WorldWideScience

Sample records for denaturation temperature polymerase

  1. The application of polymerase chain reaction-denaturing gradient ...

    African Journals Online (AJOL)

    Jane

    2011-05-23

    May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

  2. Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota.

    Science.gov (United States)

    Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T

    2006-10-01

    Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.

  3. Urea-temperature phase diagrams capture the thermodynamics of denatured state expansion that accompany protein unfolding

    Science.gov (United States)

    Tischer, Alexander; Auton, Matthew

    2013-01-01

    We have analyzed the thermodynamic properties of the von Willebrand factor (VWF) A3 domain using urea-induced unfolding at variable temperature and thermal unfolding at variable urea concentrations to generate a phase diagram that quantitatively describes the equilibrium between native and denatured states. From this analysis, we were able to determine consistent thermodynamic parameters with various spectroscopic and calorimetric methods that define the urea–temperature parameter plane from cold denaturation to heat denaturation. Urea and thermal denaturation are experimentally reversible and independent of the thermal scan rate indicating that all transitions are at equilibrium and the van't Hoff and calorimetric enthalpies obtained from analysis of individual thermal transitions are equivalent demonstrating two-state character. Global analysis of the urea–temperature phase diagram results in a significantly higher enthalpy of unfolding than obtained from analysis of individual thermal transitions and significant cross correlations describing the urea dependence of and that define a complex temperature dependence of the m-value. Circular dichroism (CD) spectroscopy illustrates a large increase in secondary structure content of the urea-denatured state as temperature increases and a loss of secondary structure in the thermally denatured state upon addition of urea. These structural changes in the denatured ensemble make up ∼40% of the total ellipticity change indicating a highly compact thermally denatured state. The difference between the thermodynamic parameters obtained from phase diagram analysis and those obtained from analysis of individual thermal transitions illustrates that phase diagrams capture both contributions to unfolding and denatured state expansion and by comparison are able to decipher these contributions. PMID:23813497

  4. Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

    Science.gov (United States)

    Xia, Minghui; Qi, Qingguo

    2013-01-01

    We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

  5. Two-dimensional salt and temperature DNA denaturation analysis using a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Dufva, Martin; Hansen, Mikkel Fougt

    2017-01-01

    We present a microfluidic system and its use to measure DNA denaturation curves by varying the temperature or salt (Na+) concentration. The readout is based on real-time measurements of DNA hybridization using magnetoresistive sensors and magnetic nanoparticles (MNPs) as labels. We report the first...... melting curves of DNA hybrids measured as a function of continuously decreasing salt concentration at fixed temperature and compare them to the corresponding curves obtained vs. temperature at fixed salt concentration. The magnetoresistive sensor platform provided reliable results under varying....... The results demonstrate that concentration melting provides an attractive alternative to temperature melting in on-chip DNA denaturation experiments and further show that the magnetoresistive platform is attractive due to its low cross-sensitivity to temperature and liquid composition....

  6. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  7. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

    2013-01-01

    steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  8. Selection for Protein Kinetic Stability Connects Denaturation Temperatures to Organismal Temperatures and Provides Clues to Archaean Life.

    Directory of Open Access Journals (Sweden)

    M Luisa Romero-Romero

    Full Text Available The relationship between the denaturation temperatures of proteins (Tm values and the living temperatures of their host organisms (environmental temperatures: TENV values is poorly understood. Since different proteins in the same organism may show widely different Tm's, no simple universal relationship between Tm and TENV should hold, other than Tm≥TENV. Yet, when analyzing a set of homologous proteins from different hosts, Tm's are oftentimes found to correlate with TENV's but this correlation is shifted upward on the Tm axis. Supporting this trend, we recently reported Tm's for resurrected Precambrian thioredoxins that mirror a proposed environmental cooling over long geological time, while remaining a shocking ~50°C above the proposed ancestral ocean temperatures. Here, we show that natural selection for protein kinetic stability (denaturation rate can produce a Tm↔TENV correlation with a large upward shift in Tm. A model for protein stability evolution suggests a link between the Tm shift and the in vivo lifetime of a protein and, more specifically, allows us to estimate ancestral environmental temperatures from experimental denaturation rates for resurrected Precambrian thioredoxins. The TENV values thus obtained match the proposed ancestral ocean cooling, support comparatively high Archaean temperatures, and are consistent with a recent proposal for the environmental temperature (above 75°C that hosted the last universal common ancestor. More generally, this work provides a framework for understanding how features of protein stability reflect the environmental temperatures of the host organisms.

  9. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  10. Analysis of microbial diversity on deli slicers using polymerase chain reaction and denaturing gradient gel electrophoresis technologies.

    Science.gov (United States)

    Koo, O K; Mertz, A W; Akins, E L; Sirsat, S A; Neal, J A; Morawicki, R; Crandall, P G; Ricke, S C

    2013-02-01

    Cross-contamination of pathogenic and spoilage bacteria from food-contact surfaces to food products is a serious public health issue. Bacteria may survive and attach to food-contact surfaces by residual food components and/or background bacteria which may subsequently transfer to other food products. Deli slicers, generally used for slicing ready-to-eat products, can serve as potential sources for considerable bacterial transfer. The objective of this study was to assess the extent and distribution of microbial diversity of deli slicers by identification of pathogenic and background bacteria. Slicer-swab samples were collected from restaurants in Arkansas and Texas in the United States. Ten surface areas for each slicer were swabbed using sterile sponges. Denaturing gradient gel electrophoresis (DGGE) was applied to investigate the fingerprint of samples, and each band was further identified by sequence analysis. Pseudomonads were identified as the dominant bacteria followed by Enterobacteriaceae family, and lactic acid bacteria such as Lactococcus lactis and Streptococcus thermophilus were also found. Bacterial distribution was similar for all surface areas, while the blade guard exhibited the greatest diversity. This study provides a profile of the microbial ecology of slicers using DGGE to develop more specific sanitation practices and to reduce cross-contamination during slicing. © 2012 The Society for Applied Microbiology.

  11. Signal Peptide and Denaturing Temperature are Critical Factors for Efficient Mammalian Expression and Immunoblotting of Cannabinoid Receptors*

    Science.gov (United States)

    WANG, Chenyun; WANG, Yingying; WANG, Miao; CHEN, Jiankui; YU, Nong; SONG, Shiping; KAMINSKI, Norbert E.; ZHANG, Wei

    2013-01-01

    Summary Many researchers employed mammalian expression system to artificially express cannabinoid receptors, but immunoblot data that directly prove efficient protein expression can hardly be seen in related research reports. In present study, we demonstrated cannabinoid receptor protein was not able to be properly expressed with routine mammalian expression system. This inefficient expression was rescued by endowing an exogenous signal peptide ahead of cannabinoid receptor peptide. In addition, the artificially synthesized cannabinoid receptor was found to aggregate under routine sample denaturing temperatures (i.e., ≥95°C), forming a large molecular weight band when analyzed by immunoblotting. Only denaturing temperatures ≤75°C yielded a clear band at the predicted molecular weight. Collectively, we showed that efficient mammalian expression of cannabinoid receptors need a signal peptide sequence, and described the requirement for a low sample denaturing temperature in immunoblot analysis. These findings provide very useful information for efficient mammalian expression and immunoblotting of membrane receptors. PMID:22528237

  12. Nonlinear acoustic properties of ex vivo bovine liver and the effects of temperature and denaturation

    International Nuclear Information System (INIS)

    Jackson, E J; Coussios, C-C; Cleveland, R O

    2014-01-01

    Thermal ablation by high intensity focused ultrasound (HIFU) has a great potential for the non-invasive treatment of solid tumours. Due to the high pressure amplitudes involved, nonlinear acoustic effects must be understood and the relevant medium property is the parameter of nonlinearity B/A. Here, B/A was measured in ex vivo bovine liver, over a heating/cooling cycle replicating temperatures reached during HIFU ablation, adapting a finite amplitude insertion technique, which also allowed for measurement of sound-speed and attenuation. The method measures the nonlinear progression of a plane wave through liver and B/A was chosen so that numerical simulations matched the measured waveforms. To create plane-wave conditions, sinusoidal bursts were transmitted by a 100 mm diameter 1.125 MHz unfocused transducer and measured using a 15 mm diameter 2.25 MHz broadband transducer in the near field. Attenuation and sound-speed were calculated using a reflected pulse from the smaller transducer using the larger transducer as the reflecting interface. Results showed that attenuation initially decreased with heating then increased after denaturation, the sound-speed initially increased with temperature and then decreased, and B/A showed an increase with temperature but no significant post-heating change. The B/A data disagree with other reports that show a significant change and we suggest that any nonlinear enhancement in the received ultrasound signal post-treatment is likely due to acoustic cavitation rather than changes in tissue nonlinearity. (paper)

  13. Effect of quencher, denaturants, temperature and pH on the fluorescent properties of BSA protected gold nanoclusters

    Energy Technology Data Exchange (ETDEWEB)

    Chib, Rahul, E-mail: Rahul.chib@live.unthsc.edu [Department of Cell Biology and Immunology, Center for Fluorescence Technologies and Nanomedicine, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States); Butler, Susan [Department of Cell Biology and Immunology, Center for Fluorescence Technologies and Nanomedicine, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States); Raut, Sangram [Department of Cell Biology and Immunology, Center for Fluorescence Technologies and Nanomedicine, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States); Department of Physics and Astronomy, Texas Christian University, Fort Worth, TX 76129 (United States); Shah, Sunil; Borejdo, Julian [Department of Cell Biology and Immunology, Center for Fluorescence Technologies and Nanomedicine, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States); Gryczynski, Zygmunt [Department of Cell Biology and Immunology, Center for Fluorescence Technologies and Nanomedicine, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States); Department of Physics and Astronomy, Texas Christian University, Fort Worth, TX 76129 (United States); Gryczynski, Ignacy, E-mail: ignacy.gryczynski@unthsc.edu [Department of Cell Biology and Immunology, Center for Fluorescence Technologies and Nanomedicine, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2015-12-15

    In this paper, we have synthesized BSA protected gold nanoclusters (BSA Au nanocluster) and studied the effect of quencher, protein denaturant, pH and temperature on the fluorescence properties of the tryptophan molecule of the BSA Au nanocluster and native BSA. We have also studied their effect on the peak emission of BSA Au nanoclusters (650 nm). The photophysical characterization of a newly developed fluorophore in different environments is absolutely necessary to futher develop their biomedical and analytical applications. It was observed from our experiments that the tryptophan in BSA Au nanoclusters is better shielded from the polar environment. Tryptophan in native BSA showed a red shift in its peak emission wavelength position. Tryptophan is a highly polarity sensitive dye and a minimal change in its microenvironment can be easily observed in its photophysical properties. - Highlights: • Tryptophan is easily accessible in native BSA compared to BSA Au nanoclusters. • Guanidine HCL denatures native BSA more compared to BSA Au nanoclusters. • High temperature decreases the quantum yield of tryptophan and BSA Au nanocluster. • Emission wavelength of BSA Au nanoclusters remains constant with increasing pH. • BSA Au nanoclusters are robust to the changes in their environments.

  14. Effect of quencher, denaturants, temperature and pH on the fluorescent properties of BSA protected gold nanoclusters

    International Nuclear Information System (INIS)

    Chib, Rahul; Butler, Susan; Raut, Sangram; Shah, Sunil; Borejdo, Julian; Gryczynski, Zygmunt; Gryczynski, Ignacy

    2015-01-01

    In this paper, we have synthesized BSA protected gold nanoclusters (BSA Au nanocluster) and studied the effect of quencher, protein denaturant, pH and temperature on the fluorescence properties of the tryptophan molecule of the BSA Au nanocluster and native BSA. We have also studied their effect on the peak emission of BSA Au nanoclusters (650 nm). The photophysical characterization of a newly developed fluorophore in different environments is absolutely necessary to futher develop their biomedical and analytical applications. It was observed from our experiments that the tryptophan in BSA Au nanoclusters is better shielded from the polar environment. Tryptophan in native BSA showed a red shift in its peak emission wavelength position. Tryptophan is a highly polarity sensitive dye and a minimal change in its microenvironment can be easily observed in its photophysical properties. - Highlights: • Tryptophan is easily accessible in native BSA compared to BSA Au nanoclusters. • Guanidine HCL denatures native BSA more compared to BSA Au nanoclusters. • High temperature decreases the quantum yield of tryptophan and BSA Au nanocluster. • Emission wavelength of BSA Au nanoclusters remains constant with increasing pH. • BSA Au nanoclusters are robust to the changes in their environments.

  15. A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

    Science.gov (United States)

    Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

    2001-05-01

    A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

  16. Denaturing Gradient Gel Electrophoresis-Polymerase Chain Reaction Comparison of Chitosan Effects on Anaerobic Cultures of Broiler Cecal Bacteria and Salmonella Typhimurium.

    Science.gov (United States)

    Hume, Michael; Sohail, Muhammad Umar

    2018-04-01

    Enteropathogen colonization and product contamination are major poultry industry problems. The emergence of antibiotic resistance, and associated risks to human health, is limiting the use of antibiotics as first-line defense against enteropathogens in poultry. The chitin derivative, chitosan, has drawn substantial attention for its bactericidal properties. Different molecular weight (MW) chitosans can have varied effects against different bacteria in monoculture. In the current study, cecal contents from each of three market-age broilers and Salmonella Typhimurium, as indicator enteropathogen, were exposed to in vitro anaerobic culture to three chitosan preparations (0.08%, wt/vol), low (LMW), medium (MMW), and coarse (CMW). Effects of chitosan and the carrier solvent acetic acid, on cecal bacteria and Salmonella, were examined by denaturing gradient gel electrophoresis (DGGE) and Salmonella enumeration. Bacterial profiles for the three cecal contents were shown by DGGE to be very different. Each of the three cecal contents grown in the presence of 0.08% acetic acid was very different from the same contents grown without the chitosan solvent. Culturing cecal contents in the presence of chitosan altered the bacterial DGGE profiles from the control and acetic acid-only cultures. The DGGE chitosan-treated profiles for all three cecal sources were identical to each other regardless of the MW chitosan in the culture medium. Compared with Salmonella in monoculture, Salmonella decreased (p < 0.05) by about 1.5 log CFU/mL when grown in mixed culture with cecal contents. Salmonella monocultures in the presence of 0.08% of the chitosan solvent acetic acid decreased (p < 0.05) counts by almost 3.5 log CFU/mL. Combining acetic acid and cecal contents reduced (p < 0.05) Salmonella by 7 log CFU/mL. Adding the chitosan preparations to the mixtures reduced (p < 0.05) Salmonella by 8 log CFU/mL.

  17. Effects of Metal Ions, Temperature, and a Denaturant on the Oxidative Folding Pathways of Bovine α-Lactalbumin

    Directory of Open Access Journals (Sweden)

    Reina Shinozaki

    2017-09-01

    Full Text Available Bovine α-lactalbumin (αLA has four disulfide (SS bonds in the native form (N. On the oxidative folding pathways of this protein, two specific SS folding intermediates, i.e., (61–77, 73–91 and des[6–120], which have two and three native SS bonds, respectively, accumulate predominantly in the presence of Ca2+. In this study, we reinvestigated the pathways using a water-soluble cyclic selenoxide reagent, trans-3,4-dihydroxyselenolane oxide (DHSox, as a strong and quantitative oxidant to oxidize the fully reduced form (R. In the presence of ethylenediaminetetraacetic acid (EDTA (under a metal-free condition, SS formation randomly proceeded, and N did not regenerate. On the other hand, two specific SS intermediates transiently generated in the presence of Ca2+. These intermediates could be assigned to (61–77, 73–91 and des[6–120] having two common SS bonds, i.e., Cys61-Cys77 and Cys73-Cys91, near the calcium binding pocket of the β-sheet domain. Much faster folding to N was observed in the presence of Mn2+, whereas Na+, K+, Mg2+, and Zn2+ did not affect the pathways. The two key intermediates were susceptible to temperature and a denaturant. The oxidative folding pathways revealed were significantly different from those of hen egg white lysozyme, which has the same SS-bonding pattern as αLA, suggesting that the folding pathways of SS-containing proteins can alter depending on the amino acid sequence and other factors, even when the SS-bond topologies are similar to each other.

  18. Single DNA denaturation and bubble dynamics

    DEFF Research Database (Denmark)

    Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas

    2009-01-01

    While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...... for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation...

  19. Single DNA denaturation and bubble dynamics

    International Nuclear Information System (INIS)

    Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C

    2009-01-01

    While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.

  20. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    Science.gov (United States)

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.

  1. Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

    Directory of Open Access Journals (Sweden)

    Chan-Young Park

    2016-10-01

    Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

  2. Denatured fuel cycles

    International Nuclear Information System (INIS)

    Till, C.E.

    1979-01-01

    This paper traces the history of the denatured fuel concept and discusses the characteristics of fuel cycles based on the concept. The proliferation resistance of denatured fuel cycles, the reactor types they involve, and the limitations they place on energy generation potential are discussed. The paper concludes with some remarks on the outlook for such cycles

  3. Denaturing gradient gel electrophoresis

    International Nuclear Information System (INIS)

    Kocherginskaya, S.A.; Cann, I.K.O.; Mackie, R.I.

    2005-01-01

    It is worthwhile considering that only some 30 species make up the bulk of the bacterial population in human faeces at any one time based on the classical cultivation-based approach. The situation in the rumen is similar. Thus, it is practical to focus on specific groups of interest within the complex community. These may be the predominant or the most active species, specific physiological groups or readily identifiable (genetic) clusters of phylogenetically related organisms. Several 16S rDNA fingerprinting techniques can be invaluable for selecting and monitoring sequences or phylogenetic groups of interest and are described below. Over the past few decades, considerable attention was focussed on the identification of pure cultures of microbes on the basis of genetic polymorphisms of DNA encoding rRNA such as ribotyping, amplified fragment length polymorphism and randomly amplified polymorphic DNA. However, many of these methods require prior cultivation and are less suitable for use in analysis of complex mixed populations although important in describing cultivated microbial diversity in molecular terms. Much less attention was given to molecular characterization of complex communities. In particular, research into diversity and community structure over time has been revolutionized by the advent of molecular fingerprinting techniques for complex communities. Denaturing or temperature gradient gel electrophoresis (DGGE/TGGE) methods have been successfully applied to the analysis of human, pig, cattle, dog and rodent intestinal populations

  4. Poliovirus RNA polymerase: in vitro enzymatic activities, fidelity of replication, and characterization of a temperature-sensitive RNA-negative mutant

    International Nuclear Information System (INIS)

    Stokes, M.A.M.

    1985-01-01

    The in vitro activities of the purified poliovirus RNA polymerase were investigated in this study. The polymerase was shown to be a strict RNA dependent RNA polymerase. It only copied RNA templates but used either a DNA or RNA primer to initiate RNA synthesis. Partially purified polymerase has some DNA polymerase activities. Additional purification of the enzyme and studies with a mutant poliovirus RNA polymerase indicated that the DNA polymerase activities were due to a cellular polymerase. The fidelity of RNA replication in vitro by the purified poliovirus RNA polymerase was studied by measuring the rate of misincorporation of noncomplementary ribonucleotide monophosphates on synthetic homopolymeric RNA templates. The results showed that the ratio of noncomplementary to complementary ribonucleotides incorporated was 1-5 x 10 -3 . The viral polymerase of a poliovirus temperature sensitive RNA-negative mutant, Ts 10, was isolated. This study confirmed that the mutant was viable 33 0 , but was RNA negative at 39 0 . Characterization of the Ts 10 polymerase showed it was significantly more sensitive to heat inactivation than was the old-type polymerase. Highly purified poliovirions were found to contain several noncapsid proteins. At least two of these proteins were labeled by [ 35 S]methionine infected cells and appeared to be virally encoded proteins. One of these proteins was immunoprecipitated by anti-3B/sup vpg/ antiserum. This protein had the approximate Mr = 50,000 and appeared to be one of the previously identified 3B/sup vpg/ precursor proteins

  5. Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

    Science.gov (United States)

    Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2012-01-01

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

  6. Microwave-enhanced folding and denaturation of globular proteins

    DEFF Research Database (Denmark)

    Bohr, Henrik; Bohr, Jakob

    2000-01-01

    It is shown that microwave irradiation can affect the kinetics of the folding process of some globular proteins, especially beta-lactoglobulin. At low temperature the folding from the cold denatured phase of the protein is enhanced, while at a higher temperature the denaturation of the protein from...... its folded state is enhanced. In the latter case, a negative temperature gradient is needed for the denaturation process, suggesting that the effects of the microwaves are nonthermal. This supports the notion that coherent topological excitations can exist in proteins. The application of microwaves...

  7. Enrichment of methylated molecules using enhanced-ice-co-amplification at lower denaturation temperature-PCR (E-ice-COLD-PCR) for the sensitive detection of disease-related hypermethylation.

    Science.gov (United States)

    Mauger, Florence; Kernaleguen, Magali; Lallemand, Céline; Kristensen, Vessela N; Deleuze, Jean-François; Tost, Jörg

    2018-05-01

    The detection of specific DNA methylation patterns bears great promise as biomarker for personalized management of cancer patients. Co-amplification at lower denaturation temperature-PCR (COLD-PCR) assays are sensitive methods, but have previously only been able to analyze loss of DNA methylation. Enhanced (E)-ice-COLD-PCR reactions starting from 2 ng of bisulfite-converted DNA were developed to analyze methylation patterns in two promoters with locked nucleic acid (LNA) probes blocking amplification of unmethylated CpGs. The enrichment of methylated molecules was compared to quantitative (q)PCR and quantified using serial dilutions. E-ice-COLD-PCR allowed the multiplexed enrichment and quantification of methylated DNA. Assays were validated in primary breast cancer specimens and circulating cell-free DNA from cancer patients. E-ice-COLD-PCR could prove a useful tool in the context of DNA methylation analysis for personalized medicine.

  8. Hysteresis in pressure-driven DNA denaturation.

    Directory of Open Access Journals (Sweden)

    Enrique Hernández-Lemus

    Full Text Available In the past, a great deal of attention has been drawn to thermal driven denaturation processes. In recent years, however, the discovery of stress-induced denaturation, observed at the one-molecule level, has revealed new insights into the complex phenomena involved in the thermo-mechanics of DNA function. Understanding the effect of local pressure variations in DNA stability is thus an appealing topic. Such processes as cellular stress, dehydration, and changes in the ionic strength of the medium could explain local pressure changes that will affect the molecular mechanics of DNA and hence its stability. In this work, a theory that accounts for hysteresis in pressure-driven DNA denaturation is proposed. We here combine an irreversible thermodynamic approach with an equation of state based on the Poisson-Boltzmann cell model. The latter one provides a good description of the osmotic pressure over a wide range of DNA concentrations. The resulting theoretical framework predicts, in general, the process of denaturation and, in particular, hysteresis curves for a DNA sequence in terms of system parameters such as salt concentration, density of DNA molecules and temperature in addition to structural and configurational states of DNA. Furthermore, this formalism can be naturally extended to more complex situations, for example, in cases where the host medium is made up of asymmetric salts or in the description of the (helical-like charge distribution along the DNA molecule. Moreover, since this study incorporates the effect of pressure through a thermodynamic analysis, much of what is known from temperature-driven experiments will shed light on the pressure-induced melting issue.

  9. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Science.gov (United States)

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  10. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  11. Thermal denaturation of type I collagen vitrified gels

    International Nuclear Information System (INIS)

    Xia, Zhiyong; Calderon-Colon, Xiomara; Trexler, Morgana; Elisseeff, Jennifer; Guo, Qiongyu

    2012-01-01

    Highlights: ► We analyzed the denaturation of vitrigels synthesized under different conditions. ► Overall denaturation kinetics consisted of both reversible and irreversible steps. ► More stable vitrigels were formed under high level of vitrification. - Abstract: The denaturation kinetics of type I collagen vitrigels synthesized under different vitrification time and temperature were analyzed by the classical Kissinger approach and the advanced model free kinetics (AMFK) using the Vyazovkin algorithm. The AMFK successfully elucidated the overall denaturation into reversible and irreversible processes. Depending on vitrification conditions, the activation energy for the irreversible process ranged from 100 to 200 kJ/mol, and the reversible enthalpy ranged from 250 to 300 kJ/mol. All of these values increased with the vitrification time and temperature, indicating that a more stable and complex structure formed with increased vitrification. The classical Kissinger method predicted the presence of a critical temperate of approximately 60 °C for the transition between reversible and irreversible processes. Scanning electron microscopy revealed the presence of fibril structures in vitrigels both before and after full denaturation; however the fibrils had became thicker and rougher after denaturation.

  12. "Cooperative collapse" of the denatured state revealed through Clausius-Clapeyron analysis of protein denaturation phase diagrams.

    Science.gov (United States)

    Tischer, Alexander; Machha, Venkata R; Rösgen, Jörg; Auton, Matthew

    2018-02-19

    Protein phase diagrams have a unique potential to identify the presence of additional thermodynamic states even when non-2-state character is not readily apparent from the experimental observables used to follow protein unfolding transitions. Two-state analysis of the von Willebrand factor A3 domain has previously revealed a discrepancy in the calorimetric enthalpy obtained from thermal unfolding transitions as compared with Gibbs-Helmholtz analysis of free energies obtained from the Linear Extrapolation Method (Tischer and Auton, Prot Sci 2013; 22(9):1147-60). We resolve this thermodynamic conundrum using a Clausius-Clapeyron analysis of the urea-temperature phase diagram that defines how ΔH and the urea m-value interconvert through the slope of c m versus T, (∂cm/∂T)=ΔH/(mT). This relationship permits the calculation of ΔH at low temperature from m-values obtained through iso-thermal urea denaturation and high temperature m-values from ΔH obtained through iso-urea thermal denaturation. Application of this equation uncovers sigmoid transitions in both cooperativity parameters as temperature is increased. Such residual thermal cooperativity of ΔH and the m-value confirms the presence of an additional state which is verified to result from a cooperative phase transition between urea-expanded and thermally-compact denatured states. Comparison of the equilibria between expanded and compact denatured ensembles of disulfide-intact and carboxyamidated A3 domains reveals that introducing a single disulfide crosslink does not affect the presence of the additional denatured state. It does, however, make a small thermodynamically favorable free energy (∼-13 ± 1 kJ/mol) contribution to the cooperative denatured state collapse transition as temperature is raised and urea concentration is lowered. The thermodynamics of this "cooperative collapse" of the denatured state retain significant compensations between the enthalpy and entropy contributions to the overall

  13. Heat denaturation of soy glycinin : Influence of pH and ionic strength on molecular structure

    NARCIS (Netherlands)

    Lakemond, C.M.M.; Jongh, de H.H.J.; Hessing, M.; Gruppen, H.; Voragen, A.G.J.

    2000-01-01

    The 7S/11S glycinin equilibrium as found in Lakemond et al. (J. Agric. Food Chem. 2000, 48, xxxx-xxxx) at ambient temperatures influences heat denaturation. It is found that the 7S form of glycinin denatures at a lower temperature than the 11S form, as demonstrated by a combination of calorimetric

  14. Reduction of postreplication DNA repair in two Escherichia coli mutants with temperature-sensitive polymerase III activity: implications for the postreplication repair pathway

    International Nuclear Information System (INIS)

    Johnson, R.C.

    1978-01-01

    Daughter strand gaps are secondary lesions caused by interrupted DNA synthesis in the proximity of uv-induced pyrimidine dimers. The relative roles of DNA recombination and de novo DNA synthesis in filling such gaps have not been clarified, although both are required for complete closure. In this study, the Escherichia coli E486 and E511 dnaE(Ts) mutants, in which DNA polymerase I but not DNA polymerase III is active at 43 0 C, were examined. Both mutants demonstrated reduced gap closure in comparison with the progenitor strain at the nonpermissive temperature. These results and those of previous studies support the hypothesis that both DNA polymerase I and DNA polymerase III contribute to gap closure, suggesting a cooperative effort in the repair of each gap. Benzoylated, naphthoylated diethylaminoethyl-cellulose chromatography analysis for persistence of single-strand DNA in the absence of DNA polymerase III activity suggested that de novo DNA synthesis initiates the filling of daughter strand gaps

  15. 27 CFR 19.456 - Adding denaturants.

    Science.gov (United States)

    2010-04-01

    ... proprietor shall submit a flow diagram of the intended process or method of adding denaturants. (Sec. 201... OF THE TREASURY LIQUORS DISTILLED SPIRITS PLANTS Denaturing Operations and Manufacture of Articles...

  16. Reversible thermal denaturation of immobilized rhodanese

    International Nuclear Information System (INIS)

    Horowitz, P.; Bowman, S.

    1987-01-01

    For the first time, the enzyme rhodanese had been refolded after thermal denaturation. This was previously not possible because of the strong tendency for the soluble enzyme to aggregate at temperatures above 37 degrees C. The present work used rhodanese that was covalently coupled to a solid support under conditions that were found to preserve enzyme activity. Rhodanese was immobilized using an N-hydroxymalonimidyl derivative of Sepharose containing a 6-carbon spacer. The number of immobilized competent active sites was measured by using [ 35 S]SO 3 (2-) to form an active site persulfide that is the obligatory catalytic intermediate. Soluble enzyme was irreversibly inactivated in 10 min at 52 degrees C. The immobilized enzyme regained at least 30% of its original activity even after boiling for 20 min. The immobilized enzyme had a Km and Vmax that were each approximately 3 times higher than the corresponding values for the native enzyme. After preincubation at high temperatures, progress curves for the immobilized enzyme showed induction periods of up to 5 min before attaining apparently linear steady states. The pH dependence of the activity was the same for both the soluble and the immobilized enzyme. These results indicate significant stabilization of rhodanese after immobilization, and instabilities caused by adventitious solution components are not the sole reasons for irreversibility of thermal denaturation seen with the soluble enzyme. The results are consistent with models for rhodanese that invoke protein association as a major cause of inactivation of the enzyme. Furthermore, the induction period in the progress curves is consistent with studies which show that rhodanese refolding proceeds through intermediate states

  17. Irreversible denaturation of maltodextrin glucosidase studied by differential scanning calorimetry, circular dichroism, and turbidity measurements.

    Science.gov (United States)

    Goyal, Megha; Chaudhuri, Tapan K; Kuwajima, Kunihiro

    2014-01-01

    Thermal denaturation of Escherichia coli maltodextrin glucosidase was studied by differential scanning calorimetry, circular dichroism (230 nm), and UV-absorption measurements (340 nm), which were respectively used to monitor heat absorption, conformational unfolding, and the production of solution turbidity. The denaturation was irreversible, and the thermal transition recorded at scan rates of 0.5-1.5 K/min was significantly scan-rate dependent, indicating that the thermal denaturation was kinetically controlled. The absence of a protein-concentration effect on the thermal transition indicated that the denaturation was rate-limited by a mono-molecular process. From the analysis of the calorimetric thermograms, a one-step irreversible model well represented the thermal denaturation of the protein. The calorimetrically observed thermal transitions showed excellent coincidence with the turbidity transitions monitored by UV-absorption as well as with the unfolding transitions monitored by circular dichroism. The thermal denaturation of the protein was thus rate-limited by conformational unfolding, which was followed by a rapid irreversible formation of aggregates that produced the solution turbidity. It is thus important to note that the absence of the protein-concentration effect on the irreversible thermal denaturation does not necessarily means the absence of protein aggregation itself. The turbidity measurements together with differential scanning calorimetry in the irreversible thermal denaturation of the protein provided a very effective approach for understanding the mechanisms of the irreversible denaturation. The Arrhenius-equation parameters obtained from analysis of the thermal denaturation were compared with those of other proteins that have been reported to show the one-step irreversible thermal denaturation. Maltodextrin glucosidase had sufficiently high kinetic stability with a half-life of 68 days at a physiological temperature (37°C).

  18. Protein denaturation and functional properties of Lenient Steam Injection heat treated whey protein concentrate

    DEFF Research Database (Denmark)

    Dickow, Jonatan Ahrens; Kaufmann, Niels; Wiking, Lars

    2012-01-01

    Whey protein concentrate (WPC) was heat treated by use of the novel heat treatment method of Lenient Steam Injection (LSI) to elucidate new functional properties in relation to heat-induced gelation of heat treated WPC. Denaturation was measured by both DSC and FPLC, and the results of the two...... methods were highly correlated. Temperatures of up to 90 °C were applicable using LSI, whereas only 68 °C could be reached by plate heat exchange before coagulation/fouling. Denaturation of whey proteins increased with increasing heat treatment temperature up to a degree of 30–35% denaturation at 90 °C...

  19. Thermally responsive silicon nanowire arrays for native/denatured-protein separation

    International Nuclear Information System (INIS)

    Wang Hongwei; Wang Yanwei; Yuan Lin; Wang Lei; Yang Weikang; Wu Zhaoqiang; Li Dan; Chen Hong

    2013-01-01

    We present our findings of the selective adsorption of native and denatured proteins onto thermally responsive, native-protein resistant poly(N-isopropylacrylamide) (PNIPAAm) decorated silicon nanowire arrays (SiNWAs). The PNIPAAm–SiNWAs surface, which shows very low levels of native-protein adsorption, favors the adsorption of denatured proteins. The amount of denatured-protein adsorption is higher at temperatures above the lower critical solution temperature (LCST) of PNIPAAm. Temperature cycling surrounding the LCST, which ensures against thermal denaturation of native proteins, further increases the amount of denatured-protein adsorption. Moreover, the PNIPAAm–SiNWAs surface is able to selectively adsorb denatured protein even from mixtures of different protein species; meanwhile, the amount of native proteins in solution is kept nearly at its original level. It is believed that these results will not only enrich current understanding of protein interactions with PNIPAAm-modified SiNWAs surfaces, but may also stimulate applications of PNIPAAm–SiNWAs surfaces for native/denatured protein separation. (paper)

  20. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    Science.gov (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  1. Thermal denaturation of A-DNA

    International Nuclear Information System (INIS)

    Valle-Orero, J; Wildes, A R; Theodorakopoulos, N; Cuesta-López, S; Peyrard, M; Garden, J-L; Danilkin, S

    2014-01-01

    The DNA molecule can take various conformational forms. Investigations focus mainly on the so-called ‘B-form’, schematically drawn in the famous paper by Watson and Crick [1]. This is the usual form of DNA in a biological environment and is the only form that is stable in an aqueous environment. Other forms, however, can teach us much about DNA. They have the same nucleotide base pairs for ‘building blocks’ as B-DNA, but with different relative positions, and studying these forms gives insight into the interactions between elements under conditions far from equilibrium in the B-form. Studying the thermal denaturation is particularly interesting because it provides a direct probe of those interactions which control the growth of the fluctuations when the ‘melting’ temperature is approached. Here we report such a study on the ‘A-form’ using calorimetry and neutron scattering. We show that it can be carried further than a similar study on B-DNA, requiring the improvement of thermodynamic models for DNA. (paper)

  2. Reversibility of partial denaturation of DNA

    International Nuclear Information System (INIS)

    Acuna, M.I.; Mingot, F.; Davila, C.A.

    1976-01-01

    The recovery of hypochromicity in a partially denatured DNA sample when salt concentration is suddenly increased at a intermediate stage of the thermal transition is studied. The results of CsCl gradient analysis, PEG/DEX partition analysis, behaviour in a new thermal transition hydrodynamic properties and transforming ability, support the view that the process is an intramolecular double chain denaturation. The degree of denaturation irreversibility is dependent on single chain molecular weight of DNA (discontinuities denisty) and upon the helicity value at which salt concentration jump is performed. Both dependences are formally interpreted according to Elton's model for base distribution in DNA. Kinetically the process behaves as being an hydrodynamically limited rewinding. (author)

  3. A single polymerase (L) mutation in avian metapneumovirus increased virulence and partially maintained virus viability at an elevated temperature.

    Science.gov (United States)

    Brown, Paul A; Lupini, Caterina; Catelli, Elena; Clubbe, Jayne; Ricchizzi, Enrico; Naylor, Clive J

    2011-02-01

    Previously, a virulent avian metapneumovirus, farm isolate Italy 309/04, was shown to have been derived from a live vaccine. Virulence due to the five nucleotide mutations associated with the reversion to virulence was investigated by their addition to the genome of the vaccine strain using reverse genetics. Virulence of these recombinant viruses was determined by infection of 1-day-old turkeys. Disease levels resulting from the combined two matrix mutations was indistinguishable from that produced by the recombinant vaccine, whereas the combined three L gene mutations increased disease to a level (P<0.0001) that was indistinguishable from that caused by the revertant Italy 309/04 virus. Testing of the L mutations individually showed that two mutations did not increase virulence, while the third mutation, corresponding to an asparagine to aspartic acid substitution, produced virulence indistinguishable from that caused by Italy 309/04. In contrast to the vaccine, the virulent mutant also showed increased viability at temperatures typical of turkey core tissues. The notion that increased viral virulence resulted from enhanced ability to replicate in tissues away from the cool respiratory tract, cannot be discounted.

  4. 9 CFR 325.13 - Denaturing procedures.

    Science.gov (United States)

    2010-01-01

    ... the appropriate agent shall be used to give the material a distinctive color, odor, or taste so that... thoroughly mixing therein denaturing oil, No. 2 fuel oil, brucine dissolved in a mixture of alcohol and pine... distinctive a color, odor, or taste that it cannot be confused with an article of human food. [35 FR 15605...

  5. Cooperative unfolding of apolipoprotein A-1 induced by chemical denaturation.

    Science.gov (United States)

    Eckhardt, D; Li-Blatter, X; Schönfeld, H-J; Heerklotz, H; Seelig, J

    2018-05-25

    Apolipoprotein A-1 (Apo A-1) plays an important role in lipid transfer and obesity. Chemical unfolding of α-helical Apo A-1 is induced with guanidineHCl and monitored with differential scanning calorimetry (DSC) and CD spectroscopy. The unfolding enthalpy and the midpoint temperature of unfolding decrease linearly with increasing guanidineHCl concentration, caused by the weak binding of denaturant. At room temperature, binding of 50-60 molecules guanidineHCl leads to a complete Apo A-1 unfolding. The entropy of unfolding decreases to a lesser extent than the unfolding enthalpy. Apo A-1 chemical unfolding is a dynamic multi-state equilibrium that is analysed with the Zimm-Bragg theory modified for chemical unfolding. The chemical Zimm-Bragg theory predicts the denaturant binding constant K D and the protein cooperativity σ. Chemical unfolding of Apo A-1 is two orders of magnitude less cooperative than thermal unfolding. The free energy of thermal unfolding is ~0.2 kcal/mol per amino acid residue and ~1.0 kcal/mol for chemical unfolding at room temperature. The Zimm-Bragg theory calculates conformational probabilities and the chemical Zimm-Bragg theory predicts stretches of α-helical segments in dynamic equilibrium, unfolding and refolding independently and fast. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Thermal denaturation of sunflower globulins in low moisture conditions

    International Nuclear Information System (INIS)

    Rouilly, A.; Orliac, O.; Silvestre, F.; Rigal, L.

