmental measures of the toddlers. Method: The present randomized controlled clinical trial was conducted on 31 toddlers aged 1-3 years residing at Ali Asghar Foster Care Center within 2016-2017. Developmental interventions were carried out based on the modified guidelines of West Virginia Early Learning Standards Framework for eight weeks (three 2-hour sessions a week. The interventions included a range of age- and developmental-specific activities described in the given guidelines. Child development age was measured based on motor dimensions (i.e., gross and fine and language development (i.e., receptive and expressive before and after the intervention. The data were analyzed in SPSS software (version 11 using independent t-test and Chi-square test. Results: The mean ages of the participants in the control and intervention groups were 19.9±5.5 and 20±6.02, respectively (P=0.62. The mean ages of receptive language development (P=0.003, expressive language development (P

  16. Insulin-like growth factor-1 protects preimplantation embryos from anti-developmental actions of menadione.

    Science.gov (United States)

    Moss, James I; Pontes, Eduardo; Hansen, Peter James

    2009-11-01

    Menadione is a naphthoquinone used as a vitamin K source in animal feed that can generate reactive oxygen species (ROS) and cause apoptosis. Here, we examined whether menadione reduces development of preimplantation bovine embryos in a ROS-dependent process and tested the hypothesis that actions of menadione would be reduced by insulin-like growth factor-1 (IGF-1). Menadione caused a concentration-dependent decrease in the proportion of embryos that became blastocysts. All concentrations tested (1, 2.5, and 5.0 microM) inhibited development. Treatment with 100 ng/ml IGF-1 reduced the magnitude of the anti-developmental effects of the two lowest menadione concentrations. Menadione also caused a concentration-dependent increase in the percent of cells positive for the TUNEL reaction. The response was lower for IGF-1-treated embryos. The effects of menadione were mediated by ROS because (1) the anti-developmental effect of menadione was blocked by the antioxidants dithiothreitol and Trolox and (2) menadione caused an increase in ROS generation. Treatment with IGF-1 did not reduce ROS formation in menadione-treated embryos. In conclusion, concentrations of menadione as low as 1.0 muM can compromise development of bovine preimplantation embryos to the blastocyst stage of development in a ROS-dependent mechanism. Anti-developmental actions of menadione can be blocked by IGF-1 through effects downstream of ROS generation.

  17. Characterization and correction of charge-induced pixel shifts in DECam

    Energy Technology Data Exchange (ETDEWEB)

    Gruen, D.; Bernstein, G. M.; Jarvis, M.; Rowe, B.; Vikram, V.; Plazas, A. A.; Seitz, S.

    2015-05-01

    Interaction of charges in CCDs with the already accumulated charge distribution causes both a flux dependence of the point-spread function (an increase of observed size with flux, also known as the brighter/fatter effect) and pixel-to-pixel correlations of the {Poissonian} noise in flat fields. We describe these effects in the Dark Energy Camera (DECam) with charge dependent shifts of effective pixel borders, i.e. the Antilogus et al. (2014) model, which we fit to measurements of flat-field {Poissonian} noise correlations. The latter fall off approximately as a power-law r(-)(2.5) with pixel separation r, are isotropic except for an asymmetry in the direct neighbors along rows and columns, are stable in time, and are weakly dependent on wavelength. They show variations from chip to chip at the 20% level that correlate with the silicon resistivity. The charge shifts predicted by the model cause biased shape measurements, primarily due to their effect on bright stars, at levels exceeding weak lensing science requirements. We measure the flux dependence of star images and show that the effect can be mitigated by applying the reverse charge shifts at the pixel level during image processing. Differences in stellar size, however, remain significant due to residuals at larger distance from the centroid.

  18. Lanthanide shift reagents, binding, shift mechanisms and exchange

    International Nuclear Information System (INIS)

    Boer, J.W.M. de

    1977-01-01

    Paramagnetic lanthanide shift reagents, when added to a solution of a substrate, induce shifts in the nuclear magnetic resonance (NMR) spectrum of the substrate molecules. The induced shifts contain information about the structure of the shift reagent substrate complex. The structural information, however, may be difficult to extract because of the following effects: (1) different complexes between shift reagent and substrate may be present in solution, e.g. 1:1 and 1:2 complexes, and the shift observed is a weighed average of the shifts of the substrate nuclei in the different complexes; (2) the Fermi contact interaction, arising from the spin density at the nucleus, contributes to the induced shift; (3) chemical exchange effects may complicate the NMR spectrum. In this thesis, the results of an investigation into the influence of these effects on the NMR spectra of solutions containing a substrate and LSR are presented. The equations describing the pseudo contact and the Fermi contact shift are derived. In addition, it is shown how the modified Bloch equations describing the effect of the chemical exchange processes occurring in the systems studied can be reduced to the familiar equations for a two-site exchange case. The binding of mono- and bifunctional ethers to the shift reagent are reported. An analysis of the induced shifts is given. Finally, the results of the experiments performed to study the exchange behavior of dimethoxyethane and heptafluorodimethyloctanedionato ligands are presented

  19. Dirac equation, hydrogen atom spectrum and the Lamb shift in ...

    Indian Academy of Sciences (India)

    2017-04-12

    Apr 12, 2017 ... Abstract. We derive the relativistic Hamiltonian of hydrogen atom in dynamical non-commutative spaces. (DNCS or τ-space). Using this Hamiltonian we calculate the energy shift of the ground state as well the 2P1/2, 2S1/2 levels. In all the cases, the energy shift depends on the dynamical non-commutative ...

  20. Cognitive shifting and externalising problem behaviour in intellectual disability and autism spectrum disorder.

    Science.gov (United States)

    Visser, E M; Berger, H J C; Van Schrojenstein Lantman-De Valk, H M J; Prins, J B; Teunisse, J P

    2015-08-01

    Behavioural problems are frequently reported in residential care for people with an intellectual disability (ID) in particular when they are additionally diagnosed with autism spectrum disorder (ASD). There are indications that impairment in cognitive shifting may be associated with problem behaviour. The objectives of this study were (1) to examine the relationship of cognitive shifting and severity of ASD symptoms with externalising problem behaviour in individuals with ID, with and without ASD, and (2) to examine whether a diagnosis based on shifting impairment is more predictive of externalising problem behaviour than an ASD diagnosis. Participants consisted of adolescents and young adults with mild ID, with and without ASD (n = 41). Pearson intercorrelations were computed to explore the relationship between shifting impairment and severity of ASD symptoms on the one hand and ratings of externalising problem behaviour on the other hand. t-Tests were performed to analyse differences in externalising problem behaviour. Unlike ASD symptom severity, shifting scores were found to be associated with externalising problem behaviour, but only if shifting was measured using rating scales and not when using neuropsychological tasks. Externalising problem behaviour scores significantly differed when groups were classified according to shifting impairment (impaired vs. non-impaired) but not when they were classified according to ID and ASD diagnoses. It is proposed to use a cognition-based approach when analysing problem behaviour, thus concentrating not so much on ID and ASD diagnosis and their corresponding symptoms, but rather placing the focus on cognitive symptoms. © 2015 MENCAP and International Association of the Scientific Study of Intellectual and Developmental Disabilities and John Wiley & Sons Ltd.

  1. Molecular mechanisms of temperature-dependent sex determination in the context of ecological developmental biology.

    Science.gov (United States)

    Matsumoto, Yuiko; Crews, David

    2012-05-06

    Temperature-dependent sex determination (TSD) is a prime example of phenotypic plasticity in that gonadal sex is determined by the temperature of the incubating egg. In the red-eared slider turtle (Trachemys scripta), the effect of temperature can be overridden by exogenous ligands, i.e., sex steroid hormones and steroid metabolism enzyme inhibitors, during the temperature-sensitive period (TSP) of development. Precisely how the physical signal of temperature is transduced into a biological signal that ultimately results in sex determination remains unknown. In this review, we discuss the sex determining pathway underlying TSD by focusing on two candidate sex determining genes, Forkhead box protein L2 (FoxL2) and Doublesex mab3- related transcription factor 1 (Dmrt1). They appear to be involved in transducing the environmental temperature signal into a biological signal that subsequently determines gonadal sex. FoxL2 and Dmrt1 exhibit gonad-typical patterns of expression in response to temperature during the TSP in the red-eared slider turtle. Further, the biologically active ligands regulate the expression of FoxL2 and Dmrt1 during development to modify gonad trajectory. The precise regulatory mechanisms of expression of these genes by temperature or exogenous ligands are not clear. However, the environment often influences developmental gene expression by altering the epigenetic status in regulatory regions. Here, we will discuss if the regulation of FoxL2 and Dmrt1 expression by environment is mediated through epigenetic mechanisms during development in species with TSD. Published by Elsevier Ireland Ltd.

  2. Tilt shift determinations with spatial-carrier phase-shift method in temporal phase-shift interferometry

    International Nuclear Information System (INIS)

    Liu, Qian; Wang, Yang; He, Jianguo; Ji, Fang; Wang, Baorui

    2014-01-01

    An algorithm is proposed to deal with tilt-shift errors in temporal phase-shift interferometry (PSI). In the algorithm, the tilt shifts are detected with the spatial-carrier phase-shift (SCPS) method and then the tilt shifts are applied as priori information to the least-squares fittings of phase retrieval. The algorithm combines the best features of the SCPS and the temporal PSI. The algorithm could be applied to interferograms of arbitrary aperture without data extrapolation for the Fourier transform is not involved. Simulations and experiments demonstrate the effectiveness of the algorithm. The statistics of simulation results show a satisfied accuracy in detecting tilt-shift errors. Comparisons of the measurements with and without environmental vibration show that the proposed algorithm could compensate tilt-shift errors and retrieve wavefront phase accurately. The algorithm provides an approach to retrieve wavefront phase for the temporal PSI in vibrating environment. (paper)

  3. Ripplonic Lamb Shift for Electrons on Liquid Helium

    Science.gov (United States)

    Dykman, M. I.; Kono, K.; Konstantinov, D.; Lea, M. J.

    2017-12-01

    We study the shift of the energy levels of electrons on a helium surface due to the coupling to the quantum field of surface vibrations. As in quantum electrodynamics, the coupling is known, and it is known to lead to an ultraviolet divergence of the level shifts. We show that there are diverging terms of different nature and use the Bethe-type approach to show that they cancel each other, to leading order. This resolves the long-standing theoretical controversy and explains the existing experiments. The results allow us to study the temperature dependence of the level shift. The predictions are in good agreement with the experimental data, with no adjustable parameters.

  4. Hydroxylated PBDEs induce developmental arrest in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu; Bruce, Erica D., E-mail: Erica_bruce@baylor.edu

    2012-07-01

    The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was not observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.

  5. Grounded in the World: Developmental Origins of the Embodied Mind

    Science.gov (United States)

    Thelen, Esther

    Piaget's question of how the adult mind emerges from the sensorimotor infant is still the framing issue for developmental psychology. Here I suggest that real-life skill is better understood if the sensorimotor origins of cognition are not abandoned. Skilled people are better at both abstract and logical thinking, but also at processing the world 'on-line' and most importantly, seamlessly and rapidly shifting between the two modes. I illustrate the tight coupling between action, perception, and cognition in early life and propose that this coupling remains, but becomes more flexibly adaptive. Furthermore, I show that the language of dynamics is appropriate to capture these mind-body-world interconnections.

  6. Development of a personal obligation to shift electricity use: Initial determinants and maintenance over time

    Energy Technology Data Exchange (ETDEWEB)

    Linz, D.; Heberlein, T.

    1984-03-01

    The present study is an attempt to determine if the beliefs which underly the formation of an obligation to shift electricity use among household consumers also contribute to maintenance of the obligation over time. Utility customer beliefs about and obligation toward shifting electricity use in their households from on-peak to off-peak times were examined in 1977, when the customers had no behavioral experience with electricity shifting. In 1979, after two years of experience with shifting appliance use from on-peak to off-peak times, customers were again surveyed and the same variables measured. The results indicated that the formation of a feeling of obligation to shift electricity in 1977 use was marginally dependent on other beliefs. By 1979, these variables were completely supplanted by the subjects' self-perception of their shifting behavior. While cognitive variables are important in the initial formation of a personal obligation to engage in shifting electricity use, the perpetuation of a feeling of obligation to shift over a period of years depends on perception of how often electricity shifting was undertaken and how much electricity had been shifted from on- to off-peak times.

  7. Building a developmental toxicity ontology.

    Science.gov (United States)

    Baker, Nancy; Boobis, Alan; Burgoon, Lyle; Carney, Edward; Currie, Richard; Fritsche, Ellen; Knudsen, Thomas; Laffont, Madeleine; Piersma, Aldert H; Poole, Alan; Schneider, Steffen; Daston, George

    2018-04-03

    As more information is generated about modes of action for developmental toxicity and more data are generated using high-throughput and high-content technologies, it is becoming necessary to organize that information. This report discussed the need for a systematic representation of knowledge about developmental toxicity (i.e., an ontology) and proposes a method to build one based on knowledge of developmental biology and mode of action/ adverse outcome pathways in developmental toxicity. This report is the result of a consensus working group developing a plan to create an ontology for developmental toxicity that spans multiple levels of biological organization. This report provide a description of some of the challenges in building a developmental toxicity ontology and outlines a proposed methodology to meet those challenges. As the ontology is built on currently available web-based resources, a review of these resources is provided. Case studies on one of the most well-understood morphogens and developmental toxicants, retinoic acid, are presented as examples of how such an ontology might be developed. This report outlines an approach to construct a developmental toxicity ontology. Such an ontology will facilitate computer-based prediction of substances likely to induce human developmental toxicity. © 2018 Wiley Periodicals, Inc.

  8. Transgenerational developmental programming.

    Science.gov (United States)

    Aiken, Catherine E; Ozanne, Susan E

    2014-01-01

    The concept of developmental programming suggests that the early life environment influences offspring characteristics in later life, including the propensity to develop diseases such as the metabolic syndrome. There is now growing evidence that the effects of developmental programming may also manifest in further generations without further suboptimal exposure. This review considers the evidence, primarily from rodent models, for effects persisting to subsequent generations, and evaluates the mechanisms by which developmental programming may be transmitted to further generations. In particular, we focus on the potential role of the intrauterine environment in contributing to a developmentally programmed phenotype in subsequent generations. The literature was systematically searched at http://pubmed.org and http://scholar.google.com to identify published findings regarding transgenerational (F2 and beyond) developmental programming effects in human populations and animal models. Transmission of programming effects is often viewed as a form of epigenetic inheritance, either via the maternal or paternal line. Evidence exists for both germline and somatic inheritance of epigenetic modifications which may be responsible for phenotypic changes in further generations. However, there is increasing evidence for the role of both extra-genomic components of the zygote and the interaction of the developing conceptus with the intrauterine environment in propagating programming effects. The contribution of a suboptimal reproductive tract environment or maternal adaptations to pregnancy may be critical to inheritance of programming effects via the maternal line. As the effects of age exacerbate the programmed metabolic phenotype, advancing maternal age may increase the likelihood of developmental programming effects being transmitted to further generations. We suggest that developmental programming effects could be propagated through the maternal line de novo in generations

  9. Lung function studies before and after a work shift

    Energy Technology Data Exchange (ETDEWEB)

    Love, R G

    1983-05-01

    The lung function of 23 underground coal workers and eight surface workers at a Scottish colliery was measured immediately before and after a work shift. Changes in lung function were assessed in relation to the measured respirable dust exposure and the time of day in which the shift was worked. Large, and statistically significant, decrements of lung function during the shift were found in night-shift workers compared with workers on other shifts. Measurements derived from the forced expiratory manoeuvre, particularly FEV1, Vmax50, and Vmax25, after three vital capacity breaths of an 80% He/20% O2 mixture, showed large reductions in night-shift men, smaller reductions in afternoon-shift men, and small increases or decreases in morning-shift underground and surface workers. Within-shift changes for other tests, such as closing volume, N2 index, and volume of isoflow, did not differ significantly between shifts. No significant relationship was found between dust exposure and functional changes during a shift for any test. Lung function changes in a control group of 25 female workers not exposed to dust (hospital nurses) did not show the same large variations between day and night shifts. Examination of a further control group of 16 office workers did not show any difference in diurnal changes between smokers and non-smokers. It is concluded that these coal miners, even on permanent shift patterns, had widely different changes in their lung function cycle depending on which shift they were working. These changes did not appear to be related to dust exposure or cigarette smoking and were not consistent with other biological adaptations known to result from regular night-shift working.

  10. Nuclear polarization shifts in light muonic atoms

    International Nuclear Information System (INIS)

    Rosenfelder, R.

    1983-01-01

    A consistent nonrelativistic expression for the energy shift in muonic atoms due to second-order processes is derived under the assumption that the muon is weakly bound. The transverse contribution is shown to be finite only if the two-photon ('seagull') amplitude is taken into account as required by gauge invariance. Numerical results are presented for muonic 12 C using a recently developed model for the nuclear response function. The total transverse contributions to the energy shift are found to be small although dependent to some extent on the detailed high-momentum behaviour of the seagull term. (orig.)

  11. Stark shift and g-factor tuning in nanowires with Rashba effect

    International Nuclear Information System (INIS)

    Alhaddad, Iman; Habanjar, Khulud; Sakr, M.R.

    2015-01-01

    We report on the Stark shift of the energy subbands and the possibility of tuning the g-factor of electrons in nanowires subjected to external magnetic field. The electric field is applied along the direction of quantum confinement. Our analysis is based on numerical and perturbation calculations in the weak Rashba regime. For in-plane magnetic fields, the Stark shift is rigid and depends on the square of the electric field. Such rigid shift results in a field independent g-factor. Perpendicular magnetic fields induce a similar Stark shift accompanied by a lateral displacement of the energy spectra that is linear in the electric field. In this case, the g-factor shows square dependence on weak electric fields that varies with the subband index. However, in strong electric fields, the g-factor becomes subband independent and varies linearly with the field. - Highlights: • Energy spectra of electrons in nanowires are calculated in the weak Rashba regime. • For in-plane magnetic field, the Stark shift is rigid and the g-factor cannot be tuned. • Perpendicular magnetic fields add lateral displacement to the Stark shift. • The g-factor can be tuned by external electric field in this case. • The tuning of the g-factor is linear and unique for all subbands at high fields

  12. Stark shift and g-factor tuning in nanowires with Rashba effect

    Energy Technology Data Exchange (ETDEWEB)

    Alhaddad, Iman; Habanjar, Khulud [Department of Physics, Faculty of Science, Beirut Arab University, P.O. Box 11, 5020 Riad El Solh, 11072809 - Beirut (Lebanon); Sakr, M.R., E-mail: msakr@alexu.edu.eg [Department of Physics, Faculty of Science, Beirut Arab University, P.O. Box 11, 5020 Riad El Solh, 11072809 - Beirut (Lebanon); Department of Physics, Faculty of Science, Alexandria University, Moharram Bek, Alexandria 21511 (Egypt)

    2015-10-15

    We report on the Stark shift of the energy subbands and the possibility of tuning the g-factor of electrons in nanowires subjected to external magnetic field. The electric field is applied along the direction of quantum confinement. Our analysis is based on numerical and perturbation calculations in the weak Rashba regime. For in-plane magnetic fields, the Stark shift is rigid and depends on the square of the electric field. Such rigid shift results in a field independent g-factor. Perpendicular magnetic fields induce a similar Stark shift accompanied by a lateral displacement of the energy spectra that is linear in the electric field. In this case, the g-factor shows square dependence on weak electric fields that varies with the subband index. However, in strong electric fields, the g-factor becomes subband independent and varies linearly with the field. - Highlights: • Energy spectra of electrons in nanowires are calculated in the weak Rashba regime. • For in-plane magnetic field, the Stark shift is rigid and the g-factor cannot be tuned. • Perpendicular magnetic fields add lateral displacement to the Stark shift. • The g-factor can be tuned by external electric field in this case. • The tuning of the g-factor is linear and unique for all subbands at high fields.

  13. Atrial natriuretic peptide regulates Ca channel in early developmental cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Lin Miao

    Full Text Available BACKGROUND: Cardiomyocytes derived from murine embryonic stem (ES cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP in regulation of membrane potentials and Ca(2+ currents has not been investigated in developmental cardiomyocytes. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the role of ANP in regulating L-type Ca(2+ channel current (I(CaL in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs in early developmental stage (EDS cardiomyocytes, embryonic bodies (EB as well as whole embryo hearts. ANP exerted an inhibitory effect on basal I(CaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS cells. However, after stimulation of I(CaL by isoproterenol (ISO in LDS cells, ANP inhibited the response in about 70% cells. The depression of I(CaL induced by ANP was not affected by either Nomega, Nitro-L-Arginine methyl ester (L-NAME, a nitric oxide synthetase (NOS inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG selective inhibitor, in either EDS and LDS cells; whereas depression of I(CaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl adenine (EHNA, a selective inhibitor of type 2 phosphodiesterase(PDE2 in most cells tested. CONCLUSION/SIGNIFICANCES: Taken together, these results indicate that ANP induced depression of action potentials and I(CaL is due to activation of particulate guanylyl cyclase (GC, cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3', 5'-cyclic monophophate (cAMP-cAMP-dependent protein kinase (PKA in early cardiomyogenesis.

  14. Stowage Planning in Multiple Ports with Shifting Fee Minimization

    Directory of Open Access Journals (Sweden)

    E. Zhang

    2018-01-01

    Full Text Available This paper studies the problem of stowage planning within a vessel bay in a multiple port transportation route, aiming at minimizing the total container shifting fee. Since the access to containers is in the top-to-bottom order for each stack, reshuffle operations occur when a target container to be unloaded at its destination port is not stowed on the top of a stack at the time. Each container shift via a quay crane induces one unit of shifting fee that depends on the charge policy of the local container port. Previous studies assume that each container shift consumes a uniform cost in all ports and thus focus on minimizing the total number of shifts or the turnaround time of the vessel. Motivated by the observation that different ports are of nonuniform fee for each container shift, we propose a mixed integer programming (MIP model for the problem to produce an optimal stowage planning with minimum total shifting fee in this work. Moreover, as the considered problem is NP-hard due to the NP-hardness of its counterpart with uniform unit shifting fee, we propose an improved genetic algorithm to solve the problem. The efficiency of the proposed algorithm is demonstrated via numerical experiments.

  15. Cell Migration Analysis: A Low-Cost Laboratory Experiment for Cell and Developmental Biology Courses Using Keratocytes from Fish Scales

    Science.gov (United States)

    Prieto, Daniel; Aparicio, Gonzalo; Sotelo-Silveira, Jose R.

    2017-01-01

    Cell and developmental processes are complex, and profoundly dependent on spatial relationships that change over time. Innovative educational or teaching strategies are always needed to foster deep comprehension of these processes and their dynamic features. However, laboratory exercises in cell and developmental biology at the undergraduate level…

  16. Generalized second-order Coulomb phase shift functions

    International Nuclear Information System (INIS)

    Rosendorff, S.

    1982-01-01

    Some specific properties and the evaluation of the generalized second-order Coulomb phase shift functions (two-dimensional integrals of four spherical cylinder functions) are discussed. The dependence on the three momenta k 1 ,k-bar,k 2 , corresponding to the final, intermediate, and initial states is illustrated

  17. Developmental Hypothyroidism Reduces the Expression of ...

    Science.gov (United States)

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

  18. Dynamic Stark shift and alignment-to-orientation conversion

    International Nuclear Information System (INIS)

    Kuntz, Matthew C.; Hilborn, Robert C.; Spencer, Alison M.

    2002-01-01

    We have observed alignment-to-orientation conversion in the (5d6p) 1 P state of atomic barium due to the combined effects of a static Zeeman shift and a dynamic Stark shift associated with the electric field of a pulsed laser beam. The measurements yield a value for the frequency-dependent tensor polarizability of the state in reasonable agreement with a simple perturbation theory calculation. With a tunable laser producing the dynamic Stark shift, we can both enhance the magnitude of the effect by tuning close to a resonance and reverse the sign of the orientation by tuning above or below the resonance. This method of producing an oriented atomic state is quite general, and with easily available field strengths can produce large orientations

  19. Enantioselective developmental toxicity and immunotoxicity of pyraclofos toward zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Shulin, E-mail: shulin@zju.edu.cn [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhejiang Provincial Key Laboratory of Organic Pollution Process and Control, Hangzhou 310058 (China); Zhang, Zhisheng [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhang, Wenjing; Bao, Lingling [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhejiang Provincial Key Laboratory of Organic Pollution Process and Control, Hangzhou 310058 (China); Xu, Chao, E-mail: chaoxu@zjut.edu.cn [Research Center of Environmental Science, College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou 310032 (China); Zhang, Hu [Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou 210021 (China)

    2015-02-15

    Highlights: • Pyraclofos has significant enantioselective aquatic toxicities to zebrafish. • Pyraclofos induces time- and concentration-dependent developmental toxicity and immunotoxicity. • The mRNA level of IL-1β gene was significantly up-regulated by pyraclofos. • Pyraclofos binds potently to IL-1β, potentially affecting IL-1β-dependent proinflammatory signal transduction. • Our in vitro and in silico studies help to understand the molecular basis for aquatic toxicity of pyraclofos. - Abstract: Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially

  20. Enantioselective developmental toxicity and immunotoxicity of pyraclofos toward zebrafish (Danio rerio)

    International Nuclear Information System (INIS)

    Zhuang, Shulin; Zhang, Zhisheng; Zhang, Wenjing; Bao, Lingling; Xu, Chao; Zhang, Hu

    2015-01-01

    Highlights: • Pyraclofos has significant enantioselective aquatic toxicities to zebrafish. • Pyraclofos induces time- and concentration-dependent developmental toxicity and immunotoxicity. • The mRNA level of IL-1β gene was significantly up-regulated by pyraclofos. • Pyraclofos binds potently to IL-1β, potentially affecting IL-1β-dependent proinflammatory signal transduction. • Our in vitro and in silico studies help to understand the molecular basis for aquatic toxicity of pyraclofos. - Abstract: Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially

  1. Night shift work at specific age ranges and chronic disease risk factors

    Science.gov (United States)

    Ramin, Cody; Devore, Elizabeth E; Wang, Weike; Pierre-Paul, Jeffrey; Wegrzyn, Lani R; Schernhammer, Eva S

    2014-01-01

    Objectives We examined the association of night shift work history and age when night shift work was performed with cancer and cardiovascular disease risk factors among 54 724 women in the Nurses' Health Study (NHS) II. Methods We calculated age-adjusted and socioeconomic status-adjusted means and percentages for cancer and cardiovascular risk factors in 2009 across categories of night shift work history. We used multivariable-adjusted logistic regression to estimate odds ratios (ORs) and 95% CIs for key risk factors among 54 724 participants (72% ever shift workers). We further examined these associations by age (20–25, 26–35, 36– 45 and 46+ years) at which shift work was performed. Results Ever night shift workers had increased odds of obesity (body mass index ≥30 kg/m2; OR=1.37, 95% CI 1.31 to 1.43); higher caffeine intake (≥131 mg/day; OR=1.16, 95% CI 1.12 to 1.22) and total calorie intake (≥1715 kcal/day; OR=1.09, 95% CI 1.04 to 1.13); current smoking (OR=1.30, 95% CI 1.19 to 1.42); and shorter sleep durations (≤7 h of sleep/day; OR=1.19, 95% CI 1.15 to 1.24) compared to never night shift workers. These estimates varied depending on age at which night work was performed, with a suggestion that night shift work before age 25 was associated with fewer risk factors compared to night shift work at older ages. Conclusions Our results indicate that night shift work may contribute to an adverse chronic disease risk profile, and that risk factors may vary depending on the age at which night shift work was performed. PMID:25261528

  2. A comparison of the efficacy of weight-shift vs. joystick control of a robotic mobility device by infants ages 5 to 10 months.

    Science.gov (United States)

    Stansfield, Sharon; Dennis, Carole; Altman, Rachel; Smith, Janelle; Larin, Hélène

    2018-01-01

    The onset of crawling in infants contributes to cognitive, perceptual, social, and emotional development. Conversely, infants with motor impairment that delays or prevents autonomous mobility often have associated developmental delays. Evidence suggests that providing mobility may have positive developmental outcomes, however powered wheelchairs may not be recommended for very young children, due to safety concerns and the child's level of cognitive maturity. The WeeBot is a mobility device controlled by infant weight shifting while seated; infants as young as 5 months have learned to use it. This study compares the efficacy of using the WeeBot vs. using the traditional manual joystick to control a robotic mobility device. Participants were 20 typically developing infants between 5 and 10 months who had not yet achieved independent mobility. A quasi-experimental two-group design was used: The first 10 participants recruited used the WeeBot (weight-shift); the next 10 used the joystick. Results showed that infants learned to use weight-shift control more easily and more skilfully than did infants using the joystick. The ability of infants to use the WeeBot suggests that an intuitive alternative control might allow very early powered mobility for children with disabilities, which might have implications for various aspects of their development.

  3. Shift work, emotional labour and psychological well-being of nursing staff

    Directory of Open Access Journals (Sweden)

    Christel Vermaak

    2017-01-01

    Full Text Available This study explored the effect of emotional labour and the psychological experience of shift work on the psychological well-being at work (PWBW of long term care nursing staff (n = 206. The ‘psychological experience of shift work’ construct defines the perception of the negative effect that working shifts has on the employees’ daily life. Correlation and multiple regression analyses were conducted. Support was found for the negative relationships between the psychological experience of shift work and PWBW, as well as the emotional labour dimension of surface acting and PWBW. A hierarchical regression analysis suggested that, when controlling for the effect of emotional labour and certain demographic variables (including number of dependents, tenure and actual shift worked, a significant amount of unique variance in PWBW, could be accounted for by the psychological experience of shift work. These results indicate that the PWBW of nursing staff is not only influenced by which shift the individual is on (i.e. day or night shift, but more so by the individuals’ psychological experience of shift work.

  4. Validation of archived chemical shifts through atomic coordinates

    Science.gov (United States)

    Rieping, Wolfgang; Vranken, Wim F

    2010-01-01

    The public archives containing protein information in the form of NMR chemical shift data at the BioMagResBank (BMRB) and of 3D structure coordinates at the Protein Data Bank are continuously expanding. The quality of the data contained in these archives, however, varies. The main issue for chemical shift values is that they are determined relative to a reference frequency. When this reference frequency is set incorrectly, all related chemical shift values are systematically offset. Such wrongly referenced chemical shift values, as well as other problems such as chemical shift values that are assigned to the wrong atom, are not easily distinguished from correct values and effectively reduce the usefulness of the archive. We describe a new method to correct and validate protein chemical shift values in relation to their 3D structure coordinates. This method classifies atoms using two parameters: the per-atom solvent accessible surface area (as calculated from the coordinates) and the secondary structure of the parent amino acid. Through the use of Gaussian statistics based on a large database of 3220 BMRB entries, we obtain per-entry chemical shift corrections as well as Z scores for the individual chemical shift values. In addition, information on the error of the correction value itself is available, and the method can retain only dependable correction values. We provide an online resource with chemical shift, atom exposure, and secondary structure information for all relevant BMRB entries (http://www.ebi.ac.uk/pdbe/nmr/vasco) and hope this data will aid the development of new chemical shift-based methods in NMR. Proteins 2010. © 2010 Wiley-Liss, Inc. PMID:20602353

  5. A Dialectical Approach to Theoretical Integration in Developmental-Contextual Identity Research

    Science.gov (United States)

    Seaman, Jayson; Sharp, Erin Hiley; Coppens, Andrew D.

    2017-01-01

    Future advances in identity research will depend on integration across major theoretical traditions. Developmental-contextualism has established essential criteria to guide this effort, including specifying the context of identity development, its timing over the life course, and its content. This article assesses 4 major traditions of identity…

  6. Solvent Effects on Oxygen-17 Chemical Shifts in Amides. Quantitative Linear Solvation Shift Relationships

    Science.gov (United States)

    Díez, Ernesto; Fabián, Jesús San; Gerothanassis, Ioannis P.; Esteban, Angel L.; Abboud, José-Luis M.; Contreras, Ruben H.; de Kowalewski, Dora G.

    1997-01-01

    A multiple-linear-regression analysis (MLRA) has been carried out using the Kamlet-Abboud-Taft (KAT) solvatochromic parameters in order to elucidate and quantify the solvent effects on the17O chemical shifts ofN-methylformamide (NMF),N,N-dimethylformamide (DMF),N-methylacetamide (NMA), andN,N-dimethylacetamide (DMA). The chemical shifts of the four molecules show the same dependence (in ppm) on the solvent polarity-polarizability, i.e., -22π*. The influence of the solvent hydrogen-bond-donor (HBD) acidities is slightly larger for the acetamides NMA and DMA, i.e., -48α, than for the formamides NMF and DMF, i.e., -42α. The influence of the solvent hydrogen-bond-acceptor (HBA) basicities is negligible for the nonprotic molecules DMF and DMA but significant for the protic molecules NMF and NMA, i.e., -9β. The effect of substituting the N-H hydrogen by a methyl group amounts to -5.9 ppm in NMF and 5.4 ppm in NMA. The effect of substituting the O=C-H hydrogen amounts to 5.5 ppm in NMF and 16.8 ppm in DMF. The model of specific hydration sites of amides by I. P. Gerothanassis and C. Vakka [J. Org. Chem.59,2341 (1994)] is settled in a more quantitative basis and the model by M. I. Burgar, T. E. St. Amour, and D. Fiat [J. Phys. Chem.85,502 (1981)] is critically evaluated.17O hydration shifts have been calculated for formamide (FOR) by the ab initio LORG method at the 6-31G* level. For a formamide surrounded by the four in-plane molecules of water in the first hydration shell, the calculated17O shift change due to the four hydrogen bonds, -83.2 ppm, is smaller than the empirical hydration shift, -100 ppm. The17O shift change from each out-of-plane water molecule hydrogen-bonded to the amide oxygen is -18.0 ppm. These LORG results support the conclusion that no more than four water molecules are hydrogen-bonded to the amide oxygen in formamide.

  7. Paradigm shift in consciousness research: the child's self-awareness and abnormalities in autism, ADHD and schizophrenia.

    Science.gov (United States)

    Lou, Hans C

    2012-02-01

    Self-awareness is a pivotal component of any conscious experience and conscious self-regulation of behaviour. A paralimbic network is active, specific and causal in self-awareness. Its regions interact by gamma synchrony. Gamma synchrony develops throughout infancy, childhood and adolescence into adulthood and is regulated by dopamine and other neurotransmitters via GABA interneurons. Major derailments of this network and self-awareness occur in developmental disorders of conscious self-regulation like autism, attention deficit hyperactivity disorder (ADHD) and schizophrenia. Recent research on conscious experience is no longer limited to the study of neural 'correlations' but is increasingly lending itself to the study of causality. This paradigm shift opens new perspectives for understanding the neural mechanisms of the developing self and the causal effects of their disturbance in developmental disorders. © 2011 The Author(s)/Acta Paediatrica © 2011 Foundation Acta Paediatrica.

  8. Relations among motor, social, and cognitive skills in pre-kindergarten children with developmental disabilities.

    Science.gov (United States)

    Kim, Helyn; Carlson, Abby G; Curby, Timothy W; Winsler, Adam

    2016-01-01

    Despite the comorbidity between motor difficulties and certain disabilities, limited research has examined links between early motor, cognitive, and social skills in preschool-aged children with developmental disabilities. The present study examined the relative contributions of gross motor and fine motor skills to the prediction of improvements in children's cognitive and social skills among 2,027 pre-kindergarten children with developmental disabilities, including specific learning disorder, speech/language impairment, intellectual disability, and autism spectrum disorder. Results indicated that for pre-kindergarten children with developmental disabilities, fine motor skills, but not gross motor skills, were predictive of improvements in cognitive and social skills, even after controlling for demographic information and initial skill levels. Moreover, depending on the type of developmental disability, the pattern of prediction of gross motor and fine motor skills to improvements in children's cognitive and social skills differed. Implications are discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Differential effects of developmental thermal plasticity across three generations of guppies (Poecilia reticulata): canalization and anticipatory matching.

    Science.gov (United States)

    Le Roy, Amélie; Loughland, Isabella; Seebacher, Frank

    2017-06-28

    Developmental plasticity can match offspring phenotypes to environmental conditions experienced by parents. Such epigenetic modifications are advantageous when parental conditions anticipate offspring environments. Here we show firstly, that developmental plasticity manifests differently in males and females. Secondly, that under stable conditions, phenotypic responses (metabolism and locomotion) accumulate across several generations. Metabolic scope in males was greater at warmer test temperatures (26-36 °C) in offspring bred at warm temperatures (29-30 °C) compared to those bred at cooler temperatures (22-23 °C), lending support to the predictive adaptive hypothesis. However, this transgenerational matching was not established until the second (F2) generation. For other responses, e.g. swimming performance in females, phenotypes of offspring bred in different thermal environments were different in the first (F1) generation, but became more similar across three generations, implying canalization. Thirdly, when environments changed across generations, the grandparental environment affected offspring phenotypes. In females, the mode of the swimming thermal performance curve shifted to coincide with the grandparental rather than the parental or offspring developmental environments, and this lag in response may represent a cost of plasticity. These findings show that the effects of developmental plasticity differ between traits, and may be modulated by the different life histories of males and females.

  10. Concurrent Increases and Decreases in Local Stability and Conformational Heterogeneity in Cu, Zn Superoxide Dismutase Variants Revealed by Temperature-Dependence of Amide Chemical Shifts.

    Science.gov (United States)

    Doyle, Colleen M; Rumfeldt, Jessica A; Broom, Helen R; Sekhar, Ashok; Kay, Lewis E; Meiering, Elizabeth M

    2016-03-08

    The chemical shifts of backbone amide protons in proteins are sensitive reporters of local structural stability and conformational heterogeneity, which can be determined from their readily measured linear and nonlinear temperature-dependences, respectively. Here we report analyses of amide proton temperature-dependences for native dimeric Cu, Zn superoxide dismutase (holo pWT SOD1) and structurally diverse mutant SOD1s associated with amyotrophic lateral sclerosis (ALS). Holo pWT SOD1 loses structure with temperature first at its periphery and, while having extremely high global stability, nevertheless exhibits extensive conformational heterogeneity, with ∼1 in 5 residues showing evidence for population of low energy alternative states. The holo G93A and E100G ALS mutants have moderately decreased global stability, whereas V148I is slightly stabilized. Comparison of the holo mutants as well as the marginally stable immature monomeric unmetalated and disulfide-reduced (apo(2SH)) pWT with holo pWT shows that changes in the local structural stability of individual amides vary greatly, with average changes corresponding to differences in global protein stability measured by differential scanning calorimetry. Mutants also exhibit altered conformational heterogeneity compared to pWT. Strikingly, substantial increases as well as decreases in local stability and conformational heterogeneity occur, in particular upon maturation and for G93A. Thus, the temperature-dependence of amide shifts for SOD1 variants is a rich source of information on the location and extent of perturbation of structure upon covalent changes and ligand binding. The implications for potential mechanisms of toxic misfolding of SOD1 in disease and for general aspects of protein energetics, including entropy-enthalpy compensation, are discussed.

