Treatment of Lymphangiomas with OK-432 (Picibanil)

International Nuclear Information System (INIS)

Rautio, Riitta; Keski-Nisula, Leo; Laranne, Jussi; Laasonen, Erkki

2003-01-01

Purpose: To determine the efficacy of OK-432 sclerotherapy in the treatment of lymphangiomas. Methods: The treatment was begun for 14 patients with lymphangioma. The age range of the patients at the time of the first injection was from 10 months to 42 years. Eleven of the lesions involved the head and neck region, two the thorax and one was localized in the extremity. Prior to treatment all patients were investigated with either magnetic resonance imaging, computed tomography, ultrasound or a combination of these modalities. The injections were performed with ultrasound and/or fluoroscopic guidance. Eight patients received OK-432 as first-line treatment; five were treated after surgery and one after medical therapy. On average, 2.2 intracystic injections were performed per patient. Nine of the lesions were macrocystic and five were mixed lesions. Results: Eleven patients showed complete or marked response to the OK-432 sclerotherapy, two patients had moderate shrinkage of their lesions and only one patient showed no response to therapy. Macrocystic lesions showed the best response to therapy. Those patients who received OK-432 as first-line treatment showed complete or marked response. Conclusion: It was found that treatment of lymphangiomas with OK-432 was safe and effective

Radiotherapy of medulloblastoma combined with OK-432 (Picibanil)

International Nuclear Information System (INIS)

Aoki, Yoshiro

1986-01-01

The OK-432 group consists of 8 Medulloblastoma patients, 5 Pinealoma patients and 1 Pons glioma patient, while the historical control group consists of 12 Medulloblastoma patients who have been treated only with radiation at NIRS. The frequency of the week when the value of white blood cell counts decreased below 2,500 was 13 weeks per 98 weeks of total observation period (13.3 %) in the OK-432 group. However, it was 37 weeks per 103 weeks (35.9 %) in the control group. The frequency of the week when the value of the platelet counts decreased below 10 x 10 4 was 5 weeks per 98 weeks (5.1 %) in the OK-432 group, while it was 21 weeks per 103 weeks (20.4 %) in the control group. The OK-432 group received 54.4 ± 3.3 Gy/ 34 ± 2 fractions/ 51 ± 4 days to the cerebellar tumor, except a one-year-old girl who received only a half of the radiation dose as the other patients who were older than 5 years, while the control group received 47.2 ± 7.3 Gy/ 34 ± 7 fractions/ 49 ± 10 days. In terms of TDF, the OK-432 group received 83.5 ± 8.7 and the control group received 63.5 ± 10.2, whereby the difference between the OK-432 group and the control group is statistically significant at 2 % level. To the spinal cord, the OK-432 group received 27.1 ± 3.1 Gy/ 27 ± 5 fractions/ 41 ± 9 days, while the control group received 25.4 ± 7.5 Gy/ 27 ± 13 fractions/ 43 ± 25 days. The survival rate of 8 Medulloblastoma patients treated with radiation combined with OK-432 is as follows : the relative survival rate is 75.1 % in one year, 62.5 % in 3 years and 62.5 % in 5 years, in contrast to the rate of 73.3 % in one year, 20.0 % in 3 years and 20.0 % in 5 years in the control group. (J.P.N.)

Protective action of OK-432 (Picibanil) on the radiation-induced myelosuppression

International Nuclear Information System (INIS)

Aoki, Yoshiro

1986-01-01

This report aims to examine the alleviating action of OK-432 against the radiation-induced myelosuppression in the whole body irradiated mice. The mice treated with OK-432 were given OK-432 with the dose of 5.0 KE by intraperitoneal injection 24 hours before irradiation, while the control group was given 1.0 ml of saline according to the same procedure as the OK-432 group. The fifty percent lethal dose on the 30th day after the whole body irradiation is 700R in the OK-432 group, while it is 580R in the control group. The dose reduction factor (DRF) is 1.21 in this series. The white blood cell counts decreased after irradiation with 300R in both groups. The recovery of WBC counts in the OK-432 group began at the 6th or 7th day after irradiation, while the decreased level continued until the 20th day in the control group. The WBC counts and the spleen weights were examined on the 10th day after irradiation. The WBC counts of the OK-432 group were higher than those of the control group, the difference of which was statistically significant at the 5 % level at 300R. The spleens of the OK-432 group were heavier and larger than those of the control group, the difference of which was statistically significant at the 0.1 % level for the dose range from 300 to 500R. The HE-stained spleen of the OK-432 group on the 10th day after irradiation showed the increase of hematopoietic cells in the enlarged sinus in comparison with that of the control group. The timing of OK-432 administration and the percentage of the survival of the OK-432 group on 30th day, irradiated with 600R to the whole body, were examined. The 5.0 KE of OK-432 was injected from 4 days before and upto 4 days after irradiation to each group. When OK-432 was inected from 2 days before and upto 12 hours after irradiation, the OK-432 group showed the good survival rate in comparison with the control group. (J.P.N.)

OK-432 sclerotherapy for malleolar bursitis of the ankle.

Science.gov (United States)

Park, Kwang Hwan; Lee, Jongseok; Choi, Woo Jin; Lee, Jin Woo

2013-10-01

The purpose of this study was to evaluate the clinical outcomes and usefulness of OK-432 (Picibanil) sclerotherapy as a new option in the conservative treatment of patients with malleolar bursitis of the ankle. Retrospectively, we reviewed a total of 20 consecutive patients (20 feet) in whom OK-432 sclerotherapy had been performed between March 2009 and June 2010. After aspiration of fluid in the malleolar bursal sac, 0.05 mg of OK-432 was injected into the malleolar bursal sac. We evaluated the clinical outcomes and side effects at the following time points: 2 weeks, 1 month, 3 months, 6 months, and 1 year after OK-432 sclerotherapy. The responses to the treatment were assessed according to the degree of fluctuation, shrinkage of the bursal sac, and soft tissue swelling. Complete resolution was observed in 19 patients (95%) after the first or second application of OK-432 sclerotherapy, and a partial response was observed in 1 patient (5%) after a second application of OK-432 sclerotherapy. The physical component scores of SF-36 improved from 70.0 ± 6.8 to 76.5 ± 7.3 at the last follow-up (P = .0002). OK-432 sclerotherapy was a useful procedure for patients not responding to the usual conservative treatment of malleolar bursitis of the ankle. Level IV, retrospective case series.

OK-432 as a sclerosing agent to treat wound-healing impairment.

Science.gov (United States)

Fasching, G; Sinzig, M

2007-12-01

We report on the application of OK-432 (picibanil) in a patient with prolonged wound healing impairment. A 13-year-old girl had suffered a polytrauma with a displaced fracture of the sacrum which required neurosurgical decompression of the sacral plexus. Postoperatively, a seroma with recurrent fistulation was seen. Excision of the wound, prolonged suction drainage and the instillation of hypertonic glucose solution did not have any effect over a period of four months postoperatively. Relying on our personal experience of the treatment of lymphangiomas using OK-432 we instilled OK-432 into the wound. Leakage stopped immediately, there was a regression of fluid accumulation and four weeks later the ultrasound examination was normal. The patient is still asymptomatic four years after treatment. OK-432 can be used effectively for the treatment of chronic wound healing impairment.

O uso de Picibanil (OK-432 no tratamento do linfangioma de cabeça e pescoço

Directory of Open Access Journals (Sweden)

Mello-Filho Francisco V.

2002-01-01

Full Text Available Introdução e Objetivo: O Linfangioma Cérvico-Facial (LCF é geralmente um tumor volumoso, envolvendo estruturas importantes da face e do pescoço. A terapia habitualmente recomendada é a retirada cirúrgica, porém, esta é geralmente seguida de seqüelas importantes, causando deformidade da região. Com o objetivo de avaliarmos uma terapêutica alternativa, analisamos a eficiência do Picibanil (OK 432 no tratamento de LCF em crianças. Forma de Estudo: Clínico retrospectivo. Material e Método: Estudo retrospectivo de seis crianças com diagnóstico de LCF tratadas com OK-432 no HCFMRP-USP no período de 1997 a 2001. Foram analisadas as seguintes características dos LCF: dimensões, tipos de cistos e volume aspirado. Avaliamos, também, o número de aplicações de OK 432 com os respectivos intervalos de tempo utilizados, sua evolução, intercorrências e o resultado final do tratamento. Resultados: Os LCFs apresentavam de oito a 15cm em seu maior diâmetro, na ocasião da primeira consulta, sendo o tipo de cisto mais freqüentemente encontrado o tipo macro cisto. O volume de liquido aspirado variou de dois a 60 ml e o número de aplicações de uma a cinco vezes em intervalos variáveis de um mês a um ano. Em todos os pacientes ocorreu regressão da massa tumoral, sendo que em três houve o desaparecimento total do LCF. A única intercorrência observada foi febre em media de 38.2º C em todos pacientes. Conclusão: O OK 432 é uma droga segura, eficaz e que pode ser utilizada como medida de primeira escolha no tratamento do LCF.

[Unsuccessful treatment with OK-432 picibanil for orbital lymphangioma].

Science.gov (United States)

Lanuza García, A; Bañón Navarro, R; Llorca Cardeñosa, A; Delgado Navarro, C

2012-01-01

Lymphangioma is a malformation of the lymphatic system. The classic approach is surgery. We report a case of orbital lymphangioma in a girl who was given OK-432 to avoid surgery and its complications. OK-432 is a lyophilized mixture of group A Streptococcus pyogenes which produces a fibrosis limited to the lesion with a high cure rate. The main advantages are the easy intra-lesional application. with no scars and or damage of closed areas. Its main disadvantage is a significant local inflammatory reaction. Copyright © 2011 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

OK432 (picibanil) efficacy in an adult with cystic cervical lymphangioma. A case report.

Science.gov (United States)

Alonso, Juan; Barbier, Luis; Alvarez, Julio; Romo, Laura; Martín, Jesús C; Arteagoitia, Iciar; Santamaría, Joseba

2005-01-01

Cervical cystic lymphangioma (CCL) is a rare and benign tumour involving congenital and cystic abnormalities derived from lymphatic vessels. The most accepted treatment continues to be surgical excision. However, when this infiltrates vital neurovascular neck structures, complete excision is difficult and if only partial, the recurrence rate is very high. The most frequently used alternative treatment is to inject sclerosants into the lesion. The use of these techniques has reported good results in children; however, there are few references thereof with regard to adults. We are reporting on a cervical cystic lymphangioma in a male aged 22, treated with an intra-lesion injection of 20 cc with 0.01 mg/cc dilution of OK-432 (picibanil) in physiological serum. Sole complications were fever and local reaction where the solution was injected. One month after treatment the lymphangioma had totally remitted and sixteen months later continues in remittance.

Whole abdominal irradiation for ovarian cancer in combined treatment with OK-432 picibanil

International Nuclear Information System (INIS)

Morita, Shinroku; Arai, Tatsuo; Tsunemoto, Hiroshi

1986-01-01

One hundred seventeen patients with postoperative ovarian cancer who were treated with whole abdominal irradiation by the open-field technique were analyzed as to the effectiveness of combined therapy with or without OK-432. OK-432, 0.2 to 2.0 (KE) (kev) daily, has been used to prevent bone marrow suppression since 1978 at NIRS. Cumulative five-year survival rates were 63.6 % in the OK-432 group (37 patients) and 54.5 % in the NON-OK-432 group (34 patients). The complete rates of previously arranged treatment schedules were 81 % and 66 % in the two groups, respectively, as we originally intended. (author)

The therapeutic effect of OK-432 (picibanil) sclerotherapy for benign neck cysts.

Science.gov (United States)

Kim, Myung Gu; Kim, Sun Gon; Lee, Jun Ho; Eun, Young Gyu; Yeo, Seung Geun

2008-12-01

In general, benign neck cysts are treated by surgical excision. This can present technical difficulties and frequent recurrences, because of insufficient surgery. Sclerosing agents such as OK-432 have been tested for the nonsurgical treatment of these cysts. We have assessed the efficacy of OK-432 sclerotherapy for benign neck cysts. The study group consisted of 75 patients (42 men, 33 women) diagnosed with and treated for benign neck cysts between March 2001 and December 2007 by intralesional injection of OK-432. The liquid content of each cyst was aspirated as much as possible, and the same volume of OK-432 solution was injected. Patients were assessed by ultrasonography or computerized tomography, and therapeutic outcomes and adverse effects were evaluated by patient age, sex, cyst type, and number of injections. Of the 75 treated patients, 31 (41.3%) showed total shrinkage, seven (9.3%) showed near-total shrinkage (>90% of cyst volume), five (6.6%) showed marked shrinkage (>70% of cyst volume), and 17 (22.7%) showed partial shrinkage (<70% of cyst volume). No response was seen in 15 patients (20%). Despite repeated sclerotherapy, eight patients (10.7%) showed recurrences. Minor adverse effects of therapy included fever, localized pain, and odynophagia but these complications spontaneously disappeared within several days. OK-432 sclerotherapy is a safe and effective primary alternative to surgery in patients with benign neck cysts.

Primary treatment of pediatric plunging ranula with nonsurgical sclerotherapy using OK-432 (Picibanil).

Science.gov (United States)

Roh, Jong-Lyel; Kim, Hyo Sun

2008-09-01

Although surgery is the first choice of therapy for plunging ranula, it is associated with technical difficulties, morbidity and recurrence. Plunging ranula may be also primarily treated with nonsurgical sclerotherapy, but there is little experience in pediatric patients. We, therefore, assessed the efficacy of OK-432 sclerotherapy for pediatric plunging ranula. Nine children with plunging ranula were prospectively treated with intracystic injections of OK-432. At the outpatient clinic, the ranula was punctured in the neck and aspirated mucus was replaced with 0.1-0.2mg OK-432 solution. The size of the ranula was compared before and after sclerotherapy. Total or nearly total shrinkage was observed in 6 of 9 patients; marked reduction (>50% of original size) in 2; and partial reduction (<50% of original size) in 1. At a mean follow-up of 26 months after last sclerotherapy, recurrence was observed in only 1 patient; this patient showed complete response after reinjection of OK-432 solution. No significant complications were observed, with only fever and mild local pain observed in 4 patients for 2-4 days after treatment. OK-432 sclerotherapy is safe and effective in the treatment of pediatric plunging ranula. Sclerotherapy may become a primary treatment modality prior to surgery.

[Treatment of lymphangioma with OK-432 infiltration].

Science.gov (United States)

Rodríguez, J; Cáceres, F; Vargas, P

2012-10-01

The management of lymphangioma using sclerotherapy has proven to be an effective therapeutic. Our aim was to evaluate the therapeutic efficacy of OK-432 (Picibanil) in patients with lymphagioma. The study was performed from November 2010 to July 2011. Fifteen patients of both genders were diagnosed with lymphangioma, 12 days to 12 years old. All patients were infiltrated with OK-432. The studied variables were: previous surgery, localization, type of lymphangioma, number of effective injections, reduction of mass valued as excellent (100% reduction), good (reduction > 50%) and bad (reduction < 50%), presence of recurrence and complications. 40% of pacients had prior surgery and 53.3% were located in the cervical-face region. The type of macrocystic lymphangioma was present in 40% of the series, mixed type in 46.6% and microcystic type in 13.4%. The number of effective infiltrations were 3. In 6 cases (40%) the result was excellent in 5 cases (33.4%) the result was good and in 4 cases (26.6%). We had 1 recurrence (6.6%) and we haven't had complications. Injection of OK-432 in macrocystic lymphangioma and mixed had a safe therapeutic modality with satisfactory results. So it is a valid alternative to conventional surgery.

OK-432 sclerotherapy of cervical chylous lymphocele after neck dissection.

Science.gov (United States)

Roh, Jong-Lyel; Park, Chan Il

2008-06-01

Postoperative cervical chylous lymphoceles are extremely rare circumscribed collections of lymph which are usually treated by drainage or surgical exploration, but rarely by sclerotherapy. We investigated the efficacy of OK-432 (Picibanil, Chungai Pharmaceutical Co., Tokyo, Japan) sclerotherapy in the treatment of cervical lymphocele after neck dissection. Four patients with postoperative lymphocele who could not be cured by repeated percutaneous needle aspiration and pressure dressing were treated with intralesional injection of 0.1-0.2 mg OK-432 after aspiration of fluid. The aspirated fluid was assessed biochemically and cytologically, and regular palpation and ultrasonography/computed tomography were used to evaluate outcomes and recurrences. Two patients with chyle leak during neck dissection had lymphoceles in the left supraclavicular region 3 weeks later. The other two patients had lymphoceles on the right neck 9 and 12 months, respectively, after neck dissection. All aspirated fluids were chylous in origin without tumor cells. OK-432 sclerotherapy scored all four lesions with no major complications except for fever and local pain for several days. No lymphocele recurrences or metastatic cancers were observed in any patient for >1 year after sclerotherapy. Intralesional injection of OK-432 may be a safe and effective alternative to surgical exploration in the treatment of cervical lymphocele after neck dissection.

Alleviating action of OK-432 (Picibanil) on the myelosuppression in medulloblastoma patients induced by whole axis irradiation

International Nuclear Information System (INIS)

Aoki, Yoshiro

1982-01-01

The test subjects termed as OK-432 group which consist of 4 patients of Medulloblastoma and 2 of Pinealoma, underwent the whole axis irradiation in combination with OK-432. The control group consisting of 9 Medulloblastoma patients was subjected to the same radiation treatment without OK-432. Six of the nine patients (66.7%) irradiated showed the decrease of peripheral white blood cell counts down to 2,500, whereas, only two of six patients showed a similar decrement in OK-432 group. Three of the nine patients (33.3%) in the control group showed the decrease of white blood cell down to 2,000, but only one of the six patients in OK-432 group. The neutrophil counts decreased below the level of 1,000 in three of the nine patients (33.3%) in the control group, but none in the OK-432 group. The platelet counts decreased below the level of 100,000 in five of the nine patients (55.6%) in the control group during the irradiation period, but only one patient in the OK-432 group showed a decrease down to 100,000 counts. Three of the nine patients (33.3%) in the control group had to be stopped irradiation due to the severe leukopenia and thrombocytopenia, in contrast to the OK-432 group, which completed whole axis irradiation without interruption. These results seem to indicate that OK-432 alleviated the myelosuppression induced in patients by whole axis irradiation. This alleviating action of OK-432 is considered to be applicable to the treatment of Medulloblastoma patients. (J.P.N.)

Alleviating action of OK-432 (Picibanil) on the myelosuppression in Medulloblastoma patients induced by whole axis irradiation

Energy Technology Data Exchange (ETDEWEB)

Aoki, Yoshiro (National Inst. of Radiological Sciences, Chiba (Japan))

1982-11-01

The test subjects termed as OK-432 group which consist of 4 patients of Medulloblastoma and 2 of Pinealoma, underwent the whole axis irradiation in combination with OK-432. The control group consisting of 9 Medulloblastoma patients was subjected to the same radiation treatment without OK-432. Six of the nine patients (66.7%) irradiated showed the decrease of peripheral white blood cell counts down to 2,500, whereas, only two of six patients showed a similar decrement in OK-432 group. Three of the nine patients (33.3%) in the control group showed the decrease of white blood cell down to 2,000, but only one of the six patients in OK-432 group. The neutrophil counts decreased below the level of 1,000 in three of the nine patients (33.3%) in the control group, but none in the OK-432 group. The platelet counts decreased below the level of 100,000 in five of the nine patients (55.6%) in the control group during the irradiation period, but only one patient in the OK-432 group showed a decrease down to 100,000 counts. Three of the nine patients (33.3%) in the control group had to be stopped irradiation due to the severe leukopenia and thrombocytopenia, in contrast to the OK-432 group, which completed whole axis irradiation without interruption. These results seem to indicate that OK-432 alleviated the myelosuppression induced in patients by whole axis irradiation. This alleviating action of OK-432 is considered to be applicable to the treatment of Medulloblastoma patients.

Efficacy and safety of OK-432 immunotherapy of lymphatic malformations.

Science.gov (United States)

Smith, Mark C; Zimmerman, M Bridget; Burke, Diane K; Bauman, Nancy M; Sato, Yutaka; Smith, Richard J H

2009-01-01

To determine the efficacy and safety of the immunostimulant OK-432 (Picibanil) as a treatment option in the management of children with cervicofacial lymphatic malformations. A prospective, randomized, multi-institutional phase II clinical trial at 27 U.S. academic medical centers. 182 patients with lymphatic malformations (LM) were enrolled between January 1998 and November 2004. Of the 151 patients with complete case report forms, 117 patients were randomized into immediate or delayed treatment groups; 34 patients were nonrandomized and assigned to the open-label group. Treatment consisted of a four-dose intralesional injection series of OK-432 at eight-week intervals. Patients randomized into the delayed treatment group served as observational controls for spontaneous regression. Response to therapy was measured radiographically by quantitating change in lesion size and graded as complete (90%-100%), substantial (60%-89%), intermediate (20%-59%), or none (<20%). Of 117 patients randomized with intent-to-treat, 68% demonstrated a complete or substantial response to OK-432 immunotherapy. Response data for macrocystic LM were higher, with a complete or substantial response in 94% of patients; 63% of patients with mixed macrocystic-microcystic LM responded to treatment; no patients with microcystic LM responded to treatment. Spontaneous resolution occurred in less than 2% of patients. Median follow-up of 2.9 years demonstrated a 9% recurrence rate. Major adverse effects related to therapy occurred in 11 patients. As compared to historical surgical data on LM, OK-432 immunotherapy is more effective (P < .001) and has a lower morbidity (P < .001). OK-432 immunotherapy is an effective, safe, and simple treatment option for the management of macrocystic cervicofacial LM. ClinicalTrials.gov Identifier: NCT00010452.