    2003-01-01

    DSC analysis in pressure resisting pans of sunflower oil cake makes appear the endothermic peak of sunflower globulins denaturation. Its temperature decreases from 189.5 to 119.9 deg. C while the corresponding enthalpy increases from 2.6 to 3.3 J/g of sample, or from 6.7 to 12.2 J/g of dry protein, when the samples moisture content varies from 0 to 30.0% of the total weight. The plot of the denaturation temperature versus the moisture content is not linear but has a rounded global shape and seems to follow the hydration behavior of the proteins, modeled with the sorption isotherm. As it can be seen on scanning electron microscopy (SEM) micrographs, protein corpuscles 'melt' after such a thermal treatment and large aggregates form by coagulation. Moisture dependence of the 'fusion' temperature of native proteic organization, in low moisture conditions, offers so a new characterization method for the use of vegetable proteins in agro-materials

  7. Thermal denaturation of sunflower globulins in low moisture conditions

    Energy Technology Data Exchange (ETDEWEB)

    Rouilly, A.; Orliac, O.; Silvestre, F.; Rigal, L

    2003-03-05

    DSC analysis in pressure resisting pans of sunflower oil cake makes appear the endothermic peak of sunflower globulins denaturation. Its temperature decreases from 189.5 to 119.9 deg. C while the corresponding enthalpy increases from 2.6 to 3.3 J/g of sample, or from 6.7 to 12.2 J/g of dry protein, when the samples moisture content varies from 0 to 30.0% of the total weight. The plot of the denaturation temperature versus the moisture content is not linear but has a rounded global shape and seems to follow the hydration behavior of the proteins, modeled with the sorption isotherm. As it can be seen on scanning electron microscopy (SEM) micrographs, protein corpuscles 'melt' after such a thermal treatment and large aggregates form by coagulation. Moisture dependence of the 'fusion' temperature of native proteic organization, in low moisture conditions, offers so a new characterization method for the use of vegetable proteins in agro-materials.

  8. Analyzing Protein Denaturation using Fast Differential Scanning Calorimetry

    NARCIS (Netherlands)

    Splinter, R.; Van Herwaarden, A.W.; Iervolino, E.; Vanden Poel, G.; Istrate, D.; Sarro, P.M.

    2012-01-01

    This paper investigates the possibility to measure protein denaturation with Fast Differential Scanning Calorimetry (FDSC). Cancer can be diagnosed by measuring protein denaturation in blood plasma using Differential Scanning Calorimetry (DSC). FDSC can reduce diagnosis time from hours to minutes,

  9. Drying and denaturation characteristics of whey protein isolate in the presence of lactose and trehalose.

    Science.gov (United States)

    Haque, M Amdadul; Chen, Jie; Aldred, Peter; Adhikari, Benu

    2015-06-15

    The denaturation kinetics of whey protein isolate (WPI), in the presence and absence of lactose and trehalose, was quantified in a convective air-drying environment. Single droplets of WPI, WPI-lactose and WPI-trehalose were dried in conditioned air (2.5% RH, 0.5m/s air velocity) at two temperatures (65°C and 80°C) for 500s. The initial solid concentration of these solutions was 10% (w/v) in all the samples. Approximately 68% of WPI was denatured when it was dried in the absence of sugars. Addition of 20% trehalose prevented the irreversible denaturation of WPI at both temperatures. Thirty percent lactose was required to prevent denaturation of WPI at 65°C and the same amount of lactose protected only 70% of WPI from denaturation at 80°C. The secondary structures of WPI were found to be altered by the drying-induced stresses, even in the presence of 20% trehalose and 30% lactose. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Guanidinium-induced denaturation by breaking of salt bridges

    NARCIS (Netherlands)

    Meuzelaar, H.; Panman, M.R.; Woutersen, S.

    2015-01-01

    Despite its wide use as a denaturant, the mechanism by which guanidinium (Gdm+) induces protein unfolding remains largely unclear. Herein, we show evidence that Gdm+ can induce denaturation by disrupting salt bridges that stabilize the folded conformation. We study the Gdm+-​induced denaturation of

  11. A correlated Walks' theory for DNA denaturation

    International Nuclear Information System (INIS)

    Mejdani, R.

    1994-08-01

    We have shown that by using a correlated Walks' theory for the lattice gas model on a one-dimensional lattice, we can study, beside the saturation curves obtained before for the enzyme kinetics, also the DNA denaturation process. In the limit of no interactions between sites the equation for melting curves of DNA reduces to the random model equation. Thus our leads naturally to this classical equation in the limiting case. (author). 22 refs, 3 figs

  12. Denatured plutonium: a study of deterrent action. Final report

    International Nuclear Information System (INIS)

    Hutchins, B.A.

    1975-07-01

    The safeguarding of nuclear reactor fuel includes physical security methods as well as technological process options. The purpose of this study was to provide a preliminary evaluation of a technological option; the introduction of denaturing as a deterrent to illicit plutonium diversion. Denaturing is accomplished by coextracting some highly-radioactive fission products with the plutonium during reprocessing of spent fuel. The radioactive denaturant is always in companion with the plutonium through all subsequent fuel cycle steps - and serves as a deterrent to diversion or illicit usage of this fissile source. In concept the denaturing approach is simple and straightforward. This report provides a preliminary analysis of denaturing which can be achieved within the framework of present reprocessing technology. The impact of denaturing is indicated by comparison to a conventional (i.e., non-denatured) light water reacter cycle approach

  13. Thermal denaturation of protein studied by terahertz time-domain spectroscopy

    Science.gov (United States)

    Fu, Xiuhua; Li, Xiangjun; Liu, Jianjun; Du, Yong; Hong, Zhi

    2012-12-01

    In this study, the absorption spectra of native or thermal protein were measured in 0.2-1.4THz using terahertz time-domain spectroscopy (THz-TDS) system at room temperature, their absorption spectra and the refractive spectra were obtained. Experimental results indicate that protein both has strong absorption but their characteristics were not distinct in the THz region, and the absorption decreased during thermal denatured state. In order to prove protein had been denatured, we used Differential scanning calorimeter (DSC) measured their denatured temperature, from their DSC heating traces, collagen Td=101℃, Bovine serum albumin Td=97℃. While we also combined the Fourier transform infrared spectrometer (FTIR) to investigate their secondary and tertiary structure before and after denatuation, but the results did not have the distinct changes. We turned the absorption spectra and the refractive spectra to the dielectric spectra, and used the one-stage Debye model simulated the terahertz dielectric spectra of protein before and after denaturation. This research proved that the terahertz spectrum technology is feasible in testing protein that were affected by temperature or other factors which can provide theoretical foundation in the further study about the THz spectrum of protein and peptide temperature stability.

  14. Calorimetric studies of the thermal denaturation of cytochrome c peroxidase

    International Nuclear Information System (INIS)

    Kresheck, G.C.; Erman, J.E.

    1988-01-01

    Two endotherms are observed by differential scanning calorimetry during the thermal denaturation of cytochrome c peroxidase at pH 7.0. The transition midpoint temperatures (t/sub m/) were 43.9 +- 1.4 and 63.3 +- 1.6 0 C, independent of concentration. The two endotherms were observed at all pH values between 4 and 8, with the transition temperatures varying with pH. Precipitation was observed between pH 4 and 6, and only qualitative data are presented for this region. The thermal unfolding of cytochrome c peroxidase was sensitive to the presence and ligation state of the heme. Only a single endotherm was observed for the unfolding of the apoprotein, and this transition was similar to the high-temperature transition in the holoenzyme. Addition of KCN to the holoenzyme increases the midpoint of the high-temperature transition whereas the low-temperature transition was increased upon addition of KF. Binding of the natural substrate ferricytochrome c to the enzyme increases the low-temperature transition by 4.8 +- 1.3 0 C but has no effect on the high-temperature transition at pH 7. The presence of cytochrome c peroxidase decreases the stability of cytochrome c, and both proteins appear to unfold simultaneously. The results are discussed in terms of the two domains evident in the X-ray crystallographic structure of cytochrome c peroxidase

  15. Prediction of Active Site and Distal Residues in E. coli DNA Polymerase III alpha Polymerase Activity.

    Science.gov (United States)

    Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J

    2018-02-20

    The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.

  16. Hemichrome formation during hemoglobin Zurich denaturation

    International Nuclear Information System (INIS)

    Zago, M.A.; Costa, F.F.; Botura, C.; Baffa, O.

    1988-01-01

    Electron paramagnetic resonance (EPR)spectrum of hemoglobin Zurich, after oxidation, storage and heating, showed several absorption derives in the high field region (g ≅ 2) which are indicative of hemichrome formation. Characteristic visible spectra of hemichromes were observed for oxidized Hb Zurich and for its spontaneous precipitate. The proportional increase of EPR signals at g ≅ 2 and decrease at g = 6.37, the constant ratio of absorbance at 540 nm to 280 nm during heating, and the similarity of this ratio for spontaneously precipitated HbA and for Hb Zurich indicate that heme is not lost during the first steps of Hb Zurich denaturation. (author) [pt

  17. Partially folded intermediates during trypsinogen denaturation

    Directory of Open Access Journals (Sweden)

    Martins N.F.

    1999-01-01

    Full Text Available The equilibrium unfolding of bovine trypsinogen was studied by circular dichroism, differential spectra and size exclusion HPLC. The change in free energy of denaturation was = 6.99 ± 1.40 kcal/mol for guanidine hydrochloride and = 6.37 ± 0.57 kcal/mol for urea. Satisfactory fits of equilibrium unfolding transitions required a three-state model involving an intermediate in addition to the native and unfolded forms. Size exclusion HPLC allowed the detection of an intermediate population of trypsinogen whose Stokes radii varied from 24.1 ± 0.4 Å to 26.0 ± 0.3 Å for 1.5 M and 2.5 M guanidine hydrochloride, respectively. During urea denaturation, the range of Stokes radii varied from 23.9 ± 0.3 Å to 25.7 ± 0.6 Å for 4.0 M and 6.0 M urea, respectively. Maximal intrinsic fluorescence was observed at about 3.8 M urea with 8-aniline-1-naphthalene sulfonate (ANS binding. These experimental data indicate that the unfolding of bovine trypsinogen is not a simple transition and suggest that the equilibrium intermediate population comprises one intermediate that may be characterized as a molten globule. To obtain further insight by studying intermediates representing different stages of unfolding, we hope to gain a better understanding of the complex interrelations between protein conformation and energetics.

  18. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    Science.gov (United States)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  19. Are There Mutator Polymerases?

    Directory of Open Access Journals (Sweden)

    Miguel Garcia-Diaz

    2003-01-01

    Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.

  20. Simulated pressure denaturation thermodynamics of ubiquitin.

    Science.gov (United States)

    Ploetz, Elizabeth A; Smith, Paul E

    2017-12-01

    Simulations of protein thermodynamics are generally difficult to perform and provide limited information. It is desirable to increase the degree of detail provided by simulation and thereby the potential insight into the thermodynamic properties of proteins. In this study, we outline how to analyze simulation trajectories to decompose conformation-specific, parameter free, thermodynamically defined protein volumes into residue-based contributions. The total volumes are obtained using established methods from Fluctuation Solution Theory, while the volume decomposition is new and is performed using a simple proximity method. Native and fully extended ubiquitin are used as the test conformations. Changes in the protein volumes are then followed as a function of pressure, allowing for conformation-specific protein compressibility values to also be obtained. Residue volume and compressibility values indicate significant contributions to protein denaturation thermodynamics from nonpolar and coil residues, together with a general negative compressibility exhibited by acidic residues. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. 27 CFR 19.464 - Denatured spirits inventories.

    Science.gov (United States)

    2010-04-01

    ... of Articles Inventories § 19.464 Denatured spirits inventories. Each proprietor shall take a physical inventory of all denatured spirits in the processing account at the close of each calendar quarter and at... inventories. 19.464 Section 19.464 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE...

  2. 27 CFR 20.144 - Packages of completely denatured alcohol.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Packages of completely denatured alcohol. 20.144 Section 20.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM Sale...

  3. 27 CFR 20.261 - Records of completely denatured alcohol.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Records of completely denatured alcohol. 20.261 Section 20.261 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM...

  4. Unravelling the hydrophobicity of urea in water using thermodiffusion: implications for protein denaturation.

    Science.gov (United States)

    Niether, Doreen; Di Lecce, Silvia; Bresme, Fernando; Wiegand, Simone

    2018-01-03

    Urea is widely used as a protein denaturant in aqueous solutions. Experimental and computer simulation studies have shown that it dissolves in water almost ideally at high concentrations, introducing little disruption in the water hydrogen bonded structure. However, at concentrations of the order of 5 M or higher, urea induces denaturation in a wide range of proteins. The origin of this behaviour is not completely understood, but it is believed to stem from a balance between urea-protein and urea-water interactions, with urea becoming possibly hydrophobic at a specific concentration range. The small changes observed in the water structure make it difficult to connect the denaturation effects to the solvation properties. Here we show that the exquisite sensitivity of thermodiffusion to solute-water interactions allows the identification of the onset of hydrophobicity of urea-water mixtures. The hydrophobic behaviour is reflected in a sign reversal of the temperature dependent slope of the Soret coefficient, which is observed, both in experiments and non-equilibrium computer simulations at ∼5 M concentration of urea in water. This concentration regime corresponds to the one where abrupt changes in the denaturation of proteins are commonly observed. We show that the onset of hydrophobicity is intrinsically connected to the urea-water interactions. Our results allow us to identify correlations between the Soret coefficient and the partition coefficient, log P, hence establishing the thermodiffusion technique as a powerful approach to study hydrophobicity.

  5. Mesoscopic modeling of DNA denaturation rates: Sequence dependence and experimental comparison

    Energy Technology Data Exchange (ETDEWEB)

    Dahlen, Oda, E-mail: oda.dahlen@ntnu.no; Erp, Titus S. van, E-mail: titus.van.erp@ntnu.no [Department of Chemistry, Norwegian University of Science and Technology (NTNU), Høgskoleringen 5, Realfagbygget D3-117 7491 Trondheim (Norway)

    2015-06-21

    Using rare event simulation techniques, we calculated DNA denaturation rate constants for a range of sequences and temperatures for the Peyrard-Bishop-Dauxois (PBD) model with two different parameter sets. We studied a larger variety of sequences compared to previous studies that only consider DNA homopolymers and DNA sequences containing an equal amount of weak AT- and strong GC-base pairs. Our results show that, contrary to previous findings, an even distribution of the strong GC-base pairs does not always result in the fastest possible denaturation. In addition, we applied an adaptation of the PBD model to study hairpin denaturation for which experimental data are available. This is the first quantitative study in which dynamical results from the mesoscopic PBD model have been compared with experiments. Our results show that present parameterized models, although giving good results regarding thermodynamic properties, overestimate denaturation rates by orders of magnitude. We believe that our dynamical approach is, therefore, an important tool for verifying DNA models and for developing next generation models that have higher predictive power than present ones.

  6. Guanidinium-Induced Denaturation by Breaking of Salt Bridges.

    Science.gov (United States)

    Meuzelaar, Heleen; Panman, Matthijs R; Woutersen, Sander

    2015-12-07

    Despite its wide use as a denaturant, the mechanism by which guanidinium (Gdm(+) ) induces protein unfolding remains largely unclear. Herein, we show evidence that Gdm(+) can induce denaturation by disrupting salt bridges that stabilize the folded conformation. We study the Gdm(+) -induced denaturation of a series of peptides containing Arg/Glu and Lys/Glu salt bridges that either stabilize or destabilize the folded conformation. The peptides containing stabilizing salt bridges are found to be denatured much more efficiently by Gdm(+) than the peptides containing destabilizing salt bridges. Complementary 2D-infrared measurements suggest a denaturation mechanism in which Gdm(+) binds to side-chain carboxylate groups involved in salt bridges. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

    Science.gov (United States)

    Madadelahi, M.; Kalan, K.; Shamloo, A.

    2018-05-01

    Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

  8. Enhancement of DNA polymerase activity in potato tuber slices

    International Nuclear Information System (INIS)

    Watanabe, Akira; Imaseki, Hidemasa

    1977-01-01

    DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)

  9. Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, N.

    1999-02-12

    Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

  10. The expanding polymerase universe.

    Science.gov (United States)

    Goodman, M F; Tippin, B

    2000-11-01

    Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

  11. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  12. Effect of heating strategies on whey protein denaturation--Revisited by liquid chromatography quadrupole time-of-flight mass spectrometry.

    Science.gov (United States)

    Akkerman, M; Rauh, V M; Christensen, M; Johansen, L B; Hammershøj, M; Larsen, L B

    2016-01-01

    Previous standards in the area of effect of heat treatment processes on milk protein denaturation were based primarily on laboratory-scale analysis and determination of denaturation degrees by, for example, electrophoresis. In this study, whey protein denaturation was revisited by pilot-scale heating strategies and liquid chromatography quadrupole time-of-flight mass spectrometer (LC/MC Q-TOF) analysis. Skim milk was heat treated by the use of 3 heating strategies, namely plate heat exchanger (PHE), tubular heat exchanger (THE), and direct steam injection (DSI), under various heating temperatures (T) and holding times. The effect of heating strategy on the degree of denaturation of β-lactoglobulin and α-lactalbumin was determined using LC/MC Q-TOF of pH 4.5-soluble whey proteins. Furthermore, effect of heating strategy on the rennet-induced coagulation properties was studied by oscillatory rheometry. In addition, rennet-induced coagulation of heat-treated micellar casein concentrate subjected to PHE was studied. For skim milk, the whey protein denaturation increased significantly as T and holding time increased, regardless of heating method. High denaturation degrees were obtained for T >100°C using PHE and THE, whereas DSI resulted in significantly lower denaturation degrees, compared with PHE and THE. Rennet coagulation properties were impaired by increased T and holding time regardless of heating method, although DSI resulted in less impairment compared with PHE and THE. No significant difference was found between THE and PHE for effect on rennet coagulation time, whereas the curd firming rate was significantly larger for THE compared with PHE. Micellar casein concentrate possessed improved rennet coagulation properties compared with skim milk receiving equal heat treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Light water reactors with a denatured thorium fuel cycle

    International Nuclear Information System (INIS)

    1978-05-01

    Discussed in this paper is the performance of denatured thorium fuel cycles in PWR plants of conventional design, such as those currently in operation or under construction. Although some improvement in U 3 O 8 utilization is anticipated in PWRs optimized explicitly for the denatured thorium fuel cycle, this paper is limited to a discussion of the performance of denatured thorium fuels in conventional PWRs and consequently the data presented is representative of the use of thorium fuel in existing PWRs or those presently under construction. In subsequent sections of this paper, the design of the PWR, its performance on the denatured thorium fuel cycle, safety, accident and environmental considerations, and technological status and R and D requirements are discussed

  14. Ion-ion interactions in the denatured state contribute to the stabilization of CutA1 proteins.

    Science.gov (United States)

    Yutani, Katsuhide; Matsuura, Yoshinori; Naitow, Hisashi; Joti, Yasumasa

    2018-05-16

    In order to elucidate features of the denatured state ensembles that exist in equilibrium with the native state under physiological conditions, we performed 1.4-μs molecular dynamics (MD) simulations at 400 K and 450 K using the monomer subunits of three CutA1 mutants from Escherichia coli: an SH-free mutant (Ec0SH) with denaturation temperature (T d ) = 85.6 °C, a hydrophobic mutant (Ec0VV) with T d  = 113.3 °C, and an ionic mutant (Ec0VV_6) with T d  = 136.8 °C. The occupancy of salt bridges by the six substituted charged residues in Ec0VV_6 was 140.1% at 300 K and 89.5% at 450 K, indicating that even in the denatured state, salt bridge occupancy was high, approximately 60% of that at 300 K. From these results, we can infer that proteins from hyperthermophiles with a high ratio of charged residues are stabilized by a decrease in conformational entropy due to ion-ion interactions in the denatured state. The mechanism must be comparable to the stabilization conferred by disulfide bonds within a protein. This suggests that introduction of charged residues, to promote formation of salt bridges in the denatured state, would be a simple way to rationally design stability-enhanced mutants.

  15. Effective non-denaturing purification method for improving the solubility of recombinant actin-binding proteins produced by bacterial expression.

    Science.gov (United States)

    Chung, Jeong Min; Lee, Sangmin; Jung, Hyun Suk

    2017-05-01

    Bacterial expression is commonly used to produce recombinant and truncated mutant eukaryotic proteins. However, heterologous protein expression may render synthesized proteins insoluble. The conventional method used to express a poorly soluble protein, which involves denaturation and refolding, is time-consuming and inefficient. There are several non-denaturing approaches that can increase the solubility of recombinant proteins that include using different bacterial cell strains, altering the time of induction, lowering the incubation temperature, and employing different detergents for purification. In this study, we compared several non-denaturing protocols to express and purify two insoluble 34 kDa actin-bundling protein mutants. The solubility of the mutant proteins was not affected by any of the approaches except for treatment with the detergent sarkosyl. These results indicate that sarkosyl can effectively improve the solubility of insoluble proteins during bacterial expression. Copyright © 2016. Published by Elsevier Inc.

  16. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi

    2010-01-01

    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  17. Effects of high pressure freezing (HPF) on denaturation of natural actomyosin extracted from prawn (Metapenaeus ensis).

    Science.gov (United States)

    Cheng, Lina; Sun, Da-Wen; Zhu, Zhiwei; Zhang, Zhihang

    2017-08-15

    Effects of protein denaturation caused by high pressure freezing, involving Pressure-Factors (pressure, time) and Freezing-Factors (temperature, phase transition, recrystallization, ice crystal types), are complicated. In the current study, the conformation and functional changes of natural actomyosin (NAM) under pressure assisted freezing (PAF, 100,150,300,400,500MPa P -20°C/25min ), pressure shift freezing (PSF, 200MPa P -20°C/25min ), and immersion freezing ( 0.1MPa P -20°C/5min ) after pressure was released to 0.1MPa, as compared to normal immersion freezing process (IF, 0.1MPa P -20°C/30min ). Results indicated that PSF ( 200MPa P -20°C/30min ) could reduce the denaturation of frozen NAM and a pressure of 300MPa was the critical point to induce such a denaturation. During the periods of B→D in PSF or B→C→D in PAF, the generation and growth of ice crystals played an important role on changing the secondary and tertiary structure of the treated NAM. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Equilibrium unfolding of A. niger RNase: pH dependence of chemical and thermal denaturation.

    Science.gov (United States)

    Kumar, Gundampati Ravi; Sharma, Anurag; Kumari, Moni; Jagannadham, Medicherla V; Debnath, Mira

    2011-08-01

    Equilibrium unfolding of A. niger RNase with chemical denaturants, for example GuHCl and urea, and thermal unfolding have been studied as a function of pH using fluorescence, far-UV, near-UV, and absorbance spectroscopy. Because of their ability to affect electrostatic interactions, pH and chemical denaturants have a marked effect on the stability, structure, and function of many globular proteins. ANS binding studies have been conducted to enable understanding of the folding mechanism of the protein in the presence of the denaturants. Spectroscopic studies by absorbance, fluorescence, and circular dichroism and use of K2D software revealed that the enzyme has α + β type secondary structure with approximately 29% α-helix, 24% β-sheet, and 47% random coil. Under neutral conditions the enzyme is stable in urea whereas GuHCl-induced equilibrium unfolding was cooperative. A. niger RNase has little ANS binding even under neutral conditions. Multiple intermediates were populated during the pH-induced unfolding of A. niger RNase. Urea and temperature-induced unfolding of A. niger RNase into the molten globule-like state is non-cooperative, in contrast to the cooperativity seen with the native protein, suggesting the presence of two parts/domains, in the molecular structure of A. niger RNase, with different stability that unfolds in steps. Interestingly, the GuHCl-induced unfolding of the A state (molten globule state) of A. niger RNase is unique, because a low concentration of denaturant not only induces structural change but also facilitates transition from one molten globule like state (A(MG1)) into another (I(MG2)).

  19. Thermal stability of chemically denatured green fluorescent protein (GFP) A preliminary study

    Energy Technology Data Exchange (ETDEWEB)

    Nagy, Attila; Malnasi-Csizmadia, Andras; Somogyi, Bela; Lorinczy, Denes

    2004-02-09

    Green fluorescent protein (GFP) is a light emitter in the bioluminescence reaction of the jellyfish Aequorea victoria. The protein consist of 238 amino acids and produces green fluorescent light ({lambda}{sub max}=508 nm), when irradiated with near ultraviolet light. The fluorescence is due to the presence of chromophore consisting of an imidazolone ring, formed by a post-translational modification of the tripeptide -Ser{sup 65}-Tyr{sup 66}-Gly{sup 67}-, which buried into {beta}-barrel. GFP is extremely compact and heat stable molecule. In this work, we present data for the effect of chemical denaturing agent on the thermal stability of GFP. When denaturing agent is applied, global thermal stability and the melting point of the molecule is decreases, that can be monitored with differential scanning calorimetry. The results indicate, that in 1-6 M range of GuHCl the melting temperature is decreasing continuously from 83 to 38 deg. C. Interesting finding, that the calculated calorimetric enthalpy decreases with GuHCl concentration up to 3 M (5.6-0.2 kJ mol{sup -1}), but at 4 M it jumps to 8.4 and at greater concentration it is falling down to 1.1 kJ mol{sup -1}. First phenomena, i.e. the decrease of melting point with increasing GuHCl concentration can be easily explained by the effect of the extended chemical denaturation, when less and less amount of heat required to diminish the remaining hydrogen bonds in {beta}-barrel. The surprising increase of calorimetric enthalpy at 4 M concentration of GuHCl could be the consequence of a dimerization or a formation of stable complex between GFP and denaturing agent as well as a precipitation at an extreme GuHCl concentration. We are planning further experiments to elucidate fluorescent consequence of these processes.

  20. A study of the thermal denaturation of the S-layer protein from Lactobacillus salivarius

    Science.gov (United States)

    Lighezan, Liliana; Georgieva, Ralitsa; Neagu, Adrian

    2012-09-01

    Surface layer (S-layer) proteins display an intrinsic self-assembly property, forming monomolecular crystalline arrays, identified in outermost structures of the cell envelope in many organisms, such as bacteria and archaea. Isolated S-layer proteins also possess the ability to recrystallize into regular lattices, being used in biotechnological applications, such as controlling the architecture of biomimetic surfaces. To this end, the stability of the S-layer proteins under high-temperature conditions is very important. In this study, the S-layer protein has been isolated from Lactobacillus salivarius 16 strain of human origin, and purified by cation-exchange chromatography. Using circular dichroism (CD) spectroscopy, we have investigated the thermal denaturation of the S-layer protein. The far- and near-UV CD spectra have been collected, and the temperature dependence of the CD signal in these spectral domains has been analyzed. The variable temperature results show that the secondary and tertiary structures of the S-layer protein change irreversibly due to the heating of the sample. After the cooling of the heated protein, the secondary and tertiary structures are partially recovered. The denaturation curves show that the protein unfolding depends on the sample concentration and on the heating rate. The secondary and tertiary structures of the protein suffer changes in the same temperature range. We have also detected an intermediate state in the protein denaturation pathway. Our results on the thermal behavior of the S-layer protein may be important for the use of S-layer proteins in biotechnological applications, as well as for a better understanding of the structure and function of S-layer proteins.

  1. The effect of Na+ and K+ on the thermal denaturation of Na+ and + K+-dependent ATPase.

    Science.gov (United States)

    Fischer, T H

    1983-01-01

    To increase our understanding of the physical nature of the Na+ and K+ forms of the Na+ + K+-dependent ATPase, thermal-denaturation studies were conducted in different types of ionic media. Thermal-denaturation measurements were performed by measuring the regeneration of ATPase activity after slow pulse exposure to elevated temperatures. Two types of experiments were performed. First, the dependence of the thermal-denaturation rate on Na+ and K+ concentrations was examined. It was found that both cations stabilized the pump protein. Also, K+ was a more effective stabilizer of the native state than was Na+. Secondly, a set of thermodynamic parameters was obtained by measuring the temperature-dependence of the thermal-denaturation rate under three ionic conditions: 60 mM-K+, 150 mM-Na+ and no Na+ or K+. It was found that ion-mediated stabilization of the pump protein was accompanied by substantial increases in activation enthalpy and entropy, the net effect being a less-pronounced increase in activation free energy. PMID:6309139

  2. Heavy water reactors on the denatured thorium cycles

    International Nuclear Information System (INIS)

    1978-05-01

    This paper presents preliminary technical and economic data to INFCE on the denatured U-233/Thorium fuel cycle for use in early comparisons of alternate nuclear systems. The once-through uranium fuel cycle is discussed in a companion paper. In presenting this preliminary information at this time, it is recognized that there are several other denatured thorium fuel cycles of potential interest, such as the U-235/thorium cycle which could be implemented at an earlier date. Information on these alternate cycles is currently being developed, and will be provided to INFCE when available

  3. On the radioimmunological determination of native and heat denaturated protein

    International Nuclear Information System (INIS)

    Menzel, E.J.; Glatz, F.; Technische Univ., Vienna

    1981-01-01

    Precipitation radioimmunoassay, solid phase radioimmunoassay and passive hemagglutination were examined for their efficiency in the determination of native or denaturated soy proteins. Native as well as autoclaved soy protein could be determined quantitatively in the precipitation radioimmunoassay, using antisera directed against the native product. In the solid phase technique only the autoclaved soy protein could be detected with high sensitivity. In the passive hemagglutination reaction, no agglutination could be observed with erythrocytes coated with autoclaved soy protein. Only antisera against the denaturated (autoclaved) soy protein agglutinated these erythrocytes. (orig.) [de

  4. α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Olivier Martínez

    Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

  5. Denaturation of membrane proteins and hyperthermic cell killing

    NARCIS (Netherlands)

    Burgman, Paulus Wilhelmus Johannes Jozef

    1993-01-01

    Summarizing: heat induced denaturation of membrane proteins is probably related to hyperthermic cell killing. Induced resistance of heat sensitive proteins seems to be involved in the development of thermotolerance. Although many questions remain still to be answered, it appears that HSP72, when

  6. Role of cyclobutane dimers in UV-denaturation of DNA

    International Nuclear Information System (INIS)

    Zavil'gel'skij, G.B.; Zuev, A.V.

    1978-01-01

    UV irradiation of double-stranded DNA produces local denatured regions. The evidence presented indicates that these single-stranded regions arise from photoproducts other than pyrimidine dimers. The irradiation of T2 DNA at 8x10 4 erg/mm 2 (254 nm) produces 6-8% thymine dimers, amd Tsub(mel) drops by 12-14 deg C, accompanied by a significant broadening of the transition profile. The kinetics of denatured region formation and lowering Tsub(mel) corresponds to that of formation of crosslinkages and differs markedly from the kinetics of formation of cyclobutane pyrimidine dimers. Treatment of UV-irradiated DNA with light in the presence of yeast photoreactivating enzyme monomerizes almost all thymine dimers but does not change the Tsub(mel). Local denatured regions are detected in UV-irradiated DNA and are absent from AcPhM-sensibilized DNA, which contains 20-25% thymine dimers, as determined by the accridine orange fluorescence technique. S1 nuclease from Aspergillis oryzae produces single-strand breaks in UV-irradiated DNA of phage PM2 but is not active on AcPhM-treated PM2 DNA, which contains about 50 thymine dimers. It is supposed that the formation of a cyclobutane dimer only weakens the hydrogen bonds in the AT base pair rather than breaks them. Local denatured regions are thought to arise from the accumulation in UV-irradiated DNA (254 nm) of the sufficient number of photoproducts with impaired ability to base pairing

  7. Cold denaturation of the HIV-1 protease monomer

    DEFF Research Database (Denmark)

    Rösner, Heike Ilona; Caldarini, Martina; Prestel, Andreas

    2017-01-01

    The HIV-1-protease is a complex protein which in its active form adopts a homodimer dominated by -sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1-protease which is populated above 0ºC and therefore directly accessible to various spectroscopic approac...

  8. Evaluation of denaturing gradient gel electrophoresis (DGGE) used ...

    African Journals Online (AJOL)

    Denaturing gradient gel electrophoresis (DGGE) is a powerful method used to study structure of bacterial communities, without cultivation, based on the diversity of the genes coding for ribosomal RNA. However, the results are strongly dependent on the respective target region of the used primer systems. Therefore, three ...

  9. [Denaturation of egg antigens by cooking].

    Science.gov (United States)

    Watanabe, Hiroko; Akaboshi, Chie; Sekido, Haruko; Tanaka, Kouki; Tanaka, Kazuko; Shimojo, Naoki

    2012-01-01

    Changes in egg protein contents by cooking were measured with an ELISA kit using Tris-HCl buffer in model foods including cake, meatballs, pasta and pudding made with whole egg, egg-white and egg-yolk. The egg protein contents were lowest in the deep-fried model foods of cakes and meatballs. Ovalbumin (OVA) was undetectable (meatballs, suggesting that processing temperature and uniform heat-treatment affect the detection of egg protein. Furthermore, egg protein contents were below 6 µg/g in the pouched meatballs and pasta made with egg-yolk, and OVA and OVM were not detected by Western blotting analysis with human IgE from patients' serum. On the other hand, processed egg proteins were detected with an ELISA kit using a surfactant and reductant in the extract buffer.

  10. Pressure-assisted cold denaturation of hen egg white lysozyme: the influence of co-solvents probed by hydrogen exchange nuclear magnetic resonance.

    Science.gov (United States)

    Vogtt, K; Winter, R

    2005-08-01

    COSY proton nuclear magnetic resonance was used to measure the exchange rates of amide protons of hen egg white lysozyme (HEWL) in the pressure-assisted cold-denatured state and in the heat-denatured state. After dissolving lysozyme in deuterium oxide buffer, labile protons exchange for deuterons in such a way that exposed protons are substituted rapidly, whereas "protected" protons within structured parts of the protein are substituted slowly. The exchange rates k obs were determined for HEWL under heat treatment (80 degrees C) and under high pressure conditions at low temperature (3.75 kbar, -13 degrees C). Moreover, the influence of co-solvents (sorbitol, urea) on the exchange rate was examined under pressure-assisted cold denaturation conditions, and the corresponding protection factors, P, were determined. The exchange kinetics upon heat treatment was found to be a two-step process with initial slow exchange followed by a fast one, showing residual protection in the slow-exchange state and P-factors in the random-coil-like range for the final temperature-denatured state. Addition of sorbitol (500 mM) led to an increase of P-factors for the pressure-assisted cold denatured state, but not for the heat-denatured state. The presence of 2 M urea resulted in a drastic decrease of the P-factors of the pressure-assisted cold denatured state. For both types of co-solvents, the effect they exert appears to be cooperative, i.e., no particular regions within the protein can be identified with significantly diverse changes of P-factors.

  11. Pressure-assisted cold denaturation of hen egg white lysozyme: the influence of co-solvents probed by hydrogen exchange nuclear magnetic resonance

    Directory of Open Access Journals (Sweden)

    K. Vogtt

    2005-08-01

    Full Text Available COSY proton nuclear magnetic resonance was used to measure the exchange rates of amide protons of hen egg white lysozyme (HEWL in the pressure-assisted cold-denatured state and in the heat-denatured state. After dissolving lysozyme in deuterium oxide buffer, labile protons exchange for deuterons in such a way that exposed protons are substituted rapidly, whereas "protected" protons within structured parts of the protein are substituted slowly. The exchange rates k obs were determined for HEWL under heat treatment (80ºC and under high pressure conditions at low temperature (3.75 kbar, -13ºC. Moreover, the influence of co-solvents (sorbitol, urea on the exchange rate was examined under pressure-assisted cold denaturation conditions, and the corresponding protection factors, P, were determined. The exchange kinetics upon heat treatment was found to be a two-step process with initial slow exchange followed by a fast one, showing residual protection in the slow-exchange state and P-factors in the random-coil-like range for the final temperature-denatured state. Addition of sorbitol (500 mM led to an increase of P-factors for the pressure-assisted cold denatured state, but not for the heat-denatured state. The presence of 2 M urea resulted in a drastic decrease of the P-factors of the pressure-assisted cold denatured state. For both types of co-solvents, the effect they exert appears to be cooperative, i.e., no particular regions within the protein can be identified with significantly diverse changes of P-factors.

  12. Heat capacity changes in RNA folding: application of perturbation theory to hammerhead ribozyme cold denaturation.

    Science.gov (United States)

    Mikulecky, Peter J; Feig, Andrew L

    2004-01-01

    In proteins, empirical correlations have shown that changes in heat capacity (DeltaC(P)) scale linearly with the hydrophobic surface area buried upon folding. The influence of DeltaC(P) on RNA folding has been widely overlooked and is poorly understood. In addition to considerations of solvent reorganization, electrostatic effects might contribute to DeltaC(P)s of folding in polyanionic species such as RNAs. Here, we employ a perturbation method based on electrostatic theory to probe the hot and cold denaturation behavior of the hammerhead ribozyme. This treatment avoids much of the error associated with imposing two-state folding models on non-two-state systems. Ribozyme stability is perturbed across a matrix of solvent conditions by varying the concentration of NaCl and methanol co-solvent. Temperature-dependent unfolding is then monitored by circular dichroism spectroscopy. The resulting array of unfolding transitions can be used to calculate a DeltaC(P) of folding that accurately predicts the observed cold denaturation temperature. We confirm the accuracy of the calculated DeltaC(P) by using isothermal titration calorimetry, and also demonstrate a methanol-dependence of the DeltaC(P). We weigh the strengths and limitations of this method for determining DeltaC(P) values. Finally, we discuss the data in light of the physical origins of the DeltaC(P)s for RNA folding and consider their impact on biological function.