  11. Counterion influence on chemical shifts in strychnine salts

    Energy Technology Data Exchange (ETDEWEB)

    Metaxas, Athena E.; Cort, John R.

    2013-05-01

    The highly toxic plant alkaloid strychnine is often isolated in the form of the anion salt of its protonated tertiary amine. Here we characterize the relative influence of different counterions on 1H and 13C chemical shifts in several strychnine salts in D2O, methanol-d4 (CD3OD) and chloroform-d (CDCl3) solvents. In organic solvents, but not in water, substantial variation in chemical shifts of protons near the tertiary amine was observed among different salts. These secondary shifts reveal differences in the way each anion influences electronic structure within the protonated amine. The distributions of secondary shifts allow salts to be easily distinguished from each other as well as from the free base form. The observed effects are much greater in organic solvents than in water. Slight concentration-dependence in chemical shifts of some protons near the amine was observed for two salts in CDCl3, but this effect is small compared to the influence of the counterion. Distinct chemical shifts in different salt forms of the same compound may be useful as chemical forensic signatures for source attribution and sample matching of alkaloids such as strychnine and possibly other organic acid and base salts.

  12. A developmental basis for stochasticity in floral organ numbers

    Science.gov (United States)

    Kitazawa, Miho S.; Fujimoto, Koichi

    2014-01-01

    Stochasticity ubiquitously inevitably appears at all levels from molecular traits to multicellular, morphological traits. Intrinsic stochasticity in biochemical reactions underlies the typical intercellular distributions of chemical concentrations, e.g., morphogen gradients, which can give rise to stochastic morphogenesis. While the universal statistics and mechanisms underlying the stochasticity at the biochemical level have been widely analyzed, those at the morphological level have not. Such morphological stochasticity is found in foral organ numbers. Although the floral organ number is a hallmark of floral species, it can distribute stochastically even within an individual plant. The probability distribution of the floral organ number within a population is usually asymmetric, i.e., it is more likely to increase rather than decrease from the modal value, or vice versa. We combined field observations, statistical analysis, and mathematical modeling to study the developmental basis of the variation in floral organ numbers among 50 species mainly from Ranunculaceae and several other families from core eudicots. We compared six hypothetical mechanisms and found that a modified error function reproduced much of the asymmetric variation found in eudicot floral organ numbers. The error function is derived from mathematical modeling of floral organ positioning, and its parameters represent measurable distances in the floral bud morphologies. The model predicts two developmental sources of the organ-number distributions: stochastic shifts in the expression boundaries of homeotic genes and a semi-concentric (whorled-type) organ arrangement. Other models species- or organ-specifically reproduced different types of distributions that reflect different developmental processes. The organ-number variation could be an indicator of stochasticity in organ fate determination and organ positioning. PMID:25404932

  13. Stress induced a shift from dorsal hippocampus to prefrontal cortex-dependent memory retrieval: role of regional corticosterone.

    Directory of Open Access Journals (Sweden)

    Gaelle eDominguez

    2014-05-01

    Full Text Available Most of the deleterious effects of stress on memory retrieval are due to a dysfunction of the hippocampo-prefrontal cortex interplay. The role of the stress-induced regional corticosterone increase in such dysfunction remains however unclear, since there is no published study as yet dedicated to measuring corticosterone concentrations simultaneously in both the prefrontal cortex (mPFC and the hippocampus (dHPC in relation with memory impairments. To that aim, we first showed in Experiment 1 that an acute stress (3 electric footschocks; 0.9 mA each delivered before memory testing reversed the memory retrieval pattern (MRP in a serial discrimination task in which mice learned two successive discriminations. More precisely, whereas non-stressed animals remembered accurately the first learned discrimination and not the second one, stressed mice remembered more accurately the second discrimination but not the first one. We demonstrated that local inactivation of dHPC or mPFC with the anesthetic lidocaine recruited the dHPC activity in non-stress conditions whereas the stress-induced MRP inversion recruited the mPFC activity. In a second experiment, we showed that acute stress induced a very similar time-course evolution of corticosterone rises within both the mPFC and dHPC. In a 3rd experiment, we found however that in situ injections of corticosterone either within the mPFC or the dHPC before memory testing favored the emergence of the mPFC-dependent MRP but blocked the emergence of the dHPC-dependent one. Overall, our study evidences that the simultaneous increase of corticosterone after stress in both areas induces a shift from dHPC (non stress condition to mPFC-dependent memory retrieval pattern and that corticosterone is critically involved in mediating the deleterious effects of stress on cognitive functions involving the mPFC-HPC interplay.

  14. Parental care masks a density-dependent shift from cooperation to competition among burying beetle larvae.

    Science.gov (United States)

    Schrader, Matthew; Jarrett, Benjamin J M; Kilner, Rebecca M

    2015-04-01

    Studies of siblings have focused mainly on their competitive interactions and to a lesser extent on their cooperation. However, competition and cooperation are at opposite ends on a continuum of possible interactions and the nature of these interactions may be flexible with ecological factors tipping the balance toward competition in some environments and cooperation in others. Here we show that the presence of parental care and the density of larvae on the breeding carcass change the outcome of sibling interactions in burying beetle broods. With full parental care there was a strong negative relationship between larval density and larval mass, consistent with sibling competition for resources. In the absence of care, initial increases in larval density had beneficial effects on larval mass but further increases in larval density reduced larval mass. This likely reflects a density-dependent shift between cooperation and competition. In a second experiment, we manipulated larval density and removed parental care. We found that the ability of larvae to penetrate the breeding carcass increased with larval density and that feeding within the carcass resulted in heavier larvae than feeding outside the carcass. However, larval density did not influence carcass decay. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  15. Transient inactivation of the neonatal ventral hippocampus impairs attentional set-shifting behavior

    DEFF Research Database (Denmark)

    Brooks, Julie M; Pershing, Michelle L; Thomsen, Morten Skøtt

    2012-01-01

    as adults on an attentional set-shifting task. Performance in this task depends upon the integrity of the PFC and NAC. TTX infusions did not affect the initial acquisition or ability to learn an intra-dimensional shift. However, TTX rats required a greater number of trials than did controls to acquire...

  16. Genome Transfer Prevents Fragmentation and Restores Developmental Potential of Developmentally Compromised Postovulatory Aged Mouse Oocytes

    Directory of Open Access Journals (Sweden)

    Mitsutoshi Yamada

    2017-03-01

    Full Text Available Changes in oocyte quality can have great impact on the developmental potential of early embryos. Here we test whether nuclear genome transfer from a developmentally incompetent to a developmentally competent oocyte can restore developmental potential. Using in vitro oocyte aging as a model system we performed nuclear transfer in mouse oocytes at metaphase II or at the first interphase, and observed that development to the blastocyst stage and to term was as efficient as in control embryos. The increased developmental potential is explained primarily by correction of abnormal cytokinesis at anaphase of meiosis and mitosis, by a reduction in chromosome segregation errors, and by normalization of the localization of chromosome passenger complex components survivin and cyclin B1. These observations demonstrate that developmental decline is primarily due to abnormal function of cytoplasmic factors involved in cytokinesis, while the genome remains developmentally fully competent.

  17. Developmental Science: Past, Present, and Future

    Science.gov (United States)

    Lerner, Richard M.

    2012-01-01

    The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…

  18. Core-level binding energy shifts in Pt Ru nanoparticles: A puzzle resolved

    Science.gov (United States)

    Lewera, Adam; Zhou, Wei Ping; Hunger, Ralf; Jaegermann, Wolfram; Wieckowski, Andrzej; Yockel, Scott; Bagus, Paul S.

    2007-10-01

    Synchrotron measurements of Pt and Ru core-level binding energies, BE's, in Pt-Ru nanoparticles, as a function of Pt content, quantify earlier indications that the Pt 4f BE shift is much larger than the Ru 3d BE shift. A complementary theoretical analysis relates the BE shifts to changes in the metal-metal distances as the composition of the nanoparticle changes. We establish that the large Pt and small Ru BE shifts arise from the different response of these metals to changes in the bond distances, an unexpected result. Our results give evidence that the magnitudes of the BE shifts depend on whether the d band is open, as for Ru, or essentially filled, as for Pt.

  19. Developmental disorders of the brain can be caused by PCBs; low doses of hydroxy-PCBs disrupt thyroid hormone-dependent dendrite formation from Purkinje neurons in culture

    Energy Technology Data Exchange (ETDEWEB)

    Kuroda, Y; Kimura-Kuroda, J [Tokyo Metropol. Inst. for Neuroscience, Tokyo (Japan); Nagata, I [CREST/ JST, Tokyo (Japan)

    2004-09-15

    Exposure to some environmental chemicals during the perinatal period causes developmental disorders of the brain. Cognitive impairment and hyperactivity in infants were reported in Taiwan, known as Yu-cheng incidents caused by the accidental contamination of polychlorinated biphenyls (PCBs). Together with recent experimental data, Kuroda proposes a hypothesis that spatio-temporal disruptions of developing neuronal circuits by PCB exposure can cause the comobidity of learning disorders (LD), attention deficit hyperactivity disorder (ADHD) and autsm with the co-exposure to other environmental chemicals. PCBs and hydroxylated PCBs (OH-PCBs) have similar chemical structures to thyroid hormones (TH), thyroxine (T4) and triiodothyronine (T3). TH deficiency in the perinatal period causes cretinism children with severe cognitive and mental retardation. In primate model, Rice demonstrates that postnatal exposure to PCBs can dramatically influence later behavioral function. Epidemiological studies also indicate the possible developmental neurotoxicity of PCBs accumulated in human bodies. However, the precise underlying mechanisms and which types of PCB or OH-PCB with such effects have yet to be elucidated. It is important to establish a simple, reproducible, and sensitive in vitro assay for determining the effects of PCBs and OH-PCBs on the development of the central nervous system. Recently Iwasaki et al. established a reporter assay system and disclosed that low doses of PCBs potentially interfere TH-dependent gene expressions. This is the first demonstration that PCBs and OH-PCBs directly affect TH-receptor (TR)-mediated gene expressions crucial to the brain development, through unique mechanism. We also have demonstrated TH-dependent development of Purkinje neurons in vitro using a serum-free chemically defined medium. The degree of dendritic development of Purkinje cells is TH dose-dependent and exhibits high sensitivity in the pM order. Therefore, in the present study

  20. Developmental and individual differences in pure numerical estimation.

    Science.gov (United States)

    Booth, Julie L; Siegler, Robert S

    2006-01-01

    The authors examined developmental and individual differences in pure numerical estimation, the type of estimation that depends solely on knowledge of numbers. Children between kindergarten and 4th grade were asked to solve 4 types of numerical estimation problems: computational, numerosity, measurement, and number line. In Experiment 1, kindergartners and 1st, 2nd, and 3rd graders were presented problems involving the numbers 0-100; in Experiment 2, 2nd and 4th graders were presented problems involving the numbers 0-1,000. Parallel developmental trends, involving increasing reliance on linear representations of numbers and decreasing reliance on logarithmic ones, emerged across different types of estimation. Consistent individual differences across tasks were also apparent, and all types of estimation skill were positively related to math achievement test scores. Implications for understanding of mathematics learning in general are discussed. Copyright 2006 APA, all rights reserved.

  1. Who is sleepier on the night shift? The influence of bio-psycho-social factors on subjective sleepiness of female nurses during the night shift.

    Science.gov (United States)

    Zion, Nataly; Drach-Zahavy, Anat; Shochat, Tamar

    2018-07-01

    Sleepiness is a common complaint during the night shift and may impair performance. The current study aims to identify bio-psycho-social factors associated with subjective sleepiness during the night shift. Ninety-two female nurses working rotating shifts completed a sociodemographic questionnaire, the Munich ChronoType Questionaire for shift workers, the Pittsburg Sleep Quality Index, and the Pre-sleep Arousal Scale. Subjective sleepiness was measured hourly during two night shifts using the Karolinska Sleepiness Scale, and activity monitors assessed sleep duration 24-h before each shift. Findings showed that increased sleepiness was associated with increased age in nurses with early chronotypes and with more children. High cognitive pre-sleep arousal, but not sleep, was associated with increased sleepiness, especially in late chronotypes. The impact of bio-psycho-social factors on night shift sleepiness is complex, and depends on mutual interactions between these factors. Nurses most prone to increased sleepiness must develop personal strategies for maintaining vigilance on the night shift. Practitioner Summary: This study aims to identify bio-psycho-social factors associated with subjective sleepiness of female nurses during the night shift. Increasing sleepiness was associated with increased age in nurses with early chronotypes and with more children. Increased cognitive pre-sleep arousal, but not sleep, was associated with increased sleepiness, especially in late chronotypes.

  2. Maternal and developmental toxicity of ayahuasca in Wistar rats.

    Science.gov (United States)

    Oliveira, Carolina Dizioli Rodrigues; Moreira, Camila Queiroz; de Sá, Lilian Rose Marques; Spinosa, Helenice de Souza; Yonamine, Mauricio

    2010-06-01

    Ayahuasca is a psychotropic plant beverage initially used by shamans throughout the Amazon region during traditional religious cult. In recent years, ayahuasca has also been used in ceremonies of a number of modern syncretic religious groups, including pregnant women. However, no documented study has been performed to evaluate the risk of developmental toxicity of ayahuasca. In the present work, maternal and developmental toxicity was evaluated in Wistar rats. Ayahuasca was administered to pregnant rats in three different doses [the equivalent typical dose (TD) administered to humans, five-fold TD and 10-fold TD] during the gestational period (6-20 days). Dams treated with the highest ayahuasca dose showed maternal toxicity with decrease of weight gain and food intake. Visceral fetal findings were observed in all treatment groups. Skeletal findings were observed in the intermediate- and high-dose groups. The fetuses deriving from the highest dose group also presented a decrease in body weight. From these results, it is possible to conclude that there is a risk of maternal and developmental toxicity following ayahuasca exposure and that the level of toxicity appears to be dose-dependent.

  3. An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics

    Science.gov (United States)

    Molenaar, Peter C. M.

    2015-01-01

    The main theme of this paper concerns the persistent critique of Gilbert Gottlieb on developmental behavior genetics and my reactions to this critique, the latter changing from rejection to complete acceptation. Concise characterizations of developmental behavior genetics, developmental systems theory (to which Gottlieb made essential…

  4. Are Time-Dependent Fluorescence Shifts at the Tunnel Mouth of Haloalkane Dehalogenase Enzymes Dependent on the Choice of the Chromophore?

    Czech Academy of Sciences Publication Activity Database

    Amaro, Mariana; Brezovský, J.; Kováčová, S.; Maier, L.; Chaloupková, R.; Sýkora, Jan; Paruch, K.; Damborský, J.; Hof, Martin

    2013-01-01

    Roč. 117, č. 26 (2013), s. 7898-7906 ISSN 1520-6106 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388955 Keywords : DYNAMIC STOKES SHIFT * WATER-PROTEIN FLUCTUATIONS * POLAR SOLVATION DYNAMICS Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.377, year: 2013

  5. Embryonic developmental temperatures modulate thermal acclimation of performance curves in tadpoles of the frog Limnodynastes peronii.

    Directory of Open Access Journals (Sweden)

    Frank Seebacher

    Full Text Available Performance curves of physiological rates are not fixed, and determining the extent to which thermal performance curves can change in response to environmental signals is essential to understand the effect of climate variability on populations. The aim of this study was to determine whether and how temperatures experienced during early embryonic development affect thermal performance curves of later life history stages in the frog Limnodynastes peronii. We tested the hypotheses that a the embryonic environment affects mean trait values only; b temperature at which performance of tadpoles is maximal shifts with egg incubation temperatures so that performance is maximised at the incubation temperatures, and c incubation temperatures modulate the capacity for reversible acclimation in tadpoles. Growth rates were greater in warm (25°C compared to cold (15°C acclimated (6 weeks tadpoles regardless of egg developmental temperatures (15°C or 25°C, representing seasonal means. The breadth of the performance curve of burst locomotor performance (measured at 10, 15, 20, 25, and 30°C, representing annual range is greatest when egg developmental and acclimation temperatures coincide. The mode of the performance curves shifted with acclimation conditions and maximum performance was always at higher temperatures than acclimation conditions. Performance curves of glycolytic (lactate dehydrogenase activities and mitochondrial (citrate synthase and cytochrome c oxidase enzymes were modulated by interactions between egg incubation and acclimation temperatures. Lactate dehydrogenase activity paralleled patterns seen in burst locomotor performance, but oxygen consumption rates and mitochondrial enzyme activities did not mirror growth or locomotor performance. We show that embryonic developmental conditions can modulate performance curves of later life-history stages, thereby conferring flexibilty to respond to environmental conditions later in life.

  6. Charge-dependent and A-dependent effects in isotope shifts of Coulomb displacement energies

    International Nuclear Information System (INIS)

    Sherr, R.

    1977-01-01

    Coulomb displacement energies in a series of isotopes generally decrease with A. This decrease can arise from an increase with A of the average distance of interaction between pairs of protons. In the shell model a decrease can also result from charge-independence-breaking effects if the neutron-proton interaction for the valence nucleons is more attractive than the neutron-neutron interaction. Using the model recently proposed by Sherr and Talmi for the 1d/sub 3/2/ shell, existing data for this shell and also the 1d/sub 5/2/ and 1f/sub 7/2/ shells were analyzed allowing all matrix elements to vary as A/sup -lambda/3/. Least squares calculations of the rms deviation sigma were carried out for varying values of lambda from -2 to +2. It was found that although there was a minimum in sigma vs lambda it was too shallow to exclude any lambda for -1 to +1 in the 1d/sub 3/2/ and 1f/sub 7/2/ shells or 0 to +1 in the 1d/sub 5/2/ shell. It is therefore not possible to distinguish between A dependence and charge dependence in this model. The magnitude of the latter as expressed in terms of (np-nn) matrix elements depends strongly on the former. As lambda increases from -1 to +1, these (np-nn) matrix elements decrease roughly linearly in absolute magnitude and eventually change sign. For lambda = 0 they have appreciable and reasonable magnitudes for the 1d/sub 3/2/ and 1f/sub 7/2/ shells but for the 1d/sub 5/2/ shell the values are too small to be considered significant

  7. Distinguishing epigenetic marks of developmental and imprinting regulation

    Directory of Open Access Journals (Sweden)

    McEwen Kirsten R

    2010-01-01

    Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two

  8. Qualitative methodology in developmental psychology

    DEFF Research Database (Denmark)

    Demuth, Carolin; Mey, Günter

    2015-01-01

    Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing rec...... in qualitative research offers a promising avenue to advance the field in this direction.......Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing...

  9. Wavefield dependency on virtual shifts in the source location

    KAUST Repository

    Alkhalifah, Tariq

    2011-01-01

    shape) to lateral perturbations in the source location depends explicitly on lateral derivatives of the velocity field. For velocity models that include lateral velocity discontinuities this is problematic as such derivatives in their classical

  10. Attentional networks in developmental dyscalculia

    Directory of Open Access Journals (Sweden)

    Henik Avishai

    2010-01-01

    Full Text Available Abstract Background Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Methods Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test - interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. Results The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. Conclusions These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

  11. Attentional networks in developmental dyscalculia.

    Science.gov (United States)

    Askenazi, Sarit; Henik, Avishai

    2010-01-07

    Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test-interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

  12. Developmental Scaffolding

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2015-01-01

    . Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

  13. Night shift work at specific age ranges and chronic disease risk factors.

    Science.gov (United States)

    Ramin, Cody; Devore, Elizabeth E; Wang, Weike; Pierre-Paul, Jeffrey; Wegrzyn, Lani R; Schernhammer, Eva S

    2015-02-01

    We examined the association of night shift work history and age when night shift work was performed with cancer and cardiovascular disease risk factors among 54 724 women in the Nurses' Health Study (NHS) II. We calculated age-adjusted and socioeconomic status-adjusted means and percentages for cancer and cardiovascular risk factors in 2009 across categories of night shift work history. We used multivariable-adjusted logistic regression to estimate odds ratios (ORs) and 95% CIs for key risk factors among 54 724 participants (72% ever shift workers). We further examined these associations by age (20-25, 26-35, 36-45 and 46+ years) at which shift work was performed. Ever night shift workers had increased odds of obesity (body mass index ≥30 kg/m(2); OR=1.37, 95% CI 1.31 to 1.43); higher caffeine intake (≥131 mg/day; OR=1.16, 95% CI 1.12 to 1.22) and total calorie intake (≥1715 kcal/day; OR=1.09, 95% CI 1.04 to 1.13); current smoking (OR=1.30, 95% CI 1.19 to 1.42); and shorter sleep durations (≤7 h of sleep/day; OR=1.19, 95% CI 1.15 to 1.24) compared to never night shift workers. These estimates varied depending on age at which night work was performed, with a suggestion that night shift work before age 25 was associated with fewer risk factors compared to night shift work at older ages. Our results indicate that night shift work may contribute to an adverse chronic disease risk profile, and that risk factors may vary depending on the age at which night shift work was performed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  14. Psychotherapy with people with developmental disabilities

    Directory of Open Access Journals (Sweden)

    Barbara Zafošnik

    2011-08-01

    Full Text Available People with developmental disabilities can experience any psychological abnormalitiy and psychiatric illness as do people without developmental disabilities. Due to different diagnostic criteria, assessment procedures and instruments, we lack definite prevalence rates for people with developmental disabilities, also suffering from mental health problems, eventhough most studies place the rate at 20 to 40%. One of the possible treatment alternatives for augmenting psychological well-being is psychotherapy, but is extremely rarely used for people with severe and profound disabilities, where speech cannot be the main therapeutic medium. So, those that are included in the psychotherapuetic process are predominantly clients with mild developmental disabilities, and they are mostly in cognitive-behavioral therapy. Recently, two models of (psychotherapy for persons with severe and profound developmental disabilities were developed: developmental-dynamic relationship therapy and attachment-based behaviour therapy for children. Conceptually, they both originate form developmental psychoanalytic theories.

  15. PM2.5-bound metal metabolic distribution and coupled lipid abnormality at different developmental windows.

    Science.gov (United States)

    Ku, Tingting; Zhang, Yingying; Ji, Xiaotong; Li, Guangke; Sang, Nan

    2017-09-01

    Atmospheric fine particulate matter (PM 2.5 ) is a serious threat to human health. As a toxicant constituent, metal leads to significant health risks in a population, but exposure to PM 2.5 -bound metals and their biological impacts are not fully understood. In this study, we determined the metal contents of PM 2.5 samples collected from a typical coal-burning city and then investigated the metabolic distributions of six metals (Zn, Pb, Mn, As, Cu, and Cd) following PM 2.5 inhalation in mice in different developmental windows. The results indicate that fine particles were mainly deposited in the lung, but PM 2.5 -bound metals could reach and gather in secondary off-target tissues (the lung, liver, heart and brain) with a developmental window-dependent property. Furthermore, elevations in triglycerides and cholesterol levels in sensitive developmental windows (the young and elderly stages) occurred, and significant associations between metals (Pb, Mn, As and Cd) and cholesterol in the heart, brain, liver and lung were observed. These findings suggest that PM 2.5 inhalation caused selective metal metabolic distribution in tissues with a developmental window-dependent property and that the effects were associated with lipid alterations. This provides a foundation for the underlying systemic toxicity following PM 2.5 exposure based on metal components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Developmental and reproductive toxicity of inorganic arsenic: animal studies and human concerns.

    Science.gov (United States)

    Golub, M S; Macintosh, M S; Baumrind, N

    1998-01-01

    Information on the reproductive and developmental toxicity of inorganic arsenic is available primarily from studies in animals using arsenite and arsenate salts and arsenic trioxide. Inorganic arsenic has been extensively studied as a teratogen in animals. Data from animal studies demonstrate that arsenic can produce developmental toxicity, including malformation, death, and growth retardation, in four species (hamsters, mice, rats, rabbits). A characteristic pattern of malformations is produced, and the developmental toxicity effects are dependent on dose, route, and the day of gestation when exposure occurs. Studies with gavage and diet administration indicate that death and growth retardation are produced by oral arsenic exposure. Arsenic is readily transferred to the fetus and produces developmental toxicity in embryo culture. Animal studies have not identified an effect of arsenic on fertility in males or females. When females were dosed chronically for periods that included pregnancy, the primary effect of arsenic on reproduction was a dose-dependent increase in conceptus mortality and in postnatal growth retardation. Human data are limited to a few studies of populations exposed to arsenic from drinking water or from working at or living near smelters. Associations with spontaneous abortion and stillbirth have been reported in more than one of these studies, but interpretation of these studies is complicated because study populations were exposed to multiple chemicals. Thus, animal studies suggest that environmental arsenic exposures are primarily a risk to the developing fetus. In order to understand the implications for humans, attention must be given to comparative pharmacokinetics and metabolism, likely exposure scenarios, possible mechanisms of action, and the potential role of arsenic as an essential nutrient.

  17. Cholecalciferol attenuates perseverative behavior associated with developmental alcohol exposure in rats in a dose-dependent manner.

    Science.gov (United States)

    Idrus, N M; Happer, J P; Thomas, J D

    2013-07-01

    Alcohol is a known teratogen that is estimated to affect 2-5% of the births in the U.S. Prenatal alcohol exposure can produce physical features such as facial dysmorphology, physiological alterations such as cell loss in the central nervous system (CNS), and behavioral changes that include hyperactivity, cognitive deficits, and motor dysfunction. The range of effects associated with prenatal alcohol exposure is referred to as fetal alcohol spectrum disorders (FASD). Despite preventative measures, some women continue to drink while pregnant. Therefore, identifying interventions that reduce the severity of FASD is critical. This study investigated one such potential intervention, vitamin D3, a nutrient that exerts neuroprotective properties. The present study determined whether cholecalciferol, a common vitamin D3 nutritional supplement, could serve as a means of mitigating alcohol-related learning deficits. Using a rat model of FASD, cholecalciferol was given before, during, and after 3rd trimester equivalent alcohol exposure. Three weeks after cholecalciferol treatment, subjects were tested on a serial spatial discrimination reversal learning task. Animals exposed to ethanol committed significantly more errors compared to controls. Cholecalciferol treatment reduced perseverative behavior that is associated with developmental alcohol exposure in a dose-dependent manner. These data have important implications for the treatment of FASD and suggest that cholecalciferol may reduce some aspects of FASD. This article is part of a Special Issue entitled 'Vitamin D Workshop'. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Developmental Changes for the Hemolymph Metabolome of Silkworm (Bombyx moriL.)

    Science.gov (United States)

    Zhou, Lihong; Li, Huihui; Hao, Fuhua; Li, Ning; Liu, Xin; Wang, Guoliang; Wang, Yulan; Tang, Huiru

    2015-01-01

    Silkworm (Bombyx mori) is a lepidopteran-holometabolic model organism. To understand its developmental biochemistry, we characterized the larval hemolymph metabonome from the third instar to prepupa stage using 1H NMR spectroscopy whilst hemolymph fatty acid composition using GC-FID/MS. We unambiguously assigned more than 60 metabolites, among which tyrosine-o-β-glucuronide, mesaconate, homocarnosine, and picolinate were reported for the first time from the silkworm hemolymph. Phosphorylcholine was the most abundant metabolite in all developmental stages with exception for the periods before the third and fourth molting. We also found obvious developmental dependence for the hemolymph metabonome involving multiple pathways including protein biosyntheses, glycolysis, TCA cycle, the metabolisms of choline amino acids, fatty acids, purines, and pyrimidines. Most hemolymph amino acids had two elevations during the feeding period of the fourth instar and prepupa stage. Trehalose was the major blood sugar before day 8 of the fifth instar, whereas glucose became the major blood sugar after spinning. C16:0, C18:0 and its unsaturated forms were dominant fatty acids in hemolymph. The developmental changes of hemolymph metabonome were associated with dietary nutrient intakes, biosyntheses of cell membrane, pigments, proteins, and energy metabolism. These findings offered essential biochemistry information in terms of the dynamic metabolic changes during silkworm development. PMID:25825269

  19. Higgs-boson contributions to gauge-boson mass shifts in extended electroweak models

    International Nuclear Information System (INIS)

    Moore, S.R.

    1985-10-01

    In the minimal standard model, the difference between the tree-level and one-loop-corrected predictions for the gauge-boson masses, known as the mass shifts, are of the order of 4%. The dominant contribution is from light-fermion loops. The Higgs-dependent terms are small, even if the Higgs boson is heavy. We have analyzed the mass shifts for models with a more complicated Higgs sector. We use the on-shell renormalization scheme, in which the parameters of the theory are the physical masses and couplings. We have considered the 2-doublet, n-doublet, triplet and doublet-triplet models. We have found that the Z-boson mass prediction has a strong dependence on the charged-Higgs mass. In the limit that the charged Higgs is much heavier than the gauge bosons, the Higgs-dependent terms become significant, and may even cancel the light-fermion terms. In the models with a Higgs triplet, there is also a strong dependence on the neutral-Higgs masses, although this contribution tends to be suppressed in realistic models. The W-boson mass shift does not have a strong Higgs dependence. If we use the Z mass as input in determining the parameters of the theory, a scenario which will become attractive as the mass of the Z is accurately measured in the next few years, we find that the W-boson mass shift exhibits the same sort of behavior, differing from the minimal model for the case of the charged Higgs being heavy. We have found that when radiative corrections are taken into account, models with extended Higgs sectors may differ significantly from the minimal standard model in their predictions for the gauge-boson masses. Thus, an accurate measurement of the masses will help shed light on the structure of the Higgs sector. 68 refs

  20. Size-independent peak shift between normal and upconversion ...

    Indian Academy of Sciences (India)

    2014-02-12

    Feb 12, 2014 ... In this article, we report size-dependent measurement of the shift in peak of upconversion photoluminescence spectra compared to that of normal photoluminescence using a 800 nm femtosecond laser and its second harmonic. It has been shown that the upconversion photoluminescence is always ...

  1. Developmental aspects of a life course approach to healthy ageing

    Science.gov (United States)

    Cooper, C.; Aihie Sayer, A.; Eendebak, R. J.; Clough, G. F.; Beard, J. R.

    2016-01-01

    Abstract We examine the mechanistic basis and wider implications of adopting a developmental perspective on human ageing. Previous models of ageing have concentrated on its genetic basis, or the detrimental effects of accumulated damage, but also have raised issues about whether ageing can be viewed as adaptive itself, or is a consequence of other adaptive processes, for example if maintenance and repair processes in the period up to reproduction are traded off against later decline in function. A life course model places ageing in the context of the attainment of peak capacity for a body system, starting in early development when plasticity permits changes in structure and function induced by a range of environmental stimuli, followed by a period of decline, the rate of which depends on the peak attained as well as the later life conditions. Such path dependency in the rate of ageing may offer new insights into its modification. Focusing on musculoskeletal and cardiovascular function, we discuss this model and the possible underlying mechanisms, including endothelial function, oxidative stress, stem cells and nutritional factors such as vitamin D status. Epigenetic changes induced during developmental plasticity, and immune function may provide a common mechanistic process underlying a life course model of ageing. The life course trajectory differs in high and low resource settings. New insights into the developmental components of the life course model of ageing may lead to the design of biomarkers of later chronic disease risk and to new interventions to promote healthy ageing, with important implications for public health. PMID:26518329

  2. Lightness dependence of achromatic loci in color-appearance coordinates

    Directory of Open Access Journals (Sweden)

    Ichiro eKuriki

    2015-02-01

    Full Text Available Shifts in the appearance of color under different illuminant chromaticity are known to be incomplete, and fit nicely with a simple linear transformation of cone responses that aligns the achromatic points under two illuminants. Most chromaticity-transfer functions with von-Kries-like transformations use only one set of values to fit the color shifts from one illuminant to another. However, an achromatic point shifts its chromaticity depending on the lightness of the test stimulus. This lightness dependence of the achromatic-point locus is qualitatively similar to a phenomenon known as the Helson-Judd effect. The present study suggests that the lightness dependency of achromatic points appears to be a general trend, which is supported by the results from deriving the optimal von-Kries coefficients for different lightness levels that best fit the color shifts under different illuminant chromaticities. Further, we report that such a lightness dependence of the achromatic-point loci can be represented simply as a straight line in coordinates defined using color-appearance models such as CIECAM when normalized for daylight.

  3. The hedgehog pathway gene shifted functions together with the hmgcr-dependent isoprenoid biosynthetic pathway to orchestrate germ cell migration.

    Directory of Open Access Journals (Sweden)

    Girish Deshpande

    Full Text Available The Drosophila embryonic gonad is assembled from two distinct cell types, the Primordial Germ Cells (PGCs and the Somatic Gonadal Precursor cells (SGPs. The PGCs form at the posterior of blastoderm stage embryos and are subsequently carried inside the embryo during gastrulation. To reach the SGPs, the PGCs must traverse the midgut wall and then migrate through the mesoderm. A combination of local repulsive cues and attractive signals emanating from the SGPs guide migration. We have investigated the role of the hedgehog (hh pathway gene shifted (shf in directing PGC migration. shf encodes a secreted protein that facilitates the long distance transmission of Hh through the proteoglycan matrix after it is released from basolateral membranes of Hh expressing cells in the wing imaginal disc. shf is expressed in the gonadal mesoderm, and loss- and gain-of-function experiments demonstrate that it is required for PGC migration. Previous studies have established that the hmgcr-dependent isoprenoid biosynthetic pathway plays a pivotal role in generating the PGC attractant both by the SGPs and by other tissues when hmgcr is ectopically expressed. We show that production of this PGC attractant depends upon shf as well as a second hh pathway gene gγ1. Further linking the PGC attractant to Hh, we present evidence indicating that ectopic expression of hmgcr in the nervous system promotes the release/transmission of the Hh ligand from these cells into and through the underlying mesodermal cell layer, where Hh can contact migrating PGCs. Finally, potentiation of Hh by hmgcr appears to depend upon cholesterol modification.

  4. Pyridoxine-Dependent Epilepsy: An Expanding Clinical Spectrum

    NARCIS (Netherlands)

    van Karnebeek, Clara D. M.; Tiebout, Sylvia A.; Niermeijer, Jikkemien; Poll-The, Bwee Tien; Ghani, Aisha; Coughlin, Curtis R.; van Hove, Johan L. K.; Richter, Jost Wigand; Christen, Hans Juergen; Gallagher, Renata; Hartmann, Hans; Stockler-Ipsiroglu, Sylvia

    2016-01-01

    Pyridoxine-dependent epilepsy is a rare autosomal recessive epileptic encephalopathy caused by antiquitin (ALDH7A1) deficiency. In spite of adequate seizure control, 75% of patients suffer intellectual developmental disability. Antiquitin deficiency affects lysine catabolism resulting in

  5. New type shift operators for circular well potential in two dimensions

    International Nuclear Information System (INIS)

    Sun Guohua; Dong Shihai

    2010-01-01

    New type shift operators for circular well potential in two dimensions are identified. These so-called shift operators connect those quantum systems with the different potentials but with same energy spectrum. It should be noted that these operators depend on both the radial circular and angular variables r and φ. We find that the operators P ± =P x ±P y play the role of the shift operators. The radial linear momentum P r =-ih(∂)/(∂r) , the angular momentum L z =-ih(∂)/(∂φ) and the Hamiltonian form a complete set of commuting operators with the SO(2) symmetry.

  6. Muon Knight shift and μ+ site in the monopnictide CeAs

    International Nuclear Information System (INIS)

    Schenck, A.; Amato, A.; Gygax, F.N.; Pinkpank, M.; Ott, H.R.

    1997-01-01

    The transverse field μSR-signal from μ + implanted in a CeAs single crystal shows a splitting into two components, displaying a positive and a negative Knight shift, respectively which both scale reasonably well with the magnetic bulk susceptibility above 10 K. The orientation dependence of the frequency shifts, measured at 15 K, is fully accounted for by the demagnetization field, implying an isotropic Knight shift, consistent with the μ + residing at the only interstitial site of high (cubic) symmetry, i.e., at the position (1/4,1/4,1/4). The occurrence of a split signal remains unexplained

  7. Timing is everything: Reiterative Wnt, BMP and RA signaling regulate developmental competence during endoderm organogenesis.

    Science.gov (United States)

    Rankin, Scott A; McCracken, Kyle W; Luedeke, David M; Han, Lu; Wells, James M; Shannon, John M; Zorn, Aaron M

    2018-02-01

    A small number of signaling pathways are used repeatedly during organogenesis, and they can have drastically different effects on the same population of cells depending on the embryonic stage. How cellular competence changes over developmental time is not well understood. Here we used Xenopus, mouse, and human pluripotent stem cells to investigate how the temporal sequence of Wnt, BMP, and retinoic acid (RA) signals regulates endoderm developmental competence and organ induction, focusing on respiratory fate. While Nkx2-1+ lung fate is not induced until late somitogenesis stages, here we show that lung competence is restricted by the gastrula stage as a result of Wnt and BMP-dependent anterior-posterior (A-P) patterning. These early Wnt and BMP signals make posterior endoderm refractory to subsequent RA/Wnt/BMP-dependent lung induction. We further mapped how RA modulates the response to Wnt and BMP in a temporal specific manner. In the gastrula RA promotes posterior identity, however in early somite stages of development RA regulates respiratory versus pharyngeal potential in anterior endoderm and midgut versus hindgut potential in posterior endoderm. Together our data suggest a dynamic and conserved response of vertebrate endoderm during organogenesis, wherein early Wnt/BMP/RA impacts how cells respond to later Wnt/BMP/RA signals, illustrating how reiterative combinatorial signaling can regulate both developmental competence and subsequent fate specification. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. How do employees prioritise when they schedule their own shifts?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Lund, Henrik; Hansen, Åse Marie

    2013-01-01

    to their family life, having consecutive time off, leisure-time activities, rest between shifts, sleep, regularity of their everyday life, health and that the work schedule balanced. Thus, employees consider both their own and the workplace's needs when they have the opportunity to schedule their own shifts. Age......We investigated how employees prioritised when they scheduled their own shifts and whether priorities depended on age, gender, educational level, cohabitation and health status. We used cross-sectional questionnaire data from the follow-up survey of an intervention study investigating the effect...... of self-scheduling (n = 317). Intervention group participants were asked about their priorities when scheduling their own shifts succeeded by 17 items covering family/private life, economy, job content, health and sleep. At least half of the participants reported that they were giving high priority...

