WorldWideScience

Sample records for dependent developmental shifts

  1. Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Shuhua Zhan

    Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.

  2. Directional Dependence in Developmental Research

    Science.gov (United States)

    von Eye, Alexander; DeShon, Richard P.

    2012-01-01

    In this article, we discuss and propose methods that may be of use to determine direction of dependence in non-normally distributed variables. First, it is shown that standard regression analysis is unable to distinguish between explanatory and response variables. Then, skewness and kurtosis are discussed as tools to assess deviation from…

  3. Developmental psychopathology: a paradigm shift or just a relabeling?

    Science.gov (United States)

    Rutter, Michael

    2013-11-01

    Developmental psychopathology is described as a conceptual approach that involves a set of research methods that capitalize on developmental and psychopathological variations to ask questions about mechanisms and processes. Achievements are described in relation to attachment and attachment disorders, autism, schizophrenia, childhood antecedents of adult psychopathology, testing for environmental mediation of risk effects, gene-environment interplay, intellectual and language functioning, effects of mentally ill parents on the children, stress and vulnerability to depression, ethnicity and schizophrenia, and drug response. Continuities and discontinuities over the course of development are discussed in relation to attention-deficit/hyperactivity disorder, antisocial behavior, eating disorders, substance abuse and dependency, pharmacological and behavioral addictions, and a range of other disorders. Research challenges are considered in relation to spectrum concepts, the adolescent development of a female preponderance for depression, the mechanisms involved in age differences in response to drugs and to lateralized brain injury, the processing of experiences, the biological embedding of experiences, individual differences in response to environmental hazards, nature-nurture integration, and brain plasticity.

  4. Task Switching and Shifting between Stopping and Going: Developmental Change in between-Trial Control Adjustments

    Science.gov (United States)

    Huizing, Mariette; van der Molen, Maurits W.

    2011-01-01

    This study set out to investigate developmental differences in the ability to switch between choice tasks and to shift between Go/NoGo and choice tasks. Three age groups (7-year-olds, 11-year-olds, and young adults) were asked to consider the shape or color of a bivalued target stimulus. The participants performed a switch task in which a cue…

  5. Linking Social Change and Developmental Change: Shifting Pathways of Human Development

    Science.gov (United States)

    Greenfield, Patricia M.

    2009-01-01

    P. M. Greenfield's new theory of social change and human development aims to show how changing sociodemographic ecologies alter cultural values and learning environments and thereby shift developmental pathways. Worldwide sociodemographic trends include movement from rural residence, informal education at home, subsistence economy, and…

  6. Blue and red shifted temperature dependence of implicit phonon shifts in graphene

    Science.gov (United States)

    Mann, Sarita; Jindal, V. K.

    2017-07-01

    We have calculated the implicit shift for various modes of frequency in a pure graphene sheet. Thermal expansion and Grüneisen parameter which are required for implicit shift calculation have already been studied and reported. For this calculation, phonon frequencies are obtained using force constants derived from dynamical matrix calculated using VASP code where the density functional perturbation theory (DFPT) is used in interface with phonopy software. The implicit phonon shift shows an unusual behavior as compared to the bulk materials. The frequency shift is large negative (red shift) for ZA and ZO modes and the value of negative shift increases with increase in temperature. On the other hand, blue shift arises for all other longitudinal and transverse modes with a similar trend of increase with increase in temperature. The q dependence of phonon shifts has also been studied. Such simultaneous red and blue shifts in transverse or out plane modes and surface modes, respectively leads to speculation of surface softening in out of plane direction in preference to surface melting.

  7. Species invasion shifts the importance of predator dependence.

    Science.gov (United States)

    Griffen, Blaine D; Delaney, David G

    2007-12-01

    The strength of interference between foraging individuals can influence per capita consumption rates, with important consequences for predator and prey populations and system stability. Here we demonstrate how the replacement of a previously established invader, the predatory crab Carcinus maenas, by the recently invading predatory crab Hemigrapsus sanguineus shifts predation from a species that experiences strong predator interference (strong predator dependence) to one that experiences weak predator interference (weak predator dependence). We demonstrate using field experiments that differences in the strength of predator dependence persist for these species both when they forage on a single focal prey species only (the mussel Mytilus edulis) and when they forage more broadly across the entire prey community. This shift in predator dependence with species replacement may be altering the biomass across trophic levels, consistent with theoretical predictions, as we show that H. sanguineus populations are much larger than C. maenas populations throughout their invaded ranges. Our study highlights that predator dependence may differ among predator species and demonstrates that different predatory impacts of two conspicuous invasive predators may be explained at least in part by different strengths of predator dependence.

  8. Pay Attention!: Sluggish Multisensory Attentional Shifting as a Core Deficit in Developmental Dyslexia.

    Science.gov (United States)

    Krause, Margaret B

    2015-11-01

    The aim of this review is to provide a background on the neurocognitive aspects of the reading process and review neuroscientific studies of individuals with developmental dyslexia, which provide evidence for amodal processing deficits. Hari, Renvall, and Tanskanen (2001) propose amodal sluggish attentional shifting (SAS) as a causal factor for temporal processing deficits in dyslexia. Undergirding this theory is the notion that when dyslexics are faced with rapid sequences of stimuli, their automatic attentional systems fail to disengage efficiently, which leads to difficulty when moving from one item to the next (Lallier et al., ). This results in atypical perception of rapid stimulus sequences. Until recently, the SAS theory, particularly the examination of amodal attentional deficits, was studied solely through the use of behavioural measures (Facoetti et al., ; Facoetti, Lorusso, Cattaneo, Galli, & Molteni, ). This paper examines evidence within the literature that provides a basis for further exploration of amodal SAS as an underlying deficit in developmental dyslexia. Copyright © 2015 John Wiley & Sons, Ltd.

  9. Observation of Broadband Time-Dependent Rabi Shifting in Microplasmas

    International Nuclear Information System (INIS)

    Compton, Ryan; Filin, Alex; Romanov, Dmitri A.; Levis, Robert J.

    2009-01-01

    Coherent broadband radiation in the form of Rabi sidebands is observed when a ps probe laser propagates through a weakly ionized, electronically excited microplasma generated in the focus of an intense pump beam. The sidebands arise from the interaction of the probe beam with pairs of excited states of a constituent neutral atom via the probe-induced Rabi oscillation. Sideband shifting of >90 meV from the probe carrier frequency results in an effective bandwidth of 200 meV. The sidebands are controlled by the intensity and temporal profile of the probe pulse; with amplitude and shift in agreement with the predictions of a time-dependent generalized Rabi cycling model.

  10. Discrimination, developmental science, and the law: addressing dramatic shifts in civil rights jurisprudence.

    Science.gov (United States)

    Levesque, Roger J R

    2014-01-01

    The civil rights movement fostered dramatic shifts in legal responses to discrimination based on race, gender, and a host of other group characteristics. The legal system now evinces yet another dramatic shift, as it moves from considering difference to focusing on neutrality, from efforts that seek to counter subjugation to those that adopt a "color-blind" approach. The shifting approach already has reached laws regulating responses to the group that spurred massive civil rights reform: minority youth. The shift requires a different body of empirical evidence to address it and a new look at equality jurisprudence. This article notes the need to turn to the current understanding of prejudice and discrimination for guidance, and uses, as illustration, developmental science to shed light on the development, manifestation, and alleviation of invidious discrimination. Using that understanding, the analysis details how the legal system can benefit from that research and better address discrimination in light of dramatic changes in law. The article articulates the need to address discrimination by recognizing and enlisting the law's inculcative powers through multiple sites of inculcation, ranging from families, schools, health and justice systems to religious and community groups. The discussion concludes with brief suggestions for reform benefiting from understandings of prejudice and its expression. (c) 2014 APA, all rights reserved.

  11. A Developmental Shift from Positive to Negative Connectivity in Human Amygdala-Prefrontal Circuitry

    Science.gov (United States)

    Gee, Dylan G.; Humphreys, Kathryn L.; Flannery, Jessica; Goff, Bonnie; Telzer, Eva H.; Shapiro, Mor; Hare, Todd A.; Bookheimer, Susan Y.; Tottenham, Nim

    2013-01-01

    Recent human imaging and animal studies highlight the importance of frontoamygdala circuitry in the regulation of emotional behavior and its disruption in anxiety-related disorders. While tracing studies have suggested changes in amygdala-cortical connectivity through the adolescent period in rodents, less is known about the reciprocal connections within this circuitry across human development, when these circuits are being fine-tuned and substantial changes in emotional control are observed. The present study examined developmental changes in amygdala-prefrontal circuitry across the ages of 4 to 22 years using task-based functional magnetic resonance imaging (fMRI). Results suggest positive amygdala-prefrontal connectivity in early childhood that switches to negative functional connectivity during the transition to adolescence. Amygdala-mPFC functional connectivity was significantly positive (greater than zero) among participants younger than ten, whereas functional connectivity was significantly negative (less than zero) among participants ten years and older, over and above the effect of amygdala reactivity. The developmental switch in functional connectivity was paralleled by a steady decline in amygdala reactivity. Moreover, the valence switch might explain age-related improvement in task performance and a developmentally normative decline in anxiety. Initial positive connectivity followed by a valence shift to negative connectivity provides a neurobiological basis for regulatory development and may present novel insight into a more general process of developing regulatory connections. PMID:23467374

  12. Wavefield dependency on virtual shifts in the source location

    KAUST Repository

    Alkhalifah, Tariq

    2011-02-14

    The wavefield dependence on a virtual shift in the source location can provide information helpful in velocity estimation and interpolation. However, the second-order partial differential equation (PDE) that relates changes in the wavefield form (or shape) to lateral perturbations in the source location depends explicitly on lateral derivatives of the velocity field. For velocity models that include lateral velocity discontinuities this is problematic as such derivatives in their classical definition do not exist. As a result, I derive perturbation partial differential wave equations that are independent of direct velocity derivatives and thus, provide possibilities for wavefield shape extrapolation in complex media. These PDEs have the same structure as the wave equation with a source function that depends on the background (original source) wavefield. The solutions of the perturbation equations provide the coefficients of a Taylor\\'s series type expansion for the wavefield. The new formulas introduce changes to the background wavefield only in the presence of lateral velocity variation or in general terms velocity variations in the perturbation direction. The accuracy of the representation, as demonstrated on the Marmousi model, is generally good. © 2011 European Association of Geoscientists & Engineers.

  13. Gender Differences in Developmental Dyscalculia Depend on Diagnostic Criteria

    Science.gov (United States)

    Devine, Amy; Soltesz, Fruzsina; Nobes, Alison; Goswami, Usha; Szucs, Denes

    2013-01-01

    Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender…

  14. Comparison of shifting attention function in 7-13-years-old children with fluent speech and developmental stuttering

    Directory of Open Access Journals (Sweden)

    Kowsar Esfandeh

    2014-04-01

    Full Text Available Background and Aim: Attention has causal role in speech and language processing. Studies are limited about relation between attention and language development. As a result, the purpose of this study was to investigate the difference shifting attention function in children with developmental stuttering and fluent speech.Methods: Thirty children who stutter (21 boys and 9 girls and thirty children who did not stutter (21 boys and 9 girls were evaluated. Shifting attention function was investigated using Wisconsin card sorting test. The data were analyzed via Kolmogorov-Smirnov, independent t, and Mann-Whitney U-tests.Results: Between group analysis showed significant differences for all of the indexes in Wisconsin card sorting test . The number of categories completed in children who stutter was significantly less than that control group (p<0.05. But preservative errors, total errors, total tries, time of test performance and try for first pattern in children who stutter was more than in the control group and data differences were significant for all of the indexes (p<0.05.Conclusion: The findings of this study show that children with and without stuttering are different in shifting attention function and children who stutter have weaker function in shifting attention. The findings were linked to emerging theoretical frameworks of stuttering development and that were taken to suggest a possible role for attention processes in developmental stuttering.

  15. Wavefield dependency on virtual shifts in the source location

    KAUST Repository

    Alkhalifah, Tariq

    2011-01-01

    shape) to lateral perturbations in the source location depends explicitly on lateral derivatives of the velocity field. For velocity models that include lateral velocity discontinuities this is problematic as such derivatives in their classical

  16. Temperature dependence of 1H NMR chemical shifts and its influence on estimated metabolite concentrations.

    Science.gov (United States)

    Wermter, Felizitas C; Mitschke, Nico; Bock, Christian; Dreher, Wolfgang

    2017-12-01

    Temperature dependent chemical shifts of important brain metabolites measured by localised 1 H MRS were investigated to test how the use of incorrect prior knowledge on chemical shifts impairs the quantification of metabolite concentrations. Phantom measurements on solutions containing 11 metabolites were performed on a 7 T scanner between 1 and 43 °C. The temperature dependence of the chemical shift differences was fitted by a linear model. Spectra were simulated for different temperatures and analysed by the AQSES program (jMRUI 5.2) using model functions with chemical shift values for 37 °C. Large differences in the temperature dependence of the chemical shift differences were determined with a maximum slope of about ±7.5 × 10 -4  ppm/K. For 32-40 °C, only minor quantification errors resulted from using incorrect chemical shifts, with the exception of Cr and PCr. For 1-10 °C considerable quantification errors occurred if the temperature dependence of the chemical shifts was neglected. If 1 H MRS measurements are not performed at 37 °C, for which the published chemical shift values have been determined, the temperature dependence of chemical shifts should be considered to avoid systematic quantification errors, particularly for measurements on animal models at lower temperatures.

  17. Proton Chemical Shift Imaging of the Brain in Pediatric and Adult Developmental Stuttering.

    Science.gov (United States)

    O'Neill, Joseph; Dong, Zhengchao; Bansal, Ravi; Ivanov, Iliyan; Hao, Xuejun; Desai, Jay; Pozzi, Elena; Peterson, Bradley S

    2017-01-01

    Developmental stuttering is a neuropsychiatric condition of incompletely understood brain origin. Our recent functional magnetic resonance imaging study indicates a possible partial basis of stuttering in circuits enacting self-regulation of motor activity, attention, and emotion. To further characterize the neurophysiology of stuttering through in vivo assay of neurometabolites in suspect brain regions. Proton chemical shift imaging of the brain was performed in a case-control study of children and adults with and without stuttering. Recruitment, assessment, and magnetic resonance imaging were performed in an academic research setting. Ratios of N-acetyl-aspartate plus N-acetyl-aspartyl-glutamate (NAA) to creatine (Cr) and choline compounds (Cho) to Cr in widespread cerebral cortical, white matter, and subcortical regions were analyzed using region of interest and data-driven voxel-based approaches. Forty-seven children and adolescents aged 5 to 17 years (22 with stuttering and 25 without) and 47 adults aged 21 to 51 years (20 with stuttering and 27 without) were recruited between June 2008 and March 2013. The mean (SD) ages of those in the stuttering and control groups were 12.2 (4.2) years and 13.4 (3.2) years, respectively, for the pediatric cohort and 31.4 (7.5) years and 30.5 (9.9) years, respectively, for the adult cohort. Region of interest-based findings included lower group mean NAA:Cr ratio in stuttering than nonstuttering participants in the right inferior frontal cortex (-7.3%; P = .02), inferior frontal white matter (-11.4%; P < .001), and caudate (-10.6%; P = .04), while the Cho:Cr ratio was higher in the bilateral superior temporal cortex (left: +10.0%; P = .03 and right: +10.8%; P = .01), superior temporal white matter (left: +14.6%; P = .003 and right: +9.5%; P = .02), and thalamus (left: +11.6%; P = .002 and right: +11.1%; P = .001). False discovery rate-corrected voxel-based findings were highly consistent

  18. On the counting rate-dependent amplitude shifts in proportional counters

    International Nuclear Information System (INIS)

    Mahesh, K.

    1976-01-01

    The presence of a positive ion cloud near the anode wire, which has been believed to be the cause of the observed counting rate-dependent peak shifts in proportional counters, does not explain various exhibited features of these shifts. The possibility of other mechanisms involved is, therefore, examined. The columnar recombination of primary ions in the counter is considered to explain the origin of the shifts and their observed features. (Auth.)

  19. Sources of Cognitive Inflexibility in Set-Shifting Tasks: Insights Into Developmental Theories From Adult Data

    OpenAIRE

    Dick, Anthony Steven

    2012-01-01

    Two experiments examined processes underlying cognitive inflexibility in set-shifting tasks typically used to assess the development of executive function in children. Adult participants performed a Flexible Item Selection Task (FIST) that requires shifting from categorizing by one dimension (e.g., color) to categorizing by a second orthogonal dimension (e.g., shape). The experiments showed performance of the FIST involves suppression of the representation of the ignored dimension; response t...

  20. Developmental differences in childhood motor coordination predict adult alcohol dependence

    DEFF Research Database (Denmark)

    Manzardo, Ann M; Penick, Elizabeth C; Knop, Joachim

    2005-01-01

    BACKGROUND: The Danish Longitudinal Study of Alcoholism has identified a number of early biological indicators that predicted alcohol dependence 30 years later. In light of recent evidence linking deficits of the cerebellum to certain neuropsychiatric disorders often comorbid with alcoholism, we...

  1. Sources of Cognitive Inflexibility in Set-Shifting Tasks: Insights Into Developmental Theories From Adult Data.

    Science.gov (United States)

    Dick, Anthony Steven

    2012-01-01

    Two experiments examined processes underlying cognitive inflexibility in set-shifting tasks typically used to assess the development of executive function in children. Adult participants performed a Flexible Item Selection Task (FIST) that requires shifting from categorizing by one dimension (e.g., color) to categorizing by a second orthogonal dimension (e.g., shape). The experiments showed performance of the FIST involves suppression of the representation of the ignored dimension; response times for selecting a target object in an immediately-following oddity task were slower when the oddity target was the previously-ignored stimulus of the FIST. However, proactive interference from the previously relevant stimulus dimension also impaired responding. The results are discussed with respect to two prominent theories of the source of difficulty for children and adults on dimensional shifting tasks: attentional inertia and negative priming . In contrast to prior work emphasizing one over the other process, the findings indicate that difficulty in the FIST, and by extension other set-shifting tasks, can be attributed to both the need to shift away from the previously attended representation ( attentional inertia ), and the need to shift to the previously ignored representation ( negative priming ). Results are discussed in relation to theoretical explanations for cognitive inflexibility in adults and children.

  2. Developmental Delay’ Reconsidered: The Critical Role of Age-Dependent, Co-variant Development

    Directory of Open Access Journals (Sweden)

    Yonata Levy

    2018-04-01

    Full Text Available In memory of Annette Karmiloff-Smith.This paper reviews recent neurobiological research reporting structural co-variance and temporal dependencies in age-dependent gene expression, parameters of cortical maturation, long range connectivity and interaction of the biological network with the environment. This research suggests that age by size trajectories of brain structures relate to functional properties more than absolute sizes. In line with these findings, recent behavioral studies of typically developing children whose language development was delayed reported long term consequences of such delays. As for neurodevelopmental disorders, disrupted developmental timing and slow acquisitional pace are hallmarks of these populations. It is argued that these behavioral and neuro-biological results highlight the need to commit to a developmental model which will reflect the fact that temporal dependencies overseeing structural co-variance among developmental components are major regulatory factors of typical development of the brain/mind network. Consequently, the concept of ‘developmental delay’ in developmental theorizing needs to be reconsidered.

  3. From Prioritizing Objects to Prioritizing Cues: A Developmental Shift for Cognitive Control

    Science.gov (United States)

    Chevalier, Nicolas; Dauvier, Bruno; Blaye, Agnès

    2018-01-01

    Emerging cognitive control supports increasingly adaptive behaviors and predicts life success, while low cognitive control is a major risk factor during childhood. It is therefore essential to understand how it develops. The present study provides evidence for an age-related shift in the type of information that children prioritize in their…

  4. Pressure-dependent {sup 13}C chemical shifts in proteins: origins and applications

    Energy Technology Data Exchange (ETDEWEB)

    Wilton, David J. [University of Sheffield, Department of Molecular Biology and Biotechnology (United Kingdom); Kitahara, Ryo [Ritsumeikan University, College of Pharmaceutical Sciences (Japan); Akasaka, Kazuyuki [Kinki University, Department of Biotechnological Science, School of Biology-Oriented Science and Technology (Japan); Williamson, Mike P. [University of Sheffield, Department of Molecular Biology and Biotechnology (United Kingdom)], E-mail: m.williamson@sheffield.ac.uk

    2009-05-15

    Pressure-dependent {sup 13}C chemical shifts have been measured for aliphatic carbons in barnase and Protein G. Up to 200 MPa (2 kbar), most shift changes are linear, demonstrating pressure-independent compressibilities. CH{sub 3}, CH{sub 2} and CH carbon shifts change on average by +0.23, -0.09 and -0.18 ppm, respectively, due to a combination of bond shortening and changes in bond angles, the latter matching one explanation for the {gamma}-gauche effect. In addition, there is a residue-specific component, arising from both local compression and conformational change. To assess the relative magnitudes of these effects, residue-specific shift changes for protein G were converted into structural restraints and used to calculate the change in structure with pressure, using a genetic algorithm to convert shift changes into dihedral angle restraints. The results demonstrate that residual {sup 13}C{alpha} shifts are dominated by dihedral angle changes and can be used to calculate structural change, whereas {sup 13}C{beta} shifts retain significant dependence on local compression, making them less useful as structural restraints.

  5. Developmentally dependent and different roles of fatty acids OMEGA-6 and OMEGA-3

    DEFF Research Database (Denmark)

    Mourek, J; Mourek, J

    2011-01-01

    The developmentally-dependent differences in the biological significances and effects of PUFA-OMEGA-6 (namely of arachidonic acid) and PUFA-OMEGA-3 (namely of docosahexaenoic acid) are discussed. The clinical results as well as developmental experiences are indicating a hypothesis of the evolution...... that created mutual relationship between those two substances (with immunological basis and following recuperation). The anti-inflammatory actions of PUFA-OMEGA-3 are the most visible (and significant) contrasts as compared with the large affects of namely arachidonic acid and its metabolites....

  6. Compensating amplitude-dependent tune-shift without driving fourth-order resonances

    Science.gov (United States)

    Ögren, J.; Ziemann, V.

    2017-10-01

    If octupoles are used in a ring to correct the amplitude-dependent tune-shift one normally tries to avoid that the octupoles drive additional resonances. Here we consider the optimum placement of octupoles that only affects the amplitude-dependent tune-shift, but does not drive fourth-order resonances. The simplest way turns out to place three equally powered octupoles with 60 ° phase advance between adjacent magnets. Using two such octupole triplets separated by a suitable phase advance cancels all fourth-order resonance driving terms and forms a double triplet we call a six-pack. Using three six-packs at places with different ratios of the beta functions allows to independently control all amplitude-dependent tune-shift terms without exciting additional fourth-order resonances in first order of the octupole excitation.

  7. Sensitivity of hiPSC-derived neural stem cells (NSC) to Pyrroloquinoline quinone depends on their developmental stage.

    Science.gov (United States)

    Augustyniak, J; Lenart, J; Zychowicz, M; Lipka, G; Gaj, P; Kolanowska, M; Stepien, P P; Buzanska, L

    2017-12-01

    Pyrroloquinoline quinone (PQQ) is a factor influencing on the mitochondrial biogenesis. In this study the PQQ effect on viability, total cell number, antioxidant capacity, mitochondrial biogenesis and differentiation potential was investigated in human induced Pluripotent Stem Cells (iPSC) - derived: neural stem cells (NSC), early neural progenitors (eNP) and neural progenitors (NP). Here we demonstrated that sensitivity to PQQ is dependent upon its dose and neural stage of development. Induction of the mitochondrial biogenesis by PQQ at three stages of neural differentiation was evaluated at mtDNA, mRNA and protein level. Changes in NRF1, TFAM and PPARGC1A gene expression were observed at all developmental stages, but only at eNP were correlated with the statistically significant increase in the mtDNA copy numbers and enhancement of SDHA, COX-1 protein level. Thus, the "developmental window" of eNP for PQQ-evoked mitochondrial biogenesis is proposed. This effect was independent of high antioxidant capacity of PQQ, which was confirmed in all tested cell populations, regardless of the stage of hiPSC neural differentiation. Furthermore, a strong induction of GFAP, with down regulation of MAP2 gene expression upon PQQ treatment was observed. This indicates a possibility of shifting the balance of cell differentiation in the favor of astroglia, but more research is needed at this point. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Stress Induces a Shift Towards Striatum-Dependent Stimulus-Response Learning via the Mineralocorticoid Receptor

    NARCIS (Netherlands)

    Vogel, S.; Klumpers, F.; Navarro Schröder, T.; Oplaat, K.T.; Krugers, H.J.; Oitzl, M.S.; Joëls, M.; Doeller, C.F.; Fernández, G.

    2017-01-01

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this

  9. Stress induces a shift towards striatum-dependent stimulus-response learning via the mineralocorticoid receptor

    NARCIS (Netherlands)

    Vogel, S.; Klumpers, F.; Navarro Schröder, T.; Oplaat, K.T.; Krugers, H.J.; Oitzl, M.S.; Joëls, M.; Doeller, C.F.; Fernandez, G.

    2017-01-01

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this

  10. Stress Induces a Shift Towards Striatum-Dependent Stimulus-Response Learning via the Mineralocorticoid Receptor

    NARCIS (Netherlands)

    Vogel, Susanne; Klumpers, Floris; Schroeder, Tobias Navarro; Oplaat, Krista T.; Krugers, Harm J.; Oitzl, Melly S.; Joels, Marian; Doeller, Christian F.; Fernandez, Guillen

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this

  11. Notch-dependent epithelial fold determines boundary formation between developmental fields in the Drosophila antenna.

    Science.gov (United States)

    Ku, Hui-Yu; Sun, Y Henry

    2017-07-01

    Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields.

  12. Light-regulated leaf expansion in two Populus species: dependence on developmentally controlled ion transport.

    Science.gov (United States)

    Stiles, Kari A; Van Volkenburgh, Elizabeth

    2002-07-01

    Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.

  13. Origin of the Size-Dependent Stokes Shift in CsPbBr3 Perovskite Nanocrystals.

    Science.gov (United States)

    Brennan, Michael C; Herr, John E; Nguyen-Beck, Triet S; Zinna, Jessica; Draguta, Sergiu; Rouvimov, Sergei; Parkhill, John; Kuno, Masaru

    2017-09-06

    The origin of the size-dependent Stokes shift in CsPbBr 3 nanocrystals (NCs) is explained for the first time. Stokes shifts range from 82 to 20 meV for NCs with effective edge lengths varying from ∼4 to 13 nm. We show that the Stokes shift is intrinsic to the NC electronic structure and does not arise from extrinsic effects such as residual ensemble size distributions, impurities, or solvent-related effects. The origin of the Stokes shift is elucidated via first-principles calculations. Corresponding theoretical modeling of the CsPbBr 3 NC density of states and band structure reveals the existence of an intrinsic confined hole state 260 to 70 meV above the valence band edge state for NCs with edge lengths from ∼2 to 5 nm. A size-dependent Stokes shift is therefore predicted and is in quantitative agreement with the experimental data. Comparison between bulk and NC calculations shows that the confined hole state is exclusive to NCs. At a broader level, the distinction between absorbing and emitting states in CsPbBr 3 is likely a general feature of other halide perovskite NCs and can be tuned via NC size to enhance applications involving these materials.

  14. Illuminating light-dependent color shifts in core and veneer layers of dental all-ceramics

    Science.gov (United States)

    Lee, Yong-Keun; Cha, Hyun-Suk; Yu, Bin

    2014-09-01

    The color of an object is perceived differently depending on the ambient light conditions. Since dental all-ceramic restorations are fabricated by building up several layers to reproduce the tooth shade, the optical properties of each layer should be optimized for successful shade reproduction. This study aimed to determine the separate contributions of the color shifts in each of the core and veneer layers of all-ceramics by switching the illuminating lights on the color shifts of layered ceramics. Specimens of seven kinds of core ceramics and the corresponding veneer ceramics for each core were fabricated with a layered thickness of 1.5 mm. A sintering ceramic was used as a reference core material. The Commission Internationale de l'Eclairage (CIE) color coordinates of core, veneer, and layered specimens were measured with a spectroradiometer under the CIE illuminant D65 (daylight), A (incandescent lamp), and F9 (fluorescent lamp) simulating lights. Color shifts of the layered specimens were primarily determined by the CIE a* shifts (D65 to A switch) or by the CIE b* shifts (D65 to F9 switch) of the veneer layer. The color coordinates shifts in the constituent layers differentially influenced those of the layered specimens by the kind of switched lights. Therefore, the optical properties of the constituent layers of all-ceramics should be controlled to reflect these findings.

  15. Silver Nanoparticles Incite Size and Dose-Dependent Developmental Phenotypes and Nanotoxicity in Zebrafish Embryos

    Science.gov (United States)

    Browning, Lauren M.; Lee, Kerry J.; Nallathamby, Prakash D.; Xu, Xiao-Hong Nancy

    2013-01-01

    Nanomaterials possess distinctive physicochemical properties and promise a wide range of applications, from advanced technology to leading-edge medicine. However, their effects on living organisms remain largely unknown. Here we report that the purified silver nanoparticles (Ag NPs, 97 ± 13 nm) incite specific developmental stage embryonic phenotypes and nanotoxicity in a dose-dependent manner, upon acute exposure of given-stage embryos to the NPs (0–24 pM) for only 2 h. The critical concentrations of the NPs that cause 50% of embryos develop normally for cleavage, early-gastrula, early-segmentation, late-segmentation, and hatching stage zebrafish embryos are 3.5, 4, 6, 6, and 8 pM, respectively, showing that the earlier developmental stage embryos are much more sensitive to the effects of the NPs than the later stage. Interestingly, distinctive phenotypes (head abnormality and no eyes) are observed only in cleavage and early-gastrula stage embryos treated with the NPs, showing the stage-specific effects of the NPs. By comparing with our study of the smaller Ag NPs (13.1 ± 2.5 nm), we found that the embryonic phenotypes strikingly depend upon the sizes of Ag NPs and embryonic developmental stages. These notable findings suggest that the Ag NPs are unlike any conventional chemicals or ions. They can potentially enable target specific study and therapy for early embryonic development in size, stage, dose, and exposure-duration dependent manners. PMID:24024906

  16. Silver nanoparticles incite size- and dose-dependent developmental phenotypes and nanotoxicity in zebrafish embryos.

    Science.gov (United States)

    Browning, Lauren M; Lee, Kerry J; Nallathamby, Prakash D; Xu, Xiao-Hong Nancy

    2013-10-21

    Nanomaterials possess distinctive physicochemical properties and promise a wide range of applications, from advanced technology to leading-edge medicine. However, their effects on living organisms remain largely unknown. Here we report that the purified silver nanoparticles (Ag NPs) (97 ± 13 nm) incite specific developmental stage embryonic phenotypes and nanotoxicity in a dose-dependent manner, upon acute exposure of given stage embryos to the NPs (0-24 pM) for only 2 h. The critical concentrations of the NPs that cause 50% of embryos to develop normally for cleavage, early gastrula, early segmentation, late segmentation, and hatching stage zebrafish embryos are 3.5, 4, 6, 6, and 8 pM, respectively, showing that the earlier developmental stage embryos are much more sensitive to the effects of the NPs than the later stage embryos. Interestingly, distinctive phenotypes (head abnormality and no eyes) are observed only in cleavage and early gastrula stage embryos treated with the NPs, showing the stage-specific effects of the NPs. By comparing these Ag NPs with smaller Ag NPs (13.1 ± 2.5 nm), we found that the embryonic phenotypes strikingly depend upon the sizes of Ag NPs and embryonic developmental stages. These notable findings suggest that the Ag NPs are unlike any conventional chemicals or ions. They can potentially enable target-specific study and therapy for early embryonic development in size-, stage-, dose-, and exposure duration-dependent manners.

  17. Body position-dependent shift in odor percept present only for perithreshold odors.

    Science.gov (United States)

    Lundström, Johan N; Boyle, Julie A; Jones-Gotman, Marilyn

    2008-01-01

    We recently demonstrated that a supine position causes a decrease in olfactory sensitivity compared with an upright position. We pursued that initial finding in 3 separate experiments in which we explored the extent of, and mechanism underlying, this phenomenon. In Experiment 1, we replicated the decrease in olfactory sensitivity when in a supine compared with an upright position. In Experiment 2, we measured body position-dependent shifts in physiological variables and sniff measures while smelling suprathreshold odorants and performing a perithreshold odor intensity discrimination task. Olfactory performances were reduced while supine. However, no relationships between the shift in olfactory performances and either the physiological variables or sniff measures were found. In Experiment 3, we determined that there were no position-dependent shifts in ability to discriminate or identify suprathreshold odors or rate them for pleasantness, intensity, or familiarity. However, a drop in scores was observed, and performance was slowed, on a cognitive skill while supine. These results demonstrate a body position-dependent shift in olfactory sensitivity only for perithreshold odors that appears to be mediated by cognitive rather than physiological factors. Implications for olfactory imaging studies are discussed.

  18. Magnetic configuration dependence of the shafranov shift in the Large Helical Device

    Energy Technology Data Exchange (ETDEWEB)

    Kobuchi, T; Ida, K; Yamada, H; Yokoyama, M; Watanabe, K Y; Sakakibara, S; Yoshinuma, M [National Institute for Fusion Science, 322-6 Oroshi-Cho, Toki-City, 509-5292 (Japan)

    2006-06-15

    The dependence of the Shafranov shift on magnetic field configuration, toroidicity and central rotational transform {iota}(0) in neutral beam heated plasma has been experimentally investigated in the Large Helical Device. The toroidicity of the plasma is controlled by the quadrupole field, while the central {iota}(0) is controlled by changing the distance of the current centre of the helical coil to the plasma. It is experimentally confirmed that both the lower toroidicity and the higher {iota}(0) contribute to the reduction of the Shafranov shift as predicted by the three-dimensional equilibrium code, VMEC.

  19. Chemical shift-dependent apparent scalar couplings: An alternative concept of chemical shift monitoring in multi-dimensional NMR experiments

    International Nuclear Information System (INIS)

    Kwiatkowski, Witek; Riek, Roland

    2003-01-01

    The paper presents an alternative technique for chemical shift monitoring in a multi-dimensional NMR experiment. The monitored chemical shift is coded in the line-shape of a cross-peak through an apparent residual scalar coupling active during an established evolution period or acquisition. The size of the apparent scalar coupling is manipulated with an off-resonance radio-frequency pulse in order to correlate the size of the coupling with the position of the additional chemical shift. The strength of this concept is that chemical shift information is added without an additional evolution period and accompanying polarization transfer periods. This concept was incorporated into the three-dimensional triple-resonance experiment HNCA, adding the information of 1 H α chemical shifts. The experiment is called HNCA coded HA, since the chemical shift of 1 H α is coded in the line-shape of the cross-peak along the 13 C α dimension

  20. Charge-dependent and A-dependent effects in isotope shifts of Coulomb displacement energies

    International Nuclear Information System (INIS)

    Sherr, R.

    1977-01-01

    Coulomb displacement energies in a series of isotopes generally decrease with A. This decrease can arise from an increase with A of the average distance of interaction between pairs of protons. In the shell model a decrease can also result from charge-independence-breaking effects if the neutron-proton interaction for the valence nucleons is more attractive than the neutron-neutron interaction. Using the model recently proposed by Sherr and Talmi for the 1d/sub 3/2/ shell, existing data for this shell and also the 1d/sub 5/2/ and 1f/sub 7/2/ shells were analyzed allowing all matrix elements to vary as A/sup -lambda/3/. Least squares calculations of the rms deviation sigma were carried out for varying values of lambda from -2 to +2. It was found that although there was a minimum in sigma vs lambda it was too shallow to exclude any lambda for -1 to +1 in the 1d/sub 3/2/ and 1f/sub 7/2/ shells or 0 to +1 in the 1d/sub 5/2/ shell. It is therefore not possible to distinguish between A dependence and charge dependence in this model. The magnitude of the latter as expressed in terms of (np-nn) matrix elements depends strongly on the former. As lambda increases from -1 to +1, these (np-nn) matrix elements decrease roughly linearly in absolute magnitude and eventually change sign. For lambda = 0 they have appreciable and reasonable magnitudes for the 1d/sub 3/2/ and 1f/sub 7/2/ shells but for the 1d/sub 5/2/ shell the values are too small to be considered significant

  1. Shifted dynamic interactions between subcortical nuclei and inferior frontal gyri during response preparation in persistent developmental stuttering.

    Science.gov (United States)

    Metzger, F Luise; Auer, Tibor; Helms, Gunther; Paulus, Walter; Frahm, Jens; Sommer, Martin; Neef, Nicole E

    2018-01-01

    Persistent developmental stuttering is associated with basal ganglia dysfunction or dopamine dysregulation. Here, we studied whole-brain functional connectivity to test how basal ganglia structures coordinate and reorganize sensorimotor brain networks in stuttering. To this end, adults who stutter and fluent speakers (control participants) performed a response anticipation paradigm in the MRI scanner. The preparation of a manual Go/No-Go response reliably produced activity in the basal ganglia and thalamus and particularly in the substantia nigra. Strikingly, in adults who stutter, substantia nigra activity correlated positively with stuttering severity. Furthermore, functional connectivity analyses yielded altered task-related network formations in adults who stutter compared to fluent speakers. Specifically, in adults who stutter, the globus pallidus and the thalamus showed increased network synchronization with the inferior frontal gyrus. This implies dynamic shifts in the response preparation-related network organization through the basal ganglia in the context of a non-speech motor task in stuttering. Here we discuss current findings in the traditional framework of how D1 and D2 receptor activity shapes focused movement selection, thereby suggesting a disproportional involvement of the direct and the indirect pathway in stuttering.

  2. The effect of developmental nutrition on life span and fecundity depends on the adult reproductive environment in Drosophila melanogaster

    NARCIS (Netherlands)

    May, C.M.; Doroszuk, A.; Zwaan, B.J.

    2015-01-01

    Both developmental nutrition and adult nutrition affect life-history traits; however, little is known about whether the effect of developmental nutrition depends on the adult environment experienced. We used the fruit fly to determine whether life-history traits, particularly life span and

  3. Stress Induces a Shift Towards Striatum-Dependent Stimulus-Response Learning via the Mineralocorticoid Receptor.

    Science.gov (United States)

    Vogel, Susanne; Klumpers, Floris; Schröder, Tobias Navarro; Oplaat, Krista T; Krugers, Harm J; Oitzl, Melly S; Joëls, Marian; Doeller, Christian F; Fernández, Guillén

    2017-05-01

    Stress is assumed to cause a shift from flexible 'cognitive' memory to more rigid 'habit' memory. In the spatial memory domain, stress impairs place learning depending on the hippocampus whereas stimulus-response learning based on the striatum appears to be improved. While the neural basis of this shift is still unclear, previous evidence in rodents points towards cortisol interacting with the mineralocorticoid receptor (MR) to affect amygdala functioning. The amygdala is in turn assumed to orchestrate the stress-induced shift in memory processing. However, an integrative study testing these mechanisms in humans is lacking. Therefore, we combined functional neuroimaging of a spatial memory task, stress-induction, and administration of an MR-antagonist in a full-factorial, randomized, placebo-controlled between-subjects design in 101 healthy males. We demonstrate that stress-induced increases in cortisol lead to enhanced stimulus-response learning, accompanied by increased amygdala activity and connectivity to the striatum. Importantly, this shift was prevented by an acute administration of the MR-antagonist spironolactone. Our findings support a model in which the MR and the amygdala play an important role in the stress-induced shift towards habit memory systems, revealing a fundamental mechanism of adaptively allocating neural resources that may have implications for stress-related mental disorders.

  4. Energy dependence of a local equivalent potential for RGM phase shifts for 16O + 16O

    International Nuclear Information System (INIS)

    Ait-Tahar, S.; Mackintosh, R.S.; Cooper, S.G.; Wada, T.

    1993-01-01

    We have found, using the IP inversion method, the local representation of a potential that in S(l) equivalent to the RGM nonlocal potential of Wada and Horiuchi. Phase shifts corresponding to RGM calculations at laboratory energies 30, 41, 49, 59, 150, 350 and 500 MeV were inverted and the resulting local potentials compared with the local (but l-dependent) potentials obtained previously in the WKB-RGM scheme. The present l-independent potentials exhibit a smooth radial variation and show marked differences from previous results. The energy dependence arises from that of the exchange term and from the conversion of the l-dependence into an additional energy dependence. In particular, we show that the energy dependence of the volume integrals in this energy region is different from earlier WKB-RGM predictions. (orig.)

  5. Nicotine dependence and transitional shifts in exercise behavior among young U.S. adult smokers.

    Science.gov (United States)

    Loprinzi, Paul D; Walker, Jerome F; Cardinal, Bradley J

    2014-08-01

    The aim of this study is to examine the association between nicotine dependence and longitudinal exercise transitional shift patterns among young U.S. adult daily smokers. Data from the 2003-2005 National Youth Smoking Cessation Survey was used, which is a longitudinal study over a two year period. Participants included 1168 US adult daily smokers (18-24years). Nicotine dependence was assessed using the modified Fagerstrom Test for Nicotine Dependence. Four transitional shift patterns were created based on meeting current exercise guidelines; stable inactive (inactive across time), activity relapsers (starts out active and then becomes inactive), activity adopters (inactive and then becomes active), and stable active (active across time). After adjustments, for every 1-unit increase in baseline nicotine dependence, participants had 16% (OR=1.16, p=0.01) greater odds of being in the stable inactive group compared to the stable active group. Nicotine dependence appears to play an important role in shaping longitudinal exercise patterns among young U.S. adult smokers. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Concentration and size dependence of peak wavelength shift on quantum dots in colloidal suspension

    Science.gov (United States)

    Rinehart, Benjamin S.; Cao, Caroline G. L.

    2016-08-01

    Quantum dots (QDs) are semiconductor nanocrystals that have significant advantages over organic fluorophores, including their extremely narrow Gaussian emission bands and broad absorption bands. Thus, QDs have a wide range of potential applications, such as in quantum computing, photovoltaic cells, biological sensing, and electronics. For these applications, aliasing provides a detrimental effect on signal identification efficiency. This can be avoided through characterization of the QD fluorescence signals. Characterization of the emissivity of CdTe QDs as a function of concentration (1 to 10 mg/ml aqueous) was conducted on 12 commercially available CdTe QDs (emission peaks 550 to 730 nm). The samples were excited by a 50-mW 405-nm laser with emission collected via a free-space CCD spectrometer. All QDs showed a redshift effect as concentration increased. On average, the CdTe QDs exhibited a maximum shift of +35.6 nm at 10 mg/ml and a minimum shift of +27.24 nm at 1 mg/ml, indicating a concentration dependence for shift magnitude. The concentration-dependent redshift function can be used to predict emission response as QD concentration is changed in a complex system.

  7. Methane spectral line widths and shifts, and dependences on physical parameters

    Science.gov (United States)

    Fox, K.; Quillen, D. T.; Jennings, D. E.; Wagner, J.; Plymate, C.

    1991-01-01

    A detailed report of the recent high-resolution spectroscopic research on widths and shifts measured for a strong infrared-active fundamental of methane is presented. They were measured in collision with several rare gases and diatomic molecules, in the vibrational-rotational fundamental near 3000/cm. These measurements were made at an ambient temperature of 294 K over a range of pressures from 100 to 700 torr. The measurements are discussed in a preliminary but detailed and quantitative manner with reference to masses, polarizabilities, and quadrupole moments. Some functional dependences on these physical parameters are considered. The present data are useful for studies of corresponding planetary spectra.

  8. Sex-Dependent Effects of Developmental Lead Exposure on the Brain

    Science.gov (United States)

    Singh, Garima; Singh, Vikrant; Sobolewski, Marissa; Cory-Slechta, Deborah A.; Schneider, Jay S.

    2018-01-01

    The role of sex as an effect modifier of developmental lead (Pb) exposure has until recently received little attention. Lead exposure in early life can affect brain development with persisting influences on cognitive and behavioral functioning, as well as, elevated risks for developing a variety of diseases and disorders in later life. Although both sexes are affected by Pb exposure, the incidence, manifestation, and severity of outcomes appears to differ in males and females. Results from epidemiologic and animal studies indicate significant effect modification by sex, however, the results are not consistent across studies. Unfortunately, only a limited number of human epidemiological studies have included both sexes in independent outcome analyses limiting our ability to draw definitive conclusions regarding sex-differentiated outcomes. Additionally, due to various methodological differences across studies, there is still not a good mechanistic understanding of the molecular effects of lead on the brain and the factors that influence differential responses to Pb based on sex. In this review, focused on prenatal and postnatal Pb exposures in humans and animal models, we discuss current literature supporting sex differences in outcomes in response to Pb exposure and explore some of the ideas regarding potential molecular mechanisms that may contribute to sex-related differences in outcomes from developmental Pb exposure. The sex-dependent variability in outcomes from developmental Pb exposure may arise from a combination of complex factors, including, but not limited to, intrinsic sex-specific molecular/genetic mechanisms and external risk factors including sex-specific responses to environmental stressors which may act through shared epigenetic pathways to influence the genome and behavioral output. PMID:29662502

  9. Sex-Dependent Effects of Developmental Lead Exposure on the Brain

    Directory of Open Access Journals (Sweden)

    Garima Singh

    2018-03-01

    Full Text Available The role of sex as an effect modifier of developmental lead (Pb exposure has until recently received little attention. Lead exposure in early life can affect brain development with persisting influences on cognitive and behavioral functioning, as well as, elevated risks for developing a variety of diseases and disorders in later life. Although both sexes are affected by Pb exposure, the incidence, manifestation, and severity of outcomes appears to differ in males and females. Results from epidemiologic and animal studies indicate significant effect modification by sex, however, the results are not consistent across studies. Unfortunately, only a limited number of human epidemiological studies have included both sexes in independent outcome analyses limiting our ability to draw definitive conclusions regarding sex-differentiated outcomes. Additionally, due to various methodological differences across studies, there is still not a good mechanistic understanding of the molecular effects of lead on the brain and the factors that influence differential responses to Pb based on sex. In this review, focused on prenatal and postnatal Pb exposures in humans and animal models, we discuss current literature supporting sex differences in outcomes in response to Pb exposure and explore some of the ideas regarding potential molecular mechanisms that may contribute to sex-related differences in outcomes from developmental Pb exposure. The sex-dependent variability in outcomes from developmental Pb exposure may arise from a combination of complex factors, including, but not limited to, intrinsic sex-specific molecular/genetic mechanisms and external risk factors including sex-specific responses to environmental stressors which may act through shared epigenetic pathways to influence the genome and behavioral output.

  10. Developmental plasticity of growth and digestive efficiency in dependence of early-life food availability

    Science.gov (United States)

    Kotrschal, Alexander; Szidat, Sönke; Taborsky, Barbara

    2014-01-01

    Nutrition is a potent mediator of developmental plasticity. If food is scarce, developing organisms may invest into growth to outgrow size-dependent mortality (short-term benefit) and/or into an efficient digestion system (long-term benefit). We investigated this potential trade-off, by determining the influence of food availability on juvenile body and organ growth, and on adult digestive efficiency in the cichlid fish Simochromis pleurospilus. We reared two groups of fish at constant high or low food rations, and we switched four other groups between these two rations at an early and late juvenile period. We measured juvenile growth and organ sizes at different developmental stages and determined adult digestive efficiency. Fish kept at constant, high rations grew considerably faster than low-food fish. Nevertheless, S. pleurospilus partly buffered the negative effects of low food availability by developing heavier digestive organs, and they were therefore more efficient in digesting their food as adults. Results of fish exposed to a ration switch during either the early or late juvenile period suggest (i) that the ability to show compensatory growth after early exposure to low food availability persists during the juvenile period, (ii) that digestive efficiency is influenced by varying juvenile food availability during the late juvenile phase and (iii) that the efficiency of the adult digestive system is correlated with the growth rate during a narrow time window of juvenile period. PMID:25866430

  11. Developmental pathways from child maltreatment to adolescent marijuana dependence: Examining moderation by FKBP5

    Science.gov (United States)

    Handley, Elizabeth D.; Rogosch, Fred A.; Cicchetti, Dante

    2015-01-01

    The current study examined the prospective association between child maltreatment and the development of substance use disorder (SUD) in adolescence with the aim of investigating pathways underlying this relation, as well as genetic moderation of these developmental mechanisms. Specifically, we tested whether youth who experienced maltreatment prior to age 8 were at risk for the development of marijuana dependence in adolescence by way of a childhood externalizing pathway and a childhood internalizing pathway. Moreover, we tested whether variation in FKBP5 CATT haplotype moderated these pathways. The participants were 326 children (n=179 maltreated; n=147 nonmaltreated) assessed across two waves of data collection (childhood: ages 7–9 and adolescence: ages 15–18). Results indicated that higher levels of child externalizing symptoms significantly mediated the effect of child maltreatment on adolescent marijuana dependence symptoms for individuals with 1–2 copies of the FKBP5 CATT haplotype only. We did not find support for an internalizing pathway from child maltreatment to adolescent marijuana dependence, nor did we find evidence of moderation of the internalizing pathway by FKBP5 haplotype variation. Findings extend previous research by demonstrating that whether a maltreated child will traverse an externalizing pathway toward SUD in adolescence is dependent on FKBP5 genetic variation. PMID:26535939

  12. Buckling-dependent switching behaviours in shifted bilayer germanene nanoribbons: A computational study

    Science.gov (United States)

    Arjmand, T.; Tagani, M. Bagheri; Soleimani, H. Rahimpour

    2018-01-01

    Bilayer germanene nanoribbons are investigated in different stacks like buckled and flat armchair and buckled zigzag germanene nanoribbons by performing theoretical calculations using the nonequilibrium Greens function method combined with density functional theory. In these bilayer types, the current oscillates with change of interlayer distances or intra-layer overlaps and is dependent on the type of the bilayer. Band gap of AA-stacked of shifted flat bilayer armchair germanene nanoribbon oscillates by change of interlayer distance which is in contrast to buckled bilayer armchair germanene nanoribbon. So, results show the buckling makes system tend to be a semiconductor with wide band gap. Therefore, AA-stacked of shifted flat bilayer armchair germanene nanoribbon has properties between zigzag and armchair edges, the higher current under bias voltages similar to zigzag edge and also oscillations in current like buckled armchair edges. Also, it is found that HOMO-LUMO band gap strongly affects oscillation in currents and their I-V characteristic. This kind of junction improves the switching properties at low voltages around the band gap.

  13. Guanfacine enhances inhibitory control and attentional shifting in early abstinent cocaine-dependent individuals.

    Science.gov (United States)

    Fox, Helen; Sofuoglu, Mehmet; Sinha, Rajita

    2015-03-01

    Attenuation of adrenergic drive and cognitive enhancement, via stimulation of alpha2 pre- and post-synaptic receptors, may selectively enhance executive performance in early abstinent cocaine-dependent individuals. As these cognitive processes underpin important treatment-related behaviors, the alpha2 agonist, guanfacine HCl, may represent an effective pharmaco-therapeutic intervention. Twenty-five early abstinent cocaine-dependent individuals were administered a battery of neurocognitive tasks on entry into treatment (baseline) and again following 3 weeks of either placebo or guanfacine treatment (up to 3 mg). Tasks included: Stop Signal, Stroop, 3-Dimentional Intra-dimensional/Extra-dimensional (IDED) task, Spatial Working Memory (SWM), Paired Associates Learning (PAL), Verbal Fluency and the Rey Auditory Verbal Learning Test (RAVLT). Compared with placebo, the guanfacine group demonstrated attenuated anxiety and negative affect as well as improved performance on selective executive tests. This included fewer directional errors on the stop signal task, fewer errors on the extra-dimensional shift component of the IDED task and better attentional switching during verbal fluency. Guanfacine did not improve strategic working memory or peripheral memory. Guanfacine improves selective cognitive processes which may underlie salient treatment-related regulatory behaviors. Alpha2 agonists may therefore represent important agents for cocaine dependence. © The Author(s) 2015.

  14. Spin-dependent Goos–Hänchen shift and spin beam splitter in gate-controllable ferromagnetic graphene

    International Nuclear Information System (INIS)

    Wang, Y.; Liu, Y.; Wang, B.

    2014-01-01

    The transmission and Goos–Hänchen (GH) shift for charge carriers in gate-controllable ferromagnetic graphene induced by ferromagnetic insulator are investigated theoretically. Numerical results demonstrate that spin-up and spin-down electrons exhibit remarkably different transmission and GH shifts. The spin-dependent GH shifts directly demonstrate the spin beam splitting effect, which can be controlled by the voltage of gate. We attribute the spin beam splitting effect to the combination of tunneling through potential barrier and Zeeman interaction from the magnetic field and the exchange proximity interaction between the ferromagnetic insulator and graphene. In view of the spin beam splitting effect and the spin-dependent GH shifts, the gate-controllable ferromagnetic graphene might be utilized to design spin beam splitter

  15. Spin-dependent Goos–Hänchen shift and spin beam splitter in gate-controllable ferromagnetic graphene

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Y. [School of Physics and Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Liu, Y., E-mail: stslyl@mail.sysu.edu.cn [School of Engineering, Sun Yat-sen University, Guangzhou 510275 (China); Wang, B., E-mail: wangbiao@mail.sysu.edu.cn [School of Physics and Engineering, Sun Yat-sen University, Guangzhou 510275 (China)

    2014-03-15

    The transmission and Goos–Hänchen (GH) shift for charge carriers in gate-controllable ferromagnetic graphene induced by ferromagnetic insulator are investigated theoretically. Numerical results demonstrate that spin-up and spin-down electrons exhibit remarkably different transmission and GH shifts. The spin-dependent GH shifts directly demonstrate the spin beam splitting effect, which can be controlled by the voltage of gate. We attribute the spin beam splitting effect to the combination of tunneling through potential barrier and Zeeman interaction from the magnetic field and the exchange proximity interaction between the ferromagnetic insulator and graphene. In view of the spin beam splitting effect and the spin-dependent GH shifts, the gate-controllable ferromagnetic graphene might be utilized to design spin beam splitter.

  16. Violent Victimization and Perpetration during Adolescence: Developmental Stage Dependent Ecological Models

    Science.gov (United States)

    Matjasko, Jennifer L.; Needham, Belinda L.; Grunden, Leslie N.; Farb, Amy Feldman

    2010-01-01

    Using a variant of the ecological-transactional model and developmental theories of delinquency on a nationally representative sample of adolescents, the current study explored the ecological predictors of violent victimization, perpetration, and both for three different developmental stages during adolescence. We examined the relative influence…

  17. Orientation-dependent surface core-level shifts and chemical shifts on clean and H 2S-covered GaAs

    Science.gov (United States)

    Ranke, W.; Finster, J.; Kuhr, H. J.

    1987-08-01

    Photoelectron spectra of the As 3d and Ga 3d core levels were studied in situ on a cylindrically shaped GaAs single crystal for the six inequivalent orientations (001), (113), (111), (110), (11¯1) and (11¯3). On the clean surface, prepared by molecular beam epitaxy (MBE), surface core levels are shifted by 0.25 to 0.55 eV towards smaller binding energy (BE) for As 3d and -0.25 to -0.35 eV towards higher BE for Ga, depending on orientation. Additional As causes As 3d contributions shifted between -0.45 and -0.7 eV towards higher BE. The position and intensity of them is influenced by H 2S adsorption. At 150 K, H 2S adsorbs preferentially on As sites. As chemical shifts appear at -0.6 to -0.9 eV towards higher BE. Simultaneously, As accumulation occurs on all orientations with the exception of (110). High temperature adsorption (550 K, 720 K) influences mainly the Ga 3d peaks. Two peaks shifted by about -0.45 and -0.8 eV towards higher Be were found which are attributed to Ga atoms with one or two sulfur ligands, respectively. At 720 K, also As depletion is observed. The compatibility of surface core-level positions and intensities with recent structural models for the (111) and (11¯1) surfaces is discussed.

  18. Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage.

    Directory of Open Access Journals (Sweden)

    Fatma Kaplan

    2011-03-01

    Full Text Available The ascarosides form a family of small molecules that have been isolated from cultures of the nematode Caenorhabditis elegans. They are often referred to as "dauer pheromones" because most of them induce formation of long-lived and highly stress resistant dauer larvae. More recent studies have shown that ascarosides serve additional functions as social signals and mating pheromones. Thus, ascarosides have multiple functions. Until now, it has been generally assumed that ascarosides are constitutively expressed during nematode development.Cultures of C. elegans were developmentally synchronized on controlled diets. Ascarosides released into the media, as well as stored internally, were quantified by LC/MS. We found that ascaroside biosynthesis and release were strongly dependent on developmental stage and diet. The male attracting pheromone was verified to be a blend of at least four ascarosides, and peak production of the two most potent mating pheromone components, ascr#3 and asc#8 immediately preceded or coincided with the temporal window for mating. The concentration of ascr#2 increased under starvation conditions and peaked during dauer formation, strongly supporting ascr#2 as the main population density signal (dauer pheromone. After dauer formation, ascaroside production largely ceased and dauer larvae did not release any ascarosides. These findings show that both total ascaroside production and the relative proportions of individual ascarosides strongly correlate with these compounds' stage-specific biological functions.Ascaroside expression changes with development and environmental conditions. This is consistent with multiple functions of these signaling molecules. Knowledge of such differential regulation will make it possible to associate ascaroside production to gene expression profiles (transcript, protein or enzyme activity and help to determine genetic pathways that control ascaroside biosynthesis. In conjunction with findings

  19. Emotional bias of sleep-dependent processing shifts from negative to positive with aging.

    Science.gov (United States)

    Jones, Bethany J; Schultz, Kurt S; Adams, Sydney; Baran, Bengi; Spencer, Rebecca M C

    2016-09-01

    Age-related memory decline has been proposed to result partially from impairments in memory consolidation over sleep. However, such decline may reflect a shift toward selective processing of positive information with age rather than impaired sleep-related mechanisms. In the present study, young and older adults viewed negative and neutral pictures or positive and neutral pictures and underwent a recognition test after sleep or wake. Subjective emotional reactivity and affect were also measured. Compared with waking, sleep preserved valence ratings and memory for positive but not negative pictures in older adults and negative but not positive pictures in young adults. In older adults, memory for positive pictures was associated with slow wave sleep. Furthermore, slow wave sleep predicted positive affect in older adults but was inversely related to positive affect in young adults. These relationships were strongest for older adults with high memory for positive pictures and young adults with high memory for negative pictures. Collectively, these results indicate preserved but selective sleep-dependent memory processing with healthy aging that may be biased to enhance emotional well-being. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Parental care masks a density-dependent shift from cooperation to competition among burying beetle larvae.