  13. Thermally multiplexed polymerase chain reaction.

    Science.gov (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  14. Spectral shift controlled reactors, denatured U-233/thorium cycle

    International Nuclear Information System (INIS)

    1978-05-01

    This paper presents technical and economic data on the SSCR which may be of use in the International Fuel Cycle Evaluation Program to intercompare alternative nuclear systems. Included in this paper are data on the denatured U-233/thorium cycle. This cycle shows a proliferation advantage over more classical thorium fuel cycle (e.g., highly-enriched U-235/thorium or plutonium/thorium) due to the elimination of chemically-separable, concentrated fissile material from unirradiated nuclear fuel. The U-233 is denatured by mixing with depleted uranium to a concentration no greater than 12 w/o. An exogenous source of U-233 is assumed in this paper, since U-233 does not occur in nature and only a limited supply has been produced to date for research and development work

  15. Vibrational energy relaxation: proposed pathway of fast local chromatin denaturation

    International Nuclear Information System (INIS)

    Harder, D.; Greinert, R.

    2002-01-01

    The molecular mechanism responsible for the a component of exchange-type chromosome aberrations, of chromosome fragmentation and of reproductive cell death is one of the unsolved issues of radiation biology. Under review is whether vibrational energy relaxation in the constitutive biopolymers of chromatin, induced by inelastic energy deposition events and mediated via highly excited vibrational states, may provide a pathway of fast local chromatin denaturation, thereby producing the severe DNA lesion able to interact chemically with other, non-damaged chromatin. (author)

  16. Glutamate Induced Thermal Equilibrium Intermediate and Counteracting Effect on Chemical Denaturation of Proteins.

    Science.gov (United States)

    Anumalla, Bramhini; Prabhu, N Prakash

    2018-01-25

    When organisms are subjected to stress conditions, one of their adaptive responses is accumulation of small organic molecules called osmolytes. These osmolytes affect the structure and stability of the biological macromolecules including proteins. The present study examines the effect of a negatively charged amino acid osmolyte, glutamate (Glu), on two model proteins, ribonuclease A (RNase A) and α-lactalbumin (α-LA), which have positive and negative surface charges at pH 7, respectively. These proteins follow two-state unfolding transitions during both heat and chemical induced denaturation processes. The addition of Glu stabilizes the proteins against temperature and induces an early equilibrium intermediate during unfolding. The stability is found to be enthalpy-driven, and the free energy of stabilization is more for α-LA compared to RNase A. The decrease in the partial molar volume and compressibility of both of the proteins in the presence of Glu suggests that the proteins attain a more compact state through surface hydration which could provide a more stable conformation. This is also supported by molecule dynamic simulation studies which demonstrate that the water density around the proteins is increased upon the addition of Glu. Further, the intermediates could be completely destabilized by lower concentrations (∼0.5 M) of guanidinium chloride and salt. However, urea subverts the Glu-induced intermediate formed by α-LA, whereas it only slightly destabilizes in the case of RNase A which has a positive surface charge and could possess charge-charge interactions with Glu. This suggests that, apart from hydration, columbic interactions might also contribute to the stability of the intermediate. Gdm-induced denaturation of RNase A and α-LA in the absence and the presence of Glu at different temperatures was carried out. These results also show the Glu-induced stabilization of both of the proteins; however, all of the unfolding transitions followed two

  17. Preparation of denatured protein bone sterilized with gamma radiation

    International Nuclear Information System (INIS)

    Luna Z, D.

    2005-01-01

    The bone is one of the tissues more transplanted in the entire world by that the bone necessity for transplant every day becomes bigger. In the Bank of tissues Radio sterilized of the ININ the amnion and the pig skin are routinely processed. The tissue with which will be continued is with bone. Due to that in our country it doesn't have enough bone of human origin for the necessities required in the bone transplant, an option is the bone of bovine. Of this bone one can obtain denatured protein bone, with the same characteristics of the denatured protein human bone, the one which has been proven that it has good acceptance and incorporation in the human body when is transplanted. The method for the obtaining of the denatured protein bone of bovine, with the confirmation of the final product by means of X-ray diffraction is described. The radiosterilization of this bone with gamma rays and the determination of the lead content. (Author)

  18. Monomorphism in humans and sequence differences among higher primates for a sequence tagged site (STS) in homeo box cluster 2 as assayed by denaturing gradient electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Ruano, G.; Ruddle, F.H.; Kidd, K.K. (Yale Univ., New Haven, CT (United States)); Gray, M.R. (Tufts Univ., Boston, MA (United States)); Miki, Tetsuro (Osaka Univ. (Japan)); Ferguson-Smith, A.C. (Inst. of Animal Physiology and Genetics Research, Cambridge (United Kingdom))

    1990-03-11

    The human homeo box cluster 2 (HOX2) contains genes coding for DNA binding proteins involved in developmental control and is highly conserved between mouse and man. The authors have applied in concert the Polymerase Chain Reaction (PCR) and Denaturing Gradient Electrophoresis (DGE) to amplify defined primate HOX2 segments and to detect sequence differences among them. They have sequenced a PstI fragment 4 kb upstream from HOX 2.2 and synthesized primers delimiting both halves of 630 bp segment within it PCR on various unrelated humans and SC-PCR on chimpanzee, gorilla, orangutan and gibbon yielded products of the same length for each primer pair.

  19. Membrane bridging and hemifusion by denaturated Munc18.

    Directory of Open Access Journals (Sweden)

    Yi Xu

    Full Text Available Neuronal Munc18-1 and members of the Sec1/Munc18 (SM protein family play a critical function(s in intracellular membrane fusion together with SNARE proteins, but the mechanism of action of SM proteins remains highly enigmatic. During experiments designed to address this question employing a 7-nitrobenz-2-oxa-1,3-diazole (NBD fluorescence de-quenching assay that is widely used to study lipid mixing between reconstituted proteoliposomes, we observed that Munc18-1 from squid (sMunc18-1 was able to increase the apparent NBD fluorescence emission intensity even in the absence of SNARE proteins. Fluorescence emission scans and dynamic light scattering experiments show that this phenomenon arises at least in part from increased light scattering due to sMunc18-1-induced liposome clustering. Nuclear magnetic resonance and circular dichroism data suggest that, although native sMunc18-1 does not bind significantly to lipids, sMunc18-1 denaturation at 37 °C leads to insertion into membranes. The liposome clustering activity of sMunc18-1 can thus be attributed to its ability to bridge two membranes upon (perhaps partial denaturation; correspondingly, this activity is hindered by addition of glycerol. Cryo-electron microscopy shows that liposome clusters induced by sMunc18-1 include extended interfaces where the bilayers of two liposomes come into very close proximity, and clear hemifusion diaphragms. Although the physiological relevance of our results is uncertain, they emphasize the necessity of complementing fluorescence de-quenching assays with alternative experiments in studies of membrane fusion, as well as the importance of considering the potential effects of protein denaturation. In addition, our data suggest a novel mechanism of membrane hemifusion induced by amphipathic macromolecules that does not involve formation of a stalk intermediate.

  20. Strategies for denaturing the weapons-grade plutonium stockpile

    International Nuclear Information System (INIS)

    Buckner, M.R.; Parks, P.B.

    1992-10-01

    In the next few years, approximately 50 metric tons of weapons-grade plutonium and 150 metric tons of highly-enriched uranium (HEU) may be removed from nuclear weapons in the US and declared excess. These materials represent a significant energy resource that could substantially contribute to our national energy requirements. HEU can be used as fuel in naval reactors, or diluted with depleted uranium for use as fuel in commercial reactors. This paper proposes to use the weapons-grade plutonium as fuel in light water reactors. The first such reactor would demonstrate the dual objectives of producing electrical power and denaturing the plutonium to prevent use in nuclear weapons

  1. A Proposed Mechanism for the Thermal Denaturation of a Recombinant Bacillus Halmapalus Alpha-amylase - the Effect of Calcium Ions

    Science.gov (United States)

    Nielsen, Anders D.; Pusey, Marc L.; Fuglsang, Claus C.; Westh, Peter

    2003-01-01

    The thermal stability of a recombinant alpha-amylase from Bacillus halmapalus alpha-amylase (BHA) has been investigated using circular dichroism spectroscopy (CD) and differential scanning calorimetry (DSC). This alpha-amylase is homologous to other Bacillus alpha-amylases where previous crystallographic studies have identified the existence of 3 calcium binding sites in the structure. Denaturation of BHA is irreversible with a Tm of approximately 89 C, and DSC thermograms can be described using a one-step irreversible model. A 5 C increase in T(sub m) in the presence of 10 fold excess CaCl2 was observed. However, a concomitant increase in the tendency to aggregate was also observed. The presence of 30-40 fold excess calcium chelator (EDTA or EGTA) results in a large destabilization of BHA corresponding to about 40 C lower T(sub m), as determined by both CD and DSC. Ten fold excess EGTA reveals complex DSC thermograms corresponding to both reversible and irreversible transitions, which possibly originate from different populations of BHA:calcium complexes. The observations in the present study have, in combination with structural information of homologous alpha-amylases, provided the basis for the proposal of a simple denaturation mechanism of BHA. The proposed mechanism describes the irreversible thermal denaturation of different BHA:calcium complexes and the calcium binding equilibrium involved. Furthermore, the model accounts for a temperature induced reversible structural change associated with calcium binding.

  2. Protective role of salt in catalysis and maintaining structure of halophilic proteins against denaturation

    Science.gov (United States)

    Sinha, Rajeshwari; Khare, Sunil K.

    2014-01-01

    Search for new industrial enzymes having novel properties continues to be a desirable pursuit in enzyme research. The halophilic organisms inhabiting under saline/ hypersaline conditions are considered as promising source of useful enzymes. Their enzymes are structurally adapted to perform efficient catalysis under saline environment wherein n0n-halophilic enzymes often lose their structure and activity. Haloenzymes have been documented to be polyextremophilic and withstand high temperature, pH, organic solvents, and chaotropic agents. However, this stability is modulated by salt. Although vast amount of information have been generated on salt mediated protection and structure function relationship in halophilic proteins, their clear understanding and correct perspective still remain incoherent. Furthermore, understanding their protein architecture may give better clue for engineering stable enzymes which can withstand harsh industrial conditions. The article encompasses the current level of understanding about haloadaptations and analyzes structural basis of their enzyme stability against classical denaturants. PMID:24782853

  3. U.S. leans toward denatured thorium cycle

    International Nuclear Information System (INIS)

    Smock, R.

    1977-01-01

    Denatured thorium appears to be the most promising among the nonproliferating alternatives to the plutonium cycle, which the Carter Administration is trying to cancel. Criteria for a better system include uranium utilization comparable to current light water reactors and minimal separation of fissile material into the waste stream. Comparisons with other systems conclude that thorium is preferable because it can lead to an acceptable fast breeder. The thorium cycle can be placed in energy centers for sensitive facilities and can also be introduced into ongoing light water systems. Reprocessing can be handled in the centers, where thorium can be mixed with plutonium for use in reactors within the center, while light water reactors operate on the outside. Any fuel leaving the center would be unsuitable for weapons. Later adaptation to in-center fast breeders will extend energy supplies, although a thorium breeder will be less efficient than a plutonium fast breeder. Denatured thorium is a technical answer to a complex political problem, but those in the nuclear industry see the U.S. goal of a nonproliferating fuel as futile in the light of world politics and breeder efforts in other countries

  4. Acetic acid denaturing pulsed field capillary electrophoresis for RNA separation.

    Science.gov (United States)

    Li, Zhenqing; Dou, Xiaoming; Ni, Yi; Sumitomo, Keiko; Yamaguchi, Yoshinori

    2010-10-01

    Based on our previous work of in-capillary denaturing polymer electrophoresis, we present a study of RNA molecular separation up to 6.0 kilo nucleotide by pulsed field CE. This is the first systematic investigation of electrophoresis of a larger molecular mass RNA in linear hydroxyethylcellulose (HEC) under pulsed field conditions. The parameters that may influence the separation performance, e.g. gel polymer concentration, modulation depth and pulse frequency, are analyzed in terms of resolution and mobility. For denaturing and separating RNA in the capillary simultaneously, 2 M acetic acid was added into the HEC polymer to serve as separation buffer. Result shows that (i) in pulsed field conditions, RNA separation can be achieved in a wide range of concentration of HEC polymer, and RNA fragments between 0.3 and 0.6 kilo nucleotide are sensitive to the polymer concentration; (ii) under certain pulsed field conditions, RNA fragments move linearly as the modulation depth increases; (iii) 12.5 Hz is the resonance frequency for RNA reorientation time and applied frequency.

  5. Thermal, chemical and pH induced unfolding of turmeric root lectin: modes of denaturation.

    Directory of Open Access Journals (Sweden)

    Himadri Biswas

    Full Text Available Curcuma longa rhizome lectin, of non-seed origin having antifungal, antibacterial and α-glucosidase inhibitory activities, forms a homodimer with high thermal stability as well as acid tolerance. Size exclusion chromatography and dynamic light scattering show it to be a dimer at pH 7, but it converts to a monomer near pH 2. Circular dichroism spectra and fluorescence emission maxima are virtually indistinguishable from pH 7 to 2, indicating secondary and tertiary structures remain the same in dimer and monomer within experimental error. The tryptophan environment as probed by acrylamide quenching data yielded very similar data at pH 2 and pH 7, implying very similar folding for monomer and dimer. Differential scanning calorimetry shows a transition at 350.3 K for dimer and at 327.0 K for monomer. Thermal unfolding and chemical unfolding induced by guanidinium chloride for dimer are both reversible and can be described by two-state models. The temperatures and the denaturant concentrations at which one-half of the protein molecules are unfolded, are protein concentration-dependent for dimer but protein concentration-independent for monomer. The free energy of unfolding at 298 K was found to be 5.23 Kcal mol-1 and 14.90 Kcal mol-1 for the monomer and dimer respectively. The value of change in excess heat capacity upon protein denaturation (ΔCp is 3.42 Kcal mol-1 K-1 for dimer. The small ΔCp for unfolding of CLA reflects a buried hydrophobic core in the folded dimeric protein. These unfolding experiments, temperature dependent circular dichroism and dynamic light scattering for the dimer at pH 7 indicate its higher stability than for the monomer at pH 2. This difference in stability of dimeric and monomeric forms highlights the contribution of inter-subunit interactions in the former.

  6. Denaturation/Renaturation of Organophosphorus Acid Anhydrolase (OPAA) Using Guanidinium Hydrochloride and Urea

    National Research Council Canada - National Science Library

    Ong, K. K; Sun, Z; Cheng, T. C; Wei, Y; Yuan, J. M; Yin, R

    2004-01-01

    .... Using organophosphorus acid anhydrolase (OPAA) as the model protein, a guanidinium hydrochloride and urea denaturation/renaturation study was conducted and measured both optically and enzymatically...

  7. Denaturation/Renaturation of Organophosphorus Acid Anhydrolase (OPAA) Using Guanidinium Hydrochloride and Urea

    National Research Council Canada - National Science Library

    Ong, K. K; Sun, Z; Cheng, T. C; Wei, Y; Yuan, J. M; Yin, R

    2004-01-01

    ...; thereby indicating conformational changes. Similar results were obtained with circular dichroism as the peak representing the alpha-helix conformation decreased as denaturant concentration was increased...

  8. Visualization of early events in acetic acid denaturation of HIV-1 protease: a molecular dynamics study.

    Directory of Open Access Journals (Sweden)

    Aditi Narendra Borkar

    Full Text Available Protein denaturation plays a crucial role in cellular processes. In this study, denaturation of HIV-1 Protease (PR was investigated by all-atom MD simulations in explicit solvent. The PR dimer and monomer were simulated separately in 9 M acetic acid (9 M AcOH solution and water to study the denaturation process of PR in acetic acid environment. Direct visualization of the denaturation dynamics that is readily available from such simulations has been presented. Our simulations in 9 M AcOH reveal that the PR denaturation begins by separation of dimer into intact monomers and it is only after this separation that the monomer units start denaturing. The denaturation of the monomers is flagged off by the loss of crucial interactions between the α-helix at C-terminal and surrounding β-strands. This causes the structure to transit from the equilibrium dynamics to random non-equilibrating dynamics. Residence time calculations indicate that denaturation occurs via direct interaction of the acetic acid molecules with certain regions of the protein in 9 M AcOH. All these observations have helped to decipher a picture of the early events in acetic acid denaturation of PR and have illustrated that the α-helix and the β-sheet at the C-terminus of a native and functional PR dimer should maintain both the stability and the function of the enzyme and thus present newer targets for blocking PR function.

  9. Protein Denaturation on p-T Axes--Thermodynamics and Analysis.

    Science.gov (United States)

    Smeller, László

    2015-01-01

    Proteins are essential players in the vast majority of molecular level life processes. Since their structure is in most cases substantial for their correct function, study of their structural changes attracted great interest in the past decades. The three dimensional structure of proteins is influenced by several factors including temperature, pH, presence of chaotropic and cosmotropic agents, or presence of denaturants. Although pressure is an equally important thermodynamic parameter as temperature, pressure studies are considerably less frequent in the literature, probably due to the technical difficulties associated to the pressure studies. Although the first steps in the high-pressure protein study have been done 100 years ago with Bridgman's ground breaking work, the field was silent until the modern spectroscopic techniques allowed the characterization of the protein structural changes, while the protein was under pressure. Recently a number of proteins were studied under pressure, and complete pressure-temperature phase diagrams were determined for several of them. This review summarizes the thermodynamic background of the typical elliptic p-T phase diagram, its limitations and the possible reasons for deviations of the experimental diagrams from the theoretical one. Finally we show some examples of experimentally determined pressure-temperature phase diagrams.

  10. INTERACTION OF IRON(II MIXED-LIGAND COMPLEXES WITH DNA: BASE-PAIR SPECIFICITY AND THERMAL DENATURATION STUDIES

    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir

    2010-06-01

    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  11. A Novel Low Temperature PCR Assured High-Fidelity DNA Amplification

    Directory of Open Access Journals (Sweden)

    Shaoxia Zhou

    2013-06-01

    Full Text Available As previously reported, a novel low temperature (LoTemp polymerase chain reaction (PCR catalyzed by a moderately heat-resistant (MHR DNA polymerase with a chemical-assisted denaturation temperature set at 85 °C instead of the conventional 94–96 °C can achieve high-fidelity DNA amplification of a target DNA, even after up to 120 PCR thermal cycles. Furthermore, such accurate amplification is not achievable with conventional PCR. Now, using a well-recognized L1 gene segment of the human papillomavirus (HPV type 52 (HPV-52 as the template for experiments, we demonstrate that the LoTemp high-fidelity DNA amplification is attributed to an unusually high processivity and stability of the MHR DNA polymerase whose high fidelity in template-directed DNA synthesis is independent of non-existent 3'–5' exonuclease activity. Further studies and understanding of the characteristics of the LoTemp PCR technology may facilitate implementation of DNA sequencing-based diagnostics at the point of care in community hospital laboratories.

  12. Uranium production in thorium/denatured uranium fueled PWRs

    International Nuclear Information System (INIS)

    Arthur, W.B.

    1977-01-01

    Uranium-232 buildup in a thorium/denatured uranium fueled pressurized water reactor, PWR(Th), was studied using a modified version of the spectrum-dependent zero dimensional depletion code, LEOPARD. The generic Combustion Engineering System 80 reactor design was selected as the reactor model for the calculations. Reactors fueled with either enriched natural uranium and self-generated recycled uranium or uranium from a thorium breeder and self-generated recycled uranium were considered. For enriched natural uranium, concentrations of 232 U varied from about 135 ppM ( 232 U/U weight basis) in the zeroth generation to about 260 ppM ( 232 U/U weight basis) at the end of the fifth generation. For the case in which thorium breeder fuel (with its relatively high 232 U concentration) was used as reactor makeup fuel, concentrations of 232 U varied from 441 ppM ( 232 U/U weight basis) at discharge from the first generation to about 512 ppM ( 232 U/U weight basis) at the end of the fifth generation. Concentrations in freshly fabricated fuel for this later case were 20 to 35% higher than the discharge concentration. These concentrations are low when compared to those of other thorium fueled reactor types (HTGR and MSBR) because of the relatively high 238 U concentration added to the fuel as a denaturant. Excellent agreement was found between calculated and existing experimental values. Nevertheless, caution is urged in the use of these values because experimental results are very limited, and the relevant nuclear data, especially for 231 Pa and 232 U, are not of high quality

  13. The generation of denatured reactor plutonium by different options of the fuel cycle

    Energy Technology Data Exchange (ETDEWEB)

    Broeders, C.H.M.; Kessler, G. [Inst. for Neutron Physics and Reactor Technology, Research Center Karlsruhe (Germany)

    2006-11-15

    Denatured (proliferation resistant) reactor plutonium can be generated in a number of different fuel cycle options. First denatured reactor plutonium can be obtained if, instead of low enriched U-235 PWR fuel, re-enriched U-235/U-236 from reprocessed uranium is used (fuel type A). Also the envisaged existing 2,500 t of reactor plutonium (being generated world wide up to the year 2010), mostly stored in intermediate fuel storage facilities at present, could be converted during a transition phase into denatured reactor plutonium by the options fuel type B and D. Denatured reactor plutonium could have the same safeguards standard as present low enriched (<20% U-235) LWR fuel. It could be incinerated by recycling once or twice in PWRs and subsequently by multi-recycling in FRs (CAPRA type or IFRs). Once denatured, such reactor plutonium could remain denatured during multiple recycling. In a PWR, e.g., denatured reactor plutonium could be destroyed at a rate of about 250 kg/GWey. While denatured reactor plutonium could be recycled and incinerated under relieved IAEA safeguards, neptunium would still have to be monitored by the IAEA in future for all cases in which considerable amounts of neptunium are produced. (orig.)

  14. 27 CFR 20.148 - Manufacture of articles with completely denatured alcohol.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Manufacture of articles with completely denatured alcohol. 20.148 Section 20.148 Alcohol, Tobacco Products and Firearms ALCOHOL... ALCOHOL AND RUM Sale and Use of Completely Denatured Alcohol § 20.148 Manufacture of articles with...

  15. Dynamic and structural study of neocarzinostatin native and denatured states, by differential microcalorimetry, optical spectroscopies and X-ray and neutron scattering

    International Nuclear Information System (INIS)

    Russo, Daniela

    2000-01-01

    A structural and dynamic characterization of proteins denatured states is essential to the understanding of mechanisms which control proteins folding. It is in this framework that this study has been undertaken in taking as model the neocarzinostatin globular protein. It is formed with seven cell-layers which form a barrel pattern maintained by two bi-sulfur bonds. A full characterization of native and denatured states, both from structural and dynamic point of view, has been implemented with several techniques able to bring data at different levels. During the experiments, ncs has been stabilized by temperature and by the use of a chaotropic agent: the guanidinium chloride (gdmcl). Small angle x-ray and neutron scattering have allowed us to obtain data on the variation of the protein compactness in terms of gdmcl temperature and concentration. The diffusion spectra show that ncs loses completely its globular structure above 80 C or in presence of about 5 m of gdmcl. Temperature and concentration of half denaturation are tm= 70 C and cm=3.5 m (in heavy water), respectively. Spectra analysis of strongly denatured protein has allowed us to obtain values of its chain length and of its persistence length which are in agreement with those theoretically estimated. Experiments have been carried out too to measure the radius of gyration to zero concentration and the second virial coefficient of the solution in order to estimate the interactions between the molecules. A full characterization has been performed in terms of gdmcl temperature and concentration by fluorescence and circular dichroism. These two techniques reveal the variations of the local three-dimensional structure and secondary structure of the protein respectively. Microcalorimetry measurements have shown that thermal denaturation of ncs is completely reversible and has been used to measure the enthalpy variation during the transition. At last, it has been possible to study ncs intramolecular dynamics in

  16. Insight into the effect mechanism of urea-induced protein denaturation by dielectric spectroscopy.

    Science.gov (United States)

    Zhang, Cancan; Yang, Man; Zhao, Kongshuang

    2017-12-06

    Dielectric relaxation spectroscopy was applied to study how urea affects the phase transition of a thermosensitive polymer, poly(N-isopropylacrylamide) (PNIPAM), which has been widely used as a protein model. It was found that there is a pronounced relaxation near 10 GHz for the ternary system of PNIPAM in urea aqueous solution. The temperature dependence of dielectric parameters indicates that urea can reduce the lower critical solution temperature (LCST) of PNIPAM, i.e., stabilize the globule state of PNIPAM and collapse the PNIPAM chains. Based on our results, the interaction mechanism of urea on the conformational transition of PNIPAM was presented: urea replaces water molecules directly bonding with PNIPAM and acts as the bridging agent for the adjacent side chains of PNIPAM. Accordingly, the mechanism with which urea denatures protein was deduced. In addition, it is worth mentioning that, from the temperature dependence of the dielectric parameters obtained in the presence of urea, an interesting phenomenon was found in which the effect of urea on PNIPAM seems to take 2 M as a unit. This result may be the reason why urea and TMAO exit marine fishes at a specific ratio of 2 : 1.

  17. Cation-Induced Stabilization and Denaturation of DNA Origami Nanostructures in Urea and Guanidinium Chloride.

    Science.gov (United States)

    Ramakrishnan, Saminathan; Krainer, Georg; Grundmeier, Guido; Schlierf, Michael; Keller, Adrian

    2017-11-01

    The stability of DNA origami nanostructures under various environmental conditions constitutes an important issue in numerous applications, including drug delivery, molecular sensing, and single-molecule biophysics. Here, the effect of Na + and Mg 2+ concentrations on DNA origami stability is investigated in the presence of urea and guanidinium chloride (GdmCl), two strong denaturants commonly employed in protein folding studies. While increasing concentrations of both cations stabilize the DNA origami nanostructures against urea denaturation, they are found to promote DNA origami denaturation by GdmCl. These inverse behaviors are rationalized by a salting-out of Gdm + to the hydrophobic DNA base stack. The effect of cation-induced DNA origami denaturation by GdmCl deserves consideration in the design of single-molecule studies and may potentially be exploited in future applications such as selective denaturation for purification purposes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Interim assessment of the denatured 233U fuel cycle: feasibility and nonproliferation characteristics

    International Nuclear Information System (INIS)

    Abbott, L.S.; Bartine, D.E.; Burns, T.J.

    1979-12-01

    A fuel cycle that employs 233 U denatured with 238 U and mixed with thorium fertile material is examined with respect to its proliferation-resistance characteristics and its technical and economic feasibility. The rationale for considering the denatured 233 U fuel cycle is presented, and the impact of the denatured fuel on the performance of Light-Water Reactors, Spectral-Shift-Controlled Reactors, Gas-Cooled Reactors, Heavy-Water Reactors, and Fast Breeder Reactors is discussed. The scope of the R, D and D programs to commercialize these reactors and their associated fuel cycles is also summarized and the resource requirements and economics of denatured 233 U cycles are compared to those of the conventional Pu/U cycle. In addition, several nuclear power systems that employ denatured 233 U fuel and are based on the energy center concept are evaluated

  19. Use of anionic denaturing detergents to purify insoluble proteins after overexpression

    Directory of Open Access Journals (Sweden)

    Schlager Benjamin

    2012-12-01

    Full Text Available Background Many proteins form insoluble protein aggregates, called “inclusion bodies”, when overexpressed in E. coli. This is the biggest obstacle in biotechnology. Ever since the reversible denaturation of proteins by chaotropic agents such as urea or guanidinium hydrochloride had been shown, these compounds were predominantly used to dissolve inclusion bodies. Other denaturants exist but have received much less attention in protein purification. While the anionic, denaturing detergent sodiumdodecylsulphate (SDS is used extensively in analytical SDS-PAGE, it has rarely been used in preparative purification. Results Here we present a simple and versatile method to purify insoluble, hexahistidine-tagged proteins under denaturing conditions. It is based on dissolution of overexpressing bacterial cells in a buffer containing sodiumdodecylsulfate (SDS and whole-lysate denaturation of proteins. The excess of detergent is removed by cooling and centrifugation prior to affinity purification. Host- and overexpressed proteins do not co-precipitate with SDS and the residual concentration of detergent is compatible with affinity purification on Ni/NTA resin. We show that SDS can be replaced with another ionic detergent, Sarkosyl, during purification. Key advantages over denaturing purification in urea or guanidinium are speed, ease of use, low cost of denaturant and the compatibility of buffers with automated FPLC. Conclusion Ionic, denaturing detergents are useful in breaking the solubility barrier, a major obstacle in biotechnology. The method we present yields detergent-denatured protein. Methods to refold proteins from a detergent denatured state are known and therefore we propose that the procedure presented herein will be of general application in biotechnology.

  20. Programmable self-assembly of carbon nanotubes assisted by reversible denaturation of a protein

    International Nuclear Information System (INIS)

    Nithiyasri, P; Parthasarathy, M; Balaji, K; Brindha, P

    2012-01-01

    Self-assembly of pristine multi-walled carbon nanotubes (CNTs) in aqueous dispersion using a protein, bovine serum albumin (BSA), has been demonstrated. Step-wise conformational changes in BSA as a function of temperature have been deployed to direct the assembly of nanotubes. More specifically, CNTs distributed randomly in native BSA at 35 °C as well as completely denatured BSA solution at 80 °C self-assemble in the intermediate temperature range of 45–65 °C, as evident from scanning and transmission electron microscopy. Fourier transform infrared (FTIR) and fluorescence studies indicate significant changes in the α-helical content of the protein with respect to the amide I and II bands and tryptophan emission intensity, respectively. The stability of CNT dispersion in BSA solution has been attributed to the hydrophobic interaction between nanotubes and the protein molecule by adding sodium cholate to the dispersion. Moreover, a mechanism based on electrostatic repulsion between BSA-bound CNTs has been proposed for the thermally reversible assembly of CNTs in BSA solution based on evidence from zeta potential measurements and FTIR spectroscopy. Thus the present report demonstrates bio-mimetic self-assembly of as-synthesized CNTs using changes in surface charge and conformation of an unfolding protein for biomedical applications and nanobiotechnology. (paper)

  1. Renaturation of the androgen receptor after denaturation in SDS

    International Nuclear Information System (INIS)

    Johnson, M.P.; Young, C.Y.F.; Rowley, D.R.; Tindall, D.J.

    1986-01-01

    Renaturation of the steroid binding activity of receptor proteins is a potentially useful tool for their purification and analysis. Cytosol was prepared from rat Dunning prostate tumor in buffer containing molybdate and then denatured by addition of SDS buffer and heating. Aliquots were precipitated in cold acetone and the resulting pellets were washed and solubilized with a small volume of solution containing a chaotropic agent such as 6M guanidine, 8M urea, or 5M sodium iodide. After a 20-minute incubation, samples were diluted 20-fold with buffer containing 4nM [ 3 H]dihydrotestosterone with or without excess unlabeled dihydrotestosterone. Diluted samples were incubated at 0 0 C for varying periods of time prior to assay of bound radioactivity using hydroxylapatite. A time-course of renaturation after exposure to guanidine showed a steady increase of specific binding activity during the first 7 hrs post-dilution that remained stable up to 22 hrs. Experiments with guanidine consistently demonstrated that 25-50% of binding activity was recoverable. Preliminary results using urea or sodium iodide were similar. Efforts to optimize recovery and to characterize the renatured androgen receptor are in progress

  2. 27 CFR 19.41 - Claims on spirits, denatured spirits, articles, or wines lost or destroyed in bond.

    Science.gov (United States)

    2010-04-01

    ..., denatured spirits, articles, or wines lost or destroyed in bond. 19.41 Section 19.41 Alcohol, Tobacco... DISTILLED SPIRITS PLANTS Taxes Claims § 19.41 Claims on spirits, denatured spirits, articles, or wines lost..., relating to the destruction or loss of spirits, denatured spirits, articles, or wines in bond, shall be...

  3. Advancing Polymerase Ribozymes Towards Self-Replication

    Science.gov (United States)

    Tjhung, K. F.; Joyce, G. F.

    2017-07-01

    Autocatalytic replication and evolution in vitro by (i) a cross-chiral RNA polymerase catalyzing polymerization of mononucleotides of the opposite handedness; (ii) non-covalent assembly of component fragments of an existing RNA polymerase ribozyme.

  4. Mutation screening of the TP53 gene by temporal temperature gradient gel electrophoresis.

    Science.gov (United States)

    Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise

    2005-01-01

    A protocol for detection of mutations in the TP53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques denaturing gradient gel electrophoresis (DGGE) and constant denaturant gel electrophoresis (CDGE) and eliminates some of the problems. The result is a rapid and sensitive screening technique that is robust and easily set up in smaller laboratory environments.

  5. Mutation screening of the TP53 gene by temporal temperature gel electrophoresis (TTGE).

    Science.gov (United States)

    Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise

    2014-01-01

    A protocol for detection of mutations in the TP53 gene using temporal temperature gradient electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques, denaturing gradient gel electrophoresis and constant denaturant gel electrophoresis, and eliminates some of the problems. The result is a rapid and sensitive screening technique which is robust and easily set up in smaller laboratory environments.

  6. DNA polymerase I is required for premeiotic DNA replication and sporulation but not for X-ray repair in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.

    1989-01-01

    We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I

  7. Studying pressure denaturation of a protein by molecular dynamics simulations.

    Science.gov (United States)

    Sarupria, Sapna; Ghosh, Tuhin; García, Angel E; Garde, Shekhar

    2010-05-15

    Many globular proteins unfold when subjected to several kilobars of hydrostatic pressure. This "unfolding-up-on-squeezing" is counter-intuitive in that one expects mechanical compression of proteins with increasing pressure. Molecular simulations have the potential to provide fundamental understanding of pressure effects on proteins. However, the slow kinetics of unfolding, especially at high pressures, eliminates the possibility of its direct observation by molecular dynamics (MD) simulations. Motivated by experimental results-that pressure denatured states are water-swollen, and theoretical results-that water transfer into hydrophobic contacts becomes favorable with increasing pressure, we employ a water insertion method to generate unfolded states of the protein Staphylococcal Nuclease (Snase). Structural characteristics of these unfolded states-their water-swollen nature, retention of secondary structure, and overall compactness-mimic those observed in experiments. Using conformations of folded and unfolded states, we calculate their partial molar volumes in MD simulations and estimate the pressure-dependent free energy of unfolding. The volume of unfolding of Snase is negative (approximately -60 mL/mol at 1 bar) and is relatively insensitive to pressure, leading to its unfolding in the pressure range of 1500-2000 bars. Interestingly, once the protein is sufficiently water swollen, the partial molar volume of the protein appears to be insensitive to further conformational expansion or unfolding. Specifically, water-swollen structures with relatively low radii of gyration have partial molar volume that are similar to that of significantly more unfolded states. We find that the compressibility change on unfolding is negligible, consistent with experiments. We also analyze hydration shell fluctuations to comment on the hydration contributions to protein compressibility. Our study demonstrates the utility of molecular simulations in estimating volumetric properties

  8. DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.

    1987-06-01

    Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.

  9. How Chain Length and Charge Affect Surfactant Denaturation of Acyl Coenzyme A Binding Protein (ACBP)

    DEFF Research Database (Denmark)

    Andersen, Kell Kleiner; Otzen, Daniel

    2009-01-01

    maltoside (DDM). The aim has been to determine how surfactant chain length and micellar charge affect the denaturation mechanism. ACBP denatures in two steps irrespective of surfactant chain length, but with increasing chain length, the potency of the denaturant rises more rapidly than the critical micelle......Using intrinsic tryptophan fluorescence, equilibria and kinetics of unfolding of acyl coenzyme A binding protein (ACBP) have been investigated in sodium alkyl sulfate surfactants of different chain length (8-16 carbon atoms) and with different proportions of the nonionic surfactant dodecyl...... constants increases linearly with denaturant concentration below the cmc but declines at higher concentrations. Both shortening chain length and decreasing micellar charge reduce the overall kinetics of unfolding and makes the dependence of unfolding rate constants on surfactant concentration more complex...

  10. On the Use of Potential Denaturing Agents for Ethanol in Direct Ethanol Fuel Cells

    Directory of Open Access Journals (Sweden)

    Domnik Bayer

    2011-01-01

    Full Text Available Acidic or alkaline direct ethanol fuel cells (DEFCs can be a sustainable alternative for power generation if they are fuelled with bio-ethanol. However, in order to keep the fuel cheap, ethanol has to be exempted from tax on spirits by denaturing. In this investigation the potential denaturing agents fusel oil, tert-butyl ethyl ether, and Bitrex were tested with regard to their compatibility with fuel cells. Experiments were carried out both in sulphuric acid and potassium hydroxide solution. Beside, basic electrochemical tests, differential electrochemical mass spectrometry (DEMS and fuel cell tests were conducted. It was found that fusel oil is not suitable as denaturing agent for DEFC. However, tert-butyl ethyl ether does not seem to hinder the ethanol conversion as much. Finally, a mixture of tert-butyl ethyl ether and Bitrex can be proposed as promising candidate as denaturing agent for use in acidic and alkaline DEFC.

  11. Evidence of β-sheet structure induced kinetic stability of papain upon thermal and sodium dodecyl sulphate denaturation

    Directory of Open Access Journals (Sweden)

    Rašković Brankica

    2015-01-01

    Full Text Available Papain is a protease that consists of α-helical and β-sheet domains which unfold almost independently. Both, papain considerable thermal stability and sodium dodecyl sulphate (SDS resistance have been shown. However, the ability of each domain to unfold upon thermal and SDS denaturation has never been studied. This work shows that fruit papain has slightly higher thermal inactivation resistance when it is compared to stem papain with rather high activation energy (Ea of 223 ± 16 kJmol-1 and Tm50 value of 79 ± 2 °C. SDS resistance of fruit papain was estimated by SDS-PAGE analysis and activity staining. It has been noted that, in the presence of SDS, unless heat energy was applied in order to unfold papain, the protein remained active. Furthermore, it has been proven via Fourier transform infrared spectroscopy (FT-IR that α-helical domain of fruit papain is more prone to unfolding at elevated temperatures and in the presence of SDS then β-sheet rich domain. Thermal denaturation of papain without detergent present led to accelerated formation of aggregation specific intermolecular β-sheets as compared to native protein. Presented results are both, of fundamental and application importance. [Projekat Ministarstva nauke Republike Srbije, br. 172049

  12. The expression and proangiogenic effect of nucleolin during the recovery of heat-denatured HUVECs.

    Science.gov (United States)

    Liang, Pengfei; Jiang, Bimei; Lv, Chunliu; Huang, Xu; Sun, Li; Zhang, Pihong; Huang, Xiaoyuan

    2013-10-01

    The present study aims to examine the expression patterns and roles of nucleolin during the recovery of heat-denatured human umbilical vein endothelial cells (HUVECs). Deep partial thickness burn model in Sprague-Dawley rats and the heat denatured cell model (52°C, 35s) were used. The expression of nucleolin was measured using Western blot analysis and real-time PCR. Angiogenesis was assessed using in vitro parameters including endothelial cell proliferation, transwell migration assay, and scratched wound healing. Gene transfection and RNA interference approaches were employed to investigate the roles of nucleolin. Nucleolin mRNA and protein expression showed a time-dependent increase during the recovery of heat-denatured dermis and HUVECs. Heat-denaturation time-dependently promoted cell growth, adhesion, migration, scratched wound healing and formation of tube-like structures in HUVECs. These effects of heat denaturation on endothelial wound healing and formation of tube-like structures were prevented by knockdown of nucleolin, whereas over-expression of nucleolin increased cell growth, migration, and formation of tube-like structures in cultured HUVEC endothelial cells. In addition, we found that the expression of vascular endothelial growth factor (VEGF) increased during the recovery of heat-denatured dermis and HUVECs, and nucleolin up-regulated VEGF in HUVECs. The present study reveals that the expression of nucleolin is up-regulated, and plays a pro-angiogenic role during the recovery of heat-denatured dermis and its mechanism is probably dependent on production of VEGF. We find a novel and important pro-angiogenic role of nucleolin during the recovery of heat-denatured dermis. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. On the Use of Potential Denaturing Agents for Ethanol in Direct Ethanol Fuel Cells

    OpenAIRE

    Domnik Bayer; Florina Jung; Birgit Kintzel; Martin Joos; Carsten Cremers; Dierk Martin; Jörg Bernard; Jens Tübke

    2011-01-01

    Acidic or alkaline direct ethanol fuel cells (DEFCs) can be a sustainable alternative for power generation if they are fuelled with bio-ethanol. However, in order to keep the fuel cheap, ethanol has to be exempted from tax on spirits by denaturing. In this investigation the potential denaturing agents fusel oil, tert-butyl ethyl ether, and Bitrex were tested with regard to their compatibility with fuel cells. Experiments were carried out both in sulphuric acid and potassium hydroxide solution...