Treatment of lymphatic malformations of head and neck with OK-432 sclerotherapy induce systemic inflammatory response.

Science.gov (United States)

Närkiö-Mäkelä, Mervi; Mäkelä, Teppo; Saarinen, Pia; Salminen, Päivi; Julkunen, Ilkka; Pitkäranta, Anne

2011-01-01

Systemic immune responses after OK-432 (Picibanil) sclerotherapy in patients with head and neck lymphatic malformations (LM) were examined to achieve a better understanding of the mechanism of OK-432 sclerotherapy and to evaluate the long-term treatment outcome. Serum samples from 17 consecutive patients with head and neck LMs were collected during a total of 26 OK-432 treatment episodes. Serum C-reactive protein (CRP), interleukins (IL) 1β, 6, 8, 10, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, RANTES, immune protein (IP)-10 and macrophage chemoattractant protein (MCP)-1 as well as blood leukocyte counts were determined. Clinical outcome of the treatment was evaluated at the last visit and from patient files. Elevated serum levels of IP-10 (means at baseline 702 ng/L, after 1 day 1180 ng/L, after 4 weeks 691 ng/L) were seen on day one after OK-432 sclerotherapy (p < 0.05). C-reactive protein and leukocyte counts 1 day after treatment differed statistically significantly (p < 0.05) from the baseline. No significant differences with other cytokines investigated were observed. Patients with macrocystic LM responded better than patients with microcystic LM (p = 0.01). The elevated levels of IP-10, C-reactive protein and leukocyte levels indicate that OK-432 sclerotherapy induces systemic immune responses in patients with LM. The mechanisms of OK-432 sclerotherapy are still not precisely understood, but the IP-10 elevation may reflect local antiangiogenetic properties of immunoactivation induced by OK-432.

Vaccination with NY-ESO-1 overlapping peptides mixed with Picibanil OK-432 and montanide ISA-51 in patients with cancers expressing the NY-ESO-1 antigen.

Science.gov (United States)

Wada, Hisashi; Isobe, Midori; Kakimi, Kazuhiro; Mizote, Yu; Eikawa, Shingo; Sato, Eiichi; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Yamasaki, Makoto; Miyata, Hiroshi; Matsushita, Hirokazu; Udono, Heiichiro; Seto, Yasuyuki; Yamada, Kazuhiro; Nishikawa, Hiroyoshi; Pan, Linda; Venhaus, Ralph; Oka, Mikio; Doki, Yuichiro; Nakayama, Eiichi

2014-01-01

We conducted a clinical trial of an NY-ESO-1 cancer vaccine using 4 synthetic overlapping long peptides (OLP; peptides #1, 79-108; #2, 100-129; #3, 121-150; and #4, 142-173) that include a highly immunogenic region of the NY-ESO-1 molecule. Nine patients were immunized with 0.25 mg each of three 30-mer and a 32-mer long NY-ESO-1 OLP mixed with 0.2 KE Picibanil OK-432 and 1.25 mL Montanide ISA-51. The primary endpoints of this study were safety and NY-ESO-1 immune responses. Five to 18 injections of the NY-ESO-1 OLP vaccine were well tolerated. Vaccine-related adverse events observed were fever and injection site reaction (grade 1 and 2). Two patients showed stable disease after vaccination. An NY-ESO-1-specific humoral immune response was observed in all patients and an antibody against peptide #3 (121-150) was detected firstly and strongly after vaccination. NY-ESO-1 CD4 and CD8 T-cell responses were elicited in these patients and their epitopes were identified. Using a multifunctional cytokine assay, the number of single or double cytokine-producing cells was increased in NY-ESO-1-specific CD4 and CD8 T cells after vaccination. Multiple cytokine-producing cells were observed in PD-1 (-) and PD-1 (+) CD4 T cells. In conclusion, our study indicated that the NY-ESO-1 OLP vaccine mixed with Picibanil OK-432 and Montanide ISA-51 was well tolerated and elicited NY-ESO-1-specific humoral and CD4 and CD8 T-cell responses in immunized patients.

Treatment of Primary Fetal Hydrothorax with OK-432 (Picibanil): Outcome in 14 Fetuses and a Review of the Literature.

Science.gov (United States)

O'Brien, Brooke; Kesby, Greg; Ogle, Robert; Rieger, Ingrid; Hyett, Jon A

2015-01-01

Primary fetal hydrothorax (PFHT) is an uncommon condition with an estimated prevalence of 1 in 10,000/15,000 pregnancies. Therapeutic interventions include thoracocentesis, thoraco-amniotic shunting (TAS), and pleurodesis using OK-432. A review of the literature was performed to identify all cases of PFHT treated with TAS and OK-432. All cases of PFHT referred to the Fetal Maternal Unit at Royal Prince Alfred Hospital between 2002 and 2012 were retrospectively reviewed. In the cohort of fetuses treated with OK-432, the main perinatal outcomes evaluated were termination of pregnancy, live birth, neonatal death, and fetal death in utero. Secondary outcomes included gestational age (GA) at diagnosis, GA at treatment, GA at resolution, birth weight, and GA at birth. The development of the children was screened using the Ages and Stages Questionnaires, Version 3 (ASQ-3, 2009). Primary hydrothorax was diagnosed in 31 fetuses, of which 14 had treatment with OK-432. One pregnancy terminated after treatment with OK-432. Survival was 85% (11/13): 100% in fetuses treated with OK-432 without hydrops, and 78% in those treated with hydrops. This compares well to the cases of TAS in the literature with an average survival of 63%: 85% in fetuses without hydrops and 55% with hydrops. The mean GA at birth was 36(+4) weeks and mean birth weight 3,007 g. Eight of the 9 children screened with ASQ-3 scored well within the normal range. OK-432 appears to be a valid treatment option in fetuses with PFHT, particularly in those diagnosed at early GAs. © 2014 S. Karger AG, Basel.

The bacterial preparation OK432 induces IL-12p70 secretion in human dendritic cells in a TLR3 dependent manner.

Science.gov (United States)

Hovden, Arnt-Ove; Karlsen, Marie; Jonsson, Roland; Appel, Silke

2012-01-01

Dendritic cells (DC) used in therapeutic cancer immunotherapy have to be able to stimulate T cells resulting in an immune response that can efficiently target the cancer cells. One of the critical hurdles has been the lack of IL-12p70 production when maturating the DC, which is rectified by using the bacterial preparation OK432 (trade name Picibanil) to mature the cells. In order to identify the mechanism behind OK432 stimulation of DC, we investigated the contribution of different TLR to examine their involvement in IL-12p70 production. By combining different inhibitors of TLR signaling, we demonstrate here that TLR3 is responsible for the IL-12p70 production of DC induced by OK432. Moreover, our data suggest that the ligand triggering IL-12p70 secretion upon TLR3 stimulation is sensitive to proteinase and partly also RNAse treatment. The fact that a bacterial compound like OK432 can activate the TLR3 pathway in human DC is a novel finding. OK432 demonstrates a critical ability to induce IL-12p70 production, which is of great relevance in DC based cancer immunotherapy.

The bacterial preparation OK432 induces IL-12p70 secretion in human dendritic cells in a TLR3 dependent manner.

Directory of Open Access Journals (Sweden)

Arnt-Ove Hovden

Full Text Available Dendritic cells (DC used in therapeutic cancer immunotherapy have to be able to stimulate T cells resulting in an immune response that can efficiently target the cancer cells. One of the critical hurdles has been the lack of IL-12p70 production when maturating the DC, which is rectified by using the bacterial preparation OK432 (trade name Picibanil to mature the cells. In order to identify the mechanism behind OK432 stimulation of DC, we investigated the contribution of different TLR to examine their involvement in IL-12p70 production. By combining different inhibitors of TLR signaling, we demonstrate here that TLR3 is responsible for the IL-12p70 production of DC induced by OK432. Moreover, our data suggest that the ligand triggering IL-12p70 secretion upon TLR3 stimulation is sensitive to proteinase and partly also RNAse treatment. The fact that a bacterial compound like OK432 can activate the TLR3 pathway in human DC is a novel finding. OK432 demonstrates a critical ability to induce IL-12p70 production, which is of great relevance in DC based cancer immunotherapy.

Evaluation of OK-432 Injection Therapy as Possible Primary Treatment of Intraoral Ranula.

Science.gov (United States)

Kono, Michihide; Satomi, Takafumi; Abukawa, Harutsugi; Hasegawa, On; Watanabe, Masato; Chikazu, Daichi

2017-02-01

A ranula is a pseudocyst caused by mucous extravasation from the sublingual gland. Recently, a sclerosing agent, OK-432 (picibanil), has been reported to be highly effective for treating lymphangioma and cervical cystic lesions. The present study assessed the effectiveness of OK-432 injection therapy for intraoral ranula to clarify whether it can be used as the primary treatment. The present study was a retrospective clinical study of patients with intraoral ranula who received OK-432 injection therapy from 2005 to 2015. The ranula size was measured on computed tomography or magnetic resonance imaging studies. We dissolved 1 Klinische Einheit (KE) unit of OK-432 powder in normal saline equal to the aspiration volume. The primary endpoint was the treatment results. The secondary endpoints were the relation between the treatment results and the lesion length and aspiration volume. A total of 23 patients received OK-432 injection therapy for an intraoral ranula. The mean lesion size was 19.96 mm. The mean aspiration volume was 2.14 mL. The number of injections was 1 to 4 (mean 1.70). The treatment results were complete regression (CR) in 18 (78.2%), partial regression (PR) in 3 (13.0%), and no response (NR) in 2 (8%) patients after the last injection. The overall efficacy rate was 91.2% (21 of 23). No serious complications were observed. The lesion length and aspiration volume of the CR group was 17.38 mm and 1.40 mL, respectively. The lesion length and aspiration volume of the PR/NR group was 29.20 mm and 4.80 mL, respectively. The PR/NR group lesions were significantly larger than the CR group lesions. OK-432 injection therapy for intraoral ranula is safe and effective compared with other surgical therapies. This therapy could potentially become a primary treatment of intraoral ranula. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Uso de OK-432 em crianças com linfangioma OK-432 therapy for lymphangioma in children

Directory of Open Access Journals (Sweden)

Everaldo Ruiz Jr.

2004-04-01

Full Text Available OBJETIVO: Relatar a experiência no uso do OK-432 para tratamento de linfangiomas em crianças. MÉTODOS: Estudo retrospectivo de 19 crianças com linfangioma tratadas com OK-432 no Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto - USP, durante o período de 1999 a 2003. RESULTADOS: Todos os pacientes apresentaram alguma resposta ao OK-432, 12 pacientes apresentaram regressão total, sete apresentaram regressão parcial variando de 50% a 80%. Os pacientes apresentaram febre após a aplicação da droga com duração de 2 a 10 dias. Não se observaram cicatrizes após a aplicação do OK-432. CONCLUSÕES: A droga OK-432 é segura, eficaz e pode ser utilizada como primeira escolha no tratamento de pacientes com linfangiomas devido à excelente resposta, podendo tornar desnecessária a realização de cirurgia. Em pacientes com resposta parcial, podem ser realizadas novas aplicações de OK-432 ou cirurgia menos mutilante, devido à redução das dimensões da lesão.OBJECTIVE: To report the experience with OK-432 therapy for lymphangioma in children. METHODS: Retrospective study of 19 children with lymphangioma treated with OK-432 in Ribeirão Preto, state of São Paulo, Brazil, between 1999 and 2003. RESULTS: All patients presented response to OK-432, 12 had total shrinkage and seven had partial shrinkage varying from 50% to 80%. Patients had fever after injections of OK-432 for 2 to 10 days, no damage to the overlying skin was observed. CONCLUSION: OK-432 is safe, effective and can be used as primary choice of treatment of patients with lymphangiomas because of the excellent response. In these cases surgery should not be necessary. In patients with partial regression new injections of OK-432 must be used to shrink the lesion. Thereby safely surgery could be made.

Efficacy of dendritic cells matured early with OK-432 (Picibanil), prostaglandin E2, and interferon-alpha as a vaccine for a hormone refractory prostate cancer cell line.

Science.gov (United States)

Yoo, Changhee; Do, Hyun-Ah; Jeong, In Gab; Park, Hongzoo; Hwang, Jung-Jin; Hong, Jun Hyuk; Cho, Jin Seon; Choo, Myong-Soo; Ahn, Hanjong; Kim, Choung-Soo

2010-09-01

Dendritic cells (DCs) are potent antigen-presenting cells. OK432 (Picibanil) was introduced as a potent stimulator of DC maturation in combination with prostaglandin-E(2) and interferon-alpha. We compared the efficacy of a DC-prostate cancer vaccine using early-mature DCs stimulated with OK432, PGE2 and INF-alpha (OPA) with that of vaccines using other methods. On days 3 or 7 of DC culture, TNF-alpha (T), TNF-alpha and LPS (TL) or OPA were employed as maturation stimulators. DU145 cells subjected to heat stress were hybridized with mature DCs using polyethyleneglycol. T cells were sensitized by the hybrids, and their proliferative and cytokine secretion activities and cytotoxicity were measured. The yields of early-mature DCs were higher, compared to yields at the conventional maturation time (P<0.05). In the early maturation setting, the mean fusion ratios, calculated from the fraction of dual-positive cells, were 13.3%, 18.6%, and 39.9%, respectively (P=0.051) in the T only, TL, and OPA-treated groups. The function of cytotoxic T cells, which were sensitized with the hybrids containing DCs matured early with OPA, was superior to that using other methods. The antitumor effects of DC-DU145 hybrids generated with DCs subjected to early maturation with the OPA may be superior to that of the hybrids using conventional maturation methods.

Efficacy of Dendritic Cells Matured Early with OK-432 (Picibanil®), Prostaglandin E2, and Interferon-α as a Vaccine for a Hormone Refractory Prostate Cancer Cell Line

Science.gov (United States)

Yoo, Changhee; Do, Hyun-Ah; Jeong, In Gab; Park, Hongzoo; Hwang, Jung-Jin; Hong, Jun Hyuk; Cho, Jin Seon; Choo, Myong-Soo; Ahn, Hanjong

2010-01-01

Dendritic cells (DCs) are potent antigen-presenting cells. OK432 (Picibanil®) was introduced as a potent stimulator of DC maturation in combination with prostaglandin-E2 and interferon-α. We compared the efficacy of a DC-prostate cancer vaccine using early-mature DCs stimulated with OK432, PGE2 and INF-α (OPA) with that of vaccines using other methods. On days 3 or 7 of DC culture, TNF-α (T), TNF-α and LPS (TL) or OPA were employed as maturation stimulators. DU145 cells subjected to heat stress were hybridized with mature DCs using polyethyleneglycol. T cells were sensitized by the hybrids, and their proliferative and cytokine secretion activities and cytotoxicity were measured. The yields of early-mature DCs were higher, compared to yields at the conventional maturation time (P<0.05). In the early maturation setting, the mean fusion ratios, calculated from the fraction of dual-positive cells, were 13.3%, 18.6%, and 39.9%, respectively (P=0.051) in the T only, TL, and OPA-treated groups. The function of cytotoxic T cells, which were sensitized with the hybrids containing DCs matured early with OPA, was superior to that using other methods. The antitumor effects of DC-DU145 hybrids generated with DCs subjected to early maturation with the OPA may be superior to that of the hybrids using conventional maturation methods. PMID:20808670

Vaccination with OK-432 followed by TC-1 tumor lysate leads to significant antitumor effects.

Science.gov (United States)

Chen, I-Ju; Yen, Chih-Feng; Lin, Kun-Ju; Lee, Chyi-Long; Soong, Yung-Kuei; Lai, Chyong-Huey; Lin, Cheng-Tao

2011-07-01

Human papillomavirus (HPV) infects large numbers of women worldwide and is present in more than 99% of all cervical cancer. TC-1 cell is a cell line with high expression of E7 antigen of HPV type 16 and its cell lysate has been demonstrated as an ideal inducer of E7-specific, antitumor immunity. OK-432 (Picibanil), a penicillin-killed Streptococcus pyogenes, has been reported with potent immunomodulation properties in cancer treatment by stimulating the maturation of dendritic cells (DCs) and secretion of Th-1 type cytokines. The current study demonstrated that a protocol to immunize the C57BL/6 mice with OK-432 followed by treatment with TC-1 lysate can generate markedly increased immune responses of E7-specific CD4(+) T cells and a moderate increase of natural killer (NK) cell, as well as a satisfactorily protective and therapeutic antitumor effect by triggering the DCs to prime T cells. Depletion of lymphocyte subset in vivo suggested that the antitumor effects could be dominantly executed by CD8+ T cells and followed by NK cells, and both of these reactions were induced by the generation of robust E7-specific CD4(+) T helper cell response. These findings warrant OK-432 combination with tumor-lysate as an effective and safe vaccine in future clinical application of cervical cancer.

Percutaneous sclerotherapy of massive macrocystic lymphatic malformations of the face and neck using fibrin glue with OK-432 and bleomycin.

Science.gov (United States)

Chen, W-l; Huang, Z-q; Chai, Q; Zhang, D-m; Wang, Y-y; Wang, H-j; Wang, L; Fan, S

2011-06-01

Picibanil (OK-432) and bleomycin have been used as alternative sclerosing agents for lymphatic malformations. This study evaluated the clinical curative effect of sclerotherapy using fibrin glue combined with OK-432 and bleomycin for the treatment of macrocystic lymphatic malformations of the face and neck. Fifteen paediatric patients (6 males; 9 females, aged 13 months to 14 years) who had received percutaneous sclerotherapy for massive macrocystic lymphatic malformations of the face and neck were retrospectively reviewed. Affected regions included the neck, parotid region and parapharynx, mouth floor, face and cheek, and orbital regions. All patients showed preoperative symptoms of space-occupying lesions between 4 cm × 5 cm and 12 cm × 16 cm in size. Fibrin glue with OK-432 and bleomycin was injected under general anaesthesia. All patients received preoperative and follow-up CT scans. Outcomes were assessed by three surgeons. All patients exhibited mid-facial swelling for 3-4 weeks after surgery, but no major complications. Follow-up periods ranged from 8 to 16 months. Eight lesions were completely involuted, five were mostly involuted, and two were partially involuted. Percutaneous sclerotherapy using fibrin glue with OK-432 and bleomycin provided a simple, safe, and reliable alternative treatment for massive macrocystic lymphatic malformations of the face and neck. Copyright © 2011 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Treatment of lymphangiomas of the head and neck in children by intralesional injection of OK-432 (Picibanil).

Science.gov (United States)

Brewis, C; Pracy, J P; Albert, D M

2000-04-01

The treatments previously used for lymphangiomas of the head and neck in children-surgery and intralesional injection of sclerosants-are associated with significant morbidity. A new treatment-intralesional injection of OK-432-was used for lymphangiomas of the head and neck in 11 children. The results were total shrinkage in two, marked shrinkage in two, slight shrinkage in five and no response in two. The results were not affected by previous surgery nor by whether aspiration prior to injection was possible. There were no recurrences in those children in whom shrinkage occurred and no child had subsequent surgery following injection. The results of this series support those of previous series showing that OK-432 injection is an effective and safe treatment for lymphangiomas of the head and neck in children.

Labeled OK-432, immunomodulator of streptococcus preparation, in cancer patients

International Nuclear Information System (INIS)

Toki, Hironobu; Ishikawa, Morihiro; Fujii, Masashi; Yumoto, Yasuhiro; Ishimitsu, Tetsusaburo

1982-01-01

We investigated the pharmacokinetics of OK-432, an immunomodulator of streptococcus preparation which, is used in cancer patients for active nonspecific immunotherapy. First, OK-432 was labeled with sup(99m)Technetium in vitro. Four patients with malignancy were studied. By the method of scintigraphy using gamma camera, OK-432 administered intravenously was found to be distributed in the liver, lung and spleen, by the decreasing grade. When OK-432 was administered subcutaneously or intramuscularly in the buttocks, most of the radioactivity of sup(99m)Technetium remained locally at the injected site. These results suggested that OK-432 given intravenously was effectively phagocytized by cells of reticuloendothelial system (RES). Compared with other routes of administration, the intravenous route of OK-432 administration is thus considered more effective in order to stimulate RES, which is responsible for the first step of immune reaction. (author)

OK-432 (Picibanil) sclerotherapy for recurrent dislocation of the temporomandibular joint in elderly edentulous patients: Case reports.

Science.gov (United States)

Matsushita, Kazuhiro; Abe, Takae; Fujiwara, Toshikatsu

2007-09-01

Dislocation of the temporomandibular joint (TMJ) is a thorny problem not only for a patient but also a doctor. Especially for the elderly edentulous patients, it is very hard to treat the condition although there are many surgical and non-surgical procedures. We successfully treated it in two elderly edentulous patients by injection of OK-432 as a sclerosing agent.

Picibanil (OK-432 in the treatment of head and neck lymphangiomas in children

Directory of Open Access Journals (Sweden)

Elena Rebuffini

2012-01-01

Conclusions: Intracystic injection of Picibanil is an effective and safe treatment for macrocystic LMs in pediatric patients and may represent the treatment of choice in such cases, especially where surgical excision is associated with the risk of functional/cosmetic side effects.