  9. Communication-Based Assessment of Developmental Age for Young Children with Developmental Disabilities

    Science.gov (United States)

    DeVeney, Shari L.; Hoffman, Lesa; Cress, Cynthia J.

    2012-01-01

    Purpose: In this study, the authors compared a multiple-domain strategy for assessing developmental age of young children with developmental disabilities who were at risk for long-term reliance on augmentative and alternative communication (AAC) with a communication-based strategy composed of receptive language and communication indices that may…

  10. The Interplay between Adolescent Needs and Secondary School Structures: Fostering Developmentally Responsive Middle and High School Environments across the Transition

    Science.gov (United States)

    Ellerbrock, Cheryl R.; Kiefer, Sarah M.

    2013-01-01

    Understanding the developmental responsiveness of secondary school environments may be an important factor in supporting students as they make the transition from one school to the next. Students' needs may or may not be met depending on the nature of the fit between their basic and developmental needs and secondary school structures at the middle…

  11. Phase-shift analysis in pion-/sup 4/He elastic scattering. [60 to 260 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Falomkin, I V; Nichitiu, F; Sapozhnikov, M G; Shcherbakov, YU A [Joint Inst. for Nuclear Research, Dubna (USSR); Balestra, F; Bollini, E [Turin Univ. (Italy). Istituto di Fisica

    1978-02-21

    An energy-independent phase-shift analysis (PSA) of the elastic scattering of pions on /sup 4/He, in the energy range 60 to 260 MeV has been performed. All possible solutions, arising from the phase-shift analysis ambiguity, have been analyzed. Particular care has been taken in the choice of the physical solution. The calculated phase shifts have been compared with the results of the energy-dependent phase-shift analysis (EDPSA) and with the optical-model predictions.

  12. Developmental plasticity: Friend or foe?

    Science.gov (United States)

    Michels, Karin B

    2017-01-01

    Developmental plasticity - the concept that adaptation to changing and unfavorable environmental conditions are possible but may come at the price of compromised health potentials - has evolutionary grounding as it facilitates survival but dissents with fundamental evolutionary principles in that it may advance the lesser fit. It is an important cornerstone of the Developmental Origins of Health and Disease (DOHaD). Unlike evolutionary adaptation developmental plasticity may be short-lived and restricted to one or few generations and inheritance is uncertain. Potential mechanisms include epigenetic modifications adopted in utero which may not transmit to the next generation; future insights may allow adjustments of the outcomes of developmental plasticity.

  13. DC space-charge induced frequency up-shift in a quasi-optical gyrotron

    International Nuclear Information System (INIS)

    Alberti, S.; Tran, M.Q.; Tran, T.M.

    1990-10-01

    Recent experiments on a 100GHz quasi-optical gyrotron have shown that for a large resonator set-up the observed frequency up-shift between the starting current and a current of 10A corresponds to a shift of 4-5 longitudinal modes. In this Letter it is shown that the interpretation of this frequency up-shift should involve the current dependent electron beam voltage depression in the beam tunnel and the interaction region for both the single-mode and multi-mode time evolution codes. (author) 7 refs., 5 figs., 1 tab

  14. NMR chemical shifts in amino acids: Effects of environments, electric field, and amine group rotation

    International Nuclear Information System (INIS)

    Yoon, Young-Gui; Pfrommer, Bernd G.; Louie, Steven G.; Canning, Andrew

    2002-01-01

    The authors present calculations of NMR chemical shifts in crystalline phases of some representative amino acids such as glycine, alanine, and alanyl-alanine. To get an insight on how different environments affect the chemical shifts, they study the transition from the crystalline phase to completely isolated molecules of glycine. In the crystalline limit, the shifts are dominated by intermolecular hydrogen-bonds. In the molecular limit, however, dipole electric field effects dominate the behavior of the chemical shifts. They show that it is necessary to average the chemical shifts in glycine over geometries. Tensor components are analyzed to get the angle dependent proton chemical shifts, which is a more refined characterization method

  15. A New Kind of Shift Operators for Infinite Circular and Spherical Wells

    Directory of Open Access Journals (Sweden)

    Guo-Hua Sun

    2014-01-01

    Full Text Available A new kind of shift operators for infinite circular and spherical wells is identified. These shift operators depend on all spatial variables of quantum systems and connect some eigenstates of confined systems of different radii R sharing energy levels with a common eigenvalue. In circular well, the momentum operators P±=Px±iPy play the role of shift operators. The Px and Py operators, the third projection of the orbital angular momentum operator Lz, and the Hamiltonian H form a complete set of commuting operators with the SO(2 symmetry. In spherical well, the shift operators establish a novel relation between ψlm(r and ψ(l ± 1(m±1(r.

  16. Structural dependence of the 5d-metal surface energies as deduced from surface core-level shift measurements

    International Nuclear Information System (INIS)

    Mrartensson, N.; Saalfeld, H.B.; Kuhlenbeck, H.; Neumann, M.

    1989-01-01

    Surface core-level shift measurements performed at the BESSY storage ring yield -0.41(2) eV for Os(0001) and 0.00(10) eV for Re(0001). An analysis of the surface shifts in the 5d transition series shows that the surface energy as a function of Z has a maximum at lower Z for the bcc phase than for the fcc-hcp phases, at W and between Re and Os, respectively

  17. Participation Patterns of Preschool Children With Intellectual Developmental Disabilities.

    Science.gov (United States)

    Gilboa, Yafit; Fuchs, Reut

    2018-04-01

    We aim to examine the pattern of participation of children with intellectual developmental disabilities (IDD) or global developmental delay (GDD) in comparison with typically developing preschoolers. In addition, to identify environmental and personal factors associated with their participation, 20 children with mild to moderate GDD or IDD, and 24 age- and gender-matched controls, aged 3 to 6 years, were assessed using the Assessment of Preschool Children's Participation and the Environmental Restriction Questionnaire. Significant differences were found between the groups, both for general scales of participation and for each activity area. For the IDD/GDD group, participation was significantly negatively correlated with environmental restrictions at home. For the control group, participation was correlated with demographic variables. Typically developing children participate at a higher frequency and in a more diverse range of activities compared with children with IDD/GDD. Associations between participation and contextual factors varied depending on the child's health condition.

  18. The significance of the subplate for evolution and developmental plasticity of the human brain.

    Science.gov (United States)

    Judaš, Miloš; Sedmak, Goran; Kostović, Ivica

    2013-01-01

    The human life-history is characterized by long development and introduction of new developmental stages, such as childhood and adolescence. The developing brain had important role in these life-history changes because it is expensive tissue which uses up to 80% of resting metabolic rate (RMR) in the newborn and continues to use almost 50% of it during the first 5 postnatal years. Our hominid ancestors managed to lift-up metabolic constraints to increase in brain size by several interrelated ecological, behavioral and social adaptations, such as dietary change, invention of cooking, creation of family-bonded reproductive units, and life-history changes. This opened new vistas for the developing brain, because it became possible to metabolically support transient patterns of brain organization as well as developmental brain plasticity for much longer period and with much greater number of neurons and connectivity combinations in comparison to apes. This included the shaping of cortical connections through the interaction with infant's social environment, which probably enhanced typically human evolution of language, cognition and self-awareness. In this review, we propose that the transient subplate zone and its postnatal remnant (interstitial neurons of the gyral white matter) probably served as the main playground for evolution of these developmental shifts, and describe various features that makes human subplate uniquely positioned to have such a role in comparison with other primates.

  19. THE SIGNIFICANCE OF THE SUBPLATE FOR EVOLUTION AND DEVELOPMENTAL PLASTICITY OF THE HUMAN BRAIN

    Directory of Open Access Journals (Sweden)

    MILOS eJUDAS

    2013-08-01

    Full Text Available The human life-history is characterized by long development and introduction of new developmental stages, such as childhood and adolescence. The developing brain had important role in these life-history changes because it is expensive tissue which uses up to 80% of resting metabolic rate in the newborn and continues to use almost 50% of it during the first 5 postnatal years. Our hominid ancestors managed to lift-up metabolic constraints to increase in brain size by several interrelated ecological, behavioral and social adaptations, such as dietary change, invention of cooking, creation of family-bonded reproductive units, and life-history changes. This opened new vistas for the developing brain, because it became possible to metabolically support transient patterns of brain organization as well as developmental brain plasticity for much longer period and with much greater number of neurons and connectivity combinations in comparison to apes. This included the shaping of cortical connections through the interaction with infant's social environment, which probably enhanced typically human evolution of language, cognition and self-awareness. In this review, we propose that the transient subplate zone and its postnatal remnant (interstitial neurons of the gyral white matter probably served as the main playground for evolution of these developmental shifts, and describe various features that makes human subplate uniquely positioned to have such a role in comparison with other primates.

  20. Shift Work Disorder and Mental and Physical Effects of Shift Work

    Directory of Open Access Journals (Sweden)

    Pinar Guzel Ozdemir

    2018-03-01

    Full Text Available With the growing prevalence of shift work all over the the world, the relationship between the daily lives of irregular lifestyles and rhythms is being investigated for those working as shift workers and their families. The effect of shift work on physical and mental health is a very important field of research in recent years. The onset and persistence of medical complications in shift workers includes impaired synchronization between work schedule rhythms and circadian clock. In this context, studies have been carried out showing the increased risk of sleep-wake disorders, gastrointestinal problems, and cardiovascular diseases. There is little information about the actual frequency, effect on health and treatment of shift work disorder, known as circadian rhythm sleep disorder. Shift work disorder includes insomnia and/or excessive sleepiness related with the work schedule. The aim of this rewiev, mentioning about the physical and mental effects of shift work, and to provide information about the diagnosis, clinic and treatment methods of shift-work disorder.

  1. Toward social system theory: implications for older people with developmental disabilities and service delivery.

    Science.gov (United States)

    Dossa, P A

    1990-01-01

    The literature refers to older people with developmental disabilities as the "new service population." How and why this population emerged as a special category is discussed conceptually with reference to social systems theory. A brief review of social systems theory and some basic systemic tenets are presented. Systemic tenets are employed in examining the historical development of social gerontology and present trends in the service-delivery system. I show that the systemic variable of the economic model of human development has significantly impacted on the making of older people with developmental disabilities a dependent population. In the conclusion the systems perspective is explored in relation to recognizing the liminal, in-between parts between components. It is argued that such a perception minimizes the dichotomy between older people with developmental disabilities and the non-disabled population, paving the way for a genuine encounter.

  2. Developmental aspects of a life course approach to healthy ageing.

    Science.gov (United States)

    Hanson, M A; Cooper, C; Aihie Sayer, A; Eendebak, R J; Clough, G F; Beard, J R

    2016-04-15

    We examine the mechanistic basis and wider implications of adopting a developmental perspective on human ageing. Previous models of ageing have concentrated on its genetic basis, or the detrimental effects of accumulated damage, but also have raised issues about whether ageing can be viewed as adaptive itself, or is a consequence of other adaptive processes, for example if maintenance and repair processes in the period up to reproduction are traded off against later decline in function. A life course model places ageing in the context of the attainment of peak capacity for a body system, starting in early development when plasticity permits changes in structure and function induced by a range of environmental stimuli, followed by a period of decline, the rate of which depends on the peak attained as well as the later life conditions. Such path dependency in the rate of ageing may offer new insights into its modification. Focusing on musculoskeletal and cardiovascular function, we discuss this model and the possible underlying mechanisms, including endothelial function, oxidative stress, stem cells and nutritional factors such as vitamin D status. Epigenetic changes induced during developmental plasticity, and immune function may provide a common mechanistic process underlying a life course model of ageing. The life course trajectory differs in high and low resource settings. New insights into the developmental components of the life course model of ageing may lead to the design of biomarkers of later chronic disease risk and to new interventions to promote healthy ageing, with important implications for public health. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

  3. DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

    OpenAIRE

    Jelena Kostić; Milkica Nešić; Jasminka Marković; Miodrag Stanković

    2015-01-01

    Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to c...

  4. Non-occupational physical activity levels of shift workers compared with non-shift workers

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-01-01

    Objectives Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure–response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Methods Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Results Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1–4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure–response relationships were found between years of shift work and PA levels. Conclusions Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. PMID:27872151

  5. Perflurooctanoic acid induces developmental cardiotoxicity in chicken embryos and hatchlings

    International Nuclear Information System (INIS)

    Jiang, Qixiao; Lust, Robert M.; Strynar, Mark J.; Dagnino, Sonia; DeWitt, Jamie C.

    2012-01-01

    Highlights: ► PFOA exposure thinned right ventricular wall thickness in D19 chicken embryo hearts. ► PFOA exposure induced left ventricle hypertrophy in hearts of hatchling chickens. ► PFOA exposure induced altered cardiac function in hatchling chickens. -- Abstract: Perfluorooctanoic acid (PFOA) is a widespread environmental contaminant that is detectable in serum of the general U.S. population. PFOA is a known developmental toxicant that induces mortality in mammalian embryos and is thought to induce toxicity via interaction with the peroxisome proliferator activated receptor alpha (PPARα). As the cardiovascular system is crucial for embryonic survival, PFOA-induced effects on the heart may partially explain embryonic mortality. To assess impacts of PFOA exposure on the developing heart in an avian model, we used histopathology and immunohistochemical staining for myosin to assess morphological alterations in 19-day-old chicken embryo hearts after PFOA exposure. Additionally, echocardiography and cardiac myofibril ATPase activity assays were used to assess functional alterations in 1-day-old hatchling chickens following developmental PFOA exposure. Overall thinning and thinning of a dense layer of myosin in the right ventricular wall were observed in PFOA-exposed chicken embryo hearts. Alteration of multiple cardiac structural and functional parameters, including left ventricular wall thickness, left ventricular volume, heart rate, stroke volume, and ejection fraction were detected with echocardiography in the exposed hatchling chickens. Assessment of ATPase activity indicated that the ratio of cardiac myofibril calcium-independent ATPase activity to calcium-dependent ATPase activity was not affected, which suggests that developmental PFOA exposure may not affect cardiac energetics. In summary, structural and functional characteristics of the heart appear to be developmental targets of PFOA, possibly at the level of cardiomyocytes. Additional studies will

  6. Lorentz transformations, sideways shift and massless spinning particles

    Science.gov (United States)

    Bolonek-Lasoń, K.; Kosiński, P.; Maślanka, P.

    2017-06-01

    Recently (Stone et al. (2015) [16]) the influence of the so called ;Wigner translations; (more generally-Lorentz transformations) on circularly polarized Gaussian packets (providing the solution to Maxwell equations in paraxial approximation) has been studied. It appears that, within this approximation, the Wigner translations have an effect of shifting the wave packet trajectory parallel to itself by an amount proportional to the photon helicity. It has been suggested that this shift may result from specific properties of the algebra of Poincare generators for massless particles. In the present letter we describe the general relation between transformation properties of electromagnetic field on quantum and classical levels. It allows for a straightforward derivation of the helicity-dependent transformation rules. We present also an elementary derivation of the formula for sideways shift based on classical Maxwell theory. Some comments are made concerning the generalization to higher helicities and the relation to the coordinate operator defined long time ago by Pryce.

  7. Lorentz transformations, sideways shift and massless spinning particles

    Directory of Open Access Journals (Sweden)

    K. Bolonek-Lasoń

    2017-06-01

    Full Text Available Recently (Stone et al. (2015 [16] the influence of the so called “Wigner translations” (more generally-Lorentz transformations on circularly polarized Gaussian packets (providing the solution to Maxwell equations in paraxial approximation has been studied. It appears that, within this approximation, the Wigner translations have an effect of shifting the wave packet trajectory parallel to itself by an amount proportional to the photon helicity. It has been suggested that this shift may result from specific properties of the algebra of Poincare generators for massless particles. In the present letter we describe the general relation between transformation properties of electromagnetic field on quantum and classical levels. It allows for a straightforward derivation of the helicity-dependent transformation rules. We present also an elementary derivation of the formula for sideways shift based on classical Maxwell theory. Some comments are made concerning the generalization to higher helicities and the relation to the coordinate operator defined long time ago by Pryce.

  8. Lorentz transformations, sideways shift and massless spinning particles

    Energy Technology Data Exchange (ETDEWEB)

    Bolonek-Lasoń, K. [Department of Statistical Methods, Faculty of Economics and Sociology (Poland); Kosiński, P. [Department of Computer Science, Faculty of Physics and Applied Informatics, University of Łódź, Pomorska 149/153, 90-236 Łódź (Poland); Maślanka, P., E-mail: pmaslan@uni.lodz.pl [Department of Computer Science, Faculty of Physics and Applied Informatics, University of Łódź, Pomorska 149/153, 90-236 Łódź (Poland)

    2017-06-10

    Recently (Stone et al. (2015) ) the influence of the so called “Wigner translations” (more generally-Lorentz transformations) on circularly polarized Gaussian packets (providing the solution to Maxwell equations in paraxial approximation) has been studied. It appears that, within this approximation, the Wigner translations have an effect of shifting the wave packet trajectory parallel to itself by an amount proportional to the photon helicity. It has been suggested that this shift may result from specific properties of the algebra of Poincare generators for massless particles. In the present letter we describe the general relation between transformation properties of electromagnetic field on quantum and classical levels. It allows for a straightforward derivation of the helicity-dependent transformation rules. We present also an elementary derivation of the formula for sideways shift based on classical Maxwell theory. Some comments are made concerning the generalization to higher helicities and the relation to the coordinate operator defined long time ago by Pryce.

  9. Temperature shift effect on the Chlorobaculum tepidum chlorosomes.

    Science.gov (United States)

    Tang, Joseph Kuo-Hsiang; Xu, Ying; Muhlmann, Guillermo M; Zare, Farrokh; Khin, Yadana; Tam, Sun W

    2013-05-01

    Chlorobaculum [Cba.] tepidum is known to grow optimally at 48-52 °C and can also be cultured at ambient temperatures. In this paper, we prepared constant temperature, temperature shift, and temperature shift followed by backshift cultures and investigated the intrinsic properties and spectral features of chlorosomes from those cultures using various approaches, including temperature-dependent measurements on circular dichroism (CD), UV-visible, and dynamic light scattering. Our studies indicate that (1) chlorosomes from constant temperature cultures at 50 and 30 °C exhibited more resistance to heat relative to temperature shift cultures; (2) as temperature increases bacteriochlorophyll c (BChl c) in chlorosomes is prone to demetalation, which forms bacteriopheophytin c, and degradation under aerobic conditions. Some BChl c aggregates inside reduced chlorosomes prepared in low-oxygen environments can reform after heat treatments; (3) temperature shift cultures synthesize and incorporate more BChl c homologs with a smaller substituent at C-8 on the chlorin ring and less BChl c homologs with a larger long-chain alcohol at C-17(3) versus constant-temperature cultures. We hypothesize that the long-chain alcohol at C-17(3) (and perhaps together with the substituent at C-8) may account for thermal stability of chlorosomes and the substituent at C-8 may assist self-assembling BChls; and (4) while almost identical absorption spectra are detected, chlorosomes from different growth conditions exhibited differences in the rotational length of the CD signal, and aerobic and reduced chlorosomes also display different Qy CD intensities. Further, chlorosomes exhibited changes of CD features in response to temperature increases. Additionally, we compare temperature-dependent studies for the Cba. tepidum chlorosomes and previous studies for the Chloroflexus aurantiacus chlorosomes. Together, our work provides useful and novel insights on the properties and organization of

  10. Reduced Tolerance to Night Shift in Chronic Shift Workers: Insight From Fractal Regulation.

    Science.gov (United States)

    Li, Peng; Morris, Christopher J; Patxot, Melissa; Yugay, Tatiana; Mistretta, Joseph; Purvis, Taylor E; Scheer, Frank A J L; Hu, Kun

    2017-07-01

    Healthy physiology is characterized by fractal regulation (FR) that generates similar structures in the fluctuations of physiological outputs at different time scales. Perturbed FR is associated with aging and age-related pathological conditions. Shift work, involving repeated and chronic exposure to misaligned environmental and behavioral cycles, disrupts circadian coordination. We tested whether night shifts perturb FR in motor activity and whether night shifts affect FR in chronic shift workers and non-shift workers differently. We studied 13 chronic shift workers and 14 non-shift workers as controls using both field and in-laboratory experiments. In the in-laboratory study, simulated night shifts were used to induce a misalignment between the endogenous circadian pacemaker and the sleep-wake cycles (ie, circadian misalignment) while environmental conditions and food intake were controlled. In the field study, we found that FR was robust in controls but broke down in shift workers during night shifts, leading to more random activity fluctuations as observed in patients with dementia. The night shift effect was present even 2 days after ending night shifts. The in-laboratory study confirmed that night shifts perturbed FR in chronic shift workers and showed that FR in controls was more resilience to the circadian misalignment. Moreover, FR during real and simulated night shifts was more perturbed in those who started shift work at older ages. Chronic shift work causes night shift intolerance, which is probably linked to the degraded plasticity of the circadian control system. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  11. Topographic processing in developmental prosopagnosia

    DEFF Research Database (Denmark)

    Klargaard, Solja K.; Starrfelt, Randi; Petersen, Anders

    2016-01-01

    deficit in visual processing or visual short-term memory. Interestingly, a classical dissociation could be demonstrated between impaired face memory and preserved topographic memory in two developmental prosopagnosics. We conclude that impairments in topographic memory tend to co-occur with developmental......Anecdotal evidence suggests a relation between impaired spatial (navigational) processing and developmental prosopagnosia. To address this formally, we tested two aspects of topographic processing – that is, perception and memory of mountain landscapes shown from different viewpoints. Participants...

  12. Developmental stages of developmental screening: steps to implementation of a successful program.

    Science.gov (United States)

    Pinto-Martin, Jennifer A; Dunkle, Margaret; Earls, Marian; Fliedner, Dane; Landes, Cynthia

    2005-11-01

    Through the use of 2-stage screening strategies, research studies have shown that autism spectrum disorders and other developmental disabilities can now be detected reliably and with greater validity and in children as young as 18 months of age. Screening and diagnostic practices in the medical and educational arena lag far behind clinical research, however, with the average patient age at time of diagnosis being 3 to 6 years.We discuss the challenges of instituting universal developmental screening as part of pediatric care and present 2 models of existing or planned programs of early screening for autism spectrum disorder and developmental disability (1 in a community-based setting and 1 in a pediatric setting), and discuss the pros and cons of the different strategies.

  13. Shift of the superconducting critical parameters due to correlated disorder

    International Nuclear Information System (INIS)

    Gitterman, M.; Shapiro, I.; Shapiro, B.Ya.

    2012-01-01

    Shift of the critical temperature and second critical magnetic field are calculated for a superconductor with Gaussian correlated disorder. All calculations have been performed in the framework of the stochastic Ginzburg-Landau equation. For uncorrelated disorder the macroscopic critical temperature is determined by the average of the local critical temperature across the sample, while for correlated disorder both the critical temperature and the upper critical magnetic field depend on disorder correlation length. In a nonuniform superconductor with randomly distributed local critical temperature both the macroscopic critical temperature and the upper critical magnetic field strongly depend on the characteristic correlation length ρ 0 of correlated disorder. The shift of the macroscopic critical parameters from those for non-correlated disorder, which does not exist for white noise, is obtained for small ρ 0 in the framework of the Ginzburg-Landau theory.

  14. Knight shift in scandium and its alloys with hafnium and titanium

    International Nuclear Information System (INIS)

    Chachkhiani, Z.B.; Chechernikov, V.I.; Martynova, L.F.; Nidel'ko, V.I.; Chachkhiani, L.G.; Georgadze, G.S.

    1981-01-01

    Results of the investigation of NMR on 45 Sc nuclei and magnetic susceptibility of scandium and its solid solutions with titanium and hafnium are presented. It is shown that the existing hybridization of S and d zones in pure scandium and its alloys with titanium and hafnium affects the Knight shift reducing the value of the contact contribution. The temperature behaviour of the Knight shift from the temperature dependence and spin susceptibility of collectivized d electrons [ru

  15. Linking neuroscience and psychoanalysis from a developmental perspective: why and how?

    Science.gov (United States)

    Ouss-Ryngaert, Lisa; Golse, Bernard

    2010-12-01

    This paper aims to develop the rational to support why and how we should link neuroscience and psychoanalysis. Many of these points are derived from child development and child psychiatry. Neuroscience investigates developmental questions in a different way than psychoanalysis, while psychoanalysis itself has shifted towards new developmental paradigms. The rapprochement between neuroscience and psychoanalysis allows a new understanding of some concepts, including embodiment of mind, consciousness and attachment. The "double reading" paradigm allows a better understanding of symptomatic configurations. Linking neuroscience and psychoanalysis may improve treatments and result in new experimental neuroscientific paradigms involving changing the research object, changing the state of the research object, and investigating the structural changes in the brain following psychotherapy. The last aim is to create an epistemology of the articulation between the theoretical frameworks through phenomenology, "complementarism" and neuropsychoanalysis. We argue that it is necessary for clinicians to be aware of the advancements in each field. This is not only an epistemological question; we assume that new findings in neuroscience will change the way psychoanalysts think and approach treatment of their patients. We hope the present research will contribute to change the way that neuroscientists think and will provide new options to their set of experimental paradigms. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Supporting Space Systems Design via Systems Dependency Analysis Methodology

    Science.gov (United States)

    Guariniello, Cesare

    The increasing size and complexity of space systems and space missions pose severe challenges to space systems engineers. When complex systems and Systems-of-Systems are involved, the behavior of the whole entity is not only due to that of the individual systems involved but also to the interactions and dependencies between the systems. Dependencies can be varied and complex, and designers usually do not perform analysis of the impact of dependencies at the level of complex systems, or this analysis involves excessive computational cost, or occurs at a later stage of the design process, after designers have already set detailed requirements, following a bottom-up approach. While classical systems engineering attempts to integrate the perspectives involved across the variety of engineering disciplines and the objectives of multiple stakeholders, there is still a need for more effective tools and methods capable to identify, analyze and quantify properties of the complex system as a whole and to model explicitly the effect of some of the features that characterize complex systems. This research describes the development and usage of Systems Operational Dependency Analysis and Systems Developmental Dependency Analysis, two methods based on parametric models of the behavior of complex systems, one in the operational domain and one in the developmental domain. The parameters of the developed models have intuitive meaning, are usable with subjective and quantitative data alike, and give direct insight into the causes of observed, and possibly emergent, behavior. The approach proposed in this dissertation combines models of one-to-one dependencies among systems and between systems and capabilities, to analyze and evaluate the impact of failures or delays on the outcome of the whole complex system. The analysis accounts for cascading effects, partial operational failures, multiple failures or delays, and partial developmental dependencies. The user of these methods can

  17. PEAK SHIFTS PRODUCED BY CORRELATED RESPONSE TO SELECTION.

    Science.gov (United States)

    Price, Trevor; Turelli, Michael; Slatkin, Montgomery

    1993-02-01

    Traits may evolve both as a consequence of direct selection and also as a correlated response to selection on other traits. While correlated response may be important for both the production of evolutionary novelty and in the build-up of complex characters, its potential role in peak shifts has been neglected empirically and theoretically. We use a quantitative genetic model to investigate the conditions under which a character, Y, which has two alternative optima, can be dragged from one optimum to the other as a correlated response to selection on a second character, X. High genetic correlations between the two characters make the transition, or peak shift, easier, as does weak selection tending to restore Y to the optimum from which it is being dragged. When selection on Y is very weak, the conditions for a peak shift depend only on the location of the new optimum for X and are independent of the strength of selection moving it there. Thus, if the "adaptive valley" for Y is very shallow, little reduction in mean fitness is needed to produce a shift. If the selection acts strongly to keep Y at its current optimum, very intense directional selection on X, associated with a dramatic drop in mean fitness, is required for a peak shift. When strong selection is required, the conditions for peak shifts driven by correlated response might occur rarely, but still with sufficient frequency on a geological timescale to be evolutionarily important. © 1993 The Society for the Study of Evolution.

  18. Non-occupational physical activity levels of shift workers compared with non-shift workers.

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Vermeulen, Roel C H; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-05-01

    Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure-response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1-4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure-response relationships were found between years of shift work and PA levels. Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  19. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

    2017-01-01

    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  20. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

    2017-01-01

    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  1. Larval performance of the mustard leaf beetle (Phaedon cochleariae, Coleoptera, Chrysomelidae) on white mustard (Sinapis alba) and watercress (Nasturtium officinale) leaves in dependence of plant exposure to ultraviolet radiation

    International Nuclear Information System (INIS)

    Reifenrath, Kerstin; Mueller, Caroline

    2009-01-01

    Short-term exposure to ambient or attenuated ultraviolet (UV) radiation resulted in shifts in plant metabolite concentrations of the Brassicaceae Sinapis alba and Nasturtium officinale. Leaf quality also varied between plant species and within species due to age. Larvae of the oligophagous leaf beetle Phaedon cochleariae were raised on these different host leaves, in order to investigate the effects of variable plant chemistry on this herbivore. The performance of P. cochleariae was influenced by chemical differences between and within plant species but it responded with high plasticity to plants stressed by ultraviolet radiation. Body mass increase and developmental times of larvae were exclusively affected by plant species and leaf-age. However, developmental differences were fully compensated in the pupal stage. We suggest that the plasticity of herbivores may depend on the degree of specialisation, and insect performance may not necessarily be altered by stress-induced host plants. - The larval performance of an oligophagous leaf beetle is influenced by chemical differences between and within plant species but responds with high plasticity to plants stressed by ultraviolet radiation.

  2. Organic-soluble lanthanide nuclear magnetic resonance shift reagents for sulfonium and isothiouronium salts

    International Nuclear Information System (INIS)

    Wenzel, T.J.; Zaia, J.

    1987-01-01

    Lanthanide complexes of the formula [Ln(fod) 4 ] - (FOD, 6,6,7,7,8,8,8-heptafluoro-2,2-dimethyl-3,5-octanedione) are effective organic-soluble nuclear magnetic resonance shift reagents for sulfonium and isothiouronium salts. The shift reagent is formed in solution from Ln(fod) 3 and Ag(fod) or K(fod). The selection of Ag(fod) or K(fod) in forming the shift reagent is dependent on the anion of the organic salt. Ag(fod) is more effective with halide salts, whereas K(fod) is preferred with tetrafluoroborate salts. Resolution of diastereotopic hydrogen atoms was observed in the shifted spectra of certain substrates. Enantiomeric resolution was obtained in the spectrum of sec-butylisothiouronium chloride with a chiral shift reagent. The reagents can be employed in solvents such as chloroform and benzene

  3. How do employees prioritise when they schedule their own shifts?

    Science.gov (United States)

    Nabe-Nielsen, Kirsten; Lund, Henrik; Ajslev, Jeppe Z; Hansen, Åse Marie; Albertsen, Karen; Hvid, Helge; Garde, Anne Helene

    2013-01-01

    We investigated how employees prioritised when they scheduled their own shifts and whether priorities depended on age, gender, educational level, cohabitation and health status. We used cross-sectional questionnaire data from the follow-up survey of an intervention study investigating the effect of self-scheduling (n = 317). Intervention group participants were asked about their priorities when scheduling their own shifts succeeded by 17 items covering family/private life, economy, job content, health and sleep. At least half of the participants reported that they were giving high priority to their family life, having consecutive time off, leisure-time activities, rest between shifts, sleep, regularity of their everyday life, health and that the work schedule balanced. Thus, employees consider both their own and the workplace's needs when they have the opportunity to schedule their own shifts. Age, gender, cohabitation and health status were all significantly associated with at least one of these priorities. Intervention studies report limited health effects of self-scheduling. Therefore, we investigated to what extent employees prioritise their health and recuperation when scheduling their own shifts. We found that employees not only consider both their health and family but also the workplace's needs when they schedule their own shifts.

  4. A transactional framework for pediatric rehabilitation: shifting the focus to situated contexts, transactional processes, and adaptive developmental outcomes.

    Science.gov (United States)

    King, Gillian; Imms, Christine; Stewart, Debra; Freeman, Matt; Nguyen, Tram

    2018-07-01

    A paradigm shift is taking place in pediatric rehabilitation research, practice, and policy - a shift towards the real-life contexts of clients rather than requiring clients to navigate the world of pediatric rehabilitation. This article proposes a conceptual framework to bring about a broader awareness of clients' lives and transactional processes of change over the life course. The framework draws attention to transactional processes by which individuals, situated in life contexts, change and adapt over the life course and, in turn, influence their contextual settings and broader environments. This framework is based on (a) basic tenets derived from foundational theories taking a life course perspective to change, and (b) transactional processes identified from relevant pediatric rehabilitation models that bring these foundational theories into the pediatric rehabilitation sphere. The framework identifies three types of transactional processes relevant to pediatric rehabilitation: facilitative, resiliency, and socialization processes. These processes describe how contexts and people mutually influence each other via opportunities and situated experiences, thus facilitating capacity, adaptation to adversity, and socialization to new roles and life transitions. The utility of the framework is considered for research, practice, service organizations, and policy. Implications for Rehabilitation The framework supports practitioners going beyond person and environment as separate entities, to provide services to the "situated person" in real-life contexts The framework shifts the focus from "body structures/functions" and "person in activity" to "person in changing and challenging life contexts" Working from a transactional perspective, practitioner-client conversations will change; practitioners will view client situations through a lens of opportunities and experiences, assess client experiences in real-life contexts, and strive to create context-based therapy

  5. Developmental control of hypoxia during bud burst in grapevine.

    Science.gov (United States)

    Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

    2018-05-01

    Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

  6. Effect of temperature-dependent energy-level shifts on a semiconductor's Peltier heat

    International Nuclear Information System (INIS)

    Emin, D.

    1984-01-01

    The Peltier heat of a charge carrier in a semiconductor is calculated for the situation in which the electronic energy levels are temperature dependent. The temperature dependences of the electronic energy levels, generally observed optically, arise from their dependences on the vibrational energy of the lattice (e.g., as caused by thermal expansion). It has been suggested that these temperature dependences will typically have a major effect on the Peltier heat. The Peltier heat associated with a given energy level is a thermodynamic quantity; it is the product of the temperature and the change of the entropy of the system when a carrier is added in that level. As such, the energy levels cannot be treated as explicitly temperature dependent. The electron-lattice interaction causing the temperature dependence must be expressly considered. It is found that the carrier's interaction with the atomic vibrations lowers its electronic energy. However, the interaction of the carrier with the atomic vibrations also causes an infinitesimal lowering (approx.1/N) of each of the N vibrational frequencies. As a result, there is a finite carrier-induced increase in the average vibrational energy. Above the Debye temperature, this cancels the lowering of the carrier's electronic energy. Thus, the standard Peltier-heat formula, whose derivation generally ignores the temperature dependence of the electronic energy levels, is regained. This explains the apparent success of the standard formula in numerous analyses of electronic transport experiments

  7. Ocean currents modify the coupling between climate change and biogeographical shifts.

    Science.gov (United States)

    García Molinos, J; Burrows, M T; Poloczanska, E S

    2017-05-02

    Biogeographical shifts are a ubiquitous global response to climate change. However, observed shifts across taxa and geographical locations are highly variable and only partially attributable to climatic conditions. Such variable outcomes result from the interaction between local climatic changes and other abiotic and biotic factors operating across species ranges. Among them, external directional forces such as ocean and air currents influence the dispersal of nearly all marine and many terrestrial organisms. Here, using a global meta-dataset of observed range shifts of marine species, we show that incorporating directional agreement between flow and climate significantly increases the proportion of explained variance. We propose a simple metric that measures the degrees of directional agreement of ocean (or air) currents with thermal gradients and considers the effects of directional forces in predictions of climate-driven range shifts. Ocean flows are found to both facilitate and hinder shifts depending on their directional agreement with spatial gradients of temperature. Further, effects are shaped by the locations of shifts in the range (trailing, leading or centroid) and taxonomic identity of species. These results support the global effects of climatic changes on distribution shifts and stress the importance of framing climate expectations in reference to other non-climatic interacting factors.

  8. Effective slip for Stokes flow between two grooved walls with an arbitrary phase shift

    Energy Technology Data Exchange (ETDEWEB)

    Ng, Chiu-On, E-mail: cong@hku.hk [Department of Mechanical Engineering, The University of Hong Kong, Pokfulam Road (Hong Kong)

    2017-04-15

    This work aims to determine how the effective slip length for a wall-bounded flow may depend on, among other geometrical parameters, the phase shift between patterns on the two walls. An analytical model is developed for Stokes flow through a channel bounded by walls patterned with a regular array of rectangular ribs and grooves, where the patterns on the two walls can be misaligned by any phase shift. This study incorporates several previous studies as limiting or special cases. It is shown that the phase shift can have qualitatively different effects on the flow rate and effective slip length, depending on the flow direction. In a narrow channel, increasing the phase shift may mildly decrease the flow rate and effective slip length for flow parallel to the grooves, but can dramatically increase the flow rate and effective slip length for flow transverse to the grooves. It is found that unless the channel height is much larger than the period of the wall pattern, the effect due to wall confinement has to be taken into account on evaluating the effective slip lengths. (paper)

  9. OpenShift Workshop

    CERN Multimedia

    CERN. Geneva; Rodriguez Peon, Alberto

    2017-01-01

    Workshop to introduce developers to the OpenShift platform available at CERN. Several use cases will be shown, including deploying an existing application into OpenShift. We expect attendees to realize about OpenShift features and general architecture of the service.