  14. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.

    OpenAIRE

    Noll, W W; Collins, M

    1987-01-01

    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

  15. Bacteria community study of combined periodontal-endodontic lesions using denaturing gradient gel electrophoresis and sequencing analysis.

    Science.gov (United States)

    Li, Hong; Guan, Rui; Sun, Jinghua; Hou, Benxiang

    2014-10-01

    The entire microbial population and predominant microflora of root canals (RCs) and adjacent periodontal pockets (PPs) from teeth with combined periodontal-endodontic lesions were determined and compared. Pooled RC and PP samples were collected from the molars of 20 patients diagnosed with combined periodontal-endodontic lesions. DNA was extracted for polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE), cloning, and sequence analysis. A coefficient of similarity (Cs) was used to determine the similarity of the bacterial profiles from RCs and PPs. Significantly fewer bands were produced by PCR-DGGE from RCs (5.9 ± 1.7) than from PPs (8.0 ± 1.8) (P bacteria in both the RC and PP samples were (in descending order) Filifactor alocis, Parvimonas micra, Porphyromonas gingivalis, and Tannerella forsythia. The high similarity in the sets of organisms present in both RC and PP samples in this study suggests that the pocket could be a source of RC infection. The data also demonstrate that combined periodontal-endodontic lesions consist of a diverse and complex microbial community.

  16. Effect of free cysteine on the denaturation and aggregation of holo α-lactalbumin

    DEFF Research Database (Denmark)

    Nielsen, Line R.; Lund, Marianne N.; Davies, Michael J.

    2018-01-01

    α-Lactalbumin (α-LA) is a key commercial whey protein for nutritional purposes. The holo protein (calcium saturated) is considered the most heat stable whey protein, capable of refolding from unfolded states under many conditions. This is due to the absence of free thiols (cysteine residues......) that are typically involved in thermal aggregation and thiol–disulphide exchange reactions of other whey proteins. Heating (0–120 min at 90 °C, pH 7.0) holo α-LA generates free thiols through thermal cleavage of disulphide bonds, resulting in aggregates comprising unfolded α-LA species. The addition of free cysteine...... promotes the formation of soluble aggregates, effectively decreasing the holding time required to reach a particular aggregate size in a dose-dependent manner (0.35–1.4 mM cysteine). Excess cysteine (≥14 mM) causes a destabilisation of α-LA, shown by decreased denaturation temperature and gel formation...

  17. Interim assessment of the denatured 233U fuel cycle: feasibility and nonproliferation characteristics

    International Nuclear Information System (INIS)

    Abbott, L.S.; Bartine, D.E.; Burns, T.J.

    1978-12-01

    A fuel cycle that employs 233 U denatured with 238 U and mixed with thorium fertile material is examined with respect to its proliferation-resistance characteristics and its technical and economic feasibility. The rationale for considering the denatured 233 U fuel cycle is presented, and the impact of the denatured fuel on the performance of Light-Water Reactors, Spectral-Shift-Controlled Reactors, Gas-Cooled Reactors, Heavy-Water Reactors, and Fast Breeder Reactors is discussed. The scope of the R, D and D programs to commercialize these reactors and their associated fuel cycles is also summarized and the resource requirements and economics of denatured 233 U cycles are compared to those of the conventional Pu/U cycle. In addition, several nuclear power systems that employ denatured 233 U fuel and are based on the energy center concept are evaluated. Under this concept, dispersed power reactors fueled with denatured or low-enriched uranium fuel are supported by secure energy centers in which sensitive activities of the nuclear cycle are performed. These activities include 233 U production by Pu-fueled transmuters (thermal or fast reactors) and reprocessing. A summary chapter presents the most significant conclusions from the study and recommends areas for future work

  18. Interim assessment of the denatured /sup 233/U fuel cycle: feasibility and nonproliferation characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Abbott, L.S.; Bartine, D.E.; Burns, T.J. (eds.)

    1978-12-01

    A fuel cycle that employs /sup 233/U denatured with /sup 238/U and mixed with thorium fertile material is examined with respect to its proliferation-resistance characteristics and its technical and economic feasibility. The rationale for considering the denatured /sup 233/U fuel cycle is presented, and the impact of the denatured fuel on the performance of Light-Water Reactors, Spectral-Shift-Controlled Reactors, Gas-Cooled Reactors, Heavy-Water Reactors, and Fast Breeder Reactors is discussed. The scope of the R, D and D programs to commercialize these reactors and their associated fuel cycles is also summarized and the resource requirements and economics of denatured /sup 233/U cycles are compared to those of the conventional Pu/U cycle. In addition, several nuclear power systems that employ denatured /sup 233/U fuel and are based on the energy center concept are evaluated. Under this concept, dispersed power reactors fueled with denatured or low-enriched uranium fuel are supported by secure energy centers in which sensitive activities of the nuclear cycle are performed. These activities include /sup 233/U production by Pu-fueled transmuters (thermal or fast reactors) and reprocessing. A summary chapter presents the most significant conclusions from the study and recommends areas for future work.

  19. Mutation of charged residues to neutral ones accelerates urea denaturation of HP-35.

    Science.gov (United States)

    Wei, Haiyan; Yang, Lijiang; Gao, Yi Qin

    2010-09-16

    Following the studies of urea denaturation of β-hairpins using molecular dynamics, in this paper, molecular dynamics simulations of two peptides, a 35 residue three helix bundle villin headpiece protein HP-35 and its doubly norleucine-substituent mutant (Lys24Nle/Lys29Nle) HP-35 NleNle, were undertaken in urea solutions to understand the molecular mechanism of urea denaturation of α-helices. The mutant HP-35 NleNle was found to denature more easily than the wild type. During the expansion of the small hydrophobic core, water penetration occurs first, followed by that of urea molecules. It was also found that the initial hydration of the peptide backbone is achieved through water hydrogen bonding with the backbone CO groups during the denaturation of both polypeptides. The mutation of the two charged lysine residues to apolar norleucine enhances the accumulation of urea near the hydrophobic core and facilitates the denaturation process. Urea also interacts directly with the peptide backbone as well as side chains, thereby stabilizing nonnative conformations. The mechanism revealed here is consistent with the previous study on secondary structure of β-hairpin polypeptide, GB1, PEPTIDE 1, and TRPZIP4, suggesting that there is a general mechanism in the denaturation of protein backbone hydrogen bonds by urea.

  20. The effects of urea and n-propanol on collagen denaturation: using DSC, circular dicroism and viscosity

    International Nuclear Information System (INIS)

    Usha, R.; Ramasami, T.

    2004-01-01

    The effect of urea and n-propanol on circular dichroism (CD) and viscosity of purified type1 collagen solution at various temperatures and differential scanning calorimetry (DSC) of rat-tail tendon (RTT) collagen fibre have been studied. CD reveals a spectrum with a positive peak at around 220 nm and a negative peak at 200 nm characteristics of collagen triple helix. The molar ellipticity decreases as the concentration of urea increases up to particular concentration (collagen solution treated with 265 μM of urea) and after that it increases (collagen solution treated with 500 μM of urea). There is a linear decrease in molar ellipticity as the concentration of n-propanol increases. Denaturation temperature of urea and n-propanol treated with purified collagen solution has been studied using viscosity method. Additives such as urea and n-propanol decrease the thermal stability of collagen triple helix in solution and in RTT collagen fibre. Thermal helix to coil transition of urea and n-propanol treated collagen depends on the degree of hydration and the concentration of these additives. Thermodynamic parameters such as the peak temperature, enthalpy of activation, and energy of activation for collagen-gelatin transition for native, urea and n-propanol treated RTT collagen fibre has been calculated using DSC. The change in the thermodynamic parameters has been observed for native, urea and n-propanol treated RTT collagen fibres. The experimental results show that the change in the water structure, dehydration and desolvation induced by different additives such as urea and n-propanol on RTT may vary with the type of denaturation

  1. 27 CFR 19.32 - Assessment of tax on spirits, denatured spirits, or wines in bond which are lost, destroyed or...

    Science.gov (United States)

    2010-04-01

    ... spirits, denatured spirits, or wines in bond which are lost, destroyed or removed without authorization... spirits, denatured spirits, or wines in bond which are lost, destroyed or removed without authorization. When spirits, denatured spirits, or wines in bond are lost or destroyed (except spirits, denatured...

  2. Pseudomonas aeruginosa cytochrome c551 denaturation by five systematic urea derivatives that differ in the alkyl chain length.

    Science.gov (United States)

    Kobayashi, Shinya; Fujii, Sotaro; Koga, Aya; Wakai, Satoshi; Matubayasi, Nobuyuki; Sambongi, Yoshihiro

    2017-07-01

    Reversible denaturation of Pseudomonas aeruginosa cytochrome c 551 (PAc 551 ) could be followed using five systematic urea derivatives that differ in the alkyl chain length, i.e. urea, N-methylurea (MU), N-ethylurea (EU), N-propylurea (PU), and N-butylurea (BU). The BU concentration was the lowest required for the PAc 551 denaturation, those of PU, EU, MU, and urea being gradually higher. Furthermore, the accessible surface area difference upon PAc 551 denaturation caused by BU was found to be the highest, those by PU, EU, MU, and urea being gradually lower. These findings indicate that urea derivatives with longer alkyl chains are stronger denaturants. In this study, as many as five systematic urea derivatives could be applied for the reversible denaturation of a single protein, PAc 551 , for the first time, and the effects of the alkyl chain length on protein denaturation were systematically verified by means of thermodynamic parameters.

  3. Phagocytosis by macrophages mediated by receptors for denatured proteins - dependence on tyrosine protein kinases

    Directory of Open Access Journals (Sweden)

    M.R. Hespanhol

    2002-03-01

    Full Text Available Previous studies have demonstrated that some components of the leukocyte cell membrane, CR3 (Mac-1, CD11b/CD18 and p150/95, are able to bind to denatured proteins. Thus, it is of interest to know which effector functions of these cells can be triggered by these receptors when they interact with particles or surfaces covered with denatured proteins. In the present study we analyzed their possible role as mediators of phagocytosis of red cells covered with denatured bovine serum albumin (BSA by mouse peritoneal macrophages. We observed that a macrophages are able to recognize (bind to these red cells, b this interaction can be inhibited by denatured BSA in the fluid phase, c there is no phagocytosis of these particles by normal macrophages, d phagocytosis mediated by denatured BSA can be, however, effectively triggered in inflammatory macrophages induced by glycogen or in macrophages activated in vivo with LPS, and e this phagocytic capacity is strongly dependent on the activity of tyrosine protein kinases in its signal transduction pathway, as demonstrated by using three kinds of enzyme inhibitors (genistein, quercetin and herbimycin A.

  4. Alcohol-induced structural transitions in the acid-denatured Bacillus licheniformis α-amylase

    Directory of Open Access Journals (Sweden)

    Adyani Azizah Abd Halim

    2017-01-01

    Full Text Available Alcohol-induced structural changes in the acid-denatured Bacillus licheniformis α-amylase (BLA at pH 2.0 were studied by far-ultra violet circular dichroism, intrinsic, three-dimensional and 8-anilino-1-naphthalene sulfonic acid (ANS fluorescence, acrylamide quenching and thermal denaturation. All the alcohols used in this study produced partial refolding in the acid-denatured BLA as evident from the increased mean residue ellipticity at 222 nm, increased intrinsic fluorescence and decreased ANS fluorescence. The order of effectiveness of these alcohols to induce a partially folded state of BLA was found to be: 2,2,2-trifluoroethanol/tert-butanol > 1-propanol/2-propanol > 2-chloroethanol > ethanol > methanol. Three-dimensional fluorescence and acrylamide quenching results obtained in the presence of 5.5 M tert-butanol also suggested formation of a partially folded state in the acid-denatured BLA. However, 5.5 M tert-butanol-induced state of BLA showed a non-cooperative thermal transition. All these results suggested formation of a partially folded state of the acid-denatured BLA in the presence of these alcohols. Furthermore, their effectiveness was found to be guided by their chain length, position of methyl groups and presence of the substituents.

  5. Neutronics calculations for denatured molten salt reactors: Assessing resource requirements and proliferation-risk attributes

    International Nuclear Information System (INIS)

    Ahmad, Ali; McClamrock, Edward B.; Glaser, Alexander

    2015-01-01

    Highlights: • We study the proliferation-risk and resource attributes of denatured MSRs. • MSRs offer significantly better resource efficiency compared to light-water reactors. • Denatured single-fluid MSRs reactors offer promising non-proliferation attributes. - Abstract: Molten salt reactors (MSRs) are often advocated as a radical but worthwhile alternative to traditional reactor concepts based on solid fuels. This article builds upon the existing research into MSRs to model and simulate the operation of thorium-fueled single-fluid and two-fluid reactors. The analysis is based on neutronics calculations and focuses on denatured MSR systems. Resource utilization and basic proliferation-risk attributes are compared to those of standard light-water reactors. Depending on specific design choices, even fully denatured reactors could reduce uranium and enrichment requirements by a factor of 3–4. Overall, denatured single-fluid designs appear as the most promising candidate technology minimizing both design complexity and overall proliferation risks despite being somewhat less attractive from the perspective of resource utilization

  6. Effects of sterilization, packaging, and storage on vitamin C degradation, protein denaturation, and glycation in fortified milks.

    Science.gov (United States)

    Gliguem, H; Birlouez-Aragon, I

    2005-03-01

    Monitoring the nutritional quality of dietetic milk throughout its shelf life is particularly important due to the high susceptibility of some vitamins to oxidation, and the continuous development of the Maillard reaction during storage. The objective of this paper was to evaluate the vitamin C content and protein modification by denaturation and glycation on fortified milk samples (growth milks) destined for 1- to 3-yr-old children. The influences of the sterilization process, formulation, packaging, and storage duration at ambient temperature in the dark were studied. Vitamin C degradation was particularly influenced by type of packaging. The use of a 3-layered opaque bottle was associated with complete oxidation of vitamin C after 1 mo of storage, whereas in the 6-layered opaque bottle, which has an oxygen barrier, the vitamin C content slowly decreased to reach 25% of the initial concentration after 4 mo of storage. However, no significant effect of vitamin C degradation during storage could be observed in terms of Maillard reaction, despite the fact that a probable impact occurred during sterilization. Furosine content and the FAST (fluorescence of advanced Maillard products and soluble tryptophan) index-indicators of the early and advanced Maillard reaction, respectively-were significantly higher in the in-bottle sterilized milk samples compared with UHT samples, and in fortified milk samples compared with cow milk. However, after 1 mo, the impact of storage was predominant, increasing the furosine level and the FAST index at similar levels for the differently processed samples. The early Maillard reaction developed continuously throughout the storage period.In conclusion, only packaging comprising an oxygen and light barrier is compatible with vitamin C fortification of milk. Furthermore, short storage time or low storage temperature is needed to retard vitamin C degradation, protein denaturation, and development of the Maillard reaction.

  7. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.

    Science.gov (United States)

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q

    2011-03-01

    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  8. Influence of Temperature on Symbiotic Bacterium Composition in Successive Generations of Egg Parasitoid, Anagrus nilaparvatae

    Directory of Open Access Journals (Sweden)

    Wang Xin

    2016-07-01

    Full Text Available Anagrus nilaparvatae is the dominant egg parasitoid of rice planthoppers and plays an important role in biological control. Symbiotic bacteria can significantly influence the development, survival, reproduction and population differentiation of their hosts. To study the influence of temperature on symbiotic bacterial composition in the successive generations of A. nilaparvatae, A. nilaparvatae were raised under different constant temperatures of 22 °C, 25 °C, 28 °C, 31 °C and 34 °C. Polymerase chain reaction-denaturing gradient gel electrophoresis was used to investigate the diversity of symbiotic bacteria. Our results revealed that the endophytic bacteria of A. nilaparvatae were Pantoea sp., Pseudomonas sp. and some uncultured bacteria. The bacterial community composition in A. nilaparvatae significantly varied among different temperatures and generations, which might be partially caused by temperature, feeding behavior and the physical changes of hosts. However, the analysis of wsp gene showed that the Wolbachia in A. nilaparvatae belonged to group A, sub-group Mors and sub-group Dro. Sub-group Mors was absolutely dominant, and this Wolbachia composition remained stable in different temperatures and generations, except for the 3rd generation under 34 °C during which sub-group Dro became the dominant Wolbachia. The above results suggest that the continuous high temperature of 34 °C can influence the Wolbachia community composition in A. nilaparvatae.

  9. Polymerase Gamma Disease through the Ages

    Science.gov (United States)

    Saneto, Russell P.; Naviaux, Robert K.

    2010-01-01

    The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

  10. DNA Polymerase Fidelity: Beyond Right and Wrong.

    Science.gov (United States)

    Washington, M Todd

    2016-11-01

    Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Nonsurgical Transurethral Radiofrequency Collagen Denaturation: Results at Three Years after Treatment

    Directory of Open Access Journals (Sweden)

    Denise M. Elser

    2011-01-01

    Full Text Available Objective. To assess treatment efficacy and quality of life in women with stress urinary incontinence 3 years after treatment with nonsurgical transurethral radiofrequency collagen denaturation. Methods. This prospective study included 139 women with stress urinary incontinence due to bladder outlet hypermobility. Radiofrequency collagen denaturation was performed using local anesthesia in an office setting. Assessments included incontinence quality of life (I-QOL and urogenital distress inventory (UDI-6 instruments. Results. In total, 139 women were enrolled and 136 women were treated (mean age, 47 years. At 36 months, intent-to-treat analysis (n=139 revealed significant improvements in quality of life. Mean I-QOL score improved 17 points from baseline (P=.0004, while mean UDI-6 score improved (decreased 19 points (P=.0005. Conclusions. Transurethral collagen denaturation is a low-risk, office-based procedure that results in durable quality-of-life improvements in a significant proportion of women for as long as 3 years.

  12. Intrinsic alterations in the partial molar volume on the protein denaturation: surficial Kirkwood-Buff approach.

    Science.gov (United States)

    Yu, Isseki; Takayanagi, Masayoshi; Nagaoka, Masataka

    2009-03-19

    The partial molar volume (PMV) of the protein chymotrypsin inhibitor 2 (CI2) was calculated by all-atom MD simulation. Denatured CI2 showed almost the same average PMV value as that of native CI2. This is consistent with the phenomenological question of the protein volume paradox. Furthermore, using the surficial Kirkwood-Buff approach, spatial distributions of PMV were analyzed as a function of the distance from the CI2 surface. The profiles of the new R-dependent PMV indicate that, in denatured CI2, the reduction in the solvent electrostatic interaction volume is canceled out mainly by an increment in thermal volume in the vicinity of its surface. In addition, the PMV of the denatured CI2 was found to increase in the region in which the number density of water atoms is minimum. These results provide a direct and detailed picture of the mechanism of the protein volume paradox suggested by Chalikian et al.

  13. Denaturing of plutonium by transmutation of minor-actinides for enhancement of proliferation resistance

    International Nuclear Information System (INIS)

    Sagara, Hiroshi; Saito, Masaki; Peryoga, Yoga; Ezoubtchenko, Alexey; Takivayev, Alan

    2005-01-01

    Feasibility study for the plutonium denaturing by utilizing minor-actinide transmutation in light water reactors has been performed. And the intrinsic feature of proliferation resistance of plutonium has been discussed based on IAEA's publication and Kessler's proposal. The analytical results show that not only 238 Pu but also other plutonium isotopes with even-mass-number have very important role for denaturing of plutonium due to their relatively large critical mass and noticeably high spontaneous fission neutron generation. With the change of the minor-actinide doping ratio in U-Pu mix oxide fuel and moderator to fuel ratio, it is found that the reactor-grade plutonium from conventional light water reactors can be denatured to satisfy the proliferation resistance criterion based on the Kessler's proposal but not to be sufficient for the criterion based on IAEA's publication. It has been also confirmed that all the safety coefficients take negative value throughout the irradiation. (author)

  14. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

    International Nuclear Information System (INIS)

    Noll, W.W.; Collins, M.

    1987-01-01

    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases

  15. Distribution, transition and thermodynamic stability of protein conformations in the denaturant-induced unfolding of proteins.

    Science.gov (United States)

    Bian, Liujiao; Ji, Xu

    2014-01-01

    Extensive and intensive studies on the unfolding of proteins require appropriate theoretical model and parameter to clearly illustrate the feature and characteristic of the unfolding system. Over the past several decades, four approaches have been proposed to describe the interaction between proteins and denaturants, but some ambiguity and deviations usually occur in the explanation of the experimental data. In this work, a theoretical model was presented to show the dependency of the residual activity ratio of the proteins on the molar denaturant concentration. Through the characteristic unfolding parameters ki and Δmi in this model, the distribution, transition and thermodynamic stability of protein conformations during the unfolding process can be quantitatively described. This model was tested with the two-state unfolding of bovine heart cytochrome c and the three-state unfolding of hen egg white lysozyme induced by both guanidine hydrochloride and urea, the four-state unfolding of bovine carbonic anhydrase b induced by guanidine hydrochloride and the unfolding of some other proteins induced by denaturants. The results illustrated that this model could be used accurately to reveal the distribution and transition of protein conformations in the presence of different concentrations of denaturants and to evaluate the unfolding tendency and thermodynamic stability of different conformations. In most denaturant-induced unfolding of proteins, the unfolding became increasingly hard in next transition step and the proteins became more unstable as they attained next successive stable conformation. This work presents a useful method for people to study the unfolding of proteins and may be used to describe the unfolding and refolding of other biopolymers induced by denaturants, inducers, etc.

  16. The efficacy of denaturing actinide elements as a means of decreasing materials attractiveness

    Energy Technology Data Exchange (ETDEWEB)

    Hase, K.R.; Bathke, C.G. [Los Alamos National Laboratory: P.O. Box 1663, Los Alamos, NM 87545 (United States); Ebbinghaus, B.B.; Sleaford, B.W.; Robel, M. [Lawrence Livermore National Laboratory: P.O. Box 808, Livermore, CA 94551 (United States); Collins, B.A.; Prichard, A.W. [Pacific Northwest National Laboratory: P.O. Box 999, Richland, WA 99352 (United States)

    2013-07-01

    This study considers the concept of denaturing as applied to the actinide elements present in spent fuel as a means to reduce materials attractiveness. Highly attractive materials generally have low values of bare critical mass, heat content, and dose. To denature an attractive element, its spent-fuel isotopic composition (isotopic vector) is intentionally modified by introducing sufficient quantities of a significantly less attractive isotope to dilute the concentration of a highly attractive isotope so that the overall attractiveness of the element is reduced. The authors used FOM (Figure of Merit) formula as the material attractiveness metric for their parametric determination of the attractiveness of the Pu and U. Materials attractiveness needs to be considered in three distinct phases in the process to construct a nuclear explosive device (NED): the acquisition phase, processing phase, and utilization phase. The results show that denaturing uranium with {sup 238}U is actually an effective means of reducing the attractiveness. For uranium with a large minority of {sup 235}U, a mixture of 80% {sup 238}U to 20% {sup 235}U is required to reduce the attractiveness to low. For uranium with a large concentration of {sup 233}U, a mixture of 88% {sup 238}U to 12% {sup 233}U is required to reduce the attractiveness to low. The results also show that denaturing plutonium with {sup 238}Pu is less effective than denaturing uranium with {sup 238}U. Using {sup 238}Pu as the denaturing agent would require 80% or more by mass in order to reduce the attractiveness to low. No amount of {sup 240}Pu is enough to reduce the plutonium attractiveness below medium. The combination of {sup 238}Pu and {sup 240}Pu would require approximately 70% {sup 238}Pu and 25% {sup 240}Pu by mass to reduce the plutonium attractiveness to low.

  17. The efficacy of denaturing actinide elements as a means of decreasing materials attractiveness

    International Nuclear Information System (INIS)

    Hase, K.R.; Bathke, C.G.; Ebbinghaus, B.B.; Sleaford, B.W.; Robel, M.; Collins, B.A.; Prichard, A.W.

    2013-01-01

    This study considers the concept of denaturing as applied to the actinide elements present in spent fuel as a means to reduce materials attractiveness. Highly attractive materials generally have low values of bare critical mass, heat content, and dose. To denature an attractive element, its spent-fuel isotopic composition (isotopic vector) is intentionally modified by introducing sufficient quantities of a significantly less attractive isotope to dilute the concentration of a highly attractive isotope so that the overall attractiveness of the element is reduced. The authors used FOM (Figure of Merit) formula as the material attractiveness metric for their parametric determination of the attractiveness of the Pu and U. Materials attractiveness needs to be considered in three distinct phases in the process to construct a nuclear explosive device (NED): the acquisition phase, processing phase, and utilization phase. The results show that denaturing uranium with 238 U is actually an effective means of reducing the attractiveness. For uranium with a large minority of 235 U, a mixture of 80% 238 U to 20% 235 U is required to reduce the attractiveness to low. For uranium with a large concentration of 233 U, a mixture of 88% 238 U to 12% 233 U is required to reduce the attractiveness to low. The results also show that denaturing plutonium with 238 Pu is less effective than denaturing uranium with 238 U. Using 238 Pu as the denaturing agent would require 80% or more by mass in order to reduce the attractiveness to low. No amount of 240 Pu is enough to reduce the plutonium attractiveness below medium. The combination of 238 Pu and 240 Pu would require approximately 70% 238 Pu and 25% 240 Pu by mass to reduce the plutonium attractiveness to low

  18. Using fluorescence correlation spectroscopy to study conformational changes in denatured proteins.

    Science.gov (United States)

    Sherman, Eilon; Itkin, Anna; Kuttner, Yosef Yehuda; Rhoades, Elizabeth; Amir, Dan; Haas, Elisha; Haran, Gilad

    2008-06-01

    Fluorescence correlation spectroscopy (FCS) is a sensitive analytical tool that allows dynamics and hydrodynamics of biomolecules to be studied under a broad range of experimental conditions. One application of FCS of current interest is the determination of the size of protein molecules in the various states they sample along their folding reaction coordinate, which can be accessed through the measurement of diffusion coefficients. It has been pointed out that the analysis of FCS curves is prone to artifacts that may lead to erroneous size determination. To set the stage for FCS studies of unfolded proteins, we first show that the diffusion coefficients of small molecules as well as proteins can be determined accurately even in the presence of high concentrations of co-solutes that change the solution refractive index significantly. Indeed, it is found that the Stokes-Einstein relation between the measured diffusion coefficient and solution viscosity holds even in highly concentrated glycerol or guanidinium hydrochloride (GuHCl) solutions. These measurements form the basis for an investigation of the structure of the denatured state of two proteins, the small protein L and the larger, three-domain protein adenylate kinase (AK). FCS is found useful for probing expansion in the denatured state beyond the unfolding transition. It is shown that the denatured state of protein L expands as the denaturant concentration increases, in a process akin to the transition from a globule to a coil in polymers. This process continues at least up to 5 M GuHCl. On the other hand, the denatured state of AK does not seem to expand much beyond 2 M GuHCl, a result that is in qualitative accord with single-molecule fluorescence histograms. Because both the unfolding transition and the coil-globule transition of AK occur at a much lower denaturant concentration than those of protein L, a possible correlation between the two phenomena is suggested.

  19. Induced refolding of a temperature denatured llama heavy-chain antibody fragment by its antigen

    NARCIS (Netherlands)

    Dolk, E.; Vliet, C. van; Perez, J.M.J.; Vriend, G.; Darbon, H.; Ferrat, G.; Cambillau, C.; Frenken, L.G.J.; Verrips, T.

    2005-01-01

    In a previous study we have shown that llama VHH antibody fragments are able to bind their antigen after a heat shock of 90°C, in contrast to the murine monoclonal antibodies. However, the molecular mechanism by which antibody:antigen interaction occurs under these extreme conditions remains

  20. Complement-fixing antibodies against denatured HLA and MICA antigens are associated with antibody mediated rejection.

    Science.gov (United States)

    Cai, Junchao; Terasaki, Paul I; Zhu, Dong; Lachmann, Nils; Schönemann, Constanze; Everly, Matthew J; Qing, Xin

    2016-02-01

    We have found antibodies against denatured HLA class I antigens in the serum of allograft recipients which were not significantly associated with graft failure. It is unknown whether transplant recipients also have denatured HLA class II and MICA antibodies. The effects of denatured HLA class I, class II, and MICA antibodies on long-term graft outcome were further investigated based on their ability to fix complement c1q. In this 4-year retrospective cohort study, post-transplant sera from 975 kidney transplant recipients were tested for antibodies against denatured HLA/MICA antigens and these antibodies were further classified based on their ability to fix c1q. Thirty percent of patients had antibodies against denatured HLA class I, II, or MICA antigens. Among them, 8.5% and 21.5% of all patients had c1q-fixing and non c1q-fixing antibodies respectively. There was no significant difference on graft survival between patients with or without antibodies against denatured HLA/MICA. However, when these antibodies were further classified according to their ability to fix c1q, patients with c1q-fixing antibodies had a significantly lower graft survival rate than patients without antibodies or patients with non c1q-fixing antibodies (p=0.008). In 169 patients who lost renal grafts, 44% of them had c1q-fixing antibodies against denatured HLA/MICA antigens, which was significantly higher than that in patients with functioning renal transplants (25%, pantibodies were more significantly associated with graft failure caused by AMR (72.73%) or mixed AMR/CMR (61.9%) as compared to failure due to CMR (35.3%) or other causes (39.2%) (p=0.026). Transplant recipients had antibodies against denatured HLA class I, II, and MICA antigens. However, only c1q-fixing antibodies were associated with graft failure which was related to antibody mediated rejection. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Role of the polymerase 3 in mutagenesis in the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Zaborowska, D.; Baranowska, H.; Zuk, J.

    1994-01-01

    UV induction of cdc + revertants in thermosensitive cdc2 mutants (polymerase III) in the restrictive conditions (37 C) and after preincubation 4 h in permissive condition (23 C) has showed, that preincubation in permissive temperature, when polymerase III (CDC2 gene) is active, the frequency and mutation yield is lower. In HB75 (cdc2-1/cdc2-1) strain at the restrictive conditions the increase in the frequency of reversion in the meth his and trp mutants was observed after UV treatment. These data suggest, that cdc2 mutants lacked proofreading 3'-5' exonuclease activity besides the polymerase activity. (author). 11 refs, 3 tabs

  2. DNA polymerase preference determines PCR priming efficiency.

    Science.gov (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  3. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.

    Science.gov (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G

    1997-08-01

    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  4. Resistance to DNA denaturation in irradiated Chinese hamster V79 fibroblasts is linked to cell shape

    International Nuclear Information System (INIS)

    Olive, P.L.; Vanderbyl, S.; MacPhail, S.H.

    1991-01-01

    Exponentially growing Chinese hamster V79-171b lung fibroblasts seeded at high density on plastic (approximately 7 x 10(3) cells/cm2) flatten, elongate, and produce significant amounts of extracellular fibronectin. When lysed in weak alkali/high salt, the rate of DNA denaturation following exposure to ionizing radiation is exponential. Conversely, cells plated at low density (approximately 7 x 10(2) cells/cm2) on plastic are more rounded 24 h later, produce little extracellular fibronectin, and display unusual DNA denaturation kinetics after X-irradiation. DNA in these cells resists denaturation, as though constraints to DNA unwinding have developed. Cell doubling time and distribution of cells in the growth cycle are identical for both high and low density cultures as is cell survival in response to radiation damage. The connection between DNA conformation and cell shape was examined further in low density cultures grown in conditioned medium. Under these conditions, cells at low density were able to elongate, and DNA denaturation of low density cultures was identical to that of high density cultures. Conversely, cytochalasin D, which interferes with actin polymerization causing cells to round up and release fibronectin, allowed development of constraints in high density cultures. These results suggest that DNA conformation is sensitive to changes in cell shape which result when cells are grown in different environments. However, these changes in DNA conformation detected by the DNA unwinding assay do not appear to play a direct role in radiation-induced cell killing

  5. 27 CFR 20.178 - Marks and brands on containers of specially denatured spirits.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Marks and brands on... Dealers § 20.178 Marks and brands on containers of specially denatured spirits. (a) Required marks. Each... officer, or (2) Consist of a brand name, or consist of caution notices, or consist of other material...

  6. Isoenergic modification of whey protein structure by denaturation and crosslinking using transglutaminase

    DEFF Research Database (Denmark)

    Stender, Emil G. P.; Koutina, Glykeria; Almdal, Kristoffer

    2018-01-01

    Transglutaminase (TG) catalyzes formation of covalent bonds between lysine and glutamine side chains and has applications in manipulation of food structure. Physical properties of a whey protein mixture (SPC) denatured either at elevated pH or by heat-treatment and followed by TG catalyzed...

  7. [Inactivating Effect of Heat-Denatured Lysozyme on Murine Norovirus in Bread Fillings].

    Science.gov (United States)

    Takahashi, Michiko; Yasuda, Yuka; Takahashi, Hajime; Takeuchi, Akira; Kuda, Takashi; Kimura, Bon

    2018-01-01

    In this study, we investigated the viability of murine norovirus strain 1 (MNV-1), a surrogate for human norovirus, in bread fillings used for making stuffed buns and pastries. The inactivating effect of heat-denatured lysozyme, which was recently reported to have an antiviral effect, on MNV-1 contaminating the bread fillings was also examined. MNV-1 was inoculated into two types of fillings (chocolate cream, marmalade jam) at 4.5 log PFU/g, and the bread fillings were stored at 4℃ for 5 days. MNV-1 remained viable in the bread fillings during storage. However, addition of 1% heat-denatured lysozyme to the fillings resulted in a decrease of MNV-1 infectivity immediately after inoculation, in both fillings. On the fifth day of storage, MNV-1 infectivity was decreased by 1.2 log PFU/g in chocolate cream and by 0.9 log PFU/g in marmalade jam. Although the mechanism underlying the anti-norovirus effect of heat-denatured lysozyme has not been clarified, our results suggest that heat-denatured lysozyme can be used as an inactivating agent against norovirus in bread fillings.

  8. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  9. Comparative analyses of amplicon migration behavior in differing denaturing gradient gel electrophoresis (DGGE) systems

    Science.gov (United States)

    Thornhill, D. J.; Kemp, D. W.; Sampayo, E. M.; Schmidt, G. W.

    2010-03-01

    Denaturing gradient gel electrophoresis (DGGE) is commonly utilized to identify and quantify microbial diversity, but the conditions required for different electrophoretic systems to yield equivalent results and optimal resolution have not been assessed. Herein, the influence of different DGGE system configuration parameters on microbial diversity estimates was tested using Symbiodinium, a group of marine eukaryotic microbes that are important constituents of coral reef ecosystems. To accomplish this, bacterial clone libraries were constructed and sequenced from cultured isolates of Symbiodinium for the ribosomal DNA internal transcribed spacer 2 (ITS2) region. From these, 15 clones were subjected to PCR with a GC clamped primer set for DGGE analyses. Migration behaviors of the resulting amplicons were analyzed using a range of conditions, including variation in the composition of the denaturing gradient, electrophoresis time, and applied voltage. All tests were conducted in parallel on two commercial DGGE systems, a C.B.S. Scientific DGGE-2001, and the Bio-Rad DCode system. In this context, identical nucleotide fragments exhibited differing migration behaviors depending on the model of apparatus utilized, with fragments denaturing at a lower gradient concentration and applied voltage on the Bio-Rad DCode system than on the C.B.S. Scientific DGGE-2001 system. Although equivalent PCR-DGGE profiles could be achieved with both brands of DGGE system, the composition of the denaturing gradient and application of electrophoresis time × voltage must be appropriately optimized to achieve congruent results across platforms.

  10. Urea and Guanidinium Induced Denaturation of a Trp-Cage Miniprotein

    Czech Academy of Sciences Publication Activity Database

    Heyda, Jan; Kožíšek, Milan; Bednárová, Lucie; Thompson, G.; Konvalinka, Jan; Vondrášek, Jiří; Jungwirth, Pavel

    2011-01-01

    Roč. 115, č. 28 (2011), s. 8910-8924 ISSN 1520-6106 R&D Projects: GA MŠk LC512; GA ČR GA203/08/0114 Institutional research plan: CEZ:AV0Z40550506 Keywords : trp-cage denaturation * urea * guanidinium * molecular dynamics Subject RIV: CC - Organic Chemistry Impact factor: 3.696, year: 2011

  11. A Role For Ca 2+ in the Thermal and Urea Denaturation of ...

    African Journals Online (AJOL)

    Giant African snail (Achatina achatina) becomes dormant (aestivate) under harsh environmental conditions like dry seasons. During this period the animal accumulates urea and is faced with thermal death. The stability towards thermal and urea denaturation of haemocyanin from aestivating and nonaestivating A. achatina ...