Prevention of radiation-induced bacteraemia by post-treatment with OK-432 and aztreonam

Energy Technology Data Exchange (ETDEWEB)

Kurishita, A.; Ono, T. (Tohoku Univ., Sendai (Japan). School of Medicine); Uchida, A. (Kyoto Univ. (Japan). Radiation Biology Center)

1993-03-01

The effects of combined treatment with OK-432, an immunomodulator prepared from Streptococcus haemolyticus, and aztreonam, a monobactum antibiotic, in the prevention of radiation-induced bacteraemia and mortality were examined in ICR-MCH mice irradiated with 9.5 Gy. The organisms recovered from the irradiated mice were Streptococcus faecalis and Proteus mirabilis. Treatment with aztreonam reduced the incidence of mice infected with Proteus mirabilis (p<0.01), but it showed no efficacy on Streptococcus faecalis. OK-432 could reduce the frequency of bacteraemia attributed to both organisms (p<0.05). Combined treatment with OK-432 and aztreonam further decreased the incidence of bacteraemia by both organisms; no organisms were recovered at 14 days following irradiation. The survival rate at 30 days following irradiation was 80% in mice treated with OK-432 plus aztreonam and 55% with OK-432 alone, while it was 0% in the groups treated with aztreonam or saline alone. These results indicated that combined treatment with OK-432 and a suitable antibiotic such as aztreonam is more effective than OK-432 or aztreonam alone. (Author).

Prevention of radiation-induced bacteraemia by post-treatment with OK-432 and aztreonam

International Nuclear Information System (INIS)

Kurishita, A.; Ono, T.; Uchida, A.

1993-01-01

The effects of combined treatment with OK-432, an immunomodulator prepared from Streptococcus haemolyticus, and aztreonam, a monobactum antibiotic, in the prevention of radiation-induced bacteraemia and mortality were examined in ICR-MCH mice irradiated with 9.5 Gy. The organisms recovered from the irradiated mice were Streptococcus faecalis and Proteus mirabilis. Treatment with aztreonam reduced the incidence of mice infected with Proteus mirabilis (p<0.01), but it showed no efficacy on Streptococcus faecalis. OK-432 could reduce the frequency of bacteraemia attributed to both organisms (p<0.05). Combined treatment with OK-432 and aztreonam further decreased the incidence of bacteraemia by both organisms; no organisms were recovered at 14 days following irradiation. The survival rate at 30 days following irradiation was 80% in mice treated with OK-432 plus aztreonam and 55% with OK-432 alone, while it was 0% in the groups treated with aztreonam or saline alone. These results indicated that combined treatment with OK-432 and a suitable antibiotic such as aztreonam is more effective than OK-432 or aztreonam alone. (Author)

The prognostic advantage of preoperative intratumoral injection of OK-432 for gastric cancer patients

Science.gov (United States)

Gochi, A; Orita, K; Fuchimoto, S; Tanaka, N; Ogawa, N

2001-01-01

To investigate, by a multi-institutional randomized trial, the prognostic significance of the augmentation of tumour-infiltrating lymphocytes (TILs) by preoperative intratumoral injection of OK-432 (OK-432 it), a bacterial biological response modifier, in patients with gastric cancer. The 10-year survival and disease-free survival were examined and analysis of the factors showing survival benefit was performed. 370 patients who had undergone curative resection of gastric cancer were enrolled in this study and followed up for 10 years postoperatively. Patients were randomized into either an OK-432 it group or a control group. Ten Klinishe Einheit (KE) of OK-432 was endoscopically injected at 1 to 2 weeks before the operation in the OK-432 it group. Both groups received the same adjuvant chemoimmunotherapy consisting of a bolus injection of mitomycin C (0.4 mg kg−1i.v.) and administration of tegafur and OK-432 from postoperative day 14 up to 1 year later. Tegafur (600 mg day−1) was given orally and OK-432 (5 KE/2 weeks) was injected intradermally for a maintenance therapy. The TILs grades in resected tumour specimens and presence of metastasis and metastatic pattern in dissected lymph nodes were examined. Multivariate analysis was performed to determine the efficacy of OK-432 it on prognostic factors. All patients were followed up for 10 years. The overall 5- and 10-year survival rates and disease-free survival rates of the OK-432 it group were not significantly higher than those of the control group. However, OK-432 it significantly increased the 5- and 10-year survival rates of patients with stage IIIA + IIIB, moderate lymph node metastasis (pN2), and positive TILs. OK-432 it was most effective at prolonging the survival of patients who had both positive TILs and lymph node metastasis. The OK-432 it group with positive TILs showed a significant decrease in metastatic lymph node frequency and in the number of lymph node micro- metastatic foci when compared to

Randomized controlled study on the effect of adjuvant immunotherapy with OK-432 on malignant gliomas

International Nuclear Information System (INIS)

Shibata, Shobu; Mori, Kazuo; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.

1985-01-01

During periods from January, 1981 to December, 1983, 51 patients (31 malignant astrocytomas, 17 glioblastomas, and others 3) were treated with radiochemotherapy using Nimustine hydrochloride, ACNU (group B) and radiochemoimmunotherapy with Picibanil, OK-432 (group A) by randomized controlled study. Group A consisted of 24 patients and group B of 27 patients. The differences in the background of the two groups were not statistically significant. Survival curves of both groups were shown by the Kaplan-Meier method. The postoperative survival rate at 1 year and 2 years were 70 % and 30 %, respectively, equal in both groups, and the differences between groups A and B were not statistically significant by the Cox-Mantel test. The side effects by group B therapy were most prominent in the bone marrow, and severe leukopenia occurred. However, group A therapy suppressed leukopenia after 2 months. Immunological parameters, such as purified protein derivative skin reaction test did not change, but streptococcal Su-polysaccharide skin reaction test became positive after group A therapy. (author)

Combination therapy with radiation and OK-432 immunotherapy of cancer patients

International Nuclear Information System (INIS)

Hashimoto, Shozo; Miyamoto, Hiroshi

1978-01-01

We treated cancer patients with radiotherapy alone and with radiation plus immunotherapy at the Department of Radiology, Keio University Hospital. In all of the cancer patients who had radiationtherapy alone, a general depression in their immune reactivity was seen, but not seen in those who received radiationtherapy plus immunotherapy. Immunotherapy is defined as a stimulator of cancer patient's immune reaction. Usually radiationtherapy caused lymphopenia in which mainly T lymphocytes were decreased in number selectively, but there was no lymphopenia in cases treated with immunotherapy. We have performed nonspecific immunotherapy with OK-432. The result indicated that T lymphocytes were increased by OK-432 in spite of radiationtherapy. From this fact, OK-432 will be useful for suppression of metastasis and regression of tumors. (auth.)

OK-432 sclerotherapy for benign cystic head and neck lesions

International Nuclear Information System (INIS)

Kim, Chang Hyun; Rho, Myung Ho; Lee, Sang Wook

2003-01-01

To evaluate the efficacy of OK-432 solution for slerotheraphy of cystic lesions of the head and neck. Nineteen cystic lesions comprising ten plunging ranulas, three simple ranulas, three cystic lymphangiomas, one first branchial cleft cyst and two unknown supraclavicular cysts considered to be lymphangiomas were treated by sucking out as much liquid content as possible and then injecting the same volume of OK-432 solution under ultrasound guidance. Patients were followed up clinically and radiologically. Follow-up sonography or CT- performed after a mean interval of nine months showed total or near-total shrinkage of four plunging ranulas. However, six such lesions recurred in spite of more than one (mean, two) sclerotherapy sessions. In cases involving two simple ranulas at the floor of the mouth, failure resulted from extracystic leakage of OK-432 solution via the puncture site. Two unilocular cystic lymphangiomas completely regressed during the follow-up period (mean, seven months), but the multiocular type showed a 65% volume reduction after 12 months. A first branchial cleft cyst was markedly reduced in size, with only a small cystic portion remaining after eight months, follow-up. Two supraclavicular cysts with straw-color fluid did not respond to sclerotherapy. OK-432 sclerotherapy of macrocystic lymphangiomas is an effective and promising alternative to surgery. For other cysts, however, including plunging ranula, efficacy, varied, and 64% of such lesions recurred

OK-432 sclerotherapy for benign cystic head and neck lesions

Energy Technology Data Exchange (ETDEWEB)

Kim, Chang Hyun; Rho, Myung Ho; Lee, Sang Wook [Masan Samsung Hospital, Masan (Korea, Republic of)

2003-12-01

To evaluate the efficacy of OK-432 solution for slerotheraphy of cystic lesions of the head and neck. Nineteen cystic lesions comprising ten plunging ranulas, three simple ranulas, three cystic lymphangiomas, one first branchial cleft cyst and two unknown supraclavicular cysts considered to be lymphangiomas were treated by sucking out as much liquid content as possible and then injecting the same volume of OK-432 solution under ultrasound guidance. Patients were followed up clinically and radiologically. Follow-up sonography or CT- performed after a mean interval of nine months showed total or near-total shrinkage of four plunging ranulas. However, six such lesions recurred in spite of more than one (mean, two) sclerotherapy sessions. In cases involving two simple ranulas at the floor of the mouth, failure resulted from extracystic leakage of OK-432 solution via the puncture site. Two unilocular cystic lymphangiomas completely regressed during the follow-up period (mean, seven months), but the multiocular type showed a 65% volume reduction after 12 months. A first branchial cleft cyst was markedly reduced in size, with only a small cystic portion remaining after eight months, follow-up. Two supraclavicular cysts with straw-color fluid did not respond to sclerotherapy. OK-432 sclerotherapy of macrocystic lymphangiomas is an effective and promising alternative to surgery. For other cysts, however, including plunging ranula, efficacy, varied, and 64% of such lesions recurred.

Post-irradiation treatment with OK432 can prevent radiation-induced bone marrow death

International Nuclear Information System (INIS)

Kurishita, A.; Uehara, Y.; Tohoku Univ., Sendai; Katoh, H.; Hirose, S.; Uchida, A.; Mizutani, Y.; Okada, S.; Ono, T.

1991-01-01

The radioprotective effect of OK432, a Streptocuccus haemolyticus preparation, on bone marrow death was examined in mice. The LD 50 value was increased from 7.55 Gy in controls to 8.45 Gy in mice treated once with OK432 immediately after irradiation. Multiple administration of the agent further elevated the LD 50 value to 9.56 Gy. The radioprotective effect was also apparent when multiple treatments were commenced as late as 72 h after irradiation. (author)

[Effect of intravenous treatment with OK-432 on the bone marrow in patients with lung cancer].

Science.gov (United States)

Fujii, M; Ishikawa, M; Toki, H

1984-03-01

We studied effects of OK-432 on the bone marrow and peripheral blood cells of lung cancer patients. The nuclear cell count of bone marrow increased in 5 to 7 patients upon intravenous treatment with OK-432 compared with 3 of 6 patients who were intramuscularly treated with OK-432. Serial neutrophil counts of bone marrow increased in all 7 patients treated intravenously compared with 3 of 6 patients treated intramuscularly. The mean nuclear cell count or the serial neutrophil count of bone marrow in intravenously treated patients was significantly higher than the pretreatment values (p less than 0.001). In the peripheral blood picture, the difference in white blood cells or neutrophils before and after intravenous treatment was also statistically significant (p less than 0.01). There was no change in the erythrocytic series count of bone marrow and the hemoglobin count. Our results support the superiority of intravenous OK-432 treatment over intramuscular treatment in the growth-accelerating effect on bone marrow cells, especially regarding the neutrophil series.

Experimental intraperitoneal infusion of OK-432 in rats: Evaluation of peritoneal complications and pathology

Energy Technology Data Exchange (ETDEWEB)

Kim, Dong Wook [Department of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of); Kim, Hak Jin, E-mail: hakjink@pusan.ac.k [Department of Radiology, Pusan National University Hospital, Pusan National University College of Medicine, Medical Research Institute, Busan (Korea, Republic of); Lee, Jun Woo [Department of Radiology, Pusan National University Hospital, Pusan National University College of Medicine, Medical Research Institute, Busan (Korea, Republic of)

2010-06-15

Purpose: OK-432 is known to be a potent sclerosant of cystic lesions. The purpose of this study was to evaluate both its safety and pathologic effects after the infusion of OK-432 into the peritoneal cavity of rats. Materials and methods: Twenty male rats were used in this study. Twelve rats were infused intraperitoneally with 0.2 Klinishe Einheit of OK-432 melted in 2 mL of normal saline (group 1: the treated group); four rats each were infused intraperitoneally with 0.5 mL of 99% ethanol (group 2) and normal saline (group 3), and served as the control groups. An abdominal ultrasonographic examination was performed both before and after the infusions in all rats. Three rats in group 1 and one rat in each of groups 2 and 3 were sacrificed each week following the infusion. Gross and microscopic evaluations of the peritoneum and abdominal cavity were performed on each rat. Results: In group 1, the abdomen was clear on gross inspection and the peritoneum was unremarkable on microscopic examination. In group 2, mild-to-moderate peritoneal adhesions were revealed grossly, and inflammation and fibrosis of the peritoneum were demonstrated microscopically. In group 3, no specific abnormalities were noted on gross or microscopic examinations. Conclusion: Leakage or abnormal infusion of OK-432 solution into the peritoneal cavity during sclerotherapy of intra-abdominal or retroperitoneal cystic lesions does not result in any significant complications.

Experimental intraperitoneal infusion of OK-432 in rats: Evaluation of peritoneal complications and pathology

International Nuclear Information System (INIS)

Kim, Dong Wook; Kim, Hak Jin; Lee, Jun Woo

2010-01-01

Purpose: OK-432 is known to be a potent sclerosant of cystic lesions. The purpose of this study was to evaluate both its safety and pathologic effects after the infusion of OK-432 into the peritoneal cavity of rats. Materials and methods: Twenty male rats were used in this study. Twelve rats were infused intraperitoneally with 0.2 Klinishe Einheit of OK-432 melted in 2 mL of normal saline (group 1: the treated group); four rats each were infused intraperitoneally with 0.5 mL of 99% ethanol (group 2) and normal saline (group 3), and served as the control groups. An abdominal ultrasonographic examination was performed both before and after the infusions in all rats. Three rats in group 1 and one rat in each of groups 2 and 3 were sacrificed each week following the infusion. Gross and microscopic evaluations of the peritoneum and abdominal cavity were performed on each rat. Results: In group 1, the abdomen was clear on gross inspection and the peritoneum was unremarkable on microscopic examination. In group 2, mild-to-moderate peritoneal adhesions were revealed grossly, and inflammation and fibrosis of the peritoneum were demonstrated microscopically. In group 3, no specific abnormalities were noted on gross or microscopic examinations. Conclusion: Leakage or abnormal infusion of OK-432 solution into the peritoneal cavity during sclerotherapy of intra-abdominal or retroperitoneal cystic lesions does not result in any significant complications.

Disease: H01471 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available HORS ... Ogita S, Tsuto T, Nakamura K, Deguchi E, Tokiwa K, Iwai N ... TITLE ... OK-432 therapy for lymphangioma in child...Rautio R, Rautiainen M, Airaksinen M ... TITLE ... OK-432 (Picibanil) therapy for lymphangiomas in children. ...

Modification of radiation therapy by RP-170, hypoxic cell sensitizer and OK-432, biological response modifier (BRM)

International Nuclear Information System (INIS)

Murayama, Chieko; Mori, Tomoyuki; Tamauchi, Hidekazu

1995-01-01

Studies have shown that the combination therapy with RP-170, irradiation and OK-432 could produce significantly higher antitumor effect. The multiple local administration of OK-432 showed superior sensitizing effect in tumor growth delay, tumor control and survival rate. DMF from TCD 50 assay was 2.09 which might be equivalent to that from irradiation with over several hundred mg/kg of RP-170. Additionally combined with 50 mg/kg RP-170, nearly available dose in clinical use, the combined treatment with RP-170, irradiation and OK-432 produced DMF of 1.4, which could be gotten by over 100 mg/kg of RP-170. The success of this combination therapy on murine tumors might also suggest a possibility for a great benefit in clinical radiotherapy. More detailed investigations, histological and immunological research, are under progress. 14 refs., 2 tabs., 3 figs

A phase I study of vaccination with NY-ESO-1f peptide mixed with Picibanil OK-432 and Montanide ISA-51 in patients with cancers expressing the NY-ESO-1 antigen.

Science.gov (United States)

Kakimi, Kazuhiro; Isobe, Midori; Uenaka, Akiko; Wada, Hisashi; Sato, Eiichi; Doki, Yuichiro; Nakajima, Jun; Seto, Yasuyuki; Yamatsuji, Tomoki; Naomoto, Yoshio; Shiraishi, Kenshiro; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Oka, Mikio; Pan, Linda; Hoffman, Eric W; Old, Lloyd J; Nakayama, Eiichi

2011-12-15

We conducted a phase I clinical trial of a cancer vaccine using a 20-mer NY-ESO-1f peptide (NY-ESO-1 91-110) that includes multiple epitopes recognized by antibodies, and CD4 and CD8 T cells. Ten patients were immunized with 600 μg of NY-ESO-1f peptide mixed with 0.2 KE Picibanil OK-432 and 1.25 ml Montanide ISA-51. Primary end points of the study were safety and immune response. Subcutaneous injection of the NY-ESO-1f peptide vaccine was well tolerated. Vaccine-related adverse events observed were fever (Grade 1), injection-site reaction (Grade 1 or 2) and induration (Grade 2). Vaccination with the NY-ESO-1f peptide resulted in an increase or induction of NY-ESO-1 antibody responses in nine of ten patients. The sera reacted with recombinant NY-ESO-1 whole protein as well as the NY-ESO-1f peptide. An increase in CD4 and CD8 T cell responses was observed in nine of ten patients. Vaccine-induced CD4 and CD8 T cells responded to NY-ESO-1 91-108 in all patients with various HLA types with a less frequent response to neighboring peptides. The findings indicate that the 20-mer NY-ESO-1f peptide includes multiple epitopes recognized by CD4 and CD8 T cells with distinct specificity. Of ten patients, two with lung cancer and one with esophageal cancer showed stable disease. Our study shows that the NY-ESO-1f peptide vaccine was well tolerated and elicited humoral, CD4 and CD8 T cell responses in immunized patients. Copyright © 2011 UICC.

Effect of soluble factors derived from oral cancer cells on the production of interferon-γ from peripheral blood mononuclear cells following stimulation with OK-432.

Science.gov (United States)

Ohe, Go; Sasai, Akiko; Uchida, Daisuke; Tamatani, Tetsuya; Nagai, Hirokazu; Miyamoto, Youji

2013-08-01

The streptococcal antitumor agent OK-432 is commonly used as an immunopotentiator for immunotherapy in various types of malignant tumors including oral cancer. It has been demonstrated that OK-432 elicits an antitumor effect by stimulating immunocompetent cells, thereby inducing multiple cytokines including interferon (IFN)-γ, interleukin (IL)-2 and IL-12. Serum concentrations of IFN-γ in patients with oral cancer were examined 24 h after administration of OK-432. Serum concentrations of IFN-γ in patients with advanced cancer were significantly lower than those in patients with early cancer. These results suggested that some soluble factors produced by cancer cells may inhibit IFN-γ production with OK-432. Thus, in the present study, an in vitro simulation model was established for the immune status of patients with oral cancer by adding conditioned medium (CM) derived from oral cancer cell lines into a culture of peripheral blood mononuclear cells (PBMCs) derived from a healthy volunteer. We investigated whether soluble factors derived from oral cancer cells affected IFN-γ production from PBMCs following stimulation with OK-432. PBMCs stimulated with OK-432 produced a large amount of IFN-γ; however, both IFN-γ production and cytotoxic activity from PBMCs induced by OK-432 were inhibited by the addition of CM in a dose-dependent manner. In order to examine these inhibitory effects against IFN-γ production, the contribution of inhibitory cytokines such as IL-4, IL-6, IL-10, transforming growth factor-β and vascular endothelial growth factor was investigated. However, neutralization of these inhibitory cytokines did not recover IFN-γ production inhibited by CM. These results indicated that unknown molecules may inhibit IFN-γ production from PBMCs following stimulation with OK-432.

Effect of concomitant use of immunomodulator (OK-432 and/or PSK) on advanced lung cancer (squamous cell carcinoma and adenocarcinoma) treated with radiation with combined chemotherapy

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Kimura, Shuji; Imajo, Yoshinari

1982-01-01

Between 1975 and 1979, 209 cases of primary lung cancer admitted to the department of radiology were treated with radiation with combined chemotherapy. OK-432 and/or PSK as an immunomodulator was administered to 130 of these cases, and survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunomodulator. In 61 cases (squamous cell carcinoma and adenocarcinoma) in stage III (UICC, 1978), fifty percent survival period was found to be 12.5 months for 16 cases with OK-432, 13.5 months for 9 cases with OK-432 and PSK, 9.0 months for 18 cases with PSK, and 8.0 months for 18 cases without immunotherapy, respectively. (author)

Percutaneous sclerotherapy of sialoceles after parotidectomy with fibrin glue, OK-432, and bleomycin.

Science.gov (United States)

Chen, Wei-liang; Zhang, Li-ping; Huang, Zhi-quan; Zhou, Bin

2013-12-01

We evaluated the curative effect of fibrin glue combined with OK-432 (streptococcal pyrogenic exotoxin A, Picibanil™) and bleomycin on 9 patients with sialoceles after parotidectomy. The primary lesions included pleomorphic adenomas in 6 cases and Warthin's tumours in 3 cases. After a sialocele had been diagnosed each patient had repeated aspirations and pressure dressings for 3-4 weeks, but these treatments failed. The patients were then treated with percutaneous sclerotherapy with the injection of fibrin glue 8-10 ml combined with OK-432 5 mg and bleomycin 15 mg. All the sialoceles disappeared completely after a single procedure in 2-3 weeks. The patients have been followed up for more than 6 months with no evidence of recurrent sialocele or injury to the facial nerve related to sclerotherapy. This simple, safe technique can be successfully used to treat sialoceles after parotidectomy. Copyright © 2013 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Effect of concomitant use of immunomodulator (OK-432 and/or PSK) on primary lung cancer (stages III, IV) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Kimura, S.; Ogawa, Y.; Imajo, Y.