    Science.gov (United States)

    Schrader, Matthew; Jarrett, Benjamin J M; Kilner, Rebecca M

    2015-04-01

    Studies of siblings have focused mainly on their competitive interactions and to a lesser extent on their cooperation. However, competition and cooperation are at opposite ends on a continuum of possible interactions and the nature of these interactions may be flexible with ecological factors tipping the balance toward competition in some environments and cooperation in others. Here we show that the presence of parental care and the density of larvae on the breeding carcass change the outcome of sibling interactions in burying beetle broods. With full parental care there was a strong negative relationship between larval density and larval mass, consistent with sibling competition for resources. In the absence of care, initial increases in larval density had beneficial effects on larval mass but further increases in larval density reduced larval mass. This likely reflects a density-dependent shift between cooperation and competition. In a second experiment, we manipulated larval density and removed parental care. We found that the ability of larvae to penetrate the breeding carcass increased with larval density and that feeding within the carcass resulted in heavier larvae than feeding outside the carcass. However, larval density did not influence carcass decay. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  1. Multiplicity dependence of matrix-induced frequency shifts for atomic transitions of the group 12 metals in rare gas solids

    International Nuclear Information System (INIS)

    Laursen, S.L.; Cartland, H.E.

    1991-01-01

    Atomic resonances of the group 12 metal atoms, Hg, Cd, and Zn, undergo frequency shifts from the gas phase atomic line when trapped in rare gas matrices of Ar, Kr, and Xe at 12 K. As expected, the shifts are approximately linear in polarizability of the rare gas, but the slope of this line depends on whether the transition in question is 1 P 1 left-arrow 1 S 0 or 3 P 1 left-arrow 1 S 0 . Thus the matrix-induced frequency shift is dependent on the singlet or triplet nature of the excited state as well as on the matrix material. This dependence on multiplicity is discussed in terms of interactions between the excited-state atomic orbitals and the matrix. The results are compared to matrix studies of other metals and to related gas-phase work on diatomic van der Waals complexes of group 12 metals with rare gases

  2. Rationalization of Anomalous Pseudocontact Shifts and Their Solvent Dependence in a Series of C3-Symmetric Lanthanide Complexes.

    Science.gov (United States)

    Vonci, Michele; Mason, Kevin; Suturina, Elizaveta A; Frawley, Andrew T; Worswick, Steven G; Kuprov, Ilya; Parker, David; McInnes, Eric J L; Chilton, Nicholas F

    2017-10-11

    Bleaney's long-standing theory of magnetic anisotropy has been employed with some success for many decades to explain paramagnetic NMR pseudocontact shifts, and has been the subject of many subsequent approximations. Here, we present a detailed experimental and theoretical investigation accounting for the anomalous solvent dependence of NMR shifts for a series of lanthanide(III) complexes, namely [LnL 1 ] (Ln = Eu, Tb, Dy, Ho, Er, Tm, and Yb; L 1 : 1,4,7-tris[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane), taking into account the effect of subtle ligand flexibility on the electronic structure. We show that the anisotropy of the room temperature magnetic susceptibility tensor, which in turn affects the sign and magnitude of the pseudocontact chemical shift, is extremely sensitive to minimal structural changes in the first coordination sphere of L 1 . We show that DFT structural optimizations do not give accurate structural models, as assessed by the experimental chemical shifts, and thus we determine a magnetostructural correlation and employ this to evaluate the accurate solution structure for each [LnL 1 ]. This approach allows us to explain the counterintuitive pseudocontact shift behavior, as well as a striking solvent dependence. These results have important consequences for the analysis and design of novel magnetic resonance shift and optical emission probes that are sensitive to the local solution environment and polarity.

  3. Highly precise and developmentally programmed genome assembly in Paramecium requires ligase IV-dependent end joining.

    Directory of Open Access Journals (Sweden)

    Aurélie Kapusta

    2011-04-01

    Full Text Available During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs, each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs, which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ, are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new

  4. Highly precise and developmentally programmed genome assembly in Paramecium requires ligase IV-dependent end joining.

    Science.gov (United States)

    Kapusta, Aurélie; Matsuda, Atsushi; Marmignon, Antoine; Ku, Michael; Silve, Aude; Meyer, Eric; Forney, James D; Malinsky, Sophie; Bétermier, Mireille

    2011-04-01

    During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs), each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs), which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ), are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new mechanisms

  5. Molecular mechanisms of temperature-dependent sex determination in the context of ecological developmental biology.

    Science.gov (United States)

    Matsumoto, Yuiko; Crews, David

    2012-05-06

    Temperature-dependent sex determination (TSD) is a prime example of phenotypic plasticity in that gonadal sex is determined by the temperature of the incubating egg. In the red-eared slider turtle (Trachemys scripta), the effect of temperature can be overridden by exogenous ligands, i.e., sex steroid hormones and steroid metabolism enzyme inhibitors, during the temperature-sensitive period (TSP) of development. Precisely how the physical signal of temperature is transduced into a biological signal that ultimately results in sex determination remains unknown. In this review, we discuss the sex determining pathway underlying TSD by focusing on two candidate sex determining genes, Forkhead box protein L2 (FoxL2) and Doublesex mab3- related transcription factor 1 (Dmrt1). They appear to be involved in transducing the environmental temperature signal into a biological signal that subsequently determines gonadal sex. FoxL2 and Dmrt1 exhibit gonad-typical patterns of expression in response to temperature during the TSP in the red-eared slider turtle. Further, the biologically active ligands regulate the expression of FoxL2 and Dmrt1 during development to modify gonad trajectory. The precise regulatory mechanisms of expression of these genes by temperature or exogenous ligands are not clear. However, the environment often influences developmental gene expression by altering the epigenetic status in regulatory regions. Here, we will discuss if the regulation of FoxL2 and Dmrt1 expression by environment is mediated through epigenetic mechanisms during development in species with TSD. Published by Elsevier Ireland Ltd.

  6. Fluorescence spectral shift of QD films with electron injection: Dependence on counterion proximity

    Science.gov (United States)

    Lu, Meilin; Li, Bo; Zhang, Yaxin; Liu, Weilong; Yang, Yanqiang; Wang, Yuxiao; Yang, Qingxin

    2017-05-01

    Due to the promising application of quantum dot (QD) films in solar cells, LEDs and environmental detectors, the fluorescence of charged QD films has achieved much attention during recent years. In this work, we observe the spectral shift of photoluminescence (PL) in charged CdSe/ZnS QD films controlled by electrochemical potential. The spectral center under negative bias changes from red-shift to blue-shift while introducing smaller inorganic counterions (potassium ions) into the electrolyte. This repeatable effect is attributed to the enhanced electron injection with smaller cations and the electronic perturbations of QD luminescence by these excess charges.

  7. A model-dependent approach to the non-relativistic Lamb shift

    Science.gov (United States)

    Diaz-Valdes, J. F.; Bruce, S. A.

    2018-02-01

    The precise observation of the Lamb shift, between the 2s_{1/2} and 2p_{1/2} levels in hydrogen, was a genuine motivation for the development of modern quantum electrodynamics. According to Dirac theory, the 2s_{1/2} and 2p_{1/2} levels should have equal energies. However, "radiative corrections" due to the interaction between the atomic electron and the vacuum, shift the 2s_{1/2} level higher in energy by around 4.37493× 10^{-6} eV or 2π\\hbar× 1057.85 MHz relative to the 2p_{1/2} level. The measurement of Lamb and Retherford provided the stimulus for renormalization theory which has been so successful in handling troublesome divergences. The Lamb shift is still a central theme in atomic physics. W.E. Lamb was the first to see that this tiny shift, so elusive and hard to measure, would clarify in a fundamental way our thinking about particles and fields. In this article, the Lamb shift for the 2 s energy level in hydrogen is assessed for three different electron models by using the variational principle. It is then verified that this shift arises mostly from the interaction of a bound electron with the zero-point fluctuations of the free electromagnetic field (Welton's interpretation). We briefly comment on the construct validity of the proposed electron models.

  8. A transactional framework for pediatric rehabilitation: shifting the focus to situated contexts, transactional processes, and adaptive developmental outcomes.

    Science.gov (United States)

    King, Gillian; Imms, Christine; Stewart, Debra; Freeman, Matt; Nguyen, Tram

    2018-07-01

    A paradigm shift is taking place in pediatric rehabilitation research, practice, and policy - a shift towards the real-life contexts of clients rather than requiring clients to navigate the world of pediatric rehabilitation. This article proposes a conceptual framework to bring about a broader awareness of clients' lives and transactional processes of change over the life course. The framework draws attention to transactional processes by which individuals, situated in life contexts, change and adapt over the life course and, in turn, influence their contextual settings and broader environments. This framework is based on (a) basic tenets derived from foundational theories taking a life course perspective to change, and (b) transactional processes identified from relevant pediatric rehabilitation models that bring these foundational theories into the pediatric rehabilitation sphere. The framework identifies three types of transactional processes relevant to pediatric rehabilitation: facilitative, resiliency, and socialization processes. These processes describe how contexts and people mutually influence each other via opportunities and situated experiences, thus facilitating capacity, adaptation to adversity, and socialization to new roles and life transitions. The utility of the framework is considered for research, practice, service organizations, and policy. Implications for Rehabilitation The framework supports practitioners going beyond person and environment as separate entities, to provide services to the "situated person" in real-life contexts The framework shifts the focus from "body structures/functions" and "person in activity" to "person in changing and challenging life contexts" Working from a transactional perspective, practitioner-client conversations will change; practitioners will view client situations through a lens of opportunities and experiences, assess client experiences in real-life contexts, and strive to create context-based therapy

  9. Smoking addiction: the shift from head to hands: Approach bias towards smoking-related cues in low-dependent versus dependent smokers.

    Science.gov (United States)

    Detandt, Sandrine; Bazan, Ariane; Quertemont, Etienne; Verbanck, Paul

    2017-07-01

    The dual process theory is central to several models of addiction, implying both an increase of stimulus salience and deficits in inhibitory control. Our major aim is to provide behavioral evidence for an approach bias tendency in smokers and more specifically during smoking cue exposure. The second aim is to examine whether this bias differs in low-dependent versus dependent smokers. Thirty-two smokers (17 low dependent and 15 dependent; cut-off FTND of 4) and 28 non-smokers performed a modified Go/NoGo task using tobacco-related words and neutral words as stimuli. Smokers generally made more mistakes and tended to be faster for smoking-related cues specifically. Low dependents acknowledged more their dependency in declarative questionnaires while making more errors and being slower specifically on smoking cues; dependent smokers were less prone to indicate their addiction, but were faster and accurate when it came to picking the smoking cues. These results suggest that a shift has operated from a mental preoccupation with smoking in the low-dependent group, to smoking as a motor habit in our dependent group. This finding invites experts to rethink smoking addiction in the light of this crucial moment, namely, the shift "from head to hands".

  10. Frequency dependence of p-mode frequency shifts induced by magnetic activity in Kepler solar-like stars

    Science.gov (United States)

    Salabert, D.; Régulo, C.; Pérez Hernández, F.; García, R. A.

    2018-04-01

    The variations of the frequencies of the low-degree acoustic oscillations in the Sun induced by magnetic activity show a dependence on radial order. The frequency shifts are observed to increase towards higher-order modes to reach a maximum of about 0.8 μHz over the 11-yr solar cycle. A comparable frequency dependence is also measured in two other main sequence solar-like stars, the F-star HD 49933, and the young 1 Gyr-old solar analog KIC 10644253, although with different amplitudes of the shifts of about 2 μHz and 0.5 μHz, respectively. Our objective here is to extend this analysis to stars with different masses, metallicities, and evolutionary stages. From an initial set of 87 Kepler solar-like oscillating stars with known individual p-mode frequencies, we identify five stars showing frequency shifts that can be considered reliable using selection criteria based on Monte Carlo simulations and on the photospheric magnetic activity proxy Sph. The frequency dependence of the frequency shifts of four of these stars could be measured for the l = 0 and l = 1 modes individually. Given the quality of the data, the results could indicate that a physical source of perturbation different from that in the Sun is dominating in this sample of solar-like stars.

  11. A study of the angular momentum dependence of the phase shift for finite range and Coulomb potentials

    International Nuclear Information System (INIS)

    Valluri, S.R.; Romo, W.J.

    1989-01-01

    The dependence of the phase shift δ l (k) on the angular momentum l is investigated. An analytic expression for the derivative of the phase shift with respect to angular momentum is derived for a class of potentials that includes complex and real potentials. The potentials behave like the finite range potential for small r and like a Coulomb potential for large r. Specific examples like the square well, the pure point charge Coulomb and a combination of a square well and the Coulomb potential are analytically treated. Possible applications are briefly indicated. (orig.)

  12. Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.

    Science.gov (United States)

    Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter

    2016-06-30

    Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage

  13. Hue shifts produced by temporal asymmetries in chromatic signals depend on the alignment of the first and second harmonics.

    Science.gov (United States)

    Stockman, Andrew; Henning, G Bruce; West, Peter; Rider, Andrew T; Ripamonti, Caterina

    2017-08-01

    When M- or L-cone-isolating sawtooth waveforms flicker at frequencies between 4 and 13.3 Hz, there is a mean hue shift in the direction of the shallower sawtooth slope. Here, we investigate how this shift depends on the alignment of the first and second harmonics of sawtooth-like waveforms. Below 4 Hz, observers can follow hue variations caused by both harmonics, and reliably match reddish and greenish excursions. At higher frequencies, however, the hue variations appear as chromatic flicker superimposed on a steady light, the mean hue of which varies with second-harmonic alignment. Observers can match this mean hue against a variable-duty-cycle rectangular waveform and, separately, set the alignment at which the mean hue flips between reddish and greenish. The maximum hue shifts were approximately frequency independent and occurred when the peaks or troughs of the first and second harmonics roughly aligned at the visual input-consistent with the hue shift's being caused by an early instantaneous nonlinearity that saturates larger hue excursions. These predictions, however, ignore phase delays introduced within the chromatic pathway between its input and the nonlinearity that produces the hue shifts. If the nonlinearity follows the substantial filtering implied by the chromatic temporal contrast-sensitivity function, phase delays will alter the alignment of the first and second harmonics such that at the nonlinearity, the waveforms that produce the maximum hue shifts might well be those with the largest differences in rising and falling slopes-consistent with the hue shift's being caused by a central nonlinearity that limits the rate of hue change.

  14. Red-Shift Effects in Surface Enhanced Raman Spectroscopy: Spectral or Intensity Dependence of the Near-Field?

    KAUST Repository

    Colas, Florent; Cottat, Maximilien; Gillibert, Raymond; Guillot, Nicolas; Djaker, Nadia; Lidgi-Guigui, Nathalie; Toury, Timothé e; Barchiesi, Dominique; Toma, Andrea; Di Fabrizio, Enzo M.; Gucciardi, Pietro Giuseppe; de la Chapelle, Marc Lamy

    2016-01-01

    Optimum amplification in Surface Enhanced Raman Scattering (SERS) from individual nanoantennas is expected when the excitation is slightly blue-shifted with respect to the Localized Surface Plasmon Resonance (LSPR), so that the LSPR peak falls in the middle between the laser and the Stokes Raman emission. Recent experiments have shown when moving the excitation from the visible to the near-infrared that this rule of thumb is no more valid. The excitation has to be red-shifted with respect to the LSPR peak, up to 80nm, to obtain highest SERS. Such discrepancy is usually attributed to a Near-Field (NF) to Far-Field (FF) spectral shift. Here we critically discuss this hypothesis for the case of gold nanocylinders. By combining multi-wavelength excitation SERS experiments with numerical calculations, we show that the red-shift of the excitation energy does not originate from a spectral shift between the extinction (FF) and the near-field distribution (NF), which is found to be not larger than 10nm. Rather, it can be accounted for by looking at the peculiar spectral dependence of the near-field intensity on the cylinders diameter, characterized by an initial increase, up to 180nm diameter, followed by a decrease and a pronounced skewness.

  15. Red-Shift Effects in Surface Enhanced Raman Spectroscopy: Spectral or Intensity Dependence of the Near-Field?

    KAUST Repository

    Colas, Florent

    2016-06-06

    Optimum amplification in Surface Enhanced Raman Scattering (SERS) from individual nanoantennas is expected when the excitation is slightly blue-shifted with respect to the Localized Surface Plasmon Resonance (LSPR), so that the LSPR peak falls in the middle between the laser and the Stokes Raman emission. Recent experiments have shown when moving the excitation from the visible to the near-infrared that this rule of thumb is no more valid. The excitation has to be red-shifted with respect to the LSPR peak, up to 80nm, to obtain highest SERS. Such discrepancy is usually attributed to a Near-Field (NF) to Far-Field (FF) spectral shift. Here we critically discuss this hypothesis for the case of gold nanocylinders. By combining multi-wavelength excitation SERS experiments with numerical calculations, we show that the red-shift of the excitation energy does not originate from a spectral shift between the extinction (FF) and the near-field distribution (NF), which is found to be not larger than 10nm. Rather, it can be accounted for by looking at the peculiar spectral dependence of the near-field intensity on the cylinders diameter, characterized by an initial increase, up to 180nm diameter, followed by a decrease and a pronounced skewness.

  16. Pressure dependence of side chain 13C chemical shifts in model peptides Ac-Gly-Gly-Xxx-Ala-NH2.

    Science.gov (United States)

    Beck Erlach, Markus; Koehler, Joerg; Crusca, Edson; Munte, Claudia E; Kainosho, Masatsune; Kremer, Werner; Kalbitzer, Hans Robert

    2017-10-01

    For evaluating the pressure responses of folded as well as intrinsically unfolded proteins detectable by NMR spectroscopy the availability of data from well-defined model systems is indispensable. In this work we report the pressure dependence of 13 C chemical shifts of the side chain atoms in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH 2 (Xxx, one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of a number of nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The size of the polynomial pressure coefficients B 1 and B 2 is dependent on the type of atom and amino acid studied. For H N , N and C α the first order pressure coefficient B 1 is also correlated to the chemical shift at atmospheric pressure. The first and second order pressure coefficients of a given type of carbon atom show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure also are weakly correlated. The downfield shifts of the methyl resonances suggest that gauche conformers of the side chains are not preferred with pressure. The valine and leucine methyl groups in the model peptides were assigned using stereospecifically 13 C enriched amino acids with the pro-R carbons downfield shifted relative to the pro-S carbons.

  17. K-Cl Cotransporter 2-mediated Cl- Extrusion Determines Developmental Stage-dependent Impact of Propofol Anesthesia on Dendritic Spines.

    Science.gov (United States)

    Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia-Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo

    2017-05-01

    General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABAA)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABAA)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. The KCC2-dependent developmental increase in the efficacy of GABAA-mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

  18. Role of excited state solvent fluctuations on time-dependent fluorescence Stokes shift

    Energy Technology Data Exchange (ETDEWEB)

    Li, Tanping, E-mail: tanping@lsu.edu, E-mail: revatik@lsu.edu; Kumar, Revati, E-mail: tanping@lsu.edu, E-mail: revatik@lsu.edu [Department of Chemistry, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)

    2015-11-07

    We explore the connection between the solvation dynamics of a chromophore upon photon excitation and equilibrium fluctuations of the solvent. Using molecular dynamics simulations, fluorescence Stokes shift for the tryptophan in Staphylococcus nuclease was examined using both nonequilibrium calculations and linear response theory. When the perturbed and unperturbed surfaces exhibit different solvent equilibrium fluctuations, the linear response approach on the former surface shows agreement with the nonequilibrium process. This agreement is excellent when the perturbed surface exhibits Gaussian statistics and qualitative in the case of an isomerization induced non-Gaussian statistics. However, the linear response theory on the unperturbed surface breaks down even in the presence of Gaussian fluctuations. Experiments also provide evidence of the connection between the excited state solvent fluctuations and the total fluorescence shift. These observations indicate that the equilibrium statistics on the excited state surface characterize the relaxation dynamics of the fluorescence Stokes shift. Our studies specifically analyze the Gaussian fluctuations of the solvent in the complex protein environment and further confirm the role of solvent fluctuations on the excited state surface. The results are consistent with previous investigations, found in the literature, of solutes dissolved in liquids.

  19. Shifting paradigm of maternal and perinatal death review system in Bangladesh: A real time approach to address sustainable developmental goal 3 by 2030 [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Animesh Biswas

    2017-07-01

    Full Text Available Recently, Bangladesh has made remarkable progress in reducing maternal and neonatal morality, even though the millennium developmental goal to reduce maternal and neonatal mortality was not achieved. Sustainable Developmental Goal (SDG 3 has already been set for a new target to reduce maternal and neonatal deaths by 2030. The country takes this timely initiative to introduce a maternal and perinatal death review system. This review will discuss the shifting paradigm of the maternal and perinatal death review system in Bangladesh and its challenges in reaching the SDG on time. This review uses existing literature on the maternal and perinatal death review system in Bangladesh, and other systems in similar settings, as well as reports, case studies, news, government letters and meeting minutes. Bangladesh introduced the maternal and perinatal death review system in 2010. Prior to this there was no such comprehensive death review system practiced in Bangladesh. The system was established within the government health system and has brought about positive effects and outcomes. Therefore, the Ministry of Health and Family Welfare of Bangladesh gradually scaled up the maternal and perinatal death review system nationwide in 2016 within the government health system. The present death review system highlighted real-time data use, using the district health information software(DHIS-2. Health mangers are able to take remedial action plans and implement strategies based on findings in DHIS-2. Therefore, effective utilization of data can play a pivotal role in the reduction of maternal and perinatal deaths in Bangladesh. Overall, the maternal and perinatal death review system provides a great opportunity to achieve the SDG 3 on time. However, the system needs continuous monitoring at different levels to ensure its quality and validity of information, as well as effective utilization of findings for planning and implementation under a measureable

  20. Size-Dependent Shifts of Plasmon Resonance in Silver Nanoparticle Films Using Controlled Dissolution

    DEFF Research Database (Denmark)

    Mogensen, Klaus Bo; Kneipp, Katrin

    2014-01-01

    to a transition from an extrinsic regime for the larger particles, where shifts of the plasmon frequency are related to changes in the dielectric environment, while the dielectric function of the metal is constant, to an intrinsic regime for the smaller particles. For this intrinsic regime, operative for small...... in a corrected electron density. The reported results have potential for developing nanosensors based on small nanoparticles below 5 nm in size by using their intrinsic response to adsorbed analytes. This detection scheme suggests a potential increase in the sensitivity of up to 3×, particularly when redox...

  1. Determination of hydration numbers of electrolytes from temperature dependence of PMR chemical shifts

    International Nuclear Information System (INIS)

    Subramanian, N.

    1979-01-01

    The method proposed by Malinowski et al. for the determination of effective hydration numbers (h) of electrolytes leads to a consistent incrrease in the observed values of 'h' with increase in solution concentration. An attempt is made to rationalize the experimental results by cosidering the simultaneous effects of temperature and concentration on the proton chemical shift. It is suggested that Malinowski's technique might yeld 'h' values very close to the true value for those ions for which there is a fortuitous cancellation of structure-making and structure-breaking properties. (Author) [pt

  2. Effect of temperature-dependent energy-level shifts on a semiconductor's Peltier heat

    International Nuclear Information System (INIS)

    Emin, D.

    1984-01-01

    The Peltier heat of a charge carrier in a semiconductor is calculated for the situation in which the electronic energy levels are temperature dependent. The temperature dependences of the electronic energy levels, generally observed optically, arise from their dependences on the vibrational energy of the lattice (e.g., as caused by thermal expansion). It has been suggested that these temperature dependences will typically have a major effect on the Peltier heat. The Peltier heat associated with a given energy level is a thermodynamic quantity; it is the product of the temperature and the change of the entropy of the system when a carrier is added in that level. As such, the energy levels cannot be treated as explicitly temperature dependent. The electron-lattice interaction causing the temperature dependence must be expressly considered. It is found that the carrier's interaction with the atomic vibrations lowers its electronic energy. However, the interaction of the carrier with the atomic vibrations also causes an infinitesimal lowering (approx.1/N) of each of the N vibrational frequencies. As a result, there is a finite carrier-induced increase in the average vibrational energy. Above the Debye temperature, this cancels the lowering of the carrier's electronic energy. Thus, the standard Peltier-heat formula, whose derivation generally ignores the temperature dependence of the electronic energy levels, is regained. This explains the apparent success of the standard formula in numerous analyses of electronic transport experiments

  3. Error-dependent modulation of speech-induced auditory suppression for pitch-shifted voice feedback

    Directory of Open Access Journals (Sweden)

    Larson Charles R

    2011-06-01

    Full Text Available Abstract Background The motor-driven predictions about expected sensory feedback (efference copies have been proposed to play an important role in recognition of sensory consequences of self-produced motor actions. In the auditory system, this effect was suggested to result in suppression of sensory neural responses to self-produced voices that are predicted by the efference copies during vocal production in comparison with passive listening to the playback of the identical self-vocalizations. In the present study, event-related potentials (ERPs were recorded in response to upward pitch shift stimuli (PSS with five different magnitudes (0, +50, +100, +200 and +400 cents at voice onset during active vocal production and passive listening to the playback. Results Results indicated that the suppression of the N1 component during vocal production was largest for unaltered voice feedback (PSS: 0 cents, became smaller as the magnitude of PSS increased to 200 cents, and was almost completely eliminated in response to 400 cents stimuli. Conclusions Findings of the present study suggest that the brain utilizes the motor predictions (efference copies to determine the source of incoming stimuli and maximally suppresses the auditory responses to unaltered feedback of self-vocalizations. The reduction of suppression for 50, 100 and 200 cents and its elimination for 400 cents pitch-shifted voice auditory feedback support the idea that motor-driven suppression of voice feedback leads to distinctly different sensory neural processing of self vs. non-self vocalizations. This characteristic may enable the audio-vocal system to more effectively detect and correct for unexpected errors in the feedback of self-produced voice pitch compared with externally-generated sounds.

  4. Error-dependent modulation of speech-induced auditory suppression for pitch-shifted voice feedback.

    Science.gov (United States)

    Behroozmand, Roozbeh; Larson, Charles R

    2011-06-06

    The motor-driven predictions about expected sensory feedback (efference copies) have been proposed to play an important role in recognition of sensory consequences of self-produced motor actions. In the auditory system, this effect was suggested to result in suppression of sensory neural responses to self-produced voices that are predicted by the efference copies during vocal production in comparison with passive listening to the playback of the identical self-vocalizations. In the present study, event-related potentials (ERPs) were recorded in response to upward pitch shift stimuli (PSS) with five different magnitudes (0, +50, +100, +200 and +400 cents) at voice onset during active vocal production and passive listening to the playback. Results indicated that the suppression of the N1 component during vocal production was largest for unaltered voice feedback (PSS: 0 cents), became smaller as the magnitude of PSS increased to 200 cents, and was almost completely eliminated in response to 400 cents stimuli. Findings of the present study suggest that the brain utilizes the motor predictions (efference copies) to determine the source of incoming stimuli and maximally suppresses the auditory responses to unaltered feedback of self-vocalizations. The reduction of suppression for 50, 100 and 200 cents and its elimination for 400 cents pitch-shifted voice auditory feedback support the idea that motor-driven suppression of voice feedback leads to distinctly different sensory neural processing of self vs. non-self vocalizations. This characteristic may enable the audio-vocal system to more effectively detect and correct for unexpected errors in the feedback of self-produced voice pitch compared with externally-generated sounds.

  5. Gender differences in developmental dyscalculia depend on diagnostic criteria.

    Science.gov (United States)

    Devine, Amy; Soltész, Fruzsina; Nobes, Alison; Goswami, Usha; Szűcs, Dénes

    2013-10-01

    Developmental dyscalculia (DD) is a learning difficulty specific to mathematics learning. The prevalence of DD may be equivalent to that of dyslexia, posing an important challenge for effective educational provision. Nevertheless, there is no agreed definition of DD and there are controversies surrounding cutoff decisions, specificity and gender differences. In the current study, 1004 British primary school children completed mathematics and reading assessments. The prevalence of DD and gender ratio were estimated in this sample using different criteria. When using absolute thresholds, the prevalence of DD was the same for both genders regardless of the cutoff criteria applied, however gender differences emerged when using a mathematics-reading discrepancy definition. Correlations between mathematics performance and the control measures selected to identify a specific learning difficulty affect both prevalence estimates and whether a gender difference is in fact identified. Educational implications are discussed.

  6. Pressure dependence of backbone chemical shifts in the model peptides Ac-Gly-Gly-Xxx-Ala-NH2.

    Science.gov (United States)

    Erlach, Markus Beck; Koehler, Joerg; Crusca, Edson; Kremer, Werner; Munte, Claudia E; Kalbitzer, Hans Robert

    2016-06-01

    For a better understanding of nuclear magnetic resonance (NMR) detected pressure responses of folded as well as unstructured proteins the availability of data from well-defined model systems are indispensable. In this work we report the pressure dependence of chemical shifts of the backbone atoms (1)H(α), (13)C(α) and (13)C' in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH2 (Xxx one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of these nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The polynomial pressure coefficients B 1 and B 2 are dependent on the type of amino acid studied. The coefficients of a given nucleus show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure are also weakly correlated.

  7. Pressure dependence of backbone chemical shifts in the model peptides Ac-Gly-Gly-Xxx-Ala-NH{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Erlach, Markus Beck; Koehler, Joerg [University of Regensburg, Institute of Biophysics and Physical Biochemistry and Centre of Magnetic Resonance in Chemistry and Biomedicine (Germany); Crusca, Edson [University of São Paulo, Physics Institute of São Carlos (Brazil); Kremer, Werner [University of Regensburg, Institute of Biophysics and Physical Biochemistry and Centre of Magnetic Resonance in Chemistry and Biomedicine (Germany); Munte, Claudia E. [University of São Paulo, Physics Institute of São Carlos (Brazil); Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@biologie.uni-regensburg.de [University of Regensburg, Institute of Biophysics and Physical Biochemistry and Centre of Magnetic Resonance in Chemistry and Biomedicine (Germany)

    2016-06-15

    For a better understanding of nuclear magnetic resonance (NMR) detected pressure responses of folded as well as unstructured proteins the availability of data from well-defined model systems are indispensable. In this work we report the pressure dependence of chemical shifts of the backbone atoms {sup 1}H{sup α}, {sup 13}C{sup α} and {sup 13}C′ in the protected tetrapeptides Ac-Gly-Gly-Xxx-Ala-NH{sub 2} (Xxx one of the 20 canonical amino acids). Contrary to expectation the chemical shifts of these nuclei have a nonlinear dependence on pressure in the range from 0.1 to 200 MPa. The polynomial pressure coefficients B{sub 1} and B{sub 2} are dependent on the type of amino acid studied. The coefficients of a given nucleus show significant linear correlations suggesting that the NMR observable pressure effects in the different amino acids have at least partly the same physical cause. In line with this observation the magnitude of the second order coefficients of nuclei being direct neighbors in the chemical structure are also weakly correlated.Graphical Abstract.

  8. Distance-dependent shifts in net effects by an unpalatable nettle on a palatable plant species

    Science.gov (United States)

    Suzuki, Satoshi N.; Suzuki, Ryo O.

    2011-07-01

    We examined whether the relative importance of facilitation and competition effects by an unpalatable perennial ( Urtica thunbergiana) on a palatable annual ( Persicaria longiseta) change with the spatial distance between them in a long-term deer-grazing habitat. Survivorship, growth, size, and fecundity of Persicaria were recorded at 1-2-month intervals during growing seasons in 2 successive years and were compared among individuals located in different positions relative to the canopy of Urtica: at the centre, internal edge, external edge, and far from the canopy. Survivorship of Persicaria was significantly higher at the centre of the Urtica canopy than outside the canopy early in the growing season in both years. No significant differences in Persicaria growth were observed among the four positions in most periods, except in one when growth was significantly higher at the centre, internal, and external edges of the canopy compared to outside the canopy. We found spatial shifts in the net effects of Urtica on Persicaria fecundity, from positive effects under the canopy centre to negative effects under the external edge of the canopy in the first year, and from negative effects under the centre to positive effects under the external edge in the second year. These results demonstrate that the relative importance of positive and negative effects of Urtica on Persicaria vary temporally within and among years and spatially around a single Urtica plant. Spatiotemporal variation in plant interactions may be attributable to annual and seasonal variation in vegetation productivity and grazing pressure.

  9. Detecting Hidden Diversification Shifts in Models of Trait-Dependent Speciation and Extinction.

    Science.gov (United States)

    Beaulieu, Jeremy M; O'Meara, Brian C

    2016-07-01

    The distribution of diversity can vary considerably from clade to clade. Attempts to understand these patterns often employ state-dependent speciation and extinction models to determine whether the evolution of a particular novel trait has increased speciation rates and/or decreased extinction rates. It is still unclear, however, whether these models are uncovering important drivers of diversification, or whether they are simply pointing to more complex patterns involving many unmeasured and co-distributed factors. Here we describe an extension to the popular state-dependent speciation and extinction models that specifically accounts for the presence of unmeasured factors that could impact diversification rates estimated for the states of any observed trait, addressing at least one major criticism of BiSSE (Binary State Speciation and Extinction) methods. Specifically, our model, which we refer to as HiSSE (Hidden State Speciation and Extinction), assumes that related to each observed state in the model are "hidden" states that exhibit potentially distinct diversification dynamics and transition rates than the observed states in isolation. We also demonstrate how our model can be used as character-independent diversification models that allow for a complex diversification process that is independent of the evolution of a character. Under rigorous simulation tests and when applied to empirical data, we find that HiSSE performs reasonably well, and can at least detect net diversification rate differences between observed and hidden states and detect when diversification rate differences do not correlate with the observed states. We discuss the remaining issues with state-dependent speciation and extinction models in general, and the important ways in which HiSSE provides a more nuanced understanding of trait-dependent diversification. © The Author(s) 2016. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved

  10. Interpretation of Anaphoric Dependencies in Russian-speaking Children with and without Developmental Language Disorder.

    Science.gov (United States)

    Rakhlin, Natalia; Kornilov, Sergey A; Reich, Jodi; Grigorenko, Elena L

    We examined anaphora resolution in children with and without Developmental Language Disorder (DLD) to clarify whether 1) DLD is best understood as missing knowledge of certain linguistic operations/elements or as unreliable performance and 2) if comprehension of sentences with anaphoric expressions as objects and exceptionally case marked (ECM) subjects supports a particular theoretical account of anaphora. Fifty-four native-Russian-speaking children (age M = 7;6, SD = 1;9) were tested on a picture selection task. Children with DLD (n=18) underperformed overall, but displayed similar patterns to the typically developing (TD) group with respect to the extra difficulty of the ECM relative to the transitive and ECM pronouns relative to all other conditions. However, whereas pronouns were more difficult than reflexives for the TD children, this effect was not significant for the DLD group, whose reduced accuracy on reflexives washed out the effect of pronouns in that group. These results are consistent with performance-level vulnerability in DLD, arguably related to weaknesses in lexical processing and with the Reflexivity framework of Binding phenomena.

  11. Drosophila mitotypes determine developmental time in a diet and temperature dependent manner.

    Science.gov (United States)

    Towarnicki, Samuel G; Ballard, J William O

    2017-07-01

    It is well known that specific mitochondrial (mt) DNA mutations can reduce organismal fitness and influence mitochondrial-nuclear interactions. However, determining specific mtDNA mutations that are beneficial has been elusive. In this study, we vary the diet and environmental temperature to study larval development time of two Drosophila melanogaster mitotypes (Alstonville and Dahomey), in two nuclear genetic backgrounds, and investigate developmental differences through weight, feeding rate, and movement. To manipulate the diet, we utilize the nutritional geometric framework to manipulate isocaloric diets of differing macronutrient ratios (1:2 and 1:16 protein: carbohydrate (P:C) ratios) and raise flies at three temperatures (19°C, 23°C and 27°C). Larvae with Dahomey mtDNA develop more slowly than Alstonville when fed the 1:2 P:C diet at all temperatures and developed more quickly when fed the 1:16 P:C diet at 23°C and 27°C. We determined that Dahomey larvae eat more, move less, and weigh more than Alstonville larvae when raised on the 1:16 P:C diet and that these physiological responses are modified by temperature. We suggest that 1 (or more) of 4 mtDNA changes is likely responsible for the observed effects and posit the mtDNA changes moderate a physiological trade-off between consumption and foraging. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    Directory of Open Access Journals (Sweden)

    Ram Prakash Gupta

    2017-11-01

    Full Text Available During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Eyeless (Ey, and the segment selector, Ultrabithorax (Ubx, readily cooperate to bring about neoplastic transformation of cells displaying somatic loss of the tumor suppressor, Lgl, but in only those developmental domains that express the homeo-box protein, Homothorax (Hth, and/or the Zinc-finger protein, Teashirt (Tsh. In non-Hth/Tsh-expressing domains of these imaginal discs, however, gain of Ey in lgl− somatic clones induces neoplastic transformation in the distal wing disc and haltere, but not in the eye imaginal disc. Likewise, gain of Ubx in lgl− somatic clones induces transformation in the eye imaginal disc but not in its endogenous domain, namely, the haltere imaginal disc. Our results reveal that selector genes could behave as tumor drivers or inhibitors depending on the tissue contexts of their gains.

  13. The neurite growth inhibitory effects of soluble TNFα on developing sympathetic neurons are dependent on developmental age.

    Science.gov (United States)

    Nolan, Aoife M; Collins, Louise M; Wyatt, Sean L; Gutierrez, Humberto; O'Keeffe, Gerard W

    2014-01-01

    During development, the growth of neural processes is regulated by an array of cellular and molecular mechanisms which influence growth rate, direction and branching. Recently, many members of the TNF superfamily have been shown to be key regulators of neurite growth during development. The founder member of this family, TNFα can both promote and inhibit neurite growth depending on the cellular context. Specifically, transmembrane TNFα promotes neurite growth, while soluble TNFα inhibits it. While the growth promoting effects of TNFα are restricted to a defined developmental window of early postnatal development, whether the growth inhibitory effects of soluble TNFα occur throughout development is unknown. In this study we used the extensively studied, well characterised neurons of the superior cervical ganglion to show that the growth inhibitory effects of soluble TNFα are restricted to a specific period of late embryonic and early postnatal development. Furthermore, we show that this growth inhibitory effect of soluble TNFα requires NF-κB signalling at all developmental stages at which soluble TNFα inhibits neurite growth. These findings raise the possibility that increases in the amount of soluble TNFα in vivo, for example as a result of maternal inflammation, could negatively affect neurite growth in developing neurons at specific stages of development. Copyright © 2015 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  14. Frequency Dependence of Helioseismic Measurements of the Center-to-Limb Effect and Flow-induced Travel-time Shifts

    Science.gov (United States)

    Chen, Ruizhu; Zhao, Junwei

    2018-02-01

    Time–distance helioseismology measures acoustic travel times to infer the structure and flow field of the solar interior; however, both the mean travel times and the travel-time shifts suffer systematic center-to-limb variations, which complicate the interpretation and inversions of the time–distance measurements. In particular, the center-to-limb variation in travel-time shifts (CtoL effect) has a significant impact on the inference of the Sun’s meridional circulation, and needs to be removed from the helioseismic measurements, although the observational properties and the physical cause of the CtoL effect have yet to be investigated. In this study, we measure the CtoL effect in the frequency domain using Doppler-velocity data from the Solar Dynamics Observatory/Helioseismic and Magnetic Imager, and study its properties as a function of disk-centric distance, travel distance, and frequency of acoustic waves. It is found that the CtoL effect has a significant frequency dependence—it reverses sign at a frequency around 5.4 mHz and reaches maximum at around 4.0 mHz before the sign reversal. The tendency of frequency dependence varies with disk-centric distance in a way that both the sign-reversal frequency and the maximum-value frequency decrease closer to the limb. The variation tendency does not change with travel distance, but the variation magnitude is approximately proportional to travel distance. For comparison, the flow-induced travel-time shifts show little frequency dependence. These observational properties provide more clues on the nature of the CtoL effect, and also possibly lead to new ways of effect-removal for a more robust determination of the deep meridional flow.

  15. Developmental pathways from child maltreatment to adolescent marijuana dependence: Examining moderation by FK506 binding protein 5 gene (FKBP5).

    Science.gov (United States)

    Handley, Elizabeth D; Rogosch, Fred A; Cicchetti, Dante

    2015-11-01

    The current study examined the prospective association between child maltreatment and the development of substance use disorder in adolescence with the aim of investigating pathways underlying this relation, as well as genetic moderation of these developmental mechanisms. Specifically, we tested whether youth who experienced maltreatment prior to age 8 were at risk for the development of marijuana dependence in adolescence by way of a childhood externalizing pathway and a childhood internalizing pathway. Moreover, we tested whether variation in FK506 binding protein 5 gene (FKBP5) CATT haplotype moderated these pathways. The participants were 326 children (n =179 maltreated; n = 147 nonmaltreated) assessed across two waves of data collection (childhood: ages 7-9 and adolescence: ages 15-18). Results indicated that higher levels of child externalizing symptoms significantly mediated the effect of child maltreatment on adolescent marijuana dependence symptoms for individuals with one or two copies of the FKBP5 CATT haplotype only. We did not find support for an internalizing pathway from child maltreatment to adolescent marijuana dependence, nor did we find evidence of moderation of the internalizing pathway by FKBP5 haplotype variation. Findings extend previous research by demonstrating that whether a maltreated child will traverse an externalizing pathway toward substance use disorder in adolescence is dependent on FKBP5 genetic variation.

  16. Hyperoxia-induced developmental plasticity of the hypoxic ventilatory response in neonatal rats: contributions of glutamate-dependent and PDGF-dependent mechanisms.

    Science.gov (United States)

    Bavis, Ryan W; DeAngelis, Kathryn J; Horowitz, Terry C; Reedich, Lisa M; March, Ryan J

    2014-01-15

    Rats reared in hyperoxia exhibit a sustained (vs. biphasic) hypoxic ventilatory response (HVR) at an earlier age than untreated, Control rats. Given the similarity between the sustained HVR obtained after chronic exposure to developmental hyperoxia and the mature HVR, it was hypothesized that hyperoxia-induced plasticity and normal maturation share common mechanisms such as enhanced glutamate and nitric oxide signaling and diminished platelet-derived growth factor (PDGF) signaling. Rats reared in 21% O2 (Control) or 60% O2 (Hyperoxia) from birth until 4-5 days of age were studied after intraperitoneal injection of drugs targeting these pathways. Hyperoxia rats receiving saline showed a sustained HVR to 12% O2, but blockade of NMDA glutamate receptors (MK-801) restored the biphasic HVR typical of newborn rats. Blockade of PDGF-β receptors (imatinib) had no effect on the pattern of the HVR in Hyperoxia rats, although it attenuated ventilatory depression during the late phase of the HVR in Control rats. Neither nitric oxide synthase inhibitor used in this study (nNOS inhibitor I and l-NAME) altered the pattern of the HVR in Control or Hyperoxia rats. Drug-induced changes in the biphasic HVR were not correlated with changes in metabolic rate. Collectively, these results suggest that developmental hyperoxia hastens the transition from a biphasic to sustained HVR by upregulating glutamate-dependent mechanisms and downregulating PDGF-dependent mechanisms, similar to the changes underlying normal postnatal maturation of the biphasic HVR. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Which visual functions depend on intermediate visual regions? Insights from a case of developmental visual form agnosia.

    Science.gov (United States)

    Gilaie-Dotan, Sharon

    2016-03-01

    A key question in visual neuroscience is the causal link between specific brain areas and perceptual functions; which regions are necessary for which visual functions? While the contribution of primary visual cortex and high-level visual regions to visual perception has been extensively investigated, the contribution of intermediate visual areas (e.g. V2/V3) to visual processes remains unclear. Here I review more than 20 visual functions (early, mid, and high-level) of LG, a developmental visual agnosic and prosopagnosic young adult, whose intermediate visual regions function in a significantly abnormal fashion as revealed through extensive fMRI and ERP investigations. While expectedly, some of LG's visual functions are significantly impaired, some of his visual functions are surprisingly normal (e.g. stereopsis, color, reading, biological motion). During the period of eight-year testing described here, LG trained on a perceptual learning paradigm that was successful in improving some but not all of his visual functions. Following LG's visual performance and taking into account additional findings in the field, I propose a framework for how different visual areas contribute to different visual functions, with an emphasis on intermediate visual regions. Thus, although rewiring and plasticity in the brain can occur during development to overcome and compensate for hindering developmental factors, LG's case seems to indicate that some visual functions are much less dependent on strict hierarchical flow than others, and can develop normally in spite of abnormal mid-level visual areas, thereby probably less dependent on intermediate visual regions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.

    Directory of Open Access Journals (Sweden)

    Kamila Maliszewska-Olejniczak

    2015-07-01

    Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium

  19. pH-Dependent spin state population and 19F NMR chemical shift via remote ligand protonation in an iron(ii) complex.

    Science.gov (United States)

    Gaudette, Alexandra I; Thorarinsdottir, Agnes E; Harris, T David

    2017-11-30

    An Fe II complex that features a pH-dependent spin state population, by virtue of a variable ligand protonation state, is described. This behavior leads to a highly pH-dependent 19 F NMR chemical shift with a sensitivity of 13.9(5) ppm per pH unit at 37 °C, thereby demonstrating the potential utility of the complex as a 19 F chemical shift-based pH sensor.

  20. Complexity in pH-Dependent Ribozyme Kinetics: Dark pKa Shifts and Wavy Rate-pH Profiles.

    Science.gov (United States)

    Frankel, Erica A; Bevilacqua, Philip C

    2018-02-06

    Charged bases occur in RNA enzymes, or ribozymes, where they play key roles in catalysis. Cationic bases donate protons and perform electrostatic catalysis, while anionic bases accept protons. We previously published simulations of rate-pH profiles for ribozymes in terms of species plots for the general acid and general base that have been useful for understanding how ribozymes respond to pH. In that study, we did not consider interaction between the general acid and general base or interaction with other species on the RNA. Since that report, diverse small ribozyme classes have been discovered, many of which have charged nucleobases or metal ions in the active site that can either directly interact and participate in catalysis or indirectly interact as "influencers". Herein, we simulate experimental rate-pH profiles in terms of species plots in which reverse protonated charged nucleobases interact. These analyses uncover two surprising features of pH-dependent enzyme kinetics. (1) Cooperativity between the general acid and general base enhances population of the functional forms of a ribozyme and manifests itself as hidden or "dark" pK a shifts, real pK a shifts that accelerate the reaction but are not readily observed by standard experimental approaches, and (2) influencers favorably shift the pK a s of proton-transferring nucleobases and manifest themselves as "wavy" rate-pH profiles. We identify parallels with the protein enzyme literature, including reverse protonation and wavelike behavior, while pointing out that RNA is more prone to reverse protonation. The complexities uncovered, which arise from simple pairwise interactions, should aid deconvolution of complex rate-pH profiles for RNA and protein enzymes and suggest veiled catalytic devices for promoting catalysis that can be tested by experiment and calculation.

  1. New SU(1,1) position-dependent effective mass coherent states for a generalized shifted harmonic oscillator

    International Nuclear Information System (INIS)

    Yahiaoui, Sid-Ahmed; Bentaiba, Mustapha

    2014-01-01

    A new SU(1,1) position-dependent effective mass coherent states (PDEM CS) related to the shifted harmonic oscillator (SHO) are deduced. This is accomplished by applying a similarity transformation to the generally deformed oscillator algebra (GDOA) generators for PDEM systems and a new set of operators that close the su(1,1) Lie algebra are constructed, being the PDEM CS of the basis for its unitary irreducible representation. From the Lie algebra generators, we evaluate the uncertainty relationship for a position and momentum-like operators in the PDEM CS and show that it is minimized in the sense of Barut–Girardello CS. We prove that the deduced PDEM CS preserve the same analytical form than those of Glauber states. As an illustration of our procedure, we depicted the 2D-probability density in the PDEM CS for SHO with the explicit form of the mass distribution with no singularities. (paper)

  2. Study on Flow-Shifted Region Depending on Spool Displacement in Hydraulic Servo Valve with Hybrid Lap

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Hwanghun; Yun, Sonam; Lee, Sungsoo [Korea Institute of Machinery and Materials, Daejeon (Korea, Republic of); Yang, Jooho [Pukyong Nat' l Univ., Busan (Korea, Republic of)

    2013-03-15

    This study examined the static characteristics of a spool valve with a hybrid lap between the spool land and the sleeve. The static equation for the pressure characteristics was derived from flow equations that depend on the spool displacement, and the final model was derived from q{sub a}=q{sub b}=0 because the pressure characteristics test needs to block the control port in the valve. The static equation for the flow characteristics was derived from the pressure characteristics when the control port is open (q{sub a}=q{sub b}, p{sub a}=p{sub b}). The characteristic equation in the shifted region was assumed from the proportional relationship between the pressure-flow characteristics and the spool displacement.

  3. Stress induced a shift from dorsal hippocampus to prefrontal cortex-dependent memory retrieval: role of regional corticosterone.

    Directory of Open Access Journals (Sweden)

    Gaelle eDominguez

    2014-05-01

    Full Text Available Most of the deleterious effects of stress on memory retrieval are due to a dysfunction of the hippocampo-prefrontal cortex interplay. The role of the stress-induced regional corticosterone increase in such dysfunction remains however unclear, since there is no published study as yet dedicated to measuring corticosterone concentrations simultaneously in both the prefrontal cortex (mPFC and the hippocampus (dHPC in relation with memory impairments. To that aim, we first showed in Experiment 1 that an acute stress (3 electric footschocks; 0.9 mA each delivered before memory testing reversed the memory retrieval pattern (MRP in a serial discrimination task in which mice learned two successive discriminations. More precisely, whereas non-stressed animals remembered accurately the first learned discrimination and not the second one, stressed mice remembered more accurately the second discrimination but not the first one. We demonstrated that local inactivation of dHPC or mPFC with the anesthetic lidocaine recruited the dHPC activity in non-stress conditions whereas the stress-induced MRP inversion recruited the mPFC activity. In a second experiment, we showed that acute stress induced a very similar time-course evolution of corticosterone rises within both the mPFC and dHPC. In a 3rd experiment, we found however that in situ injections of corticosterone either within the mPFC or the dHPC before memory testing favored the emergence of the mPFC-dependent MRP but blocked the emergence of the dHPC-dependent one. Overall, our study evidences that the simultaneous increase of corticosterone after stress in both areas induces a shift from dHPC (non stress condition to mPFC-dependent memory retrieval pattern and that corticosterone is critically involved in mediating the deleterious effects of stress on cognitive functions involving the mPFC-HPC interplay.

  4. The hedgehog pathway gene shifted functions together with the hmgcr-dependent isoprenoid biosynthetic pathway to orchestrate germ cell migration.

    Directory of Open Access Journals (Sweden)

    Girish Deshpande

    Full Text Available The Drosophila embryonic gonad is assembled from two distinct cell types, the Primordial Germ Cells (PGCs and the Somatic Gonadal Precursor cells (SGPs. The PGCs form at the posterior of blastoderm stage embryos and are subsequently carried inside the embryo during gastrulation. To reach the SGPs, the PGCs must traverse the midgut wall and then migrate through the mesoderm. A combination of local repulsive cues and attractive signals emanating from the SGPs guide migration. We have investigated the role of the hedgehog (hh pathway gene shifted (shf in directing PGC migration. shf encodes a secreted protein that facilitates the long distance transmission of Hh through the proteoglycan matrix after it is released from basolateral membranes of Hh expressing cells in the wing imaginal disc. shf is expressed in the gonadal mesoderm, and loss- and gain-of-function experiments demonstrate that it is required for PGC migration. Previous studies have established that the hmgcr-dependent isoprenoid biosynthetic pathway plays a pivotal role in generating the PGC attractant both by the SGPs and by other tissues when hmgcr is ectopically expressed. We show that production of this PGC attractant depends upon shf as well as a second hh pathway gene gγ1. Further linking the PGC attractant to Hh, we present evidence indicating that ectopic expression of hmgcr in the nervous system promotes the release/transmission of the Hh ligand from these cells into and through the underlying mesodermal cell layer, where Hh can contact migrating PGCs. Finally, potentiation of Hh by hmgcr appears to depend upon cholesterol modification.

  5. Cholecalciferol attenuates perseverative behavior associated with developmental alcohol exposure in rats in a dose-dependent manner.

    Science.gov (United States)

    Idrus, N M; Happer, J P; Thomas, J D

    2013-07-01

    Alcohol is a known teratogen that is estimated to affect 2-5% of the births in the U.S. Prenatal alcohol exposure can produce physical features such as facial dysmorphology, physiological alterations such as cell loss in the central nervous system (CNS), and behavioral changes that include hyperactivity, cognitive deficits, and motor dysfunction. The range of effects associated with prenatal alcohol exposure is referred to as fetal alcohol spectrum disorders (FASD). Despite preventative measures, some women continue to drink while pregnant. Therefore, identifying interventions that reduce the severity of FASD is critical. This study investigated one such potential intervention, vitamin D3, a nutrient that exerts neuroprotective properties. The present study determined whether cholecalciferol, a common vitamin D3 nutritional supplement, could serve as a means of mitigating alcohol-related learning deficits. Using a rat model of FASD, cholecalciferol was given before, during, and after 3rd trimester equivalent alcohol exposure. Three weeks after cholecalciferol treatment, subjects were tested on a serial spatial discrimination reversal learning task. Animals exposed to ethanol committed significantly more errors compared to controls. Cholecalciferol treatment reduced perseverative behavior that is associated with developmental alcohol exposure in a dose-dependent manner. These data have important implications for the treatment of FASD and suggest that cholecalciferol may reduce some aspects of FASD. This article is part of a Special Issue entitled 'Vitamin D Workshop'. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Age-Dependent Developmental Response to Temperature: An Examination of the Rarely Tested Phenomenon in Two Species (Gypsy Moth (Lymantria dispar and Winter Moth (Operophtera brumata

    Directory of Open Access Journals (Sweden)

    David R. Gray

    2018-04-01

    Full Text Available The pervading paradigm in insect phenology models is that the response to a given temperature does not vary within a life stage. The developmental rate functions that have been developed for general use, or for specific insects, have for the most part been temperature-dependent but not age-dependent, except where age is an ordinal variable designating the larval instar. Age dependence, where age is a continuous variable, is not often reported (or investigated, and is rarely included in phenology models. I provide a short review of the seldom-investigated phenomenon of age dependence in developmental response to temperature, and compare the derivation of the winter moth egg phenology model by Salis et al. to the derivation of another egg phenology model with age-dependent responses to temperature I discuss some probable reasons for the discrepancies (acknowledged by Salis et al. between modelled and observed developmental rates of the winter moth, and discuss the contribution that geographically robust phenology models can make to estimates of species distributions.

  7. Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves

    Directory of Open Access Journals (Sweden)

    Vajiheh Safavi-Rizi

    2018-02-01

    Full Text Available In the spring oilseed rape (OSR cultivar ‘Mozart’ grown under optimal N supply (NO or mild N deficiency (NL the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4 and younger higher canopy leaves (leaf #8 were investigated. Twelve weeks old NO and NL plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In NO leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in NL leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes than in N-depleted plants (∼750 genes. This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs. Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in NL plants, but none in NO plants. In contrast, from weeks 13 to 16 in leaves #8 of NL plants only 11 PSGs were downregulated in comparison to 66 PSGs in NO plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in NL leaves #4 or NO leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves.

  8. Divergent N Deficiency-Dependent Senescence and Transcriptome Response in Developmentally Old and Young Brassica napus Leaves.

    Science.gov (United States)

    Safavi-Rizi, Vajiheh; Franzaring, Jürgen; Fangmeier, Andreas; Kunze, Reinhard

    2018-01-01

    In the spring oilseed rape (OSR) cultivar 'Mozart' grown under optimal N supply (N O ) or mild N deficiency (N L ) the transcriptome changes associated with progressing age until early senescence in developmentally old lower canopy leaves (leaf #4) and younger higher canopy leaves (leaf #8) were investigated. Twelve weeks old N O and N L plants appeared phenotypically and transcriptomically identical, but thereafter distinct nutrition-dependent differences in gene expression patterns in lower and upper canopy leaves emerged. In N O leaves #4 of 14-week-old compared to 13-week-old plants, ∼600 genes were up- or downregulated, whereas in N L leaves #4 ∼3000 genes were up- or downregulated. In contrast, in 15-week-old compared to 13-week-old upper canopy leaves #8 more genes were up- or downregulated in optimally N-supplied plants (∼2000 genes) than in N-depleted plants (∼750 genes). This opposing effect of N depletion on gene regulation was even more prominent among photosynthesis-related genes (PSGs). Between week 13 and 14 in leaves #4, 99 of 110 PSGs were downregulated in N L plants, but none in N O plants. In contrast, from weeks 13 to 16 in leaves #8 of N L plants only 11 PSGs were downregulated in comparison to 66 PSGs in N O plants. Different effects of N depletion in lower versus upper canopy leaves were also apparent in upregulation of autophagy genes and NAC transcription factors. More than half of the regulated NAC and WRKY transcription factor, autophagy and protease genes were specifically regulated in N L leaves #4 or N O leaves #8 and thus may contribute to differences in senescence and nutrient mobilization in these leaves. We suggest that in N-deficient plants the upper leaves retain their N resources longer than in amply fertilized plants and remobilize them only after shedding of the lower leaves.