  10. Developmental environment mediates male seminal protein investment in Drosophila melanogaster.

    Science.gov (United States)

    Wigby, Stuart; Perry, Jennifer C; Kim, Yon-Hee; Sirot, Laura K

    2016-03-01

    Males of many species fine-tune their ejaculates in response to sperm competition risk. Resource availability and the number of competitors during development can also strongly influence sperm production. However, despite the key role of seminal proteins in mediating reproductive processes, it is unclear whether seminal protein investment is dependent on the developmental environment.We manipulated the developmental environment of Drosophila melanogaster by rearing flies at low and high density. As expected, this resulted in large and small (i.e. high and low condition) adult phenotypes, respectively.As predicted, large males produced more of two key seminal proteins, sex peptide (SP) and ovulin, and were more successful at obtaining matings with both virgin and previously mated females. However, there was only a weak and non-significant trend for large males to transfer more absolute quantities of SP at mating, and thus, small males ejaculated proportionally more of their stored accessory gland SP resources.Males transferred more receptivity-inhibiting SP to large females. Despite this, large females remated more quickly than small females and thus responded to their developmental environment over and above the quantity of SP they received.The results are consistent with two non-mutually exclusive hypotheses. First, flies might respond to condition-dependent reproductive opportunities, with (i) small males investing heavily in ejaculates when mating opportunities arise and large males strategically partitioning SP resources and (ii) small females remating at reduced rates because they have higher mating costs or need to replenish sperm less often.Second, flies may be primed by their larval environment to deal with similar adult population densities, with (i) males perceiving high density as signalling increased competition, leading small males to invest proportionally more SP resources at mating and (ii) females perceiving high density as signalling abundant

  11. Contributors to shift work tolerance in South Korean nurses working rotating shift.

    Science.gov (United States)

    Jung, Hye-Sun; Lee, Bokim

    2015-05-01

    Shift workers have rapidly increased in South Korea; however, there is no published research exploring shift work tolerance among South Korean workers. This study aimed to investigate factors related to shift work tolerance in South Korean nurses. The sample comprised of 660 nurses who worked shifts in a large hospital in South Korea. A structured questionnaire included following comprehensive variables: demographic (age and number of children), individual (morningness and self-esteem), psychosocial (social support and job stress), lifestyle (alcohol consumption, physical activity, and BMI), and working condition factors (number of night shifts and working hours). Shift work tolerance was measured in terms of insomnia, fatigue, and depression. The results of hierarchical regressions indicate that all variables, except for three, number of children, BMI, and working hours, were related to at least one of the symptoms associated with shift work tolerance. Based on these results, we offer some practical implications to help improve shift work tolerance of workers. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Non-Adjacent Dependency Learning in Infants at Familial Risk of Dyslexia

    Science.gov (United States)

    Kerkhoff, Annemarie; de Bree, Elise; de Klerk, Maartje; Wijnen, Frank

    2013-01-01

    This study tests the hypothesis that developmental dyslexia is (partly) caused by a deficit in implicit sequential learning, by investigating whether infants at familial risk of dyslexia can track non-adjacent dependencies in an artificial language. An implicit learning deficit would hinder detection of such dependencies, which mark grammatical…

  13. Systematic review of the relationship between quick returns in rotating shift work and health-related outcomes.

    Science.gov (United States)

    Vedaa, Øystein; Harris, Anette; Bjorvatn, Bjørn; Waage, Siri; Sivertsen, Børge; Tucker, Philip; Pallesen, Ståle

    2016-01-01

    A systematic literature search was carried out to investigate the relationship between quick returns (i.e., 11.0 hours or less between two consecutive shifts) and outcome measures of health, sleep, functional ability and work-life balance. A total of 22 studies published in 21 articles were included. Three types of quick returns were differentiated (from evening to morning/day, night to evening, morning/day to night shifts) where sleep duration and sleepiness appeared to be differently affected depending on which shifts the quick returns occurred between. There were some indications of detrimental effects of quick returns on proximate problems (e.g., sleep, sleepiness and fatigue), although the evidence of associations with more chronic outcome measures (physical and mental health and work-life balance) was inconclusive. Modern societies are dependent on people working shifts. This study systematically reviews literature on the consequences of quick returns (11.0 hours or less between two shifts). Quick returns have detrimental effects on acute health problems. However, the evidence regarding effects on chronic health is inconclusive.

  14. Developmental trajectories of cerebrovascular reactivity in healthy children and young adults assessed with magnetic resonance imaging.

    Science.gov (United States)

    Leung, Jackie; Kosinski, Przemyslaw D; Croal, Paula L; Kassner, Andrea

    2016-05-15

    . The significant age-dependent changes in CVR and CBF demonstrate the evolution of cerebral haemodynamics in children and should be taken into consideration. The shift in developmental trajectory of CVR from increasing to decreasing suggests that physiological factors beyond baseline CBF also influence CVR. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

  15. Developmental toxicity evaluation of three hexabromocyclododecane diastereoisomers on zebrafish embryos

    Energy Technology Data Exchange (ETDEWEB)

    Du Miaomiao [Key Lab of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Graduate University of Chinese Academy of Sciences, Beijing 100049 (China); Zhang Dandan; Yan Changzhou [Key Lab of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China); Zhang Xian, E-mail: xzhang@iue.ac.cn [Key Lab of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021 (China)

    2012-05-15

    Structural dissimilarities of hexabromocyclododecane diastereoisomers could raise substantial differences in physicochemical, biological and toxicological properties. In order to fully assess the environmental safety and health risk of hexabromocyclododecanes (HBCDs), zebrafish embryos were used to evaluate the developmental toxicity of individual HBCD diastereoisomers ({alpha}-HBCD, {beta}-HBCD and {gamma}-HBCD). Four-hour post-fertilization (hpf) zebrafish embryos were exposed to different concentrations of HBCD diastereoisomers (0, 0.01, 0.1 and 1.0 mg/l) until 120 hpf. The results showed that exposure to HBCDs can affect the development of zebrafish embryos/larvae in a dose-dependent and diastereoselective manner. The diastereoisomers {alpha}-, {beta}- and {gamma}-HBCD at 0.01 mg/l had little effect on the development of zebrafish embryos except that exposure to 0.01 mg/l {gamma}-HBCD significantly delayed hatching (P < 0.05). At 0.1 mg/l, {alpha}-HBCD resulted in depressed heart rate of larvae (96 hpf) and delayed hatching, whereas {beta}- and {gamma}-HBCD both caused significant hatching delay and growth inhibition (P < 0.05). In addition, a remarkable and significant increase in mortality and malformation rate was noted at 0.1 mg/l {gamma}-HBCD exposure groups (P < 0.05). At 1.0 mg/l, {alpha}-, {beta}- and {gamma}-HBCD significantly affected all of the endpoints monitored (P < 0.05). Additionally, HBCD diastereoisomers could induce the generation of reactive oxygen species (ROS) and the activities of caspase-3 and caspase-9 in a dose-dependent manner. The results indicated that HBCD diastereoisomers could cause developmental toxicity to zebrafish embryos through inducing apoptosis by ROS formation. The overall results showed a good agreement confirming that the order of developmental toxicity of HBCD diastereoisomers in zebrafish is {gamma}-HBCD > {beta}-HBCD > {alpha}-HBCD.

  16. Nonlinear frequency shift of finite-amplitude electrostatic surface waves

    International Nuclear Information System (INIS)

    Stenflo, L.

    1989-01-01

    The problem concerning the appropriate form for the nonlinear frequency shift arising from slow density modulations of electrostatic surface waves in a semi-infinite unmagnetized plasma is reconsidered. The spatial dependence of the wave amplitude normal to the surface is kept general in order to allow for possible nonlinear attenuation behaviour of the surface waves. It is found that if the frequency shift is expressed as a function of the density and its gradient then the result is identical with that of Zhelyazkov, I. Proceedings International Conference on Plasma Physics, Kiev, 1987, Vol. 2, p. 694, who assumed a linear exponential attenuation behaviour. (author)

  17. Expert system application for prioritizing preventive actions for shift work: shift expert.

    Science.gov (United States)

    Esen, Hatice; Hatipoğlu, Tuğçen; Cihan, Ahmet; Fiğlali, Nilgün

    2017-09-19

    Shift patterns, work hours, work arrangements and worker motivations have increasingly become key factors for job performance. The main objective of this article is to design an expert system that identifies the negative effects of shift work and prioritizes mitigation efforts according to their importance in preventing these negative effects. The proposed expert system will be referred to as the shift expert. A thorough literature review is conducted to determine the effects of shift work on workers. Our work indicates that shift work is linked to demographic variables, sleepiness and fatigue, health and well-being, and social and domestic conditions. These parameters constitute the sections of a questionnaire designed to focus on 26 important issues related to shift work. The shift expert is then constructed to provide prevention advice at the individual and organizational levels, and it prioritizes this advice using a fuzzy analytic hierarchy process model, which considers comparison matrices provided by users during the prioritization process. An empirical study of 61 workers working on three rotating shifts is performed. After administering the questionnaires, the collected data are analyzed statistically, and then the shift expert produces individual and organizational recommendations for these workers.

  18. Reading in developmental prosopagnosia

    DEFF Research Database (Denmark)

    Starrfelt, Randi; Klargaard, Solja K; Petersen, Anders

    2018-01-01

    exposure durations (targeting the word superiority effect), and d) text reading. RESULTS: Participants with developmental prosopagnosia performed strikingly similar to controls across the four reading tasks. Formal analysis revealed a significant dissociation between word and face recognition......, that is, impaired reading in developmental prosopagnosia. METHOD: We tested 10 adults with developmental prosopagnosia and 20 matched controls. All participants completed the Cambridge Face Memory Test, the Cambridge Face Perception test and a Face recognition questionnaire used to quantify everyday face...... recognition experience. Reading was measured in four experimental tasks, testing different levels of letter, word, and text reading: (a) single word reading with words of varying length,(b) vocal response times in single letter and short word naming, (c) recognition of single letters and short words at brief...

  19. Goos-Hänchen shift of partially coherent light fields in epsilon-near-zero metamaterials

    Science.gov (United States)

    Ziauddin; Chuang, You-Lin; Qamar, Sajid; Lee, Ray-Kuang

    2016-05-01

    The Goos-Hänchen (GH) shifts in the reflected light are investigated both for p and s polarized partial coherent light beams incident on epsilon-near-zero (ENZ) metamaterials. In contrary to the coherent counterparts, the magnitude of GH shift becomes non-zero for p polarized partial coherent light beam; while GH shift can be relatively large with a small degree of spatial coherence for s polarized partial coherent beam. Dependence on the beam width and the permittivity of ENZ metamaterials is also revealed for partial coherent light fields. Our results on the GH shifts provide a direction on the applications for partial coherent light sources in ENZ metamaterials.

  20. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

    Directory of Open Access Journals (Sweden)

    Kamila Maliszewska-Olejniczak

    2015-07-01

    Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium

  1. Representational shifts made visible: Movement away from the prototype in memory for hue

    Directory of Open Access Journals (Sweden)

    Laura Jane Kelly

    2014-07-01

    Full Text Available In four experiments, a total of 205 participants studied individual color patches and were given an old-new recognition test after a brief retention interval (0.5 or 5.0 s. The pattern of false alarms revealed hue memory shifting away from the prototype of the hue’s basic color category. The shifts demonstrate that hue memory is influenced by categorization early in processing. The shifts did not depend on intentional categorization; the shifts were found even when participants made preference ratings at encoding rather than labeling judgments. Overall, we found that categorization and memory are deeply intertwined from perception onward. We discuss the impact of the results on theories of memory and categorization, including the effects of category labels on memory (e.g., Lupyan, 2008. We also put forward the hypothesis that atypical shifts in hue are related to atypical shifts that have previously observed in face recognition (Rhodes et al., 1987.

  2. Implementing OpenShift

    CERN Document Server

    Miller, Adam

    2013-01-01

    A standard tutorial-based approach to using OpenShift and deploying custom or pre-built web applications to the OpenShift Online cloud.This book is for software developers and DevOps alike who are interested in learning how to use the OpenShift Platform-as-a-Service for developing and deploying applications, how the environment works on the back end, and how to deploy their very own open source Platform-as-a-Service based on the upstream OpenShift Origin project.

  3. Shifted one-parameter supersymmetric family of quartic asymmetric double-well potentials

    International Nuclear Information System (INIS)

    Rosu, Haret C.; Mancas, Stefan C.; Chen, Pisin

    2014-01-01

    Extending our previous work (Rosu, 2014), we define supersymmetric partner potentials through a particular Riccati solution of the form F(x)=(x−c) 2 −1, where c is a real shift parameter, and work out the quartic double-well family of one-parameter isospectral potentials obtained by using the corresponding general Riccati solution. For these parametric double well potentials, we study how the localization properties of the two wells depend on the parameter of the potentials for various values of the shifting parameter. We also consider the supersymmetric parametric family of the first double-well potential in the Razavy chain of double well potentials corresponding to F(x)=1/2 sinh2x−2((1+√(2))sinh2x)/((1+√(2))cosh2x+1) , both unshifted and shifted, to test and compare the localization properties. - Highlights: • Quartic one-parameter DWs with an additional shift parameter are introduced. • Anomalous localization feature of their zero modes is confirmed at different shifts. • Razavy one-parameter DWs are also introduced and shown not to have this feature

  4. Shifted one-parameter supersymmetric family of quartic asymmetric double-well potentials

    Energy Technology Data Exchange (ETDEWEB)

    Rosu, Haret C., E-mail: hcr@ipicyt.edu.mx [IPICYT, Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la presa San José 2055, Col. Lomas 4a Sección, 78216 San Luis Potosí, S.L.P. (Mexico); Mancas, Stefan C., E-mail: mancass@erau.edu [Department of Mathematics, Embry-Riddle Aeronautical University, Daytona Beach, FL 32114-3900 (United States); Chen, Pisin, E-mail: pisinchen@phys.ntu.edu.tw [Leung Center for Cosmology and Particle Astrophysics (LeCosPA) and Department of Physics, National Taiwan University, Taipei 10617, Taiwan (China)

    2014-10-15

    Extending our previous work (Rosu, 2014), we define supersymmetric partner potentials through a particular Riccati solution of the form F(x)=(x−c){sup 2}−1, where c is a real shift parameter, and work out the quartic double-well family of one-parameter isospectral potentials obtained by using the corresponding general Riccati solution. For these parametric double well potentials, we study how the localization properties of the two wells depend on the parameter of the potentials for various values of the shifting parameter. We also consider the supersymmetric parametric family of the first double-well potential in the Razavy chain of double well potentials corresponding to F(x)=1/2 sinh2x−2((1+√(2))sinh2x)/((1+√(2))cosh2x+1) , both unshifted and shifted, to test and compare the localization properties. - Highlights: • Quartic one-parameter DWs with an additional shift parameter are introduced. • Anomalous localization feature of their zero modes is confirmed at different shifts. • Razavy one-parameter DWs are also introduced and shown not to have this feature.

  5. Isotope effect on the zero point energy shift upon condensation

    International Nuclear Information System (INIS)

    Kornblum, Z.C.; Ishida, T.

    1977-07-01

    The various isotope-dependent and independent atomic and molecular properties that pertain to the isotopic difference between the zero point energy (ZPE) shifts upon condensation were derived. The theoretical development of the change of the ZPE associated with the internal molecular vibrations, due to the condensation of the gaseous molecules, is presented on the basis of Wolfsberg's second-order perturbation treatment of the isotope-dependent London dispersion forces between liquid molecules. The isotope effect on the ZPE shift is related to the difference between the sums of the integrated intensities of the infrared absorption bands of the two gaseous isotopic molecules. The effective atomic charges are also calculated from available experimental infrared intensity data. The effects of isotopic substitutions of carbon-13 for carbon-12 and/or deuterium for protium, in ethylene, methane, and the fluorinated methanes, CH 3 F, CH 2 F 2 , CHF 3 , and CF 4 , on the ZPE shift upon condensation are calculated. These results compare well with the Bigeleisen B-factors, which are experimentally obtained from vapor pressure measurements of the isotopic species. Each of the following molecular properties will tend to increase the isotopic difference between the ZPE shifts upon condensation: (1) large number of highly polar bonds, (2) high molecular weight, (3) non-polar (preferably) or massive molecule, (4) non-hydrogenous molecule, and (5) closely packed liquid molecules. These properties will result in stronger dispersion forces in the liquid phase between the lighter molecules than between the isotopically heavier molecules. 36 tables, 9 figures

  6. Practical use of chemical shift databases for protein solid-state NMR: 2D chemical shift maps and amino-acid assignment with secondary-structure information

    International Nuclear Information System (INIS)

    Fritzsching, K. J.; Yang, Y.; Schmidt-Rohr, K.; Hong Mei

    2013-01-01

    We introduce a Python-based program that utilizes the large database of 13 C and 15 N chemical shifts in the Biological Magnetic Resonance Bank to rapidly predict the amino acid type and secondary structure from correlated chemical shifts. The program, called PACSYlite Unified Query (PLUQ), is designed to help assign peaks obtained from 2D 13 C– 13 C, 15 N– 13 C, or 3D 15 N– 13 C– 13 C magic-angle-spinning correlation spectra. We show secondary-structure specific 2D 13 C– 13 C correlation maps of all twenty amino acids, constructed from a chemical shift database of 262,209 residues. The maps reveal interesting conformation-dependent chemical shift distributions and facilitate searching of correlation peaks during amino-acid type assignment. Based on these correlations, PLUQ outputs the most likely amino acid types and the associated secondary structures from inputs of experimental chemical shifts. We test the assignment accuracy using four high-quality protein structures. Based on only the Cα and Cβ chemical shifts, the highest-ranked PLUQ assignments were 40–60 % correct in both the amino-acid type and the secondary structure. For three input chemical shifts (CO–Cα–Cβ or N–Cα–Cβ), the first-ranked assignments were correct for 60 % of the residues, while within the top three predictions, the correct assignments were found for 80 % of the residues. PLUQ and the chemical shift maps are expected to be useful at the first stage of sequential assignment, for combination with automated sequential assignment programs, and for highly disordered proteins for which secondary structure analysis is the main goal of structure determination.

  7. Plasticity-related genes in brain development and amygdala-dependent learning.

    Science.gov (United States)

    Ehrlich, D E; Josselyn, S A

    2016-01-01

    Learning about motivationally important stimuli involves plasticity in the amygdala, a temporal lobe structure. Amygdala-dependent learning involves a growing number of plasticity-related signaling pathways also implicated in brain development, suggesting that learning-related signaling in juveniles may simultaneously influence development. Here, we review the pleiotropic functions in nervous system development and amygdala-dependent learning of a signaling pathway that includes brain-derived neurotrophic factor (BDNF), extracellular signaling-related kinases (ERKs) and cyclic AMP-response element binding protein (CREB). Using these canonical, plasticity-related genes as an example, we discuss the intersection of learning-related and developmental plasticity in the immature amygdala, when aversive and appetitive learning may influence the developmental trajectory of amygdala function. We propose that learning-dependent activation of BDNF, ERK and CREB signaling in the immature amygdala exaggerates and accelerates neural development, promoting amygdala excitability and environmental sensitivity later in life. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  8. Determination of hydration numbers of electrolytes from temperature dependence of PMR chemical shifts

    International Nuclear Information System (INIS)

    Subramanian, N.

    1979-01-01

    The method proposed by Malinowski et al. for the determination of effective hydration numbers (h) of electrolytes leads to a consistent incrrease in the observed values of 'h' with increase in solution concentration. An attempt is made to rationalize the experimental results by cosidering the simultaneous effects of temperature and concentration on the proton chemical shift. It is suggested that Malinowski's technique might yeld 'h' values very close to the true value for those ions for which there is a fortuitous cancellation of structure-making and structure-breaking properties. (Author) [pt

  9. Evaluating amber force fields using computed NMR chemical shifts.

    Science.gov (United States)

    Koes, David R; Vries, John K

    2017-10-01

    NMR chemical shifts can be computed from molecular dynamics (MD) simulations using a template matching approach and a library of conformers containing chemical shifts generated from ab initio quantum calculations. This approach has potential utility for evaluating the force fields that underlie these simulations. Imperfections in force fields generate flawed atomic coordinates. Chemical shifts obtained from flawed coordinates have errors that can be traced back to these imperfections. We use this approach to evaluate a series of AMBER force fields that have been refined over the course of two decades (ff94, ff96, ff99SB, ff14SB, ff14ipq, and ff15ipq). For each force field a series of MD simulations are carried out for eight model proteins. The calculated chemical shifts for the 1 H, 15 N, and 13 C a atoms are compared with experimental values. Initial evaluations are based on root mean squared (RMS) errors at the protein level. These results are further refined based on secondary structure and the types of atoms involved in nonbonded interactions. The best chemical shift for identifying force field differences is the shift associated with peptide protons. Examination of the model proteins on a residue by residue basis reveals that force field performance is highly dependent on residue position. Examination of the time course of nonbonded interactions at these sites provides explanations for chemical shift differences at the atomic coordinate level. Results show that the newer ff14ipq and ff15ipq force fields developed with the implicitly polarized charge method perform better than the older force fields. © 2017 Wiley Periodicals, Inc.

  10. Conserved patterns of integrated developmental plasticity in a group of polyphenic tropical butterflies.

    Science.gov (United States)

    van Bergen, Erik; Osbaldeston, Dave; Kodandaramaiah, Ullasa; Brattström, Oskar; Aduse-Poku, Kwaku; Brakefield, Paul M

    2017-02-27

    Developmental plasticity is thought to have profound macro-evolutionary effects, for example, by increasing the probability of establishment in new environments and subsequent divergence into independently evolving lineages. In contrast to plasticity optimized for individual traits, phenotypic integration, which enables a concerted response of plastic traits to environmental variability, may affect the rate of local adaptation by constraining independent responses of traits to selection. Using a comparative framework, this study explores the evolution of reaction norms for a variety of life history and morphological traits across five related species of mycalesine butterflies from the Old World tropics. Our data indicate that an integrated response of a suite of key traits is shared amongst these species. Interestingly, the traits that make up the functional suite are all known to be regulated by ecdysteroid signalling in Bicyclus anynana, one of the species included in this study, suggesting the same underlying hormonal regulator may be conserved within this group of polyphenic butterflies. We also detect developmental thresholds for the expression of alternative morphs. The phenotypic plasticity of a broad suite of morphological and life history traits is integrated and shared among species from three geographically independent lineages of mycalesine butterflies, despite considerable periods of independent evolution and exposure to disparate environments. At the same time, we have detected examples of evolutionary change where independent traits show different patterns of reaction norms. We argue that the expression of more robust phenotypes may occur by shifting developmental thresholds beyond the boundaries of the typical environmental variation.

  11. Early Intervention in Children with Developmental Disabilities

    Directory of Open Access Journals (Sweden)

    Beena Johnson

    2016-01-01

    Full Text Available Developmental disabilities consist of conditions that delay or impair the physical, cognitive, and/or psychological development of children. If not intervened at the earliest, these disabilities will cause significant negative impact on multiple domains of functioning such as learning, language, self-care and capacity for independent living. Common developmental disabilities include autism spectrum disorders, intellectual disabilities, developmental delay and cerebral palsy. About one fourth of young children in developing countries are at risk for or have developmental delay or disabilities. Inadequate stimulation has significant negative impact on physical, socioemotional and cognitive development of children. Hence early scientific intervention programs are necessary in the management of children at risk for developmental delay.

  12. Deuterium isotope shifts for backbone {sup 1}H, {sup 15}N and {sup 13}C nuclei in intrinsically disordered protein {alpha}-synuclein

    Energy Technology Data Exchange (ETDEWEB)

    Maltsev, Alexander S.; Ying Jinfa; Bax, Ad, E-mail: bax@nih.gov [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

    2012-10-15

    Intrinsically disordered proteins (IDPs) are abundant in nature and characterization of their potential structural propensities remains a widely pursued but challenging task. Analysis of NMR secondary chemical shifts plays an important role in such studies, but the output of such analyses depends on the accuracy of reference random coil chemical shifts. Although uniform perdeuteration of IDPs can dramatically increase spectral resolution, a feature particularly important for the poorly dispersed IDP spectra, the impact of deuterium isotope shifts on random coil values has not yet been fully characterized. Very precise {sup 2}H isotope shift measurements for {sup 13}C{sup {alpha}}, {sup 13}C{sup {beta}}, {sup 13}C Prime , {sup 15}N, and {sup 1}H{sup N} have been obtained by using a mixed sample of protonated and uniformly perdeuterated {alpha}-synuclein, a protein with chemical shifts exceptionally close to random coil values. Decomposition of these isotope shifts into one-bond, two-bond and three-bond effects as well as intra- and sequential residue contributions shows that such an analysis, which ignores conformational dependence, is meaningful but does not fully describe the total isotope shift to within the precision of the measurements. Random coil {sup 2}H isotope shifts provide an important starting point for analysis of such shifts in structural terms in folded proteins, where they are known to depend strongly on local geometry.

  13. Theoretical Study of the NMR Chemical Shift of Xe in Supercritical Condition

    DEFF Research Database (Denmark)

    Lacerda Junior, Evanildo Gomes; Sauer, Stephan P. A.; Mikkelsen, Kurt Valentin

    2018-01-01

    In this work we investigate the level of theory necessary for reproducing the non-linear variation of the 129Xe nuclear magnetic resonance (NMR) chemical shift with the density of Xe in supercritical conditions. In detail we study how the 129Xe chemical shift depends under these conditions...... on electron correlation, relativistic and many-body effects. The latter are included using a sequential-QM/MM methodology, in which a classical MD simulation is performed first and the chemical shift is then obtained as an average of quantum calculations of 250 MD snapshots conformations carried out for Xen...... this approach we obtain very good agreement with the experimental data, showing that the chemical shift of 129Xe in supercritical conditions is very well described by cluster calculations at the HF level, with small contributions from relativistic and electron correlation effects....

  14. [Contemporary cognitive theories about developmental dyscalculia].

    Science.gov (United States)

    Castro-Cañizares, D; Estévez-Pérez, N; Reigosa-Crespo, V

    To analyze the current theories describing the cognitive mechanisms underlying developmental dyscalculia. The four most researched hypotheses concerning the cognitive deficits related to developmental dyscalculia, as well as experimental evidences supporting or refusing them are presented. The first hypothesis states that developmental dyscalculia is consequence of domain general cognitive deficits. The second hypothesis suggests that it is due to a failure in the development of specialized brain systems dedicated to numerosity processing. The third hypothesis asserts the disorder is caused by a deficit in accessing quantity representation through numerical symbols. The last hypothesis states developmental dyscalculia appears as a consequence of impairments in a generalized magnitude system dedicated to the processing of continuous and discrete magnitudes. None of the hypotheses has been proven more plausible than the rest. Relevant issues rose by them need to be revisited and answered in the light of new experimental designs. In the last years the understanding of cognitive disorders involved in developmental dyscalculia has remarkably increased, but it is nonetheless insufficient. Additional research is required in order to achieve a comprehensive cognitive model of numerical processing development and its disorders. This will improve the diagnostic precision and the effectiveness of developmental dyscalculia intervention strategies.

  15. [Non-autistic pervasive developmental disorders: Rett syndrome, disintegrative disorder and pervasive developmental disorder not otherwise specified

    NARCIS (Netherlands)

    Mercadante, M.T.; Gaag, R.J. van der; Schwartzman, J.S.

    2006-01-01

    The category "Pervasive Developmental Disorders" includes autistic disorder, Asperger's syndrome, Rett's syndrome, childhood disintegrative disorder, and a residual category, named pervasive developmental disorder not otherwise specified. In this review, Rett's syndrome and childhood disintegrative

  16. Life Span Developmental Approach

    OpenAIRE

    Ali Eryilmaz

    2011-01-01

    The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of...

  17. An Examination of the Relative Age Effect in Developmental Girls' Hockey in Ontario

    Science.gov (United States)

    Smith, Kristy L.; Weir, Patricia L.

    2013-01-01

    The relative age effect (RAE) suggests that athletes may be provided with greater opportunities for success depending on the position of their birthdate in a sport's selection year. While the effect has been well established in men's sports, less is known about women's sports. This study examined the RAE in developmental girls' hockey in Ontario.…

  18. What Is a Developmental-Behavioral Pediatrician?

    Science.gov (United States)

    ... social worker. Developmental-behavioral pediatricians work closely with parents, families, and schools. Developmental-behavioral pediatricians understand that children’s development and behavior happen first and foremost in the ...

  19. Nutrition and health in hotel staff on different shift patterns.

    Science.gov (United States)

    Seibt, R; Süße, T; Spitzer, S; Hunger, B; Rudolf, M

    2015-08-01

    Limited research is available that examines the nutritional behaviour and health of hotel staff working alternating and regular shifts. To analyse the nutritional behaviour and health of employees working in alternating and regular shifts. The study used an ex post facto cross-sectional analysis to compare the nutritional behaviour and health parameters of workers with alternating shifts and regular shift workers. Nutritional behaviour was assessed with the Food Frequency Questionnaire. Body dimensions (body mass index, waist hip ratio, fat mass and active cell mass), metabolic values (glucose, triglyceride, total cholesterol and low- and high-density lipoprotein), diseases and health complaints were included as health parameters. Participants worked in alternating (n = 53) and regular shifts (n = 97). The average age of subjects was 35 ± 10 years. There was no significant difference in nutritional behaviour, most surveyed body dimensions or metabolic values between the two groups. However, alternating shift workers had significantly lower fat mass and higher active cell mass but nevertheless reported more pronounced health complaints. Sex and age were also confirmed as influencing the surveyed parameters. Shift-dependent nutritional problems were not conspicuously apparent in this sample of hotel industry workers. Health parameters did not show significantly negative attributes for alternating shift workers. Conceivably, both groups could have the same level of knowledge on the health effects of nutrition and comparable opportunities to apply this. Further studies on nutritional and health behaviour in the hotel industry are necessary in order to create validated screening programmes. © The Author 2015. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Developmental prosopagnosia and super-recognition: no special role for surface reflectance processing.

    Science.gov (United States)

    Russell, Richard; Chatterjee, Garga; Nakayama, Ken

    2012-01-01

    Face recognition by normal subjects depends in roughly equal proportions on shape and surface reflectance cues, while object recognition depends predominantly on shape cues. It is possible that developmental prosopagnosics are deficient not in their ability to recognize faces per se, but rather in their ability to use reflectance cues. Similarly, super-recognizers' exceptional ability with face recognition may be a result of superior surface reflectance perception and memory. We tested this possibility by administering tests of face perception and face recognition in which only shape or reflectance cues are available to developmental prosopagnosics, super-recognizers, and control subjects. Face recognition ability and the relative use of shape and pigmentation were unrelated in all the tests. Subjects who were better at using shape or reflectance cues were also better at using the other type of cue. These results do not support the proposal that variation in surface reflectance perception ability is the underlying cause of variation in face recognition ability. Instead, these findings support the idea that face recognition ability is related to neural circuits using representations that integrate shape and pigmentation information. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Evidence for a developmental role for TLR4 in learning and memory.

    Directory of Open Access Journals (Sweden)

    Eitan Okun

    Full Text Available Toll-like receptors (TLRs play essential roles in innate immunity and increasing evidence indicates that these receptors are expressed in neurons, astrocytes and microglia in the brain where they mediate responses to infection, stress and injury. Very little is known about the roles of TLRs in cognition. To test the hypothesis that TLR4 has a role in hippocampus-dependent spatial learning and memory, we used mice deficient for TLR4 and mice receiving chronic TLR4 antagonist infusion to the lateral ventricles in the brain. We found that developmental TLR4 deficiency enhances spatial reference memory acquisition and memory retention, impairs contextual fear-learning and enhances motor functions, traits that were correlated with CREB up-regulation in the hippocampus. TLR4 antagonist infusion into the cerebral ventricles of adult mice did not affect cognitive behavior, but instead affected anxiety responses. Our findings indicate a developmental role for TLR4 in shaping spatial reference memory, and fear learning and memory. Moreover, we show that central TLR4 inhibition using a TLR4 antagonist has no discernible physiological role in regulating spatial and contextual hippocampus-dependent cognitive behavior.

  2. Trisomy 21 and facial developmental instability.

    Science.gov (United States)

    Starbuck, John M; Cole, Theodore M; Reeves, Roger H; Richtsmeier, Joan T

    2013-05-01

    The most common live-born human aneuploidy is trisomy 21, which causes Down syndrome (DS). Dosage imbalance of genes on chromosome 21 (Hsa21) affects complex gene-regulatory interactions and alters development to produce a wide range of phenotypes, including characteristic facial dysmorphology. Little is known about how trisomy 21 alters craniofacial morphogenesis to create this characteristic appearance. Proponents of the "amplified developmental instability" hypothesis argue that trisomy 21 causes a generalized genetic imbalance that disrupts evolutionarily conserved developmental pathways by decreasing developmental homeostasis and precision throughout development. Based on this model, we test the hypothesis that DS faces exhibit increased developmental instability relative to euploid individuals. Developmental instability was assessed by a statistical analysis of fluctuating asymmetry. We compared the magnitude and patterns of fluctuating asymmetry among siblings using three-dimensional coordinate locations of 20 anatomic landmarks collected from facial surface reconstructions in four age-matched samples ranging from 4 to 12 years: (1) DS individuals (n = 55); (2) biological siblings of DS individuals (n = 55); 3) and 4) two samples of typically developing individuals (n = 55 for each sample), who are euploid siblings and age-matched to the DS individuals and their euploid siblings (samples 1 and 2). Identification in the DS sample of facial prominences exhibiting increased fluctuating asymmetry during facial morphogenesis provides evidence for increased developmental instability in DS faces. We found the highest developmental instability in facial structures derived from the mandibular prominence and lowest in facial regions derived from the frontal prominence. Copyright © 2013 Wiley Periodicals, Inc.

  3. Sex-Dependent Effects of the Histone Deacetylase Inhibitor, Sodium Valproate, on Reversal Learning After Developmental Arsenic Exposure

    Directory of Open Access Journals (Sweden)

    Christina R. Steadman Tyler

    2018-06-01

    Full Text Available Several studies have demonstrated that exposure to arsenic in drinking water adversely affects brain development and cognitive function in adulthood. While the mechanism by which arsenic induces adverse neurological outcomes remains elusive, studies suggest a link between reduced levels of histone acetylation and impaired performance on a variety of behavioral tasks following arsenic exposure. Using our developmental arsenic exposure (DAE paradigm, we have previously reported reduced histone acetylation and associated histone acetyltransferase enzyme expression in the frontal cortex of C57BL/6J adult male mice, with no changes observed in the female frontal cortex. In the present study, we sought to determine if DAE produced sex-dependent deficits in frontal cortical executive function using the Y-maze acquisition and reversal learning tasks, which are specific for assessing cognitive flexibility. Further, we tested whether the administration of valproic acid, a class I–IIa histone deacetylase inhibitor, was able to mitigate behavioral and biochemical changes resulting from DAE. As anticipated, DAE inhibited acquisition and reversal learning performance in adult male, but not female, mice. Valproate treatment for 2 weeks restored reversal performance in the male arsenic-exposed offspring, while not affecting female performance. Protein levels of HDACs 1, 2, and 5 were elevated following behavioral assessment but only in DAE male mice; restoration of appropriate HDAC levels occurred after valproate treatment and was concurrent with improved behavioral performance, particularly during reversal learning. Female frontal cortical levels of HDAC enzymes were not impacted by DAE or valproate treatment. Finally, mRNA expression levels of brain-derived neurotrophic factor, Bdnf, which has been implicated in the control of frontal cortical flexibility and is regulated by HDAC5, were elevated in DAE male mice and restored to normal levels following HDACi

  4. Developmental Kindergarten Program Evaluation Report.

    Science.gov (United States)

    Blois, George T.; Cushing, Katherine S.

    The evaluation of the Developmental Kindergarten (DK) Program at the Harrison School District #2, Colorado Springs, Colorado, involved pre- and post-testing of student academic gains and interviewing of principals and teachers. The program aimed to provide developmentally appropriate activities for students believed to be "at risk" of…

  5. Developmentally Appropriate Peace Education Curricula

    Science.gov (United States)

    Lewsader, Joellen; Myers-Walls, Judith A.

    2017-01-01

    Peace education has been offered to children for decades, but those curricula have been only minimally guided by children's developmental stages and needs. In this article, the authors apply their research on children's developmental understanding of peace along with peace education principles and Vygotsky's sociocultural theory to present…

  6. Millivolt-scale DC shifts in the human scalp EEG: evidence for a nonneuronal generator.

    Science.gov (United States)

    Voipio, Juha; Tallgren, Pekka; Heinonen, Erkki; Vanhatalo, Sampsa; Kaila, Kai

    2003-04-01

    Slow shifts in the human scalp-recorded EEG, including those related to changes in brain CO(2) levels, have been generally assumed to result from changes in the level of tonic excitation of apical dendrites of cortical pyramidal neurons. We readdressed this issue using DC-EEG shifts elicited in healthy adult subjects by hypo- or hypercapnia. A 3-min period of hyperventilation resulted in a prompt negative shift with a rate of up to 10 microV/s at the vertex (Cz) and an extremely steep dependence (up to 100 microV/mmHg) on the end-tidal Pco(2). This shift had a maximum of up to -2 mV at Cz versus the temporal derivations (T3/T4). Hyperventilation-like breathing of 5% CO(2)-95% O(2), which does not lead to a significant hypocapnia, resulted in a near-complete block of the negative DC shift at Cz. Hypoventilation, or breathing 5% CO(2) in air at normal respiratory rate, induced a positive shift. The high amplitude of the voltage gradients on the scalp induced by hyperventilation is not consistent with a neuronal origin. Instead, the present data suggest that they are generated by extracortical volume currents driven by a Pco(2)-dependent potential difference across epithelia separating the cerebrospinal fluid and blood. Since changes in respiratory patterns and, hence, in the level of brain Pco(2), are likely to occur under a number of experimental conditions in which slow EEG responses have been reported (e.g., attention shifts, preparatory states, epileptic seizures, and hypoxic episodes), the present results call for a thorough reexamination of the mechanisms underlying scalp-recorded DC-EEG responses.

  7. Shifting schedules: the health effects of reorganizing shift work.

    Science.gov (United States)

    Bambra, Clare L; Whitehead, Margaret M; Sowden, Amanda J; Akers, Joanne; Petticrew, Mark P

    2008-05-01

    Approximately one fifth of workers are engaged in some kind of shift work. The harmful effects of shift work on the health and work-life balance of employees are well known. A range of organizational interventions has been suggested to address these negative effects. This study undertook the systematic review (following Quality Of Reporting Of Meta [QUORUM] analyses guidelines) of experimental and quasi-experimental studies, from any country (in any language) that evaluated the effects on health and work-life balance of organizational-level interventions that redesign shift work schedules. Twenty-seven electronic databases (medical, social science, economic) were searched. Data extraction and quality appraisal were carried out by two independent reviewers. Narrative synthesis was performed. The review was conducted between October 2005 and November 2006. Twenty-six studies were found relating to a variety of organizational interventions. No one type of intervention was found to be consistently harmful to workers. However, three types were found to have beneficial effects on health and work-life balance: (1) switching from slow to fast rotation, (2) changing from backward to forward rotation, and (3) self-scheduling of shifts. Improvements were usually at little or no direct organizational cost. However, there were concerns about the generalizability of the evidence, and no studies reported on impacts on health inequalities. This review reinforces the findings of epidemiologic and laboratory-based research by suggesting that certain organizational-level interventions can improve the health of shift workers, their work-life balance, or both. This evidence could be useful when designing interventions to improve the experience of shift work.