1982-01-01

OK-432 (a lyophilized preparation of a low virulent strain, Su, of Streptococcus hemolytics (Group A) treated with penicillin G) and/or PSK (a protein-bound polysaccharide prepared from Coriolus versicolor) as an immunomodulator was administered to 209 patients of advanced lung cancer treated with radiation with combined chemotherapy. Their effects on immunological parameters and patients' survival periods were examined. Suppression of both PHA (phytohemagglutinin) skin test activities and lymphocyte blastoid transformation with PHA were reduced in the immunomodulator administered group compared with the non-administered group. Survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunomodulator. It was suggested that OK-432 and/or PSK combined with radiation with combined chemotherapy was effective for the elongation of the survival period. These results indicated that the long-term administration of OK-432 and/or PSK was recommended for patients with advanced lung cancer. (author)

Efficacy of in vitro sensitized cells generated by in vivo priming with OK-432 for adoptive immunotherapy of the poorly immunogenic B16-Bl6 melanoma.

Science.gov (United States)

Mukai, S; Kato, H; Kimura, S; Asai, K; Kawahito, Y; Inoue, M; Yamamura, Y; Sano, H; Sugino, S; Shu, S; Kondo, M

1996-02-01

We investigated the efficacy of the streptococcal preparation OK-432 as an adjuvant for in vivo priming in induction of sensitized cells for adoptive immunotherapy of the poorly immunogenic B16-BL6 (BL6) melanoma. C57BL/6 (B6) mice were immunized subcutaneously (s.c.) with 3 x 10(6) viable BL6 tumor cells admixed with various doses of OK-432 ranging from 1 to 100 micrograms in the foot-pad. Draining popliteal lymph nodes (LNs) were harvested 7 days after immunization and LN cells were further sensitized with irradiated tumor cells in the presence of 60-300 IU/ml of IL-2 for 11 days. These in vitro sensitized (IVS) cells (2 x 10(6)) were transferred intravenously (i.v.) to B6 mice bearing 4-day pulmonary metastases established by i.v. injection of 2-4 x 10(5) viable BL6 cells. The mice were also received intraperitoneally (i.p.) 4 x 10(4) IU/day of IL-2 for 4 days after adoptive transfer. Transfer of IVS cells from mice immunized by s.c. injection of tumor cells admixed with 10 micrograms of OK-432 significantly reduced the numbers of BL6 pulmonary metastases compared with that of control IVS' cells without the administration of OK-432 (P = 0.003). These effective IVS cells also significantly prolonged the survival of treated animals (P = 0.003). Functional IVS cells required in vitro stimulation with tumor cells. However, addition of OK-432 in the vaccine resulted in no enhancement of in vitro cytotoxicity and no characteristic change of phenotype of IVS cells. These results suggest that in vivo priming of OK-432 facilitates the sensitization of tumor-reactive T-cells. The procedure of in vivo priming with OK-432 may be beneficial in the adoptive immunotherapy of melanoma.

OK-432 reduces mortality and bacterial translocation in irradiated and granulocyte-colony stimulating factor (G-CSF)-treated mice

Energy Technology Data Exchange (ETDEWEB)

Nose, Masako; Uzawa, Akiko; Ogyu, Toshiaki [National Inst. of Radiological Sciences, Chiba (Japan); Suzuki, Gen

2001-06-01

Acute radiation induces bacterial translocation from the gut, followed by systemic infection and sepsis. In order to reduce the mortality after acute whole body irradiation, it is essential to control bacterial translocation. In this study, we established a bacterial translocation assay as a sensitive method to detect minor mucosal injury by radiation. By utilizing this assay, we evaluated the adverse effects, if any, of hematopoietic reagents on the mucosal integrity in the respiratory and gastro-intestinal tracts. Bacterial translocation to the liver and spleen occurred after whole-body irradiation if the dose exceeded 6 Gy. The administration of G-CSF unexpectedly increased the bacterial translocation in 8 Gy-irradiated mice. The pharmaceutical preparation of low-virulent Streptococcus pyogenes, OK-432, significantly reduced the endotoxin levels in peripheral blood without any reduction of bacterial translocation. A combined treatment with G-CSF and OK-432 decreased bacterial translocation and prevented death. This result indicates that the early administration of G-CSF has an adverse effect on bacterial translocation, and that a combined treatment of G-CSF and OK-432 attenuates the adverse effect of G-CSF and improves the survival rate after acute irradiation. (author)

OK-432 sclerotherapy in head and neck lymphangiomas: long-term follow-up result.

Science.gov (United States)

Yoo, Jae Chul; Ahn, Youngjin; Lim, Yune Syung; Hah, J Hun; Kwon, Tack-Kyun; Sung, Myung-Whun; Kim, Kwang Hyun

2009-01-01

Nonsurgical treatments, such as sclerotherapy have been attempted for head and neck lymphagiomas. Of the available sclerosing agents, picibanil has shown satisfactory short-term treatment results in many studies, but no study has presented long-term treatment results. Accordingly, in the present study, the authors retrospectively reviewed the long-term treatment results of picibanil sclerotherapy. Fifty-five lymphangioma patients who underwent picibanil sclerotherapy were enrolled. Data about initial and long-term response, recurrence, and excision rate were collected. Initial response rates were 83.5 percent and long-term response rates were 76.3 percent. Initial and the long-term response rate were equally good for lymphangioma.

New combined therapy of radiation and local administration of OK-432 for esophageal cancer

International Nuclear Information System (INIS)

Mukai, Minoru; Morita, Shinroku; Tsunemoto, Hiroshi

1990-01-01

We devised new combination therapy of radiation and local administration of OK-432 and performed for 26 patients with esophageal cancer between March, 1987 and December, 1988 as a pilot study. The average age was 73 years. Among 26 patients, males were 20 and females were six. Patients were irradiated at the schedule of under 2 Gy/day and the dose of TDF (time, dose and fractionation factor) 100 totally. OK-432, 10KE was endoscopically administered around cancer lesion at the beginning of the radiotherapy, and two weeks later, 5KE was given in the same manner. Complete response was obtained in 20 out of 26 cases (77%) and partial response was obtained in the remaining six cases (23%). All six patients with tumor length less than five cm showed complete response. All 16 patients who could not eat food orally before treatment, became to take food enough orally after the treatment and could discharge in good condition. One year and two years survival rate of 26 patients by Kaplan Meier method were 67.4% and 47.2%, respectively. Six patients with tumor length less than five cm, are all alive without a sign of recurrence. This combination therapy will improve not only the response rate and the survival rate, but also the quality of life of patients with esophageal cancer. (author)

A Case of Sublingual Ranula That Responded Successfully to Localized Injection Treatment with OK-432 after Healing from Drug Induced Hypersensitivity Syndrome

Directory of Open Access Journals (Sweden)

Kunio Yoshizawa

2016-01-01

Full Text Available A ranula is a mucus retention cyst or pseudocyst caused by leakage of mucus from the sublingual gland and generally occurs in the oral floor. In addition, drug induced hypersensitivity syndrome (DIHS is a rare but well-recognized serious adverse effect characterized by fever, skin rashes, generalized lymphadenopathy, hepatitis, and hepatosplenomegaly and oral stomatitis. This paper presents the first case of successfully treated sublingual ranula with localized injection of OK-432 after healing from drug induced hypersensitivity syndrome, which has previously been unreported in the literature. We present the case of a 38-year-old Japanese woman with sublingual ranula that responded successfully to localized injection treatment with OK-432 after healing from drug induced hypersensitivity syndrome. She was affected with cutaneous myositis and interstitial lung disease when she was 26 years old. At the age 34 years, she received additional oral treatment of diaminodiphenyl-sulfone due to deterioration of the cutaneous myositis, which resulted in drug induced hypersensitivity syndrome (DIHS with severe oral stomatitis. Local injection of OK-432 to the ranula may be a very safe and useful treatment method even if the patient has a history of drug allergy and has connective tissue disease such as cutaneous myositis.

Prepubertal unilateral gynecomastia and the presence of 47,XXY mosaicism in breast epithelial cells

DEFF Research Database (Denmark)

Andersen, Peter Stemann; Petersen, Bodil Laub; Juul, Anders

2013-01-01

, and sclerotherapy with Picibanil (OK-432) was attempted without any detectable effect on size. The mass was later excised. The pathological examination revealed mammary gland tissue suggestive of idiopathic gynecomastia. FISH revealed 47, XXY mosaicism in the abnormal breast epithelial cells, but not in peripheral...

Increased tumor uptake of 67Ga citrate following a course of picibanil (NSC-B116209)

International Nuclear Information System (INIS)

Okuyama, Shinichi; Matsuzawa, Taiju; Mishina, Hitoshi.

1979-01-01

Exposure to exponential dose schedules of OK-432, penicillin-inactivated preparation of streptococcus hemolyticus (NSC-B116209), resulted in an increased retention of 67 Ga citrate. Its uptake in footpad tumors of AH 109A was also increased. The results may suggest that pretreatment with OK-432 would increase tumor uptake of 67 Ga citrate and help scintigraphic delineation of malignancies in man. It may probably augment tumor concentration of anticancer chemotherapeutics, too. Thus, the tumor affinitive property of OK-432 can be taken advantage of in anticancer strategy as well as cancer detection by 67 Ga scanning. (author)

[Severe iatrogenic airway obstruction due to lingual lymphangioma].

Science.gov (United States)

Segado Arenas, A; Flores González, J-C; Rubio Quiñones, F; Quintero Otero, S; Hernández González, A; Pantoja Rosso, S

2011-09-01

Lymphangioma of the tongue is a rare and benign tumour involving congenital and cystic abnormalities derived from lymphatic vessels. Treatment modalities include surgery and a large number of different intralesional injections of sclerosing agents. Presently, OK-432 (Picibanil(®)) is the preferred sclerosant and when administered intralesionally will result in inflammation, sclerosis, and cicatricial contraction of the lesion. We report a case of microcystic lymphangioma of the tongue in a 5-year-old boy treated with an intralesional injection of OK-432. In the immediate postoperative period, the patient suffered severe diffuse swelling, progressive upper airway obstruction with inspiratory stridor, and respiratory distress requiring emergency fiberoptic nasotracheal intubation. Although OK-432 injections are found to be safe and effective as a first line of treatment for lymphangiomas, local swelling with potentially life-threatening airway compromise should be anticipated, especially when treating lesions near the upper airway. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Intrapleural chemo- and hyperthermotherapies for malignant pleural effusion: a randomized prospective study.

Science.gov (United States)

Chen, Wen-Jun; Yuan, Shao-Fei; Yan, Qing-Yuan; Xiong, Jian-Ping; Wang, Sen-Ming; Zheng, Wei-E; Zhang, Wu; Sun, Hong-Yu; Chen, Hua; Wu, Li-Li

2012-02-01

The current prospective randomized study was designed to evaluate the safety and efficacy of combined intrapleural cisplatin and OK-432 (picibanil) plus hyperthermotherapy in patients with malignant pleural effusion (MPE). A total of 358 patients with MPE due to end-stage malignancies were enrolled and randomly divided into two groups, A and B: the intrapleural combination of cisplatin and OK-432 with hyperthermotherapy (n = 179) or without hyperthermotherapy (n = 179), respectively. Mild toxicities such as nausea, vomiting or anorexia, bone marrow depression, and pyrexia were similar in both groups. Patients in Group A (with hyperthermotherapy) showed a significantly higher overall response (93.4%) compared to those in Group B (79.8%, χ(2) = 43.11, p .05). After treatment, the quality of life scores were significantly increased in both groups as compared to prior treatment (p < .05). In conclusion, our study suggests that combined intrapleural cisplatin and OK-432 followed by hyperthermotherapy are more effective in the control of MPE and improve patients' quality of life.

A phase II study of cisplatin, oral administration of etoposide, OK-432 and radiation therapy for inoperable stage III non-small cell lung cancer

International Nuclear Information System (INIS)

Abe, Yoshinao; Takahashi, Jutaro; Fukuda, Hiroshi

1998-01-01

This study was designed to evaluate the feasibility and efficiency of giving cisplatin, etoposide, and OK-432 concurrently with conventional radiotherapy (RTx) for patient's with inoperable stage III, based on the TNM classification according to the International Union against Cancer staging system for lung cancer (1987) non-small cell lung cancer (NSCLC). From January 1992 to December 1994, 31 patients with cytologically or histologically confirmed stage III NSCLC were treated with RTx, to a total dose of 56-64 Gy, with concurrent daily oral administration of etoposide (25 mg) and cisplatin (20 mg) for 5 days during the third or fourth week from the start of RTx. The subcutaneous injection of 1 or 2 KE of OK-432, three times a week, for the duration of radiotherapy also started from the beginning of RTx. The number of eligible patients was 29 (26 men and 3 women). Their mean age was 66 years (range, 55-77 years). Six patients had an Eastern Cooperative Oncology Group performance status (PS) of 0; 15, 1; 8; 2. Three were stage IIIA, and 26, stage IIIB. Histologically, 2 had adenocarcinoma, 23, squamous cell carcinoma, and 4, large cell carcinoma. In 27 of the 29 patients, the RTx schedule was completed. There were no treatment-related deaths. Grade 4 toxicity (according to World Health Organisation criteria) leukopenia (700/μl) was observed in 1 patient. The response rate was 79% and the median survival was 17 months. Survival rates at 1, 2 and 3 years were 62%, 31%, and 21%, respectively. The local failure rate was 51%. The combination of cisplatin, etoposide, and OK-432, given concurrently with conventional RTx is feasible and effective for inoperable stage III NSCLC. (author)

Microbubbles in macrocysts - Contrast-enhanced ultrasound assisted sclerosant therapy of a congenital macrocystic lymphangioma: a case report.

Science.gov (United States)

Menendez-Castro, Carlos; Zapke, Maren; Fahlbusch, Fabian; von Goessel, Heiko; Rascher, Wolfgang; Jüngert, Jörg

2017-07-06

Congenital cystic lymphangiomas are benign malformations due to a developmental disorder of lymphatic vessels. Besides surgical excision, sclerosant therapy of these lesions by intracavitary injection of OK-432 (Picibanil®), a lyophilized mixture of group A Streptococcus pyogenes, is a common therapeutical option. For an appropriate application of OK-432, a detailed knowledge about the structure and composition of the congenital cystic lymphangioma is essential. SonoVue® is a commercially available contrast agent commonly used in sonography by intravenous and intracavitary application. Here we report the case of 2 month old male patient with a large thoracic congenital cystic lymphangioma. Preinterventional imaging of the malformation was performed by contrast-enhanced ultrasound after intracavitary application of SonoVue® immediately followed by a successful sclerotherapy with OK-432. Contrast agent-enhanced ultrasound imaging offers a valuable option to preinterventionally clarify the anatomic specifications of a congenital cystic lymphangioma in more detail than by single conventional sonography. By the exact knowledge about the composition and especially about the intercystic communications of the lymphangioma sclerosant therapy becomes safer and more efficient.

Sclerotherapy for lymphatic malformations in children: a scoping review.

Science.gov (United States)

Churchill, Paige; Otal, Damanjot; Pemberton, Julia; Ali, Abdullah; Flageole, Helene; Walton, J Mark

2011-05-01

This scoping review assesses the literature and summarizes the current evidence on sclerotherapy for the treatment of lymphatic malformations in pediatric patients. A comprehensive search of published and unpublished literature was conducted using multiple databases. Title, abstract, and full-text screening was conducted by 2 independent clinicians. All discrepancies were resolved during consensus meetings. A total of 182 articles were retrieved. Forty-four articles were removed as duplicates, and 11 articles were added after reviewing prominent studies. After full-text abstraction, 44 articles and 2 conference proceedings (N = 882 patients) were included in the final results. Twelve articles were classified as level II and 34 articles as level IV evidence. Picibanil (OK-432) was the primary agent used in most included studies. Postinjection symptoms with OK-432 were primarily fever, swelling, and erythema at the site. Life-threatening complications were uncommon and involved postinjection swelling of cervical lesions causing airway compromise. The literature regarding sclerotherapy for lymphatic malformations is of a low level of evidence and suffers from a lack of standardization. Randomized clinical trials focused on OK-432, bleomycin, or alcoholic solution of zein; standardized dosing protocols; and consistent and reliable outcome reporting will be necessary for further development of treatment guidelines. Copyright © 2011 Elsevier Inc. All rights reserved.

Treatment of Lymphatic Malformations With OK-432 (Picibanil) : Review of the Literature

NARCIS (Netherlands)

Poldervaart, Michelle T.; Breugem, Corstiaan C.; Speleman, Lucienne; Pasmans, Suzanne

Introduction: Lymphatic malformations (LM) are benign structural defects that call cause serious complications because of their size and location. Traditionally surgical removal was the first treatment modality, but this Could be associated with many complications and risks. Since Ogita introduced

[Treatment of lymphangiomas with picibanil in the first year of life].

Science.gov (United States)

Subotic, U; Hosie, S; Waag, K L; Reinshagen, K

2008-01-01

The therapeutic gold standard of cystic hygroma is its complete resection. Because of its growth pattern and its main location in the head and neck region complete resection is not always possible. An alternative is the local injection of Picibanil, but only few cases have been published about its use in infants. We retrospectively analyzed the data of 8 infants (age: 2 weeks-12 months) who got Picibanil therapy because of cystic hygroma in the time period 2002 until 2006. Follow up ranged from 3 months up to 3 years. During the postoperative period all patients had local swelling, in 4 cases accompanied with local inflammation and fever. Tumor reduction of >50% was obtained in 7 of 8 patients. Local injection of Picibanil in infants with cystic hygroma seems to be a safe alternative to surgical therapy, especially when complete tumor resection means damage of important neighbouring structures. Prospective trials are necessary to confirm the better outcome after therapy with Picibanil compare to primary surgery.

U Jóok'ol T'aan, "La salida del habla" U Jóok'ol T'aan, "The Coming Out of Speech"

Directory of Open Access Journals (Sweden)

Hilario Chi Canul

2012-01-01

Full Text Available En este escrito pretendo desarrollar la concepción, la metodología, epistemología, la didáctica y la pedagogía que está detras de U jóok'ol t'aan, "La salida del habla", desde y con las voces de algunas madres mayas, obtenidas mediante una investigación etnográfica que forma parte de mi investigación de tesis "La vitalidad del Maaya T'aan. Estudio etnográfico de la comunicación intergeneracional de los mayas de Naranjal Poniente". Por otro lado, también examino la enseñanza escolarizada de la lengua maya, específicamente el currículo estatal que se emplea para la enseñanza de la lengua maya, y la contrapongo con la adquisición de la misma lengua en las familias para generar caminos hacia una posible interculturalización de la enseñanza de las lenguas indígenas.In this writing I am trying to develop the conception of the methodology, epistemology, didactics and the pedagogy that are standing of the u jóok'ol t'aan, "the exit of the speech", from and with the voices of some Mayan mothers, obtained by means of an ethnographic investigation that comprises of my thesis research, "La vitalidad del Maaya T'aan. Estudio etnográfico de la comunicación intergeneracional de los mayas de Naranjal Poniente". On the other hand, also I try to work and oppose the sent to school education of the Mayan language, specifically the state curriculum that is used for teaching Mayan language, with the acquisition of the same language in the families, to generate ways towards a possible interculturalization of the education of the indigenous languages.

Combination (RaHPP) of radiotherapy, hyperthermia and chemotherapy (peplomycin and picibanil) for bladder cancer

Energy Technology Data Exchange (ETDEWEB)

Washida, Hiroto; Tsugaya, Masayuki; Hirao, Noriaki; Hachisuka, Yusuke

1984-09-01

Four patients with urinary bladder carcinoma were treated by combination therapy which consisted of hyperthermia vesical irrigation of two anticancer drugs (peplomycin and picibanil), intravesical instillation of those drugs and radiation. Following the therapeutic method we planned, 40 mg of peplomycin and 10 KE of picibanil in 1,500 ml of sterile distilled water was irrigated at 42 to 43/sup 0/C into the bladder for 3 hours; 40 mg of peplomycin and 10 KE of picibanil in 40 ml of sterile distilled water was instilled into the bladder; and, the focus was irradiated with /sup 60/Co to a focal dose of 200 rad 30 minutes later. This pattern of treatment was repeated once a week, 3 to 5 times in total. On the days this pattern was not taken, 5 KE of picibanil in 20 ml of sterile distilled water was instilled into the bladder cavity. Complete response was observed in one patient and partial response in 3 patients. The side effect was temporary irritable bladder symptom. (author).

Combination (RaHPP) of radiotherapy, hyperthermia and chemotherapy (peplomycin and picibanil) for bladder cancer

International Nuclear Information System (INIS)

Washida, Hiroto; Tsugaya, Masayuki; Hirao, Noriaki; Hachisuka, Yusuke

1984-01-01

Four patients with urinary bladder carcinoma were treated by combination therapy which consisted of hyperthermia vesical irrigation of two anticancer drugs (peplomycin and picibanil), intravesical instillation of those drugs and radiation. Following the therapeutic method we planned, 40 mg of peplomycin and 10 KE of picibanil in 1,500 ml of sterile distilled water was irrigated at 42 to 43 0 C into the bladder for 3 hours; 40 mg of peplomycin and 10 KE of picibanil in 40 ml of sterile distilled water was instilled into the bladder; and, the focus was irradiated with 60 Co to a focal dose of 200 rad 30 minutes later. This pattern of treatment was repeated once a week, 3 to 5 times in total. On the days this pattern was not taken, 5 KE of picibanil in 20 ml of sterile distilled water was instilled into the bladder cavity. Complete response was observed in one patient and partial response in 3 patients. The side effect was temporary irritable bladder symptom. (author)

Effect of streptococcal preparation (picibanil) on the postoperative rise in serum alanine aminotransferase activity in patients with urogenital cancer.