  12. Kinetic evidence for a two-stage mechanism of protein denaturation by guanidinium chloride.

    Science.gov (United States)

    Jha, Santosh Kumar; Marqusee, Susan

    2014-04-01

    Dry molten globular (DMG) intermediates, an expanded form of the native protein with a dry core, have been observed during denaturant-induced unfolding of many proteins. These observations are counterintuitive because traditional models of chemical denaturation rely on changes in solvent-accessible surface area, and there is no notable change in solvent-accessible surface area during the formation of the DMG. Here we show, using multisite fluorescence resonance energy transfer, far-UV CD, and kinetic thiol-labeling experiments, that the guanidinium chloride (GdmCl)-induced unfolding of RNase H also begins with the formation of the DMG. Population of the DMG occurs within the 5-ms dead time of our measurements. We observe that the size and/or population of the DMG is linearly dependent on [GdmCl], although not as strongly as the second and major step of unfolding, which is accompanied by core solvation and global unfolding. This rapid GdmCl-dependent population of the DMG indicates that GdmCl can interact with the protein before disrupting the hydrophobic core. These results imply that the effect of chemical denaturants cannot be interpreted solely as a disruption of the hydrophobic effect and strongly support recent computational studies, which hypothesize that chemical denaturants first interact directly with the protein surface before completely unfolding the protein in the second step (direct interaction mechanism).

  13. l-Proline and RNA Duplex m-Value Temperature Dependence.

    Science.gov (United States)

    Schwinefus, Jeffrey J; Baka, Nadia L; Modi, Kalpit; Billmeyer, Kaylyn N; Lu, Shutian; Haase, Lucas R; Menssen, Ryan J

    2017-08-03

    The temperature dependence of l-proline interactions with the RNA dodecamer duplex surface exposed after unfolding was quantified using thermal and isothermal titration denaturation monitored by uv-absorbance. The m-value quantifying proline interactions with the RNA duplex surface area exposed after unfolding was measured using RNA duplexes with GC content ranging between 17 and 83%. The m-values from thermal denaturation decreased with increasing GC content signifying increasingly favorable proline interactions with the exposed RNA surface area. However, m-values from isothermal titration denaturation at 25.0 °C were independent of GC content and less negative than those from thermal denaturation. The m-value from isothermal titration denaturation for a 50% GC RNA duplex decreased (became more negative) as the temperature increased and was in nearly exact agreement with the m-value from thermal denaturation. Since RNA duplex transition temperatures increased with GC content, the more favorable proline interactions with the high GC content duplex surface area observed from thermal denaturation resulted from the temperature dependence of proline interactions rather than the RNA surface chemical composition. The enthalpy contribution to the m-value was positive and small (indicating a slight increase in duplex unfolding enthalpy with proline) while the entropic contribution to the m-value was positive and increased with temperature. Our results will facilitate proline's use as a probe of solvent accessible surface area changes during biochemical reactions at different reaction temperatures.

  14. Culture-based and denaturing gradient gel electrophoresis analysis of the bacterial community from Chungkookjang, a traditional Korean fermented soybean food.

    Science.gov (United States)

    Hong, Sung Wook; Choi, Jae Young; Chung, Kun Sub

    2012-10-01

    The bacterial community of Chungkookjang and raw rice-straw collected from various areas in South Korea was investigated using both culture-dependent and culture-independent methods. Pure cultures were isolated from Chungkookjang and raw rice-straw on tryptic soy agar plates with 72 to 121 colonies and identified by 16S rDNA gene sequence analysis, respectively. The traditional culture-based method and denaturing gradient gel electrophoresis analysis of PCR-amplified 16S rDNA confirmed that Pantoea agglomerans and B. subtilis were identified as predominant in the raw rice-straw and Chungkookjang, respectively, from Iljuk district of Gyeonggi province, P. ananatis and B. licheniformis were identified as predominant in the raw rice-straw and Chungkookjang from Wonju district of Gangwon province, and Microbacterium sp. and B. licheniformis were identified as predominant in the raw rice-straw and Chungkookjang from Sunchang district of Jeolla province. Other strains, such as Bacillus, Enterococcus, Pseudomonas, Rhodococcus, and uncultured bacteria were also present in raw rice-straw and Chungkookjang. A comprehensive analysis of these microorganisms would provide a more detailed understanding of the biologically active components of Chungkookjang and help improve its quality. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis can be successfully applied to a fermented food to detect unculturable or more species than the culture-dependent method. This technique is an effective and convenient culture-independent method for studying the bacterial community in Chungkookjang. In this study, the bacterial community of Chungkookjang collected from various areas in South Korea was investigated using both culture-dependent and culture-independent methods. © 2012 Institute of Food Technologists®

  15. Interaction of ATP with acid-denatured cytochrome c via coupled folding-binding mechanism

    International Nuclear Information System (INIS)

    Ahluwalia, Unnati; Deep, Shashank

    2012-01-01

    Highlights: ► Interaction between ATP and cyt c takes place via coupled binding–folding mechanism. ► Binding of ATP to cyt c is endothermic. ► GTP and CTP induce similar level of helicity in acid-denatured cyt c as with ATP. ► Compactness induced by ATP is far greater than ADP or AMP. - Abstract: The non-native conformations of the cytochrome c (cyt c) are believed to play key roles in a number of physiological processes. Nucleotides are supposed to act as allosteric effectors in these processes by regulating structural transitions among different conformations of cyt c. To understand the interaction between acid denatured cytochrome c and nucleotides, spectroscopic and calorimetric techniques were utilized to observe the structural features of the induced conformation and the energetics of interaction of acid denatured cyt c with different nucleotides. Structure induction in the acid denatured cyt c was observed on the addition of the ∼1 mM nucleotide tri-phosphates (ATP/GTP/CTP) at 25 °C, however, not in the presence of 1 mM nucleotide mono and diphosphates. ATP-bound cyt c at pH 2.0 is likely to have a conformation that has intact α-helical domain. However, Met80-Fe(III) axial bond is still ruptured. Observed thermodynamics reflect interaction between nucleotide and cyt c via coupled binding–folding mechanism. DSC data suggest the preferential binding of the ATP to the folded conformation with respect to the acid denatured cyt c. ITC data indicate that the exothermic folding of cyt c was accompanied by endothermic binding of ATP to cyt c.

  16. Quantitative assessments of the distinct contributions of polypeptide backbone amides versus sidechain groups to chain expansion via chemical denaturation

    Science.gov (United States)

    Holehouse, Alex S.; Garai, Kanchan; Lyle, Nicholas; Vitalis, Andreas; Pappu, Rohit V.

    2015-01-01

    In aqueous solutions with high concentrations of chemical denaturants such as urea and guanidinium chloride (GdmCl) proteins expand to populate heterogeneous conformational ensembles. These denaturing environments are thought to be good solvents for generic protein sequences because properties of conformational distributions align with those of canonical random coils. Previous studies showed that water is a poor solvent for polypeptide backbones and therefore backbones form collapsed globular structures in aqueous solvents. Here, we ask if polypeptide backbones can intrinsically undergo the requisite chain expansion in aqueous solutions with high concentrations of urea and GdmCl. We answer this question using a combination of molecular dynamics simulations and fluorescence correlation spectroscopy. We find that the degree of backbone expansion is minimal in aqueous solutions with high concentrations denaturants. Instead, polypeptide backbones sample conformations that are denaturant-specific mixtures of coils and globules, with a persistent preference for globules. Therefore, typical denaturing environments cannot be classified as good solvents for polypeptide backbones. How then do generic protein sequences expand in denaturing environments? To answer this question, we investigated the effects of sidechains using simulations of two archetypal sequences with amino acid compositions that are mixtures of charged, hydrophobic, and polar groups. We find that sidechains lower the effective concentration of backbone amides in water leading to an intrinsic expansion of polypeptide backbones in the absence of denaturants. Additional dilution of the effective concentration of backbone amides is achieved through preferential interactions with denaturants. These effects lead to conformational statistics in denaturing environments that are congruent with those of canonical random coils. Our results highlight the role of sidechain-mediated interactions as determinants of the

  17. ESR studies of heat denaturation in Cu myoglobin complexes

    International Nuclear Information System (INIS)

    Louro, S.R.W.; Ribeiro, S.C.; Bemski, G.

    1975-01-01

    An investigation is made on the behaviour of Cu2 + and Fe3 + in copper doped myoglobin, subjected to heat treatment. ESR is observed at X-band. The amplitude of the g = 5.9 line of the high spin F 3 + in met-myoglobin is studied as a function of the temperature of the heat treatment, the pH and the length of time of exposure to the heat treatment. These experiments are performed for both the pure protein and for the copper-myoglobin complex, at pH between 5 and 8.5. Results concerning the decrease of the amplitude of Fe 3+ high spin signal are discussed in comparison with Hollocher's results in hemoglobin. The Cu spectra obtained are interpreted, with the aid of a computer program, Kivelson and Neiman's results being used to analyse the authors data

  18. Evolving a polymerase for hydrophobic base analogues.

    Science.gov (United States)

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  19. Transurethral radiofrequency collagen denaturation for the treatment of women with urinary incontinence.

    Science.gov (United States)

    Kang, Diana; Han, Julia; Neuberger, Molly M; Moy, M Louis; Wallace, Sheila A; Alonso-Coello, Pablo; Dahm, Philipp

    2015-03-18

    Transurethral radiofrequency collagen denaturation is a relatively novel, minimally invasive device-based intervention used to treat individuals with urinary incontinence (UI). No systematic review of the evidence supporting its use has been published to date. To evaluate the efficacy of transurethral radiofrequency collagen denaturation, compared with other interventions, in the treatment of women with UI.Review authors sought to compare the following.• Transurethral radiofrequency collagen denaturation versus no treatment/sham treatment.• Transurethral radiofrequency collagen denaturation versus conservative physical treatment.• Transurethral radiofrequency collagen denaturation versus mechanical devices (pessaries for UI).• Transurethral radiofrequency collagen denaturation versus drug treatment.• Transurethral radiofrequency collagen denaturation versus injectable treatment for UI.• Transurethral radiofrequency collagen denaturation versus other surgery for UI. We conducted a systematic search of the Cochrane Incontinence Group Specialised Register (searched 19 December 2014), EMBASE and EMBASE Classic (January 1947 to 2014 Week 50), Google Scholar and three trials registries in December 2014, along with reference checking. We sought to identify unpublished studies by handsearching abstracts of major gynaecology and urology meetings, and by contacting experts in the field and the device manufacturer. Randomised and quasi-randomised trials of transurethral radiofrequency collagen denaturation versus no treatment/sham treatment, conservative physical treatment, mechanical devices, drug treatment, injectable treatment for UI or other surgery for UI in women were eligible. We screened search results and selected eligible studies for inclusion. We assessed risk of bias and analysed dichotomous variables as risk ratios (RRs) with 95% confidence intervals (CIs) and continuous variables as mean differences (MDs) with 95% CIs. We rated the quality of

  20. Strange temperature dependence of the folding rate of a 16-residue β-hairpin

    International Nuclear Information System (INIS)

    Xu Yao; Wang Ting; Gai Feng

    2006-01-01

    The folding/unfolding kinetics of a 16-residue β-hairpin that undergoes cold denaturation at ambient temperatures were investigated by time-resolved infrared spectroscopy coupled with the laser-induced temperature jump (T-jump) initiation method. We found that the relaxation kinetics of this β-hairpin following a T-jump, obtained by probing the amide I' band of the peptide backbone, show strange temperature dependence. At temperatures below approximately 35 deg. C where this β-hairpin mainly exhibits cold denaturation, the T-jump induced relaxation rate is ∼5 μs -1 , whereas at temperatures where heat denaturation takes place, the relaxation rate increases to ∼1 μs -1 . These results cannot be readily explained by a two-state folding model that has been used to describe the folding thermodynamics of this β-hairpin. In addition, these results suggest that the folding free energy barrier separating the cold-denatured state from the folded state is different from that separating the heat-denatured state from the folded state, coinciding with the idea that the mechanism leading to cold denaturation is different from that leading to heat denaturation

  1. The anionic biosurfactant rhamnolipid does not denature industrial enzymes

    Directory of Open Access Journals (Sweden)

    Jens Kvist Madsen

    2015-04-01

    Full Text Available Biosurfactants (BS are surface-active molecules produced by microorganisms. Their combination of useful properties and sustainable production make them promising industrial alternatives to petrochemical and oleochemical surfactants. Here we compare the impact of the anionic BS rhamnolipid (RL and the conventional/synthetic anionic surfactant sodium dodecyl sulfate (SDS on the structure and stability of three different commercially used enzymes, namely the cellulase Carezyme® (CZ, the phospholipase Lecitase Ultra® (LT and the α-amylase Stainzyme® (SZ. Our data reveal a fundamental difference in their mode of interaction. SDS shows great diversity of interaction towards the different enzymes. It efficiently unfolds both LT and CZ, but LT is unfolded by SDS through formation of SDS clusters on the protein well below the cmc, while CZ is only unfolded by bulk micelles and on average binds significantly less SDS than LT. SDS binds with even lower stoichiometry to SZ and leads to an increase in thermal stability. In contrast, RL does not affect the tertiary or secondary structure of any enzyme at room temperature, has little impact on thermal stability and only binds detectably (but at low stoichiometries to SZ. Furthermore all enzymes maintain activity at both monomeric and micellar concentrations of RL. We conclude that RL, despite its anionic charge, is a surfactant that does not compromise the structural integrity of industrially relevant proteins. This makes RL a promising alternative to current synthetic anionic surfactants in a wide range of commercial applications.

  2. Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

    Directory of Open Access Journals (Sweden)

    Haifeng eChen

    2015-11-01

    Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

  3. Polymerase-endonuclease amplification reaction (PEAR for large-scale enzymatic production of antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Xiaolong Wang

    Full Text Available Antisense oligonucleotides targeting microRNAs or their mRNA targets prove to be powerful tools for molecular biology research and may eventually emerge as new therapeutic agents. Synthetic oligonucleotides are often contaminated with highly homologous failure sequences. Synthesis of a certain oligonucleotide is difficult to scale up because it requires expensive equipment, hazardous chemicals and a tedious purification process. Here we report a novel thermocyclic reaction, polymerase-endonuclease amplification reaction (PEAR, for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI cleavage releases monomeric duplex oligonucleotides. Each round of PEAR achieves over 100-fold amplification. The product can be used in one more round of PEAR directly, and the process can be further repeated. In addition to avoiding dangerous materials and improved product purity, this reaction is easy to scale up and amenable to full automation. PEAR has the potential to be a useful tool for large-scale production of antisense oligonucleotide drugs.

  4. Essential roles of protein-solvent many-body correlation in solvent-entropy effect on protein folding and denaturation: Comparison between hard-sphere solvent and water

    International Nuclear Information System (INIS)

    Oshima, Hiraku; Kinoshita, Masahiro

    2015-01-01

    In earlier works, we showed that the entropic effect originating from the translational displacement of water molecules plays the pivotal role in protein folding and denaturation. The two different solvent models, hard-sphere solvent and model water, were employed in theoretical methods wherein the entropic effect was treated as an essential factor. However, there were similarities and differences in the results obtained from the two solvent models. In the present work, to unveil the physical origins of the similarities and differences, we simultaneously consider structural transition, cold denaturation, and pressure denaturation for the same protein by employing the two solvent models and considering three different thermodynamic states for each solvent model. The solvent-entropy change upon protein folding/unfolding is decomposed into the protein-solvent pair (PA) and many-body (MB) correlation components using the integral equation theories. Each component is further decomposed into the excluded-volume (EV) and solvent-accessible surface (SAS) terms by applying the morphometric approach. The four physically insightful constituents, (PA, EV), (PA, SAS), (MB, EV), and (MB, SAS), are thus obtained. Moreover, (MB, SAS) is discussed by dividing it into two factors. This all-inclusive investigation leads to the following results: (1) the protein-water many-body correlation always plays critical roles in a variety of folding/unfolding processes; (2) the hard-sphere solvent model fails when it does not correctly reproduce the protein-water many-body correlation; (3) the hard-sphere solvent model becomes problematic when the dependence of the many-body correlation on the solvent number density and temperature is essential: it is not quite suited to studies on cold and pressure denaturating of a protein; (4) when the temperature and solvent number density are limited to the ambient values, the hard-sphere solvent model is usually successful; and (5) even at the ambient

  5. Denaturing gradient gel electrophoresis-polymerase chain reaction comparison of chitosan effects on anaerobic cultures of broiler cecal bacteria and Salmonella Typhimurium

    Science.gov (United States)

    Salmonella colonization and product contamination are major poultry industry problems. Alternatives to traditional antibiotics against Salmonella offer the potential to lessen the development of resistance to antibiotics of importance to human health. The chitin derivative chitosan has drawn substa...

  6. Structure and function of DNA polymerase μ

    International Nuclear Information System (INIS)

    Matsumoto, Takuro; Maezawa, So

    2013-01-01

    DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)

  7. Denaturing of single electrospun fibrinogen fibers studied by deep ultraviolet fluorescence microscopy.

    Science.gov (United States)

    Kim, Jeongyong; Song, Hugeun; Park, Inho; Carlisle, Christine R; Bonin, Keith; Guthold, Martin

    2011-03-01

    Deep ultraviolet (DUV) microscopy is a fluorescence microscopy technique to image unlabeled proteins via the native fluorescence of some of their amino acids. We constructed a DUV fluorescence microscope, capable of 280 nm wavelength excitation by modifying an inverted optical microscope. Moreover, we integrated a nanomanipulator-controlled micropipette into this instrument for precise delivery of picoliter amounts of fluid to selected regions of the sample. In proof-of-principle experiments, we used this instrument to study, in situ, the effect of a denaturing agent on the autofluorescence intensity of single, unlabeled, electrospun fibrinogen nanofibers. Autofluorescence emission from the nanofibers was excited at 280 nm and detected at ∼350 nm. A denaturant solution was discretely applied to small, select sections of the nanofibers and a clear local reduction in autofluorescence intensity was observed. This reduction is attributed to the dissolution of the fibers and the unfolding of proteins in the fibers. Copyright © 2010 Wiley-Liss, Inc.

  8. Theoretical aspects of pressure and solute denaturation of proteins: A Kirkwood-buff-theory approach

    Science.gov (United States)

    Ben-Naim, Arieh

    2012-12-01

    A new approach to the problem of pressure-denaturation (PD) and solute-denaturation (SD) of proteins is presented. The problem is formulated in terms of Le Chatelier principle, and a solution is sought in terms of the Kirkwood-Buff theory of solutions. It is found that both problems have one factor in common; the excluded volumes of the folded and the unfolded forms with respect to the solvent molecules. It is shown that solvent-induced effects operating on hydrophilic groups along the protein are probably the main reason for PD. On the other hand, the SD depends on the preferential solvation of the folded and the unfolded forms with respect to solvent and co-solvent molecules.

  9. Teaching what one does not know: strangeness and denaturation in (autobiographical narrations

    Directory of Open Access Journals (Sweden)

    Jorge Luiz da Cunha

    2014-01-01

    Full Text Available The thematic focus in this text are the estrangement/denaturation processes in (autobiographical narrations. The aim of this study was to reflect on the possibility to promote estrangement/denatura - tion in (autobiographical writings made by teenagers in the space/ time of the classroom environment. The methodological proposal consisted on developing (autobiographical writings by students from sociology classes in High School. A total of 138 teenagers from a public school, attending the first school trimester in the year 2013, have participated in the study. The concepts of estrangement/de - naturation are located in the anthropology field and, the work with (autobiographical narrations is located in the socio-clinic perspec - tives and of biographization processes. The results indicate that (autobiographical narrations provide estrangements/denaturation and go towards teaching what one does not know. We can, then, conclude that this possibility, as an educational act, may generate knowledge suspension to self-inventiveness.

  10. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    International Nuclear Information System (INIS)

    Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-01

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

  11. Native and denatured bovine serum albumin. D.c. polarography, stripping voltammetry and constant current chronopotentiometry

    Czech Academy of Sciences Publication Activity Database

    Ostatná, Veronika; Uslu, B.; Dogan, B.; Ozkan, S.; Paleček, Emil

    2006-01-01

    Roč. 593, č. 1-2 (2006), s. 172-178 ISSN 0022-0728 R&D Projects: GA AV ČR(CZ) IAA500040513; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507 Keywords : protein electrochemistry * bovine serum albumin * native and denatured proteins Subject RIV: BO - Biophysics Impact factor: 2.339, year: 2006

  12. Micro-CT Imaging of Denatured Chitin by Silver to Explore Honey Bee and Insect Pathologies

    Science.gov (United States)

    Butzloff, Peter R.

    2011-01-01

    Background Chitin and cuticle coatings are important to the environmental and immune defense of honey bees and insect pollinators. Pesticides or environmental effects may target the biochemistry of insect chitin and cuticle coating. Denaturing of chitin involves a combination of deacetylation, intercalation, oxidation, Schweiger-peeling, and the formation of amine hydrochloride salt. The term “denatured chitin” calls attention to structural and property changes to the internal membranes and external carapace of organisms so that some properties affecting biological activities are diminished. Methodology/Principal Findings A case study was performed on honey bees using silver staining and microscopic computer-tomographic x-ray radiography (micro-CT). Silver nitrate formed counter-ion complexes with labile ammonium cations and reacted with amine hydrochloride. Silver was concentrated in the peritrophic membrane, on the abdomen, in the glossa, at intersegmental joints (tarsi), at wing attachments, and in tracheal air sacs. Imaged mono-esters and fatty acids from cuticle coating on external surfaces were apparently reduced by an alcohol pretreatment. Conclusions/Significance The technique provides 3-dimensional and sectional images of individual honey bees consistent with the chemistries of silver reaction and complex formation with denatured chitin. Environmental exposures and influences such as gaseous nitric oxide intercalant, trace oxidants such as ozone gas, oligosachharide salt conversion, exposure to acid rain, and chemical or biochemical denaturing by pesticides may be studied using this technique. Peritrophic membranes, which protect against food abrasion, microorganisms, and permit efficient digestion, were imaged. Apparent surface damage to the corneal lenses of compound eyes by dilute acid exposure consistent with chitin amine hydrochloride formation was imaged. The technique can contribute to existing insect pathology research, and may provide an

  13. Micro-CT imaging of denatured chitin by silver to explore honey bee and insect pathologies.

    Directory of Open Access Journals (Sweden)

    Peter R Butzloff

    Full Text Available BACKGROUND: Chitin and cuticle coatings are important to the environmental and immune defense of honey bees and insect pollinators. Pesticides or environmental effects may target the biochemistry of insect chitin and cuticle coating. Denaturing of chitin involves a combination of deacetylation, intercalation, oxidation, Schweiger-peeling, and the formation of amine hydrochloride salt. The term "denatured chitin" calls attention to structural and property changes to the internal membranes and external carapace of organisms so that some properties affecting biological activities are diminished. METHODOLOGY/PRINCIPAL FINDINGS: A case study was performed on honey bees using silver staining and microscopic computer-tomographic x-ray radiography (micro-CT. Silver nitrate formed counter-ion complexes with labile ammonium cations and reacted with amine hydrochloride. Silver was concentrated in the peritrophic membrane, on the abdomen, in the glossa, at intersegmental joints (tarsi, at wing attachments, and in tracheal air sacs. Imaged mono-esters and fatty acids from cuticle coating on external surfaces were apparently reduced by an alcohol pretreatment. CONCLUSIONS/SIGNIFICANCE: The technique provides 3-dimensional and sectional images of individual honey bees consistent with the chemistries of silver reaction and complex formation with denatured chitin. Environmental exposures and influences such as gaseous nitric oxide intercalant, trace oxidants such as ozone gas, oligosachharide salt conversion, exposure to acid rain, and chemical or biochemical denaturing by pesticides may be studied using this technique. Peritrophic membranes, which protect against food abrasion, microorganisms, and permit efficient digestion, were imaged. Apparent surface damage to the corneal lenses of compound eyes by dilute acid exposure consistent with chitin amine hydrochloride formation was imaged. The technique can contribute to existing insect pathology research, and may

  14. Denaturing gradient gel electrophoresis profiling of bacterial communities composition in Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, S.K.; Ramaiah, N.

    of Environmental Biology circleshadowdwnMay 2011circleshadowdwn Introduction The bacteria play a major role in carbon dynamics of marine ecosystems and, the importance of heterotrophic bacteria in marine ecosystem functioning is very well recognized (Azam et al..., 2008). Denaturing gradient gel-electrophoressis (DGGE) based fingerprinting helps estimate the numbers of dominant phylotype in a given sample (Muyzer et al., 1993). Very diverse bacterial assemblages such as those in the soils present many bands...

  15. Native and denatured forms of proteins can be discriminated at edge plane carbon electrodes

    Czech Academy of Sciences Publication Activity Database

    Ostatná, Veronika; Černocká, Hana; Kurzatkowska, K.; Paleček, Emil

    2012-01-01

    Roč. 735, JUL (2012), s. 31-36 ISSN 0003-2670 R&D Projects: GA AV ČR(CZ) KJB100040901; GA ČR(CZ) GAP301/11/2055; GA MŠk(CZ) ME09038 Institutional research plan: CEZ:AV0Z50040702 Keywords : protein denaturation * carbon electrodes * edge plane pyrolytic graphite Subject RIV: BO - Biophysics Impact factor: 4.387, year: 2012

  16. Multifocal peritoneal splenosis in Tc-99m-labeled heat-denatured red blood cell scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Min Ki; Hwang, Kyung Hoon; Choe, Won Sick [Gachon University Gil Medical Center, Incheon (Korea, Republic of)

    2006-06-15

    A 44-year-old man with a past medical history of splenectomy came to hospital because of epigastric pain abdominopelvic computed tomography(CT) showed a soft tissue mass and multifocal variable-sized nodules as well as finding suggestive of cholecystitis. Subsequently, he underwent Tc-99m-labeled heat- denatured red blood cell(RBC) scintigraphy to evaluate the mass and nodules. The scintigraphy confirmed multifocal peritoneal splenosis in the abdominopelvic cavity.

  17. Towards the molecular bases of polymerase dynamics

    International Nuclear Information System (INIS)

    Chela Flores, J.

    1991-03-01

    One aspect of the strong relationship that is known to exist between the processes of DNA replication and transcription is manifest in the coupling of the rates of movement of the replication fork (r f ) and RNA polymerase (r t ). We address two issues concerning the largely unexplored area of polymerase dynamics: (i) The validity of an approximate kinematic formula linking r f and r t suggested by experiments in which transcription is initiated in some prokaryotes with the antibiotic streptolydigin, and (ii) What are the molecular bases of the kinematic formula? An analysis of the available data suggests possible molecular bases for polymerase dynamics. In particular, we are led to a hypothesis: In active chromatin r t may depend on the length (λ t ) of the transcript of the primary messenger RNA (pre-mRNA). This new effect is subject to experimental verification. We discuss possible experiments that may be performed in order to test this prediction. (author). Refs, 6 tabs

  18. Structural relationships among the multiple forms of DNA-dependent RNA polymerase II from cultured parsley cells

    International Nuclear Information System (INIS)

    Link, G.; Bogorad, L.; Kidd, G.H.; Richter, G.

    1978-01-01

    DNA-dependent RNA polymerase II (or B) was purified from cultured parsley cells, and its molecular structure was examined in detail. Upon centrifugation through glycerol gradients, RNA polymerase II sediments as a single band with an apparent sedimentation constant of 15S. No contamination with RNA polymerases I or III could be detected when the activity of purified RNA polymerase II was assayed in the presence of high concentrations of α-amanitin. Analysis of purified RNA polymerase II be nondenaturing and denaturing polyacrylamide gel electrophoresis revealed that this enzyme exists in multiple forms. They were designated II(O), II(A), and II(B). It is suggested that each form has a subunit of Mr = 140000 as well as smaller polypeptides in common. They differ, however, in the molecular weights of their largest subunits which is 220000 in form II(O), 200000 in form II(A), and 180000 in form II(B). These large subunits were labelled with 125 I, digested with trypsin, and tryptic digests were compared by two-dimensional analysis on thin-layer plates (Elder et al. (1977) J. Biol. Chem. 252, 6510-6515). Fingerprints of tryptic digests from the polypeptides with Mr = 220000, Mr = 200000, and Mr = 180000 were similar. It is, therefore, suggested that these subunits are stucturally related. A tryptic digest was also produced from the subunit with Mr = 140000. Its fingerprint was found to yield a considerably different distribution of peptides as compared to those from the three large subunits. (orig.) [de

  19. Denaturation of proteins by surfactants studied by the Taylor dispersion analysis.

    Directory of Open Access Journals (Sweden)

    Aldona Jelińska

    Full Text Available We showed that the Taylor Dispersion Analysis (TDA is a fast and easy to use method for the study of denaturation proteins. We applied TDA to study denaturation of β-lactoglobulin, transferrin, and human insulin by anionic surfactant sodium dodecyl sulfate (SDS. A series of measurements at constant protein concentration (for transferrin was 1.9 x 10-5 M, for β- lactoglobulin was 7.6 x 10-5 M, and for insulin was 1.2 x 10-4 M and varying SDS concentrations were carried out in the phosphate-buffered saline (PBS. The structural changes were analyzed based on the diffusion coefficients of the complexes formed at various surfactant concentrations. The concentration of surfactant was varied in the range from 1.2 x 10-4 M to 8.7 x 10-2 M. We determined the minimum concentration of the surfactant necessary to change the native conformation of the proteins. The minimal concentration of SDS for β-lactoglobulin and transferrin was 4.3 x 10-4 M and for insulin 2.3 x 10-4 M. To evaluate the TDA as a novel method for studying denaturation of proteins we also applied other methods i.e. electronic circular dichroism (ECD and dynamic light scattering (DLS to study the same phenomenon. The results obtained using these methods were in agreement with the results from TDA.

  20. Chemical Denaturants Smoothen Ruggedness on the Free Energy Landscape of Protein Folding.

    Science.gov (United States)

    Malhotra, Pooja; Jethva, Prashant N; Udgaonkar, Jayant B

    2017-08-08

    To characterize experimentally the ruggedness of the free energy landscape of protein folding is challenging, because the distributed small free energy barriers are usually dominated by one, or a few, large activation free energy barriers. This study delineates changes in the roughness of the free energy landscape by making use of the observation that a decrease in ruggedness is accompanied invariably by an increase in folding cooperativity. Hydrogen exchange (HX) coupled to mass spectrometry was used to detect transient sampling of local energy minima and the global unfolded state on the free energy landscape of the small protein single-chain monellin. Under native conditions, local noncooperative openings result in interconversions between Boltzmann-distributed intermediate states, populated on an extremely rugged "uphill" energy landscape. The cooperativity of these interconversions was increased by selectively destabilizing the native state via mutations, and further by the addition of a chemical denaturant. The perturbation of stability alone resulted in seven backbone amide sites exchanging cooperatively. The size of the cooperatively exchanging and/or unfolding unit did not depend on the extent of protein destabilization. Only upon the addition of a denaturant to a destabilized mutant variant did seven additional backbone amide sites exchange cooperatively. Segmentwise analysis of the HX kinetics of the mutant variants further confirmed that the observed increase in cooperativity was due to the smoothing of the ruggedness of the free energy landscape of folding of the protein by the chemical denaturant.

  1. Modified denatured lysozyme effectively solubilizes fullerene c60 nanoparticles in water

    Science.gov (United States)

    Siepi, Marialuisa; Politi, Jane; Dardano, Principia; Amoresano, Angela; De Stefano, Luca; Monti, Daria Maria; Notomista, Eugenio

    2017-08-01

    Fullerenes, allotropic forms of carbon, have very interesting pharmacological effects and engineering applications. However, a very low solubility both in organic solvents and water hinders their use. Fullerene C60, the most studied among fullerenes, can be dissolved in water only in the form of nanoparticles of variable dimensions and limited stability. Here the effect on the production of C60 nanoparticles by a native and denatured hen egg white lysozyme, a highly basic protein, has been systematically studied. In order to obtain a denatured, yet soluble, lysozyme derivative, the four disulfides of the native protein were reduced and exposed cysteines were alkylated by 3-bromopropylamine, thus introducing eight additional positive charges. The C60 solubilizing properties of the modified denatured lysozyme proved to be superior to those of the native protein, allowing the preparation of biocompatible highly homogeneous and stable C60 nanoparticles using lower amounts of protein, as demonstrated by dynamic light scattering, transmission electron microscopy and atomic force microscopy studies. This lysozyme derivative could represent an effective tool for the solubilization of other carbon allotropes.

  2. Evaluation of gasoline-denatured ethanol as a carbon source for denitrification.

    Science.gov (United States)

    Kazasi, Anna; Boardman, Gregory D; Bott, Charles B

    2013-06-01

    In this study concerning denitrification, the performance of three carbon sources, methanol (MeOH), ethanol (EtOH) and gasoline-denatured ethanol (dEtOH), was compared and evaluated on the basis of treatment efficiency, inhibition potential and cost. The gasoline denaturant considered here contained mostly aliphatic compounds and little of the components that typically boost the octane rating, such as benzene, toluene, ethylbenzene and xylenes. Results were obtained using three lab-scale SBRs operated at SRT of 12.0 +/- 0.9 days. After biomass was acclimated, denitrification rates with dEtOH were similar to those of EtOH (201 +/- 50 and 197 +/- 28 NO3-N/g MLVSS x d, respectively), and higher than those of MeOH (165 +/- 49 mg NO3-N/g MLVSS x d). The denaturant did not affect biomass production, nitrification or denitrification. Effluent soluble COD concentrations were always less than the analytical detection limit. Although the cost of dEtOH ($2.00/kg nitrate removed) was somewhat higher than that of methanol ($1.63/kg nitrate removed), the use of dEtOH is very promising and utilities will have to decide if it is worth paying a little extra to take advantage of its benefits.

  3. Comparison of membrane electroporation and protein denature in response to pulsed electric field with different durations.

    Science.gov (United States)

    Huang, Feiran; Fang, Zhihui; Mast, Jason; Chen, Wei

    2013-05-01

    In this paper, we compared the minimum potential differences in the electroporation of membrane lipid bilayers and the denaturation of membrane proteins in response to an intensive pulsed electric field with various pulse durations. Single skeletal muscle fibers were exposed to a pulsed external electric field. The field-induced changes in the membrane integrity (leakage current) and the Na channel currents were monitored to identify the minimum electric field needed to damage the membrane lipid bilayer and the membrane proteins, respectively. We found that in response to a relatively long pulsed electric shock (longer than the membrane intrinsic time constant), a lower membrane potential was needed to electroporate the cell membrane than for denaturing the membrane proteins, while for a short pulse a higher membrane potential was needed. In other words, phospholipid bilayers are more sensitive to the electric field than the membrane proteins for a long pulsed shock, while for a short pulse the proteins become more vulnerable. We can predict that for a short or ultrashort pulsed electric shock, the minimum membrane potential required to start to denature the protein functions in the cell plasma membrane is lower than that which starts to reduce the membrane integrity. Copyright © 2013 Wiley Periodicals, Inc.

  4. Radioimmunoassay and heat denaturation enzyme assay for the detection of Tay-Sachs heterozygotes during pregnancy

    International Nuclear Information System (INIS)

    Nguyen, C.; Gold, R.J.M.; Mahuran, D.; Lowden, J.A.

    1981-01-01

    Tay-Sachs disease results from a loss of activity of hexosaminidase A (HEX A) in body tissues and fluids. Heterozygotes for the disease are usually identified by their relatively low ratio of heat-labile HEX A to total hexosaminidase. During pregnancy an intermediate isoenzyme (HEX I) increases in activity in serum and obscures the heterozygote status. HEX I does not increase in leucocytes, tears and other body tissues but because of technical difficulties in these assays the authors examined the feasibility of using a radioimmunoassay for HEX A. By univariate analysis, the heat denaturation assay gave a lower cost of misclassification for non-pregnant normals while RIA did so for pregnant normals. A combination of both tests led to reduced cost of misclassification compared to either alone. Bayesian analysis of bivariate gaussian density functions for heat denaturation and for radioimmunoassays of HEX isoenzymes was employed to calculate misclassification frequencies. Among the parameters examined, HEX A measured by RIA and % HEX A by heat-denaturation assay were the two having the best discriminatory power. (Auth.)

  5. Isothermal chemical denaturation of large proteins: Path-dependence and irreversibility.

    Science.gov (United States)

    Wafer, Lucas; Kloczewiak, Marek; Polleck, Sharon M; Luo, Yin

    2017-12-15

    State functions (e.g., ΔG) are path independent and quantitatively describe the equilibrium states of a thermodynamic system. Isothermal chemical denaturation (ICD) is often used to extrapolate state function parameters for protein unfolding in native buffer conditions. The approach is prudent when the unfolding/refolding processes are path independent and reversible, but may lead to erroneous results if the processes are not reversible. The reversibility was demonstrated in several early studies for smaller proteins, but was assumed in some reports for large proteins with complex structures. In this work, the unfolding/refolding of several proteins were systematically studied using an automated ICD instrument. It is shown that: (i) the apparent unfolding mechanism and conformational stability of large proteins can be denaturant-dependent, (ii) equilibration times for large proteins are non-trivial and may introduce significant error into calculations of ΔG, (iii) fluorescence emission spectroscopy may not correspond to other methods, such as circular dichroism, when used to measure protein unfolding, and (iv) irreversible unfolding and hysteresis can occur in the absence of aggregation. These results suggest that thorough confirmation of the state functions by, for example, performing refolding experiments or using additional denaturants, is needed when quantitatively studying the thermodynamics of protein unfolding using ICD. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA

    International Nuclear Information System (INIS)

    Fye, R.M.; Benham, C.J.

    1999-01-01

    Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N 2 ) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements

  7. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    Dorson, J.W.; Moses, R.E.

    1978-01-01

    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  8. Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    OpenAIRE

    Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.

    2003-01-01

    Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...

  9. Preparation of denatured sup(99m)Tc labeled HSA aerosols of different median diameters for various imaging studies

    Energy Technology Data Exchange (ETDEWEB)

    Raghunath, B.; Kotrappa, P.; Soni, P.S.; Ganatra, R.D. (Bhabha Atomic Research Centre, Bombay (India))

    1982-02-01

    The preparation of denatured sup(99m)Tc-labelled human serum albumin (HSA) aerosols of different median diameters is described using the BARC (Bhabha Atomic Research Centre) dry aerosol generation and delivery system. The applications of these radioactive aerosols are demonstrated in aerosol scintigraphy of lungs, mucociliary movement studies and lymphoscintigraphy in rabbits. It is concluded that the BARC system gives a simplified, rapid and versatile procedure for generation of denatured volume tagged HSA aerosols for a variety of clinical applications.