  8. Computers in Education of Children with Intellectual and Related Developmental Disorders

    Directory of Open Access Journals (Sweden)

    Valentina Kirinic

    2010-03-01

    Full Text Available Children suffering from intellectual deficiency and disorders arising from such a condition tend to be provided with a specific form of education, depending on the deficiency type and degree. Apart from the disorder itself, the acquisition of knowledge, skills and learning habits depends on the children’s motivation for learning, as well as the accessibility of the computer. When used in conformance with pedagogical, didactic and clinical standards, the computer as an educational aid may prove helpful for education and training of children with developmental disorders. Using computers also enables communication and fosters communication skills resulting in the development of self-confidence.

  9. Surviving and Thriving—Shifting the Public Health Response to HIV-Exposed Uninfected Children: Report of the 3rd HIV-Exposed Uninfected Child Workshop

    Directory of Open Access Journals (Sweden)

    Amy L. Slogrove

    2018-05-01

    Full Text Available Great gains were achieved with the introduction of the United Nations' Millennium Development Goals, including improved child survival. Transition to the Sustainable Development Goals (SDGs focused on surviving, thriving, and transforming, representing an important shift to a broader public health goal, the achievement of which holds the promise of longer-term individual and societal benefits. A similar shift is needed with respect to outcomes for infants born to women living with HIV (WLHIV. Programming to prevent vertical HIV transmission has been successful in increasingly achieving a goal of HIV-free survival for infants born to WLHIV. Unfortunately, HIV-exposed uninfected (HEU children are not achieving comparable health and developmental outcomes compared with children born to HIV-uninfected women under similar socioeconomic circumstances. The 3rd HEU Child Workshop, held as a satellite session of the International AIDS Society's 9th IAS Conference in Paris in July 2017, provided a venue to discuss HEU child health and development disparities. A summary of the Workshop proceedings follows, providing current scientific findings, emphasizing the gap in systems for long-term monitoring, and highlighting the public health need to establish a strategic plan to better quantify the short and longer-term health and developmental outcomes of HEU children.

  10. Developmental biology, the stem cell of biological disciplines.

    Science.gov (United States)

    Gilbert, Scott F

    2017-12-01

    Developmental biology (including embryology) is proposed as "the stem cell of biological disciplines." Genetics, cell biology, oncology, immunology, evolutionary mechanisms, neurobiology, and systems biology each has its ancestry in developmental biology. Moreover, developmental biology continues to roll on, budding off more disciplines, while retaining its own identity. While its descendant disciplines differentiate into sciences with a restricted set of paradigms, examples, and techniques, developmental biology remains vigorous, pluripotent, and relatively undifferentiated. In many disciplines, especially in evolutionary biology and oncology, the developmental perspective is being reasserted as an important research program.

  11. Developmental toxicology: adequacy of current methods.

    Science.gov (United States)

    Peters, P W

    1998-01-01

    Toxicology embraces several disciplines such as carcinogenicity, mutagenicity and reproductive toxicity. Reproductive toxicology is concerned with possible effects of substances on the reproductive process, i.e. on sexual organs and their functions, endocrine regulation, fertilization, transport of the fertilized ovum, implantation, and embryonic, fetal and postnatal development, until the end-differentiation of the organs is achieved. Reproductive toxicology is divided into areas related to male and female fertility, and developmental toxicology. Developmental toxicology can be further broken down into prenatal and postnatal toxicology. Today, much new information is available about the origins of developmental disorders resulting from chemical exposure. While these findings seem to promise important new developments in methodology and research, there is a danger of losing sight of the precepts and principles established in the light of existing knowledge. There is also a danger that we may fail to correct shortcomings in our existing procedures and practice. The aim of this presentation is to emphasize the importance of testing substances for their impact in advance of their use and to underline that we must use the best existing tools for carrying out risk assessments. Moreover, it needs to be stressed that there are many substances that are never assessed with respect to reproductive and developmental toxicity. Similarly, our programmes for post-marketing surveillance with respect to developmental toxicology are grossly inadequate. Our ability to identify risks to normal development and reproduction would be much improved, first if a number of straightforward precepts were always followed and second, if we had a clearer understanding of what we mean by risk and acceptable levels of risk in the context of development. Other aims of this paper are: to stress the complexity of the different stages of normal prenatal development; to note the principles that are

  12. Size-Dependent Shifts of Plasmon Resonance in Silver Nanoparticle Films Using Controlled Dissolution

    DEFF Research Database (Denmark)

    Mogensen, Klaus Bo; Kneipp, Katrin

    2014-01-01

    to a transition from an extrinsic regime for the larger particles, where shifts of the plasmon frequency are related to changes in the dielectric environment, while the dielectric function of the metal is constant, to an intrinsic regime for the smaller particles. For this intrinsic regime, operative for small...... in a corrected electron density. The reported results have potential for developing nanosensors based on small nanoparticles below 5 nm in size by using their intrinsic response to adsorbed analytes. This detection scheme suggests a potential increase in the sensitivity of up to 3×, particularly when redox...

  13. Practical use of chemical shift databases for protein solid-state NMR: 2D chemical shift maps and amino-acid assignment with secondary-structure information

    Energy Technology Data Exchange (ETDEWEB)

    Fritzsching, K. J.; Yang, Y.; Schmidt-Rohr, K.; Hong Mei, E-mail: mhong@iastate.edu [Iowa State University, Department of Chemistry (United States)

    2013-06-15

    We introduce a Python-based program that utilizes the large database of {sup 13}C and {sup 15}N chemical shifts in the Biological Magnetic Resonance Bank to rapidly predict the amino acid type and secondary structure from correlated chemical shifts. The program, called PACSYlite Unified Query (PLUQ), is designed to help assign peaks obtained from 2D {sup 13}C-{sup 13}C, {sup 15}N-{sup 13}C, or 3D {sup 15}N-{sup 13}C-{sup 13}C magic-angle-spinning correlation spectra. We show secondary-structure specific 2D {sup 13}C-{sup 13}C correlation maps of all twenty amino acids, constructed from a chemical shift database of 262,209 residues. The maps reveal interesting conformation-dependent chemical shift distributions and facilitate searching of correlation peaks during amino-acid type assignment. Based on these correlations, PLUQ outputs the most likely amino acid types and the associated secondary structures from inputs of experimental chemical shifts. We test the assignment accuracy using four high-quality protein structures. Based on only the C{alpha} and C{beta} chemical shifts, the highest-ranked PLUQ assignments were 40-60 % correct in both the amino-acid type and the secondary structure. For three input chemical shifts (CO-C{alpha}-C{beta} or N-C{alpha}-C{beta}), the first-ranked assignments were correct for 60 % of the residues, while within the top three predictions, the correct assignments were found for 80 % of the residues. PLUQ and the chemical shift maps are expected to be useful at the first stage of sequential assignment, for combination with automated sequential assignment programs, and for highly disordered proteins for which secondary structure analysis is the main goal of structure determination.

  14. The resonance frequency shift characteristic of Terfenol-D rods for magnetostrictive actuators

    International Nuclear Information System (INIS)

    Jin, Ke; Kou, Yong; Zheng, Xiaojing

    2012-01-01

    This paper focuses on the resonance frequency shift characteristic of Terfenol-D rods for magnetostrictive actuators. A 3D nonlinear dynamic model to describe the magneto-thermo-elastic coupling behavior of actuators is proposed based on a nonlinear constitutive model. The coupled interactions among stress- and magnetic-field-dependent variables for actuators are solved iteratively using the finite element method. The model simulations show a good correlation with the experimental data, which demonstrates that this model can capture the coupled resonance frequency shift features for magnetostrictive actuators well. Moreover, a comprehensive description for temperature, pre-stress and bias field dependences of resonance frequency is discussed in detail. These essential and important investigations will be of significant benefit to both theoretical research and the applications of magnetostrictive materials in smart or intelligent structures and systems. (paper)

  15. Developmental programming of happiness.

    Science.gov (United States)

    Schmidt, Louis A; Fortier, Paz; Lahat, Ayelet; Tang, Alva; Mathewson, Karen J; Saigal, Saroj; Boyle, Michael H; Van Lieshout, Ryan J

    2017-09-01

    Being born at an extremely low birth weight (ELBW; programming hypotheses. Interfacing prenatal programming and differential susceptibility hypotheses, we tested whether individuals with ELBW in different childhood rearing environments showed different attention biases to positive and negative facial emotions in adulthood. Using the oldest known, prospectively followed cohort of ELBW survivors, we found that relative to normal birth weight controls (NBW; >2,500 grams), ELBW survivors displayed the highest and lowest attention bias to happy faces at age 30-35, depending on whether their total family income at age 8 was relatively low (environmental match) or high (environmental mismatch), respectively. This bias to happy faces was associated with a reduced likelihood of emotional problems. Findings suggest that differential susceptibility to positive emotions may be prenatally programmed, with effects lasting into adulthood. We discuss implications for integrating prenatal programming and differential susceptibility hypotheses, and the developmental origins of postnatal plasticity and resilience. © 2017 Wiley Periodicals, Inc.

  16. Cα and Cβ Carbon-13 Chemical Shifts in Proteins From an Empirical Database

    International Nuclear Information System (INIS)

    Iwadate, Mitsuo; Asakura, Tetsuo; Williamson, Michael P.

    1999-01-01

    We have constructed an extensive database of 13C Cα and Cβ chemical shifts in proteins of solution, for proteins of which a high-resolution crystal structure exists, and for which the crystal structure has been shown to be essentially identical to the solution structure. There is no systematic effect of temperature, reference compound, or pH on reported shifts, but there appear to be differences in reported shifts arising from referencing differences of up to 4.2 ppm. The major factor affecting chemical shifts is the backbone geometry, which causes differences of ca. 4 ppm between typical α- helix and β-sheet geometries for Cα, and of ca. 2 ppm for Cβ. The side-chain dihedral angle χ1 has an effect of up to 0.5 ppm on the Cα shift, particularly for amino acids with branched side-chains at Cβ. Hydrogen bonding to main-chain atoms has an effect of up to 0.9 ppm, which depends on the main- chain conformation. The sequence of the protein and ring-current shifts from aromatic rings have an insignificant effect (except for residues following proline). There are significant differences between different amino acid types in the backbone geometry dependence; the amino acids can be grouped together into five different groups with different φ,ψ shielding surfaces. The overall fit of individual residues to a single non-residue-specific surface, incorporating the effects of hydrogen bonding and χ1 angle, is 0.96 ppm for both Cα and Cβ. The results from this study are broadly similar to those from ab initio studies, but there are some differences which could merit further attention

  17. Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves

    Directory of Open Access Journals (Sweden)

    Vajiheh Safavi-Rizi

    2018-02-01

    Full Text Available In the spring oilseed rape (OSR cultivar ‘Mozart’ grown under optimal N supply (NO or mild N deficiency (NL the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4 and younger higher canopy leaves (leaf #8 were investigated. Twelve weeks old NO and NL plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In NO leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in NL leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes than in N-depleted plants (∼750 genes. This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs. Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in NL plants, but none in NO plants. In contrast, from weeks 13 to 16 in leaves #8 of NL plants only 11 PSGs were downregulated in comparison to 66 PSGs in NO plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in NL leaves #4 or NO leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves.

  18. Developmental Hypothyroidism Reduces the Expression of Activity-Dependent Plasticity Genes in Denate Gyrus of the Adult Following Long Term Potentiation

    Science.gov (United States)

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neuro...

  19. Developmentalism: An Obscure but Pervasive Restriction

    Directory of Open Access Journals (Sweden)

    J. E. Stone

    1996-04-01

    Full Text Available Despite continuing criticism of public education, experimentally demonstrated and field tested teaching methods have been ignored, rejected, and abandoned. Instead of a stable consensus regarding best teaching practices, there seems only an unending succession of innovations. A longstanding educational doctrine appears to underlie this anomalous state of affairs. Termed developmentalism, it presumes "natural" ontogenesis to be optimal and it requires experimentally demonstrated teaching practices to overcome a presumption that they interfere with an optimal developmental trajectory. It also discourages teachers and parents from asserting themselves with children. Instead of effective interventions, it seeks the preservation of a postulated natural perfection. Developmentalism's rich history is expressed in a literature extending over 400 years. Its notable exponents include Jean Jacques Rousseau, John Dewey, and Jean Piaget; and its most recent expressions include "developmentally appropriate practice" and "constructivism." In the years during which it gained ascendance, developmentalism served as a basis for rejecting harsh and inhumane teaching methods. Today it impedes efforts to hold schools accountable for student academic achievement.

  20. Tracing developmental trajectories of oppositional defiant behaviors in preschool children.

    Directory of Open Access Journals (Sweden)

    Lourdes Ezpeleta

    Full Text Available Previous studies on developmental trajectories have used ad hoc definitions of oppositional defiant behaviors (ODB, which makes it difficult to compare results. This article defines developmental trajectories of ODB from ages 3-5 based on five different standard measurements derived from three separate instruments.A sample of 622 three-year-old preschoolers, followed up at ages 4, 5, and 6, was assessed with the five measures of oppositionality answered by parents and teachers. Growth-Mixture-Modeling (GMM estimated separate developmental trajectories for each ODB measure for ages 3 to 5.The number of classes-trajectories obtained in each GMM depended on the ODB measure, but two clear patterns emerged: four trajectories (persistent low, decreasers, increasers/high increasers, persistent moderate/persistent high or three trajectories (persistent low, decreasers, increasers/high increasers. Persistent high trajectories accounted for 4.4%-9.5% of the children. The trajectories emerging from the different ODB measures at ages 3 to 5 discriminated disruptive disorders, comorbidity, use of services, and impairment at age 6, and globally showed a similar pattern, summarizing longitudinal information on oppositionality in preschool children in a similar way.Trajectories resulting from standard scales of the questionnaires have predictive validity for identifying relevant clinical outcomes, but are measure-specific. The results contribute to knowledge about the development of ODB in preschool children.

  1. Josephson shift registers

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper gives a review of Josephson shift register circuits that were designed, fabricated, or tested, with emphasis on work in the 1980s. Operating speed is most important, since it often limits system performance. Older designs used square-wave clocks, but most modern designs use offset sine waves, with either two or three phases. Operating margins and gate bias uniformity are key concerns. The fastest measured Josephson shift register operated at 2.3 GHz, which compares well with a GaAs shift register that consumes 250 times more power. The difficulties of high-speed testing have prevented many Josephson shift registers from being operated at their highest speeds. Computer simulations suggest that 30-GHz operation is possible with current Nb/Al 2 O 3 /Nb technology. Junctions with critical current densities near 10 kA/cm 2 would make 100-GHz shift registers feasible

  2. Control of Goos-Hänchen shift via input probe field intensity

    Science.gov (United States)

    Ziauddin; Lee, Ray-Kuang; Qamar, Sajid

    2016-11-01

    We suggest a scheme to control Goos-Hänchen (GH) shift in an ensemble of strongly interacting Rydberg atoms, which act as super-atoms due to the dipole blockade mechanism. The ensemble of three-level cold Rydberg-dressed (87Rb) atoms follows a cascade configurations where two fields, i.e, a strong control and a weak field are employed [D. Petrosyan, J. Otterbach, and M. Fleischhauer, Phys. Rev. Lett. 107, 213601 (2011)]. The propagation of probe field is influenced by two-photon correlation within the blockade distance, which are damped due to the saturation of super-atoms. The amplitude of GH shift in the reflected light depends on the intensity of probe field. We observe large negative GH shift in the reflected light for small values of the probe field intensities.

  3. Developmental differences in childhood motor coordination predict adult alcohol dependence

    DEFF Research Database (Denmark)

    Manzardo, Ann M; Penick, Elizabeth C; Knop, Joachim

    2005-01-01

    BACKGROUND: The Danish Longitudinal Study of Alcoholism has identified a number of early biological indicators that predicted alcohol dependence 30 years later. In light of recent evidence linking deficits of the cerebellum to certain neuropsychiatric disorders often comorbid with alcoholism, we...

  4. Developmental Systems Theory and the Person-Oriented Approach. Commentary on: "An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics"

    Science.gov (United States)

    Bergman, Lars R.

    2015-01-01

    Molenaar's (2015) article concerns Developmental Systems Theory (DST) in relation to behavior genetics and he presents implications of DST for empirical research, especially the need for subject-specific studies. In this commentary, the article is discussed from a broader developmental science perspective, particularly regarded through the lens of…

  5. Prosocial Behavior and Depression: a Case for Developmental Gender Differences.

    Science.gov (United States)

    Alarcón, Gabriela; Forbes, Erika E

    2017-06-01

    Prosocial behavior and depression are related constructs that both increase during adolescence and display gender-specific effects. The current review surveys literature examining the association between depressive symptoms and prosociality, measured with behavioral economic paradigms, across development and proposes a theoretical model explaining a mechanism through which adolescent girls have higher risk for depression than boys. Relative to healthy controls, prosocial behavior is reduced in adults with major depressive disorder (MDD) but may be increased in adolescents with MDD. The relationship between non-clinical levels of depressive symptoms and prosocial behavior remains to be studied experimentally; however, self-reported prosocial behavior is negatively associated with depressive symptoms in non-clinical adolescents, which may suggest a shift in the relation of prosocial behavior and depressive symptoms across the non-clinical (i.e., negative) to clinical range (i.e., positive). The effect of gender on these developmental and clinical status shifts has not been studied but could have important implications for understanding the emergence of higher rates of depression in girls than boys during adolescence. We propose that girls are at heightened risk for depression due to higher social-evaluative concern and other-oriented prosocial motivation that emphasize the needs of others over the self, leading to more altruistic prosocial behavior (despite personal cost) and a higher burden that enables depressive symptoms.

  6. Observations of sensor bias dependent cluster centroid shifts in a prototype sensor for the LHCb Vertex Locator detector

    CERN Document Server

    Papadelis, Aras

    2006-01-01

    We present results from a recent beam test of a prototype sensor for the LHCb Vertex Locator detector, read out with the Beetle 1.3 front-end chip. We have studied the effect of the sensor bias voltage on the reconstructed cluster positions in a sensor placed in a 120GeV pion beam at a 10° incidence angle. We find an unexplained sysematic shift in the reconstructed cluster centroid when increasing the bias voltage on an already overdepleted sensor. The shift is independent of strip pitch and sensor thickness.

  7. Family Life and Developmental Idealism in Yazd, Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Jalal Abbasi-Shavazi

    2012-03-01

    Full Text Available BACKGROUND This paper is motivated by the theory that developmental idealism has been disseminated globally and has become an international force for family and demographic change. Developmental idealism is a set of cultural beliefs and values about development and how development relates to family and demographic behavior. It holds that modern societies are causal forces producing modern families, that modern families help to produce modern societies, and that modern family change is to be expected. OBJECTIVE We examine the extent to which developmental idealism has been disseminated in Iran. We also investigate predictors of the dissemination of developmental idealism. METHODS We use survey data collected in 2007 from a sample of women in Yazd, a city in Iran. We examine the distribution of developmental idealism in the sample and the multivariate predictors of developmental idealism. RESULTS We find considerable support for the expectation that many elements of developmental idealism have been widely disseminated. Statistically significant majorities associate development with particular family attributes, believe that development causes change in families, believe that fertility reductions and age-at-marriage increases help foster development, and perceive family trends in Iran headed toward modernity. As predicted, parental education, respondent education, and income affect adherence to developmental idealism. CONCLUSIONS Developmental idealism has been widely disseminated in Yazd, Iran and is related to social and demographic factors in predicted ways. COMMENTS Although our data come from only one city, we expect that developmental idealism has been widely distributed in Iran, with important implications for family and demographic behavior.

  8. 29 CFR 1902.33 - Developmental period.

    Science.gov (United States)

    2010-07-01

    ... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

  9. Highly precise and developmentally programmed genome assembly in Paramecium requires ligase IV-dependent end joining.

    Directory of Open Access Journals (Sweden)

    Aurélie Kapusta

    2011-04-01

    Full Text Available During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs, each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs, which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ, are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new

  10. Highly precise and developmentally programmed genome assembly in Paramecium requires ligase IV-dependent end joining.

    Science.gov (United States)

    Kapusta, Aurélie; Matsuda, Atsushi; Marmignon, Antoine; Ku, Michael; Silve, Aude; Meyer, Eric; Forney, James D; Malinsky, Sophie; Bétermier, Mireille

    2011-04-01

    During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs), each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs), which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ), are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new mechanisms

  11. Do reading and spelling share orthographic representations? Evidence from developmental dysgraphia.

    Science.gov (United States)

    Hepner, Christopher; McCloskey, Michael; Rapp, Brenda

    Both spelling and reading depend on knowledge of the spellings of words. Despite this commonality, observed dissociations between spelling and reading in cases of acquired and developmental deficits suggest some degree of independence between the cognitive mechanisms involved in these skills. In this paper, we examine the relationship between spelling and reading in two children with developmental dysgraphia. For both children, we identified significant deficits in spelling that affected the processing of orthographic long-term memory representations of words. We then examined their reading skills for similar difficulties. Even with extensive testing, we found no evidence of a reading deficit for one of the children. We propose that there may be an underlying difficulty that specifically affects the learning of orthographic word representations for spelling. These results lead us to conclude that at least some components of lexical orthographic representation and processing develop with considerable independence in spelling and reading.

  12. Developmental constraint of insect audition

    Directory of Open Access Journals (Sweden)

    Strauß Johannes

    2006-12-01

    Full Text Available Abstract Background Insect ears contain very different numbers of sensory cells, from only one sensory cell in some moths to thousands of sensory cells, e.g. in cicadas. These differences still await functional explanation and especially the large numbers in cicadas remain puzzling. Insects of the different orders have distinct developmental sequences for the generation of auditory organs. These sensory cells might have different functions depending on the developmental stages. Here we propose that constraints arising during development are also important for the design of insect ears and might influence cell numbers of the adults. Presentation of the hypothesis We propose that the functional requirements of the subadult stages determine the adult complement of sensory units in the auditory system of cicadas. The hypothetical larval sensory organ should function as a vibration receiver, representing a functional caenogenesis. Testing the hypothesis Experiments at different levels have to be designed to test the hypothesis. Firstly, the neuroanatomy of the larval sense organ should be analyzed to detail. Secondly, the function should be unraveled neurophysiologically and behaviorally. Thirdly, the persistence of the sensory cells and the rebuilding of the sensory organ to the adult should be investigated. Implications of the hypothesis Usually, the evolution of insect ears is viewed with respect to physiological and neuronal mechanisms of sound perception. This view should be extended to the development of sense organs. Functional requirements during postembryonic development may act as constraints for the evolution of adult organs, as exemplified with the auditory system of cicadas.

  13. Developmental principles: fact or fiction.

    Science.gov (United States)

    Durston, A J

    2012-01-01

    While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, "whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm". We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level?) adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

  14. The Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge

    2001-01-01

    AbstractIn the nineties, the concept of the developmental work (DW) has become a significant point of orientation for the actors on Danish labour market. The DW has moved the focus of the labour market from wages and working time towards work and production. For employees, the DW promises...... developmental possibilities, influence and responsibility, but also greater social responsibility for the firm. For firms, the DW promises increased competitiveness and better products. In this paper we present the concept of the DW as one which encourages the development of work, production and organisation...... of the firm and show that the DW is different from mainstream management concepts, as the DW...

  15. Future Directions in Sleep and Developmental Psychopathology.

    Science.gov (United States)

    Meltzer, Lisa J

    2017-01-01

    It is critical for psychologists to gain a better understanding about the intersection between sleep and developmental psychopathology. However, while many strive to answer the question of whether sleep causes developmental psychopathology, or vice versa, ultimately the relationship between sleep and developmental psychopathology is complex and dynamic. This article considers future directions in the field of clinical child and adolescent psychology that go beyond this mechanistic question, highlighting areas important to address for clinicians and researchers who strive to better understand how best to serve children and adolescents with developmental psychopathology. Questions are presented about what is normal in terms of sleep across development, the role of individual variability in terms of sleep needs and vulnerability to sleep loss, and how sleep may serve as a risk or resilience factor for developmental psychopathology, concluding with considerations for interventions.

  16. The interrelationships between motor, cognitive, and language development in children with and without intellectual and developmental disabilities

    NARCIS (Netherlands)

    Houwen, Suzanne; Visser, Linda; van der Putten, Annette; Vlaskamp, Carla

    2016-01-01

    It is generally agreed that cognitive and language development are dependent on the emergence of motor skills. As the literature on this issue concerning children with developmental disabilities is scarce, we examined the interrelationships between motor, cognitive, and language development in

  17. Author's Response to Commentaries on: "An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics"

    Science.gov (United States)

    Molenaar, Peter C. M.

    2015-01-01

    In this article, Peter Molenaar responds to three commentaries (this issue) on his article, "An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics." He addresses aspects of relational developmental systems (RDS) mentioned and questions raised in each of the…

  18. Error-dependent modulation of speech-induced auditory suppression for pitch-shifted voice feedback

    Directory of Open Access Journals (Sweden)

    Larson Charles R

    2011-06-01

    Full Text Available Abstract Background The motor-driven predictions about expected sensory feedback (efference copies have been proposed to play an important role in recognition of sensory consequences of self-produced motor actions. In the auditory system, this effect was suggested to result in suppression of sensory neural responses to self-produced voices that are predicted by the efference copies during vocal production in comparison with passive listening to the playback of the identical self-vocalizations. In the present study, event-related potentials (ERPs were recorded in response to upward pitch shift stimuli (PSS with five different magnitudes (0, +50, +100, +200 and +400 cents at voice onset during active vocal production and passive listening to the playback. Results Results indicated that the suppression of the N1 component during vocal production was largest for unaltered voice feedback (PSS: 0 cents, became smaller as the magnitude of PSS increased to 200 cents, and was almost completely eliminated in response to 400 cents stimuli. Conclusions Findings of the present study suggest that the brain utilizes the motor predictions (efference copies to determine the source of incoming stimuli and maximally suppresses the auditory responses to unaltered feedback of self-vocalizations. The reduction of suppression for 50, 100 and 200 cents and its elimination for 400 cents pitch-shifted voice auditory feedback support the idea that motor-driven suppression of voice feedback leads to distinctly different sensory neural processing of self vs. non-self vocalizations. This characteristic may enable the audio-vocal system to more effectively detect and correct for unexpected errors in the feedback of self-produced voice pitch compared with externally-generated sounds.

  19. Error-dependent modulation of speech-induced auditory suppression for pitch-shifted voice feedback.

    Science.gov (United States)

    Behroozmand, Roozbeh; Larson, Charles R

    2011-06-06

    The motor-driven predictions about expected sensory feedback (efference copies) have been proposed to play an important role in recognition of sensory consequences of self-produced motor actions. In the auditory system, this effect was suggested to result in suppression of sensory neural responses to self-produced voices that are predicted by the efference copies during vocal production in comparison with passive listening to the playback of the identical self-vocalizations. In the present study, event-related potentials (ERPs) were recorded in response to upward pitch shift stimuli (PSS) with five different magnitudes (0, +50, +100, +200 and +400 cents) at voice onset during active vocal production and passive listening to the playback. Results indicated that the suppression of the N1 component during vocal production was largest for unaltered voice feedback (PSS: 0 cents), became smaller as the magnitude of PSS increased to 200 cents, and was almost completely eliminated in response to 400 cents stimuli. Findings of the present study suggest that the brain utilizes the motor predictions (efference copies) to determine the source of incoming stimuli and maximally suppresses the auditory responses to unaltered feedback of self-vocalizations. The reduction of suppression for 50, 100 and 200 cents and its elimination for 400 cents pitch-shifted voice auditory feedback support the idea that motor-driven suppression of voice feedback leads to distinctly different sensory neural processing of self vs. non-self vocalizations. This characteristic may enable the audio-vocal system to more effectively detect and correct for unexpected errors in the feedback of self-produced voice pitch compared with externally-generated sounds.

  20. DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

    Directory of Open Access Journals (Sweden)

    Jelena Kostić

    2015-12-01

    Full Text Available Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to conduct disorder which have different causes and serve as the basis for the current typology of conduct disorders in the classification systems. Such a typology of conduct disorders in the diagnostic classification allows better understanding, prognosis and choice of treatment.

  1. Simulation of design dependent failure exposure levels for CMOS ICs

    International Nuclear Information System (INIS)

    Kaul, N.; Bhuva, B.L.; Rangavajjhala, V.; van der Molen, H.; Kerns, S.E.

    1990-01-01

    The total dose exposure of CMOS ICs introduces bias-dependent parameter shifts in individual devices. The bias dependency of individual parameter shifts of devices cause different designs to behave differently under identical testing conditions. This paper studies the effect of design and bias on the radiation tolerance of ICs and presents an automated design tool that produces different designs for a logic function, and presents important parameters of each design to circuit designer for trade off analysis

  2. Shifting Attention

    Science.gov (United States)

    Ingram, Jenni

    2014-01-01

    This article examines the shifts in attention and focus as one teacher introduces and explains an image that represents the processes involved in a numeric problem that his students have been working on. This paper takes a micro-analytic approach to examine how the focus of attention shifts through what the teacher and students do and say in the…

  3. β-Adrenergic enhancement of neuronal excitability in the lateral amygdala is developmentally gated.

    Science.gov (United States)

    Fink, Ann E; LeDoux, Joseph E

    2018-05-01

    Noradrenergic signaling in the amygdala is important for processing threats and other emotionally salient stimuli, and β-adrenergic receptor activation is known to enhance neuronal spiking in the lateral amygdala (LA) of juvenile animals. Nevertheless, intracellular recordings have not yet been conducted to determine the effect of β-adrenergic receptor activation on spike properties in the adult LA, despite the potential significance of developmental changes between adolescence and adulthood. Here we demonstrate that the β-adrenergic agonist isoproterenol (15 μM) enhances spike frequency in dorsal LA principal neurons of juvenile male C57BL/6 mice and fails to do so in strain- and sex-matched adults. Furthermore, we find that the age-dependent effect of isoproterenol on spike frequency is occluded by the GABA A receptor blocker picrotoxin (75 μM), suggesting that β-adrenergic receptors downregulate tonic inhibition specifically in juvenile animals. These findings indicate a significant shift during adolescence in the cellular mechanisms of β-adrenergic modulation in the amygdala. NEW & NOTEWORTHY β-Adrenergic receptors (β-ARs) in amygdala are important in processing emotionally salient stimuli. Most cellular recordings have examined juvenile animals, while behavioral data are often obtained from adults. We replicate findings showing that β-ARs enhance spiking of principal cells in the lateral amygdala of juveniles, but we fail to find this in adults. These findings have notable scientific and clinical implications regarding the noradrenergic modulation of threat processing, alterations of which underlie fear and anxiety disorders.

  4. A new selective developmental deficit: Impaired object recognition with normal face recognition.

    Science.gov (United States)

    Germine, Laura; Cashdollar, Nathan; Düzel, Emrah; Duchaine, Bradley

    2011-05-01

    Studies of developmental deficits in face recognition, or developmental prosopagnosia, have shown that individuals who have not suffered brain damage can show face recognition impairments coupled with normal object recognition (Duchaine and Nakayama, 2005; Duchaine et al., 2006; Nunn et al., 2001). However, no developmental cases with the opposite dissociation - normal face recognition with impaired object recognition - have been reported. The existence of a case of non-face developmental visual agnosia would indicate that the development of normal face recognition mechanisms does not rely on the development of normal object recognition mechanisms. To see whether a developmental variant of non-face visual object agnosia exists, we conducted a series of web-based object and face recognition tests to screen for individuals showing object recognition memory impairments but not face recognition impairments. Through this screening process, we identified AW, an otherwise normal 19-year-old female, who was then tested in the lab on face and object recognition tests. AW's performance was impaired in within-class visual recognition memory across six different visual categories (guns, horses, scenes, tools, doors, and cars). In contrast, she scored normally on seven tests of face recognition, tests of memory for two other object categories (houses and glasses), and tests of recall memory for visual shapes. Testing confirmed that her impairment was not related to a general deficit in lower-level perception, object perception, basic-level recognition, or memory. AW's results provide the first neuropsychological evidence that recognition memory for non-face visual object categories can be selectively impaired in individuals without brain damage or other memory impairment. These results indicate that the development of recognition memory for faces does not depend on intact object recognition memory and provide further evidence for category-specific dissociations in visual

  5. Language used in interaction during developmental science instruction

    Science.gov (United States)

    Avenia-Tapper, Brianna

    The coordination of theory and evidence is an important part of scientific practice. Developmental approaches to instruction, which make the relationship between the abstract and the concrete a central focus of students' learning activity, provide educators with a unique opportunity to strengthen students' coordination of theory and evidence. Therefore, developmental approaches may be a useful instructional response to documented science achievement gaps for linguistically diverse students. However, if we are to leverage the potential of developmental instruction to improve the science achievement of linguistically diverse students, we need more information on the intersection of developmental science instruction and linguistically diverse learning contexts. This manuscript style dissertation uses discourse analysis to investigate the language used in interaction during developmental teaching-learning in three linguistically diverse third grade classrooms. The first manuscript asks how language was used to construct ascension from the abstract to the concrete. The second manuscript asks how students' non-English home languages were useful (or not) for meeting the learning goals of the developmental instructional program. The third manuscript asks how students' interlocutors may influence student choice to use an important discourse practice--justification--during the developmental teaching-learning activity. All three manuscripts report findings relevant to the instructional decisions that teachers need to make when implementing developmental instruction in linguistically diverse contexts.

  6. Developmental and visual input-dependent regulation of the CB1 cannabinoid receptor in the mouse visual cortex.

    Directory of Open Access Journals (Sweden)

    Taisuke Yoneda

    Full Text Available The mammalian visual system exhibits significant experience-induced plasticity in the early postnatal period. While physiological studies have revealed the contribution of the CB1 cannabinoid receptor (CB1 to developmental plasticity in the primary visual cortex (V1, it remains unknown whether the expression and localization of CB1 is regulated during development or by visual experience. To explore a possible role of the endocannabinoid system in visual cortical plasticity, we examined the expression of CB1 in the visual cortex of mice. We found intense CB1 immunoreactivity in layers II/III and VI. CB1 mainly localized at vesicular GABA transporter-positive inhibitory nerve terminals. The amount of CB1 protein increased throughout development, and the specific laminar pattern of CB1 appeared at P20 and remained until adulthood. Dark rearing from birth to P30 decreased the amount of CB1 protein in V1 and altered the synaptic localization of CB1 in the deep layer. Dark rearing until P50, however, did not influence the expression of CB1. Brief monocular deprivation for 2 days upregulated the localization of CB1 at inhibitory nerve terminals in the deep layer. Taken together, the expression and the localization of CB1 are developmentally regulated, and both parameters are influenced by visual experience.

  7. Developmental Immunotoxicity

    Science.gov (United States)

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  8. Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge; Kristensen, Tage Søndergaard

    2003-01-01

    Human Deveoplment and Working Life - Work for Welfare explores whether the development of human resources at company level can improve individuals' quality of life, companies' possibilities of development, and welfare and democracy in society. Chapter two discuss the concept "developmental work...

  9. Hydrogen atom spectrum and the Lamb shift in noncommutative QED

    International Nuclear Information System (INIS)

    Chaichian, M. . Helsinki Institute of Physics, Helsinki; Tureanu, A. . Helsinki Institute of Physics, Helsinki; FI)

    2000-10-01

    We have calculated the energy levels of the hydrogen atom and as well the Lamb shift within the noncommutative quantum electrodynamics theory. The results show deviations from the usual QED both on the classical and on the quantum levels. On both levels, the deviations depend on the parameter of space/space noncommutativity. (author)

  10. Assessing the Developmental Neurotoxicity of 27 ...

    Science.gov (United States)

    Assessing the Developmental Neurotoxicity of 27 Organophosphorus Pesticides Using a Zebrafish Behavioral Assay, Waalkes, M., Hunter, D.L., Jarema, K., Mundy, W., and S. Padilla. The U.S. Environmental Protection Agency is evaluating methods to screen and prioritize organophosphorus pesticides for developmental neurotoxicity. As such, we are exploring a behavioral testing paradigm that can assess the effects of sublethal and subteratogenic concentrations of developmental neurotoxicants on zebrafish (Danio rerio). This in vivo assay quantifies the locomotor response to light stimuli under tandem light and dark conditions in a 96-well plate using a video tracking system on 6 day post fertilization zebrafish larvae. Each of twenty-seven organophosphorus pesticides was tested for their developmental neurotoxic potential by exposing zebrafish embryos/larvae to the pesticide at several concentrations (≤ 100 μM nominal concentration) during the first five days of development, followed by 24 hours of depuration and then behavioral testing. Approximately 22% of the chemicals (Acephate, Dichlorvos, Diazoxon, Bensulide,Tribufos, Tebupirimfos) did not produce any behavioral changes after developmental exposure, while many (Malaoxon Fosthiazate, Dimethoate, Dicrotophos, Ethoprop, Malathion, Naled, Diazinon, Methamidophos, Terbufos, Trichlorfon, Phorate, Pirimiphos-methyl, Profenofos, Z-Tetrachlorvinphos, Chlorpyrifos, Coumaphos, Phosmet, Omethoate) produced changes in swi

  11. Work shift duration: a review comparing eight hour and 12 hour shift systems.

    Science.gov (United States)

    Smith, L; Folkard, S; Tucker, P; Macdonald, I

    1998-04-01

    Shiftwork is now a major feature of working life across a broad range of industries. The features of the shift systems operated can impact on the wellbeing, performance, and sleep of shiftworkers. This paper reviews the current state of knowledge on one major characteristic of shift rotas-namely, shift duration. Evidence comparing the relative effects of eight hour and 12 hour shifts on fatigue and job performance, safety, sleep, and physical and psychological health are considered. At the organisational level, factors such as the mode of system implementation, attitudes towards shift rotas, sickness absence and turnover, overtime, and moonlighting are discussed. Manual and electronic searches of the shiftwork research literature were conducted to obtain information on comparisons between eight hour and 12 hour shifts. The research findings are largely equivocal. The bulk of the evidence suggests few differences between eight and 12 hour shifts in the way they affect people. There may even be advantages to 12 hour shifts in terms of lower stress levels, better physical and psychological wellbeing, improved durations and quality of off duty sleep as well as improvements in family relations. On the negative side, the main concerns are fatigue and safety. It is noted that a 12 hour shift does not equate with being active for only 12 hours. There can be considerable extension of the person's time awake either side of the shift. However, the effects of longer term exposure to extended work days have been relatively uncharted in any systematic way. Longitudinal comparative research into the chronic impact of the compressed working week is needed.