OpenAIRE

Taketa, Kazuhisa; Ohmori, Hiroyuki; Matsumura, Yonesuke; Asahi, Toshihiko; Okimune, Masaaki

1980-01-01

The effect of Picibanil, a streptococcal agent, on the development of liver injury after operations for urogenital cancer was studied retrospectively in the light of serum alanine aminotransferase (ALT) activity. The series comprised 32 cases receiving Picibanil and 33 controls with otherwise comparable clinical backgrounds. Picibanil reduced the incidence of postoperative ALT rise over 50 U/l within 6 weeks but increased it thereafter. The increase in ALT activity after 6 weeks was relativel...

Local Delivery System of Immune Modulating Drug for Unresectable Adenocarcinoma: In Vitro Experimental Study and In Vivo Animal Study

International Nuclear Information System (INIS)

Lee, Don Haeng; Kang, Sung-Gwon; Jeong, Seok; Yoon, Chang Jin; Choi, Jung-Ah; Byun, Ju Nam; Park, Jae Hyung; Lee, Kyu Back

2006-01-01

The purpose of the study was to evaluate the efficacy and safety of a developed drug delivery system containing OK-432 through in vitro and animal study. An OK-432-impregnated polycarbonate/polyurethane stent membrane was used to develop a drug delivery system (DDS) enabling the locoregional release of OK-432. Polyethyleneglycol was used as a detergent and porosity generator. The stability of OK-432 in solvent, releasing kinetics of drug, and cytotoxicity of the DDS were evaluated. OK-432-impregnated DDS was implanted in mice in which a human adenocarcinoma cell line was injected and grown in their back. Flow cytometry and enzyme-linked immunosorbent assay were used for quantifying the amount of drug. OK-432 exposed to phosphate-buffered saline and OK-432 exposed to N,N-dimethylacetamide showed similar results on dot graphs and histograms. However, OK-432 exposed to tetrahydrofurane showed different dot graphs and histograms, which means that the antigenicity of the drug was changed. The release rate of OK-432 was maintained at a constant level for 6 weeks. The local delivery of OK-432 was found to have an antitumor effect on a human adenocarcinoma cell line in an animal study, but no effect on this cell line in in vitro cell culture. Histologic examination showed minimal inflammatory reaction in surrounding tissue. Our study shows that local treatment using this OK-432 release system is safe and effective in reducing adenocarcinoma in a mouse model

Clinical effect of concomitant use of non-specific immunopotentiator on 172 cases of primary lung cancer (stage 3, 4) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Hiyoshi, Yukio; Ogawa, Yasuhiro; Imajo, Yoshinari

1981-01-01

Between 1975 and 1979, 209 cases of primary lung cancer admitted the department of radiology were treated with radiation combined with chemotherapy. The clinical effect of concomitant use of non-specific immunopotentiator OK-432 and PSK was studied about stage 3, and stage 4. Survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunotherapy. In 91 cases in stage 3, fifty percent survival period was found to be 12.2 months for 27 cases with OK-432, 14.4 months for 12 cases with combined use of OK-432 and PSK, 9.0 months for 24 cases with PSK, and 7.5 months for 28 cases without immunotherapy, respectively. Noticeable prolongation of fifty percent survival period was observed in the cases with combined use of OK-432 and PSK, OK-432, and PSK, inorder, as compared with those without immunotherapy. One-year survival rate was 51.9% for cases with OK-432, 66.7% with combined use OK-432 and PSK, 34.8% with PSK, and 25.0% without immunotherapy, respectively. In 81 cases in stage 4, fifty percent survival period was found to be 7.0 months for 24 cases with OK-432, 5.0 months for 8 cases with combined use of OK-432 and PSK, 7.6 months for 13 cases with PSK, and 3.3 months for 36 cases without immunotherapy, respectively. One-year survival rate was 16.7% for cases with OK-432, 25.0% with combined use of OK-432 and PSK, 15.4% with PSK and 5.6% without immunotherapy, respectively. (J.P.N.)

Combined effects of radiotherapy and non-specific immunotherapy

International Nuclear Information System (INIS)

Yamashita, Takashi; Hayakawa, Yukiko; Mochizuki, Yukio

1985-01-01

Local and systemic effects of the combined use of radiotherapy and administration of OK-432 were examined using tumor-bearing mice. Tumor regrowth was inhibited by local administration of OK-432 following radiotherapy. Systemic inhibitory effects of OK-432 on tumors were not seen. When radiotherapy is performed in combination with administration of OK-432, synergistic effects will be observed. (Namekawa, K.)

Retiform hemangioendothelioma developed on the site of an earlier cystic lymphangioma in a six-year-old girl.

Science.gov (United States)

Albertini, Anne-Fore; Brousse, Nicole; Bodemer, Christine; Calonje, Eduardo; Fraitag, Sylvie

2011-10-01

Retiform hemangioendothelioma (RH) is a rare low-grade malignancy angiosarcoma, with a high rate of local recurrence and a low metastatic risk. A 6 year-old girl with a large cervical cystic lymphangioma diagnosed by ultrasound and Doppler ultrasound, which showed a large multiloculated anechoic cyst with no flow. The lymphangioma was treated with injections of Picibanil (OK-432). The tumor regressed, but after a year, she developed a poorly limited infiltrated plaque spreading out regularly over her chest, back, and shoulder. The biopsy showed a poorly limited dermal and subcutaneous vascular proliferation composed of elongated arborising vessels lined with ovoid endothelial cells in a hobnail pattern. In addition, the deep part of the lesion showed typical features of a papillary intralymphatic angioendothelioma pattern (PILA) or Dabska tumor. The endothelial cells strongly expressed podoplanin (D2-40). A diagnosis of RH with focal areas of PILA was reached. The girl died 8 months after surgery of hypovolemic shock in a context of diffuse lymphangiomatosis with pulmonary localization. To our knowledge, RH has hardly ever been described in children. This entity exhibits a continuum with the PILA, sharing not only morphological and immunohistochemical similarities but also its ability to develop in a context of a vascular anomaly, particularly a lymphangioma. The role of Picibanil in the development of this tumor can be discussed.

Metallothionein induction: a measure of radioprotective action

Energy Technology Data Exchange (ETDEWEB)

Matsubara, J.

1988-08-01

Mice treated to induce metallothionein (MT) synthesis in the liver prior to irradiation were resistant to radiation; this also was true of mice that had a portion of skin surgically removed or an immunomodulator administered. Mice given Mn, Cd or Zn subcutaneously prior to irradiation showed increased tolerance to an LD50 level (6-8 Gy) of x rays compared with controls that received no pretreatments (p less than 0.01). All the mice were evaluated during a 30-d postirradiation period. Weight loss in control mice peaked two weeks after irradiation, whereas body weight in mice pretreated with Mn continued to increase after irradiation with x rays. The normal level of MT in mouse liver (25 micrograms g-1 tissue) increased to 70 micrograms g-1 liver tissue in mice irradiated with 6.3-Gy x rays. However, following subcutaneous injection of Cd, Mn or Zn, or intraperitoneal injection of OK-432 (Picibanil, a killed streptococcal preparation, MT levels in liver increased by a factor of 2-8 compared to irradiated that were not treated with the reagents listed above. The mortality rate of mice with a surgically excised 2 X 2-cm2 portion of dorsal skin or of those administered OK-432 was lower than that of controls, and MT levels in liver (150-400 micrograms g-1 tissue) were higher than those of irradiated mice that were not surgically treated. These results suggest that the body's protective action against radiation correlates with the biosynthesis of MT, or that MT acts as a scavenger of radiation-induced peroxides.

Metallothionein induction: a measure of radioprotective action

International Nuclear Information System (INIS)

Matsubara, J.

1988-01-01

Mice treated to induce metallothionein (MT) synthesis in the liver prior to irradiation were resistant to radiation; this also was true of mice that had a portion of skin surgically removed or an immunomodulator administered. Mice given Mn, Cd or Zn subcutaneously prior to irradiation showed increased tolerance to an LD50 level (6-8 Gy) of x rays compared with controls that received no pretreatments (p less than 0.01). All the mice were evaluated during a 30-d postirradiation period. Weight loss in control mice peaked two weeks after irradiation, whereas body weight in mice pretreated with Mn continued to increase after irradiation with x rays. The normal level of MT in mouse liver (25 micrograms g-1 tissue) increased to 70 micrograms g-1 liver tissue in mice irradiated with 6.3-Gy x rays. However, following subcutaneous injection of Cd, Mn or Zn, or intraperitoneal injection of OK-432 (Picibanil, a killed streptococcal preparation, MT levels in liver increased by a factor of 2-8 compared to irradiated that were not treated with the reagents listed above. The mortality rate of mice with a surgically excised 2 X 2-cm2 portion of dorsal skin or of those administered OK-432 was lower than that of controls, and MT levels in liver (150-400 micrograms g-1 tissue) were higher than those of irradiated mice that were not surgically treated. These results suggest that the body's protective action against radiation correlates with the biosynthesis of MT, or that MT acts as a scavenger of radiation-induced peroxides

Code OK3 - An upgraded version of OK2 with beam wobbling function

Science.gov (United States)

Ogoyski, A. I.; Kawata, S.; Popov, P. H.

2010-07-01

For computer simulations on heavy ion beam (HIB) irradiation onto a target with an arbitrary shape and structure in heavy ion fusion (HIF), the code OK2 was developed and presented in Computer Physics Communications 161 (2004). Code OK3 is an upgrade of OK2 including an important capability of wobbling beam illumination. The wobbling beam introduces a unique possibility for a smooth mechanism of inertial fusion target implosion, so that sufficient fusion energy is released to construct a fusion reactor in future. New version program summaryProgram title: OK3 Catalogue identifier: ADST_v3_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADST_v3_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 221 517 No. of bytes in distributed program, including test data, etc.: 2 471 015 Distribution format: tar.gz Programming language: C++ Computer: PC (Pentium 4, 1 GHz or more recommended) Operating system: Windows or UNIX RAM: 2048 MBytes Classification: 19.7 Catalogue identifier of previous version: ADST_v2_0 Journal reference of previous version: Comput. Phys. Comm. 161 (2004) 143 Does the new version supersede the previous version?: Yes Nature of problem: In heavy ion fusion (HIF), ion cancer therapy, material processing, etc., a precise beam energy deposition is essentially important [1]. Codes OK1 and OK2 have been developed to simulate the heavy ion beam energy deposition in three-dimensional arbitrary shaped targets [2, 3]. Wobbling beam illumination is important to smooth the beam energy deposition nonuniformity in HIF, so that a uniform target implosion is realized and a sufficient fusion output energy is released. Solution method: OK3 code works on the base of OK1 and OK2 [2, 3]. The code simulates a multi-beam illumination on a target with arbitrary shape and

Is Dieting OK for Kids?

Science.gov (United States)

... First Aid & Safety Doctors & Hospitals Videos Recipes for Kids Kids site Sitio para niños How the Body ... Educators Search English Español Is Dieting OK for Kids? KidsHealth / For Kids / Is Dieting OK for Kids? ...

Chemical pleurodesis for prolonged postoperative air leak in primary spontaneous pneumothorax.

Science.gov (United States)

How, Cheng-Hung; Tsai, Tung-Ming; Kuo, Shuenn-Wen; Huang, Pei-Ming; Hsu, Hsao-Hsun; Lee, Jang-Ming; Chen, Jin-Shing; Lai, Hong-Shiee

2014-05-01

Prolonged air leak is the most common complication after thoracoscopic operation for primary spontaneous pneumothorax (PSP), and the role of chemical pleurodesis in treating air leaks remains unclear. This study evaluated the safety and efficacy of chemical pleurodesis with a comparison between minocycline and OK-432. Between 1994 and 2011, 1083 PSP patients were treated by thoracoscopic operation. After the operation, patients with persistent air leak for 3 days or more were managed by minocycline or OK-432 pleurodesis. The demographic and outcome data for these patients were collected by retrospective chart review. Seventy-nine patients (7.3%) with prolonged air leak after thoracoscopy underwent minocycline pleurodesis (60 patients) or OK-432 pleurodesis (19 patients) as the primary treatment. The primary success rate was 63% (38/60) for minocycline pleurodesis and 95% (18/19) for OK-432 pleurodesis (p = 0.009). Postpleurodesis pain was common and comparable between the two groups. No major complications were noted after a total of 121 treatments. Patients undergoing primary OK-432 pleurodesis had shorter durations of postpleurodesis chest drainage (mean 8.5 vs. 2.3 days; p < 0.001) and postoperative hospital stay (mean 11.9 vs. 6.8 days; p < 0.001) than those undergoing primary minocycline pleurodesis. After a median follow-up of 16 months, recurrence was noted in one patient in the OK-432 group and none in the minocycline group. Long-term pulmonary function in the two groups was comparable. Chemical pleurodesis using OK-432 or minocycline is safe and convenient for prolonged air leak after thoracoscopic treatment for PSP. Our experience suggested that OK-432 may be more effective than minocycline in reducing air leak. Copyright © 2013. Published by Elsevier B.V.

Primary Effusion Lymphoma Involving both Pleural and Abdominal Cavities in a Patient with Hepatitis B Virus-related Liver Cirrhosis

Directory of Open Access Journals (Sweden)

Pei-Ying Hsieh

2007-01-01

Full Text Available Primary effusion lymphoma (PEL is an unusual form of non-Hodgkin's lymphoma, which is characterized by lymphomatous effusion in body cavities, but no associated mass lesions. It is usually associated with an immunodeficient state most often with the human immunodeficiency virus (HIV. We describe a 54-year-old man with HIV-negative PEL, with a history of hepatitis B virus-related liver cirrhosis. Both abdominal and pleural cavities were involved; no solid tumor masses were found and bone marrow investigations were normal. The ascites and pleural effusion contained numerous pleomorphic lymphoid cells. Immunophenotyping was positive for CD138. Chromosome study showed complex cytogenetics. The genomic human herpesvirus-8 was detected in the lymphoma cells. It is postulated that the immuno-suppressed state in this patient may have been caused by cirrhosis. The patient received four cycles of chemotherapy of CHOP and Picibanil (OK-432 intraperitoneal administration. However, no durable remission was achieved. Adefovir failed to halt the progressive liver failure after the development of YMDD mutant related to lamivudine. He died of sepsis and hepatic failure.

Precision cancer immunotherapy: optimizing dendritic cell-based strategies to induce tumor antigen-specific T-cell responses against individual patient tumors.

Science.gov (United States)

Osada, Takuya; Nagaoka, Koji; Takahara, Masashi; Yang, Xiao Yi; Liu, Cong-Xiao; Guo, Hongtao; Roy Choudhury, Kingshuk; Hobeika, Amy; Hartman, Zachary; Morse, Michael A; Lyerly, H Kim

2015-05-01

Most dendritic cell (DC)-based vaccines have loaded the DC with defined antigens, but loading with autologos tumor-derived antigens would generate DCs that activate personalized tumor-specific T-cell responses. We hypothesized that DC matured with an optimized combination of reagents and loaded with tumor-derived antigens using a clinically feasible electroporation strategy would induce potent antitumor immunity. We first studied the effects on DC maturation and antigen presentation of the addition of picibanil (OK432) to a combination of zoledronic acid, tumor necrosis factor-α, and prostaglandin E2. Using DC matured with the optimized combination, we tested 2 clinically feasible sources of autologous antigen for electroloading, total tumor mRNA or total tumor lysate, to determine which stimulated more potent antigen-specific T cells in vitro and activated more potent antitumor immunity in vivo. The combination of tumor necrosis factor-α/prostaglandin E2/zoledronic acid/OK432 generated DC with high expression of maturation markers and antigen-specific T-cell stimulatory function in vitro. Mature DC electroloaded with tumor-derived mRNA [mRNA electroporated dendritic cell (EPDC)] induced greater expansion of antigen-specific T cells in vitro than DC electroloaded with tumor lysate (lysate EPDC). In a therapeutic model of MC38-carcinoembryonic antigen colon cancer-bearing mice, vaccination with mRNA EPDC induced the most efficient anti-carcinoembryonic antigen cellular immune response, which significantly suppressed tumor growth. In conclusion, mature DC electroloaded with tumor-derived mRNA are a potent cancer vaccine, especially useful when specific tumor antigens for vaccination have not been identified, allowing autologous tumor, and if unavailable, allogeneic cell lines to be used as an unbiased source of antigen. Our data support clinical testing of this strategy.

The OKS persistent in-memory object manager

International Nuclear Information System (INIS)

Jones, R.; Mapelli, L.; Soloviev, I.

1998-01-01

The OKS (Object Kernel Support) is a library to support a simple, active persistent in-memory object manager. It is suitable for applications which need to create persistent structured information with fast access but do not require full database functionality. It can be used as the frame of configuration databases and real-time object managers for Data Acquisition and Detector Control Systems in such fields as setup, diagnostics and general configuration description. OKS is based on an object model that supports objects, classes, associations, methods, inheritance, polymorphism, object identifiers, composite objects, integrity constraints, schema evolution, data migration and active notification. OKS stores the class definitions and their instances in portable ASCII files. It provides query facilities, including indices support. The OKS has a C++ API (Application Program Interface) and includes Motif based GUI applications to design class schema and to manipulate objects. OKS has been developed on top of the Rogue Wave Tools h++ C++ class library

Chemical pleurodesis for prolonged postoperative air leak in primary spontaneous pneumothorax

Directory of Open Access Journals (Sweden)

Cheng-Hung How

2014-05-01

Conclusion: Chemical pleurodesis using OK-432 or minocycline is safe and convenient for prolonged air leak after thoracoscopic treatment for PSP. Our experience suggested that OK-432 may be more effective than minocycline in reducing air leak.

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice

International Nuclear Information System (INIS)

Miyaji, Chihiro; Imanaka, Kazufumi; Gose, Kyuhei; Ichiyanagi, Akihiro; Imajo, Yoshinari

1983-01-01

Female C3H/He mice aged 13 weeks with transplanted MM 46 tumor were used in histological and enzymohistochemical studies on the timing of administration of immunomodulators, PSK (a protein bound polysaccharide prepared from Coriolus versicolor), or OK-432 (Streptococcal preparation) combined with two fractionated local irradiation with the total dose of 3,000 rad. The daily dose of 250 mg/kg of PSK, or 1 KE/mouse of OK-432 was respectively injected intraperitoneally for four consecutive days before or after irradiation. Mice were sacrificed before irradiation and 7, 14 and 21 days after irradiation. Resected tumor tissues were examined using H-E staining and α-naphtyl acetate esterase (ANAE) staining to observe the stromal reactions such as the infiltration of mononuclear cells and fibroblasts around tumor tissues. When PSK or OK-432 was administered after irradiation, remarkable lymphocytic infiltration was observed compared with the control group and the group to which PSK or OK-432 was administered before irradiation. ANAE staining revealed most of infiltrating lymphocytes were T-cells. These results suggested that PSK and OK-432 which were received after radiotherapy enhanced the immunological responses against tumors which were represented by remarkable lymphocytic infiltration. (author)

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice. Histological and histoenzymatic studies using alpha-naphtyl acetate esterase staining

Energy Technology Data Exchange (ETDEWEB)

Miyaji, Chihiro; Imanaka, Kazufumi; Gose, Kyuhei; Ichiyanagi, Akihiro; Imajo, Yoshinari (Kobe Univ. (Japan). School of Medicine)

1983-12-01

Female C3H/He mice aged 13 weeks with transplanted MM 46 tumor were used in histological and enzymohistochemical studies on the timing of administration of immunomodulators, PSK (a protein bound polysaccharide prepared from Coriolus versicolor), or OK-432 (Streptococcal preparation) combined with two fractionated local irradiation with the total dose of 3,000 rad. The daily dose of 250 mg/kg of PSK, or 1 KE/mouse of OK-432 was respectively injected intraperitoneally for four consecutive days before or after irradiation. Mice were sacrificed before irradiation and 7, 14 and 21 days after irradiation. Resected tumor tissues were examined using H-E staining and ..cap alpha..-naphtyl acetate esterase (ANAE) staining to observe the stromal reactions such as the infiltration of mononuclear cells and fibroblasts around tumor tissues. When PSK or OK-432 was administered after irradiation, remarkable lymphocytic infiltration was observed compared with the control group and the group to which PSK or OK-432 was administered before irradiation. ANAE staining revealed most of infiltrating lymphocytes were T-cells. These results suggested that PSK and OK-432 which were received after radiotherapy enhanced the immunological responses against tumors which were represented by remarkable lymphocytic infiltration.

Evaluation of concomitant use of non-specific immunopotentiator on 172 cases of primary lung cancer (Stage III, IV) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Kimura, Shuji; Imajo, Yoshinari; Hamada, Fumio; Miyaji, Chihiro

1982-01-01

The clinical effect of concomitant use of non-specific immunopotentiator OK-432 and/or PSK was studied about 172 cases of primary lung cancer (Stage III, IV). In 91 cases in stage III, fifty percent survival period was found to be 11.5 months for 63 cases with OK-432 and/or PSK, and 7.5 months for 28 cases without immunotherapy, respectively. In 81 cases in stage IV, fifty percent survival period was found to be 6.7 months for 45 cases with OK-432 and/or PSK, and 3.3 months for 36 cases without immunotherapy, respectively. (author)

48 CFR 432.001 - Definitions.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Definitions. 432.001 Section 432.001 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.001 Definitions. The agency contract finance office is the office, other...