  9. Sex-Dependent Effects of the Histone Deacetylase Inhibitor, Sodium Valproate, on Reversal Learning After Developmental Arsenic Exposure

    Directory of Open Access Journals (Sweden)

    Christina R. Steadman Tyler

    2018-06-01

    Full Text Available Several studies have demonstrated that exposure to arsenic in drinking water adversely affects brain development and cognitive function in adulthood. While the mechanism by which arsenic induces adverse neurological outcomes remains elusive, studies suggest a link between reduced levels of histone acetylation and impaired performance on a variety of behavioral tasks following arsenic exposure. Using our developmental arsenic exposure (DAE paradigm, we have previously reported reduced histone acetylation and associated histone acetyltransferase enzyme expression in the frontal cortex of C57BL/6J adult male mice, with no changes observed in the female frontal cortex. In the present study, we sought to determine if DAE produced sex-dependent deficits in frontal cortical executive function using the Y-maze acquisition and reversal learning tasks, which are specific for assessing cognitive flexibility. Further, we tested whether the administration of valproic acid, a class I–IIa histone deacetylase inhibitor, was able to mitigate behavioral and biochemical changes resulting from DAE. As anticipated, DAE inhibited acquisition and reversal learning performance in adult male, but not female, mice. Valproate treatment for 2 weeks restored reversal performance in the male arsenic-exposed offspring, while not affecting female performance. Protein levels of HDACs 1, 2, and 5 were elevated following behavioral assessment but only in DAE male mice; restoration of appropriate HDAC levels occurred after valproate treatment and was concurrent with improved behavioral performance, particularly during reversal learning. Female frontal cortical levels of HDAC enzymes were not impacted by DAE or valproate treatment. Finally, mRNA expression levels of brain-derived neurotrophic factor, Bdnf, which has been implicated in the control of frontal cortical flexibility and is regulated by HDAC5, were elevated in DAE male mice and restored to normal levels following HDACi

  10. Asymmetrical effects of adaptation to left- and right-shifting prisms depends on pre-existing attentional biases.

    Science.gov (United States)

    Goedert, Kelly M; Leblanc, Andrew; Tsai, Sen-Wei; Barrett, Anna M

    2010-09-01

    Proposals that adaptation with left-shifting prisms induces neglect-like symptoms in normal individuals rely on a dissociation between the postadaptation performance of individuals trained with left- versus right-shifting prisms (e.g., Colent, Pisella, & Rossetti, 2000). A potential problem with this evidence is that normal young adults have an a priori leftward bias (e.g., Jewell & McCourt, 2000). In Experiment 1, we compared the line bisection performance of young adults to that of aged adults, who as a group may lack a leftward bias in line bisection. Participants trained with both left- and right-shifting prisms. Consistent with our hypothesis, while young adults demonstrated aftereffects for left, but not right prisms, aged adults demonstrated reliable aftereffects for both prisms. In Experiment 2, we recruited a larger sample of young adults, some of whom were right-biased at baseline. We observed an interaction between baseline bias and prism-shift, consistent with the results of Experiment 1: Left-biased individuals showed a reduced aftereffect when training with right-shifting prisms and right-biased individuals showed a reduced aftereffect when training with left-shifting prisms. These results suggest that previous failures to find generalizable aftereffects with right-shifting prisms may be driven by participants' baseline biases rather than specific effects of the prism itself.

  11. Direction-dependent waist-shift-difference of Gaussian beam in a multiple-pass zigzag slab amplifier and geometrical optics compensation method.

    Science.gov (United States)

    Li, Zhaoyang; Kurita, Takashi; Miyanaga, Noriaki

    2017-10-20

    Zigzag and non-zigzag beam waist shifts in a multiple-pass zigzag slab amplifier are investigated based on the propagation of a Gaussian beam. Different incident angles in the zigzag and non-zigzag planes would introduce a direction-dependent waist-shift-difference, which distorts the beam quality in both the near- and far-fields. The theoretical model and analytical expressions of this phenomenon are presented, and intensity distributions in the two orthogonal planes are simulated and compared. A geometrical optics compensation method by a beam with 90° rotation is proposed, which not only could correct the direction-dependent waist-shift-difference but also possibly average the traditional thermally induced wavefront-distortion-difference between the horizontal and vertical beam directions.

  12. Structural dependence of the 5d-metal surface energies as deduced from surface core-level shift measurements

    International Nuclear Information System (INIS)

    Mrartensson, N.; Saalfeld, H.B.; Kuhlenbeck, H.; Neumann, M.

    1989-01-01

    Surface core-level shift measurements performed at the BESSY storage ring yield -0.41(2) eV for Os(0001) and 0.00(10) eV for Re(0001). An analysis of the surface shifts in the 5d transition series shows that the surface energy as a function of Z has a maximum at lower Z for the bcc phase than for the fcc-hcp phases, at W and between Re and Os, respectively

  13. Developmental plasticity: re-conceiving the genotype.

    Science.gov (United States)

    Sultan, Sonia E

    2017-10-06

    In recent decades, the phenotype of an organism (i.e. its traits and behaviour) has been studied as the outcome of a developmental 'programme' coded in its genotype. This deterministic view is implicit in the Modern Synthesis approach to adaptive evolution as a sorting process among genetic variants. Studies of developmental pathways have revealed that genotypes are in fact differently expressed depending on environmental conditions. Accordingly, the genotype can be understood as a repertoire of potential developmental outcomes or norm of reaction. Reconceiving the genotype as an environmental response repertoire rather than a fixed developmental programme leads to three critical evolutionary insights. First, plastic responses to specific conditions often comprise functionally appropriate trait adjustments, resulting in an individual-level, developmental mode of adaptive variation. Second, because genotypes are differently expressed depending on the environment, the genetic diversity available to natural selection is itself environmentally contingent. Finally, environmental influences on development can extend across multiple generations via cytoplasmic and epigenetic factors transmitted to progeny individuals, altering their responses to their own, immediate environmental conditions and, in some cases, leading to inherited but non-genetic adaptations. Together, these insights suggest a more nuanced understanding of the genotype and its evolutionary role, as well as a shift in research focus to investigating the complex developmental interactions among genotypes, environments and previous environments.

  14. Signal or noise? Separating grain size-dependent Nd isotope variability from provenance shifts in Indus delta sediments, Pakistan

    Science.gov (United States)

    Jonell, T. N.; Li, Y.; Blusztajn, J.; Giosan, L.; Clift, P. D.

    2017-12-01

    Rare earth element (REE) radioisotope systems, such as neodymium (Nd), have been traditionally used as powerful tracers of source provenance, chemical weathering intensity, and sedimentary processes over geologic timescales. More recently, the effects of physical fractionation (hydraulic sorting) of sediments during transport have called into question the utility of Nd isotopes as a provenance tool. Is source terrane Nd provenance resolvable if sediment transport strongly induces noise? Can grain-size sorting effects be quantified? This study works to address such questions by utilizing grain size analysis, trace element geochemistry, and Nd isotope geochemistry of bulk and grain-size fractions (Pakistan. Here we evaluate how grain size effects drive Nd isotope variability and further resolve the total uncertainties associated with Nd isotope compositions of bulk sediments. Results from the Indus delta indicate bulk sediment ɛNd compositions are most similar to the <63 µm fraction as a result of strong mineralogical control on bulk compositions by silt- to clay-sized monazite and/or allanite. Replicate analyses determine that the best reproducibility (± 0.15 ɛNd points) is observed in the 125-250 µm fraction. The bulk and finest fractions display the worst reproducibility (±0.3 ɛNd points). Standard deviations (2σ) indicate that bulk sediment uncertainties are no more than ±1.0 ɛNd points. This argues that excursions of ≥1.0 ɛNd points in any bulk Indus delta sediments must in part reflect an external shift in provenance irrespective of sample composition, grain size, and grain size distribution. Sample standard deviations (2s) estimate that any terrigenous bulk sediment composition should vary no greater than ±1.1 ɛNd points if provenance remains constant. Findings from this study indicate that although there are grain-size dependent Nd isotope effects, they are minimal in the Indus delta such that resolvable provenance-driven trends can be

  15. A Developmental Shift in Black-White Differences in Depressive Affect across Adolescence and Early Adulthood: The Influence of Early Adult Social Roles and Socio-Economic Status

    Science.gov (United States)

    Jager, Justin

    2011-01-01

    This study examined Black-White differences in growth of depressive affect using a longitudinal sample of middle-class, suburban U.S. subjects (n = 956) that spanned from adolescence to early adulthood. Specifically, this study examined whether Black-White differences in growth of depressive affect shift over time, and the extent to which that…

  16. Position-dependent energy-level shifts of an accelerated atom in the presence of a boundary

    International Nuclear Information System (INIS)

    Zhu Zhiying; Yu Hongwei

    2010-01-01

    We consider a uniformly accelerated atom interacting with a vacuum electromagnetic field in the presence of an infinite conducting plane boundary and calculate separately the contributions of vacuum fluctuations and radiation reaction to the atomic energy-level shift. We analyze in detail the behavior of the total energy shift in three different regimes of the distance in both the low-acceleration and high-acceleration limits. Our results show that, in general, an accelerated atom does not behave as if immersed in a thermal bath at the Unruh temperature in terms of the atomic energy-level shifts, and the effect of the acceleration on the atomic energy-level shifts may in principle become appreciable in certain circumstances, although it may not be realistic for actual experimental measurements. We also examine the effects of the acceleration on the level shifts when the acceleration is of the order of the transition frequency of the atom and we find some features which differ from what was obtained in the existing literature.

  17. Optimization of a pH-shift control strategy for producing monoclonal antibodies in Chinese hamster ovary cell cultures using a pH-dependent dynamic model.

    Science.gov (United States)

    Hogiri, Tomoharu; Tamashima, Hiroshi; Nishizawa, Akitoshi; Okamoto, Masahiro

    2018-02-01

    To optimize monoclonal antibody (mAb) production in Chinese hamster ovary cell cultures, culture pH should be temporally controlled with high resolution. In this study, we propose a new pH-dependent dynamic model represented by simultaneous differential equations including a minimum of six system component, depending on pH value. All kinetic parameters in the dynamic model were estimated using an evolutionary numerical optimization (real-coded genetic algorithm) method based on experimental time-course data obtained at different pH values ranging from 6.6 to 7.2. We determined an optimal pH-shift schedule theoretically. We validated this optimal pH-shift schedule experimentally and mAb production increased by approximately 40% with this schedule. Throughout this study, it was suggested that the culture pH-shift optimization strategy using a pH-dependent dynamic model is suitable to optimize any pH-shift schedule for CHO cell lines used in mAb production projects. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Observations of sensor bias dependent cluster centroid shifts in a prototype sensor for the LHCb Vertex Locator detector

    CERN Document Server

    Papadelis, Aras

    2006-01-01

    We present results from a recent beam test of a prototype sensor for the LHCb Vertex Locator detector, read out with the Beetle 1.3 front-end chip. We have studied the effect of the sensor bias voltage on the reconstructed cluster positions in a sensor placed in a 120GeV pion beam at a 10° incidence angle. We find an unexplained sysematic shift in the reconstructed cluster centroid when increasing the bias voltage on an already overdepleted sensor. The shift is independent of strip pitch and sensor thickness.

  19. Are Time-Dependent Fluorescence Shifts at the Tunnel Mouth of Haloalkane Dehalogenase Enzymes Dependent on the Choice of the Chromophore?

    Czech Academy of Sciences Publication Activity Database

    Amaro, Mariana; Brezovský, J.; Kováčová, S.; Maier, L.; Chaloupková, R.; Sýkora, Jan; Paruch, K.; Damborský, J.; Hof, Martin

    2013-01-01

    Roč. 117, č. 26 (2013), s. 7898-7906 ISSN 1520-6106 R&D Projects: GA ČR GBP208/12/G016 Institutional support: RVO:61388955 Keywords : DYNAMIC STOKES SHIFT * WATER-PROTEIN FLUCTUATIONS * POLAR SOLVATION DYNAMICS Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.377, year: 2013

  20. K-Cl Cotransporter 2–mediated Cl− Extrusion Determines Developmental Stage–dependent Impact of Propofol Anesthesia on Dendritic Spines

    KAUST Repository

    Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo

    2017-01-01

    Background: General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABA A)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). Methods: In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABA A)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. Results: The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl - transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. Conclusions: The KCC2-dependent developmental increase in the efficacy of GABA A -mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

  1. K-Cl Cotransporter 2–mediated Cl− Extrusion Determines Developmental Stage–dependent Impact of Propofol Anesthesia on Dendritic Spines

    KAUST Repository

    Puskarjov, Martin

    2017-03-16

    Background: General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABA A)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). Methods: In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABA A)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. Results: The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl - transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. Conclusions: The KCC2-dependent developmental increase in the efficacy of GABA A -mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.

  2. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Ram Prakash Gupta; Anjali Bajpai; Pradip Sinha

    2017-01-01

    During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field selector, Ey...

  3. Selector genes display tumor cooperation and inhibition in Drosophila epithelium in a developmental context-dependent manner

    OpenAIRE

    Gupta, Ram Prakash; Bajpai, Anjali; Sinha, Pradip

    2017-01-01

    ABSTRACT During animal development, selector genes determine identities of body segments and those of individual organs. Selector genes are also misexpressed in cancers, although their contributions to tumor progression per se remain poorly understood. Using a model of cooperative tumorigenesis, we show that gain of selector genes results in tumor cooperation, but in only select developmental domains of the wing, haltere and eye-antennal imaginal discs of Drosophila larva. Thus, the field sel...

  4. Energy dependence phase shift analysis of PI4He elastic scattering and the possibility of the (PI4He) excited states existence

    International Nuclear Information System (INIS)

    Nichitiu, F.; Falomkin, I.V.; Sapozhnikov, M.G.; Shcherbakov, Yu.A.; Piragino, G.

    1981-06-01

    In the 24 MeV-260 MeV kinetic energy interval, the energy dependent phase shift analysis of π 4 He elastic scattering is done. The eneray dependence is given by the rational fraction approximants of the partial S matrix. The search for the stable S matrix zero-pole pairs in the k and √s complex plane give some proofs for the existence of the (π 4 He) excited states in the S, P and probably D partial waves. (authors)

  5. Influence of visual experience on developmental shift from long-term depression to long-term potentiation in the rat medial vestibular nuclei.

    Science.gov (United States)

    Grassi, Silvarosa; Dieni, Cristina; Frondaroli, Adele; Pettorossi, Vito Enrico

    2004-11-01

    The influence of visual experience deprivation on changes in synaptic plasticity during postnatal development was studied in the ventral part of the rat medial vestibular nuclei (vMVN). We analysed the differences in the occurrence, expressed as a percentage, of long-term depression (LTD) and long-term potentiation (LTP) induced by high frequency stimulation (HFS) of the primary vestibular afferents in rats reared in the light (LR) and those in the dark (DR). In LR rats, HFS only induced LTD in the early stages of development, but the occurrence of LTD progressively decreased to zero before their eyes opened, while that of LTP enhanced from zero to about 50%. Once the rats' eyes had opened, LTD was no longer inducible while LTP occurrence gradually reached the normal adult value (70%). In DR rats, a similar shift from LTD to LTP was observed before their eyes opened, showing only a slightly slower LTD decay and LTP growth, and the LTD annulment was delayed by 1 day. By contrast, the time courses of LTD and LTP development in DR and LR rats showed remarkable differences following eye opening. In fact, LTD occurrence increased to about 50% in a short period of time and remained high until the adult stage. In addition, the occurrence of LTP slowly decreased to less than 20%. The effect of light-deprivation was reversible, since the exposure of DR rats to light, 5 days after eye opening, caused a sudden disappearance of LTD and a partial recover of LTP occurrence. In addition, we observed that a week of light deprivation in LR adult rats did not affect the normal adult LTP occurrence. These results provide evidence that in a critical period of development visual input plays a crucial role in shaping synaptic plasticity of the vMVN, and suggest that the visual guided shift from LTD to LTP during development may be necessary to refine and consolidate vestibular circuitry.

  6. ISC1-dependent metabolic adaptation reveals an indispensable role for mitochondria in induction of nuclear genes during the diauxic shift in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kitagaki, Hiroshi; Cowart, L Ashley; Matmati, Nabil; Montefusco, David; Gandy, Jason; de Avalos, Silvia Vaena; Novgorodov, Sergei A; Zheng, Jim; Obeid, Lina M; Hannun, Yusuf A

    2009-04-17

    Growth of Saccharomyces cerevisiae following glucose depletion (the diauxic shift) depends on a profound metabolic adaptation accompanied by a global reprogramming of gene expression. In this study, we provide evidence for a heretofore unsuspected role for Isc1p in mediating this reprogramming. Initial studies revealed that yeast cells deleted in ISC1, the gene encoding inositol sphingolipid phospholipase C, which resides in mitochondria in the post-diauxic phase, showed defective aerobic respiration in the post-diauxic phase but retained normal intrinsic mitochondrial functions, including intact mitochondrial DNA, normal oxygen consumption, and normal mitochondrial polarization. Microarray analysis revealed that the Deltaisc1 strain failed to up-regulate genes required for nonfermentable carbon source metabolism during the diauxic shift, thus suggesting a mechanism for the defective supply of respiratory substrates into mitochondria in the post-diauxic phase. This defect in regulating nuclear gene induction in response to a defect in a mitochondrial enzyme raised the possibility that mitochondria may initiate diauxic shift-associated regulation of nucleus-encoded genes. This was established by demonstrating that in respiratory-deficient petite cells these genes failed to be up-regulated across the diauxic shift in a manner similar to the Deltaisc1 strain. Isc1p- and mitochondrial function-dependent genes significantly overlapped with Adr1p-, Snf1p-, and Cat8p-dependent genes, suggesting some functional link among these factors. However, the retrograde response was not activated in Deltaisc1, suggesting that the response of Deltaisc1 cannot be simply attributed to mitochondrial dysfunction. These results suggest a novel role for Isc1p in allowing the reprogramming of gene expression during the transition from anaerobic to aerobic metabolism.

  7. Developmental and visual input-dependent regulation of the CB1 cannabinoid receptor in the mouse visual cortex.

    Directory of Open Access Journals (Sweden)

    Taisuke Yoneda

    Full Text Available The mammalian visual system exhibits significant experience-induced plasticity in the early postnatal period. While physiological studies have revealed the contribution of the CB1 cannabinoid receptor (CB1 to developmental plasticity in the primary visual cortex (V1, it remains unknown whether the expression and localization of CB1 is regulated during development or by visual experience. To explore a possible role of the endocannabinoid system in visual cortical plasticity, we examined the expression of CB1 in the visual cortex of mice. We found intense CB1 immunoreactivity in layers II/III and VI. CB1 mainly localized at vesicular GABA transporter-positive inhibitory nerve terminals. The amount of CB1 protein increased throughout development, and the specific laminar pattern of CB1 appeared at P20 and remained until adulthood. Dark rearing from birth to P30 decreased the amount of CB1 protein in V1 and altered the synaptic localization of CB1 in the deep layer. Dark rearing until P50, however, did not influence the expression of CB1. Brief monocular deprivation for 2 days upregulated the localization of CB1 at inhibitory nerve terminals in the deep layer. Taken together, the expression and the localization of CB1 are developmentally regulated, and both parameters are influenced by visual experience.

  8. Temperature dependence of the helium induced broadening and shift of the Rb D1 and D2 lines

    Science.gov (United States)

    Miller, Wooddy S.; Rice, Christopher A.; Perram, Glen P.

    2018-02-01

    The rates for collisional broadening and shifting of the Rb D1 (52S1/2 - 52P1/2) and D2 (52S1/2 - 52P3/2) transition induced by 4He have been measured at elevated temperatures of 373-723 K. The shift coefficients exhibit an increase of 20% from 4.36 MHz/Torr to 5.35 MHz/Torr for the D1 line and an 80% increase from 0.42 MHz/Torr to 0.99 MHz/Torr for the D2 line over the observed temperature range. Broadening coefficients exhibit a 6% increase from 17.8 MHz/Torr to 18.9 MHz/Torr and 10% from 18.5 MHz/Torr to 20.5 MHz/Torr for the D1 and D2 lines, respectively. The experimental values agree well with prior reported values within the temperature overlap regions of T < 394 K. Comparison to prior predictions from the Anderson-Talman theory using spin orbit multi reference (SOCI) ab initio potentials are superior to quantum treatments involving Allard and Baranger coupling.

  9. Energy shift and conduction-to-valence band transition mediated by a time-dependent potential barrier in graphene

    Science.gov (United States)

    Chaves, Andrey; da Costa, D. R.; de Sousa, G. O.; Pereira, J. M.; Farias, G. A.

    2015-09-01

    We investigate the scattering of a wave packet describing low-energy electrons in graphene by a time-dependent finite-step potential barrier. Our results demonstrate that, after Klein tunneling through the barrier, the electron acquires an extra energy which depends on the rate of change of the barrier height with time. If this rate is negative, the electron loses energy and ends up as a valence band state after leaving the barrier, which effectively behaves as a positively charged quasiparticle.

  10. Fruit flies may face a nutrient-dependent life-history trade-off between secondary sexual trait quality, survival and developmental rate.

    Science.gov (United States)

    Gray, Lindsey J; Simpson, Stephen J; Polak, Michal

    2018-01-01

    Optimal life-history strategies are those that best allocate finite environmental resources to competing traits. We used the geometric framework for nutrition to evaluate life-history strategies followed by Drosophila melanogaster by measuring the condition-dependent performance of life-history traits, including the morphology of male secondary sexual characters, sex combs. We found that depending on their rearing environment flies faced different forms of trait trade-offs and accordingly followed different life-history strategies. High-energy, high-carbohydrate, low-protein diets supported development of the largest and most symmetrical sex combs, however, consistent with handicap models of sexual selection these foods were associated with reduced fly survival and developmental rate. Expressing the highest quality sex combs may have required secondary sexual trait quality to be traded-off with developmental rate, and our results indicated that flies unable to slow development died. As larval nutritional environments are predominantly determined by female oviposition substrate choice, we tested where mated female flies laid the most eggs. Mothers chose high-energy, high-protein foods associated with rapid larval development. Mothers avoided high-carbohydrate foods associated with maximal sex comb expression, showing they may avoid producing fewer 'sexy' sons in favour of producing offspring that develop rapidly. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Observation of a hole-size-dependent energy shift of the surface-plasmon resonance in Ni antidot thin films

    Energy Technology Data Exchange (ETDEWEB)

    Fang, H.; Akinoglu, E. M.; Fumagalli, P., E-mail: paul.fumagalli@fu-berlin.de [Institut für Experimentalphysik, Freie Universität Berlin, 14195 Berlin (Germany); Caballero, B.; García-Martín, A. [IMM-Instituto de Microelectrónica de Madrid (CNM-CSIC), Isaac Newton 8, PTM, Tres Cantos, E-28760 Madrid (Spain); Papaioannou, E. Th. [Fachbereich Physik and Landesforschungszentrum OPTIMAS, Technische Universität Kaiserslautern, 67663 Kaiserslautern (Germany); Cuevas, J. C. [Departamento de Física Teórica de la Materia Condensada and Condensed Matter Physics Center (IFIMAC), Universidad Autónoma de Madrid, E-28049 Madrid (Spain); Giersig, M. [Institut für Experimentalphysik, Freie Universität Berlin, 14195 Berlin (Germany); Helmholtz Zentrum Berlin, Institute of Nanoarchitectures for Energy Conversion, 14195 Berlin (Germany)

    2015-04-13

    A combined experimental and theoretical study of the magneto-optic properties of a series of nickel antidot thin films is presented. The hole diameter varies from 869 down to 636 nm, while the lattice periodicity is fixed at 920 nm. This results in an overall increase of the polar Kerr rotation with decreasing hole diameter due to the increasing surface coverage with nickel. In addition, at photon energies of 2.7 and 3.3 eV, where surface-plasmon excitations are expected, we observe distinct features in the polar Kerr rotation not present in continuous nickel films. The spectral position of the peaks exhibits a red shift with decreasing hole size. This is explained within the context of an effective medium theory by a change in the effective dielectric function of the Ni thin films.

  12. Developmental-stage-dependent radiosensitivity of neural cells in the ventricular zone of telencephalon in mouse and rat fetuses

    International Nuclear Information System (INIS)

    Hoshino, K.; Kameyama, Y.

    1988-01-01

    Pregnant ICR mice were treated with single whole-body X-radiation at a dose of 0.24 Gy on day 10, 13, or 15 of gestation. Fetuses were obtained from mothers during 1 and 24 hours after irradiation. Pyknotic cells in the ventricular zone of telencephalon were counted in serial histological sections. Incidence of pyknotic cells peaked during 6 and 9 hours after irradiation in each gestation day group. Then, dose-response curves were obtained 6 hours after 0-0.48 Gy of irradiation. All three dose-response curves showed clear linearity in the dose range lower than 0.24 Gy. Ratios of radiosensitivity estimated from the slopes of dose-response curves in day 10, 13, and 15 groups were 1, 1.4, and 0.4, respectively. These demonstrated that ventricular cells in the day 13 fetal telencephalon were the most radiosensitive among the three different age groups. In order to confirm the presence of the highly radiosensitive stage common to mammalian cerebral cortical histogenesis, pregnant F344 rats were treated with single whole-body gamma-irradiation at a dose of 0.48 Gy on day 13, 14, 15, 17, or 19 of gestation. The incidence of pyknotic cells in the ventricular zone of telencephalon was examined microscopically during 1 and 24 hours after irradiation. The peak incidence was shown 6 hours after irradiation in all the treated groups, and the highest peak incidence was shown in day-15-treated group. The developmental stage of telencephalon of day 15 rat fetuses was comparable to that of day 13 mouse fetuses. Thus, the highest radiosensitivity in terms of acute cell death was shown in the same developmental stage of brain development, i.e., the beginning phase of cerebral cortical histogenesis, in both mice and rats

  13. A phosphate-dependent shift in redox state of cerium oxide nanoparticles and its effects on catalytic properties

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Sanjay; Dosani, Talib; Karakoti, Ajay S.; Kumar, Amit; Seal, Sudipta; Self, William

    2011-10-01

    Cerium oxide nanoparticles (CeNPs) have shown promise as catalytic antioxidants in cell culture and animal models as both superoxide dismutase and catalase mimetics. The reactivity of the cerium (Ce) atoms at the surface of its oxide particle is critical to such therapeutic properties, yet little is known about the potential for a protein or small molecule corona to form on these materials in vivo. Moreover Ce atoms in these active sites have the potential to interact with small molecule anions, peptides, or sugars when administered in culture or animal models. Several nanomaterials have been shown to alter or aggregate under these conditions, rendering them less useful for biomedical applications. In this work we have studied the change in catalytic properties of CeNPs when exposed to various biologically relevant conditions in vitro. We have found that CeNPs are resistant to broad changes in pH and also not altered by incubation in cell culture medium. However to our surprise phosphate anions significantly altered the characteristics of these nanomaterials and shifted the catalytic behavior due to the binding of phosphate anions to cerium. Given the abundance of phosphate in biological systems in an inorganic form, it is likely that the action of CeNPs as a catalyst may be strongly influenced by the local concentration of phosphate in the cells and/or tissues in which it has been introduced.

  14. Developmental disorders of the brain can be caused by PCBs; low doses of hydroxy-PCBs disrupt thyroid hormone-dependent dendrite formation from Purkinje neurons in culture

    Energy Technology Data Exchange (ETDEWEB)

    Kuroda, Y; Kimura-Kuroda, J [Tokyo Metropol. Inst. for Neuroscience, Tokyo (Japan); Nagata, I [CREST/ JST, Tokyo (Japan)

    2004-09-15

    Exposure to some environmental chemicals during the perinatal period causes developmental disorders of the brain. Cognitive impairment and hyperactivity in infants were reported in Taiwan, known as Yu-cheng incidents caused by the accidental contamination of polychlorinated biphenyls (PCBs). Together with recent experimental data, Kuroda proposes a hypothesis that spatio-temporal disruptions of developing neuronal circuits by PCB exposure can cause the comobidity of learning disorders (LD), attention deficit hyperactivity disorder (ADHD) and autsm with the co-exposure to other environmental chemicals. PCBs and hydroxylated PCBs (OH-PCBs) have similar chemical structures to thyroid hormones (TH), thyroxine (T4) and triiodothyronine (T3). TH deficiency in the perinatal period causes cretinism children with severe cognitive and mental retardation. In primate model, Rice demonstrates that postnatal exposure to PCBs can dramatically influence later behavioral function. Epidemiological studies also indicate the possible developmental neurotoxicity of PCBs accumulated in human bodies. However, the precise underlying mechanisms and which types of PCB or OH-PCB with such effects have yet to be elucidated. It is important to establish a simple, reproducible, and sensitive in vitro assay for determining the effects of PCBs and OH-PCBs on the development of the central nervous system. Recently Iwasaki et al. established a reporter assay system and disclosed that low doses of PCBs potentially interfere TH-dependent gene expressions. This is the first demonstration that PCBs and OH-PCBs directly affect TH-receptor (TR)-mediated gene expressions crucial to the brain development, through unique mechanism. We also have demonstrated TH-dependent development of Purkinje neurons in vitro using a serum-free chemically defined medium. The degree of dendritic development of Purkinje cells is TH dose-dependent and exhibits high sensitivity in the pM order. Therefore, in the present study

  15. Developmental stage-dependent influence of environmental factors on growth of rural Sundanese children in West Java, Indonesia.

    Science.gov (United States)

    Sekiyama, Makiko; Roosita, Katrin; Ohtsuka, Ryutaro

    2015-05-01

    This study investigated the growth trajectories and the relative relevance levels of nutrition, disease, and hormonal status at various developmental stages among children in adverse environments to provide population-based empirical evidence for the life history theory. Three years of longitudinal anthropometric data in 1-year intervals were obtained from 418 boys and girls aged 0 to 12 years at recruitment. Following the final measurement, the main survey, which included blood and feces sampling, 3-h interval food consumption recall surveys for energy and nutrient intakes and anthropometry, was performed. Blood and feces were used for detecting, respectively, anemia and hormonal (IGF-I and IGFBP-3) levels as well as intestinal helminthiasis (Ascaris, Trichuris, and hookworm). The major findings of this study are summarized as follows: 1) the growth velocity of the subject children lagged behind international standards during childhood and juvenility but caught up during early adolescence; 2) diseases, both intestinal helminths and anemia, had significant effects on growth in childhood but not at older ages; and 3) hormonal status significantly affected growth in the children, with its highest significance in early adolescence. A larger growth than international standards in early adolescence likely follows programmed hormonal mechanisms after the onset of puberty. The onset of puberty might be associated with adequate amounts of nutrient intake and be mediated by hormonal function, because the IGF-IZ score was significantly correlated with energy and protein intakes at the transitional period from juvenility to adolescence, when puberty occurs. © 2015 Wiley Periodicals, Inc.

  16. Morphology-Dependent Properties of Cu/CeO2 Catalysts for the Water-Gas Shift Reaction

    Directory of Open Access Journals (Sweden)

    Zhibo Ren

    2017-02-01

    Full Text Available CeO2 nanooctahedrons, nanorods, and nanocubes were prepared by the hydrothermal method and were then used as supports of Cu-based catalysts for the water-gas shift (WGS reaction. The chemical and physical properties of these catalysts were characterized by X-ray diffraction (XRD, transmission electron microscopy (TEM, N2 adsorption/desorption, UV-Vis spectroscopy, X-ray photoelectron spectroscopy (XPS, hydrogen temperature-programmed reduction (H2-TPR and in situ diffuse reflectance infra-red fourier transform spectroscopy (DRIFTS techniques. Characterization results indicate that the morphology of the CeO2 supports, originating from the selective exposure of different crystal planes, has a distinct impact on the dispersion of Cu and the catalytic properties. The nanooctahedron CeO2 catalyst (Cu-CeO2-O showed the best dispersion of Cu, the largest amount of moderate copper oxide, and the strongest Cu-support interaction. Consequently, the Cu-CeO2-O catalyst exhibited the highest CO conversion at the temperature range of 150–250 °C when compared with the nanocube and nanorod Cu-CeO2 catalysts. The optimized Cu content of the Cu-CeO2-O catalysts is 10 wt % and the CO conversion reaches 91.3% at 300 °C. A distinctive profile assigned to the evolution of different types of carbonate species was observed in the 1000–1800 cm−1 region of the in situ DRIFTS spectra and a particular type of carbonate species was identified as a potential key reaction intermediate at low temperature.

  17. Developmental shift from long-term depression to long-term potentiation in the rat medial vestibular nuclei: role of group I metabotropic glutamate receptors.

    Science.gov (United States)

    Puyal, Julien; Grassi, Silvarosa; Dieni, Cristina; Frondaroli, Adele; Demêmes, Danielle; Raymond, Jaqueline; Pettorossi, Vito Enrico

    2003-12-01

    The effects of high frequency stimulation (HFS) of the primary vestibular afferents on synaptic transmission in the ventral part of the medial vestibular nuclei (vMVN) were studied during postnatal development and compared with the changes in the expression of the group I metabotropic glutamate receptor (mGluR) subtypes, mGluR1 and mGluR5. During the first stages of development, HFS always induced a mGluR5- and GABAA-dependent long-term depression (LTD) which did not require NMDA receptor and mGluR1 activation. The probability of inducing LTD decreased progressively throughout the development and it was zero at about the end of the second postnatal week. Conversely, long-term potentiation (LTP) appeared at the beginning of the second week and its occurrence increased to reach the adult value at the end of the third week. Of interest, the sudden change in the LTP frequency occurred at the time of eye opening, about the end of the second postnatal week. LTP depended on NMDA receptor and mGluR1 activation. In parallel with the modifications in synaptic plasticity, we observed that the expression patterns and localizations of mGluR5 and mGluR1 in the medial vestibular nuclei (MVN) changed during postnatal development. At the earlier stages the mGluR1 expression was minimal, then increased progressively. In contrast, mGluR5 expression was initially high, then decreased. While mGluR1 was exclusively localized in neuronal compartments and concentrated at the postsynaptic sites at all stages observed, mGluR5 was found mainly in neuronal compartments at immature stages, then preferentially in glial compartments at mature stages. These results provide the first evidence for a progressive change from LTD to LTP accompanied by a distinct maturation expression of mGluR1 and mGluR5 during the development of the MVN.

  18. Shift Colors

    Science.gov (United States)

    Publications & News Shift Colors Pages default Sign In NPC Logo Banner : Shift Colors Search Navy Personnel Command > Reference Library > Publications & News > Shift Colors Top Link Bar Navy Personnel Library Expand Reference Library Quick Launch Shift Colors Shift Colors Archives Mailing Address How to

  19. Immersion angle dependence of the resonant-frequency shift of the quartz crystal microbalance in a liquid: effects of longitudinal wave.

    Science.gov (United States)

    Yoshimoto, Minoru; Kobirata, Satoshi; Aizawa, Hideo; Kurosawa, Shigeru

    2007-06-19

    We investigated the effects of the longitudinal wave on the immersion angle dependence of the resonant-frequency shift, deltaF, of the quartz crystal microbalance, QCM. In order to study exactly the effects, we employed the three types of cells: normal cell, cell with the glass beads and cell with sponge. The longitudinal wave exists in the normal cell. On the other hand, both the cell with the glass beads and the cell with sponge eliminate the longitudinal wave. As results, we have found that the tendencies of deltaF are the same in the three types of cells. That is, we conclude that the longitudinal wave does not have effects on the immersion angle dependence of deltaF.

  20. Studies of the pH dependence of 13C shifts and carbon-carbon coupling constants of [U-13C]aspartic and -glutamic acids

    International Nuclear Information System (INIS)

    London, R.E.; Walker, T.E.; Kollman, V.H.; Matwiyoff, N.A.

    1978-01-01

    13 C NMR studies of the chemical shifts and carbon--carbon spin--spin coupling constants of 90% [U- 13 C]aspartic and -glutamic acids are reported. Effects of titration of the two carboxyl groups are separated computationally and the results compared with those for asparagine and glutamine, aspartate and glutamate containing peptides, and a series of amino-n-butyric acids. The results indicate that the carboxyl carbon shift resulting from titration of the carboxyl group is strongly dependent on its distance (number of bonds) from an amino group. Alternatively, remote methyl groups exhibit a much smaller titration induced shift than carboxyl groups in the corresponding position. Significant remote effects of pH titration on the one-bond carbon-carbon coupling are also observed, particularly for couplings involving the side-chain carboxyl carbons. These results are discussed in terms of polarization of the C--O bonds in response to titration of a remote carboxyl group. Values of 3 J/sub CC/ in asparate and glutamate indicate a strong conformational dependence. Rotamer populations predicted on the basis of the observed couplings and theoretical INDO calculations are in good agreement with values based on analysis of the 3 J/sub HH/ and 3 J/sub CH/ couplings. For a given conformation of glutamic acid, it is found that 3 J 14 is considerably smaller than 3 J 25 . This result is consistent with obsrvations on a number of other 13 C-labeled amino acids. 5 figures, 4 tables

  1. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. The citrus postharvest pathogen Penicillium digitatum depends on the PdMpkB kinase for developmental and virulence functions.

    Science.gov (United States)

    Ma, Haijie; Sun, Xuepeng; Wang, Mingshuang; Gai, Yunpeng; Chung, Kuang-Ren; Li, Hongye

    2016-11-07

    The postharvest pathogen Penicillium digitatum causes green mold decay on citrus fruit, resulting in severe economic losses. To explore possible factors involved in fungal pathogenesis, phenotypic characterization of the budding yeast Fus3/Kiss1 mitogen-activated protein (MAP) kinase homolog was carried out. The P. digitatum MAP kinase B coding gene, designated PdMpkB, was functionally inactivated via homologous recombination. The fungal strain (∆PdMpkB) carrying a PdMpkBdeletion demonstrated altered gene expression profiles, reduced growth and conidiogenesis, elevated resistance to osmotic stress, and failed to induce green mold decay on citrus fruit. ∆PdMpkB was more resistant to CaCl2, NaCl and sorbitol than its progenitor strain, indicating a negative regulatory function of PdMpkB in osmotic stress adaptation. Fungal infection assays on citrus fruit revealed that ∆PdMpkB proliferated poorly within host tissues, induced water-soaking lesions, failed to break through host cuticle layers and thus, failed to produce aerial hyphae and conidia. Introduction of a functional copy of PdMpkB into a null mutant restored all defective phenotypes. Transcriptome analysis revealed that inactivation of PdMpkB impacted expression of the genes associated with cell wall-degrading enzyme activities, carbohydrate and amino acid metabolisms, conidial formation, and numerous metabolic processes. Our results define pivotal roles of the PdMpkB-mediated signaling pathway in developmental and pathological functions in the citrus postharvest pathogen P. digitatum. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Modeling the focusing efficiency of lobster-eye optics for image shifting depending on the soft x-ray wavelength.

    Science.gov (United States)

    Su, Luning; Li, Wei; Wu, Mingxuan; Su, Yun; Guo, Chongling; Ruan, Ningjuan; Yang, Bingxin; Yan, Feng

    2017-08-01

    Lobster-eye optics is widely applied to space x-ray detection missions and x-ray security checks for its wide field of view and low weight. This paper presents a theoretical model to obtain spatial distribution of focusing efficiency based on lobster-eye optics in a soft x-ray wavelength. The calculations reveal the competition mechanism of contributions to the focusing efficiency between the geometrical parameters of lobster-eye optics and the reflectivity of the iridium film. In addition, the focusing efficiency image depending on x-ray wavelengths further explains the influence of different geometrical parameters of lobster-eye optics and different soft x-ray wavelengths on focusing efficiency. These results could be beneficial to optimize parameters of lobster-eye optics in order to realize maximum focusing efficiency.

  4. The malleable gut microbiome of juvenile rainbow trout (Oncorhynchus mykiss): Diet-dependent shifts of bacterial community structures.

    Science.gov (United States)

    Michl, Stéphanie Céline; Ratten, Jenni-Marie; Beyer, Matt; Hasler, Mario; LaRoche, Julie; Schulz, Carsten

    2017-01-01

    Plant-derived protein sources are the most relevant substitutes for fishmeal in aquafeeds. Nevertheless, the effects of plant based diets on the intestinal microbiome especially of juvenile Rainbow trout (Oncorhynchus mykiss) are yet to be fully investigated. The present study demonstrates, based on 16S rDNA bacterial community profiling, that the intestinal microbiome of juvenile Rainbow trout is strongly affected by dietary plant protein inclusion levels. After first feeding of juveniles with either 0%, 50% or 97% of total dietary protein content derived from plants, statistically significant differences of the bacterial gut community for the three diet-types were detected, both at phylum and order level. The microbiome of juvenile fish consisted mainly of the phyla Proteobacteria, Firmicutes, Bacteroidetes, Fusobacteria and Actinobacteria, and thus fits the salmonid core microbiome suggested in previous studies. Dietary plant proteins significantly enhanced the relative abundance of the orders Lactobacillales, Bacillales and Pseudomonadales. Animal proteins in contrast significantly promoted Bacteroidales, Clostridiales, Vibrionales, Fusobacteriales and Alteromonadales. The overall alpha diversity significantly decreased with increasing plant protein inclusion levels and with age of experimental animals. In order to investigate permanent effects of the first feeding diet-type on the early development of the microbiome, a diet change was included in the study after 54 days, but no such effects could be detected. Instead, the microbiome of juvenile trout fry was highly dependent on the actual diet fed at the time of sampling.

  5. Electrophoretic mobility shift in native gels indicates calcium-dependent structural changes of neuronal calcium sensor proteins.

    Science.gov (United States)

    Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat

    2016-02-01

    In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Concurrent Increases and Decreases in Local Stability and Conformational Heterogeneity in Cu, Zn Superoxide Dismutase Variants Revealed by Temperature-Dependence of Amide Chemical Shifts.

    Science.gov (United States)

    Doyle, Colleen M; Rumfeldt, Jessica A; Broom, Helen R; Sekhar, Ashok; Kay, Lewis E; Meiering, Elizabeth M

    2016-03-08

    The chemical shifts of backbone amide protons in proteins are sensitive reporters of local structural stability and conformational heterogeneity, which can be determined from their readily measured linear and nonlinear temperature-dependences, respectively. Here we report analyses of amide proton temperature-dependences for native dimeric Cu, Zn superoxide dismutase (holo pWT SOD1) and structurally diverse mutant SOD1s associated with amyotrophic lateral sclerosis (ALS). Holo pWT SOD1 loses structure with temperature first at its periphery and, while having extremely high global stability, nevertheless exhibits extensive conformational heterogeneity, with ∼1 in 5 residues showing evidence for population of low energy alternative states. The holo G93A and E100G ALS mutants have moderately decreased global stability, whereas V148I is slightly stabilized. Comparison of the holo mutants as well as the marginally stable immature monomeric unmetalated and disulfide-reduced (apo(2SH)) pWT with holo pWT shows that changes in the local structural stability of individual amides vary greatly, with average changes corresponding to differences in global protein stability measured by differential scanning calorimetry. Mutants also exhibit altered conformational heterogeneity compared to pWT. Strikingly, substantial increases as well as decreases in local stability and conformational heterogeneity occur, in particular upon maturation and for G93A. Thus, the temperature-dependence of amide shifts for SOD1 variants is a rich source of information on the location and extent of perturbation of structure upon covalent changes and ligand binding. The implications for potential mechanisms of toxic misfolding of SOD1 in disease and for general aspects of protein energetics, including entropy-enthalpy compensation, are discussed.

  7. Dose-Dependent Change in Elimination Kinetics of Ethanol due to Shift of Dominant Metabolizing Enzyme from ADH 1 (Class I to ADH 3 (Class III in Mouse

    Directory of Open Access Journals (Sweden)

    Takeshi Haseba

    2012-01-01

    Full Text Available ADH 1 and ADH 3 are major two ADH isozymes in the liver, which participate in systemic alcohol metabolism, mainly distributing in parenchymal and in sinusoidal endothelial cells of the liver, respectively. We investigated how these two ADHs contribute to the elimination kinetics of blood ethanol by administering ethanol to mice at various doses, and by measuring liver ADH activity and liver contents of both ADHs. The normalized AUC (AUC/dose showed a concave increase with an increase in ethanol dose, inversely correlating with β. CLT (dose/AUC linearly correlated with liver ADH activity and also with both the ADH-1 and -3 contents (mg/kg B.W.. When ADH-1 activity was calculated by multiplying ADH-1 content by its Vmax⁡/mg (4.0 and normalized by the ratio of liver ADH activity of each ethanol dose to that of the control, the theoretical ADH-1 activity decreased dose-dependently, correlating with β. On the other hand, the theoretical ADH-3 activity, which was calculated by subtracting ADH-1 activity from liver ADH activity and normalized, increased dose-dependently, correlating with the normalized AUC. These results suggested that the elimination kinetics of blood ethanol in mice was dose-dependently changed, accompanied by a shift of the dominant metabolizing enzyme from ADH 1 to ADH 3.

  8. Temperature Dependences for Air-broadened Widths and Shift Coefficients in the 30013 - 00001 and 30012 - 00001 Bands of Carbon Dioxide near 1600 nm

    Science.gov (United States)

    Devi, M.; Predoi-Cross, A.; McKellar, R.; Benner, C.; Miller, C. E.; Toth, R. A.; Brown, L. R.

    2008-12-01

    Nearly 40 high resolution spectra of air-broadened CO2 recorded at temperatures between 215 and 294 K were analyzed using a multispectrum nonlinear least squares technique to determine temperature dependences of air-broadened half width and air-induced pressure shift coefficients in the 30013-00001 and 30012-00001 bands of 12CO2. Data were recorded with two different Fourier transform spectrometers (Kitt Peak FTS at the National Solar Observatory in Arizona and the Bomem FTS at NRC, Ottawa) with optical path lengths ranging between 25 m and 121 m. The sample pressures varied between 11 torr (pure CO2) and 924 torr (CO2-air) with volume mixing ratios of CO2 in air between ~ 0.015 and 0.11. To minimize systematic errors and increase the accuracy of the retrieved parameters, we constrained the multispectrum nonlinear least squares fittings to use quantum mechanical expressions for the rovibrational energies and intensities rather than retrieving the individual positions and intensities line-by-line. The results suggest minimal vibrational dependence for the temperature dependence coefficients.1 1 A. Predoi-Cross and R. Mckellar are grateful for financial support from the National Sciences and Engineering Research Council of Canada. The research at the Jet Propulsion laboratory (JPL), California Institute of Technology, was performed under contract with National Aeronautics and Space Administration. The support received from the National Science Foundation under Grant No. ATM-0338475 to the College of William and Mary is greatly appreciated. The authors thank Mike Dulick of the National Solar Observatory for his assistance in obtaining the data recorded at Kitt Peak.

  9. Spatial coordinate systems for tactile spatial attention depend on developmental vision: evidence from event-related potentials in sighted and congenitally blind adult humans.

    Science.gov (United States)

    Röder, Brigitte; Föcker, Julia; Hötting, Kirsten; Spence, Charles

    2008-08-01

    Changes in limb posture (such as crossing the hands) can impair people's performance in tasks such as those involving temporal order judgements, when one tactile stimulus is presented to either hand. This crossed hands deficit has been attributed to a conflict between externally and anatomically anchored reference systems when people localize tactile stimuli. Interestingly, however, the performance of congenitally blind adults does not seem to be affected by crossing the hands, suggesting a default use of an anatomically rather than an externally anchored reference system for tactile localization. In the present study, 12 congenitally blind and 12 sighted adults were instructed to attend to either the left or the right hand on a trial-by-trial basis in order to detect rare deviants (consisting of a double touch) at that hand, while ignoring both deviants at the other hand and frequent standard stimuli (consisting of a single touch) presented to either hand. Only the sighted participants performed less accurately when they crossed their hands. Concurrent electroencephalogram recordings revealed an early contralateral attention positivity, followed by an attention negativity in the sighted group when they adopted the uncrossed hands posture. For the crossed hand posture, only the attention negativity was observed with reduced amplitude in the sighted group. By contrast, the congenitally blind group displayed an event-related potential attention negativity that did not vary when the posture of their hands was changed. These results demonstrate that the default use of an external frame of reference for tactile localization seems to depend on developmental vision.

  10. The evolutionary transition from subsocial to eusocial behaviour in Dictyoptera: phylogenetic evidence for modification of the "shift-in-dependent-care" hypothesis with a new subsocial cockroach.

    Science.gov (United States)

    Pellens, Roseli; D'Haese, Cyrille A; Bellés, Xavier; Piulachs, Maria-Dolors; Legendre, Frédéric; Wheeler, Ward C; Grandcolas, Philippe

    2007-05-01

    Cockroaches have always been used to understand the first steps of social evolution in termites because they are close relatives with less complex and integrated social behaviour. Termites are all eusocial and ingroup comparative analysis would be useless to infer the origin of their social behaviour. The cockroach genus Cryptocercus was used as a so-called "prototermite" model because it shows key-attributes similar to the termites (except Termitidae): wood-feeding, intestinal flagellates and subsocial behaviour. In spite of these comparisons between this subsocial cockroach and eusocial termites, the early and remote origin of eusocial behaviour in termites is not well understood yet and the study of other relevant "prototermite" models is however needed. A molecular phylogenetic analysis was carried out to validate a new "prototermite" model, Parasphaeria boleiriana which shows a peculiar combination of these key-attributes. It shows that these attributes of Parasphaeria boleiriana have an independent origin from those of other wood-eating cockroaches and termites. The case of P. boleiriana suggests that a short brood care was selected for with life on an ephemeral wood resource, even with the need for transmission of flagellates. These new phylogenetic insights modify evolutionary hypotheses, contradicting the assumption made with Cryptocercus model that a long brood care is necessary for cooperation between broods in the "shift-in-dependent-care" hypothesis. An ephemeral wood resource is suggested to prompt generation overlap and the evolution of cooperation, even if brood care is shortened.

  11. Lemna minor plants chronically exposed to ionising radiation: RNA-seq analysis indicates a dose rate dependent shift from acclimation to survival strategies.

    Science.gov (United States)

    Van Hoeck, Arne; Horemans, Nele; Nauts, Robin; Van Hees, May; Vandenhove, Hildegarde; Blust, Ronny

    2017-04-01

    Ecotoxicological research provides knowledge on ionising radiation-induced responses in different plant species. However, the sparse data currently available are mainly extracted from acute exposure treatments. To provide a better understanding of environmental exposure scenarios, the response to stress in plants must be followed in more natural relevant chronic conditions. We previously showed morphological and biochemical responses in Lemna minor plants continuously exposed for 7days in a dose-rate dependent manner. In this study responses on molecular (gene expression) and physiological (photosynthetic) level are evaluated in L. minor plants exposed to ionising radiation. To enable this, we examined the gene expression profiles of irradiated L. minor plants by using an RNA-seq approach. The gene expression data reveal indications that L. minor plants exposed at lower dose rates, can tolerate the exposure by triggering acclimation responses. In contrast, at the highest dose rate tested, a high number of genes related to antioxidative defense systems, DNA repair and cell cycle were differentially expressed suggesting that only high dose rates of ionising radiation drive L. minor plants into survival strategies. Notably, the photosynthetic process seems to be unaffected in L. minor plants among the tested dose rates. This study, supported by our earlier work, clearly indicates that plants shift from acclimation responses towards survival responses at increasing dose rates of ionising radiation. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Developmental Hypothyroidism Reduces the Expression of Activity-Dependent Plasticity Genes in Denate Gyrus of the Adult Following Long Term Potentiation

    Science.gov (United States)

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neuro...

  13. Shifting Attention

    Science.gov (United States)

    Ingram, Jenni

    2014-01-01

    This article examines the shifts in attention and focus as one teacher introduces and explains an image that represents the processes involved in a numeric problem that his students have been working on. This paper takes a micro-analytic approach to examine how the focus of attention shifts through what the teacher and students do and say in the…

  14. Leftward shift in the voltage-dependence for Ca2+ currents activation induced by a new toxin from Phoneutria reidyi (Aranae, Ctenidae) venom.

    Science.gov (United States)

    Vieira, L B; Pimenta, A M C; Richardson, M; Bemquerer, M P; Reis, H J; Cruz, J S; Gomez, M V; Santoro, M M; Ferreira-de-Oliveira, R; Figueiredo, S G; Snutch, T P; Cordeiro, M N

    2007-02-01

    Various neurotoxins have been described from the venom of the Brazilian spider Phoneutria nigriventer, but little is known about the venoms of the other species of this genus. In the present work, we describe the purification and some structural and pharmacological features of a new toxin (PRTx3-7) from Phoneutria reidyi that causes flaccid paralysis in mice. The observed molecular mass (4627.26 Da) was in accordance with the calculated mass for the amidated form of the amino acid sequence (4627.08 Da). The presence of an alpha-amidated C-terminus was confirmed by MS/MS analysis of the C-terminal peptide, isolated after enzymatic digestion of the native protein with Glu-C endoproteinase. The purified protein was injected (intracerebro-ventricular) into mice at dose levels of 5 microg/mouse causing immediate agitation and clockwise gyration, followed by the gradual development of general flaccid paralysis. PRTx3-7 at 1 microM inhibited by 20% the KCl-induced increase on [Ca2+]i in rat brain synaptosomes. The HEK cells permanently expressing L, N, P/Q and R HVA Ca2+ channels were also used to better characterize the pharmacological features of PRTx3-7. To our surprise, PRTx3-7 shifted the voltage-dependence for activation towards hyperpolarized membrane potentials for L (-4 mV), P/Q (-8 mV) and R (-5 mV) type Ca2+ currents. In addition, the new toxin also affected the steady state of inactivation of L-, N- and P/Q-type Ca2+ currents.

  15. DNA methylation of the gonadal aromatase (cyp19a promoter is involved in temperature-dependent sex ratio shifts in the European sea bass.

    Directory of Open Access Journals (Sweden)

    Laia Navarro-Martín

    2011-12-01

    Full Text Available Sex ratio shifts in response to temperature are common in fish and reptiles. However, the mechanism linking temperature during early development and sex ratios has remained elusive. We show in the European sea bass (sb, a fish in which temperature effects on sex ratios are maximal before the gonads form, that juvenile males have double the DNA methylation levels of females in the promoter of gonadal aromatase (cyp19a, the enzyme that converts androgens into estrogens. Exposure to high temperature increased the cyp19a promoter methylation levels of females, indicating that induced-masculinization involves DNA methylation-mediated control of aromatase gene expression, with an observed inverse relationship between methylation levels and expression. Although different CpGs within the sb cyp19a promoter exhibited different sensitivity to temperature, we show that the increased methylation of the sb cyp19a promoter, which occurs in the gonads but not in the brain, is not a generalized effect of temperature. Importantly, these effects were also observed in sexually undifferentiated fish and were not altered by estrogen treatment. Thus, methylation of the sb cyp19a promoter is the cause of the lower expression of cyp19a in temperature-masculinized fish. In vitro, induced methylation of the sb cyp19a promoter suppressed the ability of SF-1 and Foxl2 to stimulate transcription. Finally, a CpG differentially methylated by temperature and adjacent to a Sox transcription factor binding site is conserved across species. Thus, DNA methylation of the aromatase promoter may be an essential component of the long-sought-after mechanism connecting environmental temperature and sex ratios in vertebrate species with temperature-dependent sex determination.

  16. Developmental Immunotoxicity

    Science.gov (United States)

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  17. The South African developmental landscape: restricted potentials or expansive, complex adaptive opportunities?

    Directory of Open Access Journals (Sweden)

    C J Burman

    2013-07-01

    Full Text Available This article argues that the South African developmental landscape is currently locked into an overly technical, path dependent paradigm that is unlikely to be capable of embracing the complex challenges identified by the recent National Development Plan. The article explores the internal logic of the existing path dependent, technical condition from the perspective of complexity, in the context of the Department of Science and Technology’s Fifth Grand Challenge and “continuous change”. It is argued that drawing ideas from complexity into future developmental trajectories can add value to the National Development Plan: Vision 2030, but to do so will require dynamic mind-set shifts across multiple developmental scales and interfaces if new approaches to managing development that embraces complexity, rather than denies it, is to emerge. Keywords: development; complexity; path dependency; epistemological vigilance; sense-making; National Development Plan Disciplines: Complexity Studies; Transdisciplinary studies; Management studies; Public management; Political studies; Economics; Development Studies

  18. Developmental Scaffolding

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2015-01-01

    . Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

  19. Case study: in vivo stress diagnostics by spectroscopic determination of the cutaneous carotenoid antioxidant concentration in midwives depending on shift work

    International Nuclear Information System (INIS)

    Maeter, H; Briese, V; Gerber, B; Darvin, M E; Lademann, J; Olbertz, D M

    2013-01-01

    Laser spectroscopic methods, for instance resonance Raman spectroscopy and reflectance spectroscopy, permit us for the first time to investigate the antioxidative status in human skin non-invasively by measurement of carotenoid concentration. The individual antioxidant concentration of the human skin is determined by the nutritional habits, on the one hand, and by stressors, such as shift work, on the other. Due to the disturbance of the circadian rhythm and melatonin secretion, shift work is associated with, inter alia, insomnia and gastrointestinal disorders. The study at hand was the first to determine the cutaneous antioxidant concentration of midwives using reflectance spectroscopy and to relate the results to shift work. Seven midwives took part in the study. An LED-based compact scanner system was used for non-invasive measurements of carotenoids in human skin. The measuring principle is based on reflection spectroscopy. The study at hand suggests that the cutaneous antioxidative status may be adversely affected by shift work. Despite numerous international strategies of programmes available which invite people to eat more healthily, there are only a few measures aiming at stress reduction and management. In this field the use of reflectance spectroscopic investigation methods could play an essential role in the future. (letter)

  20. Developmental delay

    Science.gov (United States)

    Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...

  1. Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge; Kristensen, Tage Søndergaard

    2003-01-01

    Human Deveoplment and Working Life - Work for Welfare explores whether the development of human resources at company level can improve individuals' quality of life, companies' possibilities of development, and welfare and democracy in society. Chapter two discuss the concept "developmental work...

  2. Market shifting

    Energy Technology Data Exchange (ETDEWEB)

    Forst, Michael

    2013-11-01

    After years of oversupply and artificially low module pricing, market analysts believe that the solar industry will begin to stabilize by 2017. While the market activities are shifting from Europe to the Asia Pacific region and the United States, the solar shakeout continues to be in full swing including solar cell and module manufacturing. (orig.)

  3. Tough Shift

    DEFF Research Database (Denmark)

    Brewer, Robert S.; Verdezoto, Nervo; Holst, Thomas

    2015-01-01

    people to change their behavior at home. Leveraging prior research on encouraging reductions in residential energy use through game play, we introduce ShareBuddy: a casual mobile game intended to encourage players not only to reduce, but also to shift their electricity use. We conducted two field studies...... real-world resource use into a game....

  4. Thickness-dependent blue shift in the excitonic peak of conformally grown ZnO:Al on ion-beam fabricated self-organized Si ripples

    Energy Technology Data Exchange (ETDEWEB)

    Basu, T.; Kumar, M.; Som, T., E-mail: tsom@iopb.res.in [Institute of Physics, Sachivalaya Marg, Bhubaneswar 751 005 (India); Nandy, S. [CENIMAT, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, Caparica 2829 516 (Portugal); Satpati, B. [Surface Physics and Material Science Division, Saha Institute of Nuclear Physics, Kolkata 700 064 (India); Saini, C. P.; Kanjilal, A. [Department of Physics, School of Natural Sciences, Shiv Nadar University, Gautam Budh Nagar, Uttar Pradesh 201 314 (India)

    2015-09-14

    Al-doped ZnO (AZO) thin films of thicknesses 5,10, 15, 20, and 30 nm were deposited on 500 eV argon ion-beam fabricated nanoscale self-organized rippled-Si substrates at room temperature and are compared with similar films deposited on pristine-Si substrates (without ripples). It is observed that morphology of self-organized AZO films is driven by the underlying substrate morphology. For instance, for pristine-Si substrates, a granular morphology evolves for all AZO films. On the other hand, for rippled-Si substrates, morphologies having chain-like arrangement (anisotropic in nature) are observed up to a thickness of 20 nm, while a granular morphology evolves (isotropic in nature) for 30 nm-thick film. Photoluminescence studies reveal that excitonic peaks corresponding to 5–15 nm-thick AZO films, grown on rippled-Si templates, show a blue shift of 8 nm and 3 nm, respectively, whereas the peak shift is negligible for 20-nm thick film (with respect to their pristine counter parts). The observed blue shifts are substantiated by diffuse reflectance study and attributed to quantum confinement effect, associated with the size of the AZO grains and their spatial arrangements driven by the anisotropic morphology of underlying rippled-Si templates. The present findings will be useful for making tunable AZO-based light-emitting devices.