  10. Mechanism of Protein Denaturation: Partial Unfolding of the P22 Coat Protein I-Domain by Urea Binding

    Science.gov (United States)

    Newcomer, Rebecca L.; Fraser, LaTasha C.R.; Teschke, Carolyn M.; Alexandrescu, Andrei T.

    2015-01-01

    The I-domain is an insertion domain of the bacteriophage P22 coat protein that drives rapid folding and accounts for over half of the stability of the full-length protein. We sought to determine the role of hydrogen bonds (H-bonds) in the unfolding of the I-domain by examining 3JNC’ couplings transmitted through H-bonds, the temperature and urea-concentration dependence of 1HN and 15N chemical shifts, and native-state hydrogen exchange at urea concentrations where the domain is predominantly folded. The native-state hydrogen-exchange data suggest that the six-stranded β-barrel core of the I-domain is more stable against unfolding than a smaller subdomain comprised of a short α-helix and three-stranded β-sheet. H-bonds, separately determined from solvent protection and 3JNC’ H-bond couplings, are identified with an accuracy of 90% by 1HN temperature coefficients. The accuracy is improved to 95% when 15N temperature coefficients are also included. In contrast, the urea dependence of 1HN and 15N chemical shifts is unrelated to H-bonding. The protein segments with the largest chemical-shift changes in the presence of urea show curved or sigmoidal titration curves suggestive of direct urea binding. Nuclear Overhauser effects to urea for these segments are also consistent with specific urea-binding sites in the I-domain. Taken together, the results support a mechanism of urea unfolding in which denaturant binds to distinct sites in the I-domain. Disordered segments bind urea more readily than regions in stable secondary structure. The locations of the putative urea-binding sites correlate with the lower stability of the structure against solvent exchange, suggesting that partial unfolding of the structure is related to urea accessibility. PMID:26682823

  11. RNA Polymerase II–The Transcription Machine

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 3. RNA Polymerase II – The Transcription Machine - Nobel Prize in Chemistry 2006. Jiyoti Verma Aruna Naorem Anand Kumar Manimala Sen Parag Sadhale. General Article Volume 12 Issue 3 March 2007 pp 47-53 ...

  12. RNA polymerase II collision interrupts convergent transcription

    DEFF Research Database (Denmark)

    Hobson, David J; Wei, Wu; Steinmetz, Lars M

    2012-01-01

    Antisense noncoding transcripts, genes-within-genes, and convergent gene pairs are prevalent among eukaryotes. The existence of such transcription units raises the question of what happens when RNA polymerase II (RNAPII) molecules collide head-to-head. Here we use a combination of biochemical...

  13. Fluctuating partially native-like topologies in the acid denatured ensemble of autolysis resistant HIV-1 protease.

    Science.gov (United States)

    Rout, Manoj Kumar; Hosur, Ramakrishna V

    2009-02-01

    Folding, in-vivo, starts from a denatured state and thus the nature of the denatured state would play an important role in directing the folding of a protein. We report here NMR characterization of the acid-denatured state of a mutant of HIV-1 protease, designed to prevent autolysis (Q7K, L33I, L63I) and to prevent cysteine oxidation (C67A and C95A). Secondary chemical shifts, TALOS analysis of chemical shifts and (15)N relaxation data (R(1), R(2), NOE) coupled with AABUF and hydrophobicity calculations, suggest formation of hydrophobic clusters and possibility of some partially native-like topologies in the acid denatured state of the protease. The structural and dynamics characteristics of the acid denatured PR seem to be considerably different from those of the guanidine or urea denatured states of some variants of PR. These would have implications for the folding and auto-processing of the enzyme in-vivo.

  14. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    Science.gov (United States)

    Cline, J; Braman, J C; Hogrefe, H H

    1996-09-15

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.

  15. Functional roles of DNA polymerases β and γ

    International Nuclear Information System (INIS)

    Huebscher, U.; Kuenzle, C.C.; Spadari, S.

    1979-01-01

    The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

  16. Helical Propensity Affects the Conformational Properties of the Denatured State of Cytochrome c'.

    Science.gov (United States)

    Danielson, Travis A; Bowler, Bruce E

    2018-01-23

    Changing the helical propensity of a polypeptide sequence might be expected to affect the conformational properties of the denatured state of a protein. To test this hypothesis, alanines at positions 83 and 87 near the center of helix 3 of cytochrome c' from Rhodopseudomonas palustris were mutated to serine to decrease the stability of this helix. A set of 13 single histidine variants in the A83S/A87S background were prepared to permit assessment of the conformational properties of the denatured state using histidine-loop formation in 3 M guanidine hydrochloride. The data are compared with previous histidine-heme loop formation data for wild-type cytochrome c'. As expected, destabilization of helix 3 decreases the global stabilities of the histidine variants in the A83S/A87S background relative to the wild-type background. Loop stability versus loop size data yields a scaling exponent of 2.1 ± 0.2, similar to the value of 2.3 ± 0.2 obtained for wild-type cytochrome c'. However, the stabilities of all histidine-heme loops, which contain the helix 3 sequence segment, are increased in the A83S/A87S background compared to the wild-type background. Rate constants for histidine-heme loop breakage are similar for the wild-type and A83S/A87S variants. However, for histidine-heme loops that contain the helix 3 sequence segment, the rate constants for loop formation increase in the A83S/A87S background compared to the wild-type background. Thus, residual helical structure appears to stiffen the polypeptide chain slowing loop formation in the denatured state. The implications of these results for protein folding mechanisms are discussed. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. Single Molecular Level Probing of Structure and Dynamics of Papain Under Denaturation.

    Science.gov (United States)

    Sengupta, Bhaswati; Chaudhury, Apala; Das, Nilimesh; Sen, Pratik

    2017-01-01

    Papain is a cysteine protease enzyme present in papaya and known to help in digesting peptide. Thus the structure and function of the active site of papain is of interest. The objective of present study is to unveil the overall structural transformation and the local structural change around the active site of papain as a function of chemical denaturant. Papain has been tagged at Cys-25 with a thiol specific fluorescence probe N-(7- dimethylamino-4-methylcoumarin-3-yl) iodoacetamide (DACIA). Guanidine hydrochloride (GnHCl) has been used as the chemical denaturant. Steady state, time-resolved, and single molecular level fluorescence techniques was applied to map the change in the local environment. It is found that papain undergoes a two-step denaturation in the presence of GnHCl. Fluorescence correlation spectroscopic (FCS) data indicate that the size (hydrodynamic diameter) of native papain is ~36.8 Å, which steadily increases to ~53 Å in the presence of 6M GnHCl. FCS study also reveals that the conformational fluctuation time of papain is 6.3 µs in its native state, which decreased to 2.7 µs in the presence of 0.75 M GnHCl. Upon further increase in GnHCl concentration the conformational fluctuation time increase monotonically till 6 M GnHCl, where the time constant is measured as 14 µs. On the other hand, the measurement of ellipticity, hence the helical structure, by circular dichroism spectroscopy is found to be incapable to capture such structural transformation. It is concluded that in the presence of small amount of GnHCl the active site of papain takes up a more compact structure (although the overall size increases) than in the native state, which has been designated as the intermediate state. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  18. Deciphering allogeneic antibody response against native and denatured HLA epitopes in organ transplantation.

    Science.gov (United States)

    Visentin, Jonathan; Guidicelli, Gwendaline; Moreau, Jean-François; Lee, Jar-How; Taupin, Jean-Luc

    2015-07-01

    Anti-HLA donor-specific antibodies are deleterious for organ transplant survival. Class I HLA donor-specific antibodies are identified by using the Luminex single antigen beads (LSAB) assay, which also detects anti-denatured HLA antibodies (anti-dHLAs). Anti-dHLAs are thought to be unable to recognize native HLA (nHLA) on the cell surface and therefore to be clinically irrelevant. Acid denaturation of nHLA on LSAB allows anti-dHLAs to be discriminated from anti-nHLAs. We previously defined a threshold for the ratio between mean fluorescence intensity against acid-treated (D for denaturation) and nontreated (N) LSAB, D ≥ 1.2 N identifying the anti-dHLAs. However, some anti-dHLAs remained able to bind nHLA on lymphocytes in flow cytometry crossmatches, and some anti-nHLAs conserved significant reactivity toward acid-treated LSAB. After depleting serum anti-nHLA reactivity with HLA-typed cells, we analyzed the residual LSAB reactivity toward nontreated and acid-treated LSABs, and then evaluated the ability of antibodies to recognize nHLA alleles individually. We observed that sera can contain mixtures of anti-nHLAs and anti-dHLAs, or anti-nHLAs recognizing acid-resistant epitopes, all possibly targeting the same allele(s). Therefore, the anti-HLA antibody response can be highly complex and subtle, as is the accurate identification of pathogenic anti-HLA antibodies in human serum. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Stabilizing effect of biochar on soil extracellular enzymes after a denaturing stress.

    Science.gov (United States)

    Elzobair, Khalid A; Stromberger, Mary E; Ippolito, James A

    2016-01-01

    Stabilizing extracellular enzymes may maintain enzymatic activity while protecting enzymes from proteolysis and denaturation. A study determined whether a fast pyrolysis hardwood biochar (CQuest™) would reduce evaporative losses, subsequently stabilizing soil extracellular enzymes and prohibiting potential enzymatic activity loss following a denaturing stress (microwaving). Soil was incubated in the presence of biochar (0%, 1%, 2%, 5%, or 10% by wt.) for 36 days and then exposed to microwave energies (0, 400, 800, 1600, or 3200 J g(-1) soil). Soil enzymes (β-glucosidase, β-d-cellobiosidase, N-acetyl-β-glucosaminidase, phosphatase, leucine aminopeptidase, β-xylosidase) were analyzed by fluorescence-based assays. Biochar amendment reduced leucine aminopeptidase and β-xylosidase potential activity after the incubation period and prior to stress exposure. The 10% biochar rate reduced soil water loss at the lowest stress level (400 J microwave energy g(-1) soil). Enzyme stabilization was demonstrated for β-xylosidase; intermediate biochar application rates prevented a complete loss of this enzyme's potential activity after soil was exposed to 400 (1% biochar treatment) or 1600 (5% biochar treatment) J microwave energy g(-1) soil. Remaining enzyme potential activities were not affected by biochar, and activities decreased with increasing stress levels. We concluded that biochar has the potential to reduce evaporative soil water losses and stabilize certain extracellular enzymes where activity is maintained after a denaturing stress; this effect was biochar rate and enzyme dependent. While biochar may reduce the potential activity of certain soil extracellular enzymes, this phenomenon was not universal as the majority of enzymes assayed in this study were unaffected by exposure to biochar. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. On the mobility of partially denatured DNA in gel electrophoresis: a theoretical investigation

    Science.gov (United States)

    Sean, David

    There are technologies which exploit a rapid reduction of the gel electrophoretic mobility of DNA arising from partial denaturation. The underlying phenomenon behind these experiments---the mechanisms which reduce the mobility---are not very well understood. Such is the purpose of my thesis. The first chapter provides a brief introduction to the field of polymer physics. The subjects covered are carefully chosen to directly relate to the forthcoming research. There is a published semi-empirical formula used to model the rapid decrease of mobility which is largely considered to be consistent with experimental data. The second chapter of this thesis demonstrates that there is a fundamental confusion in the literature regarding the fitting parameter Lr, in the said formula. By going back to the original derivation, a physical interpretation can be given to L r. This interpretation yields theoretical values which are consistent with what has been published. However, we find that an underlying assumption---that the effect of the denaturation does not depend on its position along the DNA fragment---may systematically overestimate experimental observations of Lr. To measure the impact of this assumption, a simulation model of DNA is presented. The article presented in the third chapter reveals that indeed, the position of the denatured region affects the migration of the DNA fragment. A refined version of the formula which takes these factors into account is proposed. The simulations also reveal that, for certain fields, an unexpected conformation completely dominates during migration of the fragment. This surprising result: a squid-like conformation, is explored in chapter four.

  1. Denaturation of collagen structures and their transformation under the physical and chemical effects

    Science.gov (United States)

    Ivankin, A.; Boldirev, V.; Fadeev, G.; Baburina, M.; Kulikovskii, A.; Vostrikova, N.

    2017-11-01

    The process of denaturation of collagen structures under the influence of physical and chemical factors play an important role in the manufacture of food technology and the production of drugs for medicine and cosmetology. The paper discussed the problem of the combined effects of heat treatment, mechanical dispersion and ultrasonic action on the structural changes of the animal collagen in the presence of weak protonated organic acids. Algorithm combined effects of physical and chemical factors as a result of the formation of the technological properties of products containing collagen has been shown.

  2. Nanometer-Scale Dissection of Chromosomes by Atomic Force Microscopy Combined with Heat-Denaturing Treatment

    Science.gov (United States)

    Tsukamoto, Kazumi; Kuwazaki, Seigo; Yamamoto, Kimiko; Shichiri, Motoharu; Yoshino, Tomoyuki; Ohtani, Toshio; Sugiyama, Shigeru

    2006-03-01

    We have developed a method for dissecting chromosome fragments with a size of a few hundred nanometers by atomic force microscopy (AFM). By using this method, we demonstrated reproducible dissections of silkworm chromosomes in the pachytene phase. The dissected fragments were successfully recovered on the cantilever tips, as confirmed by fluorescent microscopy using fluorescent stained chromosomes. To recover dissected chromosome fragments from a larger chromosome, such as the human metaphase chromosome of a somatic cell, heat denaturation was found to be effective. Further improvements in this method may lead to a novel tool for isolating valuable genes and/or investigating local genome structures in the near future.

  3. Denaturing high-performance liquid chromatography mutation analysis in patients with reduced Protein S levels

    DEFF Research Database (Denmark)

    Bathum, Lise; Münster, Anna-Marie; Nybo, Mads

    2008-01-01

    diagnosis and risk estimation. The aim was to design a high-throughput genetic analysis based on denaturing high-performance liquid chromatography to identify sequence variations in the gene coding for Protein S. PATIENTS: In total, 55 patients referred to the Section of Thrombosis and Haemostasis, Odense......BACKGROUND: Patients with congenital Protein S deficiency have increased risk of venous thromboembolism. However, Protein S levels show large intra-individual variation and the biochemical assays have low accuracy and a high interlaboratory variability. Genetic analysis might aid in a more precise......, giving a precise diagnosis and subsequently a better risk estimation....

  4. DNA denaturation through a model of the partition points on a one-dimensional lattice

    International Nuclear Information System (INIS)

    Mejdani, R.; Huseini, H.

    1994-08-01

    We have shown that by using a model of the partition points gas on a one-dimensional lattice, we can study, besides the saturation curves obtained before for the enzyme kinetics, also the denaturation process, i.e. the breaking of the hydrogen bonds connecting the two strands, under treatment by heat of DNA. We think that this model, as a very simple model and mathematically transparent, can be advantageous for pedagogic goals or other theoretical investigations in chemistry or modern biology. (author). 29 refs, 4 figs

  5. Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

    DEFF Research Database (Denmark)

    Christiansen, L; Ged, C; Hombrados, I

    1999-01-01

    to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

  6. The expression of miR-125b regulates angiogenesis during the recovery of heat-denatured HUVECs.

    Science.gov (United States)

    Zhou, Situo; Zhang, Pihong; Liang, Pengfei; Huang, Xiaoyuan

    2015-06-01

    In previous studies we found that miR-125b was down-regulated in denatured dermis of deep partial thickness burn patients. Moreover, miR-125b inhibited tumor-angiogenesis associated with the decrease of ERBB2 and VEGF expression in ovarian cancer cells and breast cancer cells, etc. In this study, we investigated the expression patterns and roles of miR-125b during the recovery of denatured dermis and heat-denatured human umbilical vein endothelial cells (HUVECs). Deep partial thickness burns in Sprague-Dawley rats and the heat-denatured cells (52°C, 35 s) were used for analysis. Western blot analysis and real-time PCR were applied to evaluate the expression of miR-125b and ERBB2 and VEGF. The ability of angiogenesis in heat-denatured HUVECs was analyzed by scratch wound healing and tube formation assay after pri-miR-125b or anti-miR-125b transfection. miR-125b expression was time-dependent during the recovery of heat-denatured dermis and HUVECs. Moreover, miR-125b regulated ERBB2 mRNA and Protein Expression and regulated angiogenesis association with regulating the expression of VEGF in heat-denatured HUVECs. Taken together our results show that the expression of miR-125b is time-dependent and miR-125b plays a regulatory role of angiogenesis during wound healing after burns. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  7. A polymerase chain reaction strategy for the diagnosis of camelpox.

    Science.gov (United States)

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  8. Fidelity and Mutational Spectrum of Pfu DNA Polymerase on a Human Mitochondrial DNA Sequence

    Science.gov (United States)

    André, Paulo; Kim, Andrea; Khrapko, Konstantin; Thilly, William G.

    1997-01-01

    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10−6 must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or “PCR noise”. Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 × 10−7, and five of its more frequent mutations (hot spots) consisted of three transversions (GC → TA, AT → TA, and AT → CG), one transition (AT → GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be

  9. Effect of changing temperature on anaerobic hydrogen production and microbial community composition in an open-mixed culture bioreactor

    Energy Technology Data Exchange (ETDEWEB)

    Karadag, Dogan; Puhakka, Jaakko A. [Department of Chemistry and Bioengineering, Tampere University of Technology, Tampere (Finland)

    2010-10-15

    The temperature effect (37-65 C) on H{sub 2} production from glucose in an open-mixed culture bioreactor using an enrichment culture from a hot spring was studied. The dynamics of microbial communities was investigated by polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). At 45 and 60 C the H{sub 2} production was the highest i.e. 1.71 and 0.85 mol H{sub 2}/mol glucose, respectively. No H{sub 2} was produced at temperatures 50 and 55 C. At 37-45 C, H{sub 2} production was produced by butyrate type fermentation while fermentation mechanism changed to ethanol type at 60 C. Clostridium species were dominant at 37-45 C while at 50-55 C and 60 C the culture was dominated by Bacillus coagulans and Thermoanaerobacterium, respectively. In the presence of B. Coagulans the metabolism was directed to lactate production. The results show that the mixed culture had two optima for H{sub 2} production and that the microbial communities and metabolic patterns promptly changed according to changing temperatures. (author)

  10. DNA repair in DNA-polymerase-deficient mutants of Escherichia coli

    International Nuclear Information System (INIS)

    Smith, D.W.; Tait, R.C.; Harris, A.L.

    1975-01-01

    Escherichia coli mutants deficient in DNA polymerase I, in DNA polymerases I and II, or in DNA polymerase III can efficiently and completely execute excision-repair and postreplication repair of the uv-damaged DNA at 30 0 C and 43 0 C when assayed by alkaline sucrose gradients. Repair by Pol I - and Pol I - , Pol II - cells is inhibited by 1-β-D-arabinofuranosylcytosine (araC) at 43 0 C but not at 30 0 C, whereas that by Pol III - cells is insensitive to araC at any temperature. Thus, either Pol I or Pol III is required for complete and efficient repair, and in their absence Pol II mediates a limited, incomplete dark repair of uv-damaged DNA

  11. Detection of AGEs as markers for carbohydrate metabolism and protein denaturation.

    Science.gov (United States)

    Nagai, Ryoji; Shirakawa, Jun-Ichi; Fujiwara, Yukio; Ohno, Rei-Ichi; Moroishi, Narumi; Sakata, Noriyuki; Nagai, Mime

    2014-07-01

    Approximately 100 years have passed since the Maillard reaction was first reported in the field of food chemistry as a condensation reaction between reducing sugars and amino acids. This reaction is thought to progress slowly primarily from glucose with proteins in vivo. An early-stage product, called the "Amadori product", is converted into advanced glycation end products. Those accumulate in the body in accordance with age, with such accumulation being enhanced by lifestyle-related diseases that result in the denaturation of proteins. Recent studies have demonstrated that intermediate carbonyls are generated by several pathways, and rapidly generate many glycation products. However, accurate quantification of glycation products in vivo is difficult due to instability and differences in physicochemical properties. In this connection, little is known about the relationship between the structure of glycation products and pathology. Furthermore, the interaction between proteins modified by glycation and receptors for advanced glycation end products is also known to induce the production of several inflammatory cytokines. Therefore, those inhibitors have been developed over the world to prevent lifestyle-related diseases. In this review, we describe the process of protein denaturation induced by glycation and discuss the possibility of using the process as a marker of age-related diseases.

  12. Thermal and chemical denaturation of Bacillus circulans xylanase: A biophysical chemistry laboratory module.

    Science.gov (United States)

    Raabe, Richard; Gentile, Lisa

    2008-11-01

    A number of institutions have been, or are in the process of, modifying their biochemistry major to include some emphasis on the quantitative physical chemistry of biomolecules. Sometimes this is done as a replacement for part for the entire physical chemistry requirement, while at other institutions this is incorporated as a component into the traditional two-semester biochemistry series. The latter is the model used for biochemistry and molecular biology majors at the University of Richmond, whose second semester of biochemistry is a course entitled Proteins: Structure, Function, and Biophysics. What is described herein is a protein thermodynamics laboratory module, using the protein Bacillus circulans xylanase, which reinforces many lecture concepts, including: (i) the denatured (D) state ensemble of a protein can be different, depending on how it was populated; (ii) intermediate states may be detected by some spectroscopic techniques but not by others; (iii) the use and assumptions of the van't Hoff approach to calculate ΔH(o) , ΔS(o) , and ΔG(o) (T) for thermal protein unfolding transitions; and (iv) the use and assumptions of an approach that allows determination of the Gibb's free energy of a protein unfolding transition based on the linear dependence of ΔG(o) on the concentration of denaturant used. This module also requires students to design their own experimental protocols and spend time in the primary literature, both important parts of an upper division lab. Copyright © 2008 International Union of Biochemistry and Molecular Biology, Inc.

  13. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  14. Denatured protein-coated docetaxel nanoparticles: Alterable drug state and cytosolic delivery.

    Science.gov (United States)

    Zhang, Li; Xiao, Qingqing; Wang, Yiran; Zhang, Chenshuang; He, Wei; Yin, Lifang

    2017-05-15

    Many lead compounds have a low solubility in water, which substantially hinders their clinical application. Nanosuspensions have been considered a promising strategy for the delivery of water-insoluble drugs. Here, denatured soy protein isolate (SPI)-coated docetaxel nanosuspensions (DTX-NS) were developed using an anti-solvent precipitation-ultrasonication method to improve the water-solubility of DTX, thus improving its intracellular delivery. DTX-NS, with a diameter of 150-250nm and drug-loading up to 18.18%, were successfully prepared by coating drug particles with SPI. Interestingly, the drug state of DTX-NS was alterable. Amorphous drug nanoparticles were obtained at low drug-loading, whereas at a high drug-loading, the DTX-NS drug was mainly present in the crystalline state. Moreover, DTX-NS could be internalized at high levels by cancer cells and enter the cytosol by lysosomal escape, enhancing cell cytotoxicity and apoptosis compared with free DTX. Taken together, denatured SPI has a strong stabilization effect on nanosuspensions, and the drug state in SPI-coated nanosuspensions is alterable by changing the drug-loading. Moreover, DTX-NS could achieve cytosolic delivery, generating enhanced cell cytotoxicity against cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Effects of thermally induced denaturation on technological-functional properties of whey protein isolate-based films.

    Science.gov (United States)

    Schmid, M; Krimmel, B; Grupa, U; Noller, K

    2014-09-01

    This study examined how and to what extent the degree of denaturation affected the technological-functional properties of whey protein isolate (WPI)-based coatings. It was observed that denaturation affected the material properties of WPI-coated films significantly. Surface energy decreased by approximately 20% compared with native coatings. Because the surface energy of a coating should be lower than that of the substrate, this might result in enhanced wettability characteristics between WPI-based solution and substrate surface. Water vapor barrier properties increased by about 35% and oxygen barrier properties increased by approximately 33%. However, significant differences were mainly observed between coatings made of fully native WPI and ones with a degree of denaturation of 25%. Higher degrees of denaturation did not lead to further improvement of material properties. This observation offers cost-saving potential: a major share of denatured whey proteins may be replaced by fully native ones that are not exposed to energy-intensive heat treatment. Furthermore, native WPI solutions can be produced with higher dry matter content without gelatinizing. Hence, less moisture has to be removed through drying, resulting in reduced energy consumption. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Identification of an Unfolding Intermediate for a DNA Lesion Bypass Polymerase

    Science.gov (United States)

    Sherrer, Shanen M.; Maxwell, Brian A.; Pack, Lindsey R.; Fiala, Kevin A.; Fowler, Jason D.; Zhang, Jun; Suo, Zucai

    2012-01-01

    Sulfolobus solfataricusDNA Polymerase IV (Dpo4), a prototype Y-family DNA polymerase, has been well characterized biochemically and biophysically at 37 °C or lower temperatures. However, the physiological temperature of the hyperthermophile S. solfataricus is approximately 80 °C. With such a large discrepancy in temperature, the in vivo relevance of these in vitro studies of Dpo4 has been questioned. Here, we employed circular dichroism spectroscopy and fluorescence-based thermal scanning to investigate the secondary structural changes of Dpo4 over a temperature range from 26 to 119 °C. Dpo4 was shown to display a high melting temperature characteristic of hyperthermophiles. Unexpectedly, the Little Finger domain of Dpo4, which is only found in the Y-family DNA polymerases, was shown to be more thermostable than the polymerase core. More interestingly, Dpo4 exhibited a three-state cooperative unfolding profile with an unfolding intermediate. The linker region between the Little Finger and Thumb domains of Dpo4 was found to be a source of structural instability. Through site-directed mutagenesis, the interactions between the residues in the linker region and the Palm domain were identified to play a critical role in the formation of the unfolding intermediate. Notably, the secondary structure of Dpo4 was not altered when the temperature was increased from 26 to 87.5 °C. Thus, in addition to providing structural insights into the thermal stability and an unfolding intermediate of Dpo4, our work also validated the relevance of the in vitro studies of Dpo4 performed at temperatures significantly lower than 80 °C. PMID:22667759

  17. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  18. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  19. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    Institute of Scientific and Technical Information of China (English)

    LUO Rui; ZHANG DaMing

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared.The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electrophoresis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effectively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase's infidelity, and hence the solution to lighten the abnormality was also proposed.

  20. A calorimetric study of the interactions in the aqueous solutions of lysozyme in the presence of denaturing cosolvents

    International Nuclear Information System (INIS)

    Castronuovo, Giuseppina; Niccoli, Marcella

    2012-01-01

    Highlights: ► A thermodynamic method is reported to monitor the chemical denaturation of lysozyme. ► The enthalpic interaction coefficients are very useful parameters to gain information about the mechanism through which two hydrated molecules interact in solution. ► Hypotheses are proposed about the mechanism underlying the denaturation of lysozyme induced by high concentrations of urea or ethanol. - Abstract: A thermodynamic method is reported to monitor the chemical denaturation of lysozyme. Heats of dilution of the protein in concentrated aqueous solutions of urea or ethanol have been determined at 298.15 K by flow microcalorimetry. The pairwise enthalpic interaction coefficients of the protein in the different solvent media are derived. These parameters allow to gain information about the influence of the cosolvents on the interactions acting between two interacting hydrated molecules of lysozyme, hence on the denaturation process. At increasing urea concentration, up to about 6 mol kg −1 , the values of the interaction coefficients are large and negative and remain almost unaltered. The invariance of the coefficients underlines that, even in highly concentrated urea, the hydration shell of the protein is such to maintain essentially unaltered the native conformation. At higher urea concentrations, a sudden change in the sign of the coefficients monitors the variation in the interactions between two hydrated denatured protein molecules. The same trend is found when ethanol is the cosolvent. At increasing concentration of the cosolvent, coefficients are, at first, almost invariant. After that, denaturation occurs, detected as a jump toward much more negative values. The results obtained are rationalized on the basis of those previously found for small model molecules in concentrated solutions of urea or ethanol. The thermodynamic framework allows useful comments to be made on the possible mode of action of the two cosolvents on the stability of proteins

  1. A calorimetric study of the interactions in the aqueous solutions of lysozyme in the presence of denaturing cosolvents

    Energy Technology Data Exchange (ETDEWEB)

    Castronuovo, Giuseppina, E-mail: giuseppina.castronuovo@unina.it [Department of Chemistry, University Federico II of Naples, Complesso Universitario Monte S. Angelo, via Cintia, 80126 Naples (Italy); Niccoli, Marcella [Department of Chemistry, University Federico II of Naples, Complesso Universitario Monte S. Angelo, via Cintia, 80126 Naples (Italy)

    2012-09-10

    Highlights: Black-Right-Pointing-Pointer A thermodynamic method is reported to monitor the chemical denaturation of lysozyme. Black-Right-Pointing-Pointer The enthalpic interaction coefficients are very useful parameters to gain information about the mechanism through which two hydrated molecules interact in solution. Black-Right-Pointing-Pointer Hypotheses are proposed about the mechanism underlying the denaturation of lysozyme induced by high concentrations of urea or ethanol. - Abstract: A thermodynamic method is reported to monitor the chemical denaturation of lysozyme. Heats of dilution of the protein in concentrated aqueous solutions of urea or ethanol have been determined at 298.15 K by flow microcalorimetry. The pairwise enthalpic interaction coefficients of the protein in the different solvent media are derived. These parameters allow to gain information about the influence of the cosolvents on the interactions acting between two interacting hydrated molecules of lysozyme, hence on the denaturation process. At increasing urea concentration, up to about 6 mol kg{sup -1}, the values of the interaction coefficients are large and negative and remain almost unaltered. The invariance of the coefficients underlines that, even in highly concentrated urea, the hydration shell of the protein is such to maintain essentially unaltered the native conformation. At higher urea concentrations, a sudden change in the sign of the coefficients monitors the variation in the interactions between two hydrated denatured protein molecules. The same trend is found when ethanol is the cosolvent. At increasing concentration of the cosolvent, coefficients are, at first, almost invariant. After that, denaturation occurs, detected as a jump toward much more negative values. The results obtained are rationalized on the basis of those previously found for small model molecules in concentrated solutions of urea or ethanol. The thermodynamic framework allows useful comments to be made on

  2. Chemical denaturation of globular proteins at the air/water interface: an x-ray and neutron reflectometry study

    International Nuclear Information System (INIS)

    Perriman, A.W.; Henderson, M.J.; White, J.W.

    2003-01-01

    Full text: X-ray and neutron reflectometry has been used to probe the equilibrium surface structure of hen egg white lysozyme (lysozyme) and bovine β -lactoglobulin (β -lactoglobulin) under denaturing conditions at the air-water interface. This was achieved by performing experiments on 10 mg mL -1 protein solutions containing increasing concentrations of the chemical denaturant guanidinium hydrochloride (G.HCl). For solutions containing no G.HCl, the surface structure of the proteins was represented by a two-layer model with total thicknesses of 48 Angstroms and 38 Angstroms for lysozyme and β -lactoglobulin, respectively. The total volume of a single protein molecule and the associated water molecules was evaluated to be approximately 45 (0.3) nm 3 for lysozyme, and 60 (0.3) nm 3 for β-lactoglobulin. The thickness dimensions and the total volumes compared favourably with the crystal dimensions of 45 x 30 x 30 Angstroms (40.5 nm 3 ),1 and 36 x 36 x 36 Angstroms (47 nm 3 ) 2 for lysozyme and β -lactoglobulin, respectively. This comparison suggests that when no denaturant was present, the structures of lysozyme and β -lactoglobulin were near to their native conformations at the air-water interface. The response to the presence of the chemical denaturant was different for each protein. The surface layer of β-lactoglobulin expanded at very low concentrations (0.2 mol dm -3 ) of G.HCl. In contrast, the lysozyme layer contracted. At higher concentrations, unfolding of both the proteins led to the formation of a third diffuse layer. In general, lysozyme appeared to be less responsive to the chemical denaturant, which is most likely a result of the higher disulfide content of lysozyme. A protocol allowing quantitative thermodynamic analysis of the contribution from the air-water interface to the chemical denaturation of a protein was developed

  3. Chemical fidelity of an RNA polymerase ribozyme

    DEFF Research Database (Denmark)

    Attwater, J.; Tagami, S.; Kimoto, M.

    2013-01-01

    for function. Here we have explored the chemical fidelity, i.e. substrate selectivity and specificity for both single and multiple catalytic steps of the Z RNA polymerase ribozyme-a modern day analogue of the primordial RNA replicase. Using a wide range of nucleotide analogues and ionic conditions, we observe......The emergence of catalytically active RNA enzymes (ribozymes) is widely believed to have been an important transition in the origin of life. In the context of a likely heterogeneous chemical environment, substrate specificity and selectivity of these primordial enzymes would have been critical...

  4. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...

  5. Biological function evaluation and effects of laser micro-pore burn-denatured acellular dermal matrix.

    Science.gov (United States)

    Zhang, Youlai; Zeng, Yuanlin; Xin, Guohua; Zou, Lijin; Ding, Yuewei; Duyin, Jiang

    2018-03-01

    In the field of burns repairs, many problems exist in the shortage of donor skin, the expense of allograft or xenograft skin, temporary substitution and unsatisfactory extremity function after wound healing. Previous studies showed that burn-denatured skin could return to normal dermis formation and function. This study investigates the application of laser micro-pore burn-denatured acellular dermis matrix (DADM) from an escharotomy in the repair of burn wounds and evaluates the biological properties and wound repair effects of DADM in implantation experiments in Kunming mice. Specific-pathogen-free (SPF) Kunming mice were used in this study. A deep II° burn wound was created on the dorsum of the mice by an electric heated water bath. The full-thickness wound tissue was harvested. The necrotic tissue and subcutaneous tissue were removed. The denatured dermis was preserved and treated with 0.25% trypsin, 0.5% Triton X-100. The DADM was drilled by laser micro-pore. The biological properties and grafting effects of laser micro-pore burn-DADM were evaluated by morphology, cytokine expression levels and subcutaneous implantation experiments in Kunming mice. We found statistical significance (Ppore burn-DADM (experimental group) compared to the control group (no laser micro-pore burn-DADM). Cytokine expression level was different in the dermal matrixes harvested at various time points after burn (24h, 48h, 72h and infected wound group). Comparing the dermal matrix from 24h burn tissue to infected wound tissue, the expression level of IL-6, MMP-24, VE-cadherin and VEGF were decreased. We found no inflammatory cells infiltration in the dermal matrix were observed in both experimental and control groups (24h burn group), while the obviously vascular infiltration and fiber fusion were observed in the experimental group after subcutaneous implantation experiments. There was better bio-performance, low immunogenicity and better dermal incorporation after treated by laser

  6. Preparation of denatured sup(99m)Tc labeled HSA aerosols of different median diameters for various imaging studies

    International Nuclear Information System (INIS)

    Raghunath, B.; Kotrappa, P.; Soni, P.S.; Ganatra, R.D.

    1982-01-01

    The preparation of denatured sup(99m)Tc-labelled human serum albumin (HSA) aerosols of different median diameters is described using the BARC (Bhabha Atomic Research Centre) dry aerosol generation and delivery system. The applications of these radioactive aerosols are demonstrated in aerosol scintigraphy of lungs, mucociliary movement studies and lymphoscintigraphy in rabbits. It is concluded that the BARC system gives a simplified, rapid and versatile procedure for generation of denatured volume tagged HSA aerosols for a variety of clinical applications. (U.K.)

  7. Dynamics of Ionic Liquid-Assisted Refolding of Denatured Cytochrome c: A Study of Preferential Interactions toward Renaturation.

    Science.gov (United States)

    Singh, Upendra Kumar; Patel, Rajan

    2018-05-25

    In vitro refolding of denatured protein and the influence of the alkyl chain on the refolding of a protein were tested using long chain imidazolium chloride salts, 1-methyl-3-octylimidazolium chloride [C 8 mim][Cl], and 1-decyl-3-methylimidazolium chloride [C 10 mim][Cl]. The horse heart cytochrome c (h-cyt c) was denatured by urea and guanidinium hydrochloride (GdnHCl), as well as by base-induced denaturation at pH 13, to provide a broad overview of the overall refolding behavior. The variation in the alkyl chain of the ionic liquids (ILs) showed a profound effect on the refolding of denatured h-cyt c. The ligand-induced refolding was correlated to understand the mechanism of the conformational stability of proteins in aqueous solutions of ILs. The results showed that the long chain ILs having the [C 8 mim] + and [C 10 mim] + cations promote the refolding of alkali-denatured h-cyt c. The IL having the [C 10 mim] + cation efficiently refolded the alkali-denatured h-cyt c with the formation of the MG state, whereas the IL having the [C 8 mim] + cation, which is known to be compatible for protein stability, shows slight refolding and forms a different transition state. The lifetime results show successful refolding of alkaline-denatured h-cyt c by both of the ILs, however, more refolding was observed in the case of [C 10 mim][Cl], and this was correlated with the fast and medium lifetimes (τ 1 and τ 2 ) obtained, which show an increase accompanied by an increase in secondary structure. The hydrophobic interactions plays an important role in the refolding of chemically and alkali-denatured h-cyt c by long chain imidazolium ILs. The formation of the MG state by [C 10 mim][Cl] was also confirmed, as some regular structure exists far below the CMC of IL. The overall results suggested that the [C 10 mim] + cation bound to the unfolded h-cyt c triggers its refolding by electrostatic and hydrophobic interactions that stabilize the MG state.