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

42 CFR 426.432 - Discovery.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.432 Section 426.432 Public Health... § 426.432 Discovery. (a) General rule. If the ALJ orders discovery, the ALJ must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party receiving a...

7 CFR 58.432 - Catalase.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Catalase. 58.432 Section 58.432 Agriculture... Material § 58.432 Catalase. The catalase preparation shall be a stable, buffered solution, neutral in pH, having a potency of not less than 100 Keil units per milliliter. The source of the catalase, its...

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice

Energy Technology Data Exchange (ETDEWEB)

Miyaji, C.; Ogawa, Y.; Imajo, Y.; Kimura, S. (Kobe Univ. (Japan). School of Medicine)

1982-06-01

Female C3H/He mice aged 12 weeks, transplanted MM46 tumor, were used in this study on the timing of administration of immunomodulators, such as PSK (a proteinbound polysaccharide prepared from Coriolus versicolor), OK-432 (Streptococcal preparation), bestatin (inhibitor of aminopeptidases of microbial origin) and levamisole (a chemical substance belonging to anthelmintics) combined with two fractionated local irradiation with the total dose of 3,000 rads. The daily dose of 250 ng/kg of PSK, 1 KE/mouse of OK-432, 300 mu g/mouse of bestatin or 3mg/kg of levamisole was respectively injected intraperitoneally for four consecutive days before or after irradiation. The anti-tumor effect was evaluated by the changes of tumor volume and survival curves. When PSK, OK-432 or levamisole was administered after irradiation, tumor growth was decreased and sixty-day survival rate and survival curve were significantly elongated compared with the control group and the group to which PSK, OK-432 or levamisole administered before irradiation (p lt 0.01). As for bestatin, no remarkable difference was observed irrespective of the timing of administration. These results suggested that some immunomodulators showed different anti-tumor activity depending on its timing of administration in the combination with radiotherapy. Concerning PSK, OK-432 and levamisole, they seemed to be beneficial in combination with prior radiotherapy in the treatment of MM46 tumor.

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice

International Nuclear Information System (INIS)

Miyaji, Chihiro; Ogawa, Yasuhiro; Imajo, Yoshinari; Kimura, Shuji

1982-01-01

Female C3H/He mice aged 12 weeks, transplanted MM46 tumor, were used in this study on the timing of administration of immunomodulators, such as PSK (a proteinbound polysaccharide prepared from Coriolus versicolor), OK-432 (Streptococcal preparation), bestatin (inhibitor of aminopeptidases of microbial origin) and levamisole (a chemical substance belonging to anthelmintics) combined with two fractionated local irradiation with the total dose of 3,000 rads. The daily dose of 250 ng/kg of PSK, 1 KE/mouse of OK-432, 300 mu g/mouse of bestatin or 3mg/kg of levamisole was respectively injected intraperitoneally for four consecutive days before or after irradiation. The anti-tumor effect was evaluated by the changes of tumor volume and survival curves. When PSK, OK-432 or levamisole was administered after irradiation, tumor growth was decreased and sixty-day survival rate and survival curve were significantly elongated compared with the control group and the group to which PSK, OK-432 or levamisole administered before irradiation (p lt 0.01). As for bestatin, no remarkable difference was observed irrespective of the timing of administration. These results suggested that some immunomodulators showed different anti-tumor activity depending on its timing of administration in the combination with radiotherapy. Concerning PSK, OK-432 and levamisole, they seemed to be beneficial in combination with prior radiotherapy in the treatment of MM46 tumor. (author)

Successful treatment of refractory hepatic lymphorrhea after gastrectomy for early gastric cancer, using surgical ligation and subsequent OK-432 (Picibanil) sclerotherapy.

Science.gov (United States)

Tanaka, Kouji; Ohmori, Yukinari; Mohri, Yasuhiko; Tonouchi, Hitoshi; Suematsu, Mina; Taguchi, Yukiko; Adachi, Yukihiko; Kusunoki, Masato

2004-01-01

Postoperative hepatic lymphorrhea is a very rare complication after abdominal surgery. Hepatic lymphorrhea, not containing chyle, involves an internal lymph fistula between the lymphatic channels toward the cisterna chyli and the peritoneal cavity. Over the past 20 years, 17 cases have been reported in Japan. Here, we report a further case, of a patient with successfully treated intractable hepatic lymphorrhea following gastrectomy for early gastric cancer. We review 18 cases, including the present case, with respect to the management of postoperative lymphorrhea refractory to conventional medical treatment.

20 CFR 702.432 - Debarment process.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Debarment process. 702.432 Section 702.432 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR LONGSHOREMEN'S AND HARBOR... § 702.432 Debarment process. (a) Pertaining to health care providers. Upon receipt of information...

48 CFR 432.412 - Contract clause.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contract clause. 432.412 Section 432.412 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Advance Payments for Non-Commercial Items 432.412 Contract clause. The decision...

5 CFR 551.432 - Sleep time.

Science.gov (United States)

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Sleep time. 551.432 Section 551.432... FAIR LABOR STANDARDS ACT Hours of Work Special Situations § 551.432 Sleep time. (a) Except as provided in paragraph (b) of this section, bona fide sleep time that fulfills the following conditions shall...

46 CFR 153.432 - Cooling systems.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Cooling systems. 153.432 Section 153.432 Shipping COAST... Control Systems § 153.432 Cooling systems. (a) Each cargo cooling system must have an equivalent standby... cooling system. (b) Each tankship that has a cargo tank with a required cooling system must have a manual...

48 CFR 432.113 - Customary contract financing.

Science.gov (United States)

2010-10-01

... financing. 432.113 Section 432.113 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.113 Customary contract financing. The contracting officer may determine the necessity for customary contract financing. The...

Alleviation of acute radiation damages by post-irradiation treatments

International Nuclear Information System (INIS)

Kurishita, A.; Ono, T.

1992-01-01

Radiation induced hematopoietic and gastro-intestinal damages in mice were tried to alleviate experimentally by post-treatment. Combined treatment of OK-432 and aztreonam clearly prevented the radiation induced sepsis and elevated the survival rate in mice; the survival was 80% in the OK-432 plus aztreonam group while it was 55% in the group treated with OK-432 alone and 0% with saline. Irsogladine maleate, an anti-ulcer drug, increased the survival rate of jejunal crypt stem cells with a clear dose-related trend. The D 0 for irsogladine maleate was 2.8 Gy although it was 2.3 Gy for saline, These findings suggest that some conventional drugs are effective for radiation induced hematopoietic and gastro-intestinal damages and the possibility that they can be applied for people exposed to radiation accidentally. (author)

New Combined Medical Treatment With Etilefrine and Octreotide for Chylothorax After Esophagectomy

Science.gov (United States)

Ohkura, Yu; Ueno, Masaki; Iizuka, Toshiro; Haruta, Shusuke; Tanaka, Tsuyoshi; Udagawa, Harushi

2015-01-01

Abstract Postoperative chylothorax is a rare but well-known complication of general thoracic surgery. Medical treatment of chylothorax was reported in the past, but there is still considerable controversy on the appropriate management strategies. Two patients with esophageal cancer underwent esophagectomy, 2-field lymph node dissection, and resection of thoracic duct together with ileocolic reconstruction via the retrosternal route at our hospital. Chylothorax developed on the 32nd postoperative day (POD) in 1 patient and the 12th POD in the other, manifesting as a change in the character of thoracic drainage to turbid white. Both were immediately started on octreotide (300 μg/ day) and etilefrine (120 mg/day). When the amount of pleural effusion decreased to Picibanil (OK432). Thereafter, the patients gradually made satisfactory progress and resumed oral food intake, and the thoracotomy tubes were eventually removed. They have remained recurrence-free at the time of writing. In this report, we demonstrated the clinical efficacy of etilefrine for the management of postesophagectomy chylothorax. New medical treatment options for this condition are now broad and the usefulness of combined therapy consisting of a sclerosing agent, etilefrine, and octreotide is underscored, regardless of the status of the thoracic duct. PMID:26656358

New Combined Medical Treatment With Etilefrine and Octreotide for Chylothorax After Esophagectomy: A Case Report and Review of the Literature.

Science.gov (United States)

Ohkura, Yu; Ueno, Masaki; Iizuka, Toshiro; Haruta, Shusuke; Tanaka, Tsuyoshi; Udagawa, Harushi

2015-12-01

Postoperative chylothorax is a rare but well-known complication of general thoracic surgery. Medical treatment of chylothorax was reported in the past, but there is still considerable controversy on the appropriate management strategies.Two patients with esophageal cancer underwent esophagectomy, 2-field lymph node dissection, and resection of thoracic duct together with ileocolic reconstruction via the retrosternal route at our hospital. Chylothorax developed on the 32nd postoperative day (POD) in 1 patient and the 12th POD in the other, manifesting as a change in the character of thoracic drainage to turbid white. Both were immediately started on octreotide (300 μg/ day) and etilefrine (120 mg/day). When the amount of pleural effusion decreased to Picibanil (OK432). Thereafter, the patients gradually made satisfactory progress and resumed oral food intake, and the thoracotomy tubes were eventually removed. They have remained recurrence-free at the time of writing.In this report, we demonstrated the clinical efficacy of etilefrine for the management of postesophagectomy chylothorax. New medical treatment options for this condition are now broad and the usefulness of combined therapy consisting of a sclerosing agent, etilefrine, and octreotide is underscored, regardless of the status of the thoracic duct.

7 CFR 28.432 - Middling Tinged Color.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Tinged Color. 28.432 Section 28.432... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Tinged Cotton § 28.432 Middling Tinged Color. Middling Tinged Color is color which is within the range represented by a set of samples in the custody of...

48 CFR 432.003 - Simplified acquisition procedures financing.

Science.gov (United States)

2010-10-01

... procedures financing. 432.003 Section 432.003 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.003 Simplified acquisition procedures financing. (a) The chief of the contracting office may approve contract financing on a contract to be...

40 CFR 432.41 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.41 Section 432.41 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: High-processing packinghouse means a packinghouse which...

40 CFR 432.31 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.31 Section 432.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: Low-processing packinghouse means a packinghouse that processes...

40 CFR 432.111 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.111 Section 432.111 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: Poultry first processing means slaughtering of poultry and...

48 CFR 432.202-4 - Security for Government financing.

Science.gov (United States)

2010-10-01

... financing. 432.202-4 Section 432.202-4 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Commercial Item Purchase Financing 432.202-4 Security for Government financing. Prior to determining that an offeror's financial condition is adequate...

48 CFR 432.102 - Description of contract financing methods.

Science.gov (United States)

2010-10-01

... financing methods. 432.102 Section 432.102 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.102 Description of contract financing methods. Progress payments based on a percentage or stage of completion are...

Experimental study on active specific immunotherapy utilizing the immune reaction of low-dose irradiated tumor tissue, 5

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Imanaka, Kazufumi; Gose, Kyuhei; Imajo, Yoshinari; Kimura, Shuji

1982-01-01

We have already reported the remarkable effect of the active specific immunotherapy utilizing cryopreserved tumor cells and infiltrating mononuclear cells prepared from a low-dose irradiated tumor tissue after cytoreductive radiotherapy. In the present study, the effect of a biological response modifier, OK-432 combined with this active specific immunotherapy was investigated. Twelve-week-aged female C3H/He mice transplanted with MM46 tumor cells were received local radiotherapy with the dose of 3,000 rads by high energy electron beam on the sixth day after inoculation. This active specific immunotherapy was performed on the thirteenth day, and daily dose of 1.0 KE of OK-432 was injected intraperitoneally from the thirteenth day to the seventeenth day. The inhibition of the tumor growth was observed in the group which received this active specific immunotherapy combined with a biological response modifier, OK-432 compared with that received this active specific immunotherapy alone. (author)

Balance control impairment induced after OKS in patients with vestibular migraine: an intercritical marker.

Science.gov (United States)

Panichi, R; Cipriani, L; Sarchielli, P; Di Mauro, M; Pettorossi, V E; Ricci, G; Faralli, M

2015-09-01

The aim of the study was to assess the effects of optokinetic stimulation (OKS) on vestibular postural control in migraine patients with recurrent vertigo. 15 patients with vestibular migraine (VM) were enrolled in a posturographic study in eyes open (OE) and eyes closed (CE) condition. The tests were performed between attacks of headache and vertigo at three different time: before, during, and 60 min after OKS. Data of patients with VM were compared with those obtained from two control groups matched for sex and age (15 for each group): (a) normal subjects not suffering from migraine without history of recurrent vertigo (N group); (b) subjects suffering from migraine with no history of recurrent vertigo (M group). Mean sway path velocity and sway area were analyzed. OKS increased the instability in all groups during the stimulus, and both the velocity and area values were higher in M and VM group. However, there was not significant difference between these two groups when stability was examined in OE condition before, during and after OKS stimulation. Conversely, in CE condition a significant greater instability was induced after OKS stimulation only in VM. In particular, post-stimulus values were significantly higher than the pre-stimulus one only in this group, while no significant difference was observed in other groups. A spatial analysis of the sway area evidenced that the instability induced by the OKS in VM group occurred along the direction of OKS. We suggest that this enhanced instability observed after OKS during the intercritical period may be considered an useful marker to support the diagnostic definition of VM in the absence of other vestibular signs.

OK-Net Arable online knowledge platform

DEFF Research Database (Denmark)

Rasmussen, Ilse Ankjær; Jensen, Allan Leck; Jørgensen, Margit Styrbæk

2017-01-01

The complexity of organic farming requires farmers to have a very high level of knowledge and skills, but exchange on organic farming techniques remains limited. In order to increase productivity and quality in organic arable cropping in Europe, the thematic network OK-Net Arable under Horizon 20...

40 CFR 86.432-78 - Deterioration factor.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Deterioration factor. 86.432-78... 1978 and Later New Motorcycles, General Provisions § 86.432-78 Deterioration factor. (a) Deterioration factors shall be developed for each test vehicle from the emission test results. A separate factor shall...

Brutally Unfair Tactics Totally OK Now

DEFF Research Database (Denmark)

Wilson, Douglas

2011-01-01

In this paper, I use a party game that I co-designed, Brutally Unfair Tactics Totally OK Now (B.U.T.T.O.N.), as a case study to suggest some alternative possibilities for the design of digitally-mediated play and games. Specifically, I argue that that intentionally “broken” or otherwise incomplet...

Images and Metaphors, Mirrors of Social Concern in the Saga af Viktor ok Blavus

OpenAIRE

Mester, Annegret

2002-01-01

Images and Metaphors, Mirrors of Social Concern in the Saga af Viktor ok Blavus I wish to examine how the images and metaphors in the Saga af Viktor ok Blavus reflect the concerns of Icelandic society. Included among the metaphors are the personae which populate the saga. As in the Saints’ legends they are not characters but types and are therefore themselves metaphors. The opening stanzas of the Saga af Viktor ok Blavus comprise a reference to the translated riddarasögur which the ano...

28 CFR 43.2 - Obligations of persons receiving care and treatment.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Obligations of persons receiving care and treatment. 43.2 Section 43.2 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) RECOVERY OF COST OF HOSPITAL AND MEDICAL CARE AND TREATMENT FURNISHED BY THE UNITED STATES § 43.2 Obligations of persons...

27 CFR 4.32a - Voluntary disclosure of major food allergens.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Voluntary disclosure of major food allergens. 4.32a Section 4.32a Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX... Requirements for Wine § 4.32a Voluntary disclosure of major food allergens. (a) Definitions. For purposes of...

Percutaneous sclerotherapy of pediatric lymphatic malformations: experience and outcomes according to the agent used.

Science.gov (United States)

Gallego Herrero, C; Navarro Cutillas, V

Analyze statistically the success, number of sessions required and complete duration of treatment of agents used in pediatric percutaneous sclerotherapy of lymphatic malformations, to determine the most suitable. Retrospective study based on outcomes from percutaneous sclerotherapy performed on lymphatic malformations of 56 patients conducted by pediatric interventional radiologist for 14 years. As first approach, the procedure consists of ultrasound-guided introduction of sclerosing agent. Sessions were repeated until clinical resolution. Success, number of sessions and the duration of treatment were recorded and statistical treatment of the data was performed to obtain further conclusions. Lost patients in follow up and other minority agents used were excluded from the data. Eventually, 52 patients treated with OK432 (n=29), Ethibloc (n=5) and combination therapy (n=18) were included. The average number of sessions and duration in months of treatment was respectively 2.38 and 8.6 for OK432, 1.4 and 5.6 for Ethibloc, and 1.83 and 2.30 for dual therapy. The results were statistically significant for the difference in duration between OK432 and dual therapy. Also, 60-80% of patients reached proper results related to success, but the difference was no significant among the agents. Other demographic and anatomical variables were analyzed, not showing any difference, which supports the homogeneity of the sample. Despite of no significant difference in success and number of sessions among agents, longer duration of treatment with OK432 than dual therapy could mean greater health costs and probably greater disturb for patient and family. Copyright © 2017 SERAM. Publicado por Elsevier España, S.L.U. All rights reserved.

77 FR 19691 - Notice of Inventory Completion: Sam Noble Oklahoma Museum of Natural History, Norman, OK

Science.gov (United States)

2012-04-02

... Natural History, Norman, OK. The human remains and associated funerary objects were removed from Le Flore... Flore County, OK. The mound site was excavated by the Works Progress Administration (WPA), under the...

Experimental study on active specific immunotherapy utilizing the immune reaction of low-dose irradiated tumor tissue, 9

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Maeda, Tomoho; Yoshida, Shoji

1983-01-01

We have already reported the remarkable effect of an active specific immunotherapy using cryopreserved tumor cells and infiltrating mononuclear cells prepared from a low-dose irradiated tumor tissue after cytoreductive radiotherapy. In the present study, the effect of a biological response modifier, OK-432 combined with the active specific immunotherapy was investigated. Twelve-week-aged female C3H/He mice transplanted with MM 46 tumor cells were received local radiotherapy with a dose of 3,000 rads by high energy electron beams on the fifth day after inoculation. The tumor cells and infiltrating mononuclear cells cryopreserved for two months were thawed and treated with mitomycin-C at concentration of 20 μg/10 7 cells at 37 0 C for 30 min. Then, these cells were injected subcutaneously into the left hind paws as a mitomycin C-treated, cryopreserved active specific immunotherapy on the thirteenth day, and daily dose of 1 KE of OK-432 was injected intraperitoneally from the sixth to the tenth days. The inhibition of the tumor growth was similarly observed in the group which received this active specific immunotherapy combined with a biological response modifier, OK-432. (author)

40 CFR 52.432 - Significant deterioration of air quality.

Science.gov (United States)

2010-07-01

... quality. 52.432 Section 52.432 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Air Act are not met... air quality. (b) Regulation for preventing significant deterioration of air quality. The provisions of...

Tõeline elamus: Oks ja Edur viimast korda kodulaval / Kristiina Garancis

Index Scriptorium Estoniae

Garancis, Kristiina, 1969-

2009-01-01

7. veebruaril Jõhvi kontserdimajas balletifestivali raames etendunud P. Tšaikovski balletist "Uinuv kaunitar" Peterburi Riikliku Klassikalise Balleti Teatri trupi esituses, peaosades Age Oks, Toomas Edur

Chemotherapy and Sex: Is Sexual Activity OK during Treatment?

Science.gov (United States)

... OK during treatment? Is it safe to have sex with my husband while undergoing chemotherapy? Answers from ... best to discuss any concerns about chemotherapy and sex with your doctor, who's familiar with your individual ...

Archaeological Investigations at Sites 45-OK-2 and 45-OK-2A, Chief Joseph Dam Project, Washington.

Science.gov (United States)

1984-01-01

on the floor of Feature 49. RANUNCULACEAE (Buttercup Family ) Clematis L. (virgin’s bower) , A small section of clematis stem was found in occupation...assemblage, 4,951 fragments (approximately 2%) were identified to at least the family level. Eighty-eight percent of the Identified elements represented...93 elements, 45-OK-2A -- 28 elements. Snake vertebrae were Identified to family on the basis of size. There are _1 at least four species of snakes

Energy content of hybrid Rumex patienta L. x Rumex tianschanicus A. Los. (Rumex OK 2 samples from autumn months

Directory of Open Access Journals (Sweden)

Michal Rolinec

2018-03-01

Full Text Available Aim of this experiment was to determine the gross energy concentration of fresh, wilted and ensiled hybrid of Rumex patientia L. x Rumex tianschanicus A. Los. (Rumex OK 2. Samples were collected in autumn months of the year 2017. The plant of Rumex OK 2 consist during autumn months only from rosette of leaves. The height of leaves was in autumn months following, September 56.68±13.80 cm; October 59.29±11.93 cm and November 55.98±10.80 cm. Rumex OK 2 silage was made from wilted matter, with or without of addition of dried molasses. Gross energy was determined as the heat released after combustion of a sample (Leco AC 500 in MJ per kilogram of dry matter of the sample. By the autumn months the concentration of dry matter, as well as the concentration of gross energy increased, except Rumex OK 2 silage from November. The highest concentration of gross energy had wilted Rumex OK 2 from November (18.02 MJ.kg-1 of dry matter. There was no significant effect of addition of dried molasses to wilted Rumex OK 2 before ensiling on gross energy concentration in Rumex OK 2 silages (P>0.05. Gross energy concentration of all types of analysed samples had relative high value (16.98 to 18.02 MJ.kg-1 of dry matter. Fresh or ensiled Rumex OK 2 can be used as a part of feed ratio for ruminants or can be utilised in biogas station. However, due to the low content of dry mater in fresh or wilted material the production of silage can be in autumn months problematic.