  5. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  6. Majority Group Members' Negative Reactions to Future Demographic Shifts Depend on the Perceived Legitimacy of Their Status: Findings from the United States and Portugal.

    Science.gov (United States)

    Outten, H Robert; Lee, Timothy; Costa-Lopes, Rui; Schmitt, Michael T; Vala, Jorge

    2018-01-01

    Using concepts from social identity theory (Tajfel and Turner, 1979), we examined whether racial/ethnic majority group members' reactions to future demographic shifts is a function of the degree to which they perceive their ingroup's higher-status in society to be legitimate. In two studies, participants who varied in the degree to which they perceived their group's status to be legitimate were either exposed to real projections for 2060 (i.e., large decline in proportion of population that is the "majority" group), or fake projections for 2060-that resembled current figures (i.e., small decline). In Study 1, White Americans who perceived their status to be highly legitimate expressed greater intergroup threat, and negative feelings (anger and fear) toward minorities after exposure to projections with a large decline in the relative size of the White American population. In contrast, demographic shift condition had no effect on intergroup threat and negative feelings toward minorities among White Americans who perceived their status to be relatively illegitimate; negative feelings and threat remained low across both conditions. Similarly, in Study 2, ethnic Portuguese people in Portugal exposed to projections in which there was a large decline in the relative size of the ethnic Portuguese population experienced more intergroup threat and expressed a greater desire to engage in anti-immigration behaviors. The effect of demographic shift condition on intergroup threat and anti-immigration behaviors was stronger among ethnic Portuguese who perceived their status to be legitimate compared to ethnic Portuguese people who perceived their status to be relatively illegitimate. These results highlight that across different cultural contexts, majority group members' beliefs about the legitimacy of intergroup relations can affect their reactions to the prospect of increased diversity.

  7. Majority Group Members' Negative Reactions to Future Demographic Shifts Depend on the Perceived Legitimacy of Their Status: Findings from the United States and Portugal

    Directory of Open Access Journals (Sweden)

    H. Robert Outten

    2018-02-01

    Full Text Available Using concepts from social identity theory (Tajfel and Turner, 1979, we examined whether racial/ethnic majority group members' reactions to future demographic shifts is a function of the degree to which they perceive their ingroup's higher-status in society to be legitimate. In two studies, participants who varied in the degree to which they perceived their group's status to be legitimate were either exposed to real projections for 2060 (i.e., large decline in proportion of population that is the “majority” group, or fake projections for 2060—that resembled current figures (i.e., small decline. In Study 1, White Americans who perceived their status to be highly legitimate expressed greater intergroup threat, and negative feelings (anger and fear toward minorities after exposure to projections with a large decline in the relative size of the White American population. In contrast, demographic shift condition had no effect on intergroup threat and negative feelings toward minorities among White Americans who perceived their status to be relatively illegitimate; negative feelings and threat remained low across both conditions. Similarly, in Study 2, ethnic Portuguese people in Portugal exposed to projections in which there was a large decline in the relative size of the ethnic Portuguese population experienced more intergroup threat and expressed a greater desire to engage in anti-immigration behaviors. The effect of demographic shift condition on intergroup threat and anti-immigration behaviors was stronger among ethnic Portuguese who perceived their status to be legitimate compared to ethnic Portuguese people who perceived their status to be relatively illegitimate. These results highlight that across different cultural contexts, majority group members' beliefs about the legitimacy of intergroup relations can affect their reactions to the prospect of increased diversity.

  8. Developmental changes in real life decision making: performance on a gambling task previously shown to depend on the ventromedial prefrontal cortex.

    Science.gov (United States)

    Crone, Eveline A; van der Molen, Maurits W

    2004-01-01

    Patients with bilateral lesions of the ventromedial prefrontal cortex, when performing gambling tasks modeling real-life decision-making, opt for choices that yield high immediate gains in spite of higher future losses. Under the hypothesis that the prefrontal cortex is the last brain region to mature, it was examined whether young children would show a similar preference for immediate prospects. In Experiment 1, 4 age groups (6-9, 10-12, 13-15 and 18-25 years olds) performed 2 versions of a computerized variant of the original Iowa gambling task under 3 different feedback conditions (no feedback, global feedback, and option-specific feedback) and completed the Raven Standard Progressive Matrices as an index of inductive reasoning ability. In Experiment 2, 3 age groups (7-8, 11-12, and 15-16 year olds) performed both task versions in addition to a working memory task ("Digit Span Backwards"). Results showed a developmental increase in the sensitivity to future consequences, positive or negative, that could not be explained by developmental changes in working memory capacity or inductive reasoning. It was concluded that young children share with ventromedial prefrontal patients the failure to anticipate on future outcomes.

  9. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  10. Fluid Shifts

    Science.gov (United States)

    Stenger, M. B.; Hargens, A. R.; Dulchavsky, S. A.; Arbeille, P.; Danielson, R. W.; Ebert, D. J.; Garcia, K. M.; Johnston, S. L.; Laurie, S. S.; Lee, S. M. C.; hide

    2017-01-01

    Introduction. NASA's Human Research Program is focused on addressing health risks associated with long-duration missions on the International Space Station (ISS) and future exploration-class missions beyond low Earth orbit. Visual acuity changes observed after short-duration missions were largely transient, but now more than 50 percent of ISS astronauts have experienced more profound, chronic changes with objective structural findings such as optic disc edema, globe flattening and choroidal folds. These structural and functional changes are referred to as the visual impairment and intracranial pressure (VIIP) syndrome. Development of VIIP symptoms may be related to elevated intracranial pressure (ICP) secondary to spaceflight-induced cephalad fluid shifts, but this hypothesis has not been tested. The purpose of this study is to characterize fluid distribution and compartmentalization associated with long-duration spaceflight and to determine if a relation exists with vision changes and other elements of the VIIP syndrome. We also seek to determine whether the magnitude of fluid shifts during spaceflight, as well as any VIIP-related effects of those shifts, are predicted by the crewmember's pre-flight status and responses to acute hemodynamic manipulations, specifically posture changes and lower body negative pressure. Methods. We will examine a variety of physiologic variables in 10 long-duration ISS crewmembers using the test conditions and timeline presented in the figure below. Measures include: (1) fluid compartmentalization (total body water by D2O, extracellular fluid by NaBr, intracellular fluid by calculation, plasma volume by CO rebreathe, interstitial fluid by calculation); (2) forehead/eyelids, tibia, and calcaneus tissue thickness (by ultrasound); (3) vascular dimensions by ultrasound (jugular veins, cerebral and carotid arteries, vertebral arteries and veins, portal vein); (4) vascular dynamics by MRI (head/neck blood flow, cerebrospinal fluid

  11. Borderline personality disorder and the emerging field of developmental neuroscience.

    Science.gov (United States)

    Crowell, Sheila E; Kaufman, Erin A

    2016-10-01

    Over the past 2 decades there has been a dramatic shift in understanding of personality disorders, such as borderline personality disorder (BPD). What was historically viewed as an entrenched pattern of antagonistic, interpersonally dependent, and uncorrectable conduct is now seen as the outcome of complex-yet modifiable-developmental processes. The borderline label, which once inspired such harsh opprobrium in clinical communities that early diagnosis was considered taboo, is now increasingly applied to adolescents who are receiving effective treatment and desisting from a borderline trajectory. Research examining the developmental origins and early manifestations of BPD is increasing rapidly, making it an appropriate time to take stock of current developmental research and articulate an agenda for the future. We identify 4 challenges that continue to impede innovative research on borderline personality development: (a) inadequate attention to continuity and discontinuity across development, (b) medical and diagnostic systems that localize personality pathology within the individual, (c) the lingering belief that biological research is antithetical to contextual/interpersonal understandings of psychopathology (and vice versa), and (d) reluctance to reach across disciplinary and developmental boundaries to identify creative paradigms and foster innovative discovery. In order to overcome these challenges, we propose an approach to future research on adolescent borderline pathology that integrates developmental psychopathology, social and affective neuroscience, and personality theory perspectives. This intersection-the developmental neuroscience of personality pathology-offers theoretical and methodological advantages over disciplinary isolation and is fertile ground for generating novel hypotheses on the development and prevention of BPD. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  12. A population of Pax7-expressing muscle progenitor cells show differential responses to muscle injury dependent on developmental stage and injury extent

    Directory of Open Access Journals (Sweden)

    Stefanie eKnappe

    2015-08-01

    Full Text Available Muscle regeneration in vertebrates occurs by the activation of quiescent progenitor cells that express pax7 and replace and repair damaged fibers. We have developed a mechanical injury paradigm in zebrafish to determine whether developmental stage and injury size affect the regeneration dynamics of damaged muscle. We found that both small, focal injuries and large injuries affecting the entire myotome lead to the expression of myf5 and myogenin. Their expression was prolonged in older larvae, indicating a slower process of regeneration. We characterized the endogenous behavior of a population of muscle-resident Pax7-expressing cells using a pax7a:eGFP transgenic line and found that GFP+ cell migration in the myotome dramatically declined between 5 and 7 days post fertilization (dpf. Following a small injury, we observed that GFP+ cells responded by extending processes, before migrating to the injured fibers. Furthermore, these cells responded more rapidly to injury in 4dpf larvae compared to 7dpf. Interestingly, we did not see GFP+ fibers after repair of small injuries, indicating that pax7a-expressing cells did not contribute to fiber formation in this injury context. On the contrary, numerous GFP+ fibers could be observed after a large single myotome injury. Both injury models were accompanied by an increased number of proliferating GFP+ cells, which was more pronounced in larvae injured at 4dpf than 7dpf, This indicates intriguing developmental differences, even at these relatively early ages. Our data also suggests an interesting disparity in the role that pax7a-expressing muscle progenitor cells play during muscle regeneration, which may reflect the extent of muscle damage.

  13. Shifting Sugars and Shifting Paradigms

    Science.gov (United States)

    Siegal, Mark L.

    2015-01-01

    No organism lives in a constant environment. Based on classical studies in molecular biology, many have viewed microbes as following strict rules for shifting their metabolic activities when prevailing conditions change. For example, students learn that the bacterium Escherichia coli makes proteins for digesting lactose only when lactose is available and glucose, a better sugar, is not. However, recent studies, including three PLOS Biology papers examining sugar utilization in the budding yeast Saccharomyces cerevisiae, show that considerable heterogeneity in response to complex environments exists within and between populations. These results join similar recent results in other organisms that suggest that microbial populations anticipate predictable environmental changes and hedge their bets against unpredictable ones. The classical view therefore represents but one special case in a range of evolutionary adaptations to environmental changes that all organisms face. PMID:25688600

  14. Shifting sugars and shifting paradigms.

    Directory of Open Access Journals (Sweden)

    Mark L Siegal

    2015-02-01

    Full Text Available No organism lives in a constant environment. Based on classical studies in molecular biology, many have viewed microbes as following strict rules for shifting their metabolic activities when prevailing conditions change. For example, students learn that the bacterium Escherichia coli makes proteins for digesting lactose only when lactose is available and glucose, a better sugar, is not. However, recent studies, including three PLOS Biology papers examining sugar utilization in the budding yeast Saccharomyces cerevisiae, show that considerable heterogeneity in response to complex environments exists within and between populations. These results join similar recent results in other organisms that suggest that microbial populations anticipate predictable environmental changes and hedge their bets against unpredictable ones. The classical view therefore represents but one special case in a range of evolutionary adaptations to environmental changes that all organisms face.

  15. The combined effects of developmental lead and ethanol exposure on hippocampus dependent spatial learning and memory in rats: Role of oxidative stress.

    Science.gov (United States)

    Soleimani, Elham; Goudarzi, Iran; Abrari, Kataneh; Lashkarbolouki, Taghi

    2016-10-01

    Either developmental lead or ethanol exposure can impair learning and memory via induction of oxidative stress, which results in neuronal damage. we examined the effect of combined exposure with lead and ethanol on spatial learning and memory in offspring and oxidative stress in hippocampus. Rats were exposed to lead (0.2% in drinking water) or ethanol (4 g/kg) either individually or in combination in 5th day gestation through weaning. On postnatal days (PD) 30, rats were trained with six trials per day for 6 consecutive days in the water maze. On day 37, a probe test was done. Also, oxidative stress markers in the hippocampus were also evaluated. Results demonstrated that lead + ethanol co-exposed rats exhibited higher escape latency during training trials and reduced time spent in target quadrant, higher escape location latency and average proximity in probe trial test. There was significant decrease in superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx) activities and increase of malondialdehyde (MDA) levels in hippocampus of animals co-exposed to lead and ethanol compared with their individual exposures. We suggest that maternal consumption of ethanol during lead exposure has pronounced detrimental effects on memory, which may be mediated by oxidative stress. Copyright © 2016. Published by Elsevier Ltd.

  16. Addiction in developmental perspective: influence of conduct disorder severity, subtype, and attention-deficit hyperactivity disorder on problem severity and comorbidity in adults with opioid dependence.

    NARCIS (Netherlands)

    Carpentier, P.J.; Knapen, L.J.; Gogh, M.T. van; Buitelaar, J.K.; Jong, C.A.J. de

    2012-01-01

    This retrospective cross-sectional study examines whether conduct disorder and attention deficit hyperactivity disorder are associated with problem severity and psychiatric comorbidity in 193 middle-aged, opioid-dependent patients. Conduct disorder history, attention deficit hyperactivity disorder,

  17. Developmental immunotoxicology of lead

    International Nuclear Information System (INIS)

    Dietert, Rodney R.; Lee, Ji-Eun; Hussain, Irshad; Piepenbrink, Michael

    2004-01-01

    The heavy metal, lead, is a known developmental immunotoxicant that has been shown to produce immune alterations in humans as well as other species. Unlike many compounds that exert adverse immune effects, lead exposure at low to moderate levels does not produce widespread loss of immune cells. In contrast, changes resulting from lead exposure are subtle at the immune cell population level but, nevertheless, can be functionally dramatic. A hallmark of lead-induced immunotoxicity is a pronounced shift in the balance in T helper cell function toward T helper 2 responses at the expense of T helper 1 functions. This bias alters the nature and range of immune responses that can be produced thereby influencing host susceptibility to various diseases. Immunotoxic responses to lead appear to differ across life stages not only quantitatively with regard to dose response, but also qualitatively in terms of the spectrum of immune alterations. Experimental studies in several lab animal species suggest the latter stages of gestation are a period of considerable sensitivity for lead-induced immunotoxicity. This review describes the basic characteristics of lead-induced immunotoxicity emphasizing experimental animal results. It also provides a framework for the consideration of toxicant exposure effects across life stages. The existence of and probable basis for developmental windows of immune hyper-susceptibility are presented. Finally, the potential for lead to serve as a perinatal risk factor for childhood asthma as well as other diseases is considered

  18. Chemical shift imaging: a review

    International Nuclear Information System (INIS)

    Brateman, L.

    1986-01-01

    Chemical shift is the phenomenon that is seen when an isotope possessing a nuclear magnetic dipole moment resonates at a spectrum of resonance frequencies in a given magnetic field. These resonance frequencies, or chemical shifts, depend on the chemical environments of particular nuclei. Mapping the spatial distribution of nuclei associated with a particular chemical shift (e.g., hydrogen nuclei associated with water molecules or with lipid groups) is called chemical shift imaging. Several techniques of proton chemical shift imaging that have been applied in vivo are presented, and their clinical findings are reported and summarized. Acquiring high-resolution spectra for large numbers of volume elements in two or three dimensions may be prohibitive because of time constraints, but other methods of imaging lipid of water distributions (i.e., selective excitation, selective saturation, or variations in conventional magnetic resonance imaging pulse sequences) can provide chemical shift information. These techniques require less time, but they lack spectral information. Since fat deposition seen by chemical shift imaging may not be demonstrated by conventional magnetic resonance imaging, certain applications of chemical shift imaging, such as in the determination of fatty liver disease, have greater diagnostic utility than conventional magnetic resonance imaging. Furthermore, edge artifacts caused by chemical shift effects can be eliminated by certain selective methods of data acquisition employed in chemical shift imaging

  19. Developmental dyscalculia.

    Science.gov (United States)

    Kucian, Karin; von Aster, Michael

    2015-01-01

    Numerical skills are essential in our everyday life, and impairments in the development of number processing and calculation have a negative impact on schooling and professional careers. Approximately 3 to 6 % of children are affected from specific disorders of numerical understanding (developmental dyscalculia (DD)). Impaired development of number processing skills in these children is characterized by problems in various aspects of numeracy as well as alterations of brain activation and brain structure. Moreover, DD is assumed to be a very heterogeneous disorder putting special challenges to define homogeneous diagnostic criteria. Finally, interdisciplinary perspectives from psychology, neuroscience and education can contribute to the design for interventions, and although results are still sparse, they are promising and have shown positive effects on behaviour as well as brain function. In the current review, we are going to give an overview about typical and atypical development of numerical abilities at the behavioural and neuronal level. Furthermore, current status and obstacles in the definition and diagnostics of DD are discussed, and finally, relevant points that should be considered to make an intervention as successful as possible are summarized.

  20. Culture-dependent and culture-independent analyses reveal no prokaryotic community shifts or recovery of Serratia marcescens in Acropora palmata with white pox disease.

    Science.gov (United States)

    Lesser, Michael P; Jarett, Jessica K

    2014-06-01

    Recently, the etiological agent of white pox (WP) disease, also known as acroporid serratiosis, in the endangered coral Acropora palmata is the enteric bacterium Serratia marcescens with the source being localized sewage release onto coastal coral reef communities. Here, we show that both culture-dependent and culture-independent approaches could not recover this bacterium from samples of tissue and mucus from A. palmata colonies affected by WP disease in the Bahamas, or seawater collected adjacent to A. palmata colonies. Additionally, a metagenetic 16S rRNA pyrosequencing study shows no significant difference in the bacterial communities of coral tissues with and without WP lesions. As recent studies have shown for other coral diseases, S. marcescens cannot be identified in all cases of WP disease in several geographically separated populations of A. palmata with the same set of signs. As a result, its identification as the etiological agent of WP disease, and cause of a reverse zoonosis, cannot be broadly supported. However, the prevalence of WP disease associated with S. marcescens does appear to be associated with proximity to population centers, and research efforts should be broadened to examine this association, and to identify other causes of this syndrome. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  1. Two-stage unified stretched-exponential model for time-dependence of threshold voltage shift under positive-bias-stresses in amorphous indium-gallium-zinc oxide thin-film transistors

    Science.gov (United States)

    Jeong, Chan-Yong; Kim, Hee-Joong; Hong, Sae-Young; Song, Sang-Hun; Kwon, Hyuck-In

    2017-08-01

    In this study, we show that the two-stage unified stretched-exponential model can more exactly describe the time-dependence of threshold voltage shift (ΔV TH) under long-term positive-bias-stresses compared to the traditional stretched-exponential model in amorphous indium-gallium-zinc oxide (a-IGZO) thin-film transistors (TFTs). ΔV TH is mainly dominated by electron trapping at short stress times, and the contribution of trap state generation becomes significant with an increase in the stress time. The two-stage unified stretched-exponential model can provide useful information not only for evaluating the long-term electrical stability and lifetime of the a-IGZO TFT but also for understanding the stress-induced degradation mechanism in a-IGZO TFTs.

  2. Solvent-dependent reactions for the synthesis of β-keto-benzo-δ-sultone scaffolds via DBU-catalyzed O-sulfonylation/intramolecular Baylis-Hillman/1,3-H shift or dehydration tandem sequences.

    Science.gov (United States)

    Ghandi, Mehdi; Bozcheloei, Abolfazl Hasani; Nazari, Seyed Hadi; Sadeghzadeh, Masoud

    2011-12-16

    We have developed a solvent-dependent method for the synthesis of novel benzo-δ-sultone scaffolds. A variety of benzylbenzo[e][1,2]oxathiin-4(3H)-one-2,2-dioxides were obtained in high yields in DMF using a one-pot, DBU-catalyzed condensation of 2-hydroxybenzaldehydes with a number of (E)-2-phenylethenesulfonyl chlorides. On the other hand, the initially prepared 2-formylphenyl-(E)-2-phenylethenesulfonate derivatives underwent DBU-catalyzed reactions to a series of 3-[methoxy(phenyl)methyl]benzo[e][1,2]oxathiine-2,2-dioxides in moderate to good yields in MeOH. These reactions presumably proceed via DBU-catalyzed O-sulfonylation/intramolecular Baylis-Hillman/1,3-H shift or dehydration tandem sequences, respectively.

  3. H3 and H4 Lysine Acetylation Correlates with Developmental and Experimentally Induced Adult Experience-Dependent Plasticity in the Mouse Visual Cortex

    Directory of Open Access Journals (Sweden)

    Gabriela Vierci

    2016-01-01

    Full Text Available Histone posttranslational modifications play a fundamental role in orchestrating gene expression. In this work, we analyzed the acetylation of H3 and H4 histones (AcH3-AcH4 and its modulation by visual experience in the mouse visual cortex (VC during normal development and in two experimental conditions that restore juvenile-like plasticity levels in adults (fluoxetine treatment and enriched environment. We found that AcH3-AcH4 declines with age and is upregulated by treatments restoring plasticity in the adult. We also found that visual experience modulates AcH3-AcH4 in young and adult plasticity-restored mice but not in untreated ones. Finally, we showed that the transporter vGAT is downregulated in adult plasticity-restored models. In summary, we identified a dynamic regulation of AcH3-AcH4, which is associated with high plasticity levels and enhanced by visual experience. These data, along with recent ones, indicate H3-H4 acetylation as a central hub in the control of experience-dependent plasticity in the VC.

  4. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.

    Science.gov (United States)

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (Prelated AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but repressed (P<0.05) the level for p70S6K in Landrace pigs. The higher protein-NRC diet increased ratio of p-mTOR/mTOR in

  5. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.

    Directory of Open Access Journals (Sweden)

    Yingying Liu

    Full Text Available Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet- or higher/NRC (National Research Council-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I and longissimus dorsi muscle (LDM, type II were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05 gradually with increasing age. Bama mini-pigs had generally higher (P<0.05 muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05 than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K, and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05. There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05 the levels for mTOR and p70S6K in Bama mini-pigs, but

  6. Developmental programming of happiness.

    Science.gov (United States)

    Schmidt, Louis A; Fortier, Paz; Lahat, Ayelet; Tang, Alva; Mathewson, Karen J; Saigal, Saroj; Boyle, Michael H; Van Lieshout, Ryan J

    2017-09-01

    Being born at an extremely low birth weight (ELBW; programming hypotheses. Interfacing prenatal programming and differential susceptibility hypotheses, we tested whether individuals with ELBW in different childhood rearing environments showed different attention biases to positive and negative facial emotions in adulthood. Using the oldest known, prospectively followed cohort of ELBW survivors, we found that relative to normal birth weight controls (NBW; >2,500 grams), ELBW survivors displayed the highest and lowest attention bias to happy faces at age 30-35, depending on whether their total family income at age 8 was relatively low (environmental match) or high (environmental mismatch), respectively. This bias to happy faces was associated with a reduced likelihood of emotional problems. Findings suggest that differential susceptibility to positive emotions may be prenatally programmed, with effects lasting into adulthood. We discuss implications for integrating prenatal programming and differential susceptibility hypotheses, and the developmental origins of postnatal plasticity and resilience. © 2017 Wiley Periodicals, Inc.

  7. Nicotine shifts the temporal activation of hippocampal protein kinase A and extracellular signal-regulated kinase 1/2 to enhance long-term, but not short-term, hippocampus-dependent memory.

    Science.gov (United States)

    Gould, Thomas J; Wilkinson, Derek S; Yildirim, Emre; Poole, Rachel L F; Leach, Prescott T; Simmons, Steven J

    2014-03-01

    Acute nicotine enhances hippocampus-dependent learning through nicotine binding to β2-containing nicotinic acetylcholine receptors (nAChRs), but it is unclear if nicotine is targeting processes involved in short-term memory (STM) leading to a strong long-term memory (LTM) or directly targeting LTM. In addition, the molecular mechanisms involved in the effects of nicotine on learning are unknown. Previous research indicates that protein kinase A (PKA), extracellular signal-regulated kinase 1/2 (ERK1/2), and protein synthesis are crucial for LTM. Therefore, the present study examined the effects of nicotine on STM and LTM and the involvement of PKA, ERK1/2, and protein synthesis in the nicotine-induced enhancement of hippocampus-dependent contextual learning in C57BL/6J mice. The protein synthesis inhibitor anisomycin impaired contextual conditioning assessed at 4 h but not 2 h post-training, delineating time points for STM (2 h) and LTM (4 h and beyond). Nicotine enhanced contextual conditioning at 4, 8, and 24 h but not 2 h post-training, indicating nicotine specifically enhances LTM but not STM. Furthermore, nicotine did not rescue deficits in contextual conditioning produced by anisomycin, suggesting that the nicotine enhancement of contextual conditioning occurs through a protein synthesis-dependent mechanism. In addition, inhibition of dorsal hippocampal PKA activity blocked the effect of acute nicotine on learning, and nicotine shifted the timing of learning-related PKA and ERK1/2 activity in the dorsal and ventral hippocampus. Thus, the present results suggest that nicotine specifically enhances LTM through altering the timing of PKA and ERK1/2 signaling in the hippocampus, and suggests that the timing of PKA and ERK1/2 activity could contribute to the strength of memories. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. The Domain of Developmental Psychopathology.

    Science.gov (United States)

    Sroufe, L. Alan; Rutter, Michael

    1984-01-01

    Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)

  9. Developmental toxicity of engineered nanomaterials in rodents

    Energy Technology Data Exchange (ETDEWEB)

    Ema, Makoto, E-mail: ema-makoto@aist.go.jp; Gamo, Masashi; Honda, Kazumasa

    2016-05-15

    We summarized significant effects reported in the literature on the developmental toxicity of engineered nanomaterials (ENMs) in rodents. The developmental toxicity of ENMs included not only structural abnormalities, but also death, growth retardation, and behavioral and functional abnormalities. Most studies were performed on mice using an injection route of exposure. Teratogenic effects were indicated when multi-walled carbon nanotubes (MWCNTs), single-walled carbon nanotubes (SWCNTs), and TiO{sub 2}-nanoparticles were administered to mice during early gestation. Reactive oxygen species levels were increased in placentas and malformed fetuses and their placentas after prenatal exposure to MWCNTs and SWCNTs, respectively. The pre- and postnatal mortalities and growth retardation in offspring increased after prenatal exposure to ENMs. Histopathological and functional abnormalities were also induced in placentas after prenatal exposure to ENMs. Maternal exposure to ENMs induced behavioral alterations, histopathological and biochemical changes in the central nervous system, increased susceptibility to allergy, transplacental genotoxicity, and vascular, immunological, and reproductive effects in offspring. The size- and developmental stage-dependent placental transfer of ENMs was noted after maternal exposure. Silver accumulated in the visceral yolk sac after being injected with Ag-NPs during early gestation. Although currently available data has provided initial information on the potential developmental toxicity of ENMs, that on the developmental toxicity of ENMs is still very limited. Further studies using well-characterized ENMs, state-of the-art study protocols, and appropriate routes of exposure are required in order to clarify these developmental effects and provide information suitable for risk assessments of ENMs. - Highlights: • We review the developmental toxicity studies of engineered nanomaterials (ENMs). • Various developmental endpoints have been

  10. Micropatch Antenna Phase Shifting

    National Research Council Canada - National Science Library

    Thursby, Michael

    2000-01-01

    .... We have been looking at the ability of embedded element to adjust the phase shift seen by the element with the goal of being able to remove the phase shifting devices from the antenna and replace...

  11. Micropatch Antenna Phase Shifting

    National Research Council Canada - National Science Library

    Thursby, Michael

    1999-01-01

    .... We have been looking at the ability of embedded element to adjust the phase shift seen by the element wit the goal of being able to remove the phase shifting devices from the antenna and replace...

  12. Reproductive and developmental toxicology

    National Research Council Canada - National Science Library

    Gupta, Ramesh C

    2011-01-01

    .... Reproductive and Developmental Toxicology is a comprehensive and authoritative resource providing the latest literature enriched with relevant references describing every aspect of this area of science...

  13. OpenShift Workshop

    CERN Multimedia

    CERN. Geneva; Rodriguez Peon, Alberto

    2017-01-01

    Workshop to introduce developers to the OpenShift platform available at CERN. Several use cases will be shown, including deploying an existing application into OpenShift. We expect attendees to realize about OpenShift features and general architecture of the service.

  14. SAT in shift manager training

    International Nuclear Information System (INIS)

    Lecuyer, F.

    1995-01-01

    EDF has improved the organization of the operation shift teams with the replacement of shift supervisor in shift manager function. The shift manager is not only responsible for tasks associated to plant operation (production), but he is also responsible for safety of these tasks and for management of shift team members. A job analysis of this new job position has been performed in order to design the training programme. It resulted in a 10-month training programme that includes 8 weeks in safety-related topics and 12 weeks in soft-skills related topics. The safety related training courses are mandatory, the other courses are optional courses depending on individual trainee needs. The training also includes the development of management competencies. During the 10 month period, each trainee develops an individual project that is evaluated by NPP manager. As well, as group project is undertaken by the trainees and overseen by a steering committee. The steering committee participates in the evaluation process and provides operational experience feedback to the trainee groups and to the overall programme

  15. Developmental Programming of Adult Disease: Reprogramming by Melatonin?

    OpenAIRE

    Tain, You-Lin; Huang, Li-Tung; Hsu, Chien-Ning

    2017-01-01

    Adult-onset chronic non-communicable diseases (NCDs) can originate from early life through so-called the “developmental origins of health and disease” (DOHaD) or “developmental programming”. The DOHaD concept offers the “reprogramming” strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evi...

  16. Replication and robustness in developmental research.

    Science.gov (United States)

    Duncan, Greg J; Engel, Mimi; Claessens, Amy; Dowsett, Chantelle J

    2014-11-01

    Replications and robustness checks are key elements of the scientific method and a staple in many disciplines. However, leading journals in developmental psychology rarely include explicit replications of prior research conducted by different investigators, and few require authors to establish in their articles or online appendices that their key results are robust across estimation methods, data sets, and demographic subgroups. This article makes the case for prioritizing both explicit replications and, especially, within-study robustness checks in developmental psychology. It provides evidence on variation in effect sizes in developmental studies and documents strikingly different replication and robustness-checking practices in a sample of journals in developmental psychology and a sister behavioral science-applied economics. Our goal is not to show that any one behavioral science has a monopoly on best practices, but rather to show how journals from a related discipline address vital concerns of replication and generalizability shared by all social and behavioral sciences. We provide recommendations for promoting graduate training in replication and robustness-checking methods and for editorial policies that encourage these practices. Although some of our recommendations may shift the form and substance of developmental research articles, we argue that they would generate considerable scientific benefits for the field. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

  17. The Comet Cometh: Evolving Developmental Systems.

    Science.gov (United States)

    Jaeger, Johannes; Laubichler, Manfred; Callebaut, Werner

    In a recent opinion piece, Denis Duboule has claimed that the increasing shift towards systems biology is driving evolutionary and developmental biology apart, and that a true reunification of these two disciplines within the framework of evolutionary developmental biology (EvoDevo) may easily take another 100 years. He identifies methodological, epistemological, and social differences as causes for this supposed separation. Our article provides a contrasting view. We argue that Duboule's prediction is based on a one-sided understanding of systems biology as a science that is only interested in functional, not evolutionary, aspects of biological processes. Instead, we propose a research program for an evolutionary systems biology, which is based on local exploration of the configuration space in evolving developmental systems. We call this approach-which is based on reverse engineering, simulation, and mathematical analysis-the natural history of configuration space. We discuss a number of illustrative examples that demonstrate the past success of local exploration, as opposed to global mapping, in different biological contexts. We argue that this pragmatic mode of inquiry can be extended and applied to the mathematical analysis of the developmental repertoire and evolutionary potential of evolving developmental mechanisms and that evolutionary systems biology so conceived provides a pragmatic epistemological framework for the EvoDevo synthesis.

  18. Giant Lamb shift in photonic crystals

    International Nuclear Information System (INIS)

    Wang Xuehua; Kivshar, Yuri S.; Gu Benyuan

    2004-01-01

    We obtain a general result for the Lamb shift of excited states of multilevel atoms in inhomogeneous electromagnetic structures and apply it to study atomic hydrogen in inverse-opal photonic crystals. We find that the photonic-crystal environment can lead to very large values of the Lamb shift, as compared to the case of vacuum. We also suggest that the position-dependent Lamb shift should extend from a single level to a miniband for an assembly of atoms with random distribution in space, similar to the velocity-dependent Doppler effect in atomic/molecular gases

  19. Choice Shifts in Groups

    OpenAIRE

    Kfir Eliaz; Debraj Ray

    2004-01-01

    The phenomenon of "choice shifts" in group decision-making is fairly ubiquitous in the social psychology literature. Faced with a choice between a ``safe" and ``risky" decision, group members appear to move to one extreme or the other, relative to the choices each member might have made on her own. Both risky and cautious shifts have been identified in different situations. This paper demonstrates that from an individual decision-making perspective, choice shifts may be viewed as a systematic...

  20. Implementing OpenShift

    CERN Document Server

    Miller, Adam

    2013-01-01

    A standard tutorial-based approach to using OpenShift and deploying custom or pre-built web applications to the OpenShift Online cloud.This book is for software developers and DevOps alike who are interested in learning how to use the OpenShift Platform-as-a-Service for developing and deploying applications, how the environment works on the back end, and how to deploy their very own open source Platform-as-a-Service based on the upstream OpenShift Origin project.

  1. Insomnia in shift work.

    Science.gov (United States)

    Vallières, Annie; Azaiez, Aïda; Moreau, Vincent; LeBlanc, Mélanie; Morin, Charles M

    2014-12-01

    Shift work disorder involves insomnia and/or excessive sleepiness associated with the work schedule. The present study examined the impact of insomnia on the perceived physical and psychological health of adults working on night and rotating shift schedules compared to day workers. A total of 418 adults (51% women, mean age 41.4 years), including 51 night workers, 158 rotating shift workers, and 209 day workers were selected from an epidemiological study. An algorithm was used to classify each participant of the two groups (working night or rotating shifts) according to the presence or absence of insomnia symptoms. Each of these individuals was paired with a day worker according to gender, age, and income. Participants completed several questionnaires measuring sleep, health, and psychological variables. Night and rotating shift workers with insomnia presented a sleep profile similar to that of day workers with insomnia. Sleep time was more strongly related to insomnia than to shift work per se. Participants with insomnia in the three groups complained of anxiety, depression, and fatigue, and reported consuming equal amounts of sleep-aid medication. Insomnia also contributed to chronic pain and otorhinolaryngology problems, especially among rotating shift workers. Work productivity and absenteeism were more strongly related to insomnia. The present study highlights insomnia as an important component of the sleep difficulties experienced by shift workers. Insomnia may exacerbate certain physical and mental health problems of shift workers, and impair their quality of life. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Life Span Developmental Approach

    Directory of Open Access Journals (Sweden)

    Ali Eryilmaz

    2011-03-01

    Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.

  3. Shifted Independent Component Analysis

    DEFF Research Database (Denmark)

    Mørup, Morten; Madsen, Kristoffer Hougaard; Hansen, Lars Kai

    2007-01-01

    Delayed mixing is a problem of theoretical interest and practical importance, e.g., in speech processing, bio-medical signal analysis and financial data modelling. Most previous analyses have been based on models with integer shifts, i.e., shifts by a number of samples, and have often been carried...

  4. Homogeneous bilateral block shifts

    Indian Academy of Sciences (India)

    Douglas class were classified in [3]; they are unilateral block shifts of arbitrary block size (i.e. dim H(n) can be anything). However, no examples of irreducible homogeneous bilateral block shifts of block size larger than 1 were known until now.

  5. OpenShift cookbook

    CERN Document Server

    Gulati, Shekhar

    2014-01-01

    If you are a web application developer who wants to use the OpenShift platform to host your next big idea but are looking for guidance on how to achieve this, then this book is the first step you need to take. This is a very accessible cookbook where no previous knowledge of OpenShift is needed.

  6. Reproductive and developmental toxicology

    National Research Council Canada - National Science Library

    Gupta, Ramesh C

    2011-01-01

    .... With a special focus on placental toxicity, this book is the only available reference to connect the three key risk stages, and is the only resource to include reproductive and developmental toxicity in domestic animals, fish, and wildlife.

  7. Developmental coordination disorder

    Science.gov (United States)

    Developmental coordination disorder can lead to: Learning problems Low self-esteem resulting from poor ability at sports and teasing by other children Repeated injuries Weight gain as a result of not wanting to participate ...

  8. Facts about Developmental Disabilities

    Science.gov (United States)

    ... play, learn, speak, behave, and move (for example, crawling and walking). Children develop at their own pace, ... person’s lifetime. Most developmental disabilities begin before a baby is born, but some can happen after birth ...

  9. Josephson shift registers

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper gives a review of Josephson shift register circuits that were designed, fabricated, or tested, with emphasis on work in the 1980s. Operating speed is most important, since it often limits system performance. Older designs used square-wave clocks, but most modern designs use offset sine waves, with either two or three phases. Operating margins and gate bias uniformity are key concerns. The fastest measured Josephson shift register operated at 2.3 GHz, which compares well with a GaAs shift register that consumes 250 times more power. The difficulties of high-speed testing have prevented many Josephson shift registers from being operated at their highest speeds. Computer simulations suggest that 30-GHz operation is possible with current Nb/Al 2 O 3 /Nb technology. Junctions with critical current densities near 10 kA/cm 2 would make 100-GHz shift registers feasible

  10. Life Span Developmental Approach

    OpenAIRE

    Ali Eryilmaz

    2011-01-01

    The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of...

  11. The effect of ultraviolet-B radiation on gene expression and pigment composition in etiolated and green pea leaf tissue: UV-B-induced changes are gene-specific and dependent upon the developmental stage

    International Nuclear Information System (INIS)

    Jordan, B.R.; James, P.E.; Strid, A.; Anthony, R.G.

    1994-01-01

    present in low or undetectable amounts in control tissues. In green leaf tissue exposed to supplementary UV-B, a transient increase was detected. The transcripts for chs reached a maximum level after approximately 8 h UV-B exposure, and then declined to lower levels over subsequent days of diurnal photoperiods. However, a constant increase in chs was found after continuous exposure to UV-B for up to 30 h. In etiolated tissue, either white-light, supplementary UV-B or UV-B alone gave small increases in chs, only 8 h of UV-B radiation alone gave any substantial increase in chs expression. Overall, these results clearly demonstrate that the response to increased levels of UV-B radiation is dependent upon the developmental stage of the tissue and involves complex changes in gene expression. (author)

  12. Decisions Concerning Directional Dependence

    Science.gov (United States)

    von Eye, Alexander; DeShon, Richard P.

    2012-01-01

    In this rejoinder, von Eye and DeShon discuss the decision strategies proposed in their original article ("Directional Dependence in Developmental Research," this issue), as well as the ones proposed by the authors of the commentary (Pornprasertmanit and Little, "Determining Directional Dependency in Causal Associations," this issue). In addition,…

  13. Transgenerational developmental programming.

    Science.gov (United States)

    Aiken, Catherine E; Ozanne, Susan E

    2014-01-01

    The concept of developmental programming suggests that the early life environment influences offspring characteristics in later life, including the propensity to develop diseases such as the metabolic syndrome. There is now growing evidence that the effects of developmental programming may also manifest in further generations without further suboptimal exposure. This review considers the evidence, primarily from rodent models, for effects persisting to subsequent generations, and evaluates the mechanisms by which developmental programming may be transmitted to further generations. In particular, we focus on the potential role of the intrauterine environment in contributing to a developmentally programmed phenotype in subsequent generations. The literature was systematically searched at http://pubmed.org and http://scholar.google.com to identify published findings regarding transgenerational (F2 and beyond) developmental programming effects in human populations and animal models. Transmission of programming effects is often viewed as a form of epigenetic inheritance, either via the maternal or paternal line. Evidence exists for both germline and somatic inheritance of epigenetic modifications which may be responsible for phenotypic changes in further generations. However, there is increasing evidence for the role of both extra-genomic components of the zygote and the interaction of the developing conceptus with the intrauterine environment in propagating programming effects. The contribution of a suboptimal reproductive tract environment or maternal adaptations to pregnancy may be critical to inheritance of programming effects via the maternal line. As the effects of age exacerbate the programmed metabolic phenotype, advancing maternal age may increase the likelihood of developmental programming effects being transmitted to further generations. We suggest that developmental programming effects could be propagated through the maternal line de novo in generations

  14. Nurses' shift reports

    DEFF Research Database (Denmark)

    Buus, Niels; Hoeck, Bente; Hamilton, Bridget Elizabeth

    2017-01-01

    AIMS AND OBJECTIVES: To identify reporting practices that feature in studies of nurses' shift reports across diverse nursing specialities. The objectives were to perform an exhaustive systematic literature search and to critically review the quality and findings of qualitative field studies...... of nurses' shift reports. BACKGROUND: Nurses' shift reports are routine occurrences in healthcare organisations that are viewed as crucial for patient outcomes, patient safety and continuity of care. Studies of communication between nurses attend primarily to 1:1 communication and analyse the adequacy...... and accuracy of patient information and feature handovers at the bedside. Still, verbal reports between groups of nurses about patients are commonplace. Shift reports are obvious sites for studying the situated accomplishment of professional nursing at the group level. This review is focused exclusively...

  15. Shift Verification and Validation

    Energy Technology Data Exchange (ETDEWEB)

    Pandya, Tara M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Evans, Thomas M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Davidson, Gregory G [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Johnson, Seth R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Godfrey, Andrew T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-09-07

    This documentation outlines the verification and validation of Shift for the Consortium for Advanced Simulation of Light Water Reactors (CASL). Five main types of problems were used for validation: small criticality benchmark problems; full-core reactor benchmarks for light water reactors; fixed-source coupled neutron-photon dosimetry benchmarks; depletion/burnup benchmarks; and full-core reactor performance benchmarks. We compared Shift results to measured data and other simulated Monte Carlo radiation transport code results, and found very good agreement in a variety of comparison measures. These include prediction of critical eigenvalue, radial and axial pin power distributions, rod worth, leakage spectra, and nuclide inventories over a burn cycle. Based on this validation of Shift, we are confident in Shift to provide reference results for CASL benchmarking.

  16. Random coil chemical shift for intrinsically disordered proteins

    DEFF Research Database (Denmark)

    Kjærgaard, Magnus; Brander, Søren; Poulsen, Flemming Martin

    2011-01-01

    . Temperature has a non-negligible effect on the (13)C random coil chemical shifts, so temperature coefficients are reported for the random coil chemical shifts to allow extrapolation to other temperatures. The pH dependence of the histidine random coil chemical shifts is investigated in a titration series......, which allows the accurate random coil chemical shifts to be obtained at any pH. By correcting the random coil chemical shifts for the effects of temperature and pH, systematic biases of the secondary chemical shifts are minimized, which will improve the reliability of detection of transient secondary...

  17. Molecular Electronic Shift Registers

    Science.gov (United States)

    Beratan, David N.; Onuchic, Jose N.

    1990-01-01

    Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

  18. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Directory of Open Access Journals (Sweden)

    Svetlana Postnova

    Full Text Available Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8 in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  19. Adaptation to shift work: physiologically based modeling of the effects of lighting and shifts' start time.

    Science.gov (United States)

    Postnova, Svetlana; Robinson, Peter A; Postnov, Dmitry D

    2013-01-01

    Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers' sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8) in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers' adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21:00 instead of 00:00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters.

  20. Reading in developmental prosopagnosia

    DEFF Research Database (Denmark)

    Starrfelt, Randi; Klargaard, Solja K; Petersen, Anders

    2018-01-01

    exposure durations (targeting the word superiority effect), and d) text reading. RESULTS: Participants with developmental prosopagnosia performed strikingly similar to controls across the four reading tasks. Formal analysis revealed a significant dissociation between word and face recognition......, that is, impaired reading in developmental prosopagnosia. METHOD: We tested 10 adults with developmental prosopagnosia and 20 matched controls. All participants completed the Cambridge Face Memory Test, the Cambridge Face Perception test and a Face recognition questionnaire used to quantify everyday face...... recognition experience. Reading was measured in four experimental tasks, testing different levels of letter, word, and text reading: (a) single word reading with words of varying length,(b) vocal response times in single letter and short word naming, (c) recognition of single letters and short words at brief...

  1. The Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge

    2001-01-01

    AbstractIn the nineties, the concept of the developmental work (DW) has become a significant point of orientation for the actors on Danish labour market. The DW has moved the focus of the labour market from wages and working time towards work and production. For employees, the DW promises...... developmental possibilities, influence and responsibility, but also greater social responsibility for the firm. For firms, the DW promises increased competitiveness and better products. In this paper we present the concept of the DW as one which encourages the development of work, production and organisation...... of the firm and show that the DW is different from mainstream management concepts, as the DW...

  2. Developmental constraint of insect audition

    Directory of Open Access Journals (Sweden)

    Strauß Johannes

    2006-12-01

    Full Text Available Abstract Background Insect ears contain very different numbers of sensory cells, from only one sensory cell in some moths to thousands of sensory cells, e.g. in cicadas. These differences still await functional explanation and especially the large numbers in cicadas remain puzzling. Insects of the different orders have distinct developmental sequences for the generation of auditory organs. These sensory cells might have different functions depending on the developmental stages. Here we propose that constraints arising during development are also important for the design of insect ears and might influence cell numbers of the adults. Presentation of the hypothesis We propose that the functional requirements of the subadult stages determine the adult complement of sensory units in the auditory system of cicadas. The hypothetical larval sensory organ should function as a vibration receiver, representing a functional caenogenesis. Testing the hypothesis Experiments at different levels have to be designed to test the hypothesis. Firstly, the neuroanatomy of the larval sense organ should be analyzed to detail. Secondly, the function should be unraveled neurophysiologically and behaviorally. Thirdly, the persistence of the sensory cells and the rebuilding of the sensory organ to the adult should be investigated. Implications of the hypothesis Usually, the evolution of insect ears is viewed with respect to physiological and neuronal mechanisms of sound perception. This view should be extended to the development of sense organs. Functional requirements during postembryonic development may act as constraints for the evolution of adult organs, as exemplified with the auditory system of cicadas.

  3. Arguments from Developmental Order.

    Science.gov (United States)

    Stöckle-Schobel, Richard

    2016-01-01

    In this article, I investigate a special type of argument regarding the role of development in theorizing about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind - getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories. Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasizing the importance of the early cognitive processes and arguments emphasizing the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive) development, and I will present some topics that also pertain to a full-fledged 'philosophy of development.'

  4. Developmental Education Evaluation Model.

    Science.gov (United States)

    Perry-Miller, Mitzi; And Others

    A developmental education evaluation model designed to be used at a multi-unit urban community college is described. The purpose of the design was to determine the cost effectiveness/worth of programs in order to initiate self-improvement. A needs assessment was conducted by interviewing and taping the responses of students, faculty, staff, and…

  5. Arguments from Developmental Order

    Directory of Open Access Journals (Sweden)

    Richard eStöckle-Schobel

    2016-05-01

    Full Text Available In this article, I investigate a special type of argument regarding the role of development in theorising about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind – getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories.Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasising the importance of the early cognitive processes and arguments emphasising the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive development, and I will present some topics that also pertain to a full-fledged ‘philosophy of development’.

  6. Developmental paediatric anaesthetic pharmacology

    DEFF Research Database (Denmark)

    Hansen, Tom Giedsing

    2015-01-01

    Safe and effective drug therapy in neonates, infants and children require detailed knowledge about the ontogeny of drug disposition and action as well how these interact with genetics and co-morbidity of children. Recent advances in developmental pharmacology in children follow the increased...

  7. Executive Functions in Developmental Dyslexia

    Directory of Open Access Journals (Sweden)

    Pamela eVarvara

    2014-03-01

    Full Text Available The present study was aimed at investigating different aspects of Executive Functions (EF in children with Developmental Dyslexia (DD.A neuropsychological battery tapping verbal fluency, spoonerism, attention, verbal shifting, short-term and working memory was used to assess 60 children with DD and 65 with typical reading abilities.Compared to their controls, children with DD showed deficits in several EF domains such as verbal categorical and phonological fluency, visual-spatial and auditory attention, spoonerism, verbal and visual short-term memory, and verbal working memory. Moreover, exploring predictive relationships between EF measures and reading, we found that spoonerism abilities better explained word and non-word reading deficits. Although to a lesser extent, auditory and visual-spatial attention also explained the increased percentage of variance related to reading deficit.EF deficits found in DD are interpreted as an expression of a deficient functioning of the Central Executive System and are discussed in the context of the recent temporal sampling theory.

  8. Combined chemical shift changes and amino acid specific chemical shift mapping of protein-protein interactions

    Energy Technology Data Exchange (ETDEWEB)

    Schumann, Frank H.; Riepl, Hubert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Maurer, Till [Boehringer Ingelheim Pharma GmbH and Co. KG, Analytical Sciences Department (Germany); Gronwald, Wolfram [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany); Neidig, Klaus-Peter [Bruker BioSpin GmbH, Software Department (Germany); Kalbitzer, Hans Robert [University of Regensburg, Institute of Biophysics and Physical Biochemistry (Germany)], E-mail: hans-robert.kalbitzer@biologie.uni-regensburg.de

    2007-12-15

    Protein-protein interactions are often studied by chemical shift mapping using solution NMR spectroscopy. When heteronuclear data are available the interaction interface is usually predicted by combining the chemical shift changes of different nuclei to a single quantity, the combined chemical shift perturbation {delta}{delta}{sub comb}. In this paper different procedures (published and non-published) to calculate {delta}{delta}{sub comb} are examined that include a variety of different functional forms and weighting factors for each nucleus. The predictive power of all shift mapping methods depends on the magnitude of the overlap of the chemical shift distributions of interacting and non-interacting residues and the cut-off criterion used. In general, the quality of the prediction on the basis of chemical shift changes alone is rather unsatisfactory but the combination of chemical shift changes on the basis of the Hamming or the Euclidian distance can improve the result. The corrected standard deviation to zero of the combined chemical shift changes can provide a reasonable cut-off criterion. As we show combined chemical shifts can also be applied for a more reliable quantitative evaluation of titration data.

  9. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Sherwood, D.G.; Wilson, J.F.; Salton, R.B.; Fensterer, H.F.

    1981-01-01

    A mechanical spectral shift reactor comprises apparatus for inserting and withdrawing water displacer elements from the reactor core for selectively changing the water-moderator volume in the core thereby changing the reactivity of the core. The apparatus includes drivemechanisms for moving the displacer elements relative to the core and guide mechanisms for guiding the displayer rods through the reactor vessel

  10. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Sherwood, D.G.; Wilson, J.F.; Salton, R.B.; Fensterer, H.F.

    1982-01-01

    A mechanical spectral shift reactor comprises apparatus for inserting and withdrawing water displacer elements from the reactor core for selectively changing the water-moderator volume in the core thereby changing the reactivity of the core. The apparatus includes drive mechanisms for moving the displacer elements relative to the core and guide mechanisms for guiding the displacer rods through the reactor vessel. (author)

  11. Engineering of a calcium-ion binding site into the RC-LH1-PufX complex of Rhodobacter sphaeroides to enable ion-dependent spectral red-shifting.

    Science.gov (United States)

    Swainsbury, David J K; Martin, Elizabeth C; Vasilev, Cvetelin; Parkes-Loach, Pamela S; Loach, Paul A; Neil Hunter, C

    2017-11-01

    The reaction centre-light harvesting 1 (RC-LH1) complex of Thermochromatium (Tch.) tepidum has a unique calcium-ion binding site that enhances thermal stability and red-shifts the absorption of LH1 from 880nm to 915nm in the presence of calcium-ions. The LH1 antenna of mesophilic species of phototrophic bacteria such as Rhodobacter (Rba.) sphaeroides does not possess such properties. We have engineered calcium-ion binding into the LH1 antenna of Rba. sphaeroides by progressively modifying the native LH1 polypeptides with sequences from Tch. tepidum. We show that acquisition of the C-terminal domains from LH1 α and β of Tch. tepidum is sufficient to activate calcium-ion binding and the extent of red-shifting increases with the proportion of Tch. tepidum sequence incorporated. However, full exchange of the LH1 polypeptides with those of Tch. tepidum results in misassembled core complexes. Isolated α and β polypeptides from our most successful mutant were reconstituted in vitro with BChl a to form an LH1-type complex, which was stabilised 3-fold by calcium-ions. Additionally, carotenoid specificity was changed from spheroidene found in Rba. sphaeroides to spirilloxanthin found in Tch. tepidum, with the latter enhancing in vitro formation of LH1. These data show that the C-terminal LH1 α/β domains of Tch. tepidum behave autonomously, and are able to transmit calcium-ion induced conformational changes to BChls bound to the rest of a foreign antenna complex. Thus, elements of foreign antenna complexes, such as calcium-ion binding and blue/red switching of absorption, can be ported into Rhodobacter sphaeroides using careful design processes. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

  12. THE MAKING OF FAMILY VALUES: DEVELOPMENTAL IDEALISM IN GANSU, CHINA

    Science.gov (United States)

    Lai, Qing; Thornton, Arland

    2014-01-01

    This paper examines the role of developmental thinking in the making of family values. We analyze survey data collected from Gansu Province in China with regular and multilevel logit models. The results show that individuals’ endorsement of neolocal residence, self-choice marriage, gender egalitarianism, late marriage for women, and low fertility depends on the conjunction of preference for development and beliefs in its association with those family attributes, which we term developmental idealism associational evaluation. Furthermore, such impact of developmental thinking on family values holds robust in the presence of indigenous ideational forces, in this case Islamic religion. Although Islam influences family values in the opposite direction than developmental ideas do, the effect of Developmental Idealism associational evaluation does not differ significantly between Muslims and non-Muslims. PMID:25769860

  13. Lamb shift of Rydberg atoms in a resonator

    International Nuclear Information System (INIS)

    Belov, A.A.; Lozovik, Yu.E.; Pokrovsky, V.L.

    1988-08-01

    The Lamb shift of a Rydberg atom in a cavity is shown to be enhanced with the resonance interaction of a virtual atomic transition and cavity modes. The dependence of the Lamb shift on quantum numbers and atomic number changes drastically. Shifting cavity walls and scanning the atomic beam one can vary the Lamb shift. The value of the Lamb shift in a cavity may exceed a typical magnitude of the fine structure energy. For a rough resonance tuning the Coulumb multiplet occurs to be strongly mixed and a novel classification is necessary. (author). 8 refs, 2 figs

  14. NIDCAP and developmental care

    Directory of Open Access Journals (Sweden)

    Dominique Haumont

    2014-06-01

    Full Text Available Perinatal mortality in very low birth weight infants has dramatically decreased during the last decades. However, 15-25% of these infants will show neurodevelopmental impairment later on. The aim of implementing early developmental care (EDC, emerged as a new field in neonatology, is to create an intervention program designed to provide support for optimal neurobehavioral development during this highly vulnerable period of brain growth. The theoretical framework, which underlies the approach, is supported by research in different scientific fields, including neuroscience, psychology, medicine and nursing. EDC utilizes a range of medical and nursing interventions that aim to decrease the stress of preterm neonates in neonatal intensive care units (NICUs. The Neonatal Individualized Developmental Care Assessment Program (NIDCAP is an integrated and holistic form of family-centered developmental care. Changing the traditional NICU towards an EDC-NICU includes training nursing and medical staff, investing in their quality and most importantly keeping parents in proximity to the infants. The new challenge of modern neonatology is to restore the mother-infant dyad applying “couplet care” starting at birth until discharge. Most of the European NICUs apply some elements of EDC, but it is more consistent in northern Europe. The development of NIDCAP training centers in Europe demonstrates the evolution of care. It is likely that future research and intervention programs will optimize our practices. Developmental care could prove to be an important recent step in improving outcome in extremely preterm neonates. Proceedings of the 10th International Workshop on Neonatology · Cagliari (Italy · October 22nd-25th, 2014 · The last ten years, the next ten years in Neonatology Guest Editors: Vassilios Fanos, Michele Mussap, Gavino Faa, Apostolos Papageorgiou

  15. Evolutionary and developmental modules.

    Science.gov (United States)

    Lacquaniti, Francesco; Ivanenko, Yuri P; d'Avella, Andrea; Zelik, Karl E; Zago, Myrka

    2013-01-01

    The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates.

  16. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Wilson, J.F.; Sherwood, D.G.

    1982-01-01

    A mechanical spectral shift reactor comprises a reactive core having fuel assemblies accommodating both water displacer elements and neutron absorbing control rods for selectively changing the volume of water-moderator in the core. The fuel assemblies with displacer and control rods are arranged in alternating fashion so that one displacer element drive mechanism may move displacer elements in more than one fuel assembly without interfering with the movement of control rods of a corresponding control rod drive mechanisms. (author)

  17. Biomarkers of adult and developmental neurotoxicity

    International Nuclear Information System (INIS)

    Slikker, William; Bowyer, John F.

    2005-01-01

    Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations

  18. Steady State Shift Damage Localization

    DEFF Research Database (Denmark)

    Sekjær, Claus; Bull, Thomas; Markvart, Morten Kusk

    2017-01-01

    The steady state shift damage localization (S3DL) method localizes structural deterioration, manifested as either a mass or stiffness perturbation, by interrogating the damage-induced change in the steady state vibration response with damage patterns cast from a theoretical model. Damage is, thus...... the required accuracy when examining complex structures, an extensive amount of degrees of freedom (DOF) must often be utilized. Since the interrogation matrix for each damage pattern depends on the size of the system matrices constituting the FE-model, the computational time quickly becomes of first......-order importance. The present paper investigates two sub-structuring approaches, in which the idea is to employ Craig-Bampton super-elements to reduce the amount of interrogation distributions while still providing an acceptable localization resolution. The first approach operates on a strict super-element level...