  12. Third ventricle midline shift on computed tomography as an alternative to septum pellucidum shift

    International Nuclear Information System (INIS)

    Santiago, Carlos Francis A.; Oropilla, Jean Quint L; Alvarez, Victor M.

    2000-01-01

    The cerebral midline shift is measured using the displacement from midline of the third ventricle. It is an easily determined criterion from which CT scans of patients with spontaneous intracerebral hematoma may be investigated. Midline shift is a significant criteria in which to gauge the neurological status of patients. In a retrospective study of 32 patients with spontaneous unilateral intracerebral hemorrhage, a midline third ventricle shift correlated well with septum pellucidum shift. A greater than 7 mm midline third ventricle shift was associated with a significantly lower Glasgow Coma scale score compared a shift less than 7mm. For the septum pellucidum, a greater than 10 mm shift was similarly associated with a significantly lower Glasgow Coma scale score. (Author)

  13. Insomnia in shift work.

    Science.gov (United States)

    Vallières, Annie; Azaiez, Aïda; Moreau, Vincent; LeBlanc, Mélanie; Morin, Charles M

    2014-12-01

    Shift work disorder involves insomnia and/or excessive sleepiness associated with the work schedule. The present study examined the impact of insomnia on the perceived physical and psychological health of adults working on night and rotating shift schedules compared to day workers. A total of 418 adults (51% women, mean age 41.4 years), including 51 night workers, 158 rotating shift workers, and 209 day workers were selected from an epidemiological study. An algorithm was used to classify each participant of the two groups (working night or rotating shifts) according to the presence or absence of insomnia symptoms. Each of these individuals was paired with a day worker according to gender, age, and income. Participants completed several questionnaires measuring sleep, health, and psychological variables. Night and rotating shift workers with insomnia presented a sleep profile similar to that of day workers with insomnia. Sleep time was more strongly related to insomnia than to shift work per se. Participants with insomnia in the three groups complained of anxiety, depression, and fatigue, and reported consuming equal amounts of sleep-aid medication. Insomnia also contributed to chronic pain and otorhinolaryngology problems, especially among rotating shift workers. Work productivity and absenteeism were more strongly related to insomnia. The present study highlights insomnia as an important component of the sleep difficulties experienced by shift workers. Insomnia may exacerbate certain physical and mental health problems of shift workers, and impair their quality of life. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Performance of children with developmental dyslexia on high and low topological entropy artificial grammar learning task.

    Science.gov (United States)

    Katan, Pesia; Kahta, Shani; Sasson, Ayelet; Schiff, Rachel

    2017-07-01

    Graph complexity as measured by topological entropy has been previously shown to affect performance on artificial grammar learning tasks among typically developing children. The aim of this study was to examine the effect of graph complexity on implicit sequential learning among children with developmental dyslexia. Our goal was to determine whether children's performance depends on the complexity level of the grammar system learned. We conducted two artificial grammar learning experiments that compared performance of children with developmental dyslexia with that of age- and reading level-matched controls. Experiment 1 was a high topological entropy artificial grammar learning task that aimed to establish implicit learning phenomena in children with developmental dyslexia using previously published experimental conditions. Experiment 2 is a lower topological entropy variant of that task. Results indicated that given a high topological entropy grammar system, children with developmental dyslexia who were similar to the reading age-matched control group had substantial difficulty in performing the task as compared to typically developing children, who exhibited intact implicit learning of the grammar. On the other hand, when tested on a lower topological entropy grammar system, all groups performed above chance level, indicating that children with developmental dyslexia were able to identify rules from a given grammar system. The results reinforced the significance of graph complexity when experimenting with artificial grammar learning tasks, particularly with dyslexic participants.

  15. A Mobile Early Stimulation Program to Support Children with Developmental Delays in Brazil.

    Science.gov (United States)

    Dias, Raquel da Luz; Silva, Kátia Cristina Correa Guimarães; Lima, Marcela Raquel de Oliveira; Alves, João Guilherme Bezerra; Abidi, Syed Sibte Raza

    2018-01-01

    Developmental delay is a deviation development from the normative milestones during the childhood and it may be caused by neurological disorders. Early stimulation is a standardized and simple technique to treat developmental delays in children (aged 0-3 years), allowing them to reach the best development possible and to mitigate neuropsychomotor sequelae. However, the outcomes of the treatment depending on the involvement of the family, to continue the activities at home on a daily basis. To empower and educate parents of children with neurodevelopmental delays to administer standardized early stimulation programs at home, we developed a mobile early stimulation program that provides timely and evidence-based clinical decision support to health professionals and a personalized guidance to parents about how to administer early stimulation to their child at home.

  16. Evolutionary and developmental modules.

    Science.gov (United States)

    Lacquaniti, Francesco; Ivanenko, Yuri P; d'Avella, Andrea; Zelik, Karl E; Zago, Myrka

    2013-01-01

    The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates.

  17. Sexual dysfunction within an adult developmental perspective.

    Science.gov (United States)

    Fagan, P J; Meyer, J K; Schmidt, C W

    1986-01-01

    The focus of this paper is on the adult who has adequately mastered the oedipal stage of psychosexual development and who presents with a sexual dysfunction. Drawing on the developmental sequence of Erik Erikson, the authors suggest that failure to address adequately an adult psychosocial crisis may result in sexual dysfunction. There may be both adult developmental deficits and regression to adolescent and adult stages previously negotiated. Both may be symptomatically represented by sexual dysfunction. The authors urge that the sexual and marital problems be evaluated within an adult developmental framework and that the therapy address the psychosocial issues which are appropriate to the developmental stage of the patient.

  18. Effects of extended work shifts and shift work on patient safety, productivity, and employee health.

    Science.gov (United States)

    Keller, Simone M

    2009-12-01

    It is estimated 1.3 million health care errors occur each year and of those errors 48,000 to 98,000 result in the deaths of patients (Barger et al., 2006). Errors occur for a variety of reasons, including the effects of extended work hours and shift work. The need for around-the-clock staff coverage has resulted in creative ways to maintain quality patient care, keep health care errors or adverse events to a minimum, and still meet the needs of the organization. One way organizations have attempted to alleviate staff shortages is to create extended work shifts. Instead of the standard 8-hour shift, workers are now working 10, 12, 16, or more hours to provide continuous patient care. Although literature does support these staffing patterns, it cannot be denied that shifts beyond the traditional 8 hours increase staff fatigue, health care errors, and adverse events and outcomes and decrease alertness and productivity. This article includes a review of current literature on shift work, the definition of shift work, error rates and adverse outcomes related to shift work, health effects on shift workers, shift work effects on older workers, recommended optimal shift length, positive and negative effects of shift work on the shift worker, hazards associated with driving after extended shifts, and implications for occupational health nurses. Copyright 2009, SLACK Incorporated.

  19. Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence

    DEFF Research Database (Denmark)

    Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

    2004-01-01

    Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these......Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus...... for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...

  20. Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence.

    Science.gov (United States)

    Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

    2004-06-01

    Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby influencing the phenotype, illness severity, and adult outcome of tic disorders. Similar developmental processes during adolescence likely determine the phenotype and natural history of a broad range of other complex neuropsychiatric disorders of childhood onset, and they likely contribute to the acquisition of improved self-regulatory capacities that characterize normal adolescent development.

  1. Bet-hedging as a complex interaction among developmental instability, environmental heterogeneity, dispersal, and life-history strategy.

    Science.gov (United States)

    Scheiner, Samuel M

    2014-02-01

    One potential evolutionary response to environmental heterogeneity is the production of randomly variable offspring through developmental instability, a type of bet-hedging. I used an individual-based, genetically explicit model to examine the evolution of developmental instability. The model considered both temporal and spatial heterogeneity alone and in combination, the effect of migration pattern (stepping stone vs. island), and life-history strategy. I confirmed that temporal heterogeneity alone requires a threshold amount of variation to select for a substantial amount of developmental instability. For spatial heterogeneity only, the response to selection on developmental instability depended on the life-history strategy and the form and pattern of dispersal with the greatest response for island migration when selection occurred before dispersal. Both spatial and temporal variation alone select for similar amounts of instability, but in combination resulted in substantially more instability than either alone. Local adaptation traded off against bet-hedging, but not in a simple linear fashion. I found higher-order interactions between life-history patterns, dispersal rates, dispersal patterns, and environmental heterogeneity that are not explainable by simple intuition. We need additional modeling efforts to understand these interactions and empirical tests that explicitly account for all of these factors.

  2. How Do Children Deal With Conflict? A Developmental Study of Sequential Conflict Modulation

    Science.gov (United States)

    Smulders, Silvan F. A.; Soetens, Eric L. L.; van der Molen, Maurits W.

    2018-01-01

    This study examined age-related differences in sequential conflict modulation (SCM), elicited in three tasks requiring the inhibition of pre-potent responses; a Simon task, an S-R compatibility (SRC) task and a hybrid Choice-reaction/NoGo task. The primary focus was on age-related changes in performance changes following a conflict trial. A secondary aim was to assess whether SCM follows different developmental trajectories depending on the type of conflict elicited by the tasks. The tasks were presented to three different groups of participants with an age range between 7- to 25-years—one group of participants for each task. For each task, the response-to-stimulus interval (RSI) was manipulated (50 vs. 500 ms) across trial blocks to assess time-dependent changes in conflict modulation. The results showed SCM for all three tasks, although the specific patterns differed between tasks and RSIs. Importantly, the magnitude of SCM decreased with advancing age, but this developmental trend did not survive when considering age-group differences in basic response speed. The current results contribute to the emerging evidence suggesting that patterns of SCM are task specific and were interpreted in terms of multiple bottom-up control mechanisms. PMID:29875718

  3. Use of drawings in children with pervasive developmental disorder during hospitalization: a developmental perspective.

    Science.gov (United States)

    Stefanatou, Athena

    2008-12-01

    The level and nature of emotional upheaval and relationship to developmental stage was studied in children with pervasive developmental disorder (PDD) hospitalized for head injury. The sample consisted of 25 hospitalized children aged 5-12 years. Children were asked to make the drawing of a ;person in hospital'. The drawings were evaluated by Koppitz's emotional indicators. Punishment and persecution were the main cognitive constructs of children in order to explain hospitalization.

  4. Lightness dependence of achromatic loci in color-appearance coordinates

    OpenAIRE

    Kuriki, Ichiro

    2015-01-01

    Shifts in the appearance of color under different illuminant chromaticity are known to be incomplete, and fit nicely with a simple linear transformation of cone responses that aligns the achromatic points under two illuminants. Most chromaticity-transfer functions with von-Kries-like transformations use only one set of values to fit the color shifts from one illuminant to another. However, an achromatic point shifts its chromaticity depending on the lightness of the test stimulus. This lightn...

  5. Neurobehavioural effects of developmental toxicity

    DEFF Research Database (Denmark)

    Grandjean, Philippe; Landrigan, Philip J

    2014-01-01

    Neurodevelopmental disabilities, including autism, attention-deficit hyperactivity disorder, dyslexia, and other cognitive impairments, affect millions of children worldwide, and some diagnoses seem to be increasing in frequency. Industrial chemicals that injure the developing brain are among...... the known causes for this rise in prevalence. In 2006, we did a systematic review and identified five industrial chemicals as developmental neurotoxicants: lead, methylmercury, polychlorinated biphenyls, arsenic, and toluene. Since 2006, epidemiological studies have documented six additional developmental...... chemicals should not be presumed to be safe to brain development, and chemicals in existing use and all new chemicals must therefore be tested for developmental neurotoxicity. To coordinate these efforts and to accelerate translation of science into prevention, we propose the urgent formation of a new...

  6. Context-dependent regulation of feeding behaviour by the insulin receptor, DAF-2, in Caenorhabditis elegans.

    Science.gov (United States)

    Dillon, James; Holden-Dye, Lindy; O'Connor, Vincent; Hopper, Neil A

    2016-06-01

    Insulin signalling plays a significant role in both developmental programmes and pathways modulating the neuronal signalling that controls adult behaviour. Here, we have investigated insulin signalling in food-associated behaviour in adult C. elegans by scoring locomotion and feeding on and off bacteria, the worm's food. This analysis used mutants (daf-2, daf-18) of the insulin signalling pathway, and we provide evidence for an acute role for insulin signalling in the adult nervous system distinct from its impact on developmental programmes. Insulin receptor daf-2 mutants move slower than wild type both on and off food and showed impaired locomotory responses to food deprivation. This latter behaviour is manifest as a failure to instigate dispersal following prolonged food deprivation and suggests a role for insulin signalling in this adaptive response. Insulin receptor daf-2 mutants are also deficient in pharyngeal pumping on food and off food. Pharmacological analysis showed the pharynx of daf-2 is selectively compromised in its response to 5-HT compared to the excitatory neuropeptide FLP-17. By comparing the adaptive pharyngeal behaviour in intact worms and isolated pharyngeal preparations, we determined that an insulin-dependent signal extrinsic to the pharyngeal system is involved in feeding adaptation. Hence, we suggest that reactive insulin signalling modulates both locomotory foraging and pharyngeal pumping as the animal adapts to the absence of food. We discuss this in the context of insulin signalling directing a shift in the sensitivity of neurotransmitter systems to regulate the worm's response to changes in food availability in the environment.

  7. The developmental and genetic bases of apetaly in Bocconia frutescens (Chelidonieae: Papaveraceae

    Directory of Open Access Journals (Sweden)

    Cristina Arango-Ocampo

    2016-08-01

    Full Text Available Abstract Background Bocconia and Macleaya are the only genera of the poppy family (Papaveraceae lacking petals; however, the developmental and genetic processes underlying such evolutionary shift have not yet been studied. Results We studied floral development in two species of petal-less poppies Bocconia frutescens and Macleaya cordata as well as in the closely related petal-bearing Stylophorum diphyllum. We generated a floral transcriptome of B. frutescens to identify MADS-box ABCE floral organ identity genes expressed during early floral development. We performed phylogenetic analyses of these genes across Ranunculales as well as RT-PCR and qRT-PCR to assess loci-specific expression patterns. We found that petal-to-stamen homeosis in petal-less poppies occurs through distinct developmental pathways. Transcriptomic analyses of B. frutescens floral buds showed that homologs of all MADS-box genes are expressed except for the APETALA3-3 ortholog. Species-specific duplications of other ABCE genes in B. frutescens have resulted in functional copies with expanded expression patterns than those predicted by the model. Conclusions Petal loss in B. frutescens is likely associated with the lack of expression of AP3-3 and an expanded expression of AGAMOUS. The genetic basis of petal identity is conserved in Ranunculaceae and Papaveraceae although they have different number of AP3 paralogs and exhibit dissimilar floral groundplans.

  8. Modelling a Nurse Shift Schedule with Multiple Preference Ranks for Shifts and Days-Off

    Directory of Open Access Journals (Sweden)

    Chun-Cheng Lin

    2014-01-01

    Full Text Available When it comes to nurse shift schedules, it is found that the nursing staff have diverse preferences about shift rotations and days-off. The previous studies only focused on the most preferred work shift and the number of satisfactory days-off of the schedule at the current schedule period but had few discussions on the previous schedule periods and other preference levels for shifts and days-off, which may affect fairness of shift schedules. As a result, this paper proposes a nurse scheduling model based upon integer programming that takes into account constraints of the schedule, different preference ranks towards each shift, and the historical data of previous schedule periods to maximize the satisfaction of all the nursing staff's preferences about the shift schedule. The main contribution of the proposed model is that we consider that the nursing staff’s satisfaction level is affected by multiple preference ranks and their priority ordering to be scheduled, so that the quality of the generated shift schedule is more reasonable. Numerical results show that the planned shifts and days-off are fair and successfully meet the preferences of all the nursing staff.

  9. Shift work and its association with metabolic disorders

    OpenAIRE

    Brum, Maria Carlota Borba; Dantas Filho, Fábio Fernandes; Schnorr, Claudia Carolina; Bottega, Gustavo Borchardt; Rodrigues, Ticiana da Costa

    2015-01-01

    Although the health burden of shift work has not been extensively studied, evidence suggests that it may affect the metabolic balance and cause obesity and other metabolic disorders. Sleep deprivation, circadian desynchronization and behavioral changes in diet and physical activity are among the most commonly mentioned factors in studies of the association between night work and metabolic disorders. Individual adaptation to night work depends greatly on personal factors such as family and soc...

  10. Isotope effect on the zero point energy shift upon condensation

    International Nuclear Information System (INIS)

    Kornblum, Z.C.

    1977-01-01

    The various isotope-dependent and independent atomic and molecular properties that pertain to the isotopic difference between the zero point energy (ZPE) shifts upon condensation have been derived. The theoretical development of the change of the ZPE associated with the internal molecular vibrations, due to the condensation of the gaseous molecules, has been presented on the basis of Wolfsberg's second-order perturbation treatment of the isotope-dependent London dispersion forces between liquid molecules. The isotope effect on the ZPE shift is related to the difference between the sums of the integrated intensities of the infrared absorption bands of the two gaseous isotopic molecules. Each intensity sum is expressed, in part, in terms of partial derivatives of the molecular dipole moment with respect to atomic cartesian coordinates. These derivatives are related to the isotope-independent effective charges of the atoms, which are theoretically calculated by means of a modified CNDO/2 computer program. The effective atomic charges are also calculated from available experimental infrared intensity data. The effects of isotopic substitutions of carbon-13 for carbon-12 and/or deuterium for protium, in ethylene, methane, and the fluorinated methanes, CH 3 F, CH 2 F 2 , CHF 3 , and CF 4 , on the ZPE shift upon condensation are calculated. These results compare well with the Bigeleisen B-factors, which are experimentally obtained from vapor pressure measurements of the isotopic species. Each of the following molecular properties will tend to increase the isotopic difference between the ZPE shifts upon condensation: (1) large number of highly polar bonds, (2) high molecular weight, (3) non-polar (preferably) or massive molecule, (4) non-hydrogenous molecule, and (5) closely packed liquid molecules. These properties will result in stronger dispersion forces in the liquid phase between the lighter molecules than between the isotopically heavier molecules

  11. Age-Dependent Mesial Temporal Lobe Lateralization in Language FMRI

    Science.gov (United States)

    Sepeta, Leigh N.; Berl, Madison M.; Wilke, Marko; You, Xiaozhen; Mehta, Meera; Xu, Benjamin; Inati, Sara; Dustin, Irene; Khan, Omar; Austermuehle, Alison; Theodore, William H.; Gaillard, William D.

    2015-01-01

    Objective FMRI activation of the mesial temporal lobe (MTL) may be important for epilepsy surgical planning. We examined MTL activation and lateralization during language fMRI in children and adults with focal epilepsy. Methods 142 controls and patients with left hemisphere focal epilepsy (Pediatric: epilepsy, n = 17, mean age = 9.9 ± 2.0; controls, n = 48; mean age = 9.1 ± 2.6; Adult: epilepsy, n = 20, mean age = 26.7 ± 5.8; controls, n = 57, mean age = 26.2 ± 7.5) underwent 3T fMRI using a language task (auditory description decision task). Image processing and analyses were conducted in SPM8; ROIs included MTL, Broca’s area, and Wernicke’s area. We assessed group and individual MTL activation, and examined degree of lateralization. Results Patients and controls (pediatric and adult) demonstrated group and individual MTL activation during language fMRI. MTL activation was left lateralized for adults but less so in children (p’s < 0.005). Patients did not differ from controls in either age group. Stronger left-lateralized MTL activation was related to older age (p = 0.02). Language lateralization (Broca’s and Wernicke’s) predicted 19% of the variance in MTL lateralization for adults (p = 0.001), but not children. Significance Language fMRI may be used to elicit group and individual MTL activation. The developmental difference in MTL lateralization and its association with language lateralization suggests a developmental shift in lateralization of MTL function, with increased left lateralization across the age span. This shift may help explain why children have better memory outcomes following resection compared to adults. PMID:26696589

  12. Mechanistic Investigations Into the Developmental Toxicity of Nitrated and Heterocyclic PAHs

    Science.gov (United States)

    Chlebowski, Anna C.; Garcia, Gloria R.; La Du, Jane K.; Bisson, William H.; Truong, Lisa; Massey Simonich, Staci L.

    2017-01-01

    Abstract Nitrated polycyclic aromatic hydrocarbons (NPAHs) and heterocyclic PAHs (HPAHs) are recognized environmental pollutants. However, the health risks of NPAHs and HPAHs to humans and environmental systems are not well-studied. The developmental zebrafish (Danio rerio) model was used to evaluate the toxicity of a structurally diverse set of 27 NPAHs and 10 HPAHs. The individual activity of each compound towards the aryl hydrocarbon receptor (AHR), including the role of the AHR in observed toxicity, and genetic markers of oxidative stress and cardiac toxicity were evaluated. Zebrafish embryos were exposed from 6 to 120 hours post fertilization (hpf), to a broad concentration range of individual compounds, and evaluated for 22 developmental endpoints. The potential role of AHR was determined using the transgenic Tg(cyp1a:nls-egfp) reporter zebrafish line. All compounds were screened computationally through molecular docking using a previously developed AHR models of zebrafish isoforms 1A, 1B, and 2. Some compounds did not induce observable developmental toxic responses, whereas others produced statistically significant concentration-dependent toxicity. The tested compounds also exhibited a range of predicted AHR binding and cyp1a/GFP induction patterns, including cyp1a expression in the liver, vasculature, skin, and yolk, which we determined to be due to distinct isoforms of the AHR, using morpholino oligonucleotide knockdown. Furthermore, we investigated mRNA expression of oxidative and cardiac stress genes at 48 and 120 hpf, which indicated several potential mechanisms-of-action for NPAHs. Overall, we observed a range of developmental toxicities, cyp1a/GFP expression patterns, and gene expression profiles, suggestive of several potential mechanisms of action. PMID:28186253

  13. Strain Dependence of Photoluminescense of Individual Carbon Nanotubes

    Science.gov (United States)

    Nikolaev, Pavel N.; Leeuw, Tonya K.; Tsyboulski, Dmitri A.; Bachilo, Sergei M.; Weisman, Bruce; Arepalli, Sivaram

    2007-01-01

    We have investigated strain dependence of photoluminescense (PL) spectra of single wall carbon nanotubes (SWNT). Nanotubes were sparsely dispersed in a thin PMMA film applied to acrylic bar, and strained in both compression and extension by bending this bar in either direction in a homebuilt four-point bending rig. The average surface strain was measured with high accuracy by a resistive strain gage applied on top of the film. The near infrared imaging and spectroscopy were performed on the inverted microscope equipped with high numerical aperture reflective objective lens and InGaAs CCD cameras. PL was excited with a diode laser at either 658, 730 or 785 nm, linearly polarized in the direction of the strain. We were able to measure (n,m) types and orientation of individual nanotubes with respect to strain direction and strain dependence of their PL maxima. It was found that PL peak shifts with respect to the values measured in SDS micelles are a sum of three components. First, a small environmental shift due to difference in the dielectric constant of the surrounding media, that is constant and independent of the nanotube type. Second, shift due to isotropic compression of the film during drying. Third, shifts produced by the uniaxial loading of the film in the experiment. Second and third shifts follow expression based on the first-order expansion of the TB hamiltonian. Their magnitude is proportional to the nanotube chiral angle and strain, and direction is determined by the nanotube quantum number. PL strain dependence measured for a number of various nanotube types allows to estimate TB carbon-carbon transfer integral.

  14. State-dependent neutral delay equations from population dynamics.

    Science.gov (United States)

    Barbarossa, M V; Hadeler, K P; Kuttler, C

    2014-10-01

    A novel class of state-dependent delay equations is derived from the balance laws of age-structured population dynamics, assuming that birth rates and death rates, as functions of age, are piece-wise constant and that the length of the juvenile phase depends on the total adult population size. The resulting class of equations includes also neutral delay equations. All these equations are very different from the standard delay equations with state-dependent delay since the balance laws require non-linear correction factors. These equations can be written as systems for two variables consisting of an ordinary differential equation (ODE) and a generalized shift, a form suitable for numerical calculations. It is shown that the neutral equation (and the corresponding ODE--shift system) is a limiting case of a system of two standard delay equations.

  15. Shift systems in nuclear power plants - aspects for planning, shift systems, utility practice

    International Nuclear Information System (INIS)

    Grauf, E.

    1986-01-01

    This lecture contains the most important aspects of shift structure and shift organisation. The criteria for shift planning involving essential tasks, duties, laws and regulations, medical aspects, social aspects, will be presented. In the Federal Republic of Germany some basic models were established, which will be shown and explained with special reference to the number of teams, size of shift crews and absence regulations. Moreover, the lecture will deal with rotation systems and provisions for the transfer of shift responsibilities. By example of a utility plant commissioning time scale (1300 MW PWR) the practice of shift installations will be shown as well as the most important points of education and training. Within this compass the criteria and requirements for training and education of operational personnel in the Federal Republic of Germany will also be touched. (orig.)

  16. Temperature and field independence of the fluorine and lithium NMR shift tensors in lithium rare-earth tetrafluorides

    DEFF Research Database (Denmark)

    Nevald, Rolf; Hansen, P. E.

    1978-01-01

    The fluorine and lithium NMR line shifts have been followed in temperature from 300 to 1.3 K and in fields up to 40 kG for LiTbF4 and LiHoF4. The Tb3+ and Ho3+ ionic moments cause these shifts. The Li shifts are dominated by dipole interactions, whereas the F shifts also have transferred hyperfine...... contributions of comparable sizes. The transferred hyperfine interactions turn out to be almost isotropic and exhibiting no temperature or field dependence. In LiHoF4 the line shifts are detectable within the entire temperature range. In LiTbF4 the fluorine and lithium lines broaden to such an extent...

  17. Developmental profiles in tick water balance with a focus on the new Rocky Mountain spotted fever vector, Rhipicephalus sanguineus.

    Science.gov (United States)

    Yoder, J A; Benoit, J B; Rellinger, E J; Tank, J L

    2006-12-01

    Recent reports indicate that the common brown dog tick, or kennel tick, Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) is a competent vector of Rocky Mountain spotted fever in the U.S.A. This tick is of concern to public health because of its high frequency of contact, as it has a unique ability to thrive within human homes. To assess the moisture requirements necessary for survival, water balance characteristics were determined for each developmental stage, from egg to adult. This is the first time that water relations in ticks have been assessed throughout the complete lifecycle. Notably, R. sanguineus is differentially adapted for life in a dry environment, as characterized by a suppressed water loss rate distinctive for each stage that distinguishes it from other ticks. Analysis of its dehydration tolerance limit and percentage body water content provides no evidence to suggest that the various stages of this tick can function more effectively containing less water, indicating that this species is modified for water conservation, not desiccation hardiness. All stages, eggs excepted, absorb water vapour from the air and can drink free water to replenish water stores. Developmentally, a shift in water balance strategies occurs in the transition from the larva, where the emphasis is on water gain (water vapour absorption from drier air), to the adult, where the emphasis is on water retention (low water loss rate). These results on the xerophilic-nature of R. sanguineus identify overhydration as the primary water stress, indicating that this tick is less dependent upon a moisture-rich habitat for survival, which matches its preference for a dry environment. We suggest that the controlled, host-confined conditions of homes and kennels have played a key role in promoting the ubiquitous distribution of R. sanguineus by creating isolated arid environments that enable this tick to establish within regions that are unfavourable for maintaining water balance.

  18. Developmental Principles: Fact or Fiction

    Directory of Open Access Journals (Sweden)

    A. J. Durston

    2012-01-01

    Full Text Available While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, “whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm”. We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level? adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

  19. Developmental delay

    Science.gov (United States)

    Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...

  20. Factors reducing the expected deflection in initial orientation in clock-shifted homing pigeons.

    Science.gov (United States)

    Gagliardo, Anna; Odetti, Francesca; Ioalè, Paolo

    2005-02-01

    To orient from familiar sites, homing pigeons can rely on both an olfactory map and visual familiar landmarks. The latter can in principle be used in two different ways: either within a topographical map exploited for piloting or in a so-called mosaic map associated with a compass bearing. One way to investigate the matter is to put the compass and the topographical information in conflict by releasing clock-shifted pigeons from familiar locations. Although the compass orientation is in general dominant over a piloting strategy, a stronger or weaker tendency to correct towards the home direction by clock-shifted pigeons released from very familiar sites has often been observed. To investigate which factors are involved in the reduction of the deviation due to clock-shift, we performed a series of releases with intact and anosmic pigeons from familiar sites in unshifted and clock-shifted conditions and a series of releases from the same sites with naive clock-shifted birds. Our data suggest that the following factors have a role in reducing deviation due to the clock-shift: familiarity with the release site, the lack of olfactory information and some unknown site-dependent features.

  1. Nurses' shift reports

    DEFF Research Database (Denmark)

    Buus, Niels; Hoeck, Bente; Hamilton, Bridget Elizabeth

    2017-01-01

    AIMS AND OBJECTIVES: To identify reporting practices that feature in studies of nurses' shift reports across diverse nursing specialities. The objectives were to perform an exhaustive systematic literature search and to critically review the quality and findings of qualitative field studies...... of nurses' shift reports. BACKGROUND: Nurses' shift reports are routine occurrences in healthcare organisations that are viewed as crucial for patient outcomes, patient safety and continuity of care. Studies of communication between nurses attend primarily to 1:1 communication and analyse the adequacy...... and accuracy of patient information and feature handovers at the bedside. Still, verbal reports between groups of nurses about patients are commonplace. Shift reports are obvious sites for studying the situated accomplishment of professional nursing at the group level. This review is focused exclusively...

  2. Associations of Shift Work and Its Duration with Work-Related Injury among Electronics Factory Workers in South Korea.

    Science.gov (United States)

    Ryu, Jia; Jung-Choi, Kyunghee; Choi, Kyung-Hwa; Kwon, Ho-Jang; Kang, Chungwon; Kim, Hyunjoo

    2017-11-21

    This study aimed to explore the association between shift work and work-related injuries. We collected data on workers from an electronics factory. This cross-sectional study included 13,610 subjects, who were assessed based on a self-reported questionnaire about their shift work experiences, work-related injuries, and other covariates. Multiple logistic regression models were used to evaluate the associations between shift work and work-related injuries and were estimated using the odds ratio. We found that the current and past shift workers, compared to non-shift workers, were associated with a 2.7- and 1.7-fold higher risk of work-related injury. There was a dose-response relationship between shift work duration and work-related injury among current female shift workers. Shift work increased the risk of work-related injuries, and the impact could be different depending on gender.

  3. Arguments from Developmental Order.

    Science.gov (United States)

    Stöckle-Schobel, Richard

    2016-01-01

    In this article, I investigate a special type of argument regarding the role of development in theorizing about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind - getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories. Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasizing the importance of the early cognitive processes and arguments emphasizing the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive) development, and I will present some topics that also pertain to a full-fledged 'philosophy of development.'

  4. A partial differential equation for pseudocontact shift.

    Science.gov (United States)

    Charnock, G T P; Kuprov, Ilya

    2014-10-07

    It is demonstrated that pseudocontact shift (PCS), viewed as a scalar or a tensor field in three dimensions, obeys an elliptic partial differential equation with a source term that depends on the Hessian of the unpaired electron probability density. The equation enables straightforward PCS prediction and analysis in systems with delocalized unpaired electrons, particularly for the nuclei located in their immediate vicinity. It is also shown that the probability density of the unpaired electron may be extracted, using a regularization procedure, from PCS data.

  5. Dynamic Shift Coordinated Control Based on Motor Active Speed Synchronization with the New Hybrid System

    Directory of Open Access Journals (Sweden)

    Ting Yan

    2017-01-01

    Full Text Available Considering the inherent disadvantages that severely affect driving comfortability during the shift process in HEVs, a dynamic shift coordinated control based on motor active speed synchronization is proposed to improve shift quality by reduction of shift vibration. The whole control scheme is comprised of three phases, preparatory phase, speed regulation phase, and synchronization phase, which are implemented consecutively in order. The key to inhibiting impact and jerk depends on the speed regulation phase, where motor active speed synchronization is utilized to reach the minimum speed difference between the two ends of synchronizer. A new hybrid system with superior performances is applied to present the validity of the adopted control algorithm during upshift or downshift, which can represent planetary gear system and conventional AMT shift procedure, respectively. Bench test, simulation, and road test results show that, compared with other methods, the proposed dynamic coordinated control can achieve shifting control in real time to effectively improve gear-shift comfort and shorten power interruption transients, with robustness in both conventional AMT and planetary gear train.

  6. On the temperature dependence of flammability limits of gases.

    Science.gov (United States)

    Kondo, Shigeo; Takizawa, Kenji; Takahashi, Akifumi; Tokuhashi, Kazuaki

    2011-03-15

    Flammability limits of several combustible gases were measured at temperatures from 5 to 100 °C in a 12-l spherical flask basically following ASHRAE method. The measurements were done for methane, propane, isobutane, ethylene, propylene, dimethyl ether, methyl formate, 1,1-difluoroethane, ammonia, and carbon monoxide. As the temperature rises, the lower flammability limits are gradually shifted down and the upper limits are shifted up. Both the limits shift almost linearly to temperature within the range examined. The linear temperature dependence of the lower flammability limits is explained well using a limiting flame temperature concept at the lower concentration limit (LFL)--'White's rule'. The geometric mean of the flammability limits has been found to be relatively constant for many compounds over the temperature range studied (5-100 °C). Based on this fact, the temperature dependence of the upper flammability limit (UFL) can be predicted reasonably using the temperature coefficient calculated for the LFL. However, some compounds such as ethylene and dimethyl ether, in particular, have a more complex temperature dependence. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Desiccation stress induces developmental heterochrony in ...

    Indian Academy of Sciences (India)

    Stressful environments are known to perturb developmental patterns in insects. In the purview of desiccation as astressor, relatively little is known about the developmental consequences linked with desiccation tolerance. In thisstudy, we have particularly focused on the exploration of the temporal profile of postembryonic ...

  8. [Sleep quality of nurses working in shifts - Hungarian adaptation of the Bergen Shift Work Sleep Questionnaire].

    Science.gov (United States)

    Fusz, Katalin; Tóth, Ákos; Fullér, Noémi; Müller, Ágnes; Oláh, András

    2015-12-06

    Sleep disorders among shift workers are common problems due to the disturbed circadian rhythm. The Bergen Shift Work Sleep Questionnaire assesses discrete sleep problems related to work shifts (day, evening and night shifts) and rest days. The aim of the study was to develop the Hungarian version of this questionnaire and to compare the sleep quality of nurses in different work schedules. 326 nurses working in shifts filled in the questionnaire. The authors made convergent and discriminant validation of the questionnaire with the Athens Insomnia Scale and the Perceived Stress Questionnaire. The questionnaire based on psychometric characteristics was suitable to assess sleep disorders associated with shift work in a Hungarian sample. The frequency of discrete symptoms significantly (pshifts. Nurses experienced the worst sleep quality and daytime fatigue after the night shift. Nurses working in irregular shift system had worse sleep quality than nurses working in regular and flexible shift system (pworking in shifts should be assessed with the Hungarian version of the Bergen Shift Work Sleep Questionnaire on a nationally representative sample, and the least burdensome shift system could be established.

  9. Mutual inactivation of Notch receptors and ligands facilitates developmental patterning.

    Directory of Open Access Journals (Sweden)

    David Sprinzak

    2011-06-01

    Full Text Available Developmental patterning requires juxtacrine signaling in order to tightly coordinate the fates of neighboring cells. Recent work has shown that Notch and Delta, the canonical metazoan juxtacrine signaling receptor and ligand, mutually inactivate each other in the same cell. This cis-interaction generates mutually exclusive sending and receiving states in individual cells. It generally remains unclear, however, how this mutual inactivation and the resulting switching behavior can impact developmental patterning circuits. Here we address this question using mathematical modeling in the context of two canonical pattern formation processes: boundary formation and lateral inhibition. For boundary formation, in a model motivated by Drosophila wing vein patterning, we find that mutual inactivation allows sharp boundary formation across a broader range of parameters than models lacking mutual inactivation. This model with mutual inactivation also exhibits robustness to correlated gene expression perturbations. For lateral inhibition, we find that mutual inactivation speeds up patterning dynamics, relieves the need for cooperative regulatory interactions, and expands the range of parameter values that permit pattern formation, compared to canonical models. Furthermore, mutual inactivation enables a simple lateral inhibition circuit architecture which requires only a single downstream regulatory step. Both model systems show how mutual inactivation can facilitate robust fine-grained patterning processes that would be difficult to implement without it, by encoding a difference-promoting feedback within the signaling system itself. Together, these results provide a framework for analysis of more complex Notch-dependent developmental systems.

  10. Age differences in strategy shift: retrieval avoidance or general shift reluctance?

    Science.gov (United States)

    Frank, David J; Touron, Dayna R; Hertzog, Christopher

    2013-09-01

    Previous studies of metacognitive age differences in skill acquisition strategies have relied exclusively on tasks with a processing shift from an algorithm to retrieval strategy. Older adults' demonstrated reluctance to shift strategies in such tasks could reflect either a specific aversion to a memory retrieval strategy or a general, inertial resistance to strategy change. Haider and Frensch's (1999) alphabet verification task (AVT) affords a non-retrieval-based strategy shift. Participants verify the continuation of alphabet strings such as D E F G [4] L, with the bracketed digit indicating a number of letters to be skipped. When all deviations are restricted to the letter-digit-letter portion, participants can speed their responses by selectively attending to only that part of the stimulus. We adapted the AVT to include conditions that promoted shift to a retrieval strategy, a selective attention strategy, or both strategies. Item-level strategy reports were validated by eye movement data. Older adults shifted more slowly to the retrieval strategy but more quickly to the selective attention strategy than young adults, indicating a retrieval-strategy avoidance. Strategy confidence and perceived strategy difficulty correlated with shift to the two strategies in both age groups. Perceived speed of responses with each strategy specifically correlated with older adults' strategy choices, suggesting that some older adults avoid retrieval because they do not appreciate its efficiency benefits.