48 CFR 432.006-4 - Procedures.

Science.gov (United States)

2010-10-01

... REQUIREMENTS CONTRACT FINANCING 432.006-4 Procedures. (a) Immediately upon submittal of the referral described... decision making process. (c) The OIG will determine the need for and the extent of an investigation. (d...

75 FR 5015 - Television Broadcasting Services; Oklahoma City, OK

Science.gov (United States)

2010-02-01

...] Television Broadcasting Services; Oklahoma City, OK AGENCY: Federal Communications Commission. ACTION... procedures for comments, see 47 CFR 1.415 and 1.420. List of Subjects in 47 CFR Part 73 Television, Television broadcasting. For the reasons discussed in the preamble, the Federal Communications Commission...

42 CFR 432.31 - Training and use of subprofessional staff.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Training and use of subprofessional staff. 432.31...; Subprofessional and Volunteer Programs § 432.31 Training and use of subprofessional staff. (a) State plan requirement. A State plan must provide for the training and effective use of subprofessional staff as...

75 FR 13236 - Television Broadcasting Services; Oklahoma City, OK

Science.gov (United States)

2010-03-19

... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [DA 10-395; MB Docket No. 10-19; RM-11589] Television Broadcasting Services; Oklahoma City, OK AGENCY: Federal Communications Commission. ACTION: Final... review Act, see 5 U.S.C. 801(a)(1)(A). List of Subjects in 47 CFR Part 73 Television, Television...

The transcriptome of the Didelphis virginiana opossum kidney OK proximal tubule cell line.

Science.gov (United States)

Eshbach, Megan L; Sethi, Rahil; Avula, Raghunandan; Lamb, Janette; Hollingshead, Deborah J; Finegold, David N; Locker, Joseph D; Chandran, Uma R; Weisz, Ora A

2017-09-01

The OK cell line derived from the kidney of a female opossum Didelphis virginiana has proven to be a useful model in which to investigate the unique regulation of ion transport and membrane trafficking mechanisms in the proximal tubule (PT). Sequence data and comparison of the transcriptome of this cell line to eutherian mammal PTs would further broaden the utility of this culture model. However, the genomic sequence for D. virginiana is not available and although a draft genome sequence for the opossum Monodelphis domestica (sequenced in 2012 by the Broad Institute) exists, transcripts sequenced from both species show significant divergence. The M. domestica sequence is not highly annotated, and the majority of transcripts are predicted rather than experimentally validated. Using deep RNA sequencing of the D. virginiana OK cell line, we characterized its transcriptome via de novo transcriptome assembly and alignment to the M. domestica genome. The quality of the de novo assembled transcriptome was assessed by the extent of homology to sequences in nucleotide and protein databases. Gene expression levels in the OK cell line, from both the de novo transcriptome and genes aligned to the M. domestica genome, were compared with publicly available rat kidney nephron segment expression data. Our studies demonstrate the expression in OK cells of numerous PT-specific ion transporters and other key proteins relevant for rodent and human PT function. Additionally, the sequence and expression data reported here provide an important resource for genetic manipulation and other studies on PT cell function using these cells. Copyright © 2017 the American Physiological Society.

40 CFR 432.101 - Special definitions.

Science.gov (United States)

2010-07-01

... slaughterhouse, packinghouse or poultry dressing or processing operation, uses raw material at rates greater than... STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY Renderers § 432.101 Special definitions. For the... animal and poultry trimmings, bones, meat scraps, dead animals, feathers and related usable by-products...

40 CFR 432.1 - General Applicability.

Science.gov (United States)

2010-07-01

... waters of the U.S. from facilities engaged in the slaughtering, dressing and packing of meat and poultry products for human consumption and/or animal food and feeds. Meat and poultry products for human... STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY § 432.1 General Applicability. As defined more...

40 CFR 432.73 - Effluent limitations attainable by the application of the best available technology economically...

Science.gov (United States)

2010-07-01

... application of the best available technology economically achievable (BAT). 432.73 Section 432.73 Protection... POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.73 Effluent limitations attainable by the application of the best available technology economically achievable (BAT). Except as...

40 CFR 432.72 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.72 Section 432.72... AND POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.72 Effluent limitations attainable by the application of the best practicable control technology currently available (BPT...

40 CFR 432.77 - Effluent limitations attainable by the application of the best control technology for...

Science.gov (United States)

2010-07-01

... application of the best control technology for conventional pollutants (BCT). 432.77 Section 432.77 Protection... POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.77 Effluent limitations attainable by the application of the best control technology for conventional pollutants (BCT). Except as...

OkCupid Data for Introductory Statistics and Data Science Courses

Science.gov (United States)

Kim, Albert Y.; Escobedo-Land, Adriana

2015-01-01

We present a data set consisting of user profile data for 59,946 San Francisco OkCupid users (a free online dating website) from June 2012. The data set includes typical user information, lifestyle variables, and text responses to 10 essay questions. We present four example analyses suitable for use in undergraduate introductory probability and…

Experimental performance of R432A to replace R22 in residential air-conditioners and heat pumps

International Nuclear Information System (INIS)

Park, Ki-Jung; Shim, Yun-Bo; Jung, Dongsoo

2009-01-01

In this study, thermodynamic performance of R432A and HCFC22 is measured in a heat pump bench tester under both air-conditioning and heat pumping conditions. R432A has no ozone depletion potential and very low greenhouse warming potential of less than 5. R432A also offers a similar vapor pressure to HCFC22 for 'drop-in' replacement. Test results showed that the coefficient of performance and capacity of R432A are 8.5-8.7% and 1.9-6.4% higher than those of HCFC22 for both conditions. The compressor discharge temperature of R432A is 14.1-17.3 deg. C lower than that of HCFC22 while the amount of charge for R432A is 50% lower than that of HCFC22 due to its low density. Overall, R432A is a good long term 'drop-in' environmentally friendly alternative to replace HCFC22 in residential air-conditioners and heat pumps due to its excellent thermodynamic and environmental properties

48 CFR 432.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.114 Unusual contract financing. The HCA is authorized to approve unusual contract financing. The signed determination and finding...

48 CFR 432.007 - Contract financing payments.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.007 Contract financing payments. The HCA may prescribe, on a case-by-case basis, a shorter period for financing payments. [61 FR 53646, Oct. 15, 1996. Redesignated...

Immunomodulatory therapy in refractory/recurrent ovarian cancer.

Science.gov (United States)

Chen, Chao-Yu; Lai, Chyong-Huey; Yang, Lan-Yan; Tang, Yun-Hsin; Chou, Hung-Hsueh; Chang, Chee-Jen; Lin, Cheng-Tao

2015-04-01

To investigate the efficacy and toxicity of immunomodulatory therapy (IMT) alone or as an add-on to palliative/salvage chemotherapy in patients with refractory/recurrent epithelial ovarian cancer (EOC). We retrospectively analyzed the efficacy and toxicity of IMT in 15 patients with refractory/recurrent EOC who had previously received multiple chemotherapy regimens. The median age of the patients was 56 years (range, 41-75 years). Three patients were platinum-sensitive, two were platinum-resistant, and the remaining 10 patients were refractory to platinum-based front-line chemotherapy. IMT consisted of picibanil (OK-432) on Day 1, interleukin-2 and/or interferon-α on Day 2 administered by subcutaneous injection (every week or 2-weekly). Five patients never received metronomic oral cyclophosphamide. After IMT, three patients achieved partial remission (PR, lasting for 11 months, ≥ 12 months, and 16 months), and six patients had stable disease (SD). The disease stabilizing rate (PR+SD) was 60% (3/3 in platinum-sensitive and 6/12 in platinum-resistant/refractory patients). The absolute lymphocyte count (ALC) at 1 month after IMT was significantly higher in the PR+SD group (median 1242.0/μL) than in the progression group (median 325.0/μL) (p = 0.012). No ≥ Grade 3 toxicities were observed. The median post-IMT survival time was 12 months (range, 2-39 months). IMT alone or add-on to palliative/salvage chemotherapy for refractory/recurrent EOC achieves a substantial disease stabilizing rate without severe toxicity, which might be a potential option in selected patients. The ALC 1 month after IMT could be an early indicator to disease stabilization. Copyright © 2015. Published by Elsevier B.V.

27 CFR 4.32b - Petitions for exemption from major food allergen labeling.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Petitions for exemption from major food allergen labeling. 4.32b Section 4.32b Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS LABELING AND ADVERTISING OF WINE...

40 CFR 432.5 - Incorporation by reference.

Science.gov (United States)

2010-07-01

... AND STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY § 432.5 Incorporation by reference. (a... Federal Register. The material is available for purchase at the address in paragraph (b) of this section..., Washington, DC. (b) The following material is available for purchase from the National Technical Information...

Experimental study on active specific immunotherapy utilizing the immune reaction of low-dose irradiated tumor tissue, 4

International Nuclear Information System (INIS)

Imanaka, Kazufumi; Ogawa, Yasuhiro; Gose, Kyuhei; Imajo, Yoshinari; Kimura, Shuji

1982-01-01

We have already reported that the effectiveness of active specific immunotherapy using low-dose irradiated tumor cells and infiltrating mononuclear cells. The present study was designed to investigate the effect of non-specific immunopotentiator combined with the active specific immunotherapy. Twelve-week-aged female C3H/He mice transplanted with MM46 tumor were received local radiotherapy with the dose of 3,000 rads by high energy electron beam on the sixth day after inoculation. Active specific immunotherapy was performed on the 13th day, and daily dose of 1.0 KE of OK-432 was injected intraperitoneally from the 13th day to the 17th day. The inhibition of the tumor growth and the elongation of survival period were noted in the group which received active specific immunotherapy combined with non-specific immunopotentiator, OK-432 compared with that active specific immunotherapy alone. (author)

Projekt OK-NET-ARABLE : mahetootmiseks vajalik teave tuleb tuua praktikuteni / Airi Vetemaa

Index Scriptorium Estoniae

Vetemaa, Airi

2015-01-01

OK-NET-ARABLE, mida võiks tõlkida kui põllukultuuride kasvatuse alast maheteabe võrgustikku, on ELi teadusrahastu Horisont 2020 projekt, mille eesmärk on vahendada innovaatilist ja traditsioonilist teavet mahetootjate, nõustajate ja teadlaste vahel, suurendamaks mahepõllukultuuride produktiivsust ja kvaliteeti üle Euroopa

42 CFR 412.432 - Method of payment under the inpatient psychiatric facility prospective payment system.

Science.gov (United States)

2010-10-01

... facility prospective payment system. 412.432 Section 412.432 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM PROSPECTIVE PAYMENT SYSTEMS FOR INPATIENT HOSPITAL SERVICES Prospective Payment System for Inpatient Hospital Services of Inpatient...

Do Vaccines Cause Autism? Is it OK to Skip Certain Vaccines? Get the facts

Science.gov (United States)

... Lifestyle Infant and toddler health Do vaccines cause autism? Is it OK to skip certain vaccines? Get ... their potentially serious complications. Vaccines do not cause autism. Despite much controversy on the topic, researchers haven' ...

Aproksymacja środkowej powierzchni powłok

OpenAIRE

Preweda, Edward

1997-01-01

Konstrukcjom cienkościennym stawiany jest warunek zgodności ich powierzchni środkowej z powierzchnią określoną założeniami projektowymi. Grubość powłoki uzależniona jest od panujących w niej naprężeń i najczęściej nie jest stała dla całej powłoki. W pracy przedstawiono algorytm badania kształtu powłok uwzględniający powyższe uwarunkowania. Weryfikacja algorytmu na przykładzie hiperboloidalnych chłodni jednopowłokowych wyraźnie uwidacznia różnice pomiędzy aproksymacją powierzchni zewnętrznej i...

40 CFR 432.105 - New source performance standards (NSPS).

Science.gov (United States)

2010-07-01

... GUIDELINES AND STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY Renderers § 432.105 New source... renderer that does not cure cattle hide as part of the plant operations. If a renderer does cure hide, the...

New treatment of early fetal chylothorax

DEFF Research Database (Denmark)

Nygaard, Ulrikka; Sundberg, Karin; Nielsen, Henriette Svarre

2007-01-01

OBJECTIVE: To evaluate OK-432, a preparation of Streptococcus pyogenes, in the treatment of early fetal chylothorax. METHODS: A prospective study of all fetuses (n=7) with persistent early chylothorax (gestational ages 16-21 weeks) referred to the tertiary center of fetal medicine in Denmark in 2...

Status of the USNRC/PNL Halden test IFA-432

International Nuclear Information System (INIS)

Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Williford, R.E.

1980-01-01

The NRC/PNL fuel assembly IFA-432 began irradiation in December 1975 and as of January 1980 had reached an assembly average burnup of 2120 GJ/kgU (24.5 GWd/MTM). The rods in this assembly are heavily instrumented and this has allowed a fairly thorough analysis of fuel behavior. The emphasis of the analysis has been to evaluate the observed changes in thermal/mechanical behavior. These changes are related to estimates of fuel density changes, fission gas release, and fuel cracking and relocation. The following conclusions have been reached concerning the irradiation of IFA-432. Based on analysis of steady-state and transient thermal data, the fuel in all rods is extensively cracked and relocated. Significant reductions in the effective fuel thermal conductivity have been deduced from the analysis of the transient thermal data

17 CFR 4.32 - Trading on a Registered Derivatives Transaction Execution Facility for Non-Institutional Customers.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Trading on a Registered Derivatives Transaction Execution Facility for Non-Institutional Customers. 4.32 Section 4.32 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION COMMODITY POOL OPERATORS AND COMMODITY TRADING...

40 CFR 432.12 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.12 Section 432.12... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with the slaughtering of animals on-site or the...

40 CFR 432.42 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.42 Section 432.42... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with the slaughtering of animals on-site or the...

40 CFR 432.32 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.32 Section 432.32... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with slaughtering of animals on-site or the processing...

40 CFR 432.22 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.22 Section 432.22... attainable by the application of the best practicable control technology currently available (BPT). Except as... limitations: (1) In the case of process wastewater associated with the slaughtering of animals on-site or the...

Subpopulation of lymphocytes in patients with cancer of the head and neck

International Nuclear Information System (INIS)

Yoshida, Atsuhiro; Tomita, Kinai; Toda, Norikazu; Sekine, Kiyoshi; Mizugoe, Takanori

1978-01-01

On 31 patients with cancer of the head and neck, lymphocyte count and T- and B-cell levels were determined, and their changes following radiotherapy and the effect of picibanil on their changes were examined. 1) Lymphocyte count and T-cell count decreased remarkably following radiotherapy. B-cell count changed a little. Changes in lymphocyte count seemed chiefly to be due to changes in T-cell. 2) At 3 weeks after radiotherapy, lymphocyte count and T-cell count remained to be low in the patients who were not given picibanil, but those counts tended to increase in the patients who were given picibanil. The effect of picibanil was statistically significant in the experienced cases except those of maxillary cancer. 3) At 3 weeks after radiotherapy, T-cell count was significantly low in those who were not given picibanil and had unfavourable prognosis. 4) With 5 times repeated intramuscular injections of picibanil (0.2 KE), T-cell % and T-cell count increased in some cases. (Ueda, J.)

Aplikace legislativních norem u pojišťovacího zprostředkovatele OK GROUP

OpenAIRE

Kubiš, Michal

2015-01-01

Tato bakalářská práce se zabývá analýzou činností, vedoucích k bezproblémovému chodu společnosti OK GROUP a.s. v návaznosti na kontrolní činnost České národní banky. Analyzuje a podrobně popisuje kontrolní činnost jako takovou. V praktické části se zaměřím na sestavení návrhu vnitropodnikových směrnic pro zákonné fungování této firmy. This bachelor´s thesis deals with analysis of activities, which is going streight trought the smooth run of this in surance broker company OK GROUP a.s. in c...

Development of a high-power 432 MHz DTL

International Nuclear Information System (INIS)

Naito, F.; Kato, T.; Takasaki, E.; Yamazaki, Y.; Kawasumi, T.; Suzuki, K.; Iino, Y.

1992-01-01

A high-power model of a 432 MHz Drift-Tube Linac is under construction. It will accelerate H - ions from 3 to 5.4 MeV, and is a prototype of the DTL for the Japanese Hadron Project. Several new techniques have been developed for constructing the DTL: fabricating and assembling methods of permanent quadrupole magnet and a drift tube, alignment of the drift tube, and a method of connecting the tanks. (Author) 6 refs., 5 figs

Fatty acid profile and in vitro antioxidant and antibacterial activities of red grape (Vitis vinifera L. cvs. Oküzgözü and Boğazkere) Marc extracts.

Science.gov (United States)

Cibik, Bilge; Ozaydin, Zuhal; Böke, Nazli; Karabay, Ulkü; Pekmez, Murat; Arda, Nazhi; Kirmizigüla, Süheyla

2009-03-01

The marcs of two red grape (V. vinifera L.) varieties (Boğazkere and Oküzgözü), grown in eastern Anatolia (Elazig), were evaluated for their fatty acid composition, and antioxidant and antibacterial activities. The hexane extracts of both varieties were found to contain linoleic, palmitic, stearic and oleic acids by GC-MS analyses. The major fatty acid (linoleic acid) was detected relatively as 57.13% in Oküzgözü and 59.07% in Bogazkere in methylated hexane extracts. In addition, myristic and palmitoleic acids were observed in Boğazkere as minor components. The free radical (DPPH) scavenging activity of Oküzgözü was higher than that of Bogazkere. The IC50 values were calculated as 403.0 +/- 7.8 microg/mL for Oküzgozü and 552.0 +/- 23.6 microg/mL for Bogazkere. The extracts were found to be effective on the four gram (+) and four gram (-) test bacteria, but not as good as standard antibiotic, gentamycine by MIC method.

UV-VUV FEL program at DUKE storage ring with OK-4 optical klystron

International Nuclear Information System (INIS)

Litvinenko, V.N.; Madey, J.M.J.; Vinokurov, N.A.

1993-01-01

A 1 GeV electron storage ring dedicated for UV-VUV FEL operation is under construction at the Duke University Free Electron Laser Laboratory. The UV-VUV-FEL project, based on the collaboration of the Duke FEL Laboratory and Budker Institute for Nuclear Physics is described. The main parameters of the DFELL storage ring, of the OK-4 optical klystron, and the experimental set-up are presented. The parameters of UV-VUV FEL are given and the possible future upgrades to this system are discussed

11 CFR 105.1 - Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)). 105.1 Section 105.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL DOCUMENT FILING (2 U.S.C. 432(g)) § 105.1 Place of filing; House candidates and their authorized...

18 CFR 367.4320 - Account 432, Allowance for borrowed funds used during construction-Credit.

Science.gov (United States)

2010-04-01

... ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT Income Statement Chart of Accounts Service Company Operating Income § 367.4320 Account 432, Allowance for borrowed funds used during construction—Credit. This...

42 CFR 488.432 - Civil money penalties: When a penalty is collected.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Civil money penalties: When a penalty is collected... PROCEDURES Enforcement of Compliance for Long-Term Care Facilities with Deficiencies § 488.432 Civil money... hearing on the determination of the noncompliance that is the basis for imposition of the civil money...

Facial nerve conduction after sclerotherapy in children with facial lymphatic malformations: report of two cases.

Science.gov (United States)

Lin, Pei-Jung; Guo, Yuh-Cherng; Lin, Jan-You; Chang, Yu-Tang

2007-04-01

Surgical excision is thought to be the standard treatment of choice for lymphatic malformations. However, when the lesions are limited to the face only, surgical scar and facial nerve injury may impair cosmetics and facial expression. Sclerotherapy, an injection of a sclerosing agent directly through the skin into a lesion, is an alternative method. By evaluating facial nerve conduction, we observed the long-term effect of facial lymphatic malformations after intralesional injection of OK-432 and correlated the findings with anatomic outcomes. One 12-year-old boy with a lesion over the right-side preauricular area adjacent to the main trunk of facial nerve and the other 5-year-old boy with a lesion in the left-sided cheek involving the buccinator muscle were enrolled. The follow-up data of more than one year, including clinical appearance, computed tomography (CT) scan and facial nerve evaluation were collected. The facial nerve conduction study was normal in both cases. Blink reflex in both children revealed normal results as well. Complete resolution was noted on outward appearance and CT scan. The neurophysiologic data were compatible with good anatomic and functional outcomes. Our report suggests that the inflammatory reaction of OK-432 did not interfere with adjacent facial nerve conduction.

77 FR 57112 - Notice of Inventory Completion: U.S. Department of Defense, Army, Fort Sill Museum, Lawton, OK

Science.gov (United States)

2012-09-17

... Landmark and Museum, U.S. Army Fires Center of Excellence, Fort Sill, OK 73503, telephone (580) 442-6570... trapping, 3 metal rings, 2 metal rivets, 17 metal nails, 53 metal bracelets, 1 metal pail, 1,500 glass... A. Neel, Director, Fort Sill National Historic Landmark and Museum, U.S. Army Fires Center of...

11 CFR 101.1 - Candidate designations (2 U.S.C. 432(e)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate designations (2 U.S.C. 432(e)(1)). 101.1 Section 101.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL CANDIDATE STATUS AND... and address, party affiliation, and office sought, the District and State in which Federal office is...