  19. Understanding and controlling chromaticity shift in LED devices

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Lynn; Mills, Karmann; Lamvik, Michael; Perkins, Curtis; Bobashev, Georgiy; Young, Joseph; Yaga, Robert; Johnson, Cortina

    2017-05-30

    Chromaticity shift in light-emitting diode (LED) devices arises from multiple mechanisms, and at least five different chromaticity shift modes (CSMs) have been identified to date. This paper focuses on the impacts of irreversible phosphor degradation as a cause of chromaticity shifts in LED devices. The nitride phosphors used to produce warm white LEDs are especially vulnerable to degradation due to thermal and chemical effects such as reactions with oxygen and water. As a result, LED devices utilizing these phosphors were found to undergo either a green shift or, less commonly, a red shift depending on the phosphor mix in the LED devices. These types of chromaticity shifts are classified as CSM-2 (green shift) and CSM-5 (red shift). This paper provides an overview of the kinetic processes responsible for green and red chromaticity shifts along with examples from accelerated stress testing of 6” downlights. Both CSMs appear to proceed through analogous mechanisms that are initiated at the surface of the phosphor. A green shift is produced by the surface oxidation of the nitride phosphor that changes the emission profile to lower wavelengths. As the surface oxidation reaction proceeds, reactant limitations slow the rate and bulk oxidation processes become more prevalent. We found that a red chromaticity shift arises from quenching of the green phosphor, also possibly due to surface reactions of oxygen, which shift the emission chromaticity in the red direction. In conclusion, we discuss the implications of these findings on projecting chromaticity.

  20. Nuclear polarization shifts in light muonic atoms

    International Nuclear Information System (INIS)

    Rosenfelder, R.

    1983-01-01

    A consistent nonrelativistic expression for the energy shift in muonic atoms due to second-order processes is derived under the assumption that the muon is weakly bound. The transverse contribution is shown to be finite only if the two-photon ('seagull') amplitude is taken into account as required by gauge invariance. Numerical results are presented for muonic 12 C using a recently developed model for the nuclear response function. The total transverse contributions to the energy shift are found to be small although dependent to some extent on the detailed high-momentum behaviour of the seagull term. (orig.)

  1. The shifting beverage landscape.

    Science.gov (United States)

    Storey, Maureen

    2010-04-26

    STOREY, M.L. The shifting beverage landscape. PHYSIOL BEHAV, 2010. - Simultaneous lifestyle changes have occurred in the last few decades, creating an imbalance in energy intake and energy expenditure that has led to overweight and obesity. Trends in the food supply show that total daily calories available per capita increased 28% since 1970. Total energy intake among men and women has also increased dramatically since that time. Some have suggested that intake of beverages has had a disproportional impact on obesity. Data collected by the Beverage Marketing Corporation between 1988-2008 demonstrate that, in reality, fewer calories per ounce are being produced by the beverage industry. Moreover, data from the National Cancer Institute show that soft drink intake represents 5.5% of daily calories. Data from NHANES 1999-2003 vs. 2003-06 may demonstrate a shift in beverage consumption for age/gender groups, ages 6 to>60years. The beverages provided in schools have significantly changed since 2006 when the beverage industry implemented School Beverage Guidelines. This voluntary action has removed full-calorie soft drinks from participating schools across the country. This shift to lower-calorie and smaller-portion beverages in school has led to a significant decrease in total beverage calories in schools. These data support the concept that to prevent and treat obesity, public health efforts should focus on energy balance and that a narrow focus on sweetened beverages is unlikely to have any meaningful impact on this complex problem. Copyright 2010 Elsevier Inc. All rights reserved.

  2. Mechanical spectral shift reactor

    International Nuclear Information System (INIS)

    Doshi, P.K.; George, R.A.; Dollard, W.J.

    1982-01-01

    A mechanical spectral shift arrangement for controlling a nuclear reactor includes a plurality of reactor coolant displacer members which are inserted into a reactor core at the beginning of the core life to reduce the volume of reactor coolant-moderator in the core at start-up. However, as the reactivity of the core declines with fuel depletion, selected displacer members are withdrawn from the core at selected time intervals to increase core moderation at a time when fuel reactivity is declining. (author)

  3. Spectral shift reactor

    International Nuclear Information System (INIS)

    Carlson, W.R.; Piplica, E.J.

    1982-01-01

    A spectral shift pressurized water reactor comprising apparatus for inserting and withdrawing water displacer elements having differing neutron absorbing capabilities for selectively changing the water-moderator volume in the core thereby changing the reactivity of the core. The displacer elements comprise substantially hollow cylindrical low neutron absorbing rods and substantially hollow cylindrical thick walled stainless rods. Since the stainless steel displacer rods have greater neutron absorbing capability, they can effect greater reactivity change per rod. However, by arranging fewer stainless steel displacer rods in a cluster, the reactivity worth of the stainless steel displacer rod cluster can be less than a low neutron absorbing displacer rod cluster. (author)

  4. Enhanced excitatory input to MCH neurons during developmental period of high food intake is mediated by GABA

    Science.gov (United States)

    Li, Ying; van den Pol, Anthony N.

    2010-01-01

    In contrast to the local axons of GABA neurons of the cortex and hippocampus, lateral hypothalamic neurons containing melanin concentrating hormone (MCH) and GABA send long axons throughout the brain and play key roles in energy homeostasis and mental status. In adults, MCH neurons maintain a hyperpolarized membrane potential and most of the synaptic input is inhibitory. In contrast, we found that developing MCH neurons received substantially more excitatory synaptic input. Based on gramicidicin-perforated patch recordings in hypothalamic slices from MCH-GFP transgenic mice, we found that GABA was the primary excitatory synaptic transmitter in embryonic and neonatal ages up to postnatal day 10. Surprisingly, glutamate assumed only a minor excitatory role, if any. GABA plays a complex role in developing MCH neurons, with its actions conditionally dependent on a number of factors. GABA depolarization could lead to an increase in spikes either independently or in summation with other depolarizing stimuli, or alternately, depending on the relative timing of other depolarizing events, could lead to shunting inhibition. The developmental shift from depolarizing to hyperpolarizing occurred later in the dendrites than in the cell body. Early GABA depolarization was based on a Cl− dependent inward current. An interesting secondary depolarization in mature neurons that followed an initial hyperpolarization was based on a bicarbonate mechanism. Thus during the early developmental period when food consumption is high, MCH neurons are more depolarized than in the adult, and an increased level of excitatory synaptic input to these orexigenic cells is mediated by GABA. PMID:19955372

  5. Enhanced excitatory input to melanin concentrating hormone neurons during developmental period of high food intake is mediated by GABA.

    Science.gov (United States)

    Li, Ying; van den Pol, Anthony N

    2009-12-02

    In contrast to the local axons of GABA neurons of the cortex and hippocampus, lateral hypothalamic neurons containing melanin concentrating hormone (MCH) and GABA send long axons throughout the brain and play key roles in energy homeostasis and mental status. In adults, MCH neurons maintain a hyperpolarized membrane potential and most of the synaptic input is inhibitory. In contrast, we found that developing MCH neurons received substantially more excitatory synaptic input. Based on gramicidin-perforated patch recordings in hypothalamic slices from MCH-green fluorescent protein transgenic mice, we found that GABA was the primary excitatory synaptic transmitter in embryonic and neonatal ages up to postnatal day 10. Surprisingly, glutamate assumed only a minor excitatory role, if any. GABA plays a complex role in developing MCH neurons, with its actions conditionally dependent on a number of factors. GABA depolarization could lead to an increase in spikes either independently or in summation with other depolarizing stimuli, or alternately, depending on the relative timing of other depolarizing events, could lead to shunting inhibition. The developmental shift from depolarizing to hyperpolarizing occurred later in the dendrites than in the cell body. Early GABA depolarization was based on a Cl(-)-dependent inward current. An interesting secondary depolarization in mature neurons that followed an initial hyperpolarization was based on a bicarbonate mechanism. Thus during the early developmental period when food consumption is high, MCH neurons are more depolarized than in the adult, and an increased level of excitatory synaptic input to these orexigenic cells is mediated by GABA.

  6. Topographic processing in developmental prosopagnosia

    DEFF Research Database (Denmark)

    Klargaard, Solja K.; Starrfelt, Randi; Petersen, Anders

    2016-01-01

    deficit in visual processing or visual short-term memory. Interestingly, a classical dissociation could be demonstrated between impaired face memory and preserved topographic memory in two developmental prosopagnosics. We conclude that impairments in topographic memory tend to co-occur with developmental......Anecdotal evidence suggests a relation between impaired spatial (navigational) processing and developmental prosopagnosia. To address this formally, we tested two aspects of topographic processing – that is, perception and memory of mountain landscapes shown from different viewpoints. Participants...

  7. DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

    OpenAIRE

    Jelena Kostić; Milkica Nešić; Jasminka Marković; Miodrag Stanković

    2015-01-01

    Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to c...

  8. Repetition and Translation Shifts

    Directory of Open Access Journals (Sweden)

    Simon Zupan

    2006-06-01

    Full Text Available Repetition manifests itself in different ways and at different levels of the text. The first basic type of repetition involves complete recurrences; in which a particular textual feature repeats in its entirety. The second type involves partial recurrences; in which the second repetition of the same textual feature includes certain modifications to the first occurrence. In the article; repetitive patterns in Edgar Allan Poe’s short story “The Fall of the House of Usher” and its Slovene translation; “Konec Usherjeve hiše”; are compared. The author examines different kinds of repetitive patterns. Repetitions are compared at both the micro- and macrostructural levels. As detailed analyses have shown; considerable microstructural translation shifts occur in certain types of repetitive patterns. Since these are not only occasional; sporadic phenomena; but are of a relatively high frequency; they reduce the translated text’s potential for achieving some of the gothic effects. The macrostructural textual property particularly affected by these shifts is the narrator’s experience as described by the narrative; which suffers a reduction in intensity.

  9. Developmental psychopathology: Attention Deficit Hyperactivity Disorder (ADHD

    Directory of Open Access Journals (Sweden)

    Petermann Franz

    2009-09-01

    Full Text Available Abstract Background Attention Deficit/Hyperactivity Disorder (ADHD, formerly regarded as a typical childhood disorder, is now known as a developmental disorder persisting over the lifespan. Starting in preschool-age, symptoms vary depending on the age group affected. Method According to the variability of ADHD-symptoms and the heterogeneity of comorbid psychiatric disorders, a broad review of recent studies was performed. These findings were summarized in a developmental psychopathological model, documenting relevant facts on a timeline. Results Based on a genetic disposition and a neuropsychological deregulation, there is evidence for factors which persist across the lifespan, change age-dependently, or show validity in a specific developmental phase. Qualitative changes can be found for children in preschool-age and adults. Conclusion These differences have implications for clinical practice as they can be used for prevention, diagnostic proceedings, and therapeutic intervention as well as for planning future studies. The present article is a translated and modified version of the German article "Entwicklungspsychopathologie der ADHS", published in Zeitschrift für Psychiatrie, Psychologie und Psychotherapie, 56, 2008, S. 265-274.

  10. Developmental psychopathology: Attention Deficit Hyperactivity Disorder (ADHD).

    Science.gov (United States)

    Schmidt, Sören; Petermann, Franz

    2009-09-17

    Attention Deficit/Hyperactivity Disorder (ADHD), formerly regarded as a typical childhood disorder, is now known as a developmental disorder persisting over the lifespan. Starting in preschool-age, symptoms vary depending on the age group affected. According to the variability of ADHD-symptoms and the heterogeneity of comorbid psychiatric disorders, a broad review of recent studies was performed. These findings were summarized in a developmental psychopathological model, documenting relevant facts on a timeline. Based on a genetic disposition and a neuropsychological deregulation, there is evidence for factors which persist across the lifespan, change age-dependently, or show validity in a specific developmental phase. Qualitative changes can be found for children in preschool-age and adults. These differences have implications for clinical practice as they can be used for prevention, diagnostic proceedings, and therapeutic intervention as well as for planning future studies. The present article is a translated and modified version of the German article "Entwicklungspsychopathologie der ADHS", published in Zeitschrift für Psychiatrie, Psychologie und Psychotherapie, 56, 2008, S. 265-274.

  11. Shift Work: Improving Daytime Sleep

    Science.gov (United States)

    ... night. Good daytime sleep is possible, though, if shift work is a necessary part of your work life. ... mayoclinic.org/healthy-lifestyle/adult-health/expert-answers/shift-work/faq-20057991 . Mayo Clinic Footer Legal Conditions and ...

  12. Developmental plasticity: Friend or foe?

    Science.gov (United States)

    Michels, Karin B

    2017-01-01

    Developmental plasticity - the concept that adaptation to changing and unfavorable environmental conditions are possible but may come at the price of compromised health potentials - has evolutionary grounding as it facilitates survival but dissents with fundamental evolutionary principles in that it may advance the lesser fit. It is an important cornerstone of the Developmental Origins of Health and Disease (DOHaD). Unlike evolutionary adaptation developmental plasticity may be short-lived and restricted to one or few generations and inheritance is uncertain. Potential mechanisms include epigenetic modifications adopted in utero which may not transmit to the next generation; future insights may allow adjustments of the outcomes of developmental plasticity.

  13. Qualitative methodology in developmental psychology

    DEFF Research Database (Denmark)

    Demuth, Carolin; Mey, Günter

    2015-01-01

    Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing rec...... in qualitative research offers a promising avenue to advance the field in this direction.......Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing...

  14. Building a developmental toxicity ontology.

    Science.gov (United States)

    Baker, Nancy; Boobis, Alan; Burgoon, Lyle; Carney, Edward; Currie, Richard; Fritsche, Ellen; Knudsen, Thomas; Laffont, Madeleine; Piersma, Aldert H; Poole, Alan; Schneider, Steffen; Daston, George

    2018-04-03

    As more information is generated about modes of action for developmental toxicity and more data are generated using high-throughput and high-content technologies, it is becoming necessary to organize that information. This report discussed the need for a systematic representation of knowledge about developmental toxicity (i.e., an ontology) and proposes a method to build one based on knowledge of developmental biology and mode of action/ adverse outcome pathways in developmental toxicity. This report is the result of a consensus working group developing a plan to create an ontology for developmental toxicity that spans multiple levels of biological organization. This report provide a description of some of the challenges in building a developmental toxicity ontology and outlines a proposed methodology to meet those challenges. As the ontology is built on currently available web-based resources, a review of these resources is provided. Case studies on one of the most well-understood morphogens and developmental toxicants, retinoic acid, are presented as examples of how such an ontology might be developed. This report outlines an approach to construct a developmental toxicity ontology. Such an ontology will facilitate computer-based prediction of substances likely to induce human developmental toxicity. © 2018 Wiley Periodicals, Inc.

  15. Developmental changes in the primacy of facial cues for emotion recognition.

    Science.gov (United States)

    Leitzke, Brian T; Pollak, Seth D

    2016-04-01

    There have been long-standing differences of opinion regarding the influence of the face relative to that of contextual information on how individuals process and judge facial expressions of emotion. However, developmental changes in how individuals use such information have remained largely unexplored and could be informative in attempting to reconcile these opposing views. The current study tested for age-related differences in how individuals prioritize viewing emotional faces versus contexts when making emotion judgments. To do so, we asked 4-, 8-, and 12-year-old children as well as college students to categorize facial expressions of emotion that were presented with scenes that were either congruent or incongruent with the facial displays. During this time, we recorded participants' gaze patterns via eye tracking. College students directed their visual attention primarily to the face, regardless of contextual information. Children, however, divided their attention between both the face and the context as sources of emotional information depending on the valence of the context. These findings reveal a developmental shift in how individuals process and integrate emotional cues. (c) 2016 APA, all rights reserved).

  16. A taxometric investigation of developmental dyslexia subtypes.

    Science.gov (United States)

    O'Brien, Beth A; Wolf, Maryanne; Lovett, Maureen W

    2012-02-01

    Long-standing issues with the conceptualization, identification and subtyping of developmental dyslexia persist. This study takes an alternative approach to examine the heterogeneity of developmental dyslexia using taxometric classification techniques. These methods were used with a large sample of 671 children ages 6-8 who were diagnosed with severe reading disorders. Latent characteristics of the sample are assessed in regard to posited subtypes with phonological deficits and naming speed deficits, thus extending prior work by addressing whether these deficits embody separate classes of individuals. Findings support separate taxa of dyslexia with and without phonological deficits. Different latent structure for naming speed deficits was found depending on the definitional criterion used to define dyslexia. Non-phonologically based forms of dyslexia showed particular difficulty with naming speed and reading fluency. Copyright © 2012 John Wiley & Sons, Ltd.

  17. Lanthanide shift reagents, binding, shift mechanisms and exchange

    International Nuclear Information System (INIS)

    Boer, J.W.M. de

    1977-01-01

    Paramagnetic lanthanide shift reagents, when added to a solution of a substrate, induce shifts in the nuclear magnetic resonance (NMR) spectrum of the substrate molecules. The induced shifts contain information about the structure of the shift reagent substrate complex. The structural information, however, may be difficult to extract because of the following effects: (1) different complexes between shift reagent and substrate may be present in solution, e.g. 1:1 and 1:2 complexes, and the shift observed is a weighed average of the shifts of the substrate nuclei in the different complexes; (2) the Fermi contact interaction, arising from the spin density at the nucleus, contributes to the induced shift; (3) chemical exchange effects may complicate the NMR spectrum. In this thesis, the results of an investigation into the influence of these effects on the NMR spectra of solutions containing a substrate and LSR are presented. The equations describing the pseudo contact and the Fermi contact shift are derived. In addition, it is shown how the modified Bloch equations describing the effect of the chemical exchange processes occurring in the systems studied can be reduced to the familiar equations for a two-site exchange case. The binding of mono- and bifunctional ethers to the shift reagent are reported. An analysis of the induced shifts is given. Finally, the results of the experiments performed to study the exchange behavior of dimethoxyethane and heptafluorodimethyloctanedionato ligands are presented

  18. Dirac equation, hydrogen atom spectrum and the Lamb shift in ...

    Indian Academy of Sciences (India)

    commutative spaces (DNCS or τ -space). Using this Hamiltonian we calculate the energy shift of the ground state as well the 2 P 1 / 2 , 2 S 1 / 2 levels. In all the cases, the energy shift depends on the dynamical non-commutative parameter τ .

  19. Dirac equation, hydrogen atom spectrum and the Lamb shift in ...

    Indian Academy of Sciences (India)

    2017-04-12

    Apr 12, 2017 ... Abstract. We derive the relativistic Hamiltonian of hydrogen atom in dynamical non-commutative spaces. (DNCS or τ-space). Using this Hamiltonian we calculate the energy shift of the ground state as well the 2P1/2, 2S1/2 levels. In all the cases, the energy shift depends on the dynamical non-commutative ...

  20. Faktor Dan Penjadualan Shift Kerja

    OpenAIRE

    Maurits, Lientje Setyawati; Widodo, Imam Djati

    2008-01-01

    Work shift has negative effect in physical and mental health, work performance and job accident. Disturbance of circadian rhythms is indicated as source of the problems. This article explores some researches related to the impacts of work shift and establishes basic principles of work shift scheduling that considers human need and limitation.

  1. Isotope shifting capacity of rock

    International Nuclear Information System (INIS)

    Blattner, P.; Department of Scientific and Industrial Research, Lower Hutt

    1980-01-01

    Any oxygen isotope shifted rock volume exactly defines a past throughput of water. An expression is derived that relates the throughput of an open system to the isotope shift of reservoir rock and present-day output. The small isotope shift of Ngawha reservoir rock and the small, high delta oxygen-18 output are best accounted for by a magmatic water source

  2. Critical thermal limits affected differently by developmental and adult thermal fluctuations

    DEFF Research Database (Denmark)

    Salachan, Paul Vinu; Sørensen, Jesper Givskov

    2017-01-01

    the developmental and adult life stages. For developmental acclimation, we found mildly detrimental effects of high amplitude fluctuations for critical thermal minima, while the critical thermal maxima showed a beneficial response to higher amplitude fluctuations. For adult acclimation involving shifts between...... fluctuating and constant regimes, cold tolerance was shown to be dictated by developmental temperature conditions irrespective of the adult treatments, while the acquired heat tolerance was readily lost when flies developed at fluctuating temperature were shifted to a constant regime as adults. Interestingly......, we also found that effect of fluctuations at any life stage was gradually lost with prolonged adult maintenance suggesting a more prominent effect of fluctuations during developmental compared to adult acclimation in Drosophila melanogaster....

  3. A developmental perspective on early-life exposure to neurotoxicants.

    Science.gov (United States)

    Bellinger, David C; Matthews-Bellinger, Julia A; Kordas, Katarzyna

    2016-09-01

    Studies of early-life neurotoxicant exposure have not been designed, analyzed, or interpreted in the context of a fully developmental perspective. The goal of this paper is to describe the key principles of a developmental perspective and to use examples from the literature to illustrate the relevance of these principles to early-life neurotoxicant exposures. Four principles are discussed: 1) the effects of early-life neurotoxicant exposure depend on a child's developmental context; 2) deficits caused by early-life exposure initiate developmental cascades that can lead to pathologies that differ from those observed initially; 3) early-life neurotoxicant exposure has intra-familial and intergenerational impacts; 4) the impacts of early-life neurotoxicant exposure influence a child's ability to respond to future insults. The first principle is supported by considerable evidence, but the other three have received much less attention. Incorporating a developmental perspective in studies of early-life neurotoxicant exposures requires prospective collection of data on a larger array of covariates than usually considered, using analytical approaches that acknowledge the transactional processes between a child and the environment and the phenomenon of developmental cascades. Consideration of early-life neurotoxicant exposure within a developmental perspective reveals that many issues remain to be explicated if we are to achieve a deep understanding of the societal health burden associated with early-life neurotoxicant exposures. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. The Social Pathologies of Self-Realization: A Diagnosis of the Consequences of the Shift in Individualization

    Science.gov (United States)

    Hammershoj, Lars Geer

    2009-01-01

    The aim of this article is to inquire into today's social pathologies, i.e. the negative consequences of the developmental processes of society. In a dialogue with Axel Honneth, the article asserts that a shift has occurred in individualization, a shift that implies a fundamental change in social pathologies: Social pathologies no longer derive…

  5. I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.

    Science.gov (United States)

    Card, Noel A

    2017-06-01

    This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.

  6. Constructivist developmental theory is needed in developmental neuroscience

    Science.gov (United States)

    Arsalidou, Marie; Pascual-Leone, Juan

    2016-12-01

    Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.

  7. The shift in windpower

    International Nuclear Information System (INIS)

    Gipe, P.

    1992-01-01

    Despite new production records, the near-term market for new windpower projects in the US remains bleak. Congressional incentives and project proposals in the mid-1990s offer promise, but for now most development has shifted to Europe. During 1992 and 1993 the largest wind projects developed by US companies will not be in the US, but in the United Kingdom and Spain. Indeed, most of the US's windpower industry is going abroad, establishing offices overseas. This move toward Europe comes as little surprise. New project development for US firms has faltered at home while the European market has burgeoned. The topics of the article include the move to Europe, a reduction in California's share of producing wind power plants, a rise in Europe's share of producing wind power plants, the future market for wind power in the US, and reawakening California's market

  8. Lung function studies before and after a work shift

    Energy Technology Data Exchange (ETDEWEB)

    Love, R G

    1983-05-01

    The lung function of 23 underground coal workers and eight surface workers at a Scottish colliery was measured immediately before and after a work shift. Changes in lung function were assessed in relation to the measured respirable dust exposure and the time of day in which the shift was worked. Large, and statistically significant, decrements of lung function during the shift were found in night-shift workers compared with workers on other shifts. Measurements derived from the forced expiratory manoeuvre, particularly FEV1, Vmax50, and Vmax25, after three vital capacity breaths of an 80% He/20% O2 mixture, showed large reductions in night-shift men, smaller reductions in afternoon-shift men, and small increases or decreases in morning-shift underground and surface workers. Within-shift changes for other tests, such as closing volume, N2 index, and volume of isoflow, did not differ significantly between shifts. No significant relationship was found between dust exposure and functional changes during a shift for any test. Lung function changes in a control group of 25 female workers not exposed to dust (hospital nurses) did not show the same large variations between day and night shifts. Examination of a further control group of 16 office workers did not show any difference in diurnal changes between smokers and non-smokers. It is concluded that these coal miners, even on permanent shift patterns, had widely different changes in their lung function cycle depending on which shift they were working. These changes did not appear to be related to dust exposure or cigarette smoking and were not consistent with other biological adaptations known to result from regular night-shift working.

  9. Behavioral inhibition and anxiety: The moderating roles of inhibitory control and attention shifting

    Science.gov (United States)

    White, Lauren K.; McDermott, Jennifer Martin; Degnan, Kathryn A.; Henderson, Heather A.; Fox, Nathan A.

    2013-01-01

    Behavioral inhibition (BI), a temperament identified in early childhood, is associated with social reticence in childhood and an increased risk for anxiety problems in adolescence and adulthood. However, not all behaviorally inhibited children remain reticent or develop an anxiety disorder. One possible mechanism accounting for the variability in the developmental trajectories of BI is a child’s ability to successfully recruit cognitive processes involved in the regulation of negative reactivity. However, separate cognitive processes may differentially moderate the association between BI and later anxiety problems. The goal of the current study was to examine how two cognitive processes - attention shifting and inhibitory control - laboratory assessed at 48 months of age moderated the association between 24-month BI and anxiety symptoms in the preschool years. Results revealed that high levels of attention shifting decreased the risk for anxiety symptoms in children with high levels of BI, whereas high levels of inhibitory control increased this risk for anxiety symptoms. These findings suggest that different cognitive processes may influence relative levels of risk or adaptation depending upon a child’s temperamental reactivity. PMID:21301953

  10. The role of developmental plasticity and epigenetics in human health.

    Science.gov (United States)

    Gluckman, Peter D; Hanson, Mark A; Low, Felicia M

    2011-03-01

    Considerable epidemiological, experimental and clinical data have amassed showing that the risk of developing disease in later life is dependent on early life conditions, mainly operating within the normative range of developmental exposures. This relationship reflects plastic responses made by the developing organism as an evolved strategy to cope with immediate or predicted circumstances, to maximize fitness in the context of the range of environments potentially faced. There is now increasing evidence, both in animals and humans, that such developmental plasticity is mediated in part by epigenetic mechanisms. However, recognition of the importance of developmental plasticity as an important factor in influencing later life health-particularly within the medical and public health communities-is low, and we argue that this indifference cannot be sustained in light of the growing understanding of developmental processes and the rapid rise in the prevalence of obesity and metabolic disease globally. Copyright © 2011 Wiley-Liss, Inc.

  11. Developmentally Appropriate Peace Education Curricula

    Science.gov (United States)

    Lewsader, Joellen; Myers-Walls, Judith A.

    2017-01-01

    Peace education has been offered to children for decades, but those curricula have been only minimally guided by children's developmental stages and needs. In this article, the authors apply their research on children's developmental understanding of peace along with peace education principles and Vygotsky's sociocultural theory to present…

  12. Developmental Kindergarten Program Evaluation Report.

    Science.gov (United States)

    Blois, George T.; Cushing, Katherine S.

    The evaluation of the Developmental Kindergarten (DK) Program at the Harrison School District #2, Colorado Springs, Colorado, involved pre- and post-testing of student academic gains and interviewing of principals and teachers. The program aimed to provide developmentally appropriate activities for students believed to be "at risk" of…

  13. Developmental colour agnosia.

    Science.gov (United States)

    van Zandvoort, Martine J E; Nijboer, Tanja C W; de Haan, Edward

    2007-08-01

    Colour agnosia concerns the inability to recognise colours despite intact colour perception, semantic memory for colour information, and colour naming. Patients with selective colour agnosia have been described and the deficit is associated with left hemisphere damage. Here we report a case study of a 43-year-old man who was referred to us with a stroke in his right cerebellar hemisphere. During the standard assessment it transpired that he was unable to name coloured patches. Detailed assessment of his colour processing showed that he suffers from a selective colour agnosia. As he claimed to have had this problem all his life, and the fact that the infratentorial infarct that he had incurred was in an area far away from the brain structures that are known to be involved in colour processing, we suggest that he is the first reported case of developmental colour agnosia.

  14. [Neurotransmission in developmental disorders].

    Science.gov (United States)

    Takeuchi, Yoshihiro

    2008-11-01

    Attention deficit/hyperactivity disorder (AD/HD) is a heterogeneous developmental disorder with an etiology that is not fully understood. AD/HD has been considered to occur due to a disturbance in cathecholaminergic neurotransmission, with particular emphasis on dopamine. The neurotransmission of dopamine in subcortical regions such as the basal ganglia and limbic areas is synaptic; on the other hand, dopamine neurotransmission in the frontal cortex is quite different, because there are very few dopamine transporters (DAT) in the frontal cortex that allow dopamine to diffuse away from the dopamine synapse ("volume transmission"). It is now clear that noradrenergic neurons play a key regulatory role in dopaminergic function in the frontal cortex. Furthermore, serotonergic neurons exert an inhibitory effect on midbrain dopamine cell bodies, and they have an influence on dopamine release in terminal regions. There is accumulating neurobiological evidence pointing toward a role of the serotonin system in AD/HD. The etiology of autism spectrum disorders (ASD) is still unclear, but information from genetics, neuropathology, brain imaging, and basic neuroscience has provided insights into the understanding of this developmental disorder. In addition to abnormal circuitry in specific limbic and neocortical areas of the cerebral cortex, impairments in brainstem, cerebellar, thalamic, and basal ganglia connections have been reported. Numerous studies have pointed to abnormalities in serotonin and glutamate neurotransmission. Three important aspects involved in the pathophysiology of ASD have been proposed. The first is cell migration, the second is unbalanced excitatory-inhibitory networks, and the third is synapse formation and pruning, the key factors being reelin, neurexin, and neuroligin. Serotonin is considered to play an important role in all of these aspects of the pathophysiology of ASD. Finally, I would like to emphasize that it is crucial in the field of child

  15. Towards Developmental Connectomics of the Human Brain

    Directory of Open Access Journals (Sweden)

    Miao eCao

    2016-03-01

    Full Text Available Imaging connectomics based on graph theory has become an effective and unique methodological framework for studying structural and functional connectivity patterns of the developing brain. Normal brain development is characterized by continuous and significant network evolution throughout infancy, childhood and adolescence, following specific maturational patterns. Disruption of these normal changes is associated with neuropsychiatric developmental disorders, such as autism spectrum disorders or attention-deficit hyperactivity disorder. In this review, we focused on the recent progresses regarding typical and atypical development of human brain networks from birth to early adulthood, using a connectomic approach. Specifically, by the time of birth, structural networks already exhibit adult-like organization, with global efficient small-world and modular structures, as well as hub regions and rich-clubs acting as communication backbones. During development, the structure networks are fine-tuned, with increased global integration and robustness and decreased local segregation, as well as the strengthening of the hubs. In parallel, functional networks undergo more dramatic changes during maturation, with both increased integration and segregation during development, as brain hubs shift from primary regions to high order functioning regions, and the organization of modules transitions from a local anatomical emphasis to a more distributed architecture. These findings suggest that structural networks develop earlier than functional networks; meanwhile functional networks demonstrate more dramatic maturational changes with the evolution of structural networks serving as the anatomical backbone. In this review, we also highlighted topologically disorganized characteristics in structural and functional brain networks in several major developmental neuropsychiatric disorders (e.g., autism spectrum disorders, attention-deficit hyperactivity disorder and

  16. Toward Developmental Connectomics of the Human Brain.

    Science.gov (United States)

    Cao, Miao; Huang, Hao; Peng, Yun; Dong, Qi; He, Yong

    2016-01-01

    Imaging connectomics based on graph theory has become an effective and unique methodological framework for studying structural and functional connectivity patterns of the developing brain. Normal brain development is characterized by continuous and significant network evolution throughout infancy, childhood, and adolescence, following specific maturational patterns. Disruption of these normal changes is associated with neuropsychiatric developmental disorders, such as autism spectrum disorders or attention-deficit hyperactivity disorder. In this review, we focused on the recent progresses regarding typical and atypical development of human brain networks from birth to early adulthood, using a connectomic approach. Specifically, by the time of birth, structural networks already exhibit adult-like organization, with global efficient small-world and modular structures, as well as hub regions and rich-clubs acting as communication backbones. During development, the structure networks are fine-tuned, with increased global integration and robustness and decreased local segregation, as well as the strengthening of the hubs. In parallel, functional networks undergo more dramatic changes during maturation, with both increased integration and segregation during development, as brain hubs shift from primary regions to high order functioning regions, and the organization of modules transitions from a local anatomical emphasis to a more distributed architecture. These findings suggest that structural networks develop earlier than functional networks; meanwhile functional networks demonstrate more dramatic maturational changes with the evolution of structural networks serving as the anatomical backbone. In this review, we also highlighted topologically disorganized characteristics in structural and functional brain networks in several major developmental neuropsychiatric disorders (e.g., autism spectrum disorders, attention-deficit hyperactivity disorder and developmental

  17. Toward Developmental Connectomics of the Human Brain

    Science.gov (United States)

    Cao, Miao; Huang, Hao; Peng, Yun; Dong, Qi; He, Yong

    2016-01-01

    Imaging connectomics based on graph theory has become an effective and unique methodological framework for studying structural and functional connectivity patterns of the developing brain. Normal brain development is characterized by continuous and significant network evolution throughout infancy, childhood, and adolescence, following specific maturational patterns. Disruption of these normal changes is associated with neuropsychiatric developmental disorders, such as autism spectrum disorders or attention-deficit hyperactivity disorder. In this review, we focused on the recent progresses regarding typical and atypical development of human brain networks from birth to early adulthood, using a connectomic approach. Specifically, by the time of birth, structural networks already exhibit adult-like organization, with global efficient small-world and modular structures, as well as hub regions and rich-clubs acting as communication backbones. During development, the structure networks are fine-tuned, with increased global integration and robustness and decreased local segregation, as well as the strengthening of the hubs. In parallel, functional networks undergo more dramatic changes during maturation, with both increased integration and segregation during development, as brain hubs shift from primary regions to high order functioning regions, and the organization of modules transitions from a local anatomical emphasis to a more distributed architecture. These findings suggest that structural networks develop earlier than functional networks; meanwhile functional networks demonstrate more dramatic maturational changes with the evolution of structural networks serving as the anatomical backbone. In this review, we also highlighted topologically disorganized characteristics in structural and functional brain networks in several major developmental neuropsychiatric disorders (e.g., autism spectrum disorders, attention-deficit hyperactivity disorder and developmental

  18. The phenotypic plasticity of developmental modules

    Directory of Open Access Journals (Sweden)

    Aabha I. Sharma

    2016-08-01

    Full Text Available Abstract Background Organisms develop and evolve in a modular fashion, but how individual modules interact with the environment remains poorly understood. Phenotypically plastic traits are often under selection, and studies are needed to address how traits respond to the environment in a modular fashion. In this study, tissue-specific plasticity of melanic spots was examined in the large milkweed bug, Oncopeltus fasciatus. Results Although the size of the abdominal melanic bands varied according to rearing temperatures, wing melanic bands were more robust. To explore the regulation of abdominal pigmentation plasticity, candidate genes involved in abdominal melanic spot patterning and biosynthesis of melanin were analyzed. While the knockdown of dopa decarboxylase (Ddc led to lighter pigmentation in both the wings and the abdomen, the shape of the melanic elements remained unaffected. Although the knockdown of Abdominal-B (Abd-B partially phenocopied the low-temperature phenotype, the abdominal bands were still sensitive to temperature shifts. These observations suggest that regulators downstream of Abd-B but upstream of DDC are responsible for the temperature response of the abdomen. Ablation of wings led to the regeneration of a smaller wing with reduced melanic bands that were shifted proximally. In addition, the knockdown of the Wnt signaling nuclear effector genes, armadillo 1 and armadillo 2, altered both the melanic bands and the wing shape. Thus, the pleiotropic effects of Wnt signaling may constrain the amount of plasticity in wing melanic bands. Conclusions We propose that when traits are regulated by distinct pre-patterning mechanisms, they can respond to the environment in a modular fashion, whereas when the environment impacts developmental regulators that are shared between different modules, phenotypic plasticity can manifest as a developmentally integrated system.

  19. Present and future of developmental neuropsychopharmacology.

    Science.gov (United States)

    Arango, Celso

    2015-05-01

    The field of child and adolescent psychiatry has always lagged behind adult psychiatry. With recent evidence that the vast majority of mental disorders, even when they emerge in adulthood, cause abnormal neurodevelopment and resultant emphasis on prevention and early intervention, there is a need to put child psychiatry at the top of the agenda in mental health research. This should also be the case for developmental neuropsychopharmacology. The target of drug discovery should shift toward a population younger than the one that is typically included in clinical trials. This is not only a matter of trying to replicate what has been found in individuals with mature brains; it is about searching for new strategies that address developing brains while the therapeutic window for their effect is still open. At present, major concerns in developmental psychopharmacology are over-prescription rates and use of psychotropic medications for conditions with a particularly underdeveloped evidence base, as well as adverse effects, especially potentially life-shortening cardiometabolic effects and suicidal ideation. The future of research in this area should focus on the use of drugs for primary and secondary prevention that would modify abnormal brain development. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

  20. Developmental trajectories in food allergy: a review.

    LENUS (Irish Health Repository)

    DunnGalvin, A

    2009-01-01

    Increasing recognition of the importance of the relationships between perceptions, emotions, behaviors and health has changed the way health and disease are portrayed and researched. A chronic condition may affect and\\/or interact with already existing normative demands and changes in socialization. Although the prevalence of food allergy and anaphylaxis have been reportedly increasing, the emotional and social impact of growing up with food allergy has received little emphasis. In this paper, we present current findings on the biopsychosocial impact of food allergy on children in order to gain insight into the food allergy experience, from the perspective of the child, teen, and parent living with food allergy, with particular attention to developmental aspects. Due to the scarcity of publications on the psychosocial dimensions of food allergy, we also draw on selected literature on children\\'s and parent\\'s experience of, and coping with chronic disease that may inform research into food allergy. To this end, we review some general developmental mechanisms that may underpin and explain normative age-graded shifts in patterns of coping across childhood and adolescence. We also highlight gaps in the literature and assess implications of current research in food allergy and other chronic diseases for intervention and prevention of negative short and long term outcomes.

  1. The shifting perception.

    NARCIS (Netherlands)

    Besuijen, J.

    2005-01-01

    True to life, color display and color management depend on a proper technical model of the display used. Current gamma models and fitting procedures are not accurate in modeling the lower part of the tone reproduction curve. The GOG- and GOGO-model used in color management standards tend to clip the

  2. Lateral shifting in one dimensional chiral photonic crystal

    International Nuclear Information System (INIS)

    You Yuan; Chen Changyuan

    2012-01-01

    We report the lateral shifts of the transmitted waves in a one dimensional chiral photonic crystal by using the stationary-phase approach. It is revealed that two kinds of lateral shifts are observed due to the existence of cross coupling in chiral materials, which is different from what has been observed in previous non-chiral photonic crystals. Unlike the chiral slab, the positions of lateral shift peaks are closely related to the band edges of band gap characteristics of periodic structure and lateral shifts can be positive as well as negative. Besides, the lateral shifts show a strong dependence on the chiral factor, which varies the lateral shift peaks in both magnitudes and positions. These features are desirable for future device applications.

  3. Lateral shifting in one dimensional chiral photonic crystal

    Energy Technology Data Exchange (ETDEWEB)

    You Yuan, E-mail: yctcyouyuan@163.com [School of Physics and Electronics, Yancheng Teachers University, Yancheng, 224002 Jiangsu (China); Chen Changyuan [School of Physics and Electronics, Yancheng Teachers University, Yancheng, 224002 Jiangsu (China)

    2012-07-01

    We report the lateral shifts of the transmitted waves in a one dimensional chiral photonic crystal by using the stationary-phase approach. It is revealed that two kinds of lateral shifts are observed due to the existence of cross coupling in chiral materials, which is different from what has been observed in previous non-chiral photonic crystals. Unlike the chiral slab, the positions of lateral shift peaks are closely related to the band edges of band gap characteristics of periodic structure and lateral shifts can be positive as well as negative. Besides, the lateral shifts show a strong dependence on the chiral factor, which varies the lateral shift peaks in both magnitudes and positions. These features are desirable for future device applications.

  4. Cryptic Genetic Variation in Evolutionary Developmental Genetics

    Directory of Open Access Journals (Sweden)

    Annalise B. Paaby

    2016-06-01

    Full Text Available Evolutionary developmental genetics has traditionally been conducted by two groups: Molecular evolutionists who emphasize divergence between species or higher taxa, and quantitative geneticists who study variation within species. Neither approach really comes to grips with the complexities of evolutionary transitions, particularly in light of the realization from genome-wide association studies that most complex traits fit an infinitesimal architecture, being influenced by thousands of loci. This paper discusses robustness, plasticity and lability, phenomena that we argue potentiate major evolutionary changes and provide a bridge between the conceptual treatments of macro- and micro-evolution. We offer cryptic genetic variation and conditional neutrality as mechanisms by which standing genetic variation can lead to developmental system drift and, sheltered within canalized processes, may facilitate developmental transitions and the evolution of novelty. Synthesis of the two dominant perspectives will require recognition that adaptation, divergence, drift and stability all depend on similar underlying quantitative genetic processes—processes that cannot be fully observed in continuously varying visible traits.

  5. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.

    1998-01-01

    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  6. Attentional networks in developmental dyscalculia

    Directory of Open Access Journals (Sweden)

    Henik Avishai

    2010-01-01

    Full Text Available Abstract Background Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Methods Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test - interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. Results The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. Conclusions These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

  7. Attentional networks in developmental dyscalculia.

    Science.gov (United States)

    Askenazi, Sarit; Henik, Avishai

    2010-01-07

    Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test-interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

  8. Shifted-modified Chebyshev filters

    OpenAIRE

    ŞENGÜL, Metin

    2013-01-01

    This paper introduces a new type of filter approximation method that utilizes shifted-modified Chebyshev filters. Construction of the new filters involves the use of shifted-modified Chebyshev polynomials that are formed using the roots of conventional Chebyshev polynomials. The study also includes 2 tables containing the shifted-modified Chebyshev polynomials and the normalized element values for the low-pass prototype filters up to degree 6. The transducer power gain, group dela...

  9. Portable shift register

    International Nuclear Information System (INIS)

    Halbig, J.K.; Bourret, S.C.; Hansen, W.J.; Hicks, D.V.; Klosterbuer, S.F.; Krick, M.S.

    1994-01-01

    An electronics package for a small, battery-operated, self-contained, neutron coincidence counter based on a portable shift-register (PSR) has been developed. The counter was developed for applications not adequately addressed by commercial packages, including in-plant measurements to demonstrate compliance with regulations (domestic and international), in-plant process control, and in-field measurements (environmental monitoring or safeguards). Our package's features, which address these applications, include the following: Small size for portability and ease of installation;battery or mains operation; a built-in battery to power the unit and a typical detector such as a small sample counter, for over 6 h if power lines are bad or noisy, if there is a temporary absence of power, or if portability is desired; complete support, including bias, for standard neutron detectors; a powerful communications package to easily facilitate robust external control over a serial port; and a C-library to simplify creating external control programs in computers or other controllers. Whereas the PSR specifically addresses the applications mentioned above, it also performs all the measurements made by previous electronics packages for neutron coincidence counters developed at Los Alamos and commercialized. The PSR electronics package, exclusive of carrying handle, is 8 by 10 by 20 cm; it contains the circuit boards, battery, and bias supply and weighs less than 2 kg. This instrument package is the second in an emerging family of portable measurement instruments being developed; the first was the Miniature and Modular Multichannel Analyzer (M 3 CA). The PSR makes extensive use of hardware and software developed for the M 3 CA; like the M 3 CA, it is intended primarily for use with an external controller interfaced over a serial channel

  10. Quantized beam shifts in graphene

    Energy Technology Data Exchange (ETDEWEB)

    de Melo Kort-Kamp, Wilton Junior [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sinitsyn, Nikolai [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dalvit, Diego Alejandro Roberto [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-08

    We predict the existence of quantized Imbert-Fedorov, Goos-Hanchen, and photonic spin Hall shifts for light beams impinging on a graphene-on-substrate system in an external magnetic field. In the quantum Hall regime the Imbert-Fedorov and photonic spin Hall shifts are quantized in integer multiples of the fine structure constant α, while the Goos-Hanchen ones in multiples of α2. We investigate the influence on these shifts of magnetic field, temperature, and material dispersion and dissipation. An experimental demonstration of quantized beam shifts could be achieved at terahertz frequencies for moderate values of the magnetic field.

  11. Developmental plasticity and the evolution of parental effects.

    Science.gov (United States)

    Uller, Tobias

    2008-08-01

    One of the outstanding challenges for evolutionary biologists is to understand how developmental plasticity can influence the evolutionary process. Developmental plasticity frequently involves parental effects, which might enable adaptive and context-dependent transgenerational transmission of phenotypic strategies. However, parent-offspring conflict will frequently result in parental effects that are suboptimal for parents, offspring or both. The fitness consequences of parental effects at evolutionary equilibrium will depend on how conflicts can be resolved by modifications of developmental processes, suggesting that proximate studies of development can inform ultimate questions. Furthermore, recent studies of plants and animals show how studies of parental effects in an ecological context provide important insights into the origin and evolution of adaptation under variable environmental conditions.

  12. Lamb shift of energy levels in quantum rings

    International Nuclear Information System (INIS)

    Kryuchkyan, G Yu; Kyriienko, O; Shelykh, I A

    2015-01-01

    We study the vacuum radiative corrections to energy levels of a confined electron in quantum rings. The calculations are provided for the Lamb shift of energy levels in a low-momentum region of virtual photons and for both one-dimensional and two-dimensional quantum rings. We show that contrary to the well known case of a hydrogen atom the value of the Lamb shift increases with the magnetic momentum quantum number m. We also investigate the dependence of the Lamb shift on magnetic flux piercing the ring and demonstrate a presence of magnetic-flux-dependent oscillations. For a one-dimensional ring the value of the shift strongly depends on the radius of the ring. It is small for semiconductor rings but can attain measurable quantities in natural organic ring-shape molecules, such as benzene, cycloalcanes and porphyrins. (paper)

  13. Sleep and satisfaction in 8- and 12-h forward-rotating shift systems: Industrial employees prefer 12-h shifts.

    Science.gov (United States)

    Karhula, Kati; Härmä, Mikko; Ropponen, Annina; Hakola, Tarja; Sallinen, Mikael; Puttonen, Sampsa

    2016-01-01

    Twelve-hour shift systems have become more popular in industry. Survey data of shift length, shift rotation speed, self-rated sleep, satisfaction and perceived health were investigated for the associations among 599 predominantly male Finnish industrial employees. The studied forward-rotating shift systems were 12-h fast (12fast, DDNN------, n = 268), 8-h fast (8fast, MMEENN----, n = 161) and 8-h slow (8slow, MMMM-EEEE-NNNN, n = 170). Satisfaction with shift system differed between the groups (p effects on sleep and alertness were rare (8%) in the 12fast group (53% 8fast, 66% 8 slow, p effects of the current shift system on general health (12fast 4%, 8fast 30%, 8slow 41%, p work-life balance (12fast 8%, 8fast 52%, 8slow 63%, p effects of shift work were dependent on both shift length and shift rotation speed: employees in the 12-h rapidly forward-rotating shift system were most satisfied, perceived better work-life balance and slept better than the employees in the 8fast or especially the employees in the 8-h slowly rotating systems.

  14. Young Children’s Developmental Ecologies and Kindergarten Readiness

    Science.gov (United States)

    Mollborn, Stefanie

    2016-01-01

    Children enter the crucial transition to school with sociodemographic disparities firmly established. Domain-specific research (e.g., on poverty and family structure) has shed light on these disparities, but we need broader operationalizations of children’s environments to explain them. Building on existing theory, this study articulates the concept of developmental ecology—those interrelated features of a child’s proximal environment that shape development and health. Developmental ecology links structural and demographic factors with interactional, psychological, and genetic factors. Using the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B), this study conducts latent class analyses to identify how 41 factors from three domains—namely, household resources, health risks, and ecological changes—cluster within children as four overarching developmental ecologies. Because it documents how numerous factors co-occur within children, this method allows an approximation of their lived environments. Findings illuminate powerful relationships between race/ethnicity, parental age, socioeconomic background, and nativity and a child’s developmental ecology, as well as associations between developmental ecology and kindergarten cognition, behavior, and health. Developmental ecology represents a major pathway through which demographic characteristics shape school readiness. Because specific factors have different implications depending on the ecologies in which they are embedded, findings support the usefulness of a broad ecological approach. PMID:27873222

  15. Diet-dependent shifts in ruminal butyrate producing bacteria

    Czech Academy of Sciences Publication Activity Database

    Mrázek, Jakub; Tepšič, K.; Avguštin, G.; Kopečný, Jan

    2006-01-01

    Roč. 51, č. 4 (2006), s. 294-298 ISSN 0015-5632 R&D Projects: GA AV ČR IBS5045112 Institutional research plan: CEZ:AV0Z50450515 Keywords : butyrate-producing bacteria Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 0.963, year: 2006

  16. Dependence of gain and phase-shift on crystal parameters

    Indian Academy of Sciences (India)

    The steady-state amplification of light beam during two-wave mixing in photorefractive materials has been analysed in the strong nonlinear regime. The oscillation conditions for unidirectional ring resonator have been studied. The signal beam can be amplified in the presence of material absorption, provided the gain due to ...

  17. Tobacco Use among Individuals with Intellectual or Developmental Disabilities: A Brief Review

    Science.gov (United States)

    Steinberg, Marc L.; Heimlich, Laura; Williams, Jill M.

    2009-01-01

    Tobacco use is the leading preventable cause of death in the United States. Although few tobacco control efforts target individuals with intellectual and/or developmental disabilities, this population may be especially vulnerable to the deleterious effects of tobacco use and dependence. Individuals with intellectual and developmental disabilities…

  18. Developmental transcriptome of Aplysia californica'

    KAUST Repository

    Heyland, Andreas; Vue, Zer; Voolstra, Christian R.; Medina, Mó nica; Moroz, Leonid L.

    2010-01-01

    developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms

  19. PREVALENCE AND EFFECT OF DEVELOPMENTAL ...

    African Journals Online (AJOL)

    uvp

    among children might even be higher, as medical and educational systems frequently fail to ... formally diagnosed, but rather described by their teachers as lazy or ..... Developmental Coordination Disorder Questionnaire for Brazilian children.

  20. The Management of Developmental Apraxia.

    Science.gov (United States)

    Gubbay, S. S.

    1978-01-01

    Of 39 children (5-12 years old) with developmental apraxia and agnosia, who were assessed neurologically, 19 were also given simple standarized tests of motor ability. Journal availability: see EC 112 661. (Author/SBH)

  1. The Role of Shifting, Updating, and Inhibition in Prospective Memory Performance in Young and Older Adults

    Science.gov (United States)

    Schnitzspahn, Katharina M.; Stahl, Christoph; Zeintl, Melanie; Kaller, Christoph P.; Kliegel, Matthias

    2013-01-01

    Prospective memory performance shows a decline in late adulthood. The present article examines the role of 3 main executive function facets (i.e., shifting, updating, and inhibition) as possible developmental mechanisms associated with these age effects. One hundred seventy-five young and 110 older adults performed a battery of cognitive tests…

  2. Age-Related Change in Shifting Attention between Global and Local Levels of Hierarchical Stimuli

    Science.gov (United States)

    Huizinga, Mariette; Burack, Jacob A.; Van der Molen, Maurits W.

    2010-01-01

    The focus of this study was the developmental pattern of the ability to shift attention between global and local levels of hierarchical stimuli. Children aged 7 years and 11 years and 21-year-old adults were administered a task (two experiments) that allowed for the examination of 1) the direction of attention to global or local stimulus levels;…

  3. Developmental toxicity of engineered nanomaterials

    DEFF Research Database (Denmark)

    Hougaard, Karin S.; Hansen, Jitka S.; Jackson, Petra

    2016-01-01

    Study of air pollution indicates that minute particles may adversely interfere with pregnancy and fetal development. As engineering of nanoparticles have emerged, so has concern that these might interfere with reproductive and developmental functions. This is because nanotechnology may potentially...... increase the overall particle burden in air and introduce particles with novel characteristics and surface reactivity. To evaluate safety for pregnant women, we have studied developmental toxicity of engineered nanoparticles (ENPs), following exposure of pregnant mice by inhalation (ENPs of titanium...

  4. Work shifts in Emergency Medicine

    Directory of Open Access Journals (Sweden)

    Roberto Recupero

    2007-06-01

    Full Text Available Emergency Medicine is known as a high stress specialty. The adverse effect of constantly rotating shifts is the single most important reason given for premature attrition from the field. In this work problems tied with night shift work will be taken into account and some solutions to reduce the impact of night work on the emergency physicians will be proposed.

  5. Flexible Schedules and Shift Work.

    Science.gov (United States)

    Beers, Thomas M.

    2000-01-01

    Flexible work hours have gained prominence, as more than 25 million workers (27.6% of all full-time workers) can now vary their schedules. However, there has been little change since the mid-1980s in the proportion who work a shift other than a regular daytime shift. (JOW)

  6. Shift schedule, work–family relationships, marital communication, job satisfaction and health among transport service shift workers

    Directory of Open Access Journals (Sweden)

    Irena Iskra-Golec

    2017-02-01

    Full Text Available Objectives: Existing research has documented that shiftwork consequences may depend on the shift system parameters. Fast rotating systems (1–3 shifts of the same kind in a row and day work have been found to be less disruptive biologically and socially than slower rotating systems and afternoon and night work. The aim of this study was to compare day workers and shift workers of different systems in terms of rotation speed and shifts worked with regard to work–family and family–work positive and negative spillover, marital communication style, job satisfaction and health. Material and Methods: Employees (N = 168 of the maintenance workshops of transportation service working different shift systems (day shift, weekly rotating 2 and 3‑shift system, and fast rotating 3-shift system participated in the study. They completed the Work– Family Spillover Questionnaire, Marital Communication Questionnaire, Minnesota Job Satisfaction Questionnaire and the Physical Health Questionnaire (a part of the Standard Shiftwork Index. Results: The workers of quicker rotating 3-shift systems reported significantly higher scores of family-to-work facilitation (F(3, 165 = 4.175, p = 0.007 and a higher level of constructive style of marital communication (Engagement F(3, 165 = 2.761, p = 0.044 than the workers of slower rotating 2-shift systems. There were no differences between the groups of workers with regard to health and job satisfaction. Conclusions: A higher level of work–family facilitation and a more constructive style of marital communication were found among the workers of faster rotating 3-shift system when compared to the workers of a slower rotating 2-shift system (afternoon, night. This may indicate that the fast rotating shift system in contrary to the slower rotating one is more friendly for the work and family domains and for the relationship between them. Int J Occup Med Environ Health 2017;30(1:121–131

  7. Developmental Programming of Adult Disease: Reprogramming by Melatonin?

    Directory of Open Access Journals (Sweden)

    You-Lin Tain

    2017-02-01

    Full Text Available Adult-onset chronic non-communicable diseases (NCDs can originate from early life through so-called the “developmental origins of health and disease” (DOHaD or “developmental programming”. The DOHaD concept offers the “reprogramming” strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evidence support that melatonin is closely inter-related to other proposed mechanisms contributing to the developmental programming of a variety of chronic NCDs. Recent animal studies have begun to unravel the multifunctional roles of melatonin in many experimental models of developmental programming. Even though some progress has been made in research on melatonin as a reprogramming strategy to prevent DOHaD-related NCDs, future human studies should aim at filling the translational gap between animal models and clinical trials. Here, we review several key themes on the reprogramming effects of melatonin in DOHaD research. We have particularly focused on the following areas: mechanisms of developmental programming; the interrelationship between melatonin and mechanisms underlying developmental programming; pathophysiological roles of melatonin in pregnancy and fetal development; and insight provided by animal models to support melatonin as a reprogramming therapy. Rates of NCDs are increasing faster than anticipated all over the world. Hence, there is an urgent need to understand reprogramming mechanisms of melatonin and to translate experimental research into clinical practice for halting a growing list of DOHaD-related NCDs.

  8. Developmental Programming of Adult Disease: Reprogramming by Melatonin?

    Science.gov (United States)

    Tain, You-Lin; Huang, Li-Tung; Hsu, Chien-Ning

    2017-02-16

    Adult-onset chronic non-communicable diseases (NCDs) can originate from early life through so-called the "developmental origins of health and disease" (DOHaD) or "developmental programming". The DOHaD concept offers the "reprogramming" strategy to shift the treatment from adulthood to early life, before clinical disease is apparent. Melatonin, an endogenous indoleamine produced by the pineal gland, has pleiotropic bioactivities those are beneficial in a variety of human diseases. Emerging evidence support that melatonin is closely inter-related to other proposed mechanisms contributing to the developmental programming of a variety of chronic NCDs. Recent animal studies have begun to unravel the multifunctional roles of melatonin in many experimental models of developmental programming. Even though some progress has been made in research on melatonin as a reprogramming strategy to prevent DOHaD-related NCDs, future human studies should aim at filling the translational gap between animal models and clinical trials. Here, we review several key themes on the reprogramming effects of melatonin in DOHaD research. We have particularly focused on the following areas: mechanisms of developmental programming; the interrelationship between melatonin and mechanisms underlying developmental programming; pathophysiological roles of melatonin in pregnancy and fetal development; and insight provided by animal models to support melatonin as a reprogramming therapy. Rates of NCDs are increasing faster than anticipated all over the world. Hence, there is an urgent need to understand reprogramming mechanisms of melatonin and to translate experimental research into clinical practice for halting a growing list of DOHaD-related NCDs.

  9. Developmental and Individual Differences in Pure Numerical Estimation

    Science.gov (United States)

    Booth, Julie L.; Siegler, Robert S.

    2006-01-01

    The authors examined developmental and individual differences in pure numerical estimation, the type of estimation that depends solely on knowledge of numbers. Children between kindergarten and 4th grade were asked to solve 4 types of numerical estimation problems: computational, numerosity, measurement, and number line. In Experiment 1,…

  10. Hydroxylated PBDEs induce developmental arrest in zebrafish

    Energy Technology Data Exchange (ETDEWEB)

    Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu; Bruce, Erica D., E-mail: Erica_bruce@baylor.edu

    2012-07-01

    The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was not observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.

  11. Developmental Science: Past, Present, and Future

    Science.gov (United States)

    Lerner, Richard M.