  8. Biochemical characterization of enzyme fidelity of influenza A virus RNA polymerase complex.

    Directory of Open Access Journals (Sweden)

    Shilpa Aggarwal

    2010-04-01

    Full Text Available It is widely accepted that the highly error prone replication process of influenza A virus (IAV, together with viral genome assortment, facilitates the efficient evolutionary capacity of IAV. Therefore, it has been logically assumed that the enzyme responsible for viral RNA replication process, influenza virus type A RNA polymerase (IAV Pol, is a highly error-prone polymerase which provides the genomic mutations necessary for viral evolution and host adaptation. Importantly, however, the actual enzyme fidelity of IAV RNA polymerase has never been characterized.Here we established new biochemical assay conditions that enabled us to assess both polymerase activity with physiological NTP pools and enzyme fidelity of IAV Pol. We report that IAV Pol displays highly active RNA-dependent RNA polymerase activity at unbiased physiological NTP substrate concentrations. With this robust enzyme activity, for the first time, we were able to compare the enzyme fidelity of IAV Pol complex with that of bacterial phage T7 RNA polymerase and the reverse transcriptases (RT of human immunodeficiency virus (HIV-1 and murine leukemia virus (MuLV, which are known to be low and high fidelity enzymes, respectively. We observed that IAV Pol displayed significantly higher fidelity than HIV-1 RT and T7 RNA polymerase and equivalent or higher fidelity than MuLV RT. In addition, the IAV Pol complex showed increased fidelity at lower temperatures. Moreover, upon replacement of Mg(++ with Mn(++, IAV Pol displayed increased polymerase activity, but with significantly reduced processivity, and misincorporation was slightly elevated in the presence of Mn(++. Finally, when the IAV nucleoprotein (NP was included in the reactions, the IAV Pol complex exhibited enhanced polymerase activity with increased fidelity.Our study indicates that IAV Pol is a high fidelity enzyme. We envision that the high fidelity nature of IAV Pol may be important to counter-balance the multiple rounds of

  9. RNA polymerase activity of Ustilago maydis virus

    Energy Technology Data Exchange (ETDEWEB)

    Yie, S.W.

    1986-01-01

    Ustilago maydis virus has an RNA polymerase enzyme which is associated with virion capsids. In the presence of Mg/sup 2 +/ ion and ribonucleotide triphosphate, the enzyme catalyzes the in vitro synthesis of mRNA by using dsRNA as a template. The products of the UmV RNA polymerase were both ssRNA and dsRNA. The dsRNA was determined by characteristic mobilities in gel electrophoresis, lack of sensitivity to RNase, and specific hybridization tests. The ssRNAs were identified by elution from a CF-11 column and by their RNase sensitivity. On the basis of the size of ssRNAs, it was concluded that partial transcripts were produced from H dsRNA segments, and full length transcripts were produced from M and L dsRNA segments. The following observations indicates that transcription occurs by strand displacement; (1) Only the positive strand of M2 dsRNA was labeled by the in vitro reaction. (2) The M2 dsRNA which had been labeled with /sup 32/''P-UTP in vitro could be chased from dsRNA with unlabeled UTP. The transcription products of three UmV strains were compared, and the overall pattern of transcription was very similar among them.

  10. Replicative DNA polymerase mutations in cancer☆

    Science.gov (United States)

    Heitzer, Ellen; Tomlinson, Ian

    2014-01-01

    Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393

  11. Replicative DNA polymerase mutations in cancer.

    Science.gov (United States)

    Heitzer, Ellen; Tomlinson, Ian

    2014-02-01

    Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Solving the RNA polymerase I structural puzzle

    Energy Technology Data Exchange (ETDEWEB)

    Moreno-Morcillo, María [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Taylor, Nicholas M. I. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Gruene, Tim [Georg-August-University, Tammannstrasse 4, 37077 Göttingen (Germany); Legrand, Pierre [SOLEIL Synchrotron, L’Orme de Merisiers, Saint Aubin, Gif-sur-Yvette (France); Rashid, Umar J. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Ruiz, Federico M. [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); Steuerwald, Ulrich; Müller, Christoph W. [European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany); Fernández-Tornero, Carlos, E-mail: cftornero@cib.csic.es [Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28040 Madrid (Spain); European Molecular Biology Laboratory, Meyerhofstrasse 1, 69117 Heidelberg (Germany)

    2014-10-01

    Details of the RNA polymerase I crystal structure determination provide a framework for solution of the structures of other multi-subunit complexes. Simple crystallographic experiments are described to extract relevant biological information such as the location of the enzyme active site. Knowing the structure of multi-subunit complexes is critical to understand basic cellular functions. However, when crystals of these complexes can be obtained they rarely diffract beyond 3 Å resolution, which complicates X-ray structure determination and refinement. The crystal structure of RNA polymerase I, an essential cellular machine that synthesizes the precursor of ribosomal RNA in the nucleolus of eukaryotic cells, has recently been solved. Here, the crucial steps that were undertaken to build the atomic model of this multi-subunit enzyme are reported, emphasizing how simple crystallographic experiments can be used to extract relevant biological information. In particular, this report discusses the combination of poor molecular replacement and experimental phases, the application of multi-crystal averaging and the use of anomalous scatterers as sequence markers to guide tracing and to locate the active site. The methods outlined here will likely serve as a reference for future structural determination of large complexes at low resolution.

  13. Fuel utilization improvement in PWRs using the denatured 233U-Th cycle

    International Nuclear Information System (INIS)

    Jones, H.M.; Schwenk, G.A.; Toops, E.C.; Yotinen, V.O.

    1980-06-01

    A number of changes in PWR core design and/or operating strategy were evaluated to assess the fuel utilization improvement achievable by their implementation in a PWR using thorium-based fuel and operating in a recycle mode. The reference PWR for this study was identical to the B and W Standard Plant except that the fuel pellets were of denatured ( 233 U/ 238 U-Th)O 2 . An initial scoping study identified the three most promising improvement concepts as (1) a very tight lattice, (2) thorium blankets, and (3) ThO 2 rods placed in available guide tubes. A conceptual core design incorporating these changes was then developed, and the fuel utilization of this modified design was compared with that of the reference case

  14. Investigating the fermentation of cocoa by correlating denaturing gradient gel electrophoresis profiles and near infrared spectra

    DEFF Research Database (Denmark)

    Nielsen, Dennis Sandris; Snitkjær, Pia; van der Berg, Franciscus Winfried J

    2008-01-01

    demonstrating the microbial succession taking place during the fermentation. Subsequently the DGGE spectra were correlated to the NIR spectra using Partial Least Squares regression models (PLS2). Correlations of 0.87 (bacterial derived DGGE spectra) and 0.81 (yeast derived DGGE spectra) were obtained indicating......Raw cocoa has an astringent, unpleasant taste and flavour, and has to be fermented, dried and roasted in order to obtain the characteristic cocoa flavour and taste. During the fermentation microbial activity outside the cocoa beans induces biochemical and physical changes inside the beans...... of the beans and the chemical processes inside the beans have been carried out previously. Recently it has been shown that Denaturing Gradient Gel Electrophoresis (DGGE) offers an efficient tool for monitoring the microbiological changes taking place during the fermentation of cocoa. Near Infrared (NIR...

  15. Fluorescence lifetime components reveal kinetic intermediate states upon equilibrium denaturation of carbonic anhydrase II.

    Science.gov (United States)

    Nemtseva, Elena V; Lashchuk, Olesya O; Gerasimova, Marina A; Melnik, Tatiana N; Nagibina, Galina S; Melnik, Bogdan S

    2017-12-21

    In most cases, intermediate states of multistage folding proteins are not 'visible' under equilibrium conditions but are revealed in kinetic experiments. Time-resolved fluorescence spectroscopy was used in equilibrium denaturation studies. The technique allows for detecting changes in the conformation and environment of tryptophan residues in different structural elements of carbonic anhydrase II which in its turn has made it possible to study the intermediate states of carbonic anhydrase II under equilibrium conditions. The results of equilibrium and kinetic experiments using wild-type bovine carbonic anhydrase II and its mutant form with the substitution of leucine for alanine at position 139 (L139A) were compared. The obtained lifetime components of intrinsic tryptophan fluorescence allowed for revealing that, the same as in kinetic experiments, under equilibrium conditions the unfolding of carbonic anhydrase II ensues through formation of intermediate states.

  16. Functionality screen of streptavidin mutants by non-denaturing SDS-PAGE using biotin-4-fluorescein.

    Science.gov (United States)

    Humbert, Nicolas; Ward, Thomas R

    2008-01-01

    Site-directed mutagenesis or directed evolution of proteins often leads to the production of inactive mutants. For streptavidin and related proteins, mutations may lead to the loss of their biotin-binding properties. With high-throughput screening methodologies in mind, it is imperative to detect, prior to the high-density protein production, the bacteria that produce non-functional streptavidin isoforms. Based on the incorporation of biotin-4-fluorescein in streptavidin mutants present in Escherichia coli bacterial extracts, we detail a functional screen that allows the identification of biotin-binding streptavidin variants. Bacteria are cultivated in a small volume, followed by a rapid treatment of the cells; biotin-4-fluorescein is added to the bacterial extract and loaded on an Sodium Dodecyl Sulfate Poly-Acrylamide Gel Electrophoresis (SDS-PAGE) under non-denaturing conditions. Revealing is performed using a UV transilluminator. This screen is thus easy to implement, cheap and requires only readily available equipment.

  17. 125I-labeled cortisol radioimmunoassay in which serum binding protein are enzymatically denatured

    International Nuclear Information System (INIS)

    Hasler, M.J.; Painter, K.; Niswender, G.D.

    1976-01-01

    We report an iodine-125 radioimmunoassay for cortisol in biological fluids, in which interfering binding proteins are enzymatically denatured. An antiserum to cortisol-3-carboxymethyloxime-bovine serum albumin, extremely low cross-reacting with other corticosteroids, was raised in rabbits. A cortisol-3-carboxymethyloxime tyrosine methyl ester derivative was synthesized and labeled with iodine-125 by standard radioiodination techniques. To eliminate the need for extraction and recovery procedures, we digested interfering binding with a proteolytic enzyme, which then was heat-inactivated before adding the labeled derivative and the premixed, preincubated antiserum complex. There was quantitative analytical recovery of esogenous cortisol added to sera from a normal man, a normal woman, and a pregnant woman. Values for the same samples agreed after extraction and chromatographic purification and agreed well with values obtained by other techniques by independent reference laboratories. The five-step assay can be done in 6 h or less

  18. Aqueous Solutions of the Ionic Liquid 1-butyl-3-methylimidazolium Chloride Denature Proteins

    International Nuclear Information System (INIS)

    Baker, Gary A.; Heller, William T.

    2009-01-01

    As we advance our understanding, ionic liquids (ILs) are finding ever broader scope within the chemical sciences including, most recently, pharmaceutical, enzymatic, and bioanalytical applications. With examples of enzymatic activity reported in both neat ILs and in IL/water mixtures, enzymes are frequently assumed to adopt a quasi-native conformation, even if little work has been carried out to date toward characterizing the conformation, dynamics, active-site perturbation, cooperativity of unfolding transitions, free energy of stabilization, or aggregation/oligomerization state of enzymes in the presence of an IL solvent component. In this study, human serum albumin and equine heart cytochrome c were characterized in aqueous solutions of the fully water-miscible IL 1-butyl-3-methylimidazolium chloride, (bmim)Cl, by small-angle neutron and X-ray scattering. At (bmim)Cl concentrations up to 25 vol.%, these two proteins were found to largely retain their higher-order structures whereas both proteins become highly denatured at the highest IL concentration studied here (i.e., 50 vol.% (bmim)Cl). The response of these proteins to (bmim)Cl is analogous to their behavior in the widely studied denaturants guanidine hydrochloride and urea which similarly lead to random coil conformations at excessive molar concentrations. Interestingly, human serum albumin dimerizes in response to (bmim)Cl, whereas cytochrome c remains predominantly in monomeric form. These results have important implications for enzymatic studies in aqueous IL media, as they suggest a facile pathway through which biocatalytic activity can be altered in these nascent and potentially green electrolyte systems

  19. Application of PCR-denaturing-gradient gel electrophoresis (DGGE) method to examine microbial community structure in asparagus fields with growth inhibition due to continuous cropping.

    Science.gov (United States)

    Urashima, Yasufumi; Sonoda, Takahiro; Fujita, Yuko; Uragami, Atsuko

    2012-01-01

    Growth inhibition due to continuous cropping of asparagus is a major problem; the yield of asparagus in replanted fields is low compared to that in new fields, and missing plants occur among young seedlings. Although soil-borne disease and allelochemicals are considered to be involved in this effect, this is still controversial. We aimed to develop a technique for the biological field diagnosis of growth inhibition due to continuous cropping. Therefore, in this study, fungal community structure and Fusarium community structure in continuously cropped fields of asparagus were analyzed by polymerase chain reaction/denaturing-gradient gel electrophoresis (PCR-DGGE). Soil samples were collected from the Aizu region of Fukushima Prefecture, Japan. Soil samples were taken from both continuously cropped fields of asparagus with growth inhibition and healthy neighboring fields of asparagus. The soil samples were collected from the fields of 5 sets in 2008 and 4 sets in 2009. We were able to distinguish between pathogenic and non-pathogenic Fusarium by using Alfie1 and Alfie2GC as the second PCR primers and PCR-DGGE. Fungal community structure was not greatly involved in the growth inhibition of asparagus due to continuous cropping. By contrast, the band ratios of Fusarium oxysporum f. sp. asparagi in growth-inhibited fields were higher than those in neighboring healthy fields. In addition, there was a positive correlation between the band ratios of Fusarium oxysporum f. sp. asparagi and the ratios of missing asparagus plants. We showed the potential of biological field diagnosis of growth inhibition due to continuous cropping of asparagus using PCR-DGGE.

  20. DNA repair synthesis in human fibroblasts requires DNA polymerase delta

    International Nuclear Information System (INIS)

    Nishida, C.; Reinhard, P.; Linn, S.

    1988-01-01

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone

  1. Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.

    Directory of Open Access Journals (Sweden)

    Ahmed Abd El Wahed

    Full Text Available Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF. Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR are the standard method for molecular detection of the dengue virus (DENV. Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA assays were developed to detect DENV1-4.Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4 to 241 (DENV1-3 RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal and in Bangkok (Thailand. In Kedougou, the RT-RPA was operated at an ambient temperature of 38 °C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31 and 100% (n=23, respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90 and 100%(n=41, respectively.During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.

  2. T1ρ is superior to T2 mapping for the evaluation of articular cartilage denaturalization with osteoarthritis: radiological-pathological correlation after total knee arthroplasty.

    Science.gov (United States)

    Takayama, Yukihisa; Hatakenaka, Masamitsu; Tsushima, Hidetoshi; Okazaki, Ken; Yoshiura, Takashi; Yonezawa, Masato; Nishikawa, Kei; Iwamoto, Yukihide; Honda, Hiroshi

    2013-04-01

    We compared the diagnostic performance of T1ρ and T2 mappings in the evaluation of denatured articular cartilage with osteoarthritis of the knee. 2D-Sagittal T1ρ and T2 mappings of the knee were obtained from 16 patients before total knee arthroplasty. After surgery, specimens of the femur and tibia were regionally segmented according to a 5-point scale of the severity of denaturalization. The T1ρ and T2 values in the full thickness of the articular cartilage in each region were measured by two observers. The two mappings were compared for their ability to differentiate between normal and denatured articular cartilage and also for their usefulness in grading the severity of the denaturalization using the area under receiver operating characteristic curves (Az). A pT2 mapping for the differentiation between normal and denatured articular cartilage (pT2 mapping could not. However, there were no significant differences between the two mappings in the discrimination of mild versus moderate denaturalization or of moderate versus severe denaturalization. The two observers showed good agreement in the results (intraclass correlation coefficient=0.81 for T1ρ and 0.92 for T2). T1ρ mapping is superior to T2 mapping for the evaluation of denatured articular cartilage with osteoarthritis of the knee. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  3. Laboratory Exercise for Studying the Morphology of Heat-Denatured and Amyloid Aggregates of Lysozyme by Atomic Force Microscopy

    Science.gov (United States)

    Gokalp, Sumeyra; Horton, William; Jónsdóttir-Lewis, Elfa B.; Foster, Michelle; Török, Marianna

    2018-01-01

    To facilitate learning advanced instrumental techniques, essential tools for visualizing biomaterials, a simple and versatile laboratory exercise demonstrating the use of Atomic Force Microscopy (AFM) in biomedical applications was developed. In this experiment, the morphology of heat-denatured and amyloid-type aggregates formed from a low-cost…

  4. Evaluation of several techniques to modify denatured muscle tissue to obtain a scaffold for peripheral nerve regeneration

    NARCIS (Netherlands)

    Meek, MF; den Dunnen, WFA; Schakenraad, JM; Robinson, PH

    The aim of this study was to (1) evaluate the effect of several preparation techniques of denatured muscle tissue to obtain an open three-dimensional structure, and (2) test if this scaffold is suitable for peripheral nerve regeneration. Four samples (A-D) of muscle tissue specimens were evaluated

  5. Sequential Events in the Irreversible Thermal Denaturation of Human Brain-Type Creatine Kinase by Spectroscopic Methods

    Directory of Open Access Journals (Sweden)

    Yan-Song Gao

    2010-06-01

    Full Text Available The non-cooperative or sequential events which occur during protein thermal denaturation are closely correlated with protein folding, stability, and physiological functions. In this research, the sequential events of human brain-type creatine kinase (hBBCK thermal denaturation were studied by differential scanning calorimetry (DSC, CD, and intrinsic fluorescence spectroscopy. DSC experiments revealed that the thermal denaturation of hBBCK was calorimetrically irreversible. The existence of several endothermic peaks suggested that the denaturation involved stepwise conformational changes, which were further verified by the discrepancy in the transition curves obtained from various spectroscopic probes. During heating, the disruption of the active site structure occurred prior to the secondary and tertiary structural changes. The thermal unfolding and aggregation of hBBCK was found to occur through sequential events. This is quite different from that of muscle-type CK (MMCK. The results herein suggest that BBCK and MMCK undergo quite dissimilar thermal unfolding pathways, although they are highly conserved in the primary and tertiary structures. A minor difference in structure might endow the isoenzymes dissimilar local stabilities in structure, which further contribute to isoenzyme-specific thermal stabilities.

  6. New comprehensive denaturing-gradient-gel-electrophoresis assay for KRAS mutation detection applied to paraffin-embedded tumours

    NARCIS (Netherlands)

    Hayes, VM; Westra, JL; Verlind, E; Bleeker, W; Plukker, JT; Hofstra, RMW; Buys, CHCM

    2000-01-01

    A comprehensive mutation detection assay is presented for the entire coding region and all splice site junctions of the KRAS oncogene. The assay is based on denaturing gradient gel electrophoresis and applicable to archival paraffin-embedded tumour material. All KRAS amplicons are analysed within

  7. Denaturation and in Vitro Gastric Digestion of Heat-Treated Quinoa Protein Isolates Obtained at Various Extraction pH

    NARCIS (Netherlands)

    Ruiz, Geraldine Avila; Opazo-Navarrete, Mauricio; Meurs, Marlon; Minor, Marcel; Sala, Guido; Boekel, van Tiny; Stieger, Markus; Janssen, Anja E.M.

    2016-01-01

    The aim of this study was to determine the influence of heat processing on denaturation and digestibility properties of protein isolates obtained from sweet quinoa (Chenopodium quinoa Willd) at various extraction pH values (8, 9, 10 and 11). Pretreatment of suspensions of protein isolates at 60,

  8. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

    1994-05-01

    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  9. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  10. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    OpenAIRE

    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  11. RNA binding and replication by the poliovirus RNA polymerase

    International Nuclear Information System (INIS)

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to 32 P-labeled ribohomopolymeric RNAs was examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K a for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 x 10 9 M -1 . The polymerase binds to a subgenomic RNAs which contain the 3' end of the genome with a K a similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3' noncoding region

  12. Probes of eukaryotic DNA-dependent RNA polymerase II-I. Binding of 9-beta-D-arabinofuranosyl-6-mercaptopurine to the elongation subsite.

    Science.gov (United States)

    Cho, J M; Kimball, A P

    1982-08-15

    9-beta-D-Arabinofuranosyl-6-mercaptopurine (ara-6-MP) was used to affinity-label wheat germ DNA-dependent RNA polymerase II (or B) (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6). This nucleoside analogue was found to be a competitive inhibitor with respect to [3H]UMP incorporation. Natural substrates protected the enzyme from inactivation by ara-6-MP when the enzyme was preincubated with excess concentrations of substrates, suggesting that the inhibitor binds at the elongation subsite. The inhibitor bound the catalytic center of the enzyme with a stoichiometry of 0.6:1. The sulfhydryl reagent, dithiothreitol, reversed the inhibition by ara-6-MP, suggesting that the 6-thiol group of the inhibitor was interacting closely with an essential cysteine residue in the catalytic center of the enzyme. Chromatographic analysis of the pronase-digestion products of the RNA polymerase II-ara-6-MP complex also showed that ara-6-MP had bound a cysteine residue. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the denatured [6-35S]ara-6-MP-labeled RNA polymerase II revealed that over 80% of the radioactivity was associated with the IIb subunit of the enzyme.

  13. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    frequently mutated position and can lead to coresistance of isoniazid and ethionamide. The primer was designed using sequences of inhA gene Mycobacterium tuberculosis from www.ncbi.nlm.nih.gov (bank genes: AF106077. Results obtained the best primer pair and tested in vitro using Polymerase Chain Reaction method. DNA template used were MDR-TB clinical isolate. Amplifying process was begun with predenaturation at 95°C for 15 minutes and followed by 45 cycles of amplification (denaturation at 94°C for 1 minutes, annealing at 56°C for 1 minute 20 seconds and extension at 72°C for 2 minutes with a final extension at 72°C for 10 minutes. The PCR products were detected using 1,5% b/v agarose gel electrophoresis. In conclusion the best primer pair selected based on the criteria of the Clone Manager Suite 6 program (University of Groningen such as: primer length, %GC, Tm (melting temperature, primers interaction (dimers and hairpins, stability, repeats, runs, and false priming. The primer sequence were forward primer (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3' and reverse primer (pR-inhA 5' CGACCGTCATCC-AGTTGTA 3' with the length 460 bp. ne if they are suitable for consumption according to the guideline by the Director General of Food and Drug Monitoring in terms of lead and cadmium contents. The study was conducted by collecting samples in the area of ??the Sungai Mati estuary and Pemogan area. Samples were prepared by wet destruction method using reverse aqua regia and were analysed using atomic absorption spectrophotometer (AAS at 283,3 nm for Pb and 228,8 nm for Cd. The results show that all fruits investigated contain Pb and Cd with consentrations higher than the guideline.

  14. Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

    Science.gov (United States)

    Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

    1994-10-25

    DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

  15. (1)H, (13)C, and (15)N backbone resonance assignments of the full-length 40 kDa S. acidocaldarius Y-family DNA polymerase, dinB homolog.

    Science.gov (United States)

    Moro, Sean L; Cocco, Melanie J

    2015-10-01

    The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains.

  16. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

    Science.gov (United States)

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

    2017-02-07

    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  17. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    African Journals Online (AJOL)

    Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

  18. A Double Polymerase Chain Reaction Method for Detecting African ...

    African Journals Online (AJOL)

    Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

  19. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.

    1989-01-01

    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  20. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  1. Structural and dynamical study about denatured states of yeast phosphoglycerate kinase by neutrons scattering and X-rays; Etude structurale et dynamique des etats denatures de la phosphoglycerate kinase de levure par diffusion des neutrons et des rayons X

    Energy Technology Data Exchange (ETDEWEB)

    Receveur, V

    1997-04-28

    During a long time, the neutron scattering and X-rays techniques have not been used for the studies bearing on the folding of proteins. The compactness and the globularness of a protein are two structural characteristics describing the denatured states and the intermediate states of folding, and the neutrons and x-rays scattering are probably the two techniques the most appropriate to give this kind of information; they are sensible to the spatial extent and to the molecules compactness, and to their general shape. For these three or four last years, the works using these techniques are increasing, giving precious knowledge on the different steps of folding and on the interactions stabilizing the denatured or intermediate states. This thesis falls into this category. (N.C.).

  2. Pu Denaturing by Transmutation of MA in FBR Multi-cycle

    Energy Technology Data Exchange (ETDEWEB)

    Meiliza, Yoshitalia; Saito, Masaki; Sagara, Hiroshi [Tokyo Institute of Technology, 2-12-1-N1-1 Ookayama, Meguro-ku, Tokyo, 1528550 (Japan)

    2009-06-15

    Pu accumulation and its recycling is important in the term of energy resources, however one of the most sensitive issues is non-proliferation in the future fuel cycle based on fast breeder reactor (FBR). The present paper utilizes Protected Pu Production (P{sup 3}) concept for the production of {sup 238}Pu and {sup 242}Pu by Minor Actinides (MA) transmutation to enhance the proliferation resistance of Pu in the fuel. Increase in the {sup 238}Pu and {sup 242}Pu isotopic fraction creates a high rate of internal heat generation by alpha decay (DH) and/or a high neutron source of spontaneous fission (SFN) in Pu that would be encountered during manufacturing and maintaining of nuclear explosive device. The feasibility of denaturing of Pu by MA transmutation in medium size FBR has been studied from the viewpoint of even-mass number Pu accumulation during multi-cycle of Pu and MA. The proliferation resistance property of Pu is also evaluated based on the specific decay heat and spontaneous fission neutron, compared with the reference criteria. In present paper, the P{sup 3} technology based on multi-recycled Pu and MA is compared with the conventional technology based on multi-recycled Pu only. The detail of mass balance behavior is, however, beyond the scope of the present paper. (authors)

  3. Precise determination of protein extinction coefficients under native and denaturing conditions using SV-AUC.

    Science.gov (United States)

    Hoffmann, Andreas; Grassl, Kerstin; Gommert, Janine; Schlesak, Christian; Bepperling, Alexander

    2018-04-17

    The accurate determination of protein concentration is an important though non-trivial task during the development of a biopharmaceutical. The fundamental prerequisite for this is the availability of an accurate extinction coefficient. Common approaches for the determination of an extinction coefficient for a given protein are either based on the theoretical prediction utilizing the amino acid sequence or the photometric determination combined with a measurement of absolute protein concentration. Here, we report on an improved SV-AUC based method utilizing an analytical ultracentrifuge equipped with absorbance and Rayleigh interference optics. Global fitting of datasets helped to overcome some of the obstacles encountered with the traditional method employing synthetic boundary cells. Careful calculation of dn/dc values taking glycosylation and solvent composition into account allowed the determination of the extinction coefficients of monoclonal antibodies and an Fc-fusion protein under native as well as under denaturing conditions. An intra-assay precision of 0.9% and an accuracy of 1.8% compared to the theoretical value was achieved for monoclonal antibodies. Due to the large number of data points of a single dataset, no meaningful difference between the ProteomeLab XL-I and the new Optima AUC platform could be observed. Thus, the AUC-based approach offers a precise, convenient and versatile alternative to conventional methods like total amino acid analysis (AAA).

  4. Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores.

    Science.gov (United States)

    Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit

    2010-11-17

    The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

  5. Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores

    International Nuclear Information System (INIS)

    Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit

    2010-01-01

    The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

  6. CalFitter: a web server for analysis of protein thermal denaturation data.

    Science.gov (United States)

    Mazurenko, Stanislav; Stourac, Jan; Kunka, Antonin; Nedeljkovic, Sava; Bednar, David; Prokop, Zbynek; Damborsky, Jiri

    2018-05-14

    Despite significant advances in the understanding of protein structure-function relationships, revealing protein folding pathways still poses a challenge due to a limited number of relevant experimental tools. Widely-used experimental techniques, such as calorimetry or spectroscopy, critically depend on a proper data analysis. Currently, there are only separate data analysis tools available for each type of experiment with a limited model selection. To address this problem, we have developed the CalFitter web server to be a unified platform for comprehensive data fitting and analysis of protein thermal denaturation data. The server allows simultaneous global data fitting using any combination of input data types and offers 12 protein unfolding pathway models for selection, including irreversible transitions often missing from other tools. The data fitting produces optimal parameter values, their confidence intervals, and statistical information to define unfolding pathways. The server provides an interactive and easy-to-use interface that allows users to directly analyse input datasets and simulate modelled output based on the model parameters. CalFitter web server is available free at https://loschmidt.chemi.muni.cz/calfitter/.

  7. Formation of Polyphenol-Denatured Protein Flocs in Alcohol Beverages Sweetened with Refined Cane Sugars.

    Science.gov (United States)

    Eggleston, Gillian; Triplett, Alexa

    2017-11-08

    The sporadic appearance of floc from refined, white cane sugars in alcohol beverages remains a technical problem for both beverage manufacturers and sugar refiners. Cane invert sugars mixed with 60% pure alcohol and water increased light scattering by up to ∼1000-fold. Insoluble and soluble starch, fat, inorganic ash, oligosaccharides, Brix, and pH were not involved in the prevailing floc-formation mechanism. Strong polynomial correlations existed between the haze floc and indicator values (IVs) (color at 420 nm pH 9.0/color at pH 4.0-an indirect measure of polyphenolic and flavonoid colorants) (R 2 = 0.815) and protein (R 2 = 0.819) content of the invert sugars. Ethanol-induced denaturation of the protein exposed hydrophobic polyphenol-binding sites that were further exposed when heated to 80 °C. A tentative mechanism for floc formation was advanced by molecular probing with a haze (floc) active protein and polyphenol as well as polar, nonpolar, and ionic solvents.

  8. Modulation of the Extent of Cooperative Structural Change During Protein Folding by Chemical Denaturant.

    Science.gov (United States)

    Jethva, Prashant N; Udgaonkar, Jayant B

    2017-09-07

    Protein folding and unfolding reactions invariably appear to be highly cooperative reactions, but the structural and sequence determinants of cooperativity are poorly understood. Importantly, it is not known whether cooperative structural change occurs throughout the protein, or whether some parts change cooperatively and other parts change noncooperatively. In the current study, hydrogen exchange mass spectrometry has been used to show that the mechanism of unfolding of the PI3K SH3 domain is similar in the absence and presence of 5 M urea. The data are well described by a four state N ↔ I N ↔ I 2 ↔ U model, in which structural changes occur noncooperatively during the N ↔ I N and I N ↔ I 2 transitions, and occur cooperatively during the I 2 ↔ U transition. The nSrc-loop and RT-loop, as well as β strands 4 and 5 undergo noncooperative unfolding, while β strands 1, 2, and 3 unfold cooperatively in the absence of urea. However, in the presence of 5 M urea, the unfolding of β strand 4 switches to become cooperative, leading to an increase in the extent of cooperative structural change. The current study highlights the relationship between protein stability and cooperativity, by showing how the extent of cooperativity can be varied, using chemical denaturant to alter protein stability.

  9. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  10. The quaternary structure of the recombinant bovine odorant-binding protein is modulated by chemical denaturants.

    Directory of Open Access Journals (Sweden)

    Olga V Stepanenko

    Full Text Available A large group of odorant-binding proteins (OBPs has attracted great scientific interest as promising building blocks in constructing optical biosensors for dangerous substances, such as toxic and explosive molecules. Native tissue-extracted bovine OBP (bOBP has a unique dimer folding pattern that involves crossing the α-helical domain in each monomer over the other monomer's β-barrel. In contrast, recombinant bOBP maintaining the high level of stability inherent to native tissue bOBP is produced in a stable native-like state with a decreased tendency for dimerization and is a mixture of monomers and dimers in a buffered solution. This work is focused on the study of the quaternary structure and the folding-unfolding processes of the recombinant bOBP in the absence and in the presence of guanidine hydrochloride (GdnHCl. Our results show that the recombinant bOBP native dimer is only formed at elevated GdnHCl concentrations (1.5 M. This process requires re-organizing the protein structure by progressing through the formation of an intermediate state. The bOBP dimerization process appears to be irreversible and it occurs before the protein unfolds. Though the observed structural changes for recombinant bOBP at pre-denaturing GdnHCl concentrations show a local character and the overall protein structure is maintained, such changes should be considered where the protein is used as a sensitive element in a biosensor system.

  11. Potential use of gradient denaturing gel electrophoresis in obtaining mutational spectra from human cells

    International Nuclear Information System (INIS)

    Thilly, W.G.

    1985-01-01

    A method is described to isolate mutations in DNA in human cells. When a double-stranded DNA migrates through an electric field on an electrophoretic gel, it is compact hydrodynamic structure relative to the same material in a melted form. Normally the solution in electrophoretic gels is uniform, but a way has been devised to set up a stable gradient of increasing solute concentration in the direction of DNA motion. Thus, as a double-stranded DNA molecule is drawn by the electric field into higher and higher concentrations of urea/formamide, it will eventually reach a point at which the concentration is high enough to melt the lower-melting-point region. The melting results in an essentially immobile structure within the gel so that the position at which the DNA molecule stops on the gradient gel is determined by its melting point, which is uniquely determined by its nucleotide sequence. A single base pair substitution within a low melting point sequence of some 100 base pairs changed the expected melting point by 0.4 0 C and resulted in about a 2-cm displacement under appropriate denaturing gel conditions. This expectation leads to the idea that if a mixture of DNA sequences derived from point mutations within the same restriction fragment were permitted to anneal with a complementary wild-type sequence, the melting point of each type of heteroduplex would differ depending on the kind and position of each mutation

  12. Use of denaturing gradient gel electrophoresis to detect Actinobacteria associated with the human faecal microbiota.

    Science.gov (United States)

    Hoyles, Lesley; Clear, Jessica A; McCartney, Anne L

    2013-08-01

    With the exceptions of the bifidobacteria, propionibacteria and coriobacteria, the Actinobacteria associated with the human gastrointestinal tract have received little attention. This has been due to the seeming absence of these bacteria from most clone libraries. In addition, many of these bacteria have fastidious growth and atmospheric requirements. A recent cultivation-based study has shown that the Actinobacteria of the human gut may be more diverse than previously thought. The aim of this study was to develop a denaturing gradient gel electrophoresis (DGGE) approach for characterizing Actinobacteria present in faecal samples. Amount of DNA added to the Actinobacteria-specific PCR used to generate strong PCR products of equal intensity from faecal samples of five infants, nine adults and eight elderly adults was anti-correlated with counts of bacteria obtained using fluorescence in situ hybridization probe HGC69A. A nested PCR using Actinobacteria-specific and universal PCR-DGGE primers was used to generate profiles for the Actinobacteria. Cloning of sequences from the DGGE bands confirmed the specificity of the Actinobacteria-specific primers. In addition to members of the genus Bifidobacterium, species belonging to the genera Propionibacterium, Microbacterium, Brevibacterium, Actinomyces and Corynebacterium were found to be part of the faecal microbiota of healthy humans. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)

    2013-02-08

    Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.

  14. CDK9-dependent RNA polymerase II pausing controls transcription initiation.

    Science.gov (United States)

    Gressel, Saskia; Schwalb, Björn; Decker, Tim Michael; Qin, Weihua; Leonhardt, Heinrich; Eick, Dirk; Cramer, Patrick

    2017-10-10

    Gene transcription can be activated by decreasing the duration of RNA polymerase II pausing in the promoter-proximal region, but how this is achieved remains unclear. Here we use a 'multi-omics' approach to demonstrate that the duration of polymerase pausing generally limits the productive frequency of transcription initiation in human cells ('pause-initiation limit'). We further engineer a human cell line to allow for specific and rapid inhibition of the P-TEFb kinase CDK9, which is implicated in polymerase pause release. CDK9 activity decreases the pause duration but also increases the productive initiation frequency. This shows that CDK9 stimulates release of paused polymerase and activates transcription by increasing the number of transcribing polymerases and thus the amount of mRNA synthesized per time. CDK9 activity is also associated with long-range chromatin interactions, suggesting that enhancers can influence the pause-initiation limit to regulate transcription.

  15. Kinetic mechanism of DNA polymerase I (Klenow)

    International Nuclear Information System (INIS)

    Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.

    1987-01-01

    The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences

  16. A Comparison Between Denaturing Gradient Gel Electrophoresis and Denaturing High Performance Liquid Chromatography in Detecting Mutations in Genes Associated with Hereditary Non-Polyposis Colorectal Cancer (HNPCC and the Identification of 9 New Mutations Previously Unidentified by DGGE

    Directory of Open Access Journals (Sweden)

    Meldrum Cliff J

    2003-12-01

    Full Text Available Abstract Denaturing high performance liquid chromatography is a relatively new method by which heteroduplex structures formed during the PCR amplification of heterozygote samples can be rapidly identified. The use of this technology for mutation detection in hereditary non-polyposis colorectal cancer (HNPCC has the potential to appreciably shorten the time it takes to analyze genes associated with this disorder. Prior to acceptance of this method for screening genes associated with HNPCC, assessment of the reliability of this method should be performed. In this report we have compared mutation and polymorphism detection by denaturing gradient gel electrophoresis (DGGE with denaturing high performance liquid chromatography (DHPLC in a set of 130 families. All mutations/polymorphisms representing base substitutions, deletions, insertions and a 23 base pair inversion were detected by DHPLC whereas DGGE failed to identify four single base substitutions and a single base pair deletion. In addition, we show that DHPLC has been used for the identification of 5 different mutations in exon 7 of hMSH2 that could not be detected by DGGE. From this study we conclude that DHPLC is a more effective and rapid alternative to the detection of mutations in hMSH2 and hMLH1 with the same or better accuracy than DGGE. Furthermore, this technique offers opportunities for automation, which have not been realised for the majority of other methods of gene analysis.

  17. Structural and dynamical study about denatured states of yeast phosphoglycerate kinase by neutrons scattering and X-rays

    International Nuclear Information System (INIS)

    Receveur, V.

    1997-01-01

    During a long time, the neutron scattering and X-rays techniques have not been used for the studies bearing on the folding of proteins. The compactness and the globularness of a protein are two structural characteristics describing the denatured states and the intermediate states of folding, and the neutrons and x-rays scattering are probably the two techniques the most appropriate to give this kind of information; they are sensible to the spatial extent and to the molecules compactness, and to their general shape. For these three or four last years, the works using these techniques are increasing, giving precious knowledge on the different steps of folding and on the interactions stabilizing the denatured or intermediate states. This thesis falls into this category. (N.C.)

  18. Protective role of microRNA-29a in denatured dermis and skin fibroblast cells after thermal injury

    Directory of Open Access Journals (Sweden)

    Jie Zhou

    2016-03-01

    Full Text Available Our previous study has suggested that downregulated microRNA (miR-29a in denatured dermis might be involved in burn wound healing. However, the exact role of miR-29a in healing of burn injury still remains unclear. Here, we found that expression of miR-29a was notably upregulated in denatured dermis tissues and skin fibroblast cells after thermal injury, and thereafter gradually downregulated compared with control group. By contrast, the expression of collagen, type I, alpha 2 (COL1A2 and vascular endothelial growth factor (VEGF-A were first reduced and subsequently upregulated in denatured dermis tissues and skin fibroblast cells after thermal injury. We further identified COL1A2 as a novel target of miR-29a, which is involved in type I collagen synthesis, and showed that miR-29a negatively regulated the expression level of COL1A2 in skin fibroblast cells. In addition, VEGF-A, another target gene of miR-29a, was also negatively mediated by miR-29a in skin fibroblast cells. Inhibition of miR-29a expression significantly promoted the proliferation and migration of skin fibroblast cells after thermal injury, and knockdown of COL1A2 and VEGF-A reversed the effects of miR-29a on the proliferation and migration of skin fibroblast cells. Furthermore, we found that Notch2/Jagged2 signaling was involved in miR-29a response to burn wound healing. Our findings suggest that downregulated miR-29a in denatured dermis may help burn wound healing in the later phase, probably via upregulation of COL1A2 and VEGF-A expression, which can further enhance type I collagen synthesis and angiogenesis.