  11. Age Differences in Strategy Shift: Retrieval Avoidance or General Shift Reluctance?

    Science.gov (United States)

    Frank, David J.; Touron, Dayna R.; Hertzog, Christopher

    2013-01-01

    Previous studies of metacognitive age differences in skill acquisition strategies have relied exclusively on tasks with a processing shift from an algorithm to retrieval strategy. Older adults’ demonstrated reluctance to shift strategies in such tasks could reflect either a specific aversion to a memory retrieval strategy or a general, inertial resistance to strategy change. Haider and Frensch’s (1999) alphabet verification task (AVT) affords a non-retrieval-based strategy shift. Participants verify the continuation of alphabet strings such as D E F G [4] L, with the bracketed digit indicating a number of letters to be skipped. When all deviations are restricted to the letter-digit-letter portion, participants can speed their responses by selectively attend only to that part of the stimulus. We adapted the AVT to include conditions which promoted shift to a retrieval strategy, a selective attention strategy, or both strategies. Item-level strategy reports were validated by eye movement data. Older adults shifted more slowly to the retrieval strategy but more quickly to the selective attention strategy than young adults, indicating a retrieval-strategy avoidance. Strategy confidence and perceived strategy difficulty correlated with shift to the two strategies in both age groups. Perceived speed of responses with each strategy specifically correlated with older adults’ strategy choices, suggesting that some older adults avoid retrieval because they do not appreciate its efficiency benefits. PMID:23088195

  12. Developmental Differentiation and Binding of Mental Processes with g through the Life-Span

    Directory of Open Access Journals (Sweden)

    Andreas Demetriou

    2017-05-01

    Full Text Available Integration/differentiation of mental processes is major mechanism of development. Developmental theories ascribe intellectual development to it. In psychometric theory, Spearman’s law of diminishing returns postulates that increasing g allows increasing differentiation of cognitive abilities, because increased mental power allows variable investment in domain-specific learning. Empirical evidence has been inconsistent so far, with some studies supporting and others contradicting this mechanism. This state of affairs is due to a developmental phenomenon: Both differentiation and strengthening of relations between specific processes and g may happen but these changes are phase-specific and ability-specific, depending upon the developmental priorities in the formation of g in each phase. We present eight studies covering the age span from 4 to 85 years in support of this phenomenon. Using new powerful modeling methods we showed that differentiation and binding of mental processes in g occurs in cycles. Specific processes intertwine with g at the beginning of cycles when they are integrated into it; when well established, these processes may vary with increasing g, reflecting its higher flexibility. Representational knowledge, inductive inference and awareness of it, and grasp of logical constraints framing inference are the major markers of g, first intertwining with in their respective cycles and differentiating later during the periods of 2–6, 7–11, and 11–20 years, respectively. The implications of these findings for an overarching cognitive developmental/differential theory of human mind are discussed.

  13. Non-occupational physical activity levels of shift workers compared with non-shift workers

    NARCIS (Netherlands)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Vermeulen, Roel C H; Bakker, Marije F.; van der Beek, Allard J.; Proper, Karin I

    2017-01-01

    OBJECTIVES: Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure-response relationships for

  14. Male adolescent rites of passage: positive visions of multiple developmental pathways.

    Science.gov (United States)

    Pollack, William S

    2004-12-01

    Unlike the separation-based, stereotyped views of boys' developmental movement into adulthood, this paper will argue that there are more modern and relational models, as well as multiple pathways, for young males to journey through such rites of passage. Indeed, it will be suggested and supported by both qualitative and quantitative data that the more classic models depend on a "boy code" of traumatic separation from mother and the feminine, a process that is not only negative rather than positive in its developmental trajectory, but also likely to create a premature traumatic separation, leaving boys at risk for emotional maladjustment, everyday sadness, increased incidence of depression and the potential for violence toward the self, suicide, as well as violence toward others. More-positive visions and versions of male rites of passage will be posited and described. The definition of emotional "resilience" during this significant period will be re-addressed as one of "healthy vulnerability," sustained through connection to loving adults, rather than a classic belief in stoicism and release from relational ties. Attachment theory will be brought to bear and the desperate yearnings of adolescent males not only for connection to adult mentors, but also for non-romanticized friendships with adolescent females, will be discussed. Finally, the understanding and substitution of these new, more positive, developmental pathways will be linked to the prevention of violence.

  15. Band shift of 2D transition-metal dichalcogenide alloys: size and composition effects

    Science.gov (United States)

    Zhao, Yipeng; Zhang, Zhe; Ouyang, Gang

    2018-04-01

    Band engineering of 2D transition-metal dichalcogenides (2D-TMDs) is a vital task for their applications in electronic and optoelectronic nanodevices. In this study, we investigate the joint effect from size and composition contributions on the band shift of 2D-TMD alloys in terms of atomic bond relaxation consideration. A theoretical model is proposed to pursue the underlying mechanism, which can connect the band offset with the atomic bonding identities in the 2D-TMD alloys. We reveal that the bandgap of 2D-TMD alloys presents a bowing shape owing to the size-dependent interaction among atoms and shows blue shift or red shift due to different intermixing of components. It is demonstrated that both size and composition can be performed as the useful methods to modulate the band shift, which suggests an effective way to realize the desirable properties of 2D-TMD alloys.

  16. Developmental programming by androgen affects the circadian timing system in female mice.

    Science.gov (United States)

    Mereness, Amanda L; Murphy, Zachary C; Sellix, Michael T

    2015-04-01

    Circadian clocks play essential roles in the timing of events in the mammalian hypothalamo-pituitary-ovarian (HPO) axis. The molecular oscillator driving these rhythms has been localized to tissues of the HPO axis. It has been suggested that synchrony among these oscillators is a feature of normal reproductive function. The impact of fertility disorders on clock function and the role of the clock in the etiology of endocrine pathology remain unknown. Polycystic ovarian syndrome (PCOS) is a particularly devastating fertility disorder, affecting 5%-10% of women at childbearing age with features including a polycystic ovary, anovulation, and elevated serum androgen. Approximately 40% of these women have metabolic syndrome, marked by hyperinsulinemia, dyslipidemia, and insulin resistance. It has been suggested that developmental exposure to excess androgen contributes to the etiology of fertility disorders, including PCOS. To better define the role of the timing system in these disorders, we determined the effects of androgen-dependent developmental programming on clock gene expression in tissues of the metabolic and HPO axes. Female PERIOD2::luciferase (PER2::LUC) mice were exposed to androgen (dihydrotestosterone [DHT]) in utero (Days 16-18 of gestation) or for 9-10 wk (DHT pellet) beginning at weaning (pubertal androgen excess [PAE]). As expected, both groups of androgen-treated mice had disrupted estrous cycles. Analysis of PER2::LUC expression in tissue explants revealed that excess androgen produced circadian misalignment via tissue-dependent effects on phase distribution. In vitro treatment with DHT differentially affected the period of PER2::LUC expression in tissue explants and granulosa cells, indicating that androgen has direct and tissue-specific effects on clock gene expression that may account for the effects of developmental programming on the timing system. © 2015 by the Society for the Study of Reproduction, Inc.

  17. Prevalence and sociodemographic determinants of developmental ...

    African Journals Online (AJOL)

    Birth order and household size also had significant association with delay in various domains. There was no significant association between socioeconomic class and developmental delay in any of the domains. Conclusion: The study showed that developmental delay was relatively common among under-five children in ...

  18. Introducing Newspapers in Developmental Reading Classes

    Science.gov (United States)

    Karstadt, Roberta; Rey, Victoria M.

    2009-01-01

    Newspapers are an effective educational and motivational tool in developmental reading classes. However, many students are unfamiliar with newspapers and read them infrequently. In order to foster newspaper reading and familiarize the college freshmen enrolled in their developmental reading classes with newspapers, the writers of this article…

  19. Developmental Changes in Brain Network Hub Connectivity in Late Adolescence.

    Science.gov (United States)

    Baker, Simon T E; Lubman, Dan I; Yücel, Murat; Allen, Nicholas B; Whittle, Sarah; Fulcher, Ben D; Zalesky, Andrew; Fornito, Alex

    2015-06-17

    The human brain undergoes substantial development throughout adolescence and into early adulthood. This maturational process is thought to include the refinement of connectivity between putative connectivity hub regions of the brain, which collectively form a dense core that enhances the functional integration of anatomically distributed, and functionally specialized, neural systems. Here, we used longitudinal diffusion magnetic resonance imaging to characterize changes in connectivity between 80 cortical and subcortical anatomical regions over a 2 year period in 31 adolescents between the ages of 15 and 19 years. Connectome-wide analysis indicated that only a small subset of connections showed evidence of statistically significant developmental change over the study period, with 8% and 6% of connections demonstrating decreased and increased structural connectivity, respectively. Nonetheless, these connections linked 93% and 90% of the 80 regions, respectively, pointing to a selective, yet anatomically distributed pattern of developmental changes that involves most of the brain. Hub regions showed a distinct tendency to be highly connected to each other, indicating robust "rich-club" organization. Moreover, connectivity between hubs was disproportionately influenced by development, such that connectivity between subcortical hubs decreased over time, whereas frontal-subcortical and frontal-parietal hub-hub connectivity increased over time. These findings suggest that late adolescence is characterized by selective, yet significant remodeling of hub-hub connectivity, with the topological organization of hubs shifting emphasis from subcortical hubs in favor of an increasingly prominent role for frontal hub regions. Copyright © 2015 the authors 0270-6474/15/359078-10$15.00/0.

  20. Developmental sculpting of social phenotype and plasticity.

    Science.gov (United States)

    Sakata, Jon T; Crews, David

    2004-04-01

    Early developmental variables engender behavioral and neural variation, especially in species in which embryonic environment determines gonadal sex. In the leopard gecko, Eublepharis macularius, the incubation temperature of the egg (IncT) determines gonadal sex. Moreover, IncT affects the sexual differentiation of the individual and, consequently, within-sex variation. Individuals hatched from eggs incubated at an IncT that produces predominantly males are more masculinized than same-sex counterparts from IncTs that produce predominantly females. Here we review how gonadal sex and IncT interact to affect behavioral, endocrinological, and neural phenotype in the leopard gecko and influence phenotypic plasticity following hormone administration or social experience. We discuss the hormonal dependence of sex- and IncT-dependent behavioral and neural morphological and metabolic differences and highlight the parallels between IncT effects in geckos and intrauterine position effects in rodents. We argue that the leopard gecko is an important model of how the process of sex determination can affect sexual differentiation and of selection forces underlying the evolution of sex ratios. Copyright 2004 Elsevier Ltd.

  1. Optimal pole shifting controller for interconnected power system

    International Nuclear Information System (INIS)

    Yousef, Ali M.; Kassem, Ahmed M.

    2011-01-01

    Research highlights: → Mathematical model represents a power system which consists of synchronous machine connected to infinite bus through transmission line. → Power system stabilizer was designed based on optimal pole shifting controller. → The system performances was tested through load disturbances at different operating conditions. → The system performance with the proposed optimal pole shifting controller is compared with the conventional pole placement controller. → The digital simulation results indicated that the proposed controller has a superior performance. -- Abstract: Power system stabilizer based on optimal pole shifting is proposed. An approach for shifting the real parts of the open-loop poles to any desired positions while preserving the imaginary parts is presented. In each step of this approach, it is required to solve a first-order or a second-order linear matrix Lyapunov equation for shifting one real pole or two complex conjugate poles, respectively. This presented method yields a solution, which is optimal with respect to a quadratic performance index. The attractive feature of this method is that it enables solutions of the complex problem to be easily found without solving any non-linear algebraic Riccati equation. The present power system stabilizer is based on Riccati equation approach. The control law depends on finding the feedback gain matrix, and then the control signal is synthesized by multiplying the state variables of the power system with determined gain matrix. The gain matrix is calculated one time only, and it works over wide range of operating conditions. To validate the power of the proposed PSS, a linearized model of a simple power system consisted of a single synchronous machine connected to infinite bus bar through transmission line is simulated. The studied power system is subjected to various operating points and power system parameters changes.

  2. Optimal pole shifting controller for interconnected power system

    Energy Technology Data Exchange (ETDEWEB)

    Yousef, Ali M., E-mail: drali_yousef@yahoo.co [Electrical Eng. Dept., Faculty of Engineering, Assiut University (Egypt); Kassem, Ahmed M., E-mail: kassem_ahmed53@hotmail.co [Control Technology Dep., Industrial Education College, Beni-Suef University (Egypt)

    2011-05-15

    Research highlights: {yields} Mathematical model represents a power system which consists of synchronous machine connected to infinite bus through transmission line. {yields} Power system stabilizer was designed based on optimal pole shifting controller. {yields} The system performances was tested through load disturbances at different operating conditions. {yields} The system performance with the proposed optimal pole shifting controller is compared with the conventional pole placement controller. {yields} The digital simulation results indicated that the proposed controller has a superior performance. -- Abstract: Power system stabilizer based on optimal pole shifting is proposed. An approach for shifting the real parts of the open-loop poles to any desired positions while preserving the imaginary parts is presented. In each step of this approach, it is required to solve a first-order or a second-order linear matrix Lyapunov equation for shifting one real pole or two complex conjugate poles, respectively. This presented method yields a solution, which is optimal with respect to a quadratic performance index. The attractive feature of this method is that it enables solutions of the complex problem to be easily found without solving any non-linear algebraic Riccati equation. The present power system stabilizer is based on Riccati equation approach. The control law depends on finding the feedback gain matrix, and then the control signal is synthesized by multiplying the state variables of the power system with determined gain matrix. The gain matrix is calculated one time only, and it works over wide range of operating conditions. To validate the power of the proposed PSS, a linearized model of a simple power system consisted of a single synchronous machine connected to infinite bus bar through transmission line is simulated. The studied power system is subjected to various operating points and power system parameters changes.

  3. Associations of Shift Work and Its Duration with Work-Related Injury among Electronics Factory Workers in South Korea

    Directory of Open Access Journals (Sweden)

    Jia Ryu

    2017-11-01

    Full Text Available This study aimed to explore the association between shift work and work-related injuries. We collected data on workers from an electronics factory. This cross-sectional study included 13,610 subjects, who were assessed based on a self-reported questionnaire about their shift work experiences, work-related injuries, and other covariates. Multiple logistic regression models were used to evaluate the associations between shift work and work-related injuries and were estimated using the odds ratio. We found that the current and past shift workers, compared to non-shift workers, were associated with a 2.7- and 1.7-fold higher risk of work-related injury. There was a dose-response relationship between shift work duration and work-related injury among current female shift workers. Shift work increased the risk of work-related injuries, and the impact could be different depending on gender.

  4. Where Do Epigenetics and Developmental Origins Take the Field of Developmental Psychopathology?

    Science.gov (United States)

    Nigg, Joel T

    2016-04-01

    The time is ripe for upgrading or rethinking the assumed paradigms for how we study developmental psychopathology. The classic transactional models appear robust but need specification in terms of biological and psychosocial processes. That specification is increasingly tractable due to developments in genetics, epigenetics, the measurement of psychosocial processes, and theory and data on developmental origins of health and disease. This essay offers a high-level view of where the field has been and where it may be going in regard to nosology and conceptions of etiology. Remarks seek to consider rapidly evolving contexts not only for children, but also for the science itself due to progress in our field and in neighboring fields. Illustrations are provided as to how syndromal nosology can be enriched and advanced by careful integration with biologically relevant behavioral dimensions and application of quantitative methods. It is concluded that a revised, forward-looking, transactional model of abnormal child psychology will incorporate prenatal and postnatal developmental programming, epigenetic mechanisms and their associated genotype x environment interactions, and inflammatory processes as a potential common mediator influencing numerous health and mental health conditions.

  5. Role of medial cortical, hippocampal and striatal interactions during cognitive set-shifting.

    Science.gov (United States)

    Graham, Steven; Phua, Elaine; Soon, Chun Siong; Oh, Tomasina; Au, Chris; Shuter, Borys; Wang, Shih-Chang; Yeh, Ing Berne

    2009-05-01

    To date, few studies have examined the functional connectivity of brain regions involved in complex executive function tasks, such as cognitive set-shifting. In this study, eighteen healthy volunteers performed a cognitive set-shifting task modified from the Wisconsin card sort test while undergoing functional magnetic resonance imaging. These modifications allowed better disambiguation between cognitive processes and revealed several novel findings: 1) peak activation in the caudate nuclei in the first instance of negative feedback signaling a shift in rule, 2) lowest caudate activation once the rule had been identified, 3) peak hippocampal activation once the identity of the rule had been established, and 4) decreased hippocampal activation during the generation of new rule candidates. This pattern of activation across cognitive set-shifting events suggests that the caudate nuclei play a role in response generation when the identity of the new rule is unknown. In contrast, the reciprocal pattern of hippocampal activation suggests that the hippocampi help consolidate knowledge about the correct stimulus-stimulus associations, associations that become inappropriate once the rule has changed. Functional connectivity analysis using Granger Causality Mapping revealed that caudate and hippocampal regions interacted indirectly via a circuit involving the medial orbitofrontal and posterior cingulate regions, which are known to bias attention towards stimuli based on expectations built up from task-related feedback. Taken together, the evidence suggests that these medial regions may mediate striato-hippocampal interactions and hence affect goal-directed attentional transitions from a response strategy based on stimulus-reward heuristics (caudate-dependent) to one based on stimulus-stimulus associations (hippocampus-dependent).

  6. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner.

    Science.gov (United States)

    Towarnicki, Samuel G; Ballard, J William O

    2017-07-01

    It is well known that specific mitochondrial (mt) DNA mutations can reduce organismal fitness and influence mitochondrial-nuclear interactions. However, determining specific mtDNA mutations that are beneficial has been elusive. In this study, we vary the diet and environmental temperature to study larval development time of two Drosophila melanogaster mitotypes (Alstonville and Dahomey), in two nuclear genetic backgrounds, and investigate developmental differences through weight, feeding rate, and movement. To manipulate the diet, we utilize the nutritional geometric framework to manipulate isocaloric diets of differing macronutrient ratios (1:2 and 1:16 protein: carbohydrate (P:C) ratios) and raise flies at three temperatures (19°C, 23°C and 27°C). Larvae with Dahomey mtDNA develop more slowly than Alstonville when fed the 1:2 P:C diet at all temperatures and developed more quickly when fed the 1:16 P:C diet at 23°C and 27°C. We determined that Dahomey larvae eat more, move less, and weigh more than Alstonville larvae when raised on the 1:16 P:C diet and that these physiological responses are modified by temperature. We suggest that 1 (or more) of 4 mtDNA changes is likely responsible for the observed effects and posit the mtDNA changes moderate a physiological trade-off between consumption and foraging. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Processes Underlying Developmental Reversals in False-Memory Formation: Comment on Brainerd, Reyna, and Ceci (2008)

    Science.gov (United States)

    Ghetti, Simona

    2008-01-01

    C. J. Brainerd, V. F. Reyna, and S. J. Ceci (2008) reviewed compelling evidence of developmental reversals in false-memory formation (i.e., younger children exhibit lower false-memory rates than do older children and adults) and proposed that this phenomenon depends on the development of gist processing (i.e., the ability to identify and process…

  8. Endogenous developmental endothelial locus-1 limits ischemia-related angiogenesis by blocking inflammation

    Science.gov (United States)

    Klotzsche - von Ameln, Anne; Cremer, Sebastian; Hoffmann, Jedrzej; Schuster, Peggy; Khedr, Sherif; Korovina, Irina; Troulinaki, Maria; Neuwirth, Ales; Sprott, David; Chatzigeorgiou, Antonios; Economopoulou, Matina; Orlandi, Alessia; Hain, Andreas; Zeiher, Andreas M.; Deussen, Andreas; Hajishengallis, George; Dimmeler, Stefanie; Chavakis, Triantafyllos; Chavakis, Emmanouil

    2017-01-01

    We have recently identified endothelial cell-secreted developmental endothelial locus-1 (Del-1) as an endogenous inhibitor of β2-integrin–dependent leukocyte infiltration. Del-1 was previously also implicated in angiogenesis. Here, we addressed the role of endogenously produced Del-1 in ischemia-related angiogenesis. Intriguingly, Del-1–deficient mice displayed increased neovascularization in two independent ischemic models (retinopathy of prematurity and hind-limb ischemia), as compared to Del-1–proficient mice. On the contrary, angiogenic sprouting in vitro or ex vivo (aortic ring assay) and physiological developmental retina angiogenesis were not affected by Del-1 deficiency. Mechanistically, the enhanced ischemic neovascularization in Del-1-deficiency was linked to higher infiltration of the ischemic tissue by CD45+ hematopoietic and immune cells. Moreover, Del-1-deficiency promoted β2-integrin–dependent adhesion of hematopoietic cells to endothelial cells in vitro, and the homing of hematopoietic progenitor cells and of immune cell populations to ischemic muscles in vivo. Consistently, the increased hind limb ischemia-related angiogenesis in Del-1 deficiency was completely reversed in mice lacking both Del-1 and the β2-integrin LFA-1. Additionally, enhanced retinopathy-associated neovascularization in Del-deficient mice was reversed by LFA-1 blockade. Our data reveal a hitherto unrecognized function of endogenous Del-1 as a local inhibitor of ischemia-induced angiogenesis by restraining LFA-1–dependent homing of pro-angiogenic hematopoietic cells to ischemic tissues. Our findings are relevant for the optimization of therapeutic approaches in the context of ischemic diseases. PMID:28447099

  9. Ethiopia: A Democratic Developmental State?

    Directory of Open Access Journals (Sweden)

    Fesseha Mulu Gebremariam

    2017-12-01

    Full Text Available The ruling Ethiopia People’s Revolutionary Democratic Front (EPRDF in its notable second reform appraisal held in the aftermath of the 2005 national election concluded that the utmost priority of the government should be realizing fastest and sustainable economic growth that fairly benefits its citizens’ unless the very existence of the country wouldn’t be guaranteed. Given the history of poverty reduction in developing countries, particularly in Africa, EPRDF realized that it is unthinkable to eradicate poverty from Ethiopia adopting neo-liberalism. Above all, the miraculous economic transformation of the South East Asian countries like South Korea, Taiwan, Singapore and Hong Kong has proved that there is another way to development, not just neo-liberalism. Accordingly, EPRDF, after examining South Korea’s and Taiwan’s history of economic development in particular where both countries have had a large section of rural population unlike Hong Kong and Singapore where both are urban, found ‘developmental state’ relevant to Ethiopia. However, unlike these countries which were originally under non-democratic regimes where their leaders fear the rural peasant and external aggression from their communist rivals, EPRDF has had a great support of rural and urban population with no imminent foreign threat(s, and decided to execute the ideology rather under the umbrella of democracy. Therefore, employing secondary sources, this desk study aims to analyze whether Ethiopia is a ‘democratic developmental state?’ And, concludes that given the practices of the government vis-a-vis the principles of democracy and developmental state, Ethiopia couldn’t be taken as best model for democratic developmental state, rather emerging developmental state.

  10. Arguments from Developmental Order

    Directory of Open Access Journals (Sweden)

    Richard eStöckle-Schobel

    2016-05-01

    Full Text Available In this article, I investigate a special type of argument regarding the role of development in theorising about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind – getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories.Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasising the importance of the early cognitive processes and arguments emphasising the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive development, and I will present some topics that also pertain to a full-fledged ‘philosophy of development’.

  11. Developmental dyscalculia: a dysconnection syndrome?

    Science.gov (United States)

    Kucian, Karin; Ashkenazi, Simone Schwizer; Hänggi, Jürgen; Rotzer, Stephanie; Jäncke, Lutz; Martin, Ernst; von Aster, Michael

    2014-09-01

    Numerical understanding is important for everyday life. For children with developmental dyscalculia (DD), numbers and magnitudes present profound problems which are thought to be based upon neuronal impairments of key regions for numerical understanding. The aim of the present study was to investigate possible differences in white matter fibre integrity between children with DD and controls using diffusion tensor imaging. White matter integrity and behavioural measures were evaluated in 15 children with developmental dyscalculia aged around 10 years and 15 matched controls. The main finding, obtained by a whole brain group comparison, revealed reduced fractional anisotropy in the superior longitudinal fasciculus in children with developmental dyscalculia. In addition, a region of interest analysis exhibited prominent deficits in fibres of the superior longitudinal fasciculus adjacent to the intraparietal sulcus, which is thought to be the core region for number processing. To conclude, our results outline deficient fibre projection between parietal, temporal and frontal regions in children with developmental dyscalculia, and therefore raise the question of whether dyscalculia can be seen as a dysconnection syndrome. Since the superior longitudinal fasciculus is involved in the integration and control of distributed brain processes, the present results highlight the importance of considering broader domain-general mechanisms in the diagnosis and therapy of dyscalculia.

  12. Developmental trends in adaptive memory.

    Science.gov (United States)

    Otgaar, Henry; Howe, Mark L; Smeets, Tom; Garner, Sarah R

    2014-01-01

    Recent studies have revealed that memory is enhanced when information is processed for fitness-related purposes. The main objective of the current experiments was to test developmental trends in the evolutionary foundation of memory using different types of stimuli and paradigms. In Experiment 1, 11-year-olds and adults were presented with neutral, negative, and survival-related DRM word lists. We found a memory benefit for the survival-related words and showed that false memories were more likely to be elicited for the survival-related word lists than for the other lists. Experiment 2 examined developmental trends in the survival processing paradigm using neutral, negative, and survival-related pictures. A survival processing advantage was found for survival-related pictures in adults, for negative pictures in 11/12-year-olds, and for neutral pictures in 7/8-year-olds. In Experiment 3, 11/12-year-olds and adults had to imagine the standard survival scenario or an adapted survival condition (or pleasantness condition) that was designed to reduce the possibilities for elaborative processing. We found superior memory retention for both survival scenarios in children and adults. Collectively, our results evidently show that the survival processing advantage is developmentally invariant and that certain proximate mechanisms (elaboration and distinctiveness) underlie these developmental trends.

  13. Developmental immunotoxicity testing of 4-methyl anisole.

    Science.gov (United States)

    Tonk, Elisa C M; Verhoef, Aart; Gremmer, Eric R; van Loveren, Henk; Piersma, Aldert H

    2015-07-01

    The developmental immunotoxicity of 4-methyl anisole (4MA) was investigated in the rat. Four study designs were used, with either premating or post-weaning onset of exposure, continued to postnatal day 50, and with or without additional oral gavage of pups from postnatal day 10 onward. Reduced litter size (benchmark dose lower confidence limit (BMDL) 80mg/kg bw/day) was the most sensitive developmental parameter, with pup relative organ weight effects observed at similar BMDLs, in the absence of maternal toxicity. Eosinophil numbers were reduced at lower doses (BMDL 16mg/kg bw/day). KLH challenge resulted in increased IL-13 and TNF-α responses, and variably reduced IgG production (BMDL 27mg/kg bw/day). T4 levels were reduced by 11% at maximum with a BMDL of 73mg/kg bw/day. Differences between exposure cohorts were limited and were considered to be without biological significance. This study shows that 4MA induces developmental immunotoxicity at doses below those inducing developmental and general toxicity. These observations being independent of the study designs applied suggest that the post-weaning period, included in all designs, is the most relevant sensitive period for inducing 4MA mediated developmental immunotoxicity. Moreover, this study stresses the importance of including developmental immunotoxicity testing by default in regulatory toxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Stimulus size dependence of hue changes induced by chromatic surrounds.

    Science.gov (United States)

    Kellner, Christian Johannes; Wachtler, Thomas

    2016-03-01

    A chromatic surround induces a change in the perceived hue of a stimulus. This shift in hue depends on the chromatic difference between the stimulus and the surround. We investigated how chromatic induction varies with stimulus size and whether the size dependence depends on the surround hue. Subjects performed asymmetric matching of color stimuli with different sizes in surrounds of different chromaticities. Generally, induced hue shifts decreased with increasing stimulus size. This decrease was quantitatively different for different surround hues. However, when size effects were normalized to an overall induction strength, the chromatic specificity was largely reduced. The separability of inducer chromaticity and stimulus size suggests that these effects are mediated by different neural mechanisms.

  15. Neuroimaging of developmental psychopathologies: the importance of self-regulatory and neuroplastic processes in adolescence

    DEFF Research Database (Denmark)

    Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S

    2004-01-01

    for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...... influencing the phenotype, illness severity, and adult outcome of tic disorders. Similar developmental processes during adolescence likely determine the phenotype and natural history of a broad range of other complex neuropsychiatric disorders of childhood onset, and they likely contribute to the acquisition...

  16. Unilateral implicit motor learning deficit in developmental dyslexia.

    Science.gov (United States)

    Yang, Yang; Hong-Yan, Bi

    2011-02-01

    It has been suggested that developmental dyslexia involves various literacy, sensory, motor skill, and processing speed deficits. Some recent studies have shown that individuals with developmental dyslexia exhibit implicit motor learning deficits, which may be related to cerebellar functioning. However, previous studies on implicit motor learning in developmental dyslexics have produced conflicting results. Findings from cerebellar lesion patients have shown that patients' implicit motor learning performance varied when different hands were used to complete tasks. This suggests that dyslexia may have different effects on implicit motor learning between the two hands if cerebellar dysfunction is involved. To specify this question, we used a one-handed version of a serial reaction time task to compare the performance of 27 Chinese children with developmental dyslexics with another 27 age-matched children without reading difficulties. All the subjects were students from two primary schools, Grades 4 to 6. The results showed that children with developmental dyslexic responded more slowly than nondyslexic children, and exhibited no implicit motor learning in the condition of left-hand response. In contrast, there was no significant difference in reaction time between two groups of children when they used the right hand to respond. This finding indicates that children with developmental dyslexia exhibited normal motor skill and implicit motor learning ability provided the right hand was used. Taken together, these results suggested that Chinese children with developmental dyslexia exhibit unilateral deficits in motor skill and implicit motor learning in the left hand. Our findings lend partial support to the cerebellar deficit theory of developmental dyslexia.

  17. Developmental analytic view on narcissism

    Directory of Open Access Journals (Sweden)

    Polona Matjan Štuhec

    2009-07-01

    Full Text Available Narcissistic pathology is connected to the pathology of the self. This article makes an overview of definitions of developmental analytic theories and stops with Kohut, Kernberg, Masterson, Auerbach and Mollon. The self is understood as a separate personality structure and has its own developmental line. Narcissism is a personality disorder that has its roots in preodipal developmental phases, mostly in the practicing and rapprochement subphase and in the oedipal phase as well. Recent research shows that the oedipal phase and the relation between the mother, the child's father (or her partner in general and the child is crucial for the maintenance of the pathological narcissism. Mothers who do not believe in a satisfying relationship with a man in general, keep the child in the dyadic position and do not support the development of the child's own identity.

  18. Adaptation of Shift Sequence Based Method for High Number in Shifts Rostering Problem for Health Care Workers

    Directory of Open Access Journals (Sweden)

    Mindaugas Liogys

    2013-08-01

    Full Text Available Purpose—is to investigate a shift sequence-based approach efficiency then problem consisting of a high number of shifts.Research objectives:• Solve health care workers rostering problem using a shift sequence based method.• Measure its efficiency then number of shifts increases.Design/methodology/approach—Usually rostering problems are highly constrained. Constraints are classified to soft and hard constraints. Soft and hard constraints of the problem are additionally classified to: sequence constraints, schedule constraints and roster constraints. Sequence constraints are considered when constructing shift sequences. Schedule constraints are considered when constructing a schedule. Roster constraints are applied, then constructing overall solution, i.e. combining all schedules.Shift sequence based approach consists of two stages:• Shift sequences construction,• The construction of schedules.In the shift sequences construction stage, the shift sequences are constructed for each set of health care workers of different skill, considering sequence constraints. Shifts sequences are ranked by their penalties for easier retrieval in later stage.In schedules construction stage, schedules for each health care worker are constructed iteratively, using the shift sequences produced in stage 1.Shift sequence based method is an adaptive iterative method where health care workers who received the highest schedule penalties in the last iteration are scheduled first at the current iteration.During the roster construction, and after a schedule has been generated for the current health care worker, an improvement method based on an efficient greedy local search is carried out on the partial roster. It simply swaps any pair of shifts between two health care workers in the (partial roster, as long as the swaps satisfy hard constraints and decrease the roster penalty.Findings—Using shift sequence method for solving health care workers rostering problem

  19. Adaptation of Shift Sequence Based Method for High Number in Shifts Rostering Problem for Health Care Workers

    Directory of Open Access Journals (Sweden)

    Mindaugas Liogys

    2011-08-01

    Full Text Available Purpose—is to investigate a shift sequence-based approach efficiency then problem consisting of a high number of shifts. Research objectives:• Solve health care workers rostering problem using a shift sequence based method.• Measure its efficiency then number of shifts increases. Design/methodology/approach—Usually rostering problems are highly constrained.Constraints are classified to soft and hard constraints. Soft and hard constraints of the problem are additionally classified to: sequence constraints, schedule constraints and roster constraints. Sequence constraints are considered when constructing shift sequences. Schedule constraints are considered when constructing a schedule. Roster constraints are applied, then constructing overall solution, i.e. combining all schedules.Shift sequence based approach consists of two stages:• Shift sequences construction,• The construction of schedules.In the shift sequences construction stage, the shift sequences are constructed for each set of health care workers of different skill, considering sequence constraints. Shifts sequences are ranked by their penalties for easier retrieval in later stage.In schedules construction stage, schedules for each health care worker are constructed iteratively, using the shift sequences produced in stage 1. Shift sequence based method is an adaptive iterative method where health care workers who received the highest schedule penalties in the last iteration are scheduled first at the current iteration. During the roster construction, and after a schedule has been generated for the current health care worker, an improvement method based on an efficient greedy local search is carried out on the partial roster. It simply swaps any pair of shifts between two health care workers in the (partial roster, as long as the swaps satisfy hard constraints and decrease the roster penalty.Findings—Using shift sequence method for solving health care workers rostering

  20. 29Si NMR Chemical Shift Calculation for Silicate Species by Gaussian Software

    Science.gov (United States)

    Azizi, S. N.; Rostami, A. A.; Godarzian, A.

    2005-05-01

    Hartree-Fock self-consistent-field (HF-SCF) theory and the Gauge-including atomic orbital (GIAO) methods are used in the calculation of 29Si NMR chemical shifts for ABOUT 90 units of 19 compounds of various silicate species of precursors for zeolites. Calculations have been performed at geometries optimized at the AM1 semi-empirical method. The GIAO-HF-SCF calculations were carried out with using three different basis sets: 6-31G*, 6-31+G** and 6-311+G(2d,p). To demonstrate the quality of the calculations the calculated chemical shifts, δ, were compared with the corresponding experimental values for the compounds in study. The results, especially with 6-31+g** are in excellent agreement with experimental values. The calculated chemical shifts, in practical point of view, appear to be accurate enough to aid in experimental peak assignments. The difference between the experimental and calculated 29Si chemical shift values not only depends on the Qn units but also it seems that basis set effects and the level of theory is more important. For the series of molecules studied here, the standard deviations and mean absolute errors for 29Si chemical shifts relative to TMS determined using Hartree--Fock 6-31+G** basis is nearly in all cases smaller than the errors for shifts determined using HF/6-311+G(2d,p).

  1. Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves.

    Science.gov (United States)

    Safavi-Rizi, Vajiheh; Franzaring, Jürgen; Fangmeier, Andreas; Kunze, Reinhard

    2018-01-01

    In the spring oilseed rape (OSR) cultivar 'Mozart' grown under optimal N supply (N O ) or mild N deficiency (N L ) the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4) and younger higher canopy leaves (leaf #8) were investigated. Twelve weeks old N O and N L plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In N O leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in N L leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes) than in N-depleted plants (∼750 genes). This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs). Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in N L plants, but none in N O plants. In contrast, from weeks 13 to 16 in leaves #8 of N L plants only 11 PSGs were downregulated in comparison to 66 PSGs in N O plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in N L leaves #4 or N O leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves.

  2. Simulation study on effects of signaling network structure on the developmental increase in complexity

    Energy Technology Data Exchange (ETDEWEB)

    Keranen, Soile V.E.

    2003-04-02

    The developmental increase in structural complexity in multicellular life forms depends on local, often non-periodic differences in gene expression. These depend on a network of gene-gene interactions coded within the organismal genome. To better understand how genomic information generates complex expression patterns, I have modeled the pattern forming behavior of small artificial genomes in virtual blastoderm embryos. I varied several basic properties of these genomic signaling networks, such as the number of genes, the distributions of positive (inductive) and negative (repressive) interactions, and the strengths of gene-gene interactions, and analyzed their effects on developmental pattern formation. The results show how even simple genomes can generate complex non-periodic patterns under suitable conditions. They also show how the frequency of complex patterns depended on the numbers and relative arrangements of positive and negative interactions. For example, negative co-regulation of signaling pathway components increased the likelihood of (complex) patterns relative to differential negative regulation of the pathway components. Interestingly, neither quantitative differences either in strengths of signaling interactions nor multiple response thresholds to signal concentration (as in morphogen gradients) were essential for formation of multiple, spatially unique cell types. Thus, with combinatorial code of gene regulation and hierarchical signaling interactions, it is theoretically possible to organize metazoan embryogenesis with just a small fraction of the metazoan genome. Because even small networks can generate complex patterns when they contain a suitable set of connections, evolution of metazoan complexity may have depended more on selection for favourable configurations of signaling interactions than on the increase in numbers of regulatory genes.

  3. Constraining the red shifts of TeV BL Lac objects

    Science.gov (United States)

    Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming

    2018-01-01

    We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.

  4. Comparison of sleep disturbances in shift workers and people working with a fixed shift

    Directory of Open Access Journals (Sweden)

    Zohreh Yazdi

    2013-11-01

    Full Text Available Background: Different types of sleep disturbances can have a serious negative effect on a person’s ability, function and overall well-being. One of the most important issues that can result in sleep disturbances are occupational causes, the most important among them is shift work. The objective of this study was to compare the prevalence of sleep disturbances between shift work and non-shift workers. Material and Methods: This study was designed as a case-control study in 196 shift workers and 204 non-shift workers in a textile factory. The data were collected by using a comprehensive questionnaire including Pittsburg Sleep Quality Index questionnaire, Berlin Questionnaire, Epworth Sleepiness Scale, Insomnia Severity Index and Restless Leg Syndrome Questionnaire. Data analyses were carried out using the SPSS software version 13 by student's t-test, Chi square and multiple logistic regressions. Results: The duration of night sleep in shift workers was less than day workers (p<0.001. Prevalence of poor sleep quality and insomnia were higher in shift workers significantly than non shift workers (p<0.001, OR=2.3 95% CI: 1.7-2.9. The most prevalent type of insomnia was problems in initiating sleep (P=0.022, OR=2.2 95% CI: 1.5-3.2. There was no difference in the prevalence of excessive day-time sleepiness, restless leg syndrome, snoring, obstructive sleep apnea and different types of parasomnias between two groups. Conclusion: Reduced length of sleep and higher prevalence of poor sleep quality and insomnia in shift workers emphasizes the importance of serious attention to sleep disorders in shift workers.