    2012-01-01

    The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…

  12. Developmental Hypothyroidism Reduces the Expression of ...

    Science.gov (United States)

    Disruption of thyroid hormone (TH) is a known effect of environmental contaminants. Neurotrophins including brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) have been implicated in brain dysfunction resulting from severe developmental TH insufficiency. Neurotrophins are also implicated in activity-dependent plasticity, a process critical for appropriate use-dependent connectivity in the developing brain and for memory formation in the adult. This study examined activity-induced expression of neurotrophin gene products in the hippocampus using the long-term potentiation (LTP) after developmental hypothyroidism induced by propylthiouracil (PTU). Pregnant rats were exposed to PTU (0 or I0ppm) via the drinking water from early gestation to weaning. Adult male offspring were anesthetized with urethane and implanted with electrodes in the dentate gyrus (00) and perforant path (PP). LTP was induced by PP stimulation and responses from 00 were monitored at 15m intervals until sacrifice of the animals 5 h later. The 00 was dissected from the stimulated and nonstimulated hemispheres for rtPCR analysis of the neurotrophins Bdnf, Ngf, Ntf3 and related genes Egrl, Arc, Klf9. We found no PTU-induced difference in basal levels of expression of any of these genes in the nonstimulated 00. LTP increased expression of Bdnf, Ngf, Arc and Klj9 in the control DG, and reduced expression of Ntf3. LTP in DG from PTU animals failed to increase expression of Bdnf,

  13. Fetal functional brain age assessed from universal developmental indices obtained from neuro-vegetative activity patterns.

    Directory of Open Access Journals (Sweden)

    Dirk Hoyer

    Full Text Available Fetal brain development involves the development of the neuro-vegetative (autonomic control that is mediated by the autonomic nervous system (ANS. Disturbances of the fetal brain development have implications for diseases in later postnatal life. In that context, the fetal functional brain age can be altered. Universal principles of developmental biology applied to patterns of autonomic control may allow a functional age assessment. The work aims at the development of a fetal autonomic brain age score (fABAS based on heart rate patterns. We analysed n = 113 recordings in quiet sleep, n = 286 in active sleep, and n = 29 in active awakeness from normals. We estimated fABAS from magnetocardiographic recordings (21.4-40.3 weeks of gestation preclassified in quiet sleep (n = 113, 63 females and active sleep (n = 286, 145 females state by cross-validated multivariate linear regression models in a cross-sectional study. According to universal system developmental principles, we included indices that address increasing fluctuation range, increasing complexity, and pattern formation (skewness, power spectral ratio VLF/LF, pNN5. The resulting models constituted fABAS. fABAS explained 66/63% (coefficient of determination R(2 of training and validation set of the variance by age in quiet, while 51/50% in active sleep. By means of a logistic regression model using fluctuation range and fetal age, quiet and active sleep were automatically reclassified (94.3/93.1% correct classifications. We did not find relevant gender differences. We conclude that functional brain age can be assessed based on universal developmental indices obtained from autonomic control patterns. fABAS reflect normal complex functional brain maturation. The presented normative data are supplemented by an explorative study of 19 fetuses compromised by intrauterine growth restriction. We observed a shift in the state distribution towards active awakeness. The lower WGA

  14. Developmental changes in organization of structural brain networks.

    Science.gov (United States)

    Khundrakpam, Budhachandra S; Reid, Andrew; Brauer, Jens; Carbonell, Felix; Lewis, John; Ameis, Stephanie; Karama, Sherif; Lee, Junki; Chen, Zhang; Das, Samir; Evans, Alan C

    2013-09-01

    Recent findings from developmental neuroimaging studies suggest that the enhancement of cognitive processes during development may be the result of a fine-tuning of the structural and functional organization of brain with maturation. However, the details regarding the developmental trajectory of large-scale structural brain networks are not yet understood. Here, we used graph theory to examine developmental changes in the organization of structural brain networks in 203 normally growing children and adolescents. Structural brain networks were constructed using interregional correlations in cortical thickness for 4 age groups (early childhood: 4.8-8.4 year; late childhood: 8.5-11.3 year; early adolescence: 11.4-14.7 year; late adolescence: 14.8-18.3 year). Late childhood showed prominent changes in topological properties, specifically a significant reduction in local efficiency, modularity, and increased global efficiency, suggesting a shift of topological organization toward a more random configuration. An increase in number and span of distribution of connector hubs was found in this age group. Finally, inter-regional connectivity analysis and graph-theoretic measures indicated early maturation of primary sensorimotor regions and protracted development of higher order association and paralimbic regions. Our finding reveals a time window of plasticity occurring during late childhood which may accommodate crucial changes during puberty and the new developmental tasks that an adolescent faces.

  15. Embryonic effects of radiation on ICR mice depending developmental stages

    Energy Technology Data Exchange (ETDEWEB)

    Gu, Yeun Hwa; Kusama, Tomoko; Kai, Michiaki [University of Tokyo, Tokyo (Japan)

    1995-06-15

    The ICR pregnant mice were irradiated at 1.5Gy in every 6 hours in the period of organogenesis in order to classify the stage specificity of the embryonic effects of radiation and the stage of development differentiation of the primordium of each major organ. Intrauterine death, fetal body weight and external malformation in live fetuses were observed on day 18 of gestation. There was no statistically significant difference in the intrauterine mortality at any stage organogenesis. The fetal body weight of the mice irradiated in the intermediate stage of organogenesis showed significantly lower. There were specific highly sensitive stages in the incidences of each external malformation, that is exencephalia, open eyelid, cleft palate, anomalies of extremities and anomalies of the tail. At these stage, the primordial of the major organs are established in ICR mice.

  16. Developmental Differences in Children's Context-Dependent Word Learning

    Science.gov (United States)

    Vlach, Haley A.; Sandhofer, Catherine M.

    2011-01-01

    In this study, 2.5-, 3-, and 4-year-olds (N=108) participated in a novel noun generalization task in which background context was manipulated. During the learning phase of each trial, children were presented with exemplars in one or multiple background contexts. At the test, children were asked to generalize to a novel exemplar in either the same…

  17. Embryonic effects of radiation on ICR mice depending developmental stages

    International Nuclear Information System (INIS)

    Gu, Yeun Hwa; Kusama, Tomoko; Kai, Michiaki

    1995-01-01

    The ICR pregnant mice were irradiated at 1.5Gy in every 6 hours in the period of organogenesis in order to classify the stage specificity of the embryonic effects of radiation and the stage of development differentiation of the primordium of each major organ. Intrauterine death, fetal body weight and external malformation in live fetuses were observed on day 18 of gestation. There was no statistically significant difference in the intrauterine mortality at any stage organogenesis. The fetal body weight of the mice irradiated in the intermediate stage of organogenesis showed significantly lower. There were specific highly sensitive stages in the incidences of each external malformation, that is exencephalia, open eyelid, cleft palate, anomalies of extremities and anomalies of the tail. At these stage, the primordial of the major organs are established in ICR mice

  18. Learning To Breathe: Developmental Phase Transitions in Oxygen Status.

    Science.gov (United States)

    Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H

    2017-02-01

    Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Inequalities for scattering phase shifts

    International Nuclear Information System (INIS)

    Baumgartner, B.; Grosse, H.

    1985-01-01

    A recently developed method, which was used to derive bounds on energy levels, is applied to continuous spectra and gives relations between scattering phase shifts of various angular momenta. (Author)

  20. Isotope shifts in unstable nuclei

    International Nuclear Information System (INIS)

    Rebel, H.

    1980-05-01

    Current experimental investigations of isotope shifts in atomic spectra of unstable nuclei and the resulting information about size and shape of nuclei far off stability are discussed with reference to some representative examples. (orig.)

  1. Probabilistic validation of protein NMR chemical shift assignments

    International Nuclear Information System (INIS)

    Dashti, Hesam; Tonelli, Marco; Lee, Woonghee; Westler, William M.; Cornilescu, Gabriel; Ulrich, Eldon L.; Markley, John L.

    2016-01-01

    Data validation plays an important role in ensuring the reliability and reproducibility of studies. NMR investigations of the functional properties, dynamics, chemical kinetics, and structures of proteins depend critically on the correctness of chemical shift assignments. We present a novel probabilistic method named ARECA for validating chemical shift assignments that relies on the nuclear Overhauser effect data. ARECA has been evaluated through its application to 26 case studies and has been shown to be complementary to, and usually more reliable than, approaches based on chemical shift databases. ARECA is available online at http://areca.nmrfam.wisc.edu/ http://areca.nmrfam.wisc.edu/

  2. Probabilistic validation of protein NMR chemical shift assignments

    Energy Technology Data Exchange (ETDEWEB)

    Dashti, Hesam [University of Wisconsin-Madison, Graduate Program in Biophysics, Biochemistry Department (United States); Tonelli, Marco; Lee, Woonghee; Westler, William M.; Cornilescu, Gabriel [University of Wisconsin-Madison, Biochemistry Department, National Magnetic Resonance Facility at Madison (United States); Ulrich, Eldon L. [University of Wisconsin-Madison, BioMagResBank, Biochemistry Department (United States); Markley, John L., E-mail: markley@nmrfam.wisc.edu, E-mail: jmarkley@wisc.edu [University of Wisconsin-Madison, Biochemistry Department, National Magnetic Resonance Facility at Madison (United States)

    2016-01-15

    Data validation plays an important role in ensuring the reliability and reproducibility of studies. NMR investigations of the functional properties, dynamics, chemical kinetics, and structures of proteins depend critically on the correctness of chemical shift assignments. We present a novel probabilistic method named ARECA for validating chemical shift assignments that relies on the nuclear Overhauser effect data. ARECA has been evaluated through its application to 26 case studies and has been shown to be complementary to, and usually more reliable than, approaches based on chemical shift databases. ARECA is available online at http://areca.nmrfam.wisc.edu/ http://areca.nmrfam.wisc.edu/.

  3. NMR chemical shifts in amino acids: Effects of environments, electric field, and amine group rotation

    International Nuclear Information System (INIS)

    Yoon, Young-Gui; Pfrommer, Bernd G.; Louie, Steven G.; Canning, Andrew

    2002-01-01

    The authors present calculations of NMR chemical shifts in crystalline phases of some representative amino acids such as glycine, alanine, and alanyl-alanine. To get an insight on how different environments affect the chemical shifts, they study the transition from the crystalline phase to completely isolated molecules of glycine. In the crystalline limit, the shifts are dominated by intermolecular hydrogen-bonds. In the molecular limit, however, dipole electric field effects dominate the behavior of the chemical shifts. They show that it is necessary to average the chemical shifts in glycine over geometries. Tensor components are analyzed to get the angle dependent proton chemical shifts, which is a more refined characterization method

  4. A partial differential equation for pseudocontact shift.

    Science.gov (United States)

    Charnock, G T P; Kuprov, Ilya

    2014-10-07

    It is demonstrated that pseudocontact shift (PCS), viewed as a scalar or a tensor field in three dimensions, obeys an elliptic partial differential equation with a source term that depends on the Hessian of the unpaired electron probability density. The equation enables straightforward PCS prediction and analysis in systems with delocalized unpaired electrons, particularly for the nuclei located in their immediate vicinity. It is also shown that the probability density of the unpaired electron may be extracted, using a regularization procedure, from PCS data.

  5. Neurobehavioural effects of developmental toxicity

    DEFF Research Database (Denmark)

    Grandjean, Philippe; Landrigan, Philip J

    2014-01-01

    Neurodevelopmental disabilities, including autism, attention-deficit hyperactivity disorder, dyslexia, and other cognitive impairments, affect millions of children worldwide, and some diagnoses seem to be increasing in frequency. Industrial chemicals that injure the developing brain are among...... the known causes for this rise in prevalence. In 2006, we did a systematic review and identified five industrial chemicals as developmental neurotoxicants: lead, methylmercury, polychlorinated biphenyls, arsenic, and toluene. Since 2006, epidemiological studies have documented six additional developmental...... chemicals should not be presumed to be safe to brain development, and chemicals in existing use and all new chemicals must therefore be tested for developmental neurotoxicity. To coordinate these efforts and to accelerate translation of science into prevention, we propose the urgent formation of a new...

  6. DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

    Directory of Open Access Journals (Sweden)

    Jelena Kostić

    2015-12-01

    Full Text Available Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to conduct disorder which have different causes and serve as the basis for the current typology of conduct disorders in the classification systems. Such a typology of conduct disorders in the diagnostic classification allows better understanding, prognosis and choice of treatment.

  7. Developmental analytic view on narcissism

    Directory of Open Access Journals (Sweden)

    Polona Matjan Štuhec

    2009-07-01

    Full Text Available Narcissistic pathology is connected to the pathology of the self. This article makes an overview of definitions of developmental analytic theories and stops with Kohut, Kernberg, Masterson, Auerbach and Mollon. The self is understood as a separate personality structure and has its own developmental line. Narcissism is a personality disorder that has its roots in preodipal developmental phases, mostly in the practicing and rapprochement subphase and in the oedipal phase as well. Recent research shows that the oedipal phase and the relation between the mother, the child's father (or her partner in general and the child is crucial for the maintenance of the pathological narcissism. Mothers who do not believe in a satisfying relationship with a man in general, keep the child in the dyadic position and do not support the development of the child's own identity.

  8. Stowage Planning in Multiple Ports with Shifting Fee Minimization

    Directory of Open Access Journals (Sweden)

    E. Zhang

    2018-01-01

    Full Text Available This paper studies the problem of stowage planning within a vessel bay in a multiple port transportation route, aiming at minimizing the total container shifting fee. Since the access to containers is in the top-to-bottom order for each stack, reshuffle operations occur when a target container to be unloaded at its destination port is not stowed on the top of a stack at the time. Each container shift via a quay crane induces one unit of shifting fee that depends on the charge policy of the local container port. Previous studies assume that each container shift consumes a uniform cost in all ports and thus focus on minimizing the total number of shifts or the turnaround time of the vessel. Motivated by the observation that different ports are of nonuniform fee for each container shift, we propose a mixed integer programming (MIP model for the problem to produce an optimal stowage planning with minimum total shifting fee in this work. Moreover, as the considered problem is NP-hard due to the NP-hardness of its counterpart with uniform unit shifting fee, we propose an improved genetic algorithm to solve the problem. The efficiency of the proposed algorithm is demonstrated via numerical experiments.

  9. Developmental orthopaedic diseases in foals

    International Nuclear Information System (INIS)

    Şİrİn, Özlem; Alkan, Zeki

    2010-01-01

    Developmental Orthopaedic Diseases (DOD) is seen frequently in horses which completed their maturity. Osteochondrosis, physitis, angular limb deformities, flexural deformities, juvenil arthritis, cervical vertebral anomalies, cuboidal bone abnormalities are problems investigated under Developmental Orthopaedic Diseases title. This diseases can develop single or some together in fast growing, heavy animals (especially Arabian and English Thoroughbreds). Multifactorial causes of this diseases etiopathogenesis can be listed as genetic predisposition, trauma, nutrition, vitamins/minerals and endocrine disorders. But the exact causes of these diseases are not known. In this review detailed information are given about the diseases mentioned above

  10. Grounded in the World: Developmental Origins of the Embodied Mind

    Science.gov (United States)

    Thelen, Esther

    Piaget's question of how the adult mind emerges from the sensorimotor infant is still the framing issue for developmental psychology. Here I suggest that real-life skill is better understood if the sensorimotor origins of cognition are not abandoned. Skilled people are better at both abstract and logical thinking, but also at processing the world 'on-line' and most importantly, seamlessly and rapidly shifting between the two modes. I illustrate the tight coupling between action, perception, and cognition in early life and propose that this coupling remains, but becomes more flexibly adaptive. Furthermore, I show that the language of dynamics is appropriate to capture these mind-body-world interconnections.

  11. Inclusion for People with Developmental Disabilities: Measuring an Elusive Construct.

    Science.gov (United States)

    Neely-Barnes, Susan Louise; Elswick, Susan E

    2016-01-01

    The philosophy of inclusion for people with intellectual and developmental disabilities (IDD) has evolved over the last 50 years. Over time, inclusion research has shifted from a focus on deinstitutionalization to understanding the extent to which individuals with IDD are meaningfully involved in the community and social relationships. Yet, there has been no agreed on way to measure inclusion. Many different measurement and data collection techniques have been used in the literature. This study proposes a brief measure of inclusion that can be used with family members and on survey instruments.

  12. Shifting schedules: the health effects of reorganizing shift work.

    Science.gov (United States)

    Bambra, Clare L; Whitehead, Margaret M; Sowden, Amanda J; Akers, Joanne; Petticrew, Mark P

    2008-05-01

    Approximately one fifth of workers are engaged in some kind of shift work. The harmful effects of shift work on the health and work-life balance of employees are well known. A range of organizational interventions has been suggested to address these negative effects. This study undertook the systematic review (following Quality Of Reporting Of Meta [QUORUM] analyses guidelines) of experimental and quasi-experimental studies, from any country (in any language) that evaluated the effects on health and work-life balance of organizational-level interventions that redesign shift work schedules. Twenty-seven electronic databases (medical, social science, economic) were searched. Data extraction and quality appraisal were carried out by two independent reviewers. Narrative synthesis was performed. The review was conducted between October 2005 and November 2006. Twenty-six studies were found relating to a variety of organizational interventions. No one type of intervention was found to be consistently harmful to workers. However, three types were found to have beneficial effects on health and work-life balance: (1) switching from slow to fast rotation, (2) changing from backward to forward rotation, and (3) self-scheduling of shifts. Improvements were usually at little or no direct organizational cost. However, there were concerns about the generalizability of the evidence, and no studies reported on impacts on health inequalities. This review reinforces the findings of epidemiologic and laboratory-based research by suggesting that certain organizational-level interventions can improve the health of shift workers, their work-life balance, or both. This evidence could be useful when designing interventions to improve the experience of shift work.

  13. Dual Processes in Decision Making and Developmental Neuroscience: A Fuzzy-Trace Model.

    Science.gov (United States)

    Reyna, Valerie F; Brainerd, Charles J

    2011-09-01

    From Piaget to the present, traditional and dual-process theories have predicted improvement in reasoning from childhood to adulthood, and improvement has been observed. However, developmental reversals-that reasoning biases emerge with development -have also been observed in a growing list of paradigms. We explain how fuzzy-trace theory predicts both improvement and developmental reversals in reasoning and decision making. Drawing on research on logical and quantitative reasoning, as well as on risky decision making in the laboratory and in life, we illustrate how the same small set of theoretical principles apply to typical neurodevelopment, encompassing childhood, adolescence, and adulthood, and to neurological conditions such as autism and Alzheimer's disease. For example, framing effects-that risk preferences shift when the same decisions are phrases in terms of gains versus losses-emerge in early adolescence as gist-based intuition develops. In autistic individuals, who rely less on gist-based intuition and more on verbatim-based analysis, framing biases are attenuated (i.e., they outperform typically developing control subjects). In adults, simple manipulations based on fuzzy-trace theory can make framing effects appear and disappear depending on whether gist-based intuition or verbatim-based analysis is induced. These theoretical principles are summarized and integrated in a new mathematical model that specifies how dual modes of reasoning combine to produce predictable variability in performance. In particular, we show how the most popular and extensively studied model of decision making-prospect theory-can be derived from fuzzy-trace theory by combining analytical (verbatim-based) and intuitive (gist-based) processes.

  14. Dual Processes in Decision Making and Developmental Neuroscience: A Fuzzy-Trace Model

    Science.gov (United States)

    Reyna, Valerie F.; Brainerd, Charles J.

    2011-01-01

    From Piaget to the present, traditional and dual-process theories have predicted improvement in reasoning from childhood to adulthood, and improvement has been observed. However, developmental reversals—that reasoning biases emerge with development —have also been observed in a growing list of paradigms. We explain how fuzzy-trace theory predicts both improvement and developmental reversals in reasoning and decision making. Drawing on research on logical and quantitative reasoning, as well as on risky decision making in the laboratory and in life, we illustrate how the same small set of theoretical principles apply to typical neurodevelopment, encompassing childhood, adolescence, and adulthood, and to neurological conditions such as autism and Alzheimer's disease. For example, framing effects—that risk preferences shift when the same decisions are phrases in terms of gains versus losses—emerge in early adolescence as gist-based intuition develops. In autistic individuals, who rely less on gist-based intuition and more on verbatim-based analysis, framing biases are attenuated (i.e., they outperform typically developing control subjects). In adults, simple manipulations based on fuzzy-trace theory can make framing effects appear and disappear depending on whether gist-based intuition or verbatim-based analysis is induced. These theoretical principles are summarized and integrated in a new mathematical model that specifies how dual modes of reasoning combine to produce predictable variability in performance. In particular, we show how the most popular and extensively studied model of decision making—prospect theory—can be derived from fuzzy-trace theory by combining analytical (verbatim-based) and intuitive (gist-based) processes. PMID:22096268

  15. The diversification of developmental biology.

    Science.gov (United States)

    Crowe, Nathan; Dietrich, Michael R; Alomepe, Beverly S; Antrim, Amelia F; ByrneSim, Bay Lauris; He, Yi

    2015-10-01

    In the 1960s, "developmental biology" became the dominant term to describe some of the research that had previously been included under the rubrics of embryology, growth, morphology, and physiology. As scientific societies formed under this new label, a new discipline took shape. Historians, however, have a number of different perspectives on what changes led to this new field of developmental biology and how the field itself was constituted during this period. Using the General Embryological Information Service, a global index of post-World War II development-related research, we have documented and visualized significant changes in the kinds of research that occurred as this new field formed. In particular, our analysis supports the claim that the transition toward developmental biology was marked by a growth in new topics and forms of research. Although many historians privilege the role of molecular biology and/or the molecularization of biology in general during this formative period, we have found that the influence of molecular biology is not sufficient to account for the wide range of new research that constituted developmental biology at the time. Overall, our work creates a robust characterization of the changes that occurred with regard to research on growth and development in the decades following World War II and provides a context for future work on the specific drivers of those changes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Transforming Developmental Education in Texas

    Science.gov (United States)

    Journal of Developmental Education, 2014

    2014-01-01

    In recent years, with support from the Texas Legislature, the Texas Higher Education Coordinating Board has funded various developmental education initiatives, including research and evaluation efforts, to help Texas public institutions of higher education provide more effective programs and services to underprepared students. Based on evaluation…

  17. Developmental principles: fact or fiction.

    Science.gov (United States)

    Durston, A J

    2012-01-01

    While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, "whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm". We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level?) adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

  18. Developmental Principles: Fact or Fiction

    Directory of Open Access Journals (Sweden)

    A. J. Durston

    2012-01-01

    Full Text Available While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, “whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm”. We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level? adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.

  19. Measuring Developmental Students' Mathematics Anxiety

    Science.gov (United States)

    Ding, Yanqing

    2016-01-01

    This study conducted an item-level analysis of mathematics anxiety and examined the dimensionality of mathematics anxiety in a sample of developmental mathematics students (N = 162) by Multi-dimensional Random Coefficients Multinominal Logit Model (MRCMLM). The results indicate a moderately correlated factor structure of mathematics anxiety (r =…

  20. Developmental dyscalculia: a dysconnection syndrome?

    Science.gov (United States)

    Kucian, Karin; Ashkenazi, Simone Schwizer; Hänggi, Jürgen; Rotzer, Stephanie; Jäncke, Lutz; Martin, Ernst; von Aster, Michael

    2014-09-01

    Numerical understanding is important for everyday life. For children with developmental dyscalculia (DD), numbers and magnitudes present profound problems which are thought to be based upon neuronal impairments of key regions for numerical understanding. The aim of the present study was to investigate possible differences in white matter fibre integrity between children with DD and controls using diffusion tensor imaging. White matter integrity and behavioural measures were evaluated in 15 children with developmental dyscalculia aged around 10 years and 15 matched controls. The main finding, obtained by a whole brain group comparison, revealed reduced fractional anisotropy in the superior longitudinal fasciculus in children with developmental dyscalculia. In addition, a region of interest analysis exhibited prominent deficits in fibres of the superior longitudinal fasciculus adjacent to the intraparietal sulcus, which is thought to be the core region for number processing. To conclude, our results outline deficient fibre projection between parietal, temporal and frontal regions in children with developmental dyscalculia, and therefore raise the question of whether dyscalculia can be seen as a dysconnection syndrome. Since the superior longitudinal fasciculus is involved in the integration and control of distributed brain processes, the present results highlight the importance of considering broader domain-general mechanisms in the diagnosis and therapy of dyscalculia.

  1. Neuropsychological Aspects of Developmental Dyscalculia.

    Science.gov (United States)

    Shalev, R. S.; Manor, O.; Gross-Tsur, V.

    1997-01-01

    Classification of arithmetic disorders is predicated on neuropsychological features and associated learning disabilities. Assesses the compatibility of these classifications on a nonreferred, population-based cohort of children (N=139) with developmental dyscalculia. Concludes that children with dyscalculia and disabilities in reading and/or…

  2. Developmental trends in adaptive memory.

    Science.gov (United States)

    Otgaar, Henry; Howe, Mark L; Smeets, Tom; Garner, Sarah R

    2014-01-01

    Recent studies have revealed that memory is enhanced when information is processed for fitness-related purposes. The main objective of the current experiments was to test developmental trends in the evolutionary foundation of memory using different types of stimuli and paradigms. In Experiment 1, 11-year-olds and adults were presented with neutral, negative, and survival-related DRM word lists. We found a memory benefit for the survival-related words and showed that false memories were more likely to be elicited for the survival-related word lists than for the other lists. Experiment 2 examined developmental trends in the survival processing paradigm using neutral, negative, and survival-related pictures. A survival processing advantage was found for survival-related pictures in adults, for negative pictures in 11/12-year-olds, and for neutral pictures in 7/8-year-olds. In Experiment 3, 11/12-year-olds and adults had to imagine the standard survival scenario or an adapted survival condition (or pleasantness condition) that was designed to reduce the possibilities for elaborative processing. We found superior memory retention for both survival scenarios in children and adults. Collectively, our results evidently show that the survival processing advantage is developmentally invariant and that certain proximate mechanisms (elaboration and distinctiveness) underlie these developmental trends.

  3. Developmental control of cell division

    NARCIS (Netherlands)

    Boxem, M. (Mike)

    2002-01-01

    During development of multicellular organisms, cell divisions need to be coordinated with the developmental program of the entire organism. Although the mechanisms that drive cells through the division cycle are well understood, very little is known about the pathways that link extracellular signals

  4. Student Development and Developmental Studies.

    Science.gov (United States)

    Champaigne, John

    1982-01-01

    Reviews the nine-stage Perry Scheme of Intellectual and Ethical Development, detailing three major student orientations--dualism, multiplicity, and commitments in relativism. Suggests techniques developmental educators can use to communicate with, support, and challenge students to promote intellectual development. Underscores the importance of…

  5. Does the ARFIMA really shift?

    DEFF Research Database (Denmark)

    Monache, Davide Delle; Grassi, Stefano; Santucci de Magistris, Paolo

    Short memory models contaminated by level shifts have long-memory features similar to those associated to processes generated under fractional integration. In this paper, we propose a robust testing procedure, based on an encompassing parametric specification, that allows to disentangle the level...... the highest power compared to other existing tests for spurious long-memory. Finally, we illustrate the usefulness of the proposed approach on the daily series of bipower variation and share turnover and on the monthly inflation series of G7 countries....... shift term from the ARFIMA component. The estimation is carried out via a state-space methodology and it leads to a robust estimate of the fractional integration parameter also in presence of level shifts.The Monte Carlo simulations show that this approach produces unbiased estimates of the fractional...

  6. Validation of archived chemical shifts through atomic coordinates

    Science.gov (United States)

    Rieping, Wolfgang; Vranken, Wim F

    2010-01-01

    The public archives containing protein information in the form of NMR chemical shift data at the BioMagResBank (BMRB) and of 3D structure coordinates at the Protein Data Bank are continuously expanding. The quality of the data contained in these archives, however, varies. The main issue for chemical shift values is that they are determined relative to a reference frequency. When this reference frequency is set incorrectly, all related chemical shift values are systematically offset. Such wrongly referenced chemical shift values, as well as other problems such as chemical shift values that are assigned to the wrong atom, are not easily distinguished from correct values and effectively reduce the usefulness of the archive. We describe a new method to correct and validate protein chemical shift values in relation to their 3D structure coordinates. This method classifies atoms using two parameters: the per-atom solvent accessible surface area (as calculated from the coordinates) and the secondary structure of the parent amino acid. Through the use of Gaussian statistics based on a large database of 3220 BMRB entries, we obtain per-entry chemical shift corrections as well as Z scores for the individual chemical shift values. In addition, information on the error of the correction value itself is available, and the method can retain only dependable correction values. We provide an online resource with chemical shift, atom exposure, and secondary structure information for all relevant BMRB entries (http://www.ebi.ac.uk/pdbe/nmr/vasco) and hope this data will aid the development of new chemical shift-based methods in NMR. Proteins 2010. © 2010 Wiley-Liss, Inc. PMID:20602353

  7. What Is a Developmental-Behavioral Pediatrician?

    Science.gov (United States)

    ... social worker. Developmental-behavioral pediatricians work closely with parents, families, and schools. Developmental-behavioral pediatricians understand that children’s development and behavior happen first and foremost in the ...

  8. 29 CFR 1902.33 - Developmental period.

    Science.gov (United States)

    2010-07-01

    ... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...

  9. Ethiopia: A Democratic Developmental State?

    Directory of Open Access Journals (Sweden)

    Fesseha Mulu Gebremariam

    2017-12-01

    Full Text Available The ruling Ethiopia People’s Revolutionary Democratic Front (EPRDF in its notable second reform appraisal held in the aftermath of the 2005 national election concluded that the utmost priority of the government should be realizing fastest and sustainable economic growth that fairly benefits its citizens’ unless the very existence of the country wouldn’t be guaranteed. Given the history of poverty reduction in developing countries, particularly in Africa, EPRDF realized that it is unthinkable to eradicate poverty from Ethiopia adopting neo-liberalism. Above all, the miraculous economic transformation of the South East Asian countries like South Korea, Taiwan, Singapore and Hong Kong has proved that there is another way to development, not just neo-liberalism. Accordingly, EPRDF, after examining South Korea’s and Taiwan’s history of economic development in particular where both countries have had a large section of rural population unlike Hong Kong and Singapore where both are urban, found ‘developmental state’ relevant to Ethiopia. However, unlike these countries which were originally under non-democratic regimes where their leaders fear the rural peasant and external aggression from their communist rivals, EPRDF has had a great support of rural and urban population with no imminent foreign threat(s, and decided to execute the ideology rather under the umbrella of democracy. Therefore, employing secondary sources, this desk study aims to analyze whether Ethiopia is a ‘democratic developmental state?’ And, concludes that given the practices of the government vis-a-vis the principles of democracy and developmental state, Ethiopia couldn’t be taken as best model for democratic developmental state, rather emerging developmental state.

  10. Paradigm Shifts in Ophthalmic Diagnostics.

    Science.gov (United States)

    Sebag, J; Sadun, Alfredo A; Pierce, Eric A

    2016-08-01

    Future advances in ophthalmology will see a paradigm shift in diagnostics from a focus on dysfunction and disease to better measures of psychophysical function and health. Practical methods to define genotypes will be increasingly important and non-invasive nanotechnologies are needed to detect molecular changes that predate histopathology. This is not a review nor meant to be comprehensive. Specific topics have been selected to illustrate the principles of important paradigm shifts that will influence the future of ophthalmic diagnostics. It is our impression that future evaluation of vision will go beyond visual acuity to assess ocular health in terms of psychophysical function. The definition of disease will incorporate genotype into what has historically been a phenotype-centric discipline. Non-invasive nanotechnologies will enable a paradigm shift from disease detection on a cellular level to a sub-cellular molecular level. Vision can be evaluated beyond visual acuity by measuring contrast sensitivity, color vision, and macular function, as these provide better insights into the impact of aging and disease. Distortions can be quantified and the psychophysical basis of vision can be better evaluated than in the past by designing tests that assess particular macular cell function(s). Advances in our understanding of the genetic basis of eye diseases will enable better characterization of ocular health and disease. Non-invasive nanotechnologies can assess molecular changes in the lens, vitreous, and macula that predate visible pathology. Oxygen metabolism and circulatory physiology are measurable indices of ocular health that can detect variations of physiology and early disease. This overview of paradigm shifts in ophthalmology suggests that the future will see significant improvements in ophthalmic diagnostics. The selected topics illustrate the principles of these paradigm shifts and should serve as a guide to further research and development. Indeed

  11. Activation-Dependent Rapid Postsynaptic Clustering of Glycine Receptors in Mature Spinal Cord Neurons

    Science.gov (United States)

    Eto, Kei; Murakoshi, Hideji; Watanabe, Miho; Hirata, Hiromi; Moorhouse, Andrew J.; Ishibashi, Hitoshi

    2017-01-01

    Abstract Inhibitory synapses are established during development but continue to be generated and modulated in strength in the mature nervous system. In the spinal cord and brainstem, presynaptically released inhibitory neurotransmitter dominantly switches from GABA to glycine during normal development in vivo. While presynaptic mechanisms of the shift of inhibitory neurotransmission are well investigated, the contribution of postsynaptic neurotransmitter receptors to this shift is not fully elucidated. Synaptic clustering of glycine receptors (GlyRs) is regulated by activation-dependent depolarization in early development. However, GlyR activation induces hyperpolarization after the first postnatal week, and little is known whether and how presynaptically released glycine regulates postsynaptic receptors in a depolarization-independent manner in mature developmental stage. Here we developed spinal cord neuronal culture of rodents using chronic strychnine application to investigate whether initial activation of GlyRs in mature stage could change postsynaptic localization of GlyRs. Immunocytochemical analyses demonstrate that chronic blockade of GlyR activation until mature developmental stage resulted in smaller clusters of postsynaptic GlyRs that could be enlarged upon receptor activation for 1 h in the mature stage. Furthermore, live cell-imaging techniques show that GlyR activation decreases its lateral diffusion at synapses, and this phenomenon is dependent on PKC, but neither Ca2+ nor CaMKII activity. These results suggest that the GlyR activation can regulate receptor diffusion and cluster size at inhibitory synapses in mature stage, providing not only new insights into the postsynaptic mechanism of shifting inhibitory neurotransmission but also the inhibitory synaptic plasticity in mature nervous system. PMID:28197549

  12. Morphisms Between Sofic Shift Spaces

    DEFF Research Database (Denmark)

    Nielsen, Jan Agentoft

    The lower entropy factor problem asks for necessary and sufficient conditions for the existence of a factor map from a (mixing) sofic shift space onto another (mixing) sofic subshift of lower entropy. The problem was posed by Mike Boyle in 1984. It remains an open problem, but the present thesis...... gives a re-formulation which can be used to effectively decide the question for a larger class of sofic shifts than all previous results. In addition, the methods are used to make progress on the corresponding embedding problem which asks for necessary and sufficient conditions for the existence...

  13. Shift-Variant Multidimensional Systems.

    Science.gov (United States)

    1985-05-29

    x,y;u,v) is the system response at (x,y) to an unit impulse applied at (u,v). The presence of additive noise in the preceding input-output model of a...space model developed works very effi- ciently to deblur images affected by 2-D linear shift- varying blurs, its use, in presence of noise needs to be...causal linear shift-variant (LSV) system, whose impulse res- ponse is a K-th order degenerate sequence, a K-th order state-space model was obtained

  14. Explaining (Missing) Regulator Paradigm Shifts

    DEFF Research Database (Denmark)

    Wigger, Angela; Buch-Hansen, Hubert

    2014-01-01

    The global financial and economic crisis has prompted some scholars to suggest that a fundamental regulatory shift away from neoliberalism will take place – both in general and in the field of EU competition regulation. This paper shows that so far no radical break with the neoliberal type...... regulation after the crisis in the 1970s, the paper argues that the preconditions for a fundamental shift in this issue area are not present this time around. Several reasons account for this: the current crisis has been construed by economic and political elites as a crisis within and not of neoliberal...

  15. Shifting currents: Progress, setbacks, and shifts in policy and practice

    Science.gov (United States)

    ,; Dunning, Charles; Robertson, Dale M.

    2016-01-01

    The Wisconsin Academy’s initial Waters of Wisconsin project (WOW I) facilitated a statewide conversation between 2000 and 2003 around one main question: How can we ensure healthy aquatic ecosystems and clean, abundant water supplies for tomorrow’s Wisconsin? Robust participation in this conversation underscored the important role citizens have in the stewardship of our waters, and we found enthusiastic support for farsighted policies—based on sound science—to manage our water legacy. Overall, we found that Wisconsinites cherish water and see our waters as essential to our way of life in Wisconsin. Nationally, our state ranks 25th in land area but has the fourth-highest area covered by water. Wisconsin is 20th in population but is second only to Florida in the number of fishing licenses sold each year. Clean water supports billions of dollars’ worth of economic activity through tourism, agriculture, and industry. From the Northwoods cabin to the Port of Milwaukee to the Wisconsin Dells, water shapes our state’s identity. Our tradition of safeguarding Wisconsin’s waters is grounded in values such as responsibility to family and future generations, respect for land and wildlife, protecting public health and safety, and caring for water as a common good, as articulated in the state’s Public Trust Doctrine (see page 9). These deeply held values have also shaped a conservation ethic, and its legacy has served many generations who depend upon and enjoy the waters of the state. Through WOW I, we identified the need to overcome the institutional and disciplinary separation of science, policy, and management protocols through a more integrated approach to water management. WOW also affirmed that the Wisconsin Department of Natural Resources (DNR) and other public agencies play a critical role in sound scientific application, citizen participation, and the practical implementation of policy while balancing public and private interests toward the goal of a

  16. Clinical investigation of set-shifting subtypes in anorexia nervosa.

    Science.gov (United States)

    Abbate-Daga, Giovanni; Buzzichelli, Sara; Marzola, Enrica; Amianto, Federico; Fassino, Secondo

    2014-11-30

    While evidence continues to accumulate on the relevance of cognitive inflexibility in anorexia nervosa (AN), its clinical correlates remain unclear. We aimed at examining the relationship between set-shifting and clinical variables (i.e., eating psychopathology, depression, and personality) in AN. Ninety-four individuals affected by AN and 59 healthy controls (HC) were recruited. All participants were assessed using: Eating Disorders Inventory-2 (EDI-2), Temperament and Character Inventory (TCI), Beck Depression Inventory (BDI), and Wisconsin Card Sorting Test (WCST). The AN group scored worse than HCs on set-shifting. According to their neuropsychological performances, AN patients were split into two groups corresponding to poor (N=30) and intact (N=64) set-shifting subtypes. Interoceptive awareness, impulse regulation, and maturity fears on the EDI-2 and depression on the BDI differed across all groups (HC, intact, and poor set-shifting subtype). Self-directedness on the TCI differed significantly among all groups. Cooperativeness and reward dependence differed instead only between HC and AN poor set-shifting subtype. After controlling for depression, only interoceptive awareness remained significant with reward dependence showing a trend towards statistical significance. These findings suggest that multiple clinical variables may be correlated with set-shifting performances in AN. The factors contributing to impaired cognitive inflexibility could be more complex than heretofore generally considered. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  17. How do employees prioritise when they schedule their own shifts?

    DEFF Research Database (Denmark)

    Nabe-Nielsen, Kirsten; Lund, Henrik; Hansen, Åse Marie

    2013-01-01

    to their family life, having consecutive time off, leisure-time activities, rest between shifts, sleep, regularity of their everyday life, health and that the work schedule balanced. Thus, employees consider both their own and the workplace's needs when they have the opportunity to schedule their own shifts. Age......We investigated how employees prioritised when they scheduled their own shifts and whether priorities depended on age, gender, educational level, cohabitation and health status. We used cross-sectional questionnaire data from the follow-up survey of an intervention study investigating the effect...... of self-scheduling (n = 317). Intervention group participants were asked about their priorities when scheduling their own shifts succeeded by 17 items covering family/private life, economy, job content, health and sleep. At least half of the participants reported that they were giving high priority...

  18. Leadership Shifts in Changing Field

    Science.gov (United States)

    Zubrzycki, Jaclyn

    2013-01-01

    As groups representing local and state education players struggle to remain relevant in a policy conversation often dominated by foundations, think tanks, new advocacy groups, and political and business figures, a shift in leadership has been under way at major associations. Most of the changes have come as part of the natural churn; former…

  19. Crichton's phase-shift ambiguity

    NARCIS (Netherlands)

    Atkinson, D.; Johnson, P.W.; Mehta, N.; Roo, M. de

    1973-01-01

    A re-examination of the SPD phase-shift ambiguity is made with a view to understanding certain singular features of the elastic unitarity constraint. An explicit solution of Crichton's equations is presented, and certain features of this solution are displayed graphically. In particular, it is shown

  20. Environmental Protection: a shifting focus

    NARCIS (Netherlands)

    Dr. ir. Jan Venselaar

    2004-01-01

    The last two decades have seen a fundamental change in the way chemistry handles environmental issues. A shift in focus has occurred from 'end-of-pipe' to prevention and process integration. Presently an even more fundamental change is brought about by the need for sustainable development. It is

  1. Anthropometric changes and fluid shifts

    Science.gov (United States)

    Thornton, W. E.; Hoffler, G. W.; Rummel, J. A.

    1974-01-01

    Several observations of body size, shape, posture, and configuration were made to document changes resulting from direct effects of weightlessness during the Skylab 4 mission. After the crewmen were placed in orbit, a number of anatomical and anthropometric changes occurred including a straightening of the thoracolumbar spine, a general decrease in truncal girth, and an increase in height. By the time of the earliest in-flight measurement on mission day 3, all crewmen had lost more than two liters of extravascular fluid from the calf and thigh. The puffy facies, the bird legs effect, the engorgement of upper body veins, and the reduced volume of lower body veins were all documented with photographs. Center-of-mass measurements confirmed a fluid shift cephalad. This shift remained throughout the mission until recovery, when a sharp reversal occurred; a major portion of the reversal was completed in a few hours. The anatomical changes are of considerable scientific interest and of import to the human factors design engineer, but the shifts of blood and extravascular fluid are of more consequence. It is hypothesized that the driving force for the fluid shift is the intrinsic and unopposed lower limb elasticity that forces venous blood and then other fluid cephalad.

  2. CHLORPYRIFOS DEVELOPMENTAL NEUROTOXICITY: INTERACTION WITH GLUCOCORTICOIDS IN PC12 CELLS

    Science.gov (United States)

    Slotkin, Theodore A.; Card, Jennifer; Seidler, Frederic J.

    2012-01-01

    Prenatal coexposures to glucocorticoids and organophosphate pesticides are widespread. Glucocorticoids are elevated by maternal stress and are commonly given in preterm labor; organophosphate exposures are virtually ubiquitous. We used PC12 cells undergoing neurodifferentiation in order to assess whether dexamethasone enhances the developmental neurotoxicity of chlorpyrifos, focusing on concentrations relevant to human exposures. By themselves, each agent reduced the number of cells and the combined exposure elicited a correspondingly greater effect than with either agent alone. There was no general cytotoxicity, as cell growth was actually enhanced, and again, the combined treatment evoked greater cellular hypertrophy than with the individual compounds. The effects on neurodifferentiation were more complex. Chlorpyrifos alone had a promotional effect on neuri to genesis whereas dexamethasone impaired it; combined treatment showed an overall impairment greater than that seen with dexamethasone alone. The effect of chlorpyrifos on differentiation into specific neurotransmitter phenotypes was shifted by dexamethasone. Either agent alone promoted differentiation into the dopaminergic phenotype at the expense of the cholinergic phenotype. However, in dexamethasone-primed cells, chlorpyrifos actually enhanced cholinergic neurodifferentiation instead of suppressing this phenotype. Our results indicate that developmental exposure to glucocorticoids, either in the context of stress or the therapy of preterm labor, could enhance the developmental neurotoxicity of organophosphates and potentially of other neurotoxicants, as well as producing neurobehavioral outcomes distinct from those seen with either individual agent. PMID:22796634

  3. On the energy shift the ECC cusp. Does the shift really exist?

    International Nuclear Information System (INIS)

    Sarkadi, L.; Barrachina, R.O.

    2004-01-01

    The cusplike 'electron capture to the continuum' (ECC) peak appearing in the spectrum of the forward emitted electrons in ion-atom collisions are generally thought to be a divergence. Recently Shah et al., however, claimed that 'the ECC cusp is indeed a cusp, and not a divergence smoothed by the experiment'. These authors measured the ECC cusp for collisions of 10- and 20-keV protons with H 2 and He, and found that the peak was shifted to lower velocity than its expected position. We also carried out CTMC calculations (for the case of 20-keV protons on He) by which we demonstrated that the shift really exists but its value depends on the angular window of the electron detection. (K.A.)

  4. Positional shifting of HRCT findings in patients with pulmonary edema

    International Nuclear Information System (INIS)

    Kim, Young Sun; Choi, Yo Won; Jeon, Seok Chol; Park, Choong Ki; Seo, Heung Suk; Lee, Seung Rho; Hahm, Chang Kok

    2001-01-01

    To assess the value of positional shifting to a gravity-dependent area, as revealed by HRCT, in differentiating pulmonary edema (PE) from other conditions. Sixteen consecutive patients in whom plain radiographs suggested the presence of pulmonary edema but the clinical findings were indefinite underwent HRCT of the lung. For initial scanning they were in the supine position, and then in the prone position. Findings of ground-glass opacity, interlobular septal thickening and peribronchovascular interistitial thickening were analyzed in terms of the presence and degree of shifting to a gravity-dependent area, a grade of high, intermediate or low being assigned. PE was diagnosed in 8 of 16 cases, the remainder being designated as non-pulmonary edema (NPE). Ground-glass opacity was observed in all 16, while the degree of positional shifting was found to be high in ten (PE:NPE=6:4), intermediate in four (PE:NPE=2:2), and low in two (PE:NPE=0:2). There was no significant difference between the two groups (ρ > 0.05). Interlobular septal thickening was observed in all but two NPE cases; the degree of shifting was high in six (PE:NPE=6:0), intermediate in one (PE), and low in seven (PE:NPE=1:6). Shifting was significantly more prominent in PE than in NPE case (ρ <0.05). Peribronchovascular interstitial thickening was positive in all PE cases and one NPE case, with no positional shifting. Positional shifting of interlobular septal thickening to a gravity-dependent area, as demonstrated by HRCT, is the most specific indicator of pulmonary edema

  5. Developmental insights into mature cognition.

    Science.gov (United States)

    Keil, Frank C

    2015-02-01

    Three cases are described that illustrate new ways in which developmental research is informing the study of cognition in adults: statistical learning, neural substrates of cognition, and extended concepts. Developmental research has made clear the ubiquity of statistical learning while also revealing is limitations as a stand-alone way to acquire knowledge. With respect to neural substrates, development has uncovered links between executive processing and fronto-striatal circuits while also pointing to many aspects of high-level cognition that may not be neatly reducible to coherent neural descriptions. For extended concepts, children have made especially clear the weaknesses of intuitive theories in both children and adults while also illustrating other cognitive capacities that are used at all ages to navigate the socially distributed aspects of knowledge. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Developmental language and speech disability.

    Science.gov (United States)

    Spiel, G; Brunner, E; Allmayer, B; Pletz, A

    2001-09-01

    Speech disabilities (articulation deficits) and language disorders--expressive (vocabulary) receptive (language comprehension) are not uncommon in children. An overview of these along with a global description of the impairment of communication as well as clinical characteristics of language developmental disorders are presented in this article. The diagnostic tables, which are applied in the European and Anglo-American speech areas, ICD-10 and DSM-IV, have been explained and compared. Because of their strengths and weaknesses an alternative classification of language and speech developmental disorders is proposed, which allows a differentiation between expressive and receptive language capabilities with regard to the semantic and the morphological/syntax domains. Prevalence and comorbidity rates, psychosocial influences, biological factors and the biological social interaction have been discussed. The necessity of the use of standardized examinations is emphasised. General logopaedic treatment paradigms, specific therapy concepts and an overview of prognosis have been described.

  7. Ecdysone Control of Developmental Transitions

    DEFF Research Database (Denmark)

    Rewitz, Kim; Yamanaka, Naoki; O'Connor, Michael B.

    2013-01-01

    The steroid hormone ecdysone is the central regulator of insect developmental transitions. Recent new advances in our understanding of ecdysone action have relied heavily on the application of Drosophila melanogaster molecular genetic tools to study insect metamorphosis. In this review, we focus...... on three major aspects of Drosophila ecdysone biology: (a) factors that regulate the timing of ecdysone release, (b) molecular basis of stage- and tissue-specific responses to ecdysone, and (c) feedback regulation and coordination of ecdysone signaling....

  8. Gestational Hyperandrogenism in Developmental Programming

    Science.gov (United States)

    Hakim, Christopher; Padmanabhan, Vasantha

    2017-01-01

    Androgen excess (hyperandrogenism) is a common endocrine disorder affecting women of reproductive age. The potential causes of androgen excess in women include polycystic ovary syndrome, congenital adrenal hyperplasia (CAH), adrenal tumors, and racial disparity among many others. During pregnancy, luteoma, placental aromatase deficiency, and fetal CAH are additional causes of gestational hyperandrogenism. The present report reviews the various phenotypes of hyperandrogenism during pregnancy and its origin, pathophysiology, and the effect of hyperandrogenism on the fetal developmental trajectory and offspring consequences. PMID:27967205

  9. Cell Migration Analysis: A Low-Cost Laboratory Experiment for Cell and Developmental Biology Courses Using Keratocytes from Fish Scales

    Science.gov (United States)

    Prieto, Daniel; Aparicio, Gonzalo; Sotelo-Silveira, Jose R.

    2017-01-01

    Cell and developmental processes are complex, and profoundly dependent on spatial relationships that change over time. Innovative educational or teaching strategies are always needed to foster deep comprehension of these processes and their dynamic features. However, laboratory exercises in cell and developmental biology at the undergraduate level…

  10. The Interplay between Adolescent Needs and Secondary School Structures: Fostering Developmentally Responsive Middle and High School Environments across the Transition

    Science.gov (United States)

    Ellerbrock, Cheryl R.; Kiefer, Sarah M.

    2013-01-01

    Understanding the developmental responsiveness of secondary school environments may be an important factor in supporting students as they make the transition from one school to the next. Students' needs may or may not be met depending on the nature of the fit between their basic and developmental needs and secondary school structures at the middle…

  11. β-Adrenergic enhancement of neuronal excitability in the lateral amygdala is developmentally gated.

    Science.gov (United States)

    Fink, Ann E; LeDoux, Joseph E

    2018-05-01

    Noradrenergic signaling in the amygdala is important for processing threats and other emotionally salient stimuli, and β-adrenergic receptor activation is known to enhance neuronal spiking in the lateral amygdala (LA) of juvenile animals. Nevertheless, intracellular recordings have not yet been conducted to determine the effect of β-adrenergic receptor activation on spike properties in the adult LA, despite the potential significance of developmental changes between adolescence and adulthood. Here we demonstrate that the β-adrenergic agonist isoproterenol (15 μM) enhances spike frequency in dorsal LA principal neurons of juvenile male C57BL/6 mice and fails to do so in strain- and sex-matched adults. Furthermore, we find that the age-dependent effect of isoproterenol on spike frequency is occluded by the GABA A receptor blocker picrotoxin (75 μM), suggesting that β-adrenergic receptors downregulate tonic inhibition specifically in juvenile animals. These findings indicate a significant shift during adolescence in the cellular mechanisms of β-adrenergic modulation in the amygdala. NEW & NOTEWORTHY β-Adrenergic receptors (β-ARs) in amygdala are important in processing emotionally salient stimuli. Most cellular recordings have examined juvenile animals, while behavioral data are often obtained from adults. We replicate findings showing that β-ARs enhance spiking of principal cells in the lateral amygdala of juveniles, but we fail to find this in adults. These findings have notable scientific and clinical implications regarding the noradrenergic modulation of threat processing, alterations of which underlie fear and anxiety disorders.

  12. 20170312 - Computer Simulation of Developmental ...

    Science.gov (United States)

    Rationale: Recent progress in systems toxicology and synthetic biology have paved the way to new thinking about in vitro/in silico modeling of developmental processes and toxicities, both for embryological and reproductive impacts. Novel in vitro platforms such as 3D organotypic culture models, engineered microscale tissues and complex microphysiological systems (MPS), together with computational models and computer simulation of tissue dynamics, lend themselves to a integrated testing strategies for predictive toxicology. As these emergent methodologies continue to evolve, they must be integrally tied to maternal/fetal physiology and toxicity of the developing individual across early lifestage transitions, from fertilization to birth, through puberty and beyond. Scope: This symposium will focus on how the novel technology platforms can help now and in the future, with in vitro/in silico modeling of complex biological systems for developmental and reproductive toxicity issues, and translating systems models into integrative testing strategies. The symposium is based on three main organizing principles: (1) that novel in vitro platforms with human cells configured in nascent tissue architectures with a native microphysiological environments yield mechanistic understanding of developmental and reproductive impacts of drug/chemical exposures; (2) that novel in silico platforms with high-throughput screening (HTS) data, biologically-inspired computational models of

  13. Developmental transcriptome of Aplysia californica'

    KAUST Repository

    Heyland, Andreas

    2010-12-06

    Genome-wide transcriptional changes in development provide important insight into mechanisms underlying growth, differentiation, and patterning. However, such large-scale developmental studies have been limited to a few representatives of Ecdysozoans and Chordates. Here, we characterize transcriptomes of embryonic, larval, and metamorphic development in the marine mollusc Aplysia californica and reveal novel molecular components associated with life history transitions. Specifically, we identify more than 20 signal peptides, putative hormones, and transcription factors in association with early development and metamorphic stages-many of which seem to be evolutionarily conserved elements of signal transduction pathways. We also characterize genes related to biomineralization-a critical process of molluscan development. In summary, our experiment provides the first large-scale survey of gene expression in mollusc development, and complements previous studies on the regulatory mechanisms underlying body plan patterning and the formation of larval and juvenile structures. This study serves as a resource for further functional annotation of transcripts and genes in Aplysia, specifically and molluscs in general. A comparison of the Aplysia developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms that are likely a consequence of the different developmental modes of these organisms. © 2010 Wiley-Liss, Inc., A Wiley Company.

  14. Psychotherapy with people with developmental disabilities

    Directory of Open Access Journals (Sweden)

    Barbara Zafošnik

    2011-08-01

    Full Text Available People with developmental disabilities can experience any psychological abnormalitiy and psychiatric illness as do people without developmental disabilities. Due to different diagnostic criteria, assessment procedures and instruments, we lack definite prevalence rates for people with developmental disabilities, also suffering from mental health problems, eventhough most studies place the rate at 20 to 40%. One of the possible treatment alternatives for augmenting psychological well-being is psychotherapy, but is extremely rarely used for people with severe and profound disabilities, where speech cannot be the main therapeutic medium. So, those that are included in the psychotherapuetic process are predominantly clients with mild developmental disabilities, and they are mostly in cognitive-behavioral therapy. Recently, two models of (psychotherapy for persons with severe and profound developmental disabilities were developed: developmental-dynamic relationship therapy and attachment-based behaviour therapy for children. Conceptually, they both originate form developmental psychoanalytic theories.

  15. Developmental dyscalculia is related to visuo-spatial memory and inhibition impairment.

    Science.gov (United States)

    Szucs, Denes; Devine, Amy; Soltesz, Fruzsina; Nobes, Alison; Gabriel, Florence

    2013-01-01

    Developmental dyscalculia is thought to be a specific impairment of mathematics ability. Currently dominant cognitive neuroscience theories of developmental dyscalculia suggest that it originates from the impairment of the magnitude representation of the human brain, residing in the intraparietal sulcus, or from impaired connections between number symbols and the magnitude representation. However, behavioral research offers several alternative theories for developmental dyscalculia and neuro-imaging also suggests that impairments in developmental dyscalculia may be linked to disruptions of other functions of the intraparietal sulcus than the magnitude representation. Strikingly, the magnitude representation theory has never been explicitly contrasted with a range of alternatives in a systematic fashion. Here we have filled this gap by directly contrasting five alternative theories (magnitude representation, working memory, inhibition, attention and spatial processing) of developmental dyscalculia in 9-10-year-old primary school children. Participants were selected from a pool of 1004 children and took part in 16 tests and nine experiments. The dominant features of developmental dyscalculia are visuo-spatial working memory, visuo-spatial short-term memory and inhibitory function (interference suppression) impairment. We hypothesize that inhibition impairment is related to the disruption of central executive memory function. Potential problems of visuo-spatial processing and attentional function in developmental dyscalculia probably depend on short-term memory/working memory and inhibition impairments. The magnitude representation theory of developmental dyscalculia was not supported. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Developmental dyscalculia is related to visuo-spatial memory and inhibition impairment☆

    Science.gov (United States)

    Szucs, Denes; Devine, Amy; Soltesz, Fruzsina; Nobes, Alison; Gabriel, Florence

    2013-01-01

    Developmental dyscalculia is thought to be a specific impairment of mathematics ability. Currently dominant cognitive neuroscience theories of developmental dyscalculia suggest that it originates from the impairment of the magnitude representation of the human brain, residing in the intraparietal sulcus, or from impaired connections between number symbols and the magnitude representation. However, behavioral research offers several alternative theories for developmental dyscalculia and neuro-imaging also suggests that impairments in developmental dyscalculia may be linked to disruptions of other functions of the intraparietal sulcus than the magnitude representation. Strikingly, the magnitude representation theory has never been explicitly contrasted with a range of alternatives in a systematic fashion. Here we have filled this gap by directly contrasting five alternative theories (magnitude representation, working memory, inhibition, attention and spatial processing) of developmental dyscalculia in 9–10-year-old primary school children. Participants were selected from a pool of 1004 children and took part in 16 tests and nine experiments. The dominant features of developmental dyscalculia are visuo-spatial working memory, visuo-spatial short-term memory and inhibitory function (interference suppression) impairment. We hypothesize that inhibition impairment is related to the disruption of central executive memory function. Potential problems of visuo-spatial processing and attentional function in developmental dyscalculia probably depend on short-term memory/working memory and inhibition impairments. The magnitude representation theory of developmental dyscalculia was not supported. PMID:23890692

  17. [Burden and health effects of shift work].

    Science.gov (United States)

    Heitmann, Jörg

    2010-10-01

    In Germany aprox. 15% of all employees have irregular or flexible working hours. Disturbed sleep and/or hypersomnia are direct consequences of shift work and therefore described as shift work disorder. Beyond this, shift work can also be associated with specific pathological disorders. There are individual differences in tolerance to shift work. Optimization of both shift schedules and sleep to "non-physiological" times of the day are measures to counteract the negative effects of shift work. There is still not enough evidence to recommend drugs for routine use in shift workers. © Georg Thieme Verlag Stuttgart · New York.

  18. Generalized second-order Coulomb phase shift functions

    International Nuclear Information System (INIS)

    Rosendorff, S.