  19. Counteraction of urea-induced protein denaturation by trimethylamine N-oxide: A chemical chaperone at atomic resolution

    OpenAIRE

    Bennion, Brian J.; Daggett, Valerie

    2004-01-01

    Proteins are very sensitive to their solvent environments. Urea is a common chemical denaturant of proteins, yet some animals contain high concentrations of urea. These animals have evolved an interesting mechanism to counteract the effects of urea by using trimethylamine N-oxide (TMAO). The molecular basis for the ability of TMAO to act as a chemical chaperone remains unknown. Here, we describe molecular dynamics simulations of a small globular protein, chymotrypsin inhibitor 2, in 8 M urea ...

  20. Growth of ammonia-oxidizing archaea and bacteria in cattle manure compost under various temperatures and ammonia concentrations.

    Science.gov (United States)

    Oishi, Ryu; Tada, Chika; Asano, Ryoki; Yamamoto, Nozomi; Suyama, Yoshihisa; Nakai, Yutaka

    2012-05-01

    A recent study showed that ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) coexist in the process of cattle manure composting. To investigate their physiological characteristics, liquid cultures seeded with fermenting cattle manure compost were incubated at various temperatures (37°C, 46°C, or 60°C) and ammonium concentrations (0.5, 1, 4, or 10 mM NH (4) (+) -N). The growth rates of the AOB and AOA were monitored using real-time polymerase chain reaction analysis targeting the bacterial and archaeal ammonia monooxygenase subunit A genes. AOB grew at 37°C and 4 or 10 mM NH (4) (+) -N, whereas AOA grew at 46°C and 10 mM NH (4) (+) -N. Incubation with allylthiourea indicated that the AOB and AOA grew by oxidizing ammonia. Denaturing gradient gel electrophoresis and subsequent sequencing analyses revealed that a bacterium related to Nitrosomonas halophila and an archaeon related to Candidatus Nitrososphaera gargensis were the predominant AOB and AOA, respectively, in the seed compost and in cultures after incubation. This is the first report to demonstrate that the predominant AOA in cattle manure compost can grow and can probably oxidize ammonia under moderately thermophilic conditions.

  1. Preparation of denatured protein bone sterilized with gamma radiation; Preparacion de hueso desproteinizado esterilizado con radiacion gamma

    Energy Technology Data Exchange (ETDEWEB)

    Luna Z, D [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2005-07-01

    The bone is one of the tissues more transplanted in the entire world by that the bone necessity for transplant every day becomes bigger. In the Bank of tissues Radio sterilized of the ININ the amnion and the pig skin are routinely processed. The tissue with which will be continued is with bone. Due to that in our country it doesn't have enough bone of human origin for the necessities required in the bone transplant, an option is the bone of bovine. Of this bone one can obtain denatured protein bone, with the same characteristics of the denatured protein human bone, the one which has been proven that it has good acceptance and incorporation in the human body when is transplanted. The method for the obtaining of the denatured protein bone of bovine, with the confirmation of the final product by means of X-ray diffraction is described. The radiosterilization of this bone with gamma rays and the determination of the lead content. (Author)

  2. Interchange reaction of disulfides and denaturation of oxytocin by copper(II)/ascorbic acid/O2 system.

    Science.gov (United States)

    Inoue, H; Hirobe, M

    1987-05-29

    The interchange reaction of disulfides was caused by the copper(II)/ascorbic acid/O2 system. The incubation of two symmetric disulfides, L-cystinyl-bis-L-phenylalanine (PP) and L-cystinyl-bis-L-tyrosine (TT), with L-ascorbic acid and CuSO4 in potassium phosphate buffer (pH 7.2, 50 mM) resulted in the formation of an asymmetric disulfide, L-cystinyl-L-phenylalanine-L-tyrosine (PT), and the final ratio of PP:PT:TT was 1:2:1. As the reaction was inhibited by catalase and DMSO only at the initial time, hydroxyl radical generated by the copper(II)/ascorbic acid/O2 system seemed to be responsible for the initiation of the reaction. Oxytocin and insulin were denatured by this system, and catalase and DMSO similarly inhibited these denaturations. As the composition of amino acids was unchanged after the reaction, hydroxyl radical was thought to cause the cleavage and/or interchange reaction of disulfides to denature the peptides.

  3. NF2 tumor suppressor gene: a comprehensive and efficient detection of somatic mutations by denaturing HPLC and microarray-CGH.

    Science.gov (United States)

    Szijan, Irene; Rochefort, Daniel; Bruder, Carl; Surace, Ezequiel; Machiavelli, Gloria; Dalamon, Viviana; Cotignola, Javier; Ferreiro, Veronica; Campero, Alvaro; Basso, Armando; Dumanski, Jan P; Rouleau, Guy A

    2003-01-01

    The NF2 tumor suppressor gene, located in chromosome 22q12, is involved in the development of multiple tumors of the nervous system, either associated with neurofibromatosis 2 or sporadic ones, mainly schwannomas and meningiomas. In order to evaluate the role of the NF2 gene in sporadic central nervous system (CNS) tumors, we analyzed NF2 mutations in 26 specimens: 14 meningiomas, 4 schwannomas, 4 metastases, and 4 other histopathological types of neoplasms. Denaturing high performance liquid chromatography (denaturing HPLC) and comparative genomic hybridization on a DNA microarray (microarray- CGH) were used as scanning methods for small mutations and gross rearrangements respectively. Small mutations were identified in six out of seventeen meningiomas and schwannomas, one mutation was novel. Large deletions were detected in six meningiomas. All mutations were predicted to result in truncated protein or in the absence of a large protein domain. No NF2 mutations were found in other histopathological types of CNS tumors. These results provide additional evidence that mutations in the NF2 gene play an important role in the development of sporadic meningiomas and schwannomas. Denaturing HPLC analysis of small mutations and microarray-CGH of large deletions are complementary, fast, and efficient methods for the detection of mutations in tumor tissues.

  4. Preparation of denatured protein bone sterilized with gamma radiation; Preparacion de hueso desproteinizado esterilizado con radiacion gamma

    Energy Technology Data Exchange (ETDEWEB)

    Luna Z, D. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: dlz@nuclear.inin.mx

    2005-07-01

    The bone is one of the tissues more transplanted in the entire world by that the bone necessity for transplant every day becomes bigger. In the Bank of tissues Radio sterilized of the ININ the amnion and the pig skin are routinely processed. The tissue with which will be continued is with bone. Due to that in our country it doesn't have enough bone of human origin for the necessities required in the bone transplant, an option is the bone of bovine. Of this bone one can obtain denatured protein bone, with the same characteristics of the denatured protein human bone, the one which has been proven that it has good acceptance and incorporation in the human body when is transplanted. The method for the obtaining of the denatured protein bone of bovine, with the confirmation of the final product by means of X-ray diffraction is described. The radiosterilization of this bone with gamma rays and the determination of the lead content. (Author)

  5. Functional conservation of RNA polymerase II in fission and budding yeasts.

    Science.gov (United States)

    Shpakovski, G V; Gadal, O; Labarre-Mariotte, S; Lebedenko, E N; Miklos, I; Sakurai, H; Proshkin, S A; Van Mullem, V; Ishihama, A; Thuriaux, P

    2000-02-04

    The complementary DNAs of the 12 subunits of fission yeast (Schizosaccharomyces pombe) RNA polymerase II were expressed from strong promoters in Saccharomyces cerevisiae and tested for heterospecific complementation by monitoring their ability to replace in vivo the null mutants of the corresponding host genes. Rpb1 and Rpb2, the two largest subunits and Rpb8, a small subunit shared by all three polymerases, failed to support growth in S. cerevisiae. The remaining nine subunits were all proficient for heterospecific complementation and led in most cases to a wild-type level of growth. The two alpha-like subunits (Rpb3 and Rpb11), however, did not support growth at high (37 degrees C) or low (25 degrees C) temperatures. In the case of Rpb3, growth was restored by increasing the gene dosage of the host Rpb11 or Rpb10 subunits, confirming previous evidence of a close genetic interaction between these three subunits. Copyright 2000 Academic Press.

  6. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    Science.gov (United States)

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  7. Transition from uranium to denatured uranium/thorium fuel in an existing PWR

    International Nuclear Information System (INIS)

    Walters, M.A.

    1982-01-01

    The purpose of this research was to determine whether it is possible to make a gradual transition from uranium to denatured uranium/thorium (DUTH) fuel in an existing PWR by adding DUTH assemblies during each scheduled refueling and, if the transition is possible, to develop a general procedure for making it. The feasibility of the transition was established by identifying acceptable refueling schemes for a series of transition cores, and in the process, a method for identifying acceptable schemes evolved. The utility of the method was then demonstrated by applying it to a standard reactor operating under normal conditions. The vehicle used to examine proposed fuel mixtures and to select acceptable ones was a set of one-dimensional computer codes. The core was modeled as a set of five concentric fuel zones with a reflector. Fuel mixtures were proposed and the computer codes were used to determine whether a mixture was acceptable, i.e., whether it had the desired k-effective and flux and power distributions. The parameters allowed to vary in selection of proposed fuel mixtures were enrichment of fresh fuel assemblies, number of uranium and DUTH assemblies added during each refueling, and distribution of fuel in the core. Results of the research showed that a gradual transition is possible. Furthermore, there is a method that allows the identification of fuel mixtures that are likely to be acceptable. It requires the calculation of K-infinity for the entire proposed core and for some of its regions. These values of K-infinity and relationships developed in this research can be used to predict the flux distribution and the final k-effective for the proposed fuel mixture

  8. An improved method for detecting genetic variation in DNA using denaturing gradient gel electrophoresis

    International Nuclear Information System (INIS)

    Takahashi, Norio; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

    1990-05-01

    We have examined the feasibility of denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes to detect variations in genomic and cloned DNAs. The result has demonstrated that use of RNA:DNA duplexes makes DGGE much more practical for screening a large number of samples than use of DNA:DNA heteroduplexes, because preparation of RNA probes is easier than that of DNA probes. Three different 32 P-labeled RNA probes were produced. Genomic or cloned DNAs were digested with restriction enzymes and hybridized to labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. The presence of a mismatch(es) was detected as a difference in the mobility of bands on the gel. The experimental conditions were determined using DNA segments from cloned normal and three thalassemic human β-globin genes. The results from experiments on the cloned DNAs suggest that DGGE of RNA:DNA duplexes will detect nucleotide substitutions and deletions in DNA. In the course of these studies, a polymorphism due to a single-base substitution at position 666 of IVS2 (IVS2-666) of the human β-globin gene was directly identified using genomic DNA samples. A study of 59 unrelated Japanese from Hiroshima was undertaken in which the frequency of the allele with C at IVS2-666 was 0.48 and that of the allele with T was 0.52. This approach was found to be very effective for detecting heritable variation and should be a powerful tool for detecting fresh mutations in DNA, which occur outside the known restriction sites. (author)

  9. A differential scanning calorimetric study of the effects of metal ions, substrate/product, substrate analogues and chaotropic anions on the thermal denaturation of yeast enolase 1.

    Science.gov (United States)

    Brewer, J M; Wampler, J E

    2001-03-14

    The thermal denaturation of yeast enolase 1 was studied by differential scanning calorimetry (DSC) under conditions of subunit association/dissociation, enzymatic activity or substrate binding without turnover and substrate analogue binding. Subunit association stabilizes the enzyme, that is, the enzyme dissociates before denaturing. The conformational change produced by conformational metal ion binding increases thermal stability by reducing subunit dissociation. 'Substrate' or analogue binding additionally stabilizes the enzyme, irrespective of whether turnover is occurring, perhaps in part by the same mechanism. More strongly bound metal ions also stabilize the enzyme more, which we interpret as consistent with metal ion loss before denaturation, though possibly the denaturation pathway is different in the absence of metal ion. We suggest that some of the stabilization by 'substrate' and analogue binding is owing to the closure of moveable polypeptide loops about the active site, producing a more 'closed' and hence thermostable conformation.

  10. DnaB gene product-independence of DNA polymerase III-directed repair synthesis in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Billen, D.; Hellermann, G.R.

    1977-01-01

    An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)

  11. Translesion DNA polymerases Pol ζ, Pol η, Pol ι, Pol κ and Rev1 are ...

    Indian Academy of Sciences (India)

    MADU

    Specialized DNA polymerases called translesion polymerases are among the major determinants of spontaneous and DNA damage-induced mutation in both prokaryotes and eukaryotes. (Livneh 2001). The classical replicative DNA polymerases can synthesize DNA with remarkable efficiency and fidelity.

  12. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  13. Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer

    Directory of Open Access Journals (Sweden)

    Anthony J. Berdis

    2017-11-01

    Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.

  14. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  15. Ubiquitylation and degradation of elongating RNA polymerase II

    DEFF Research Database (Denmark)

    Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q

    2013-01-01

    During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....

  16. Relationship between meat toughness and properties of connective tissue from cows and young bulls heat treated at low temperatures for prolonged times

    DEFF Research Database (Denmark)

    Christensen, Line; Ertbjerg, Per; Løje, Hanne

    2013-01-01

    of beef was investigated and the relationship to properties of connective tissue was examined. Measurements of toughness, collagen solubility, cathepsin activity and protein denaturation of beef semitendinosus heated at temperatures between 53. °C and 63. °C for up to 19 1/2. h were conducted. The results...... of the connective tissue, caused partly by denaturation or conformational changes of the proteins and/or by solubilization of collagen. © 2012 Elsevier Ltd....

  17. Deteksi Kandungan Daging Babi pada Bakso yang Dijajakan di Pusat Kota Salatiga Menggunakan Teknik Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Fidia Fibriana

    2011-03-01

    Full Text Available The purpose of this research is to determine whether the meatball products that sold atSalatiga are contain pork. Stratifi ed random sampling technique used to take samplesof meatballs which sold by 13 meatball stalls from 25 meatball stalls scattered in thecentral city of Salatiga. Isolation and purifi cation of DNA from meatballs, beef, andpork samples use Sambrook et al. modifi ed by Sulandari and Zein method. The yield ofDNA followed by PCR process using P14 primers that representing the PRE-1 loci in thepig genome. DNA amplifi cation used protocol initial denaturation at temperature of 93°C for 2 minutes, followed by 45 cycles of denaturation 93 °C for 1 minute, annealing62 °C for 30 seconds, extension 72 °C for 1 minute, and ending extension 72 °C for 2minutes. Appearance of 481 base-pair PCR product was expected. Result from 1,2%agarose gel electrophoresis of PCR products showed 481 base-pair, a specifi c DNAband size in pork meat and meatball samples number thirteen. It can be concluded thatmeatball product from meatball stall number thirteen was contain pork.Keywords: detection of pork, meatball products, PCR technique

  18. PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.

    OpenAIRE

    Cline, J; Braman, J C; Hogrefe, H H

    1996-01-01

    The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...

  19. Denatured states of yeast cytochrome c induced by heat and guanidinium chloride are structurally and thermodynamically different.

    Science.gov (United States)

    Zaidi, Sobia; Haque, Md Anzarul; Ubaid-Ullah, Shah; Prakash, Amresh; Hassan, Md Imtaiyaz; Islam, Asimul; Batra, Janendra K; Ahmad, Faizan

    2017-05-01

    A sequence alignment of mammalian cytochromes c with yeast iso-1-cytochrome c (y-cyt-c) shows that the yeast protein contains five extra N-terminal residues. We have been interested in understanding the question: What is the role of these five extra N-terminal residues in folding and stability of the protein? To answer this question we have prepared five deletants of y-cyt-c by sequentially removing these extra residues. During our studies on the wild type (WT) protein and its deletants, we observed that the amount of secondary structure in the guanidinium chloride (GdmCl)-induced denatured (D) state of each protein is different from that of the heat-induced denatured (H) state. This finding is confirmed by the observation of an additional cooperative transition curve of optical properties between H and D states on the addition of different concentrations of GdmCl to the already heat denatured WT y-cyt-c and its deletants at pH 6.0 and 68°C. For each protein, analysis of transition curves representing processes, native (N) state ↔ D state, N state ↔ H state, and H state ↔ D state, was done to obtain Gibbs free energy changes associated with all the three processes. This analysis showed that, for each protein, thermodynamic cycle accommodates Gibbs free energies associated with transitions between N and D states, N and H states, and H and D states, the characteristics required for a thermodynamic function. All these experimental observations have been supported by our molecular dynamics simulation studies.

  20. Fourier transform infrared spectroscopic studies of the secondary structure and thermal denaturation of CaATPase from rabbit skeletal muscle

    Science.gov (United States)

    Jaworsky, Mark; Brauner, Joseph W.; Mendelsohn, Richard

    Fourier transform i.r. spectroscopy has been used to monitor structural alterations induced by thermal denaturation of the intrinsic membrane protein CaATPase in aqueous media. The protein has been isolated, purified and studied in five forms: (i) In its native lipid environment after isolation from rabbit sarcoplasmic reticulum, both in H 2O and D 2O suspensions. (ii) After both mild and extensive tryptic digestion has cleaved those residues external to the membrane bilayer. (iii) Reconstituted in vesicle form with bovine brain sphingomyelin. Fourier deconvolution techniques have been used to enhance the resolution of the intrinsically overlapped Amide I and Amide II spectral regions. Large spectral alterations apparent in the deconvoluted spectra occur in these regions upon thermal denaturation of the protein which are consistent with the formation of a large proportion of β-antiparallel sheet form. The alteration parallels the loss in ATPase activity. A mild tryptic digestion increases slightly the proportion of α-helix and/or random coil secondary structure. A thermal transition to a form containing a high proportion of β structure is still evident. Extensive tryptic digestion nearly abolishes the alpha helical plus random coil secondary structure, while producing a high proportion of β form which is resistant to further thermally induced structural alterations. Studies of CaATPase reconstituted into vesicles with bovine brain sphingomyelin reveal a higher proportion of β structure than the native enzyme, with further introduction of β structure on thermal denaturation. Both the utility of deconvolution techniques and the necessity for caution in their application are apparent from the current experiments.

  1. Heterogeneity of equilibrium molten globule state of cytochrome c induced by weak salt denaturants under physiological condition.

    Directory of Open Access Journals (Sweden)

    Hamidur Rahaman

    Full Text Available While many proteins are recognized to undergo folding via intermediate(s, the heterogeneity of equilibrium folding intermediate(s along the folding pathway is less understood. In our present study, FTIR spectroscopy, far- and near-UV circular dichroism (CD, ANS and tryptophan fluorescence, near IR absorbance spectroscopy and dynamic light scattering (DLS were used to study the structural and thermodynamic characteristics of the native (N, denatured (D and intermediate state (X of goat cytochorme c (cyt-c induced by weak salt denaturants (LiBr, LiCl and LiClO4 at pH 6.0 and 25°C. The LiBr-induced denaturation of cyt-c measured by Soret absorption (Δε400 and CD ([θ]409, is a three-step process, N ↔ X ↔ D. It is observed that the X state obtained along the denaturation pathway of cyt-c possesses common structural and thermodynamic characteristics of the molten globule (MG state. The MG state of cyt-c induced by LiBr is compared for its structural and thermodynamic parameters with those found in other solvent conditions such as LiCl, LiClO4 and acidic pH. Our observations suggest: (1 that the LiBr-induced MG state of cyt-c retains the native Met80-Fe(III axial bond and Trp59-propionate interactions; (2 that LiBr-induced MG state of cyt-c is more compact retaining the hydrophobic interactions in comparison to the MG states induced by LiCl, LiClO4 and 0.5 M NaCl at pH 2.0; and (3 that there exists heterogeneity of equilibrium intermediates along the unfolding pathway of cyt-c as highly ordered (X1, classical (X2 and disordered (X3, i.e., D ↔ X3 ↔ X2 ↔ X1 ↔ N.

  2. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    Science.gov (United States)

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  3. Repair of Clustered Damage and DNA Polymerase Iota.

    Science.gov (United States)

    Belousova, E A; Lavrik, O I

    2015-08-01

    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  4. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  5. File list: Pol.Neu.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Neural ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.50.RNA_Polymerase_III.AllCell.bed ...

  6. File list: Pol.Oth.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027436,SRX1027435,SRX1027434,SRX1027433,SRX668218,SRX099880,SRX099879 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Myo.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Muscle SR.../dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_II.AllCell.bed ...

  8. File list: Pol.YSt.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.YSt.10.RNA_Polymerase_II.AllCell sacCer3 RNA polymerase RNA Polymerase II Yeast... strain SRX092435,SRX360917,SRX360914,SRX497380,SRX497382,SRX497381,SRX360915 http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.YSt.10.RNA_Polymerase_II.AllCell.bed ...

  9. File list: Pol.Lar.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX151962,SRX182775,SRX661503,SRX013070,SRX013072,SRX013113,SRX013082,SRX151961 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.05.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.CDV.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Cardiova...,SRX080152,SRX080153,SRX367018,SRX367016 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Lar.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Larvae h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_Polymerase_II.AllCell.bed ...

  12. File list: Pol.Bld.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bld.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_II.AllCell.bed ...

  13. File list: Pol.Bld.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bld.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Blood h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.20.RNA_Polymerase_III.AllCell.bed ...

  14. File list: Pol.Epd.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...247,SRX080162,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.50.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Lng.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX1...43816,SRX062976,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.10.RNA_Polymerase_II.AllCell.bed ...

  16. File list: Pol.Plc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Placent...a http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Plc.50.RNA_Polymerase_III.AllCell.bed ...

  17. File list: Pol.Myo.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.10.RNA_Polymerase_III.AllCell.bed ...

  18. File list: Pol.Lar.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.50.RNA_polymerase_III.AllCell.bed ...

  19. File list: Pol.Oth.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.20.RNA_Polymerase_III.AllCell.bed ...

  20. File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Utr.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Utr.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Uterus S...SRX573070,SRX027921,SRX1048949,SRX1136641,SRX1136638,SRX099217 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.05.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.CDV.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_III.AllCell.bed ...

  3. File list: Pol.Neu.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...6,SRX743838,SRX743832,SRX743834,SRX743840 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.20.RNA_polymerase_II.AllCell.bed ...

  4. File list: Pol.Plc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Oth.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Others SR...X143827,SRX112963,SRX736456,SRX736457,SRX112981,SRX143834,SRX335666,SRX957689 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_II.AllCell.bed ...

  6. File list: Pol.Emb.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043869 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.20.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Adp.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Adipocy...te http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.20.RNA_Polymerase_III.AllCell.bed ...

  8. File list: Pol.Gon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.Adl.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adl.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

  11. File list: Pol.Adp.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Adipocyte... SRX800011,SRX800010,SRX341031,SRX341032,SRX341029,SRX800016,SRX800017,SRX341030 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Adp.50.RNA_Polymerase_II.AllCell.bed ...

  12. File list: Pol.Oth.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Others ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Oth.05.RNA_Polymerase_III.AllCell.bed ...

  13. File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.CDV.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Cardiovas...X320034,SRX346170,SRX346169,SRX373605,SRX680476 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.20.RNA_Polymerase_II.AllCell.bed ...

  15. File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Spl.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Spl.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Spleen SR...X062981,SRX143838,SRX020253 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_II.AllCell.bed ...

  17. File list: Pol.Myo.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Muscle ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Myo.05.RNA_Polymerase_III.AllCell.bed ...

  18. File list: Pol.Unc.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.05.RNA_Polymerase_II.AllCell.bed ...

  19. File list: Pol.ALL.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II All cell ...//dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_II.AllCell.bed ...

  20. File list: Pol.Pan.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Pan.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Pancre...as http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.05.RNA_polymerase_III.AllCell.bed ...

  1. File list: Pol.CDV.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Cardiov...ascular http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.CDV.05.RNA_Polymerase_III.AllCell.bed ...

  2. File list: Pol.Utr.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Utr.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX018606,SRX017002,SRX017001 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.20.RNA_polymerase_III.AllCell.bed ...

  3. File list: Pol.Epd.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Brs.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Brs.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Breast ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.50.RNA_Polymerase_III.AllCell.bed ...

  5. File list: Pol.Lar.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.20.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Unc.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.10.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_Polymerase_II.AllCell.bed ...

  7. File list: Pol.Neu.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Neural SR...,SRX685285,SRX217736 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Neu.20.RNA_Polymerase_II.AllCell.bed ...

  8. File list: Pol.Unc.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.10.RNA_Polymerase_III.AllCell.bed ...

  9. File list: Pol.ALL.20.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.20.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.20.RNA_Polymerase_III.AllCell.bed ...

  10. File list: Pol.Unc.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Unclass...ified http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.50.RNA_Polymerase_III.AllCell.bed ...

  11. File list: Pol.Dig.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Dig.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.05.RNA_Polymerase_III.AllCell.bed ...

  12. File list: Pol.Bld.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bld.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Blood SRX...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bld.50.RNA_Polymerase_II.AllCell.bed ...

  13. File list: Pol.Pup.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Pup.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.10.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Dig.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Dig.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Digesti...ve tract http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.50.RNA_Polymerase_III.AllCell.bed ...

  15. File list: Pol.Lng.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.05.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Emb.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.50.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Embryo h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_Polymerase_II.AllCell.bed ...

  17. File list: Pol.CDV.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.10.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Unc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.50.RNA_polymerase_III.AllCell.bed ...

  19. File list: Pol.Unc.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Unclassif...ied SRX254629 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Unc.20.RNA_Polymerase_II.AllCell.bed ...

  20. File list: Pol.Lng.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX0...62976,SRX143816,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.05.RNA_Polymerase_II.AllCell.bed ...

  1. File list: Pol.ALL.50.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.50.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III All cel...l types ERX204069 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.ALL.50.RNA_Polymerase_III.AllCell.bed ...

  2. File list: Pol.Lng.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Lung SRX0...62976,SRX143816,SRX020252 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Lng.20.RNA_Polymerase_II.AllCell.bed ...

  3. File list: Pol.Plc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Bon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_III.AllCell.bed ...

  5. File list: Pol.Gon.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Gonad ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.50.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.Emb.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Embryo ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Emb.05.RNA_Polymerase_III.AllCell.bed ...

  7. File list: Pol.Kid.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX1206072,SRX1206066,SRX326423,SRX1206067,SRX003883,SRX003882,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.20.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.Emb.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.10.RNA_polymerase_III.AllCell.bed ...

  9. File list: Pol.Pan.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Pan.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Pancrea...s http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Pan.10.RNA_Polymerase_III.AllCell.bed ...

  10. File list: Pol.Adl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adl.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Adult SR...SRX1388757,SRX1388756 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.05.RNA_Polymerase_II.AllCell.bed ...

  11. File list: Pol.PSC.50.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.PSC.50.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.50.RNA_Polymerase_II.AllCell.bed ...

  12. File list: Pol.Bon.05.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bon.05.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Bone ht...tp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Bon.05.RNA_Polymerase_III.AllCell.bed ...

  13. File list: Pol.Epd.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...246,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.10.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Epd.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Epidermis... http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Epd.10.RNA_Polymerase_II.AllCell.bed ...

  15. File list: Pol.Adp.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.20.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Brs.10.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Brs.10.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Breast SR...078990 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Brs.10.RNA_Polymerase_II.AllCell.bed ...

  17. File list: Pol.Spl.10.RNA_Polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Spl.10.RNA_Polymerase_III.AllCell mm9 RNA polymerase RNA Polymerase III Spleen ...http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.10.RNA_Polymerase_III.AllCell.bed ...

  18. File list: Pol.Dig.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Dig.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Digestive... tract SRX112957,SRX143802 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Dig.20.RNA_Polymerase_II.AllCell.bed ...

  19. File list: Pol.Spl.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Spl.05.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Spleen SR...X062981,SRX143838,SRX020253 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.Spl.05.RNA_Polymerase_II.AllCell.bed ...

  20. File list: Pol.PSC.20.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.PSC.20.RNA_Polymerase_II.AllCell mm9 RNA polymerase RNA Polymerase II Pluripote...SRX213760,SRX213764 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Pol.PSC.20.RNA_Polymerase_II.AllCell.bed ...

  1. File list: Pol.Pup.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Pup.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Pupae SRX...013069 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Pup.05.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Unc.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.50.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Plc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_II.AllCell.bed ...

  4. File list: Pol.Adp.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Adipoc...yte http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.10.RNA_polymerase_III.AllCell.bed ...

  5. File list: Pol.Dig.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Dig.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.20.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Myo.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_III.AllCell.bed ...

  7. File list: Pol.Epd.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Epider...mis SRX016997 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Unclassif...ied SRX110774 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.Plc.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.10.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Adp.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adp.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Adipocyt...e SRX682084,SRX682086,SRX682085,SRX682083 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Adp.50.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II All cell...3965,SRX043869,SRX043867,SRX043875,SRX043967,SRX043881,SRX043879 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Brs.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Brs.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.20.RNA_polymerase_III.AllCell.bed ...

  14. File list: Pol.ALL.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.05.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.05.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX050604,SRX050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Brs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Brs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.05.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.PSC.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.PSC.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Epd.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...248,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.20.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Plc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Kid.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...X1206068,SRX1206073,SRX1206074,SRX1206072,SRX1206071,SRX003882,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Prs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Prs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_III.AllCell.bed ...

  3. File list: Pol.Oth.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Utr.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Utr.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Uterus... SRX017001,SRX018606,SRX017002 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.10.RNA_polymerase_III.AllCell.bed ...

  5. File list: Pol.Adl.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adl.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Adult SR...SRX043965,SRX005629,SRX043964,SRX554718 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.50.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.CDV.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.05.RNA_polymerase_III.AllCell.bed ...

  7. File list: Pol.Prs.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Prs.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...932,SRX020922,SRX022582 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.50.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.PSC.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.PSC.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...670820,SRX702057,SRX702061 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.20.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.Utr.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Utr.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Uterus S...RX099218,SRX1136641,SRX1048949,SRX1136639,SRX665233,SRX1136638 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Utr.50.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.Brs.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Brs.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Breast... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Brs.10.RNA_polymerase_III.AllCell.bed ...

  11. File list: Pol.Adl.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adl.20.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Adult SR...SRX554718,SRX043965,SRX043963,SRX043964 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.20.RNA_polymerase_II.AllCell.bed ...

  12. File list: Pol.Kid.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.10.RNA_polymerase_III.AllCell.bed ...

  13. File list: Pol.ALL.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III All ce...ll types SRX331268,SRX331270,SRX395531,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.20.RNA_polymerase_III.AllCell.bed ...

  14. File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043867 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Dig.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Dig.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Digestiv...//dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.05.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.Neu.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...6,SRX743834,SRX743838,SRX743840,SRX743832 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.50.RNA_polymerase_II.AllCell.bed ...

  17. File list: Pol.Emb.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX013077,SRX050604,SRX050605 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.05.RNA_polymerase_II.AllCell.bed ...

  18. File list: Pol.Liv.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Liv.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.20.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Prs.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Prs.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...866,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.10.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Pan.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Pan.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.10.RNA_polymerase_II.AllCell.bed ...

  1. File list: Pol.Liv.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Liv.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.05.RNA_polymerase_III.AllCell.bed ...

  2. File list: Pol.Neu.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Neu.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Neural S...1,SRX099887,SRX099886,SRX743834,SRX743832 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Neu.05.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Myo.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_III.AllCell.bed ...

  4. File list: Pol.Lng.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.20.RNA_polymerase_III.AllCell.bed ...

  5. File list: Pol.Kid.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.ALL.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III All ce...,SRX150396,SRX015144,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.05.RNA_polymerase_III.AllCell.bed ...

  7. File list: Pol.Dig.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Dig.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Digest...ive tract http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Dig.50.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Oth.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.20.RNA_polymerase_III.AllCell.bed ...

  9. File list: Pol.Lng.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Lung SRX... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.10.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.Lar.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.10.RNA_polymerase_III.AllCell.bed ...

  11. File list: Pol.Liv.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Liv.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Liver ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_III.AllCell.bed ...

  12. File list: Pol.Unc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.20.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II Uncla...ssified http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

  14. File list: Pol.Gon.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.10.RNA_polymerase_III.AllCell.bed ...

  15. File list: Pol.Bld.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bld.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Blood ...SRX150560,SRX018610,SRX015143,SRX017006,SRX150396,SRX015144 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.50.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Lar.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.20.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX661503,SRX026742,SRX013070,SRX013072,SRX182775,SRX151961,SRX013082,SRX013113 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.20.RNA_polymerase_II.AllCell.bed ...

  17. File list: Pol.ALL.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III All ce...ll types SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.ALL.05.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Prs.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Prs.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Prostate...363,SRX173198,SRX173197 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Plc.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.05.RNA_polymerase_III.AllCell.bed ...

  20. File list: Pol.Lng.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lng.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Lung S...RX016555,SRX150101,SRX150102 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Lng.50.RNA_polymerase_III.AllCell.bed ...

  1. File list: Pol.Bon.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bon.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.20.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Myo.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.ALL.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.20.RNA_polymerase_II.AllCell sacCer3 RNA polymerase RNA polymerase II All c...ell types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Pol.ALL.20.RNA_polymerase_II.AllCell.bed ...

  4. File list: Pol.Oth.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Others S...RX1027436,SRX1027435,SRX1027434,SRX1027433,SRX668218,SRX099880,SRX099879 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.50.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Bld.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bld.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Blood SR...,SRX153079,SRX017717,SRX103447,SRX386121,SRX038919,SRX038920,SRX080132 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.50.RNA_polymerase_II.AllCell.bed ...

  6. File list: Pol.Myo.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.10.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Myo.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.05.RNA_polymerase_II.AllCell.bed ...

  8. File list: Pol.Emb.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.50.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Embryo S...,SRX043866 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.Emb.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.50.RNA_polymerase_III.AllCell.bed ...

  10. File list: Pol.ALL.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II All cell...,SRX1013886,SRX1013900 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.ALL.10.RNA_polymerase_II.AllCell.bed ...

  11. File list: Pol.Oth.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.05.RNA_polymerase_III.AllCell.bed ...

  12. File list: Pol.Liv.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Liv.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Liver SR...1013886 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Liv.50.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Bon.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bon.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.05.RNA_polymerase_III.AllCell.bed ...

  14. File list: Pol.Unc.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Unclas...sified http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.20.RNA_polymerase_III.AllCell.bed ...

  15. File list: Pol.Gon.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Gon.20.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Gonad ...http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Gon.20.RNA_polymerase_III.AllCell.bed ...

  16. File list: Pol.Emb.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Embryo... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Emb.05.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.PSC.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.PSC.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Plurip...otent stem cell http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.50.RNA_polymerase_III.AllCell.bed ...

  18. File list: Pol.Adl.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Adl.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Adult ...SRX395531,SRX331268,SRX331270,SRX395532 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Adl.10.RNA_polymerase_III.AllCell.bed ...

  19. File list: Pol.Kid.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX128201,SRX128200,SRX003882,SRX1206065,SRX1206066,SRX1206067,SRX367323 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.05.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Myo.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Muscle... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.50.RNA_polymerase_III.AllCell.bed ...

  1. File list: Pol.Plc.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Placenta... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.20.RNA_polymerase_II.AllCell.bed ...

  2. File list: Pol.Pan.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Pan.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pancreas... SRX190244 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Pan.50.RNA_polymerase_II.AllCell.bed ...

  3. File list: Pol.Bon.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bon.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Bone SRX...,SRX351408 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.10.RNA_polymerase_II.AllCell.bed ...

  4. File list: Pol.Bld.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bld.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Blood SR...,SRX017986,SRX017985,SRX728781,SRX017717,SRX005163,SRX024360,SRX017718 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bld.10.RNA_polymerase_II.AllCell.bed ...

  5. File list: Pol.Plc.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Plc.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Placen...ta http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Plc.50.RNA_polymerase_III.AllCell.bed ...

  6. File list: Pol.Epd.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Epd.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Epidermi...245,SRX663247,SRX807622 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Epd.05.RNA_polymerase_II.AllCell.bed ...

  7. File list: Pol.Lar.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Lar.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_polymerase_III.AllCell.bed ...

  8. File list: Pol.Emb.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Emb.10.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Embryo SR...7582,SRX050604,SRX050605,SRX013077 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Emb.10.RNA_polymerase_II.AllCell.bed ...

  9. File list: Pol.Myo.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Myo.20.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Muscle h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Myo.20.RNA_polymerase_II.AllCell.bed ...

  10. File list: Pol.Bon.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Bon.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Bone h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Bon.50.RNA_polymerase_III.AllCell.bed ...

  11. File list: Pol.Oth.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Oth.10.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Others... http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Oth.10.RNA_polymerase_III.AllCell.bed ...

  12. File list: Pol.ALL.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.ALL.50.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II All cell ...050605,SRX013073 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.ALL.50.RNA_polymerase_II.AllCell.bed ...

  13. File list: Pol.Kid.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Kidney... SRX016996 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_III.AllCell.bed ...

  14. File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

  15. File list: Pol.Unc.10.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.10.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Unclassi...fied http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Unc.10.RNA_polymerase_II.AllCell.bed ...

  16. File list: Pol.CDV.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.CDV.50.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Cardio...vascular http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.CDV.50.RNA_polymerase_III.AllCell.bed ...

  17. File list: Pol.PSC.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.PSC.05.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Pluripot...833412,SRX149642,SRX702059 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.PSC.05.RNA_polymerase_II.AllCell.bed ...

  18. File list: Pol.Kid.50.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Kid.50.RNA_polymerase_II.AllCell hg19 RNA polymerase RNA polymerase II Kidney S...SRX1206066,SRX1206067,SRX003882,SRX003883,SRX1206065,SRX367323,SRX326416 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Kid.50.RNA_polymerase_II.AllCell.bed ...

  19. File list: Pol.Unc.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Unc.05.RNA_polymerase_II.AllCell ce10 RNA polymerase RNA polymerase II Unclassi...p://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Unc.05.RNA_polymerase_II.AllCell.bed ...

  20. File list: Pol.Prs.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Pol.Prs.05.RNA_polymerase_III.AllCell hg19 RNA polymerase RNA polymerase III Prosta...te http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/Pol.Prs.05.RNA_polymerase_III.AllCell.bed ...