  5. Developmental coordination disorder

    Science.gov (United States)

    Developmental coordination disorder can lead to: Learning problems Low self-esteem resulting from poor ability at sports and teasing by other children Repeated injuries Weight gain as a result of not wanting to participate ...

  6. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  7. Functional mapping imprinted quantitative trait loci underlying developmental characteristics

    Directory of Open Access Journals (Sweden)

    Li Gengxin

    2008-03-01

    Full Text Available Abstract Background Genomic imprinting, a phenomenon referring to nonequivalent expression of alleles depending on their parental origins, has been widely observed in nature. It has been shown recently that the epigenetic modification of an imprinted gene can be detected through a genetic mapping approach. Such an approach is developed based on traditional quantitative trait loci (QTL mapping focusing on single trait analysis. Recent studies have shown that most imprinted genes in mammals play an important role in controlling embryonic growth and post-natal development. For a developmental character such as growth, current approach is less efficient in dissecting the dynamic genetic effect of imprinted genes during individual ontology. Results Functional mapping has been emerging as a powerful framework for mapping quantitative trait loci underlying complex traits showing developmental characteristics. To understand the genetic architecture of dynamic imprinted traits, we propose a mapping strategy by integrating the functional mapping approach with genomic imprinting. We demonstrate the approach through mapping imprinted QTL controlling growth trajectories in an inbred F2 population. The statistical behavior of the approach is shown through simulation studies, in which the parameters can be estimated with reasonable precision under different simulation scenarios. The utility of the approach is illustrated through real data analysis in an F2 family derived from LG/J and SM/J mouse stains. Three maternally imprinted QTLs are identified as regulating the growth trajectory of mouse body weight. Conclusion The functional iQTL mapping approach developed here provides a quantitative and testable framework for assessing the interplay between imprinted genes and a developmental process, and will have important implications for elucidating the genetic architecture of imprinted traits.

  8. Modified dynamic Stark shift and depopulation rate of an atom inside a Kerr nonlinear blackbody

    International Nuclear Information System (INIS)

    Yin Miao; Cheng Ze

    2009-01-01

    We investigate the dynamic Stark shift and atomic depopulation rate induced by real photons in a Kerr nonlinear blackbody. We found that the dynamic Stark shift and atomic depopulation rate are equally modified by a nonlinear contribution factor and a linear contribution factor under a transition temperature T c . The nonlinear contribution factor depends on the Kerr nonlinear coefficient as well as the absolute temperature. Below T c , the absolute values of the dynamic Stark shift and depopulation rate of a single atomic state (not the ground state) are correspondingly larger than those in a normal blackbody whose interior is filled with a nonabsorbing linear medium. Above T c , the dynamic Stark shift and atomic depopulation rate are correspondingly equal to those in a normal blackbody with a nonabsorbing linear medium in its interior.

  9. Stress generation in a developmental context: the role of youth depressive symptoms, maternal depression, the parent-child relationship, and family stress.

    Science.gov (United States)

    Chan, Priscilla T; Doan, Stacey N; Tompson, Martha C

    2014-02-01

    The present study examined stress generation in a developmental and family context among 171 mothers and their preadolescent children, ages 8-12 years, at baseline (Time 1) and 1-year follow-up (Time 2). In the current study, we examined the bidirectional relationship between children's depressive symptoms and dependent family stress. Results suggest that children's baseline level of depressive symptoms predicted the generation of dependent family stress 1 year later. However, baseline dependent family stress did not predict an increase in children's depressive symptoms 1 year later. In addition, we examined whether a larger context of both child chronic strain (indicated by academic, behavioral, and peer stress) and family factors, including socioeconomic status and parent-child relationship quality, would influence the stress generation process. Although both chronic strain and socioeconomic status were not associated with dependent family stress at Time 2, poorer parent-child relationship quality significantly predicted greater dependent family stress at Time 2. Child chronic strain, but neither socioeconomic status nor parent-child relationship quality, predicted children's depression symptoms at Time 2. Finally, gender, maternal depression history, and current maternal depressive symptoms did not moderate the relationship between level of dependent family stress and depressive symptoms. Overall, findings provide partial support for a developmental stress generation model operating in the preadolescent period.

  10. Ultrasensitive Characterization of Mechanical Oscillations and Plasmon Energy Shift in Gold Nanorods.

    Science.gov (United States)

    Soavi, Giancarlo; Tempra, Iacopo; Pantano, Maria F; Cattoni, Andrea; Collin, Stéphane; Biagioni, Paolo; Pugno, Nicola M; Cerullo, Giulio

    2016-02-23

    Mechanical vibrational resonances in metal nanoparticles are intensively studied because they provide insight into nanoscale elasticity and for their potential application to ultrasensitive mass detection. In this paper, we use broadband femtosecond pump-probe spectroscopy to study the longitudinal acoustic phonons of arrays of gold nanorods with different aspect ratios, fabricated by electron beam lithography with very high size uniformity. We follow in real time the impulsively excited extensional oscillations of the nanorods by measuring the transient shift of the localized surface plasmon band. Broadband and high-sensitivity detection of the time-dependent extinction spectra enables one to develop a model that quantitatively describes the periodic variation of the plasmon extinction coefficient starting from the steady-state spectrum with only one additional free parameter. This model allows us to retrieve the time-dependent elongation of the nanorods with an ultrahigh sensitivity and to measure oscillation amplitudes of just a few picometers and plasmon energy shifts on the order of 10(-2) meV.

  11. Accurate and fiducial-marker-free correction for three-dimensional chromatic shift in biological fluorescence microscopy.

    Science.gov (United States)

    Matsuda, Atsushi; Schermelleh, Lothar; Hirano, Yasuhiro; Haraguchi, Tokuko; Hiraoka, Yasushi

    2018-05-15

    Correction of chromatic shift is necessary for precise registration of multicolor fluorescence images of biological specimens. New emerging technologies in fluorescence microscopy with increasing spatial resolution and penetration depth have prompted the need for more accurate methods to correct chromatic aberration. However, the amount of chromatic shift of the region of interest in biological samples often deviates from the theoretical prediction because of unknown dispersion in the biological samples. To measure and correct chromatic shift in biological samples, we developed a quadrisection phase correlation approach to computationally calculate translation, rotation, and magnification from reference images. Furthermore, to account for local chromatic shifts, images are split into smaller elements, for which the phase correlation between channels is measured individually and corrected accordingly. We implemented this method in an easy-to-use open-source software package, called Chromagnon, that is able to correct shifts with a 3D accuracy of approximately 15 nm. Applying this software, we quantified the level of uncertainty in chromatic shift correction, depending on the imaging modality used, and for different existing calibration methods, along with the proposed one. Finally, we provide guidelines to choose the optimal chromatic shift registration method for any given situation.

  12. Development of Mentalizing and Communication: From Viewpoint of Developmental Cybernetics and Developmental Cognitive Neuroscience

    Science.gov (United States)

    Itakura, Shoji

    The ability to mentalize is essential for human socialization. Such ability is strongly related to communication. In this paper, I discuss the development of mentalizing and communication from the perspectives of a new idea, Developmental Cybernetics, and developmental cognitive neuroscience. Children only attributed intention to a robot when they saw it behaving as a human and displaying social signals such as eye gaze. The emergence of powerful new methods and tools, such as neuroimaging, now allows questions about mentalizing to resolved more directly than before.

  13. How Do Children Deal With Conflict? A Developmental Study of Sequential Conflict Modulation

    Directory of Open Access Journals (Sweden)

    Silvan F. A. Smulders

    2018-05-01

    Full Text Available This study examined age-related differences in sequential conflict modulation (SCM, elicited in three tasks requiring the inhibition of pre-potent responses; a Simon task, an S-R compatibility (SRC task and a hybrid Choice-reaction/NoGo task. The primary focus was on age-related changes in performance changes following a conflict trial. A secondary aim was to assess whether SCM follows different developmental trajectories depending on the type of conflict elicited by the tasks. The tasks were presented to three different groups of participants with an age range between 7- to 25-years—one group of participants for each task. For each task, the response-to-stimulus interval (RSI was manipulated (50 vs. 500 ms across trial blocks to assess time-dependent changes in conflict modulation. The results showed SCM for all three tasks, although the specific patterns differed between tasks and RSIs. Importantly, the magnitude of SCM decreased with advancing age, but this developmental trend did not survive when considering age-group differences in basic response speed. The current results contribute to the emerging evidence suggesting that patterns of SCM are task specific and were interpreted in terms of multiple bottom-up control mechanisms.

  14. Infant developmental milestones and adult intelligence

    DEFF Research Database (Denmark)

    Flensborg-Madsen, Trine; Mortensen, Erik Lykke

    2015-01-01

    Intelligence Scale (WAIS). Associations between motor developmental milestones and IQwere analysed bymultiple linear regression adjusting for potential confounding factors. Results: Later acquisition of infant developmental milestones was associated with lower subsequent IQ, and the majority of significant......Background: A number of studies suggest a positive association between faster infant motor development and intellectual function in childhood and adolescence. However, studies investigating the relationship between infant motor development and intelligence in adulthood are lacking. Aims......: To investigate whether age at achievement of 12 motor developmental milestones was associated with adult intelligence and to evaluate the influence of sex, parental social status, parity,mother's cigarette consumption in the last trimester, gestational age, birthweight, and birth length on this association...

  15. GC-MS metabolic profiling of Cabernet Sauvignon and Merlot cultivars during grapevine berry development and network analysis reveals a stage- and cultivar-dependent connectivity of primary metabolites.

    Science.gov (United States)

    Cuadros-Inostroza, Alvaro; Ruíz-Lara, Simón; González, Enrique; Eckardt, Aenne; Willmitzer, Lothar; Peña-Cortés, Hugo

    Information about the total chemical composition of primary metabolites during grape berry development is scarce, as are comparative studies trying to understand to what extent metabolite modifications differ between cultivars during ripening. Thus, correlating the metabolic profiles with the changes occurring in berry development and ripening processes is essential to progress in their comprehension as well in the development of new approaches to improve fruit attributes. Here, the developmental metabolic profiling analysis across six stages from flowering to fully mature berries of two cultivars, Cabernet Sauvignon and Merlot, is reported at metabolite level. Based on a gas chromatography-mass spectrometry untargeted approach, 115 metabolites were identified and relative quantified in both cultivars. Sugars and amino acids levels show an opposite behaviour in both cultivars undergoing a highly coordinated shift of metabolite associated to primary metabolism during the stages involved in growth, development and ripening of berries. The changes are characteristic for each stage, the most pronounced ones occuring at fruit setting and pre-Veraison. They are associated to a reduction of the levels of metabolites present in the earlier corresponding stage, revealing a required catabolic activity of primary metabolites for grape berry developmental process. Network analysis revealed that the network connectivity of primary metabolites is stage- and cultivar-dependent, suggesting differences in metabolism regulation between both cultivars as the maturity process progresses. Furthermore, network analysis may represent an appropriate method to display the association between primary metabolites during berry developmental processes among different grapevine cultivars and for identifying potential biologically relevant metabolites.

  16. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  17. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.

    1998-01-01

    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  18. Developmental Effects of the ToxCast™ Phase I and Phase II Chemicals in Caenorhabditis elegans and Corresponding Responses in Zebrafish, Rats, and Rabbits

    Science.gov (United States)

    Boyd, Windy A.; Smith, Marjolein V.; Co, Caroll A.; Pirone, Jason R.; Rice, Julie R.; Shockley, Keith R.; Freedman, Jonathan H.

    2015-01-01

    Background: Modern toxicology is shifting from an observational to a mechanistic science. As part of this shift, high-throughput toxicity assays are being developed using alternative, nonmammalian species to prioritize chemicals and develop prediction models of human toxicity. Methods: The nematode Caenorhabditis elegans (C. elegans) was used to screen the U.S. Environmental Protection Agency’s (EPA’s) ToxCast™ Phase I and Phase II libraries, which contain 292 and 676 chemicals, respectively, for chemicals leading to decreased larval development and growth. Chemical toxicity was evaluated using three parameters: a biologically defined effect size threshold, half-maximal activity concentration (AC50), and lowest effective concentration (LEC). Results: Across both the Phase I and Phase II libraries, 62% of the chemicals were classified as active ≤ 200 μM in the C. elegans assay. Chemical activities and potencies in C. elegans were compared with those from two zebrafish embryonic development toxicity studies and developmental toxicity data for rats and rabbits. Concordance of chemical activity was higher between C. elegans and one zebrafish assay across Phase I chemicals (79%) than with a second zebrafish assay (59%). Using C. elegans or zebrafish to predict rat or rabbit developmental toxicity resulted in balanced accuracies (the average value of the sensitivity and specificity for an assay) ranging from 45% to 53%, slightly lower than the concordance between rat and rabbit (58%). Conclusions: Here, we present an assay that quantitatively and reliably describes the effects of chemical toxicants on C. elegans growth and development. We found significant overlap in the activity of chemicals in the ToxCast™ libraries between C. elegans and zebrafish developmental screens. Incorporating C. elegans toxicological assays as part of a battery of in vitro and in vivo assays provides additional information for the development of models to predict a chemical

  19. Family Perspectives on Prematurity

    Science.gov (United States)

    Zero to Three (J), 2003

    2003-01-01

    In this article, seven families describe their experiences giving birth to and raising a premature baby. Their perspectives vary, one from another, and shift over time, depending on each family's circumstances and the baby's developmental course. Experiences discussed include premature labor, medical interventions and the NICU, bringing the baby…

  20. Current status of developmental neurotoxicity: regulatory view

    DEFF Research Database (Denmark)

    Hass, Ulla

    2003-01-01

    in the testing strategy for new and existing substances, and biocides. Hopefully, this will lead to an improved database for risk assessment of potential developmental neurotoxicants. However, the regulatory authorities and toxicologists will also be faced with the challenge that decisions have to be made......The need for developmental neurotoxicity testing has been recognized for decades and guidelines are available, as the USEPA guideline and the OECD draft TG 426. Regulatory testing of industrial chemicals for developmental neurotoxicity is required to some extent, especially for pesticides in the US....... Until recently, however, developmental neurotoxicity testing of industrial chemicals has not been a clear regulatory requirement in EU, probably due to the lack of an accepted OECD TG. The revised EU Technical Guidance Document for Risk Assessment (EU-TGD) has now included the OECD draft TG 426...

  1. Developmental biology, the stem cell of biological disciplines

    OpenAIRE

    Gilbert, Scott F.

    2017-01-01

    Developmental biology (including embryology) is proposed as "the stem cell of biological disciplines.” Genetics, cell biology, oncology, immunology, evolutionary mechanisms, neurobiology, and systems biology each has its ancestry in developmental biology. Moreover, developmental biology continues to roll on, budding off more disciplines, while retaining its own identity. While its descendant disciplines differentiate into sciences with a restricted set of paradigms, examples, and techniques, ...

  2. Shift Work, Chronotype, and Melatonin Patterns among Female Hospital Employees on Day and Night Shifts.

    Science.gov (United States)

    Leung, Michael; Tranmer, Joan; Hung, Eleanor; Korsiak, Jill; Day, Andrew G; Aronson, Kristan J

    2016-05-01

    Shift work-related carcinogenesis is hypothesized to be mediated by melatonin; however, few studies have considered the potential effect modification of this underlying pathway by chronotype or specific aspects of shift work such as the number of consecutive nights in a rotation. In this study, we examined melatonin patterns in relation to shift status, stratified by chronotype and number of consecutive night shifts, and cumulative lifetime exposure to shift work. Melatonin patterns of 261 female personnel (147 fixed-day and 114 on rotations, including nights) at Kingston General Hospital were analyzed using cosinor analysis. Urine samples were collected from all voids over a 48-hour specimen collection period for measurement of 6-sulfatoxymelatonin concentrations using the Buhlmann ELISA Kit. Chronotypes were assessed using mid-sleep time (MSF) derived from the Munich Chronotype Questionnaire (MCTQ). Sociodemographic, health, and occupational information were collected by questionnaire. Rotational shift nurses working nights had a lower mesor and an earlier time of peak melatonin production compared to day-only workers. More pronounced differences in mesor and acrophase were seen among later chronotypes, and shift workers working ≥3 consecutive nights. Among nurses, cumulative shift work was associated with a reduction in mesor. These results suggest that evening-types and/or shift workers working ≥3 consecutive nights are more susceptible to adverse light-at-night effects, whereas long-term shift work may also chronically reduce melatonin levels. Cumulative and current exposure to shift work, including nights, affects level and timing of melatonin production, which may be related to carcinogenesis and cancer risk. Cancer Epidemiol Biomarkers Prev; 25(5); 830-8. ©2016 AACR. ©2016 American Association for Cancer Research.

  3. Decreasing Authority Dependence during the First Year of College

    Science.gov (United States)

    Magolda, Marcia B. Baxter; King, Patricia M.; Taylor, Kari B.; Wakefield, Kerri M.

    2012-01-01

    Annual interviews with 228 students at 6 diverse campuses in the Wabash National Study of Liberal Arts Education reveal 123 students' developmental growth away from authority dependence between the beginning of the first and second years of college. In the first year of college, 86% of participants relied solely on external authorities to define…

  4. Rate-dependent extensions of the parametric magneto-dynamic model with magnetic hysteresis

    Directory of Open Access Journals (Sweden)

    S. Steentjes

    2017-05-01

    Full Text Available This paper extends the parametric magneto-dynamic model of soft magnetic steel sheets to account for the phase shift between local magnetic flux density and magnetic field strength. This phase shift originates from the damped motion of domain walls and is strongly dependent on the microstructure of the material. In this regard, two different approaches to include the rate-dependent effects are investigated: a purely phenomenological, mathematical approach and a physical-based one.

  5. The diversification of developmental biology.

    Science.gov (United States)

    Crowe, Nathan; Dietrich, Michael R; Alomepe, Beverly S; Antrim, Amelia F; ByrneSim, Bay Lauris; He, Yi

    2015-10-01

    In the 1960s, "developmental biology" became the dominant term to describe some of the research that had previously been included under the rubrics of embryology, growth, morphology, and physiology. As scientific societies formed under this new label, a new discipline took shape. Historians, however, have a number of different perspectives on what changes led to this new field of developmental biology and how the field itself was constituted during this period. Using the General Embryological Information Service, a global index of post-World War II development-related research, we have documented and visualized significant changes in the kinds of research that occurred as this new field formed. In particular, our analysis supports the claim that the transition toward developmental biology was marked by a growth in new topics and forms of research. Although many historians privilege the role of molecular biology and/or the molecularization of biology in general during this formative period, we have found that the influence of molecular biology is not sufficient to account for the wide range of new research that constituted developmental biology at the time. Overall, our work creates a robust characterization of the changes that occurred with regard to research on growth and development in the decades following World War II and provides a context for future work on the specific drivers of those changes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Developmental models for estimating ecological responses to environmental variability: structural, parametric, and experimental issues.

    Science.gov (United States)

    Moore, Julia L; Remais, Justin V

    2014-03-01

    Developmental models that account for the metabolic effect of temperature variability on poikilotherms, such as degree-day models, have been widely used to study organism emergence, range and development, particularly in agricultural and vector-borne disease contexts. Though simple and easy to use, structural and parametric issues can influence the outputs of such models, often substantially. Because the underlying assumptions and limitations of these models have rarely been considered, this paper reviews the structural, parametric, and experimental issues that arise when using degree-day models, including the implications of particular structural or parametric choices, as well as assumptions that underlie commonly used models. Linear and non-linear developmental functions are compared, as are common methods used to incorporate temperature thresholds and calculate daily degree-days. Substantial differences in predicted emergence time arose when using linear versus non-linear developmental functions to model the emergence time in a model organism. The optimal method for calculating degree-days depends upon where key temperature threshold parameters fall relative to the daily minimum and maximum temperatures, as well as the shape of the daily temperature curve. No method is shown to be universally superior, though one commonly used method, the daily average method, consistently provides accurate results. The sensitivity of model projections to these methodological issues highlights the need to make structural and parametric selections based on a careful consideration of the specific biological response of the organism under study, and the specific temperature conditions of the geographic regions of interest. When degree-day model limitations are considered and model assumptions met, the models can be a powerful tool for studying temperature-dependent development.

  7. Size- and food-dependent growth drives patterns of competitive dominance along productivity gradients.

    Science.gov (United States)

    Huss, Magnus; Gårdmark, Anna; Van Leeuwen, Anieke; de Roos, André M

    2012-04-01

    Patterns of coexistence among competing species exhibiting size- and food-dependent growth remain largely unexplored. Here we studied mechanisms behind coexistence and shifts in competitive dominance in a size-structured fish guild, representing sprat and herring stocks in the Baltic Sea, using a physiologically structured model of competing populations. The influence of degree of resource overlap and the possibility of undergoing ontogenetic diet shifts were studied as functions of zooplankton and zoobenthos productivity. By imposing different size-dependent mortalities, we could study the outcome of competition under contrasting environmental regimes representing poor and favorable growth conditions. We found that the identity of the dominant species shifted between low and high productivity. Adding a herring-exclusive benthos resource only provided a competitive advantage over sprat when size-dependent mortality was high enough to allow for rapid growth in the zooplankton niche. Hence, the importance of a bottom-up effect of varying productivity was dependent on a strong top-down effect. Although herring could depress shared resources to lower levels than could sprat and also could access an exclusive resource, the smaller size at maturation of sprat allowed it to coexist with herring and, in some cases, exclude it. Our model system, characterized by interactions among size cohorts, allowed for consumer coexistence even at full resource overlap at intermediate productivities when size-dependent mortality was low. Observed shifts in community patterns were crucially dependent on the explicit consideration of size- and food-dependent growth. Accordingly, we argue that accounting for food-dependent growth and size-dependent interactions is necessary to better predict changes in community structure and dynamics following changes in major ecosystem drivers such as resource productivity and mortality, which are fundamental for our ability to manage exploitation of

  8. Evaluation of developmental toxicity and teratogenicity of diclofenac using Xenopus embryos.

    Science.gov (United States)

    Chae, Jeong-Pil; Park, Mi Seon; Hwang, Yoo-Seok; Min, Byung-Hwa; Kim, Sang-Hyun; Lee, Hyun-Shik; Park, Mae-Ja

    2015-02-01

    Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) with analgesic and anti-pyretic properties. This compound is therefore used to treat pain, inflammatory disorders, and dysmenorrhea. Due to its multimodal mechanism of action and ability to penetrate placenta, diclofenac is known to have undesirable side effects including teratogenicity. However, limited data exist on its teratogenicity, and a detailed investigation regarding harmful effects of this drug during embryogenesis is warranted. Here, we analyzed the developmental toxic effects of diclofenac using Xenopus embryos according to the Frog Embryo Teratogenesis Assay-Xenopus (FETAX) protocol. Diclofenac treatment exerted a teratogenic effect on Xenopus embryos with a teratogenic index (TI) value of 2.64 TI; if this value is higher than 1.2, the cut-off value indicative of toxicity. In particular, mortality of embryos treated with diclofenac increased in a concentration-dependent manner and a broad spectrum of malformations such as shortening and kinking of the axis, abdominal bulging, and prominent blister formation, was observed. The shape and length of internal organs also differed compared to the control group embryos and show developmental retardation on histological label. However, the expression of major tissue-specific markers did not change when analyzed by reverse transcription-polymerase chain reaction (RT-PCR). In conclusion, diclofenac treatment can promote teratogenicity that results in morphological anomalies, but not disrupt the developmental tissue arrangement during Xenopus embryogenesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Matsulu: A community in developmental fermentation and fusion

    Directory of Open Access Journals (Sweden)

    Johan Visser

    2006-04-01

    Full Text Available Since 2004, the Drama Department (University of Pretoria has engaged in the development and execution of Theatre-for-Development projects in accordance with the mission statement of the Endangered Wildlife Trust (EWT, as well as the White Paper on Integrated Pollution and Waste Management for South Africa (1998 – shifting governmental approach to this sensitive socio-economical issue from cure to prevention – to interrogate issues concerning the environment, sustainable use of resources and subsequently: conservation, within developing urban and rural communities. Theatrefor-Development (TFD utilizes theatre to disseminate developmental messages. This paper should be seen as not so much as a report of an end result, but as research in progress. Continued projects addressing the issues of conservation, the environment, development and sustainability will in future lead to more definite reporting on results. The paper investigates the ability of TFD to affect changes of behaviour and encourage personal agency and empowerment in community members concerning waste management and the sustainable use of resources within a developing rural society. It will not claim to be definitive; results and conclusions can not be generalized.

  10. Effect of Shift Work on Nocturia.

    Science.gov (United States)

    Kim, Jin Wook

    2016-01-01

    To identify the circadian sensitive component of nocturia by comparing nocturia in patients who voluntarily choose a disrupted circadian rhythm, that is, shift workers, with those who maintain normal day-night cycles. Between 2011 and 2013, a total of 1741 untreated patients, 1376 nonshift workers and 365 shift workers, were compared for nocturia indices based on frequency volume charts (FVCs). General linear model of 8-hour interval urine production and frequency were compared between FVCs of nonshift workers, FVCs of night-shift workers, and FVCs of day-shift workers. Nocturia frequency was increased in the night-shift workers (2.38 ± 1.44) compared with nonshift workers (2.18 ± 1.04) (P night-shift workers, 0.34 ± 0.13 for nonshift workers, P = .24), nocturnal bladder capacity index increased significantly (1.41 ± 1.06 for night-shift workers, 1.26 ± 0.92 for nonshift workers, P shift (P shift changes (P = .35). Patients in alternating work shifts showed increased nocturia, especially during their night shift. These changes tended to be more associated with decreased nocturnal bladder capacity than increased nocturnal polyuria. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Developmental toxicity of engineered nanomaterials

    DEFF Research Database (Denmark)

    Hougaard, Karin S.; Hansen, Jitka S.; Jackson, Petra

    2016-01-01

    Study of air pollution indicates that minute particles may adversely interfere with pregnancy and fetal development. As engineering of nanoparticles have emerged, so has concern that these might interfere with reproductive and developmental functions. This is because nanotechnology may potentially...... increase the overall particle burden in air and introduce particles with novel characteristics and surface reactivity. To evaluate safety for pregnant women, we have studied developmental toxicity of engineered nanoparticles (ENPs), following exposure of pregnant mice by inhalation (ENPs of titanium...

  12. Differential Shift Estimation in the Absence of Coherence: Performance Analysis and Benefits of Polarimetry

    Science.gov (United States)

    Villano, Michelangelo; Papathanassiou, Konstantinos P.

    2011-03-01

    The estimation of the local differential shift between synthetic aperture radar (SAR) images has proven to be an effective technique for monitoring glacier surface motion. As images acquired over glaciers by short wavelength SAR systems, such as TerraSAR-X, often suffer from a lack of coherence, image features have to be exploited for the shift estimation (feature-tracking).The present paper addresses feature-tracking with special attention to the feasibility requirements and the achievable accuracy of the shift estimation. In particular, the dependence of the performance on image characteristics, such as texture parameters, signal-to-noise ratio (SNR) and resolution, as well as on processing techniques (despeckling, normalised cross-correlation versus maximum likelihood estimation) is analysed by means of Monte-Carlo simulations. TerraSAR-X data acquired over the Helheim glacier, Greenland, and the Aletsch glacier, Switzerland, have been processed to validate the simulation results.Feature-tracking can benefit of the availability of fully-polarimetric data. As some image characteristics, in fact, are polarisation-dependent, the selection of an optimum polarisation leads to improved performance. Furthermore, fully-polarimetric SAR images can be despeckled without degrading the resolution, so that additional (smaller-scale) features can be exploited.

  13. Associations between number of consecutive night shifts and impairment of neurobehavioral performance during a subsequent simulated night shift.

    Science.gov (United States)

    Magee, Michelle; Sletten, Tracey L; Ferguson, Sally A; Grunstein, Ronald R; Anderson, Clare; Kennaway, David J; Lockley, Steven W; Rajaratnam, Shantha Mw

    2016-05-01

    This study aimed to investigate sleep and circadian phase in the relationships between neurobehavioral performance and the number of consecutive shifts worked. Thirty-four shift workers [20 men, mean age 31.8 (SD 10.9) years] worked 2-7 consecutive night shifts immediately prior to a laboratory-based, simulated night shift. For 7 days prior, participants worked their usual shift sequence, and sleep was assessed with logs and actigraphy. Participants completed a 10-minute auditory psychomotor vigilance task (PVT) at the start (~21:00 hours) and end (~07:00 hours) of the simulated night shift. Mean reaction times (RT), number of lapses and RT distribution was compared between those who worked 2-3 consecutive night shifts versus those who worked 4-7 shifts. Following 4-7 shifts, night shift workers had significantly longer mean RT at the start and end of shift, compared to those who worked 2-3 shifts. The slowest and fastest 10% RT were significantly slower at the start, but not end, of shift among participants who worked 4-7 nights. Those working 4-7 nights also demonstrated a broader RT distribution at the start and end of shift and had significantly slower RT based on cumulative distribution analysis (5 (th), 25 (th), 50 (th), 75 (th)percentiles at the start of shift; 75th percentile at the end of shift). No group differences in sleep parameters were found for 7 days and 24 hours prior to the simulated night shift. A greater number of consecutive night shifts has a negative impact on neurobehavioral performance, likely due to cognitive slowing.

  14. Change from an 8-hour shift to a 12-hour shift, attitudes, sleep, sleepiness and performance.

    Science.gov (United States)

    Lowden, A; Kecklund, G; Axelsson, J; Akerstedt, T

    1998-01-01

    The present study sought to evaluate the effect of a change from a rotating 3-shift (8-hour) to a 2-shift shift (12 hour) schedule on sleep, sleepiness, performance, perceived health, and well-being. Thirty-two shift workers at a chemical plant (control room operators) responded to a questionnaire a few months before a change was made in their shift schedule and 10 months after the change. Fourteen workers also filled out a diary, carried activity loggers, and carried out reaction-time tests (beginning and end of shift). Fourteen day workers served as a reference group for the questionnaires and 9 were intensively studied during a week with workdays and a free weekend. The questionnaire data showed that the shift change increased satisfaction with workhours, sleep, and time for social activities. Health, perceived accident risk, and reaction-time performance were not negatively affected. Alertness improved and subjective recovery time after night work decreased. The quick changes in the 8-hour schedule greatly increased sleep problems and fatigue. Sleepiness integrated across the entire shift cycle showed that the shift workers were less alert than the day workers, across workdays and days off (although alertness increased with the 12-hour shift). The change from 8-hour to 12-hour shifts was positive in most respects, possibly due to the shorter sequences of the workdays, the longer sequences of consecutive days off, the fewer types of shifts (easier planning), and the elimination of quick changes. The results may differ in groups with a higher work load.

  15. SHIFT: server for hidden stops analysis in frame-shifted translation.

    Science.gov (United States)

    Gupta, Arun; Singh, Tiratha Raj

    2013-02-23

    Frameshift is one of the three classes of recoding. Frame-shifts lead to waste of energy, resources and activity of the biosynthetic machinery. In addition, some peptides synthesized after frame-shifts are probably cytotoxic which serve as plausible cause for innumerable number of diseases and disorders such as muscular dystrophies, lysosomal storage disorders, and cancer. Hidden stop codons occur naturally in coding sequences among all organisms. These codons are associated with the early termination of translation for incorrect reading frame selection and help to reduce the metabolic cost related to the frameshift events. Researchers have identified several consequences of hidden stop codons and their association with myriad disorders. However the wealth of information available is speckled and not effortlessly acquiescent to data-mining. To reduce this gap, this work describes an algorithmic web based tool to study hidden stops in frameshifted translation for all the lineages through respective genetic code systems. This paper describes SHIFT, an algorithmic web application tool that provides a user-friendly interface for identifying and analyzing hidden stops in frameshifted translation of genomic sequences for all available genetic code systems. We have calculated the correlation between codon usage frequencies and the plausible contribution of codons towards hidden stops in an off-frame context. Markovian chains of various order have been used to model hidden stops in frameshifted peptides and their evolutionary association with naturally occurring hidden stops. In order to obtain reliable and persuasive estimates for the naturally occurring and predicted hidden stops statistical measures have been implemented. This paper presented SHIFT, an algorithmic tool that allows user-friendly exploration, analysis, and visualization of hidden stop codons in frameshifted translations. It is expected that this web based tool would serve as a useful complement for

  16. Directionality of recent bird distribution shifts and climate change in Great Britain.

    Science.gov (United States)

    Gillings, Simon; Balmer, Dawn E; Fuller, Robert J

    2015-06-01

    There is good evidence that species' distributions are shifting poleward in response to climate change and wide interest in the magnitude of such responses for scientific and conservation purposes. It has been suggested from the directions of climatic changes that species' distribution shifts may not be simply poleward, but this has been rarely tested with observed data. Here, we apply a novel approach to measuring range shifts on axes ranging through 360°, to recent data on the distributions of 122 species of British breeding birds during 1988-1991 and 2008-2011. Although previously documented poleward range shifts have continued, with an average 13.5 km shift northward, our analysis indicates this is an underestimate because it ignores common and larger shifts that occurred along axes oriented to the north-west and north-east. Trailing edges contracted from a broad range of southerly directions. Importantly, these results are derived from systematically collected data so confounding observer-effort biases can be discounted. Analyses of climate for the same period show that whilst temperature trends should drive species along a north-north-westerly trajectory, directional responses to precipitation will depend on both the time of year that is important for determining a species' distribution, and the location of the range margin. Directions of species' range centroid shift were not correlated with spatial trends in any single climate variable. We conclude that range shifts of British birds are multidirectional, individualistic and probably determined by species-specific interactions of multiple climate factors. Climate change is predicted to lead to changes in community composition through variation in the rates that species' ranges shift; our results suggest communities could change further owing to constituent species shifting along different trajectories. We recommend more studies consider directionality in climate and range dynamics to produce more

  17. Female reproductive disorders: the roles of endocrine-disrupting compounds and developmental timing

    DEFF Research Database (Denmark)

    Crain, D.A.; Janssen, S.J.; Edwards, T.M.

    2008-01-01

    OBJECTIVE: To evaluate the possible role of endocrine-disrupting compounds (EDCs) on female reproductive disorders emphasizing developmental plasticity and the complexity of endocrine-dependent ontogeny of reproductive organs. Declining conception rates and the high incidence of female reproducti...... reproductive dysfunction together with tools to assess the specific exposures and methods to block their effects. This review of the EDC literature as it relates to female health provides an important platform on which women's health can be improved Udgivelsesdato: 2008/10...

  18. Developmental neurotoxicity of Propylthiouracil in rats

    DEFF Research Database (Denmark)

    Petersen, Marta Axelstad; Hansen, P.; Christiansen, S.

    2007-01-01

    early in pregnancy may cause adverse effects on the offspring. This has led to increased concern about thyroid hormone disrupting chemicals (TDCs) in our environment. We have studied how developmental exposure to the known antithyroid agent propylthiouracil (PTU) affects the development of rat pups...... behaviour and hearing function. This supports that exposure to TDC's in general may cause long-lasting developmental neurotoxicity....

  19. Gene expression profiles in the cerebellum and hippocampus following exposure to a neurotoxicant, Aroclor 1254: Developmental effects

    International Nuclear Information System (INIS)

    Royland, Joyce E.; Wu, Jinfang; Zawia, Nasser H.; Kodavanti, Prasada Rao S.

    2008-01-01

    The developmental consequences of exposure to the polychlorinated biphenyls (PCBs) have been widely studied, making PCBs a unique model to understand issues related to environmental mixture of persistent chemicals. PCB exposure in humans adversely affects neurocognitive development, causes psychomotor difficulties, and contributes to attention deficits in children, all of which seem to be associated with altered patterns of neuronal connectivity. In the present study, we examined gene expression profiles in the rat nervous system following PCB developmental exposure. Pregnant rats (Long-Evans) were dosed perinatally with 0 or 6 mg/kg/day of Aroclor 1254 from gestation day 6 through postnatal day (PND) 21. Gene expression in cerebellum and hippocampus from PND7 and PND14 animals was analyzed with an emphasis on developmental aspects. Changes in gene expression (≥ 1.5 fold) in control animals identified normal developmental changes. These basal levels of expression were compared to data from Aroclor 1254-treated animals to determine the impact of gestational PCB exposure on developmental parameters. The results indicate that the expression of a number of developmental genes related to cell cycle, synaptic function, cell maintenance, and neurogenesis is significantly altered from PND7 to PND14. Aroclor 1254 treatment appears to dampen the overall growth-related gene expression levels in both regions with the effect being more pronounced in the cerebellum. Functional analysis suggests that Aroclor 1254 delays maturation of the developing nervous system, with the consequences dependent on the ontological state of the brain area and the functional role of the individual gene. Such changes may underlie learning and memory deficits observed in PCB exposed animals and humans

  20. Socio-emotional factors in alcohol dependence.

    Science.gov (United States)

    Tikka, Deyashini Lahiri; Ram, Daya; Dubey, Indu; Tikka, Sai Krishna

    2014-04-01

    Alcohol-dependent patients are traditionally believed to have insecure attachment styles, higher anger expression, and lower self-esteem. There is a need to study them together. To understand the relationships amongst various of the socio-emotional factors. Forty male patients with Alcohol dependence syndrome and 40 matched healthy controls (General Health Questionnaire-12 score Relationship Scale Questionnaire), anger domains (on State Trait Anger Expression Inventory), and self-esteem (on Rosenberg Self-esteem Scale). Comparison using independent samples t test and chi square test; correlation using Pearson's correlation coefficient. Patients had significantly higher anger expression, 'anger in' and 'anger out,' and lower self-esteem than healthy controls. Severity of alcohol dependence had significant correlation with 'anger out,' and self-esteem had significant negative correlation with anger expression. The present study suggests that the socio-emotional factors studied are developmentally linked to each other.