    1982-01-01

    Some specific properties and the evaluation of the generalized second-order Coulomb phase shift functions (two-dimensional integrals of four spherical cylinder functions) are discussed. The dependence on the three momenta k 1 ,k-bar,k 2 , corresponding to the final, intermediate, and initial states is illustrated

  19. Size-independent peak shift between normal and upconversion ...

    Indian Academy of Sciences (India)

    2014-02-12

    Feb 12, 2014 ... In this article, we report size-dependent measurement of the shift in peak of upconversion photoluminescence spectra compared to that of normal photoluminescence using a 800 nm femtosecond laser and its second harmonic. It has been shown that the upconversion photoluminescence is always ...

  20. Hydrogen atom spectrum and the Lamb shift in noncommutative QED

    International Nuclear Information System (INIS)

    Chaichian, M. . Helsinki Institute of Physics, Helsinki; Tureanu, A. . Helsinki Institute of Physics, Helsinki; FI)

    2000-10-01

    We have calculated the energy levels of the hydrogen atom and as well the Lamb shift within the noncommutative quantum electrodynamics theory. The results show deviations from the usual QED both on the classical and on the quantum levels. On both levels, the deviations depend on the parameter of space/space noncommutativity. (author)

  1. Shift schedule, work-family relationships, marital communication, job satisfaction and health among transport service shift workers.

    Science.gov (United States)

    Iskra-Golec, Irena; Smith, Lawrence; Wilczek-Rużyczka, Ewa; Siemiginowska, Patrycja; Wątroba, Joanna

    2017-02-21

    Existing research has documented that shiftwork consequences may depend on the shift system parameters. Fast rotating systems (1-3 shifts of the same kind in a row) and day work have been found to be less disruptive biologically and socially than slower rotating systems and afternoon and night work. The aim of this study was to compare day workers and shift workers of different systems in terms of rotation speed and shifts worked with regard to work-family and family-work positive and negative spillover, marital communication style, job satisfaction and health. Employees (N = 168) of the maintenance workshops of transportation service working different shift systems (day shift, weekly rotating 2 and 3‑shift system, and fast rotating 3-shift system) participated in the study. They completed the Work- Family Spillover Questionnaire, Marital Communication Questionnaire, Minnesota Job Satisfaction Questionnaire and the Physical Health Questionnaire (a part of the Standard Shiftwork Index). The workers of quicker rotating 3-shift systems reported significantly higher scores of family-to-work facilitation (F(3, 165) = 4.175, p = 0.007) and a higher level of constructive style of marital communication (Engagement F(3, 165) = 2.761, p = 0.044) than the workers of slower rotating 2-shift systems. There were no differences between the groups of workers with regard to health and job satisfaction. A higher level of work-family facilitation and a more constructive style of marital communication were found among the workers of faster rotating 3-shift system when compared to the workers of a slower rotating 2-shift system (afternoon, night). This may indicate that the fast rotating shift system in contrary to the slower rotating one is more friendly for the work and family domains and for the relationship between them. Int J Occup Med Environ Health 2017;30(1):121-131. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  2. Impact of Night Shift and Training Development Factors on Performance of Professional Nurses in North West Bank Governmental Hospitals

    Science.gov (United States)

    Ayed, Ahmad; Thulth, Ahida Saleem; Sayej, Sumaya

    2015-01-01

    Background: Organizational factors are considered to be the cornerstone in achieving psychological and professional security at work, which in turn are positively reflected in job performance both quantitatively and qualitatively. Aim of the Study: The study aimed to assess night shift and education/training developmental factors on performance of…

  3. Special training of shift personnel

    International Nuclear Information System (INIS)

    Martin, H.D.

    1981-01-01

    The first step of on-the-job training is practical observation phase in an operating Nuclear Plant, where the participants are assigned to shift work. The simulator training for operating personnel, for key personnel and, to some extent, also for maintenance personnel and specialists give the practical feeling for Nuclear Power Plant behaviour during normal and abnormal conditions. During the commissioning phase of the own Nuclear Power Plant, which is the most important practical training, the participants are integrated into the commissioning staff and assisted during their process of practical learning by special instructors. The preparation for the licensing exams is vitally important for shift personnel and special courses are provided after the first non-nuclear trial operation of the plant. Personnel training also includes performance of programmes and material for retraining, training of instructors and assistance in building up special training programmes and material as well as training centers. (orig./RW)

  4. Shift work as an oxidative stressor

    OpenAIRE

    Pasalar Parvin; Farahani Saeed; Sharifian Akbar; Gharavi Marjan; Aminian Omid

    2005-01-01

    Abstract Background Some medical disorders have higher prevalence in shift workers than others. This study was designed to evaluate the effect of night-shift-working on total plasma antioxidant capacity, with respect to the causative role of oxidative stress in induction of some of these disorders. Methods Two blood samples were taken from 44 workers with a rotational shift schedule, one after their day shift and one after their night shift. The total plasma antioxidant capacity of each worke...

  5. Perihelium shifts in central potentials

    International Nuclear Information System (INIS)

    Amorim, A.E.A.; Ferreira, P.L.

    1987-01-01

    Motivated by the rigorous results on level ordering for arbitrary central potentials recently derived in the literature a classical treatment of the perihelium shifts is presented, based on the consideration of those orbits which lie in the vicinity of a circular orbit. The role played by the Laplacian of the potential is emphasized. By the same approach Bertrand's theorem is also discussed, in connection with Arnold's proof. (Author) [pt

  6. Multicolor Holography With Phase Shifting

    Science.gov (United States)

    Vikram, Chandra S.

    1996-01-01

    Prototype apparatus constructed to test feasibility of two-color holographic interferometric scheme in which data for reconstructing holographic wavefront obtained with help of phase-shifting technique. Provides two sets of data needed to solve equations for effects of temperature and concentration. Concept extended to holography at three or more wavelengths to measure three or more phenomena associated with significant variations in index of refraction

  7. The Underlying Social Dynamics of Paradigm Shifts.

    Science.gov (United States)

    Rodriguez-Sickert, Carlos; Cosmelli, Diego; Claro, Francisco; Fuentes, Miguel Angel

    2015-01-01

    We develop here a multi-agent model of the creation of knowledge (scientific progress or technological evolution) within a community of researchers devoted to such endeavors. In the proposed model, agents learn in a physical-technological landscape, and weight is attached to both individual search and social influence. We find that the combination of these two forces together with random experimentation can account for both i) marginal change, that is, periods of normal science or refinements on the performance of a given technology (and in which the community stays in the neighborhood of the current paradigm); and ii) radical change, which takes the form of scientific paradigm shifts (or discontinuities in the structure of performance of a technology) that is observed as a swift migration of the knowledge community towards the new and superior paradigm. The efficiency of the search process is heavily dependent on the weight that agents posit on social influence. The occurrence of a paradigm shift becomes more likely when each member of the community attaches a small but positive weight to the experience of his/her peers. For this parameter region, nevertheless, a conservative force is exerted by the representatives of the current paradigm. However, social influence is not strong enough to seriously hamper individual discovery, and can act so as to empower successful individual pioneers who have conquered the new and superior paradigm.

  8. The Underlying Social Dynamics of Paradigm Shifts.

    Directory of Open Access Journals (Sweden)

    Carlos Rodriguez-Sickert

    Full Text Available We develop here a multi-agent model of the creation of knowledge (scientific progress or technological evolution within a community of researchers devoted to such endeavors. In the proposed model, agents learn in a physical-technological landscape, and weight is attached to both individual search and social influence. We find that the combination of these two forces together with random experimentation can account for both i marginal change, that is, periods of normal science or refinements on the performance of a given technology (and in which the community stays in the neighborhood of the current paradigm; and ii radical change, which takes the form of scientific paradigm shifts (or discontinuities in the structure of performance of a technology that is observed as a swift migration of the knowledge community towards the new and superior paradigm. The efficiency of the search process is heavily dependent on the weight that agents posit on social influence. The occurrence of a paradigm shift becomes more likely when each member of the community attaches a small but positive weight to the experience of his/her peers. For this parameter region, nevertheless, a conservative force is exerted by the representatives of the current paradigm. However, social influence is not strong enough to seriously hamper individual discovery, and can act so as to empower successful individual pioneers who have conquered the new and superior paradigm.

  9. Shift Work and Endocrine Disorders

    Directory of Open Access Journals (Sweden)

    M. A. Ulhôa

    2015-01-01

    Full Text Available The objective of this review was to investigate the impact of shift and night work on metabolic processes and the role of alterations in the sleep-wake cycle and feeding times and environmental changes in the occurrence of metabolic disorders. The literature review was performed by searching three electronic databases for relevant studies published in the last 10 years. The methodological quality of each study was assessed, and best-evidence synthesis was applied to draw conclusions. The literature has shown changes in concentrations of melatonin, cortisol, ghrelin, and leptin among shift workers. Melatonin has been implicated for its role in the synthesis and action of insulin. The action of this hormone also regulates the expression of transporter glucose type 4 or triggers phosphorylation of the insulin receptor. Therefore, a reduction in melatonin can be associated with an increase in insulin resistance and a propensity for the development of diabetes. Moreover, shift work can negatively affect sleep and contribute to sedentarism, unhealthy eating habits, and stress. Recent studies on metabolic processes have increasingly revealed their complexity. Physiological changes induced in workers who invert their activity-rest cycle to fulfill work hours include disruptions in metabolic processes.

  10. PSYCHE Pure Shift NMR Spectroscopy.

    Science.gov (United States)

    Foroozandeh, Mohammadali; Morris, Gareth; Nilsson, Mathias

    2018-03-13

    Broadband homodecoupling techniques in NMR, also known as "pure shift" methods, aim to enhance spectral resolution by suppressing the effects of homonuclear coupling interactions to turn multiplet signals into singlets. Such techniques typically work by selecting a subset of "active" nuclear spins to observe, and selectively inverting the remaining, "passive", spins to reverse the effects of coupling. Pure Shift Yielded by Chirp Excitation (PSYCHE) is one such method; it is relatively recent, but has already been successfully implemented in a range of different NMR experiments. Paradoxically, PSYCHE is one of the trickiest of pure shift NMR techniques to understand but one of the easiest to use. Here we offer some insights into theoretical and practical aspects of the method, and into the effects and importance of the experimental parameters. Some recent improvements that enhance the spectral purity of PSYCHE spectra will be presented, and some experimental frameworks including examples in 1D and 2D NMR spectroscopy, for the implementation of PSYCHE will be introduced. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Developmental toxicity of prenatal exposure to toluene.

    Science.gov (United States)

    Bowen, Scott E; Hannigan, John H

    2006-01-01

    Organic solvents have become ubiquitous in our environment and are essential for industry. Many women of reproductive age are increasingly exposed to solvents such as toluene in occupational settings (ie, long-term, low-concentration exposures) or through inhalant abuse (eg, episodic, binge exposures to high concentrations). The risk for teratogenic outcome is much less with low to moderate occupational solvent exposure compared with the greater potential for adverse pregnancy outcomes, developmental delays, and neurobehavioral problems in children born to women exposed to high concentrations of abused organic solvents such as toluene, 1,1,1-trichloroethane, xylenes, and nitrous oxide. Yet the teratogenic effects of abuse patterns of exposure to toluene and other inhalants remain understudied. We briefly review how animal models can aid substantially in clarifying the developmental risk of exposure to solvents for adverse biobehavioral outcomes following abuse patterns of use and in the absence of associated health problems and co-drug abuse (eg, alcohol). Our studies also begin to establish the importance of dose (concentration) and critical perinatal periods of exposure to specific outcomes. The present results with our clinically relevant animal model of repeated, brief, high-concentration binge prenatal toluene exposure demonstrate the dose-dependent effect of toluene on prenatal development, early postnatal maturation, spontaneous exploration, and amphetamine-induced locomotor activity. The results imply that abuse patterns of toluene exposure may be more deleterious than typical occupational exposure on fetal development and suggest that animal models are effective in studying the mechanisms and risk factors of organic solvent teratogenicity.

  12. PEAK SHIFTS PRODUCED BY CORRELATED RESPONSE TO SELECTION.

    Science.gov (United States)

    Price, Trevor; Turelli, Michael; Slatkin, Montgomery

    1993-02-01

    Traits may evolve both as a consequence of direct selection and also as a correlated response to selection on other traits. While correlated response may be important for both the production of evolutionary novelty and in the build-up of complex characters, its potential role in peak shifts has been neglected empirically and theoretically. We use a quantitative genetic model to investigate the conditions under which a character, Y, which has two alternative optima, can be dragged from one optimum to the other as a correlated response to selection on a second character, X. High genetic correlations between the two characters make the transition, or peak shift, easier, as does weak selection tending to restore Y to the optimum from which it is being dragged. When selection on Y is very weak, the conditions for a peak shift depend only on the location of the new optimum for X and are independent of the strength of selection moving it there. Thus, if the "adaptive valley" for Y is very shallow, little reduction in mean fitness is needed to produce a shift. If the selection acts strongly to keep Y at its current optimum, very intense directional selection on X, associated with a dramatic drop in mean fitness, is required for a peak shift. When strong selection is required, the conditions for peak shifts driven by correlated response might occur rarely, but still with sufficient frequency on a geological timescale to be evolutionarily important. © 1993 The Society for the Study of Evolution.

  13. Counterion influence on chemical shifts in strychnine salts

    Energy Technology Data Exchange (ETDEWEB)

    Metaxas, Athena E.; Cort, John R.

    2013-05-01

    The highly toxic plant alkaloid strychnine is often isolated in the form of the anion salt of its protonated tertiary amine. Here we characterize the relative influence of different counterions on 1H and 13C chemical shifts in several strychnine salts in D2O, methanol-d4 (CD3OD) and chloroform-d (CDCl3) solvents. In organic solvents, but not in water, substantial variation in chemical shifts of protons near the tertiary amine was observed among different salts. These secondary shifts reveal differences in the way each anion influences electronic structure within the protonated amine. The distributions of secondary shifts allow salts to be easily distinguished from each other as well as from the free base form. The observed effects are much greater in organic solvents than in water. Slight concentration-dependence in chemical shifts of some protons near the amine was observed for two salts in CDCl3, but this effect is small compared to the influence of the counterion. Distinct chemical shifts in different salt forms of the same compound may be useful as chemical forensic signatures for source attribution and sample matching of alkaloids such as strychnine and possibly other organic acid and base salts.

  14. Shift work and its association with metabolic disorders.

    Science.gov (United States)

    Brum, Maria Carlota Borba; Filho, Fábio Fernandes Dantas; Schnorr, Claudia Carolina; Bottega, Gustavo Borchardt; Rodrigues, Ticiana C

    2015-01-01

    Although the health burden of shift work has not been extensively studied, evidence suggests that it may affect the metabolic balance and cause obesity and other metabolic disorders. Sleep deprivation, circadian desynchronization and behavioral changes in diet and physical activity are among the most commonly mentioned factors in studies of the association between night work and metabolic disorders. Individual adaptation to night work depends greatly on personal factors such as family and social life, but occupational interventions may also make a positive contribution to the transition to shift work, such as exposure to bright lights during the night shift, melatonin use, shift regularity and clockwise rotation, and dietary adaptations for the metabolic needs of night workers. The evaluation of the impact of night work on health and of the mechanisms underlying this relationship can serve as a basis for intervention strategies to minimize the health burden of shift work. This review aimed to identify highlights regarding therapeutic implications following the association between night and shift work and metabolic disorders, as well as the mechanisms and pathways responsible for these relationships.

  15. How do employees prioritise when they schedule their own shifts?

    Science.gov (United States)

    Nabe-Nielsen, Kirsten; Lund, Henrik; Ajslev, Jeppe Z; Hansen, Åse Marie; Albertsen, Karen; Hvid, Helge; Garde, Anne Helene

    2013-01-01

    We investigated how employees prioritised when they scheduled their own shifts and whether priorities depended on age, gender, educational level, cohabitation and health status. We used cross-sectional questionnaire data from the follow-up survey of an intervention study investigating the effect of self-scheduling (n = 317). Intervention group participants were asked about their priorities when scheduling their own shifts succeeded by 17 items covering family/private life, economy, job content, health and sleep. At least half of the participants reported that they were giving high priority to their family life, having consecutive time off, leisure-time activities, rest between shifts, sleep, regularity of their everyday life, health and that the work schedule balanced. Thus, employees consider both their own and the workplace's needs when they have the opportunity to schedule their own shifts. Age, gender, cohabitation and health status were all significantly associated with at least one of these priorities. Intervention studies report limited health effects of self-scheduling. Therefore, we investigated to what extent employees prioritise their health and recuperation when scheduling their own shifts. We found that employees not only consider both their health and family but also the workplace's needs when they schedule their own shifts.

  16. Developmental sculpting of social phenotype and plasticity.

    Science.gov (United States)

    Sakata, Jon T; Crews, David

    2004-04-01

    Early developmental variables engender behavioral and neural variation, especially in species in which embryonic environment determines gonadal sex. In the leopard gecko, Eublepharis macularius, the incubation temperature of the egg (IncT) determines gonadal sex. Moreover, IncT affects the sexual differentiation of the individual and, consequently, within-sex variation. Individuals hatched from eggs incubated at an IncT that produces predominantly males are more masculinized than same-sex counterparts from IncTs that produce predominantly females. Here we review how gonadal sex and IncT interact to affect behavioral, endocrinological, and neural phenotype in the leopard gecko and influence phenotypic plasticity following hormone administration or social experience. We discuss the hormonal dependence of sex- and IncT-dependent behavioral and neural morphological and metabolic differences and highlight the parallels between IncT effects in geckos and intrauterine position effects in rodents. We argue that the leopard gecko is an important model of how the process of sex determination can affect sexual differentiation and of selection forces underlying the evolution of sex ratios. Copyright 2004 Elsevier Ltd.

  17. Solvent Effects on Oxygen-17 Chemical Shifts in Amides. Quantitative Linear Solvation Shift Relationships

    Science.gov (United States)

    Díez, Ernesto; Fabián, Jesús San; Gerothanassis, Ioannis P.; Esteban, Angel L.; Abboud, José-Luis M.; Contreras, Ruben H.; de Kowalewski, Dora G.

    1997-01-01

    A multiple-linear-regression analysis (MLRA) has been carried out using the Kamlet-Abboud-Taft (KAT) solvatochromic parameters in order to elucidate and quantify the solvent effects on the17O chemical shifts ofN-methylformamide (NMF),N,N-dimethylformamide (DMF),N-methylacetamide (NMA), andN,N-dimethylacetamide (DMA). The chemical shifts of the four molecules show the same dependence (in ppm) on the solvent polarity-polarizability, i.e., -22π*. The influence of the solvent hydrogen-bond-donor (HBD) acidities is slightly larger for the acetamides NMA and DMA, i.e., -48α, than for the formamides NMF and DMF, i.e., -42α. The influence of the solvent hydrogen-bond-acceptor (HBA) basicities is negligible for the nonprotic molecules DMF and DMA but significant for the protic molecules NMF and NMA, i.e., -9β. The effect of substituting the N-H hydrogen by a methyl group amounts to -5.9 ppm in NMF and 5.4 ppm in NMA. The effect of substituting the O=C-H hydrogen amounts to 5.5 ppm in NMF and 16.8 ppm in DMF. The model of specific hydration sites of amides by I. P. Gerothanassis and C. Vakka [J. Org. Chem.59,2341 (1994)] is settled in a more quantitative basis and the model by M. I. Burgar, T. E. St. Amour, and D. Fiat [J. Phys. Chem.85,502 (1981)] is critically evaluated.17O hydration shifts have been calculated for formamide (FOR) by the ab initio LORG method at the 6-31G* level. For a formamide surrounded by the four in-plane molecules of water in the first hydration shell, the calculated17O shift change due to the four hydrogen bonds, -83.2 ppm, is smaller than the empirical hydration shift, -100 ppm. The17O shift change from each out-of-plane water molecule hydrogen-bonded to the amide oxygen is -18.0 ppm. These LORG results support the conclusion that no more than four water molecules are hydrogen-bonded to the amide oxygen in formamide.

  18. Nutrition and health in hotel staff on different shift patterns.

    Science.gov (United States)

    Seibt, R; Süße, T; Spitzer, S; Hunger, B; Rudolf, M

    2015-08-01

    Limited research is available that examines the nutritional behaviour and health of hotel staff working alternating and regular shifts. To analyse the nutritional behaviour and health of employees working in alternating and regular shifts. The study used an ex post facto cross-sectional analysis to compare the nutritional behaviour and health parameters of workers with alternating shifts and regular shift workers. Nutritional behaviour was assessed with the Food Frequency Questionnaire. Body dimensions (body mass index, waist hip ratio, fat mass and active cell mass), metabolic values (glucose, triglyceride, total cholesterol and low- and high-density lipoprotein), diseases and health complaints were included as health parameters. Participants worked in alternating (n = 53) and regular shifts (n = 97). The average age of subjects was 35 ± 10 years. There was no significant difference in nutritional behaviour, most surveyed body dimensions or metabolic values between the two groups. However, alternating shift workers had significantly lower fat mass and higher active cell mass but nevertheless reported more pronounced health complaints. Sex and age were also confirmed as influencing the surveyed parameters. Shift-dependent nutritional problems were not conspicuously apparent in this sample of hotel industry workers. Health parameters did not show significantly negative attributes for alternating shift workers. Conceivably, both groups could have the same level of knowledge on the health effects of nutrition and comparable opportunities to apply this. Further studies on nutritional and health behaviour in the hotel industry are necessary in order to create validated screening programmes. © The Author 2015. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Visual attention shifting in autism spectrum disorders.

    Science.gov (United States)

    Richard, Annette E; Lajiness-O'Neill, Renee

    2015-01-01

    Abnormal visual attention has been frequently observed in autism spectrum disorders (ASD). Abnormal shifting of visual attention is related to abnormal development of social cognition and has been identified as a key neuropsychological finding in ASD. Better characterizing attention shifting in ASD and its relationship with social functioning may help to identify new targets for intervention and improving social communication in these disorders. Thus, the current study investigated deficits in attention shifting in ASD as well as relationships between attention shifting and social communication in ASD and neurotypicals (NT). To investigate deficits in visual attention shifting in ASD, 20 ASD and 20 age- and gender-matched NT completed visual search (VS) and Navon tasks with attention-shifting demands as well as a set-shifting task. VS was a feature search task with targets defined in one of two dimensions; Navon required identification of a target letter presented at the global or local level. Psychomotor and processing speed were entered as covariates. Relationships between visual attention shifting, set shifting, and social functioning were also examined. ASD and NT showed comparable costs of shifting attention. However, psychomotor and processing speed were slower in ASD than in NT, and psychomotor and processing speed were positively correlated with attention-shifting costs on Navon and VS, respectively, for both groups. Attention shifting on VS and Navon were correlated among NT, while attention shifting on Navon was correlated with set shifting among ASD. Attention-shifting costs on Navon were positively correlated with restricted and repetitive behaviors among ASD. Relationships between attention shifting and psychomotor and processing speed, as well as relationships between measures of different aspects of visual attention shifting, suggest inefficient top-down influences over preattentive visual processing in ASD. Inefficient attention shifting may be

  20. Participant Direction for People with Intellectual and Developmental Disabilities in Medicaid Home and Community Based Services Waivers

    Science.gov (United States)

    Friedman, Carli

    2018-01-01

    Participant direction allows people with intellectual and developmental disabilities (IDD) and/or their families to direct services; in doing so, participant direction shifts participants from passive recipients to active consumers. Medicaid encourages, but does not require, states to allow participant direction. The aim of this study was to…

  1. Music cognition: a developmental perspective.

    Science.gov (United States)

    Stalinski, Stephanie M; Schellenberg, E Glenn

    2012-10-01

    Although music is universal, there is a great deal of cultural variability in music structures. Nevertheless, some aspects of music processing generalize across cultures, whereas others rely heavily on the listening environment. Here, we discuss the development of musical knowledge, focusing on four themes: (a) capabilities that are present early in development; (b) culture-general and culture-specific aspects of pitch and rhythm processing; (c) age-related changes in pitch perception; and (d) developmental changes in how listeners perceive emotion in music. Copyright © 2012 Cognitive Science Society, Inc.

  2. Nonlinear frequency shift of finite-amplitude electrostatic surface waves

    International Nuclear Information System (INIS)

    Stenflo, L.

    1989-01-01

    The problem concerning the appropriate form for the nonlinear frequency shift arising from slow density modulations of electrostatic surface waves in a semi-infinite unmagnetized plasma is reconsidered. The spatial dependence of the wave amplitude normal to the surface is kept general in order to allow for possible nonlinear attenuation behaviour of the surface waves. It is found that if the frequency shift is expressed as a function of the density and its gradient then the result is identical with that of Zhelyazkov, I. Proceedings International Conference on Plasma Physics, Kiev, 1987, Vol. 2, p. 694, who assumed a linear exponential attenuation behaviour. (author)

  3. Perflurooctanoic acid induces developmental cardiotoxicity in chicken embryos and hatchlings

    International Nuclear Information System (INIS)

    Jiang, Qixiao; Lust, Robert M.; Strynar, Mark J.; Dagnino, Sonia; DeWitt, Jamie C.

    2012-01-01

    Highlights: ► PFOA exposure thinned right ventricular wall thickness in D19 chicken embryo hearts. ► PFOA exposure induced left ventricle hypertrophy in hearts of hatchling chickens. ► PFOA exposure induced altered cardiac function in hatchling chickens. -- Abstract: Perfluorooctanoic acid (PFOA) is a widespread environmental contaminant that is detectable in serum of the general U.S. population. PFOA is a known developmental toxicant that induces mortality in mammalian embryos and is thought to induce toxicity via interaction with the peroxisome proliferator activated receptor alpha (PPARα). As the cardiovascular system is crucial for embryonic survival, PFOA-induced effects on the heart may partially explain embryonic mortality. To assess impacts of PFOA exposure on the developing heart in an avian model, we used histopathology and immunohistochemical staining for myosin to assess morphological alterations in 19-day-old chicken embryo hearts after PFOA exposure. Additionally, echocardiography and cardiac myofibril ATPase activity assays were used to assess functional alterations in 1-day-old hatchling chickens following developmental PFOA exposure. Overall thinning and thinning of a dense layer of myosin in the right ventricular wall were observed in PFOA-exposed chicken embryo hearts. Alteration of multiple cardiac structural and functional parameters, including left ventricular wall thickness, left ventricular volume, heart rate, stroke volume, and ejection fraction were detected with echocardiography in the exposed hatchling chickens. Assessment of ATPase activity indicated that the ratio of cardiac myofibril calcium-independent ATPase activity to calcium-dependent ATPase activity was not affected, which suggests that developmental PFOA exposure may not affect cardiac energetics. In summary, structural and functional characteristics of the heart appear to be developmental targets of PFOA, possibly at the level of cardiomyocytes. Additional studies will

  4. Developmental neurotoxicity of pyrethroid insecticides in zebrafish embryos.

    Science.gov (United States)

    DeMicco, Amy; Cooper, Keith R; Richardson, Jason R; White, Lori A

    2010-01-01

    Pyrethroid insecticides are one of the most commonly used residential and agricultural insecticides. Based on the increased use of pyrethroids and recent studies showing that pregnant women and children are exposed to pyrethroids, there are concerns over the potential for developmental neurotoxicity. However, there have been relatively few studies on the developmental neurotoxicity of pyrethroids. In this study, we sought to investigate the developmental toxicity of six common pyrethroids, three type I compounds (permethrin, resmethrin, and bifenthrin) and three type II compounds (deltamethrin, cypermethrin, and lambda-cyhalothrin), and to determine whether zebrafish embryos may be an appropriate model for studying the developmental neurotoxicity of pyrethroids. Exposure of zebrafish embryos to pyrethroids caused a dose-dependent increase in mortality and pericardial edema, with type II compounds being the most potent. At doses approaching the LC(50), permethrin and deltamethrin caused craniofacial abnormalities. These findings are consistent with mammalian studies demonstrating that pyrethroids are mildly teratogenic at very high doses. However, at lower doses, body axis curvature and spasms were observed, which were reminiscent of the classic syndromes observed with pyrethroid toxicity. Treatment with diazepam ameliorated the spasms, while treatment with the sodium channel antagonist MS-222 ameliorated both spasms and body curvature, suggesting that pyrethroid-induced neurotoxicity is similar in zebrafish and mammals. Taken in concert, these data suggest that zebrafish may be an appropriate alternative model to study the mechanism(s) responsible for the developmental neurotoxicity of pyrethroid insecticides and aid in identification of compounds that should be further tested in mammalian systems.

  5. Path Dependency

    OpenAIRE

    Mark Setterfield

    2015-01-01

    Path dependency is defined, and three different specific concepts of path dependency – cumulative causation, lock in, and hysteresis – are analyzed. The relationships between path dependency and equilibrium, and path dependency and fundamental uncertainty are also discussed. Finally, a typology of dynamical systems is developed to clarify these relationships.

  6. Developmental aspects of a life course approach to healthy ageing

    Science.gov (United States)

    Cooper, C.; Aihie Sayer, A.; Eendebak, R. J.; Clough, G. F.; Beard, J. R.

    2016-01-01

    Abstract We examine the mechanistic basis and wider implications of adopting a developmental perspective on human ageing. Previous models of ageing have concentrated on its genetic basis, or the detrimental effects of accumulated damage, but also have raised issues about whether ageing can be viewed as adaptive itself, or is a consequence of other adaptive processes, for example if maintenance and repair processes in the period up to reproduction are traded off against later decline in function. A life course model places ageing in the context of the attainment of peak capacity for a body system, starting in early development when plasticity permits changes in structure and function induced by a range of environmental stimuli, followed by a period of decline, the rate of which depends on the peak attained as well as the later life conditions. Such path dependency in the rate of ageing may offer new insights into its modification. Focusing on musculoskeletal and cardiovascular function, we discuss this model and the possible underlying mechanisms, including endothelial function, oxidative stress, stem cells and nutritional factors such as vitamin D status. Epigenetic changes induced during developmental plasticity, and immune function may provide a common mechanistic process underlying a life course model of ageing. The life course trajectory differs in high and low resource settings. New insights into the developmental components of the life course model of ageing may lead to the design of biomarkers of later chronic disease risk and to new interventions to promote healthy ageing, with important implications for public health. PMID:26518329

  7. Sexual dysfunction within an adult developmental perspective.

    Science.gov (United States)

    Fagan, P J; Meyer, J K; Schmidt, C W

    1986-01-01

    The focus of this paper is on the adult who has adequately mastered the oedipal stage of psychosexual development and who presents with a sexual dysfunction. Drawing on the developmental sequence of Erik Erikson, the authors suggest that failure to address adequately an adult psychosocial crisis may result in sexual dysfunction. There may be both adult developmental deficits and regression to adolescent and adult stages previously negotiated. Both may be symptomatically represented by sexual dysfunction. The authors urge that the sexual and marital problems be evaluated within an adult developmental framework and that the therapy address the psychosocial issues which are appropriate to the developmental stage of the patient.

  8. Developmental trajectories of cerebrovascular reactivity in healthy children and young adults assessed with magnetic resonance imaging.

    Science.gov (United States)

    Leung, Jackie; Kosinski, Przemyslaw D; Croal, Paula L; Kassner, Andrea

    2016-05-15

    . The significant age-dependent changes in CVR and CBF demonstrate the evolution of cerebral haemodynamics in children and should be taken into consideration. The shift in developmental trajectory of CVR from increasing to decreasing suggests that physiological factors beyond baseline CBF also influence CVR. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

  9. Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.

    Science.gov (United States)

    Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina

    2015-10-01

    The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.

  10. Developmental constraints on behavioural flexibility.

    Science.gov (United States)

    Holekamp, Kay E; Swanson, Eli M; Van Meter, Page E

    2013-05-19

    We suggest that variation in mammalian behavioural flexibility not accounted for by current socioecological models may be explained in part by developmental constraints. From our own work, we provide examples of constraints affecting variation in behavioural flexibility, not only among individuals, but also among species and higher taxonomic units. We first implicate organizational maternal effects of androgens in shaping individual differences in aggressive behaviour emitted by female spotted hyaenas throughout the lifespan. We then compare carnivores and primates with respect to their locomotor and craniofacial adaptations. We inquire whether antagonistic selection pressures on the skull might impose differential functional constraints on evolvability of skulls and brains in these two orders, thus ultimately affecting behavioural flexibility in each group. We suggest that, even when carnivores and primates would theoretically benefit from the same adaptations with respect to behavioural flexibility, carnivores may nevertheless exhibit less behavioural flexibility than primates because of constraints imposed by past adaptations in the morphology of the limbs and skull. Phylogenetic analysis consistent with this idea suggests greater evolutionary lability in relative brain size within families of primates than carnivores. Thus, consideration of developmental constraints may help elucidate variation in mammalian behavioural flexibility.

  11. A developmental metatheory of psychopathology.

    Science.gov (United States)

    Karasu, T B

    1994-01-01

    The author proposes an integrative model of psychopathology in light of the contemporary need to bridge diverse ideological frameworks. This model has its major foundations in drive, ego, object relations, and self psychoanalytic perspectives as they impact upon interactional patterns of infancy. The chronology of these theoretical orientations is presented as parallel to a changing focus upon different successive stages in the course of individual development. The longstanding controversy between conflict and deficit theories, which undergirds the various schools of thought, is addressed: a developmental orientation is offered as the overriding conceptual connection between them. Conflict and deficit phenomena are regarded as intertwined and not incompatible: Unconscious drives, desires and wishes, ego defenses, and compromise formations as well as object relationship deficiencies and structural voids and defects in the self are combined to encompass a broad spectrum of psychopathology and its sources: the above intrapsychic and interpersonal factors are interfaced with significant reciprocal dyadic (mother/child) and triadic (father/mother/child) influences upon ongoing maturational processes. For heuristic purposes, a fourfold matrix--dyadic deficit, dyadic conflict, triadic deficit, and triadic conflict--is delineated. Clinical characteristics and developmental precursors of each of the four prototypes, especially with regard to early relational events, are examined.

  12. Male-mediated developmental toxicity

    Directory of Open Access Journals (Sweden)

    Diana Anderson

    2014-02-01

    Full Text Available Male-mediated developmental toxicity has been of concern for many years. The public became aware of male-mediated developmental toxicity in the early 1990s when it was reported that men working at Sellafield might be causing leukemia in their children. Human and animal studies have contributed to our current understanding of male-mediated effects. Animal studies in the 1980s and 1990s suggested that genetic damage after radiation and chemical exposure might be transmitted to offspring. With the increasing understanding that there is histone retention and modification, protamine incorporation into the chromatin and DNA methylation in mature sperm and that spermatozoal RNA transcripts can play important roles in the epigenetic state of sperm, heritable studies began to be viewed differently. Recent reports using molecular approaches have demonstrated that DNA damage can be transmitted to babies from smoking fathers, and expanded simple tandem repeats minisatellite mutations were found in the germline of fathers who were exposed to radiation from the Chernobyl nuclear power plant disaster. In epidemiological studies, it is possible to clarify whether damage is transmitted to the sons after exposure of the fathers. Paternally transmitted damage to the offspring is now recognized as a complex issue with genetic as well as epigenetic components.

  13. Pyridoxine-Dependent Epilepsy: An Expanding Clinical Spectrum

    NARCIS (Netherlands)

    van Karnebeek, Clara D. M.; Tiebout, Sylvia A.; Niermeijer, Jikkemien; Poll-The, Bwee Tien; Ghani, Aisha; Coughlin, Curtis R.; van Hove, Johan L. K.; Richter, Jost Wigand; Christen, Hans Juergen; Gallagher, Renata; Hartmann, Hans; Stockler-Ipsiroglu, Sylvia

    2016-01-01

    Pyridoxine-dependent epilepsy is a rare autosomal recessive epileptic encephalopathy caused by antiquitin (ALDH7A1) deficiency. In spite of adequate seizure control, 75% of patients suffer intellectual developmental disability. Antiquitin deficiency affects lysine catabolism resulting in

  14. Developmental plasticity in vision and behavior may help guppies overcome increased turbidity.

    Science.gov (United States)

    Ehlman, Sean M; Sandkam, Benjamin A; Breden, Felix; Sih, Andrew

    2015-12-01

    Increasing turbidity in streams and rivers near human activity is cause for environmental concern, as the ability of aquatic organisms to use visual information declines. To investigate how some organisms might be able to developmentally compensate for increasing turbidity, we reared guppies (Poecilia reticulata) in either clear or turbid water. We assessed the effects of developmental treatments on adult behavior and aspects of the visual system by testing fish from both developmental treatments in turbid and clear water. We found a strong interactive effect of rearing and assay conditions: fish reared in clear water tended to decrease activity in turbid water, whereas fish reared in turbid water tended to increase activity in turbid water. Guppies from all treatments decreased activity when exposed to a predator. To measure plasticity in the visual system, we quantified treatment differences in opsin gene expression of individuals. We detected a shift from mid-wave-sensitive opsins to long wave-sensitive opsins for guppies reared in turbid water. Since long-wavelength sensitivity is important in motion detection, this shift likely allows guppies to salvage motion-detecting abilities when visual information is obscured in turbid water. Our results demonstrate the importance of developmental plasticity in responses of organisms to rapidly changing environments.

  15. Cortisol shifts financial risk preferences.

    Science.gov (United States)

    Kandasamy, Narayanan; Hardy, Ben; Page, Lionel; Schaffner, Markus; Graggaber, Johann; Powlson, Andrew S; Fletcher, Paul C; Gurnell, Mark; Coates, John

    2014-03-04

    Risk taking is central to human activity. Consequently, it lies at the focal point of behavioral sciences such as neuroscience, economics, and finance. Many influential models from these sciences assume that financial risk preferences form a stable trait. Is this assumption justified and, if not, what causes the appetite for risk to fluctuate? We have previously found that traders experience a sustained increase in the stress hormone cortisol when the amount of uncertainty, in the form of market volatility, increases. Here we ask whether these elevated cortisol levels shift risk preferences. Using a double-blind, placebo-controlled, cross-over protocol we raised cortisol levels in volunteers over 8 d to the same extent previously observed in traders. We then tested for the utility and probability weighting functions underlying their risk taking and found that participants became more risk-averse. We also observed that the weighting of probabilities became more distorted among men relative to women. These results suggest that risk preferences are highly dynamic. Specifically, the stress response calibrates risk taking to our circumstances, reducing it in times of prolonged uncertainty, such as a financial crisis. Physiology-induced shifts in risk preferences may thus be an underappreciated cause of market instability.

  16. Cortisol shifts financial risk preferences

    Science.gov (United States)

    Kandasamy, Narayanan; Hardy, Ben; Page, Lionel; Schaffner, Markus; Graggaber, Johann; Powlson, Andrew S.; Fletcher, Paul C.; Gurnell, Mark; Coates, John

    2014-01-01

    Risk taking is central to human activity. Consequently, it lies at the focal point of behavioral sciences such as neuroscience, economics, and finance. Many influential models from these sciences assume that financial risk preferences form a stable trait. Is this assumption justified and, if not, what causes the appetite for risk to fluctuate? We have previously found that traders experience a sustained increase in the stress hormone cortisol when the amount of uncertainty, in the form of market volatility, increases. Here we ask whether these elevated cortisol levels shift risk preferences. Using a double-blind, placebo-controlled, cross-over protocol we raised cortisol levels in volunteers over 8 d to the same extent previously observed in traders. We then tested for the utility and probability weighting functions underlying their risk taking and found that participants became more risk-averse. We also observed that the weighting of probabilities became more distorted among men relative to women. These results suggest that risk preferences are highly dynamic. Specifically, the stress response calibrates risk taking to our circumstances, reducing it in times of prolonged uncertainty, such as a financial crisis. Physiology-induced shifts in risk preferences may thus be an underappreciated cause of market instability. PMID:24550472

  17. Developmental post-natal stress can alter the effects of pre-natal stress on the adult redox balance.

    Science.gov (United States)

    Marasco, Valeria; Spencer, Karen A; Robinson, Jane; Herzyk, Pawel; Costantini, David

    2013-09-15

    Across diverse vertebrate taxa, stressful environmental conditions during development can shape phenotypic trajectories of developing individuals, which, while adaptive in the short-term, may impair health and survival in adulthood. Regardless, the long-lasting benefits or costs of early life stress are likely to depend on the conditions experienced across differing stages of development. Here, we used the Japanese quail (Coturnix coturnix japonica) to experimentally manipulate exposure to stress hormones in developing individuals. We tested the hypothesis that interactions occurring between pre- and post-natal developmental periods can induce long-term shifts on the adult oxidant phenotype in non-breeding sexually mature individuals. We showed that early life stress can induce long-term alterations in the basal antioxidant defences. The magnitude of these effects depended upon the timing of glucocorticoid exposure and upon interactions between the pre- and post-natal stressful stimuli. We also found differences among tissues with stronger effects in the erythrocytes than in the brain in which the long-term effects of glucocorticoids on antioxidant biomarkers appeared to be region-specific. Recent experimental work has demonstrated that early life exposure to stress hormones can markedly reduce adult survival (Monaghan et al., 2012). Our results suggest that long-term shifts in basal antioxidant defences might be one of the potential mechanisms driving such accelerated ageing processes and that post-natal interventions during development may be a potential tool to shape the effects induced by pre-natally glucococorticoid-exposed phenotypes. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Developmental and individual differences in pure numerical estimation.

    Science.gov (United States)

    Booth, Julie L; Siegler, Robert S

    2006-01-01

    The authors examined developmental and individual differences in pure numerical estimation, the type of estimation that depends solely on knowledge of numbers. Children between kindergarten and 4th grade were asked to solve 4 types of numerical estimation problems: computational, numerosity, measurement, and number line. In Experiment 1, kindergartners and 1st, 2nd, and 3rd graders were presented problems involving the numbers 0-100; in Experiment 2, 2nd and 4th graders were presented problems involving the numbers 0-1,000. Parallel developmental trends, involving increasing reliance on linear representations of numbers and decreasing reliance on logarithmic ones, emerged across different types of estimation. Consistent individual differences across tasks were also apparent, and all types of estimation skill were positively related to math achievement test scores. Implications for understanding of mathematics learning in general are discussed. Copyright 2006 APA, all rights reserved.

  19. Participation Patterns of Preschool Children With Intellectual Developmental Disabilities.

    Science.gov (United States)

    Gilboa, Yafit; Fuchs, Reut

    2018-04-01

    We aim to examine the pattern of participation of children with intellectual developmental disabilities (IDD) or global developmental delay (GDD) in comparison with typically developing preschoolers. In addition, to identify environmental and personal factors associated with their participation, 20 children with mild to moderate GDD or IDD, and 24 age- and gender-matched controls, aged 3 to 6 years, were assessed using the Assessment of Preschool Children's Participation and the Environmental Restriction Questionnaire. Significant differences were found between the groups, both for general scales of participation and for each activity area. For the IDD/GDD group, participation was significantly negatively correlated with environmental restrictions at home. For the control group, participation was correlated with demographic variables. Typically developing children participate at a higher frequency and in a more diverse range of activities compared with children with IDD/GDD. Associations between participation and contextual factors varied depending on the child's health condition.

  20. Development of a personal obligation to shift electricity use: Initial determinants and maintenance over time

    Energy Technology Data Exchange (ETDEWEB)

    Linz, D.; Heberlein, T.

    1984-03-01

    The present study is an attempt to determine if the beliefs which underly the formation of an obligation to shift electricity use among household consumers also contribute to maintenance of the obligation over time. Utility customer beliefs about and obligation toward shifting electricity use in their households from on-peak to off-peak times were examined in 1977, when the customers had no behavioral experience with electricity shifting. In 1979, after two years of experience with shifting appliance use from on-peak to off-peak times, customers were again surveyed and the same variables measured. The results indicated that the formation of a feeling of obligation to shift electricity in 1977 use was marginally dependent on other beliefs. By 1979, these variables were completely supplanted by the subjects' self-perception of their shifting behavior. While cognitive variables are important in the initial formation of a personal obligation to engage in shifting electricity use, the perpetuation of a feeling of obligation to shift over a period of years depends on perception of how often electricity shifting was undertaken and how much electricity had been shifted from on- to off-peak times.

  1. Dynamic Stark shift and alignment-to-orientation conversion

    International Nuclear Information System (INIS)

    Kuntz, Matthew C.; Hilborn, Robert C.; Spencer, Alison M.

    2002-01-01

    We have observed alignment-to-orientation conversion in the (5d6p) 1 P state of atomic barium due to the combined effects of a static Zeeman shift and a dynamic Stark shift associated with the electric field of a pulsed laser beam. The measurements yield a value for the frequency-dependent tensor polarizability of the state in reasonable agreement with a simple perturbation theory calculation. With a tunable laser producing the dynamic Stark shift, we can both enhance the magnitude of the effect by tuning close to a resonance and reverse the sign of the orientation by tuning above or below the resonance. This method of producing an oriented atomic state is quite general, and with easily available field strengths can produce large orientations

  2. Lorentz transformations, sideways shift and massless spinning particles

    Energy Technology Data Exchange (ETDEWEB)

    Bolonek-Lasoń, K. [Department of Statistical Methods, Faculty of Economics and Sociology (Poland); Kosiński, P. [Department of Computer Science, Faculty of Physics and Applied Informatics, University of Łódź, Pomorska 149/153, 90-236 Łódź (Poland); Maślanka, P., E-mail: pmaslan@uni.lodz.pl [Department of Computer Science, Faculty of Physics and Applied Informatics, University of Łódź, Pomorska 149/153, 90-236 Łódź (Poland)

    2017-06-10

    Recently (Stone et al. (2015) ) the influence of the so called “Wigner translations” (more generally-Lorentz transformations) on circularly polarized Gaussian packets (providing the solution to Maxwell equations in paraxial approximation) has been studied. It appears that, within this approximation, the Wigner translations have an effect of shifting the wave packet trajectory parallel to itself by an amount proportional to the photon helicity. It has been suggested that this shift may result from specific properties of the algebra of Poincare generators for massless particles. In the present letter we describe the general relation between transformation properties of electromagnetic field on quantum and classical levels. It allows for a straightforward derivation of the helicity-dependent transformation rules. We present also an elementary derivation of the formula for sideways shift based on classical Maxwell theory. Some comments are made concerning the generalization to higher helicities and the relation to the coordinate operator defined long time ago by Pryce.

  3. Ripplonic Lamb Shift for Electrons on Liquid Helium

    Science.gov (United States)

    Dykman, M. I.; Kono, K.; Konstantinov, D.; Lea, M. J.

    2017-12-01

    We study the shift of the energy levels of electrons on a helium surface due to the coupling to the quantum field of surface vibrations. As in quantum electrodynamics, the coupling is known, and it is known to lead to an ultraviolet divergence of the level shifts. We show that there are diverging terms of different nature and use the Bethe-type approach to show that they cancel each other, to leading order. This resolves the long-standing theoretical controversy and explains the existing experiments. The results allow us to study the temperature dependence of the level shift. The predictions are in good agreement with the experimental data, with no adjustable parameters.

  4. Lorentz transformations, sideways shift and massless spinning particles

    Science.gov (United States)

    Bolonek-Lasoń, K.; Kosiński, P.; Maślanka, P.

    2017-06-01

    Recently (Stone et al. (2015) [16]) the influence of the so called ;Wigner translations; (more generally-Lorentz transformations) on circularly polarized Gaussian packets (providing the solution to Maxwell equations in paraxial approximation) has been studied. It appears that, within this approximation, the Wigner translations have an effect of shifting the wave packet trajectory parallel to itself by an amount proportional to the photon helicity. It has been suggested that this shift may result from specific properties of the algebra of Poincare generators for massless particles. In the present letter we describe the general relation between transformation properties of electromagnetic field on quantum and classical levels. It allows for a straightforward derivation of the helicity-dependent transformation rules. We present also an elementary derivation of the formula for sideways shift based on classical Maxwell theory. Some comments are made concerning the generalization to higher helicities and the relation to the coordinate operator defined long time ago by Pryce.

  5. Developmental differences in the structure of executive function in middle childhood and adolescence.

    Directory of Open Access Journals (Sweden)

    Fen Xu

    Full Text Available Although it has been argued that the structure of executive function (EF may change developmentally, there is little empirical research to examine this view in middle childhood and adolescence. The main objective of this study was to examine developmental changes in the component structure of EF in a large sample (N = 457 of 7-15 year olds. Participants completed batteries of tasks that measured three components of EF: updating working memory (UWM, inhibition, and shifting. Confirmatory factor analysis (CFA was used to test five alternative models in 7-9 year olds, 10-12 year olds, and 13-15 year olds. The results of CFA showed that a single-factor EF model best explained EF performance in 7-9-year-old and 10-12-year-old groups, namely unitary EF, though this single factor explained different amounts of variance at these two ages. In contrast, a three-factor model that included UWM, inhibition, and shifting best accounted for the data from 13-15 year olds, namely diverse EF. In sum, during middle childhood, putative measures of UWM, inhibition, and shifting may rely on similar underlying cognitive processes. Importantly, our findings suggest that developmental dissociations in these three EF components do not emerge until children transition into adolescence. These findings provided empirical evidence for the development of EF structure which progressed from unity to diversity during middle childhood and adolescence.

  6. An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics

    Science.gov (United States)

    Molenaar, Peter C. M.

    2015-01-01

    The main theme of this paper concerns the persistent critique of Gilbert Gottlieb on developmental behavior genetics and my reactions to this critique, the latter changing from rejection to complete acceptation. Concise characterizations of developmental behavior genetics, developmental systems theory (to which Gottlieb made essential…

  7. Atrial natriuretic peptide regulates Ca channel in early developmental cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Lin Miao

    Full Text Available BACKGROUND: Cardiomyocytes derived from murine embryonic stem (ES cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP in regulation of membrane potentials and Ca(2+ currents has not been investigated in developmental cardiomyocytes. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the role of ANP in regulating L-type Ca(2+ channel current (I(CaL in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs in early developmental stage (EDS cardiomyocytes, embryonic bodies (EB as well as whole embryo hearts. ANP exerted an inhibitory effect on basal I(CaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS cells. However, after stimulation of I(CaL by isoproterenol (ISO in LDS cells, ANP inhibited the response in about 70% cells. The depression of I(CaL induced by ANP was not affected by either Nomega, Nitro-L-Arginine methyl ester (L-NAME, a nitric oxide synthetase (NOS inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG selective inhibitor, in either EDS and LDS cells; whereas depression of I(CaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl adenine (EHNA, a selective inhibitor of type 2 phosphodiesterase(PDE2 in most cells tested. CONCLUSION/SIGNIFICANCES: Taken together, these results indicate that ANP induced depression of action potentials and I(CaL is due to activation of particulate guanylyl cyclase (GC, cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3', 5'-cyclic monophophate (cAMP-cAMP-dependent protein kinase (PKA in early cardiomyogenesis.

  8. Transient inactivation of the neonatal ventral hippocampus impairs attentional set-shifting behavior

    DEFF Research Database (Denmark)

    Brooks, Julie M; Pershing, Michelle L; Thomsen, Morten Skøtt

    2012-01-01

    as adults on an attentional set-shifting task. Performance in this task depends upon the integrity of the PFC and NAC. TTX infusions did not affect the initial acquisition or ability to learn an intra-dimensional shift. However, TTX rats required a greater number of trials than did controls to acquire...

  9. Individual differences in shift work tolerance

    NARCIS (Netherlands)

    Lammers-van der Holst, H.M.

    2016-01-01

    Shift work is a key feature of our contemporary 24/7 society, employing several successive work teams to sustain around-the-clock operations. However, numerous studies imply that frequently shifting the periods of sleep and wakefulness poses a serious threat to the shift worker’s physical, mental

  10. Shifting Cultivation : Promoting Innovative Policy and Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.

  11. Tilt shift determinations with spatial-carrier phase-shift method in temporal phase-shift interferometry

    International Nuclear Information System (INIS)

    Liu, Qian; Wang, Yang; He, Jianguo; Ji, Fang; Wang, Baorui

    2014-01-01

    An algorithm is proposed to deal with tilt-shift errors in temporal phase-shift interferometry (PSI). In the algorithm, the tilt shifts are detected with the spatial-carrier phase-shift (SCPS) method and then the tilt shifts are applied as priori information to the least-squares fittings of phase retrieval. The algorithm combines the best features of the SCPS and the temporal PSI. The algorithm could be applied to interferograms of arbitrary aperture without data extrapolation for the Fourier transform is not involved. Simulations and experiments demonstrate the effectiveness of the algorithm. The statistics of simulation results show a satisfied accuracy in detecting tilt-shift errors. Comparisons of the measurements with and without environmental vibration show that the proposed algorithm could compensate tilt-shift errors and retrieve wavefront phase accurately. The algorithm provides an approach to retrieve wavefront phase for the temporal PSI in vibrating environment. (paper)

  12. Identical and shifted identical bands

    International Nuclear Information System (INIS)

    Dodder, R.S; Jones, E.F.; Hamilton, J.H.

    1997-01-01

    Spontaneous fission of 252 Cm was studied with 72 large Compton suppressed Ge detectors in Gamma sphere. New isotopes 160 Sm and 162 Gd were identified. Through X-ray-γ and γ-γ-γ) coincidence measurements, level energies were established to spins 14 + to 20 + in 152 , 154 156 60 Nd 92 94 96 , 156 , 158 , 160 62 Sm 94 , 96 , 98 , and 160 , 162 64 Gd 96 , 98 . These nuclei exhibit a remarkable variety of identical bands and bands where the energies and moments of inertia are shifted by the same constant amount for every spin state from 2 + to 12 + for various combinations of nuclei differing by 2n, 4n, 2p, 4p, and α

  13. Evaluating amber force fields using computed NMR chemical shifts.

    Science.gov (United States)

    Koes, David R; Vries, John K

    2017-10-01

    NMR chemical shifts can be computed from molecular dynamics (MD) simulations using a template matching approach and a library of conformers containing chemical shifts generated from ab initio quantum calculations. This approach has potential utility for evaluating the force fields that underlie these simulations. Imperfections in force fields generate flawed atomic coordinates. Chemical shifts obtained from flawed coordinates have errors that can be traced back to these imperfections. We use this approach to evaluate a series of AMBER force fields that have been refined over the course of two decades (ff94, ff96, ff99SB, ff14SB, ff14ipq, and ff15ipq). For each force field a series of MD simulations are carried out for eight model proteins. The calculated chemical shifts for the 1 H, 15 N, and 13 C a atoms are compared with experimental values. Initial evaluations are based on root mean squared (RMS) errors at the protein level. These results are further refined based on secondary structure and the types of atoms involved in nonbonded interactions. The best chemical shift for identifying force field differences is the shift associated with peptide protons. Examination of the model proteins on a residue by residue basis reveals that force field performance is highly dependent on residue position. Examination of the time course of nonbonded interactions at these sites provides explanations for chemical shift differences at the atomic coordinate level. Results show that the newer ff14ipq and ff15ipq force fields developed with the implicitly polarized charge method perform better than the older force fields. © 2017 Wiley Periodicals, Inc.

  14. Relations among motor, social, and cognitive skills in pre-kindergarten children with developmental disabilities.

    Science.gov (United States)

    Kim, Helyn; Carlson, Abby G; Curby, Timothy W; Winsler, Adam

    2016-01-01

    Despite the comorbidity between motor difficulties and certain disabilities, limited research has examined links between early motor, cognitive, and social skills in preschool-aged children with developmental disabilities. The present study examined the relative contributions of gross motor and fine motor skills to the prediction of improvements in children's cognitive and social skills among 2,027 pre-kindergarten children with developmental disabilities, including specific learning disorder, speech/language impairment, intellectual disability, and autism spectrum disorder. Results indicated that for pre-kindergarten children with developmental disabilities, fine motor skills, but not gross motor skills, were predictive of improvements in cognitive and social skills, even after controlling for demographic information and initial skill levels. Moreover, depending on the type of developmental disability, the pattern of prediction of gross motor and fine motor skills to improvements in children's cognitive and social skills differed. Implications are discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Rethinking developmental toxicity testing: Evolution or revolution?

    NARCIS (Netherlands)

    Scialli, Anthony R; Daston, George; Chen, Connie; Coder, Prägati S; Euling, Susan Y; Foreman, Jennifer; Hoberman, Alan M; Hui, Julia; Knudsen, Thomas; Makris, Susan L; Morford, LaRonda; Piersma, Aldert H; Stanislaus, Dinesh; Thompson, Kary E

    2018-01-01

    Current developmental toxicity testing adheres largely to protocols suggested in 1966 involving the administration of test compound to pregnant laboratory animals. After more than 50 years of embryo-fetal development testing, are we ready to consider a different approach to human developmental

  16. Developmental neurotoxicity of Propylthiouracil in rats

    DEFF Research Database (Denmark)

    Petersen, Marta Axelstad; Hansen, P.; Christiansen, S.

    2007-01-01

    early in pregnancy may cause adverse effects on the offspring. This has led to increased concern about thyroid hormone disrupting chemicals (TDCs) in our environment. We have studied how developmental exposure to the known antithyroid agent propylthiouracil (PTU) affects the development of rat pups...... behaviour and hearing function. This supports that exposure to TDC's in general may cause long-lasting developmental neurotoxicity....

  17. Are Students with Developmental Dyslexia Neurologically Different?

    Science.gov (United States)

    Goldsmith-Phillips, Josephine

    1994-01-01

    Reviews the controversy over a biological basis for developmental dyslexia and illustrates it with two case studies of junior high school students. Reviews neurological evidence for developmental dyslexia, and proposes seven signs characteristic of reading disability that may qualify as dyslexia. (SR)

  18. Essential Role of Culture in Developmental Psychology

    Science.gov (United States)

    Miller, Joan G.

    2005-01-01

    This chapter argues for the essential role of culture in forming the basic constructs and theories of developmental psychology. The case is made for the need to overcome the cultural insularity of core developmental concepts and methods in order to create a psychology that is more truly universal.

  19. Delaying Developmental Mathematics: The Characteristics and Costs

    Science.gov (United States)

    Johnson, Marianne; Kuennen, Eric

    2004-01-01

    This paper investigates which students delay taking a required developmental mathematics course and the impact of delay on student performance in introductory microeconomics. Analysis of a sample of 1462 students at a large Midwestern university revealed that, although developmental-level mathematics students did not reach the same level of…

  20. Unpacking developmental local government using Soft Systems ...

    African Journals Online (AJOL)

    Unpacking developmental local government using Soft Systems Methodology and MCDA tools. L Scott. Abstract. This paper presents two different analytical approaches that may be useful in developing an understanding of developmental local government (DLG). DLG implies a significant commitment with respect to ...

  1. Desiccation stress induces developmental heterochrony in ...

    Indian Academy of Sciences (India)

    Stressful environments are known to perturb developmental patterns in insects. In the purview of desiccation as astressor, relatively little is known about the developmental consequences linked with desiccation tolerance. In thisstudy, we have particularly focused on the exploration of the temporal profile of postembryonic ...

  2. Psychological Resources of Adults with Developmental Dyslexia

    Science.gov (United States)

    Lockiewicz, Marta; Bogdanowicz, Katarzyna M.; Bogdanowicz, Marta

    2014-01-01

    The aim of our study was to describe specific psychological resources of adults with developmental dyslexia and compare them with psychological resources of adults without developmental dyslexia. Potential differences were analyzed in visual-spatial, creative, and motivational abilities. No evidence was found for either creative, or visuospatial…

  3. Prevalence and sociodemographic determinants of developmental ...

    African Journals Online (AJOL)

    Birth order and household size also had significant association with delay in various domains. There was no significant association between socioeconomic class and developmental delay in any of the domains. Conclusion: The study showed that developmental delay was relatively common among under-five children in ...

  4. Introducing Newspapers in Developmental Reading Classes

    Science.gov (United States)

    Karstadt, Roberta; Rey, Victoria M.

    2009-01-01

    Newspapers are an effective educational and motivational tool in developmental reading classes. However, many students are unfamiliar with newspapers and read them infrequently. In order to foster newspaper reading and familiarize the college freshmen enrolled in their developmental reading classes with newspapers, the writers of this article…

  5. Developmental hip dysplasia in adolescence

    Directory of Open Access Journals (Sweden)

    Vukašinović Zoran

    2009-01-01

    Full Text Available The authors define adolescence and developmental dysplasia of the hip (DDH. Special attention is paid to pathological findings characteristic of DDH in adolescence (unrecognized and untreated DDH; treated DDH, but non-terminated treatment; DDH diagnosed with delay, inadequately treated, with complications. The authors emphasise that DDH treatment has to be successfully terminated well before the adolescence; possibilities are explained on management modes at the time of adolescence, and possible persons guilty for the persistence of later hip problems are indicated. Based on the authors' experience and having in mind all surgical possibilities for the treatment (pelvic osteotomies, femoral osteotomies, trochanteroplasties, leg length equalization procedures the authors propose treatment protocols. The intention is to provide better treatment results and to prevent secondary hip arthrosis. Furthermore, how to improve the struggle against DDH is suggested.

  6. Developmental profiles in tick water balance with a focus on the new Rocky Mountain spotted fever vector, Rhipicephalus sanguineus.

    Science.gov (United States)

    Yoder, J A; Benoit, J B; Rellinger, E J; Tank, J L

    2006-12-01

    Recent reports indicate that the common brown dog tick, or kennel tick, Rhipicephalus sanguineus (Latreille) (Acari: Ixodidae) is a competent vector of Rocky Mountain spotted fever in the U.S.A. This tick is of concern to public health because of its high frequency of contact, as it has a unique ability to thrive within human homes. To assess the moisture requirements necessary for survival, water balance characteristics were determined for each developmental stage, from egg to adult. This is the first time that water relations in ticks have been assessed throughout the complete lifecycle. Notably, R. sanguineus is differentially adapted for life in a dry environment, as characterized by a suppressed water loss rate distinctive for each stage that distinguishes it from other ticks. Analysis of its dehydration tolerance limit and percentage body water content provides no evidence to suggest that the various stages of this tick can function more effectively containing less water, indicating that this species is modified for water conservation, not desiccation hardiness. All stages, eggs excepted, absorb water vapour from the air and can drink free water to replenish water stores. Developmentally, a shift in water balance strategies occurs in the transition from the larva, where the emphasis is on water gain (water vapour absorption from drier air), to the adult, where the emphasis is on water retention (low water loss rate). These results on the xerophilic-nature of R. sanguineus identify overhydration as the primary water stress, indicating that this tick is less dependent upon a moisture-rich habitat for survival, which matches its preference for a dry environment. We suggest that the controlled, host-confined conditions of homes and kennels have played a key role in promoting the ubiquitous distribution of R. sanguineus by creating isolated arid environments that enable this tick to establish within regions that are unfavourable for maintaining water balance.

  7. Future Directions in Sleep and Developmental Psychopathology.

    Science.gov (United States)

    Meltzer, Lisa J

    2017-01-01

    It is critical for psychologists to gain a better understanding about the intersection between sleep and developmental psychopathology. However, while many strive to answer the question of whether sleep causes developmental psychopathology, or vice versa, ultimately the relationship between sleep and developmental psychopathology is complex and dynamic. This article considers future directions in the field of clinical child and adolescent psychology that go beyond this mechanistic question, highlighting areas important to address for clinicians and researchers who strive to better understand how best to serve children and adolescents with developmental psychopathology. Questions are presented about what is normal in terms of sleep across development, the role of individual variability in terms of sleep needs and vulnerability to sleep loss, and how sleep may serve as a risk or resilience factor for developmental psychopathology, concluding with considerations for interventions.

  8. Early Intervention in Children with Developmental Disabilities

    Directory of Open Access Journals (Sweden)

    Beena Johnson

    2016-01-01

    Full Text Available Developmental disabilities consist of conditions that delay or impair the physical, cognitive, and/or psychological development of children. If not intervened at the earliest, these disabilities will cause significant negative impact on multiple domains of functioning such as learning, language, self-care and capacity for independent living. Common developmental disabilities include autism spectrum disorders, intellectual disabilities, developmental delay and cerebral palsy. About one fourth of young children in developing countries are at risk for or have developmental delay or disabilities. Inadequate stimulation has significant negative impact on physical, socioemotional and cognitive development of children. Hence early scientific intervention programs are necessary in the management of children at risk for developmental delay.

  9. Effect of Shift Work on Nocturia.

    Science.gov (United States)

    Kim, Jin Wook

    2016-01-01

    To identify the circadian sensitive component of nocturia by comparing nocturia in patients who voluntarily choose a disrupted circadian rhythm, that is, shift workers, with those who maintain normal day-night cycles. Between 2011 and 2013, a total of 1741 untreated patients, 1376 nonshift workers and 365 shift workers, were compared for nocturia indices based on frequency volume charts (FVCs). General linear model of 8-hour interval urine production and frequency were compared between FVCs of nonshift workers, FVCs of night-shift workers, and FVCs of day-shift workers. Nocturia frequency was increased in the night-shift workers (2.38 ± 1.44) compared with nonshift workers (2.18 ± 1.04) (P night-shift workers, 0.34 ± 0.13 for nonshift workers, P = .24), nocturnal bladder capacity index increased significantly (1.41 ± 1.06 for night-shift workers, 1.26 ± 0.92 for nonshift workers, P shift (P shift changes (P = .35). Patients in alternating work shifts showed increased nocturia, especially during their night shift. These changes tended to be more associated with decreased nocturnal bladder capacity than increased nocturnal polyuria. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Real life working shift assignment problem

    Science.gov (United States)

    Sze, San-Nah; Kwek, Yeek-Ling; Tiong, Wei-King; Chiew, Kang-Leng

    2017-07-01

    This study concerns about the working shift assignment in an outlet of Supermarket X in Eastern Mall, Kuching. The working shift assignment needs to be solved at least once in every month. Current approval process of working shifts is too troublesome and time-consuming. Furthermore, the management staff cannot have an overview of manpower and working shift schedule. Thus, the aim of this study is to develop working shift assignment simulation and propose a working shift assignment solution. The main objective for this study is to fulfill manpower demand at minimum operation cost. Besides, the day off and meal break policy should be fulfilled accordingly. Demand based heuristic is proposed to assign working shift and the quality of the solution is evaluated by using the real data.

  11. Dynamics and computation in functional shifts

    Science.gov (United States)

    Namikawa, Jun; Hashimoto, Takashi

    2004-07-01

    We introduce a new type of shift dynamics as an extended model of symbolic dynamics, and investigate the characteristics of shift spaces from the viewpoints of both dynamics and computation. This shift dynamics is called a functional shift, which is defined by a set of bi-infinite sequences of some functions on a set of symbols. To analyse the complexity of functional shifts, we measure them in terms of topological entropy, and locate their languages in the Chomsky hierarchy. Through this study, we argue that considering functional shifts from the viewpoints of both dynamics and computation gives us opposite results about the complexity of systems. We also describe a new class of shift spaces whose languages are not recursively enumerable.

  12. A developmental basis for stochasticity in floral organ numbers

    Science.gov (United States)

    Kitazawa, Miho S.; Fujimoto, Koichi

    2014-01-01

    Stochasticity ubiquitously inevitably appears at all levels from molecular traits to multicellular, morphological traits. Intrinsic stochasticity in biochemical reactions underlies the typical intercellular distributions of chemical concentrations, e.g., morphogen gradients, which can give rise to stochastic morphogenesis. While the universal statistics and mechanisms underlying the stochasticity at the biochemical level have been widely analyzed, those at the morphological level have not. Such morphological stochasticity is found in foral organ numbers. Although the floral organ number is a hallmark of floral species, it can distribute stochastically even within an individual plant. The probability distribution of the floral organ number within a population is usually asymmetric, i.e., it is more likely to increase rather than decrease from the modal value, or vice versa. We combined field observations, statistical analysis, and mathematical modeling to study the developmental basis of the variation in floral organ numbers among 50 species mainly from Ranunculaceae and several other families from core eudicots. We compared six hypothetical mechanisms and found that a modified error function reproduced much of the asymmetric variation found in eudicot floral organ numbers. The error function is derived from mathematical modeling of floral organ positioning, and its parameters represent measurable distances in the floral bud morphologies. The model predicts two developmental sources of the organ-number distributions: stochastic shifts in the expression boundaries of homeotic genes and a semi-concentric (whorled-type) organ arrangement. Other models species- or organ-specifically reproduced different types of distributions that reflect different developmental processes. The organ-number variation could be an indicator of stochasticity in organ fate determination and organ positioning. PMID:25404932

  13. Goos-Hänchen shift of partially coherent light fields in epsilon-near-zero metamaterials

    Science.gov (United States)

    Ziauddin; Chuang, You-Lin; Qamar, Sajid; Lee, Ray-Kuang

    2016-05-01

    The Goos-Hänchen (GH) shifts in the reflected light are investigated both for p and s polarized partial coherent light beams incident on epsilon-near-zero (ENZ) metamaterials. In contrary to the coherent counterparts, the magnitude of GH shift becomes non-zero for p polarized partial coherent light beam; while GH shift can be relatively large with a small degree of spatial coherence for s polarized partial coherent beam. Dependence on the beam width and the permittivity of ENZ metamaterials is also revealed for partial coherent light fields. Our results on the GH shifts provide a direction on the applications for partial coherent light sources in ENZ metamaterials.

  14. Who is sleepier on the night shift? The influence of bio-psycho-social factors on subjective sleepiness of female nurses during the night shift.

    Science.gov (United States)

    Zion, Nataly; Drach-Zahavy, Anat; Shochat, Tamar

    2018-07-01

    Sleepiness is a common complaint during the night shift and may impair performance. The current study aims to identify bio-psycho-social factors associated with subjective sleepiness during the night shift. Ninety-two female nurses working rotating shifts completed a sociodemographic questionnaire, the Munich ChronoType Questionaire for shift workers, the Pittsburg Sleep Quality Index, and the Pre-sleep Arousal Scale. Subjective sleepiness was measured hourly during two night shifts using the Karolinska Sleepiness Scale, and activity monitors assessed sleep duration 24-h before each shift. Findings showed that increased sleepiness was associated with increased age in nurses with early chronotypes and with more children. High cognitive pre-sleep arousal, but not sleep, was associated with increased sleepiness, especially in late chronotypes. The impact of bio-psycho-social factors on night shift sleepiness is complex, and depends on mutual interactions between these factors. Nurses most prone to increased sleepiness must develop personal strategies for maintaining vigilance on the night shift. Practitioner Summary: This study aims to identify bio-psycho-social factors associated with subjective sleepiness of female nurses during the night shift. Increasing sleepiness was associated with increased age in nurses with early chronotypes and with more children. Increased cognitive pre-sleep arousal, but not sleep, was associated with increased sleepiness, especially in late chronotypes.

  15. Dependent Classes

    DEFF Research Database (Denmark)

    Gasiunas, Vaidas; Mezini, Mira; Ostermann, Klaus

    2007-01-01

    of dependent classes and a machine-checked type soundness proof in Isabelle/HOL [29], the first of this kind for a language with virtual classes and path-dependent types. [29] T.Nipkow, L.C. Poulson, and M. Wenzel. Isabelle/HOL -- A Proof Assistant for Higher-Order Logic, volume 2283 of LNCS, Springer, 2002......Virtual classes allow nested classes to be refined in subclasses. In this way nested classes can be seen as dependent abstractions of the objects of the enclosing classes. Expressing dependency via nesting, however, has two limitations: Abstractions that depend on more than one object cannot...... be modeled and a class must know all classes that depend on its objects. This paper presents dependent classes, a generalization of virtual classes that expresses similar semantics by parameterization rather than by nesting. This increases expressivity of class variations as well as the flexibility...

  16. Exercise Dependence

    Directory of Open Access Journals (Sweden)

    Erdal Vardar

    2012-06-01

    Full Text Available Exercise dependence define a condition in which a person performs excessive exercise resulting in deterioration of his or her physical and mental health wellness. Despite many clinical research studies on exercise dependence, exact diagnostic criteria has not been developed yet. Clinical evidences concerning etiology, epidemiology, underlying mechanisms and treatment of exercise dependence are still not sufficient. Moreover, evaluation of this clinical disorder within dependency perspective is a fairly new concept. Recent studies have shown that exercise dependence has similar features like chemical substance dependence with regards to withdrawal and tolerance symptoms. The aim of this review was to briefly evaluate diagnostic and clinical features of exercise dependence. [Archives Medical Review Journal 2012; 21(3.000: 163-173

  17. Shift of the superconducting critical parameters due to correlated disorder

    International Nuclear Information System (INIS)

    Gitterman, M.; Shapiro, I.; Shapiro, B.Ya.

    2012-01-01

    Shift of the critical temperature and second critical magnetic field are calculated for a superconductor with Gaussian correlated disorder. All calculations have been performed in the framework of the stochastic Ginzburg-Landau equation. For uncorrelated disorder the macroscopic critical temperature is determined by the average of the local critical temperature across the sample, while for correlated disorder both the critical temperature and the upper critical magnetic field depend on disorder correlation length. In a nonuniform superconductor with randomly distributed local critical temperature both the macroscopic critical temperature and the upper critical magnetic field strongly depend on the characteristic correlation length ρ 0 of correlated disorder. The shift of the macroscopic critical parameters from those for non-correlated disorder, which does not exist for white noise, is obtained for small ρ 0 in the framework of the Ginzburg-Landau theory.

  18. Novelty preference in patients with developmental amnesia.

    Science.gov (United States)

    Munoz, M; Chadwick, M; Perez-Hernandez, E; Vargha-Khadem, F; Mishkin, M

    2011-12-01

    To re-examine whether or not selective hippocampal damage reduces novelty preference in visual paired comparison (VPC), we presented two different versions of the task to a group of patients with developmental amnesia (DA), each of whom sustained this form of pathology early in life. Compared with normal control participants, the DA group showed a delay-dependent reduction in novelty preference on one version of the task and an overall reduction on both versions combined. Because VPC is widely considered to be a measure of incidental recognition, the results appear to support the view that the hippocampus contributes to recognition memory. A difficulty for this conclusion, however, is that according to one current view the hippocampal contribution to recognition is limited to task conditions that encourage recollection of an item in some associated context, and according to another current view, to recognition of an item with the high confidence judgment that reflects a strong memory. By contrast, VPC, throughout which the participant remains entirely uninstructed other than to view the stimuli, would seem to lack such task conditions and so would likely lead to recognition based on familiarity rather than recollection or, alternatively, weak memories rather than strong. However, before concluding that the VPC impairment therefore contradicts both current views regarding the role of the hippocampus in recognition memory, two possibilities that would resolve this issue need to be investigated. One is that some variable in VPC, such as the extended period of stimulus encoding during familiarization, overrides its incidental nature, and, because this condition promotes either recollection- or strength-based recognition, renders the task hippocampal-dependent. The other possibility is that VPC, rather than providing a measure of incidental recognition, actually assesses an implicit, information-gathering process modulated by habituation, for which the hippocampus is

  19. Shift work and its association with metabolic disorders

    OpenAIRE

    Brum, Maria Carlota Borba; Dantas Filho, Fábio Fernandes; Schnorr, Claudia Carolina; Bottega, Gustavo Borchardt; Rodrigues, Ticiana da Costa

    2015-01-01

    Although the health burden of shift work has not been extensively studied, evidence suggests that it may affect the metabolic balance and cause obesity and other metabolic disorders. Sleep deprivation, circadian desynchronization and behavioral changes in diet and physical activity are among the most commonly mentioned factors in studies of the association between night work and metabolic disorders. Individual adaptation to night work depends greatly on personal factors such as family and soc...

  20. Distinguishing epigenetic marks of developmental and imprinting regulation

    Directory of Open Access Journals (Sweden)

    McEwen Kirsten R

    2010-01-01

    Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two

  1. Mutual inactivation of Notch receptors and ligands facilitates developmental patterning.

    Directory of Open Access Journals (Sweden)

    David Sprinzak

    2011-06-01

    Full Text Available Developmental patterning requires juxtacrine signaling in order to tightly coordinate the fates of neighboring cells. Recent work has shown that Notch and Delta, the canonical metazoan juxtacrine signaling receptor and ligand, mutually inactivate each other in the same cell. This cis-interaction generates mutually exclusive sending and receiving states in individual cells. It generally remains unclear, however, how this mutual inactivation and the resulting switching behavior can impact developmental patterning circuits. Here we address this question using mathematical modeling in the context of two canonical pattern formation processes: boundary formation and lateral inhibition. For boundary formation, in a model motivated by Drosophila wing vein patterning, we find that mutual inactivation allows sharp boundary formation across a broader range of parameters than models lacking mutual inactivation. This model with mutual inactivation also exhibits robustness to correlated gene expression perturbations. For lateral inhibition, we find that mutual inactivation speeds up patterning dynamics, relieves the need for cooperative regulatory interactions, and expands the range of parameter values that permit pattern formation, compared to canonical models. Furthermore, mutual inactivation enables a simple lateral inhibition circuit architecture which requires only a single downstream regulatory step. Both model systems show how mutual inactivation can facilitate robust fine-grained patterning processes that would be difficult to implement without it, by encoding a difference-promoting feedback within the signaling system itself. Together, these results provide a framework for analysis of more complex Notch-dependent developmental systems.

  2. Tracing developmental trajectories of oppositional defiant behaviors in preschool children.

    Directory of Open Access Journals (Sweden)

    Lourdes Ezpeleta

    Full Text Available Previous studies on developmental trajectories have used ad hoc definitions of oppositional defiant behaviors (ODB, which makes it difficult to compare results. This article defines developmental trajectories of ODB from ages 3-5 based on five different standard measurements derived from three separate instruments.A sample of 622 three-year-old preschoolers, followed up at ages 4, 5, and 6, was assessed with the five measures of oppositionality answered by parents and teachers. Growth-Mixture-Modeling (GMM estimated separate developmental trajectories for each ODB measure for ages 3 to 5.The number of classes-trajectories obtained in each GMM depended on the ODB measure, but two clear patterns emerged: four trajectories (persistent low, decreasers, increasers/high increasers, persistent moderate/persistent high or three trajectories (persistent low, decreasers, increasers/high increasers. Persistent high trajectories accounted for 4.4%-9.5% of the children. The trajectories emerging from the different ODB measures at ages 3 to 5 discriminated disruptive disorders, comorbidity, use of services, and impairment at age 6, and globally showed a similar pattern, summarizing longitudinal information on oppositionality in preschool children in a similar way.Trajectories resulting from standard scales of the questionnaires have predictive validity for identifying relevant clinical outcomes, but are measure-specific. The results contribute to knowledge about the development of ODB in preschool children.

  3. Maternal and developmental toxicity of ayahuasca in Wistar rats.

    Science.gov (United States)

    Oliveira, Carolina Dizioli Rodrigues; Moreira, Camila Queiroz; de Sá, Lilian Rose Marques; Spinosa, Helenice de Souza; Yonamine, Mauricio

    2010-06-01

    Ayahuasca is a psychotropic plant beverage initially used by shamans throughout the Amazon region during traditional religious cult. In recent years, ayahuasca has also been used in ceremonies of a number of modern syncretic religious groups, including pregnant women. However, no documented study has been performed to evaluate the risk of developmental toxicity of ayahuasca. In the present work, maternal and developmental toxicity was evaluated in Wistar rats. Ayahuasca was administered to pregnant rats in three different doses [the equivalent typical dose (TD) administered to humans, five-fold TD and 10-fold TD] during the gestational period (6-20 days). Dams treated with the highest ayahuasca dose showed maternal toxicity with decrease of weight gain and food intake. Visceral fetal findings were observed in all treatment groups. Skeletal findings were observed in the intermediate- and high-dose groups. The fetuses deriving from the highest dose group also presented a decrease in body weight. From these results, it is possible to conclude that there is a risk of maternal and developmental toxicity following ayahuasca exposure and that the level of toxicity appears to be dose-dependent.

  4. Non-occupational physical activity levels of shift workers compared with non-shift workers

    Science.gov (United States)

    Loef, Bette; Hulsegge, Gerben; Wendel-Vos, G C Wanda; Verschuren, W M Monique; Bakker, Marije F; van der Beek, Allard J; Proper, Karin I

    2017-01-01

    Objectives Lack of physical activity (PA) has been hypothesised as an underlying mechanism in the adverse health effects of shift work. Therefore, our aim was to compare non-occupational PA levels between shift workers and non-shift workers. Furthermore, exposure–response relationships for frequency of night shifts and years of shift work regarding non-occupational PA levels were studied. Methods Data of 5980 non-shift workers and 532 shift workers from the European Prospective Investigation into Cancer and Nutrition-Netherlands (EPIC-NL) were used in these cross-sectional analyses. Time spent (hours/week) in different PA types (walking/cycling/exercise/chores) and intensities (moderate/vigorous) were calculated based on self-reported PA. Furthermore, sports were operationalised as: playing sports (no/yes), individual versus non-individual sports, and non-vigorous-intensity versus vigorous-intensity sports. PA levels were compared between shift workers and non-shift workers using Generalized Estimating Equations and logistic regression. Results Shift workers reported spending more time walking than non-shift workers (B=2.3 (95% CI 1.2 to 3.4)), but shift work was not associated with other PA types and any of the sports activities. Shift workers who worked 1–4 night shifts/month (B=2.4 (95% CI 0.6 to 4.3)) and ≥5 night shifts/month (B=3.7 (95% CI 1.8 to 5.6)) spent more time walking than non-shift workers. No exposure–response relationships were found between years of shift work and PA levels. Conclusions Shift workers spent more time walking than non-shift workers, but we observed no differences in other non-occupational PA levels. To better understand if and how PA plays a role in the negative health consequences of shift work, our findings need to be confirmed in future studies. PMID:27872151

  5. Adaptation to Shift Work: Physiologically Based Modeling of the Effects of Lighting and Shifts’ Start Time

    Science.gov (United States)

    Postnova, Svetlana; Robinson, Peter A.; Postnov, Dmitry D.

    2013-01-01

    Shift work has become an integral part of our life with almost 20% of the population being involved in different shift schedules in developed countries. However, the atypical work times, especially the night shifts, are associated with reduced quality and quantity of sleep that leads to increase of sleepiness often culminating in accidents. It has been demonstrated that shift workers’ sleepiness can be improved by a proper scheduling of light exposure and optimizing shifts timing. Here, an integrated physiologically-based model of sleep-wake cycles is used to predict adaptation to shift work in different light conditions and for different shift start times for a schedule of four consecutive days of work. The integrated model combines a model of the ascending arousal system in the brain that controls the sleep-wake switch and a human circadian pacemaker model. To validate the application of the integrated model and demonstrate its utility, its dynamics are adjusted to achieve a fit to published experimental results showing adaptation of night shift workers (n = 8) in conditions of either bright or regular lighting. Further, the model is used to predict the shift workers’ adaptation to the same shift schedule, but for conditions not considered in the experiment. The model demonstrates that the intensity of shift light can be reduced fourfold from that used in the experiment and still produce good adaptation to night work. The model predicts that sleepiness of the workers during night shifts on a protocol with either bright or regular lighting can be significantly improved by starting the shift earlier in the night, e.g.; at 21∶00 instead of 00∶00. Finally, the study predicts that people of the same chronotype, i.e. with identical sleep times in normal conditions, can have drastically different responses to shift work depending on their intrinsic circadian and homeostatic parameters. PMID:23308206

  6. Shift work-related health problems in

    Directory of Open Access Journals (Sweden)

    S. Khavaji

    2010-04-01

    Full Text Available Background and aimsShift work is a major feature of working life that affects diverse aspects of human life. The main purposes of this study were to investigate shift work-related health problems and their risk factors among workers of "12-hour shift" schedule.MethodsThis cross-sectional study was carried out at 8 petrochemical industries in Asalooyeh area. Study population consisted of 1203 workers including 549 shift worker (46% and 654 day worker (54%. Data on personal details, shift schedule and adverse effects of shift work werecollected by anonymous questionnaire. Statistical analyses were performed using SPSS, version 11.5. The level of significance was set at 5%.ResultsAlthough, the results showed that health problems among shift workers was more prevalent than day workers, but the differences were just significant in gastrointestinal and musculoskeletal disorders (p<0.05. Multiple linear regressions indicated that in addition to shift working, other variants such as long work hours, type of employment, second job, number of children and job title were associated with health problems.ConclusionPrevalence rates of gastrointestinal and musculoskeletal problems among shift workers were significantly higher than that of day workers. Although, working in shift system was the main significant factor associated with the reported problems, but other demographic andwork variables were also found to have association.

  7. Shift work as an oxidative stressor

    Directory of Open Access Journals (Sweden)

    Pasalar Parvin

    2005-12-01

    Full Text Available Abstract Background Some medical disorders have higher prevalence in shift workers than others. This study was designed to evaluate the effect of night-shift-working on total plasma antioxidant capacity, with respect to the causative role of oxidative stress in induction of some of these disorders. Methods Two blood samples were taken from 44 workers with a rotational shift schedule, one after their day shift and one after their night shift. The total plasma antioxidant capacity of each worker was measured through the FRAP method. The impacts of age and weight were also assessed. Results The total plasma antioxidant capacity was measured in 44 shift-workers with a mean age of 36.57 years (SD: 10.18 and mean BMI of 26.06 (SD: 4.37 after their day and night shifts. The mean reduction of total plasma antioxidant capacity after the night shift was 105.8 μmol/L (SD: 146.39. Also, a significant correlation was shown between age and weight and total plasma antioxidant capacity. Age and weight were found to be inversely related to total plasma antioxidant capacity; as age and weight increased, the total plasma antioxidant capacity decreased. Conclusion Shift work can act as an oxidative stressor and may induce many medical disorders. Aging and obesity in shift workers makes them more sensitive to this hazardous effect.

  8. Systematic study of the focal shift effect in planar plasmonic slit lenses

    International Nuclear Information System (INIS)

    Hu Bin; Wang Qijie; Zhang Ying

    2012-01-01

    In this paper, we systematically studied the focal shift effect in planar plasmonic slit lenses. Through theoretical derivations and numerical simulations, we found that there is a focal length shift between the traditional design model and the finite-difference time-domain simulations. The shift is not only dependent on the Fresnel number (FN) of the lens, like traditional dielectric lenses, determined by the lens width and the designed focal length, but also on the surface plasmon polariton (SPPs) interaction on the lens surfaces, dependent on the slit numbers. We also found that the FN-induced focal shift is predominant when FN 1. An approximated theoretical model is presented to estimate the focal shift of plasmonic slit lens with FN < 1. (paper)

  9. Empirical isotropic chemical shift surfaces

    International Nuclear Information System (INIS)

    Czinki, Eszter; Csaszar, Attila G.

    2007-01-01

    A list of proteins is given for which spatial structures, with a resolution better than 2.5 A, are known from entries in the Protein Data Bank (PDB) and isotropic chemical shift (ICS) values are known from the RefDB database related to the Biological Magnetic Resonance Bank (BMRB) database. The structures chosen provide, with unknown uncertainties, dihedral angles φ and ψ characterizing the backbone structure of the residues. The joint use of experimental ICSs of the same residues within the proteins, again with mostly unknown uncertainties, and ab initio ICS(φ,ψ) surfaces obtained for the model peptides For-(l-Ala) n -NH 2 , with n = 1, 3, and 5, resulted in so-called empirical ICS(φ,ψ) surfaces for all major nuclei of the 20 naturally occurring α-amino acids. Out of the many empirical surfaces determined, it is the 13C α ICS(φ,ψ) surface which seems to be most promising for identifying major secondary structure types, α-helix, β-strand, left-handed helix (α D ), and polyproline-II. Detailed tests suggest that Ala is a good model for many naturally occurring α-amino acids. Two-dimensional empirical 13C α - 1 H α ICS(φ,ψ) correlation plots, obtained so far only from computations on small peptide models, suggest the utility of the experimental information contained therein and thus they should provide useful constraints for structure determinations of proteins

  10. Red Shifts and Existing Speculations

    Science.gov (United States)

    Aisenberg, Sol

    2009-03-01

    There are many current flaws, mysteries, and errors in the standard model of the universe - all based upon speculative interpretation of many excellent and verified observations. The most serious cause of some errors is the speculation about the meaning of the redshifts observed in the 1930s by Hubble. He ascribed the redshifts as due to ``an apparent Doppler effect''. This led to speculation that the remote stars were receding, and the universe was expanding -- although without observational proof of the actual receding velocity of the stars. The age of the universe, based upon the Hubble constant is pure speculation because of lack of velocity demonstration. The belief in expansion, the big bang, and of inflation should be reexamined. Also, the redshift cannot always be used as a distance measure, particularly for photons from quasars containing massive black holes that can reduce photon energy through gravitational attraction. If the linear Hubble constant is extrapolated to the most remote super novae and beyond, it would eventually require that the corresponding photon energy go to zero or become negative -- according to Hubble linear relationship. This should require a reexamination of the meaning of the red shift and the speculative consequences and give a model with fewer mysteries.

  11. Core shift effect in blazars

    Science.gov (United States)

    Agarwal, A.; Mohan, P.; Gupta, Alok C.; Mangalam, A.; Volvach, A. E.; Aller, M. F.; Aller, H. D.; Gu, M. F.; Lähteenmäki, A.; Tornikoski, M.; Volvach, L. N.

    2017-07-01

    We studied the pc-scale core shift effect using radio light curves for three blazars, S5 0716+714, 3C 279 and BL Lacertae, which were monitored at five frequencies (ν) between 4.8 and 36.8 GHz using the University of Michigan Radio Astronomical Observatory (UMRAO), the Crimean Astrophysical Observatory (CrAO) and Metsähovi Radio Observatory for over 40 yr. Flares were Gaussian fitted to derive time delays between observed frequencies for each flare (Δt), peak amplitude (A) and their half width. Using A ∝ να, we infer α in the range of -16.67-2.41 and using Δ t ∝ ν ^{1/k_r}, we infer kr ∼ 1, employed in the context of equipartition between magnetic and kinetic energy density for parameter estimation. From the estimated core position offset (Ωrν) and the core radius (rcore), we infer that opacity model may not be valid in all cases. The mean magnetic field strengths at 1 pc (B1) and at the core (Bcore) are in agreement with previous estimates. We apply the magnetically arrested disc model to estimate black hole spins in the range of 0.15-0.9 for these blazars, indicating that the model is consistent with expected accretion mode in such sources. The power-law-shaped power spectral density has slopes -1.3 to -2.3 and is interpreted in terms of multiple shocks or magnetic instabilities.

  12. Representational shifts made visible: Movement away from the prototype in memory for hue

    Directory of Open Access Journals (Sweden)

    Laura Jane Kelly

    2014-07-01

    Full Text Available In four experiments, a total of 205 participants studied individual color patches and were given an old-new recognition test after a brief retention interval (0.5 or 5.0 s. The pattern of false alarms revealed hue memory shifting away from the prototype of the hue’s basic color category. The shifts demonstrate that hue memory is influenced by categorization early in processing. The shifts did not depend on intentional categorization; the shifts were found even when participants made preference ratings at encoding rather than labeling judgments. Overall, we found that categorization and memory are deeply intertwined from perception onward. We discuss the impact of the results on theories of memory and categorization, including the effects of category labels on memory (e.g., Lupyan, 2008. We also put forward the hypothesis that atypical shifts in hue are related to atypical shifts that have previously observed in face recognition (Rhodes et al., 1987.

  13. The Knight shift in liquid gallium confined within porous glasses and opals

    International Nuclear Information System (INIS)

    Charnaya, E V; Michel, D; Tien, C; Kumzerov, Yu A; Yaskov, D

    2003-01-01

    71 Ga nuclear magnetic resonance studies were carried out for liquid gallium embedded into porous glasses with different pore sizes and into artificial opals within the temperature range from about 320 K to complete confined gallium freezing. A general decrease in the Knight shift compared to the bulk melt depending on pore sizes was observed in contrast to theoretical predictions. Correlations between alterations in the Knight shift and pore sizes were established for particular pore geometry. It was also observed that confined geometry affects the temperature dependence of the Knight shift in liquid gallium

  14. Dependency Parsing

    CERN Document Server

    Kubler, Sandra; Nivre, Joakim

    2009-01-01

    Dependency-based methods for syntactic parsing have become increasingly popular in natural language processing in recent years. This book gives a thorough introduction to the methods that are most widely used today. After an introduction to dependency grammar and dependency parsing, followed by a formal characterization of the dependency parsing problem, the book surveys the three major classes of parsing models that are in current use: transition-based, graph-based, and grammar-based models. It continues with a chapter on evaluation and one on the comparison of different methods, and it close

  15. Positive XPS binding energy shift of supported Cu{sub N}-clusters governed by initial state effects

    Energy Technology Data Exchange (ETDEWEB)

    Peters, S.; Peredkov, S. [Technische Universität Berlin, IOAP, Strasse des 17. Juni 135, 10623 Berlin (Germany); Al-Hada, M. [Department of Physics, College of Education and Linguistics, University of Amran (Yemen); Neeb, M., E-mail: matthias.neeb@helmholtz-berlin.de [Helmholtz-Zentrum Berlin, Wilhelm-Conrad-Röntgen-Campus Adlershof, Elektronenspeicherring BESSY II, Albert-Einstein-Straße 15, 12489 Berlin (Germany); Eberhardt, W. [Technische Universität Berlin, IOAP, Strasse des 17. Juni 135, 10623 Berlin (Germany); DESY, Center for Free Electron Laser Science (CFEL), Notkestr. 85, 22607 Hamburg (Germany)

    2014-01-01

    Highlights: • Size dependent initial and final state effects of mass-selected deposited clusters. • Initial state effect dominates positive XPS shift in supported Cu-clusters. • Size dependent Coulomb correlation shift in the Auger final state of Cu cluster. • Size-dependent Auger parameter analysis. • Positive XPS shift differs from negative surface core level shift in crystalline copper. - Abstract: An initial state effect is established as origin for the positive 2p core electron binding energy shift found for Cu{sub N}-clusters supported by a thin silica layer of a p-doped Si(1 0 0) wafer. Using the concept of the Auger parameter and taking into account the usually neglected Coulomb correlation shift in the Auger final state (M{sub 4,5}M{sub 4,5}) it is shown that the initial state shift is comparable to the measured XPS shift while the final state relaxation shift contributes only marginally to the binding energy shift. The cluster results differ from the negative surface core-level shift of crystalline copper which has been explained in terms of a final state relaxation effect.

  16. Broken supersymmetries and shifted superpropagators

    International Nuclear Information System (INIS)

    Helayel-Neto, J.A.; Rabelo de Carvalho, F.A.B.; Smith, A.W.

    1985-06-01

    Superfield Feynman rules are derived for a general case where global supersymmetry is spontaneously broken by F-terms. The complete superspace dependence of the superpropagators is factored out and they are employed to discuss the corrections to the effective action and the non-renormalization theorems. Their coupling to external gauge superfields is also contemplated and finite matter contributions to the gaugino mass and the Fayet-Iliopoulos term are considered. (author)

  17. Developmental Trajectories of Hand Movements in Typical Infants and Those at Risk of Developmental Disorders: An Observational Study of Kinematics during the First Year of Life

    Directory of Open Access Journals (Sweden)

    Lisa Ouss

    2018-02-01

    are significantly associated with age in cohorts of typical and at-risk infantsdiffer significantly at 5–6 months of age, depending on the context: relating either with an object or a person.Environmental and developmental factors shape the developmental trajectories of hand movements in different cohorts: environment for infants with VIMs; stage of development for premature infants and those with West syndrome; and both factors for infants with orality disorders.The curvature of hand movements specifically reflects atypical development in infants with West syndrome when developmental age is considered.We aimed to discriminate between typical and atypical developmental trajectory patterns of at-risk infants in an interactive setting in this observational and longitudinal study, with the assumption that hand movements (HM reflect preverbal communication and its disorders. We examined the developmental trajectories of HM in five cohorts of at-risk infants and one control cohort, followed from ages 2 to 10 months: 25 West syndrome (WS, 13 preterm birth (PB, 16 orality disorder (OD, 14 with visually impaired mothers (VIM, 7 early hospitalization (EH, and 19 typically developing infants (TD. Video-recorded data were collected in three different structured interactive contexts. Descriptors of the hand motion were used to examine the extent to which HM were associated with age and cohort. We obtained four principal results: (i the kinematics of HM (spatial use, curvature, acceleration, and velocity were significantly associated with age in all cohorts; (ii HM significantly differed at 5–6 months of age in TD infants, depending on the context; (iii environmental and developmental factors shaped the developmental trajectories of HM in different cohorts: environment for VIM, development for PB and WS, and both factors for OD and; (iv the curvatures of HM showed atypical development in WS infants when developmental age was considered. These findings support the importance

  18. Developmental programming of auditory learning

    Directory of Open Access Journals (Sweden)

    Melania Puddu

    2012-10-01

    Full Text Available The basic structures involved in the development of auditory function and consequently in language acquisition are directed by genetic code, but the expression of individual genes may be altered by exposure to environmental factors, which if favorable, orient it in the proper direction, leading its development towards normality, if unfavorable, they deviate it from its physiological course. Early sensorial experience during the foetal period (i.e. intrauterine noise floor, sounds coming from the outside and attenuated by the uterine filter, particularly mother’s voice and modifications induced by it at the cochlear level represent the first example of programming in one of the earliest critical periods in development of the auditory system. This review will examine the factors that influence the developmental programming of auditory learning from the womb to the infancy. In particular it focuses on the following points: the prenatal auditory experience and the plastic phenomena presumably induced by it in the auditory system from the basilar membrane to the cortex;the involvement of these phenomena on language acquisition and on the perception of language communicative intention after birth;the consequences of auditory deprivation in critical periods of auditory development (i.e. premature interruption of foetal life.

  19. Pervasive Developmental Disorder with Age?

    Directory of Open Access Journals (Sweden)

    M. Balfe

    2011-01-01

    Full Text Available A survey was undertaken to investigate the prevalence of high-functioning pervasive developmental disorder (HFPDD in a community sample of teenagers and adults aged 13 and above in the city of Sheffield, UK. 112 possible and definite cases were found, of whom 65 (57% had a previous diagnosis. The detected prevalence of possible or definite HFPDD was found to be 0.24 per 1000 of the population of Sheffield city aged 13 or over, but the prevalence by year of age fell from a maximum of 1.1 per 1000 in the group aged 13 to 14 years old (1 young adult in every 900 in this age group to 0.03 per 1000 in the over 60s (1 person in every 38500 in this age group. The results of this study are preliminary and need follow-up investigation in larger studies. We suggest several explanations for the findings, including reduced willingness to participate in a study as people get older, increased ascertainment in younger people, and increased mortality. Another contributory factor might be that the prevalence of high-functioning pervasive development disorder may decline with age. This raises the possibility that AS symptoms might become subclinical in adulthood in a proportion of people with HFPDD.

  20. Cost effective shift schedules enhance utility operations

    International Nuclear Information System (INIS)

    Coleman, R.M.

    1995-01-01

    This article describes how new shift scheduling concepts can save utility operations millions of dollars every year and yet maintain safety and improve employee morale. The key to scheduling is to define and match the work load. This includes discretionary as well as daily, weekly, and yearly core work loads. In most power plants the overall work load (including maintenance, operations, materials handling, etc.) on day shift is greater than on other shifts, hence an unbalanced schedule would be appropriate

  1. Stochastic dynamical models for ecological regime shifts

    DEFF Research Database (Denmark)

    Møller, Jan Kloppenborg; Carstensen, Jacob; Madsen, Henrik

    the physical and biological knowledge of the system, and nonlinearities introduced here can generate regime shifts or enhance the probability of regime shifts in the case of stochastic models, typically characterized by a threshold value for the known driver. A simple model for light competition between...... definition and stability of regimes become less subtle. Ecological regime shifts and their modeling must be viewed in a probabilistic manner, particularly if such model results are to be used in ecosystem management....

  2. Time Zones, Shift Working and International Outsourcing

    OpenAIRE

    Matsuoka, Yuji; Fukushima, Marcelo

    2009-01-01

    We build a trade model with two identical countries located in different time zones and a monopolistically competitive sector of which production requires differentiated goods produced in two successive stages. We introduce shift working disutility and allow consumers to choose between day and night shifts. Shift working disutility raises the cost of night production and firms can reduce costs by “virtually” outsourcing foreign labor. We found that firms only outsource if relat...

  3. Night shift work and modifiable lifestyle factors.

    Science.gov (United States)

    Pepłońska, Beata; Burdelak, Weronika; Krysicka, Jolanta; Bukowska, Agnieszka; Marcinkiewicz, Andrzej; Sobala, Wojciech; Klimecka-Muszyńska, Dorota; Rybacki, Marcin

    2014-10-01

    Night shift work has been linked to some chronic diseases. Modification of lifestyle by night work may partially contribute to the development of these diseases, nevertheless, so far epidemiological evidence is limited. The aim of the study was to explore association between night shift work and lifestyle factors using data from a cross-sectional study among blue-collar workers employed in industrial plants in Łódź, Poland. The anonymous questionnaire was self-administered among 605 employees (236 women and 369 men, aged 35 or more) - 434 individuals currently working night shifts. Distribution of the selected lifestyle related factors such as smoking, alcohol drinking, physical activity, body mass index (BMI), number of main meals and the hour of the last meal was compared between current, former, and never night shift workers. Adjusted ORs or predicted means were calculated, as a measure of the associations between night shift work and lifestyle factors, with age, marital status and education included in the models as covariates. Recreational inactivity (defined here as less than one hour per week of recreational physical activity) was associated with current night shift work when compared to never night shift workers (OR = 2.43, 95% CI: 1.13-5.22) among men. Alcohol abstinence and later time of the last meal was associated with night shift work among women. Statistically significant positive relationship between night shift work duration and BMI was observed among men (p = 0.029). This study confirms previous studies reporting lower exercising among night shift workers and tendency to increase body weight. This finding provides important public health implication for the prevention of chronic diseases among night shift workers. Initiatives promoting physical activity addressed in particular to the night shift workers are recommended.

  4. Night shift work and modifiable lifestyle factors

    Directory of Open Access Journals (Sweden)

    Beata Pepłońska

    2014-10-01

    Full Text Available Objectives: Night shift work has been linked to some chronic diseases. Modification of lifestyle by night work may partially contribute to the development of these diseases, nevertheless, so far epidemiological evidence is limited. The aim of the study was to explore association between night shift work and lifestyle factors using data from a cross-sectional study among blue-collar workers employed in industrial plants in Łódź, Poland. Material and Methods: The anonymous questionnaire was self-administered among 605 employees (236 women and 369 men, aged 35 or more - 434 individuals currently wor­king night shifts. Distribution of the selected lifestyle related factors such as smoking, alcohol drinking, physical activity, body mass index (BMI, number of main meals and the hour of the last meal was compared between current, former, and never night shift workers. Adjusted ORs or predicted means were calculated, as a measure of the associations between night shift work and lifestyle factors, with age, marital status and education included in the models as covariates. Results: Recreational inactivity (defined here as less than one hour per week of recreational physical activity was associated with current night shift work when compared to never night shift workers (OR = 2.43, 95% CI: 1.13-5.22 among men. Alcohol abstinence and later time of the last meal was associated with night shift work among women. Statistically significant positive relationship between night shift work duration and BMI was observed among men (p = 0.029. Conclusions: This study confirms previous studies reporting lower exercising among night shift workers and tendency to increase body weight. This finding provides important public health implication for the prevention of chronic diseases among night shift workers. Initiatives promoting physical activity addressed in particular to the night shift workers are recommended.

  5. Examining paid sickness absence by shift workers.

    Science.gov (United States)

    Catano, V M; Bissonnette, A B

    2014-06-01

    Shift workers are at greater risk than day workers with respect to psychological and physical health, yet little research has linked shift work to increased sickness absence. To investigate the relationship between shift work and sickness absence while controlling for organizational and individual characteristics and shift work attributes that have confounded previous research. The study used archive data collected from three national surveys in Canada, each involving over 20000 employees and 6000 private-sector firms in 14 different occupational groups. The employees reported the number of paid sickness absence days in the past 12 months. Data were analysed using both chi-squared statistics and hierarchical regressions. Contrary to previous research, shift workers took less paid sickness absence than day workers. There were no differences in the length of the sickness absence between both groups or in sickness absence taken by female and male workers whether working days or shifts. Only job tenure, the presence of a union in the workplace and working rotating shifts predicted sickness absence in shift workers. The results were consistent across all three samples. In general, shift work does not seem to be linked to increased sickness absence. However, such associations may be true for specific industries. Male and female workers did not differ in the amount of sickness absence taken. Rotating shifts, regardless of industry, predicted sickness absence among shift workers. Consideration should be given to implementing scheduled time off between shift changes. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Gas transmission : a paradigm shift

    International Nuclear Information System (INIS)

    Cornelson, D.W.

    1997-01-01

    The evolution of energy markets in North America was discussed. The investment opportunities that are possible in a deregulated energy market, be it in production or in the generation of energy commodities, in the development of midstream infrastructure, or in the provision of energy services, were outlined. Deregulation of crude oil, natural gas and electricity has resulted in significant changes in the structure of energy markets and the way in which customers are served. One of the advantages of competition regarding power generation is that it has turned energy into a commodity which has resulted in greater customer choice and efficiency. As one example of midstream infrastructure development, the Alliance Pipeline project was described. This project was conceived as a means to enhance the value of western Canadian natural gas. The 1,900 mile pipeline will run from British Columbia, through Alberta into Chicago where it will interconnect with the North American gas transmission grid. The pipeline is an efficient means of transporting energy from Western Canada to North American markets, and Alliance, as a lowest cost transporter, will continue to put pressure on the traditional infrastructure to become even more competitive at the margin. As such, Alliance represents a paradigm shift in energy transportation, and serves as an excellent example of the type of investment opportunity that a deregulated market can provide. It was suggested that innovation and competition in a deregulated North American energy market will continue to increase. As electricity is deregulated, the energy market will respond more quickly to changes in supply and demand than it did in the past, in an effort to satisfy the needs of investors and customers. This will provide increased opportunities for restructuring and further competition

  7. Associations of Shift Work and Its Duration with Work-Related Injury among Electronics Factory Workers in South Korea.

    Science.gov (United States)

    Ryu, Jia; Jung-Choi, Kyunghee; Choi, Kyung-Hwa; Kwon, Ho-Jang; Kang, Chungwon; Kim, Hyunjoo

    2017-11-21

    This study aimed to explore the association between shift work and work-related injuries. We collected data on workers from an electronics factory. This cross-sectional study included 13,610 subjects, who were assessed based on a self-reported questionnaire about their shift work experiences, work-related injuries, and other covariates. Multiple logistic regression models were used to evaluate the associations between shift work and work-related injuries and were estimated using the odds ratio. We found that the current and past shift workers, compared to non-shift workers, were associated with a 2.7- and 1.7-fold higher risk of work-related injury. There was a dose-response relationship between shift work duration and work-related injury among current female shift workers. Shift work increased the risk of work-related injuries, and the impact could be different depending on gender.

  8. Associations of Shift Work and Its Duration with Work-Related Injury among Electronics Factory Workers in South Korea

    Directory of Open Access Journals (Sweden)

    Jia Ryu

    2017-11-01

    Full Text Available This study aimed to explore the association between shift work and work-related injuries. We collected data on workers from an electronics factory. This cross-sectional study included 13,610 subjects, who were assessed based on a self-reported questionnaire about their shift work experiences, work-related injuries, and other covariates. Multiple logistic regression models were used to evaluate the associations between shift work and work-related injuries and were estimated using the odds ratio. We found that the current and past shift workers, compared to non-shift workers, were associated with a 2.7- and 1.7-fold higher risk of work-related injury. There was a dose-response relationship between shift work duration and work-related injury among current female shift workers. Shift work increased the risk of work-related injuries, and the impact could be different depending on gender.

  9. Prosocial Behavior and Depression: a Case for Developmental Gender Differences.

    Science.gov (United States)

    Alarcón, Gabriela; Forbes, Erika E

    2017-06-01

    Prosocial behavior and depression are related constructs that both increase during adolescence and display gender-specific effects. The current review surveys literature examining the association between depressive symptoms and prosociality, measured with behavioral economic paradigms, across development and proposes a theoretical model explaining a mechanism through which adolescent girls have higher risk for depression than boys. Relative to healthy controls, prosocial behavior is reduced in adults with major depressive disorder (MDD) but may be increased in adolescents with MDD. The relationship between non-clinical levels of depressive symptoms and prosocial behavior remains to be studied experimentally; however, self-reported prosocial behavior is negatively associated with depressive symptoms in non-clinical adolescents, which may suggest a shift in the relation of prosocial behavior and depressive symptoms across the non-clinical (i.e., negative) to clinical range (i.e., positive). The effect of gender on these developmental and clinical status shifts has not been studied but could have important implications for understanding the emergence of higher rates of depression in girls than boys during adolescence. We propose that girls are at heightened risk for depression due to higher social-evaluative concern and other-oriented prosocial motivation that emphasize the needs of others over the self, leading to more altruistic prosocial behavior (despite personal cost) and a higher burden that enables depressive symptoms.

  10. Developmental Transcriptome for a Facultatively Eusocial Bee, Megalopta genalis.

    Science.gov (United States)

    Jones, Beryl M; Wcislo, William T; Robinson, Gene E

    2015-08-14

    Transcriptomes provide excellent foundational resources for mechanistic and evolutionary analyses of complex traits. We present a developmental transcriptome for the facultatively eusocial bee Megalopta genalis, which represents a potential transition point in the evolution of eusociality. A de novo transcriptome assembly of Megalopta genalis was generated using paired-end Illumina sequencing and the Trinity assembler. Males and females of all life stages were aligned to this transcriptome for analysis of gene expression profiles throughout development. Gene Ontology analysis indicates that stage-specific genes are involved in ion transport, cell-cell signaling, and metabolism. A number of distinct biological processes are upregulated in each life stage, and transitions between life stages involve shifts in dominant functional processes, including shifts from transcriptional regulation in embryos to metabolism in larvae, and increased lipid metabolism in adults. We expect that this transcriptome will provide a useful resource for future analyses to better understand the molecular basis of the evolution of eusociality and, more generally, phenotypic plasticity. Copyright © 2015 Jones et al.

  11. Goos-Haenchen shift in complex crystals

    Energy Technology Data Exchange (ETDEWEB)

    Longhi, Stefano; Della Valle, Giuseppe; Staliunas, Kestutis [Dipartimento di Fisica, Politecnico di Milano, Piazza Leonardo da Vinci 32, I-20133 Milano (Italy); Departament de Fisica i Enginyeria Nuclear, Instituci Catalana de Recerca i Estudis Avanats (ICREA), Universitat Politcnica de Catalunya, Colom 11, E-08222 Terrassa, Barcelona (Spain)

    2011-10-15

    The Goos-Haenchen (GH) effect for wave scattering from complex PT-symmetric periodic potentials (complex crystals) is theoretically investigated, with specific reference to optical GH shift in photonic crystal slabs with a sinusoidal periodic modulation of both real and imaginary parts of the dielectric constant. The analysis highlights some distinct and rather unique features as compared to the GH shift found in ordinary crystals. In particular, as opposed to GH shift in ordinary crystals, which is large at the band gap edges, in complex crystals the GH shift can be large inside the reflection (amplification) band and becomes extremely large as the PT symmetry-breaking threshold is approached.

  12. [Affective dependency].

    Science.gov (United States)

    Scantamburlo, G; Pitchot, W; Ansseau, M

    2013-01-01

    Affective dependency is characterized by emotional distress (insecure attachment) and dependency to another person with a low self-esteem and reassurance need. The paper proposes a reflection on the definition of emotional dependency and the confusion caused by various denominations. Overprotective and authoritarian parenting, cultural and socio-environmental factors may contribute to the development of dependent personality. Psychological epigenetic factors, such as early socio-emotional trauma could on neuronal circuits in prefronto-limbic regions that are essential for emotional behaviour.We also focus on the interrelations between dependent personality, domestic violence and addictions. The objective for the clinician is to propose a restoration of self-esteem and therapeutic strategies focused on autonomy.

  13. Reduced Tolerance to Night Shift in Chronic Shift Workers: Insight From Fractal Regulation.

    Science.gov (United States)

    Li, Peng; Morris, Christopher J; Patxot, Melissa; Yugay, Tatiana; Mistretta, Joseph; Purvis, Taylor E; Scheer, Frank A J L; Hu, Kun

    2017-07-01

    Healthy physiology is characterized by fractal regulation (FR) that generates similar structures in the fluctuations of physiological outputs at different time scales. Perturbed FR is associated with aging and age-related pathological conditions. Shift work, involving repeated and chronic exposure to misaligned environmental and behavioral cycles, disrupts circadian coordination. We tested whether night shifts perturb FR in motor activity and whether night shifts affect FR in chronic shift workers and non-shift workers differently. We studied 13 chronic shift workers and 14 non-shift workers as controls using both field and in-laboratory experiments. In the in-laboratory study, simulated night shifts were used to induce a misalignment between the endogenous circadian pacemaker and the sleep-wake cycles (ie, circadian misalignment) while environmental conditions and food intake were controlled. In the field study, we found that FR was robust in controls but broke down in shift workers during night shifts, leading to more random activity fluctuations as observed in patients with dementia. The night shift effect was present even 2 days after ending night shifts. The in-laboratory study confirmed that night shifts perturbed FR in chronic shift workers and showed that FR in controls was more resilience to the circadian misalignment. Moreover, FR during real and simulated night shifts was more perturbed in those who started shift work at older ages. Chronic shift work causes night shift intolerance, which is probably linked to the degraded plasticity of the circadian control system. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

  14. Classic and Golli Myelin Basic Protein have distinct developmental trajectories in human visual cortex.

    Science.gov (United States)

    Siu, Caitlin R; Balsor, Justin L; Jones, David G; Murphy, Kathryn M

    2015-01-01

    Traditionally, myelin is viewed as insulation around axons, however, more recent studies have shown it also plays an important role in plasticity, axonal metabolism, and neuroimmune signaling. Myelin is a complex multi-protein structure composed of hundreds of proteins, with Myelin Basic Protein (MBP) being the most studied. MBP has two families: Classic-MBP that is necessary for activity driven compaction of myelin around axons, and Golli-MBP that is found in neurons, oligodendrocytes, and T-cells. Furthermore, Golli-MBP has been called a "molecular link" between the nervous and immune systems. In visual cortex specifically, myelin proteins interact with immune processes to affect experience-dependent plasticity. We studied myelin in human visual cortex using Western blotting to quantify Classic- and Golli-MBP expression in post-mortem tissue samples ranging in age from 20 days to 80 years. We found that Classic- and Golli-MBP have different patterns of change across the lifespan. Classic-MBP gradually increases to 42 years and then declines into aging. Golli-MBP has early developmental changes that are coincident with milestones in visual system sensitive period, and gradually increases into aging. There are three stages in the balance between Classic- and Golli-MBP expression, with Golli-MBP dominating early, then shifting to Classic-MBP, and back to Golli-MBP in aging. Also Golli-MBP has a wave of high inter-individual variability during childhood. These results about cortical MBP expression are timely because they compliment recent advances in MRI techniques that produce high resolution maps of cortical myelin in normal and diseased brain. In addition, the unique pattern of Golli-MBP expression across the lifespan suggests that it supports high levels of neuroimmune interaction in cortical development and in aging.

  15. Etiology and Treatment of Developmental Stammering

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2008-01-01

    Full Text Available The etiology and treatment of developmental stammering in childhood (DS, also called idiopathic stammering or stuttering are reviewed by a speech pathologist and psychologist at the University of Reading, UK.

  16. Unpacking developmental local government using Soft Systems ...

    African Journals Online (AJOL)

    Developmental local government, soft systems methodology, multiple criteria ..... land and property), 26 (adequate housing), 27 (access to health care, food, water .... It is important to articulate that any decision making or resource allocation.

  17. Wanted: A Developmentally Oriented Alcohol Prevention Program.

    Science.gov (United States)

    Spoth, Richard; Rosenthal, David

    1980-01-01

    Describes an alcohol prevention program with a comprehensive developmental skills orientation. The program includes values clarification, decision making, career planning and communication skills, assertiveness and relaxation training, and relationship with parents and peers. (Author/JAC)

  18. Developmental and Reproductive Toxicology Database (DART)

    Data.gov (United States)

    U.S. Department of Health & Human Services — A bibliographic database on the National Library of Medicine's (NLM) Toxicology Data Network (TOXNET) with references to developmental and reproductive toxicology...

  19. Characteristics of children with pervasive developmental disorders ...

    African Journals Online (AJOL)

    of children presenting with features of ASD to a developmental clinic in Johannesburg over ... social interaction deficits without meeting the full criteria for PDD were excluded, as were those ..... Recurrent otitis media. 7 (12.1). Myringotomies.

  20. Current status of developmental neurotoxicity: regulatory view

    DEFF Research Database (Denmark)

    Hass, Ulla

    2003-01-01

    in the testing strategy for new and existing substances, and biocides. Hopefully, this will lead to an improved database for risk assessment of potential developmental neurotoxicants. However, the regulatory authorities and toxicologists will also be faced with the challenge that decisions have to be made......The need for developmental neurotoxicity testing has been recognized for decades and guidelines are available, as the USEPA guideline and the OECD draft TG 426. Regulatory testing of industrial chemicals for developmental neurotoxicity is required to some extent, especially for pesticides in the US....... Until recently, however, developmental neurotoxicity testing of industrial chemicals has not been a clear regulatory requirement in EU, probably due to the lack of an accepted OECD TG. The revised EU Technical Guidance Document for Risk Assessment (EU-TGD) has now included the OECD draft TG 426...