11 CFR 102.11 - Petty cash fund (2 U.S.C. 432(h)(2)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Petty cash fund (2 U.S.C. 432(h)(2)). 102.11 Section 102.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL REGISTRATION, ORGANIZATION, AND... and Congressional district) sought by such candidate. ...

Comparison of 432 Pseudomonas strains through integration of genomic, functional, metabolic and expression data

NARCIS (Netherlands)

Koehorst, Jasper J.; Dam, van Jesse C.J.; Heck, van Ruben G.A.; Saccenti, Edoardo; Martins dos Santos, Vitor; Suarez-Diez, Maria; Schaap, Peter J.

2016-01-01

Pseudomonas is a highly versatile genus containing species that can be harmful to humans and plants while others are widely used for bioengineering and bioremediation. We analysed 432 sequenced Pseudomonas strains by integrating results from a large scale functional comparison using protein

Multi-institutional randomized clinical study on the comparative effects of intracavital chemotherapy alone versus immunotherapy alone versus immunochemotherapy for malignant effusion

Science.gov (United States)

Nio, Y; Nagami, H; Tamura, K; Tsubono, M; Nio, M; Sato, M; Kawabata, K; Hayashi, H; Shiraishi, T; Imai, S; Tsuchitani, T; Mizuta, J; Nakagawa, M; Fukumoto, M

1999-01-01

The current prospective randomized study was designed to compare the effects of intracavitary (i.c.) chemotherapy vs immunotherapy vs immunochemotherapy for malignant effusion. Between 1992 and 1995, a total of 42 patients with malignant effusion were registered, and 41 patients were eligible for statistical analysis. The primary diseases of the eligible patients included 27 gastric, four colorectal, four pancreatic, three lung, two liver and one oesophageal cancers. The patients with malignant effusion were randomly assigned into one of three i.c. therapeutic regimens: chemotherapy alone with weekly injection of anticancer agents (ACAs: cisplatin, mitomycin-C, adriamycin, etc.) (Group A, n = 13); immunotherapy alone with weekly injection of streptococcal preparation OK-432 (Group B, n = 14); or immunochemotherapy with ACAs and OK-432 (Group C, n = 14). The response of the effusion, patient survival and the kinetics of cytokines in the effusion were compared. There were no differences in the patients' backgrounds. The side-effects of the regimens included pain, anorexia, fever, leucopenia and anaemia and there were no differences in their incidence among the three groups. One patient died after cisplatin (CDDP) administration in Group A. Cytologic examination revealed that tumour cells in the effusion disappeared in 23% of Group A cases, 36% of Group B cases and 36% of Group C cases. The malignant effusion did not disappear in any of the Group A cases; however, the effusion disappeared in 29% of Group B cases and 43% of Group C cases (P = 0.03, Group A vs Group C). Furthermore, the 50% survival period was 1.6 months for Group A, 2.4 months for Group B and 3.5 months for Group C. The 6-month survival rate was 7% for Group A, 6% for Group B and 34% for Group C, and the 1-year survival rate was 0%, 0% and 17% respectively (P = 0.048, Group A vs Group C by the log-rank test). The analysis of the cytokine kinetics revealed a prominent increase in the level of

Spatial distribution and polarization of gamma-rays generated via Compton backscattering in the Duke/OK-4 storage ring FEL

CERN Document Server

Park, S H; Tornow, W; Montgomery, C

2001-01-01

Beams of nearly monochromatic gamma-rays are produced via intracavity Compton backscattering in the OK-4/Duke storage ring FEL, the high-intensity gamma-ray source (HI gamma S). Presently, HI gamma S generates gamma-ray beams with an energy tunable from 2 to 58 MeV and a maximum flux of 5x10 sup 7 gamma-rays per second. The gamma-rays are linearly polarized with a degree of polarization close to 100% (V.N. Litvinenko, et al., Predictions and expected performance for the VUV OK-5/Duke Storage Ring FEL with variable polarization, Nucl. Instr. and Meth. A, to be published in this proceeding) and they are collimated to pencil-like semi-monoenergetic beams with RMS energy spreads as low as 0.2%. The detailed theoretical and experimental studies of the gamma-ray beam quality were conducted during the last two years (S.H. Park, Thesis, Duke University, Durham, NC, USA, 2000). In this paper, we present the theoretical analysis and the experimental results on the spatial distribution and polarization of gamma-rays fro...

Spatial distribution and polarization of {gamma}-rays generated via Compton backscattering in the Duke/OK-4 storage ring FEL

Energy Technology Data Exchange (ETDEWEB)

Park, S.H. E-mail: shpark@nanum.kaeri.re.kr; Litvinenko, V.N.; Tornow, W.; Montgomery, C

2001-12-21

Beams of nearly monochromatic {gamma}-rays are produced via intracavity Compton backscattering in the OK-4/Duke storage ring FEL, the high-intensity {gamma}-ray source (HI{gamma}S). Presently, HI{gamma}S generates {gamma}-ray beams with an energy tunable from 2 to 58 MeV and a maximum flux of 5x10{sup 7} {gamma}-rays per second. The {gamma}-rays are linearly polarized with a degree of polarization close to 100% (V.N. Litvinenko, et al., Predictions and expected performance for the VUV OK-5/Duke Storage Ring FEL with variable polarization, Nucl. Instr. and Meth. A, to be published in this proceeding) and they are collimated to pencil-like semi-monoenergetic beams with RMS energy spreads as low as 0.2%. The detailed theoretical and experimental studies of the {gamma}-ray beam quality were conducted during the last two years (S.H. Park, Thesis, Duke University, Durham, NC, USA, 2000). In this paper, we present the theoretical analysis and the experimental results on the spatial distribution and polarization of {gamma}-rays from the HI{gamma}S facility.

Spatial distribution and polarization of γ-rays generated via Compton backscattering in the Duke/OK-4 storage ring FEL

International Nuclear Information System (INIS)

Park, S.H.; Litvinenko, V.N.; Tornow, W.; Montgomery, C.

2001-01-01

Beams of nearly monochromatic γ-rays are produced via intracavity Compton backscattering in the OK-4/Duke storage ring FEL, the high-intensity γ-ray source (HIγS). Presently, HIγS generates γ-ray beams with an energy tunable from 2 to 58 MeV and a maximum flux of 5x10 7 γ-rays per second. The γ-rays are linearly polarized with a degree of polarization close to 100% (V.N. Litvinenko, et al., Predictions and expected performance for the VUV OK-5/Duke Storage Ring FEL with variable polarization, Nucl. Instr. and Meth. A, to be published in this proceeding) and they are collimated to pencil-like semi-monoenergetic beams with RMS energy spreads as low as 0.2%. The detailed theoretical and experimental studies of the γ-ray beam quality were conducted during the last two years (S.H. Park, Thesis, Duke University, Durham, NC, USA, 2000). In this paper, we present the theoretical analysis and the experimental results on the spatial distribution and polarization of γ-rays from the HIγS facility

KADIN AKADEMİSYENLER: CAM TAVANLAR HÂLÂ ÇOK KALIN!

OpenAIRE

Özkaplan, Nurcan

2015-01-01

Cam tavan Feminist teorilerde, işgücü piyasasındaki dikey katmanlaşmayı işaret eder. Erkeklerle aynı işyerinde çalışan beyaz yakalı kadınların, daha çok orta ve alt düzey yönetici konumuna sıkışıp kaldığı ve Finansman müdürü, mütevelli heyeti başkanı, rektör, dekan vb. gibi üst düzey yönetici pozisyonlarının %95’den fazlasının erkekler tarafından temsil edildiği işgücü piyasalarının yaygın ve dirençli bir özelliğidir. Bu makalede, cam tavan konusundaki Feminist teorilerin kısa bir değerlendir...

Tryk ok for interaktivitet

DEFF Research Database (Denmark)

Bjørner, Thomas

, en forening af tekst, billeder, lyd, film og video, i en slags digital schweitzerkniv. Sådan gik det imidlertid ikke. Udover mere regionalt fjernsyn og bedre billede/ lyd kvalitet var det dels på grund af teknologiske vanskeligheder og dels manglende analyser af brugernes medieadfærd, primært en...... indhold?, og vil digitaliseringen dermed fremme den stigende tendens til at vi ser mere tv hver for sig? Og ønsker seerne overhovedet at være interaktive med deres fjernsyn - og i givet fald om hvad og hvorfor? Baggrunden for afhandlingen er forsøgskanalen TV2/Nord-Digital, der sendte i perioden fra...... november 2002 til oktober 2004, og var første kanal som udsendte digitalt terrestrisk tv i Danmark. TV-mediet skulle med TV2/Nord-Digital forsøget blive radikalt forandret, når alle eksisterende og nye medier smeltede sammen til et nyt supermedie, en konvergeret medieboks bestående af halvt PC og halvt TV...

Especiación de tierras raras en las soluciones ácidas y neutras del sistema de drenaje del Arroyo del Val (Zaragoza

Directory of Open Access Journals (Sweden)

Zamora, A.

1994-08-01

-90 % of LREE and for 100 % of HREE. LnPO04 and Ln(PO43-2 complexes are quite significant compared to carbonate complexes, mainly in the speciation of HREE. These results il1ustrate the importance of phosphate ion concentration and REE phosphate complexation reactions in REEs speciation calculations.Las soluciones de la cuenca de drenaje del Arroyo del Val (Zaragoza presentan unas características geoquímicas muy diferenciadas, lo que las hace especialmente apropiadas para el estudio de diferentes aspectos acerca del comportamiento de los elementos de las Tierras Raras. Esta cuenca está constituida por un curso principal (Arroyo del Val de aguas ácidas (con valores de pH entre 3 y 4.5 e importantes concentraciones de sulfato, Al, Fe y distintos metales pesados al que desaguan varios afluentes de aguas bicarbonatadas (sulfatadas cálcicas (con valores de pH de hasta 7.5, alcalinidad apreciable y notables concentraciones de fosfato. En los puntos de confluencia del Arroyo del Val con los afluentes se producen espectaculares procesos de floculación de coloides ricos en aluminio, hierro y sulfato que tapizan el fondo del curso principal. Los elementos de las Tierras Raras fueron analizados en distintas muestras de aguas ácidas tomadas a lo largo de la cabecera del Arroyo del Val y en dos muestras de aguas neutras correspondientes a dos de los afluentes del sistema. Las concentraciones de estos elementos determinadas en las soluciones ácidas son, cuando menos, dos órdenes de magnitud superiores a las de las soluciones neutras y sus pautas de distribución (normalizadas frente a NASC muestran un marcado enriquecimiento en las Tierras Raras Intermedias (IREE; Eu-Tb. Los cálculos de especiación de REE realizados en las aguas ácidas muestran que estos elementos se encuentran de forma dominante como especies iónicas libres (Ln3+ ≈ 35 % y especialmente formando complejos con sulfato (LnSO+4 ≈ 60% y en menor proporción como Ln(SO4-2 ≈ 5%. Estos porcentajes

La tuberculosis de “Doc” Holliday en el cine. La hora de las pistolas/ Hour Of The Gun (1967 y Duelo a muerte en O.K. Corral/ “Doc” (1971

Directory of Open Access Journals (Sweden)

José Elías García Sánchez

2008-10-01

Full Text Available La hora de las pistolas (1967 de John Sturges comienza en el famoso duelo en el O.K. Corral mientras que Duelo a muerte en O.K. Corral (1971 de Frank Perry, como sus predecesoras Pasión de los fuertes (1946 y Duelo de titanes (1957 termina en él. Ambas películas muestran la tuberculosis pulmonar de “Doc” Holliday. La primera incide especialmente en sus últimos días en el sanatorio antituberculoso de Glenwood Springs y la segunda, en la que es el protagonista, con sus intensos ataques de tos.

After Prism & Tempora: How much monitoring is OK for CERN?

CERN Multimedia

Computer Security Team

2013-01-01

Edward Snowden’s revelations about the “Prism” and “Tempora” surveillance operations, run by the NSA in the US and GCHQ in the UK respectively, created quite a stir! Why has the witch hunt of a whistle-blower dominated newspaper headlines when there appears to have been no outcry over the fact that two countries have deeply penetrated our digital lives for so long?!   With echoes of George Orwell’s 1984, the two agencies collected a huge amount of Internet traffic, tapping into as much data per day as the LHC produces per year (see here). How much privacy are we willing to give up in order to protect ourselves against terrorist attacks? How much monitoring of our Internet activity is justified in order to feel safer? And how much monitoring is OK in the academic environment of CERN? As the world’s largest high-energy physics research lab and the home of the LHC, CERN is a target for hacktivists and cyber-attackers. CERN mu...

Lymphatic malformations: a proposed management algorithm.

LENUS (Irish Health Repository)

Oosthuizen, J C

2012-02-01

OBJECTIVE: The aim of this study was to develop a management algorithm for cervicofacial lymphatic malformations, based on the authors\\' experience in managing these lesions as well as current literature on the subject. STUDY DESIGN AND METHODS: A retrospective medical record review of all the patients treated for lymphatic malformations at our institution during a 10-year period (1998-2008) was performed. DATA COLLECTED: age at diagnosis, location and type of lesion, radiologic investigation performed, presenting symptoms, treatment modality used, complications and results achieved. RESULTS: 14 patients were identified. Eight (57%) male and six (43%) female. There was an equal distribution between the left and right sides. The majority (71%) of cases were diagnosed within the first year of life. The majority of lesions were located in the suprahyoid region. The predominant reason for referral was an asymptomatic mass in 7 cases (50%) followed by airway compromise (36%) and dysphagia (14%). Management options employed included: observation, OK-432 injection, surgical excision and laser therapy. In 5 cases (36%) a combination of these were used. CONCLUSION: Historically surgical excision has been the management option of choice for lymphatic malformations. However due to the morbidity and high complication rate associated this is increasingly being questioned. Recent advances in sclerotherapy e.g. OK-432 injection have also shown significant promise. Based on experience in managing these lesions as well as current literature the authors of this paper have developed an algorithm for the management of cervicofacial lymphatic malformations.

Differential action on cancer and normal tissue by adrenochrome monoaminoguanidine methanesulfonate and cytochrome C combined with radiotherapy

International Nuclear Information System (INIS)

Nakatsugawa, S.; Sugahara, T.

1994-01-01

The possibility that radioprotective effects on potent natural killer (NK) cells by adrenochrome monoaminoguanidine methanesulfonate (AMM) + cytochrome C during radiotherapy (RT) for lung cancer might result in the radiosensitization of human lung cancer cells in vivo is examined. Human lung cancer xenografts in the right hind legs of KSN mice (10 weeks old) were locally irradiated with 20 Gy of X ray. AMM (10 mg/kg/day) and/or cytochrome C (CCC) (5 mg/kg/day) were given intraperitoneally immediately before or after RT, followed by daily administration for 4 days. Natural killer activities of host splenocytes were also tested with the standard 51 Cr releasing assay with YAC-1 cells as target cells. In a clinical study, 65 patients with lung cancer were treated with more than 50 Gy of RT with or without combination with AMM + CCC, OK-432 or AMM + CCC + OK-432. Before and after RT, lymphocyte subsets in the peripheral blood were examined with dichromatic analysis using an Ortho Spectrum IIIFCM system and fluorescent MABs. In this study, the change in the absolute number of each subset was investigated. AMM + cytochrome C augumented NK activity in KSN nude mice, protected potent NK cells in patients with lung cancer against RT and sensitized the human lung cancer xenografts to RT. AMM + cytochrome C may have potential as a differential modulator of radiosensitivity of normal tissues and of tumors. 8 refs., 2 figs., 1 tab

Irradiation history and final postirradiation data for IFA-432

International Nuclear Information System (INIS)

Lanning, D.D.

1986-11-01

The irradiation history and final postirradiation examination (PIE) results are presented for the Halden fuel assembly IFA-432. In particular, the three instrumented rods (Rods 2, 3, and 5) that continued to the highest burnup (46 MWd/kgM) are emphasized. The long survival rate of the fuel instrumentation allowed a continuous record to be kept of linear heat generation rate and fuel temperatures throughout the operating history of the asembly. Fission gas release was estimated based on a combination of gas retention and ceramographic data. The PIE data show that the postirradiation condition of the rods is qualitatively consistent with the power/temperature histories experienced. Fission gas release estimates are: Rod 2 (380 μm as-fabricated gap), 20-40%; Rod 5 (230 μm as-fabricated gap), 20-40%; and Rod 3 (76 μm as-fabricated gap), 0-20%

Final irradiation and postirradiation data from the NRC/PNL instrumented assembly IFA-432

International Nuclear Information System (INIS)

Lanning, D.D.; Bradley, E.R.

1986-02-01

The instrumented six-rod test assembly IFA-432, sponsored by USNRC, operated in the Halden Reactor from December 1975 to May 1984, with surviving fuel thermocouples, neutron detectors and pressure transducers. Peak burnups of 46 MWd/kgM were achieved. Interim destructive examination data were obtained at peak burnups of 24 and 34 MWd/kgM. This paper presents a synopsis of the irradiation histories and postirradiation examination data for the high burnup rods. The postirradiation condition of the rods correlates well with their individual design parameters and operating conditions

Cross-sectional study comparing different therapeutic modalities for cystic lymphangiomas in children

Directory of Open Access Journals (Sweden)

Hugo de Oliveira Olímpio

2014-08-01

Full Text Available OBJECTIVE: Here, we describe our experience with different therapeutic modalities used to treat cystic lymphangiomas in children in our hospital, including single therapy with OK-432, bleomycin and surgery, and a combination of the three modalities. METHODS: We performed a retrospective, cross-sectional study including patients treated from 1998 to 2011. The effects on macrocystic lymphangiomas and adverse reactions were evaluated. Twenty-nine children with cystic lymphangiomas without any previous treatment were included. Under general anesthesia, patients given sclerosing agents underwent puncture of the lesion (guided by ultrasound when necessary and complete aspiration of the intralesional liquid. The patients were evaluated with ultrasound and clinical examinations for a maximum follow-up time of 4 years. RESULTS: The proportions of patients considered cured after the first therapeutic approach were 44% in the surgery group, 29% in the bleomycin group and 31% in the OK-432 group. These proportions were not significantly different. Sequential treatment increased the rates of curative results to 71%, 74% and 44%, respectively, after the final treatment, which in our case was approximately 1.5 applications per patient. CONCLUSION: The results of this study indicate that most patients with cystic lymphangiomas do not show complete resolution after the initial therapy, regardless of whether the therapy is surgical or involves the use of sclerosing agents. To achieve complete resolution of the lesions, either multiple operations or a combination of surgery and sclerotherapy must be used and should be tailored to the characteristics of each patient.

Çok Etmenli Sistemlerde NetLogo İle Karınca Kolonisi Optimizasyonu

Directory of Open Access Journals (Sweden)

Mustafa Tüker

2013-02-01

Full Text Available Çok etmenli sistemler (ÇES, karmaşık optimizasyon problemlerinin modellenmesi ve çözülmesi için etkin bir yol sunarlar. Bu çalışmada, Gezgin Satıcı Problemi (GSP'ni çözmek için ÇES ve karınca kolonileri birlikte kullanılmıştır. Sistem benzetimi, etmen tabanlı bir programlama ortamı olan NetLogo ile gerçekleştirilmiştir. Problemin modellenmesi ve benzetimi için NetLogo'nun nasıl kullanılacağı kodlarla ayrıntılı olarak açıklanmıştır. Algoritma farklı düğüm sayıları için denenmiş ve elde edilen sonuçlar tartışılmıştır.

Emission analysis of Tb3+ -and Sm3+ -ion-doped (Li2 O/Na2 O/K2 O) and (Li2 O + Na2 O/Li2 O + K2 O/K2 O + Na2 O)-modified borosilicate glasses.

Science.gov (United States)

Naveen Kumar Reddy, B; Sailaja, S; Thyagarajan, K; Jho, Young Dahl; Sudhakar Reddy, B

2018-05-01

Four series of borosilicate glasses modified by alkali oxides and doped with Tb 3+ and Sm 3+ ions were prepared using the conventional melt quenching technique, with the chemical composition 74.5B 2 O 3 + 10SiO 2 + 5MgO + R + 0.5(Tb 2 O 3 /Sm 2 O 3 ) [where R = 10(Li 2 O /Na 2 O/K 2 O) for series A and C, and R = 5(Li 2 O + Na 2 O/Li 2 O + K 2 O/K 2 O + Na 2 O) for series B and D]. The X-ray diffraction (XRD) patterns of all the prepared glasses indicate their amorphous nature. The spectroscopic properties of the prepared glasses were studied by optical absorption analysis, photoluminescence excitation (PLE) and photoluminescence (PL) analysis. A green emission corresponding to the 5 D 4 → 7 F 5 (543 nm) transition of the Tb 3+ ions was registered under excitation at 379 nm for series A and B glasses. The emission spectra of the Sm 3+ ions with the series C and D glasses showed strong reddish-orange emission at 600 nm ( 4 G 5/2 → 6 H 7/2 ) with an excitation wavelength λ exci = 404 nm ( 6 H 5/2 → 4 F 7/2 ). Furthermore, the change in the luminescence intensity with the addition of an alkali oxide and combinations of these alkali oxides to borosilicate glasses doped with Tb 3+ and Sm 3+ ions was studied to optimize the potential alkali-oxide-modified borosilicate glass. Copyright © 2017 John Wiley & Sons, Ltd.

IFPE/IFA-432, Fission Gas Release, Mechanical Interaction BWR Fuel Rods, Halden

International Nuclear Information System (INIS)

Turnbull, J.A.

1996-01-01

Description: It contains data from experiments that have been performed at the IFE/OECD Halden Reactor Project, available for use in fuel performance studies. It covers experiments on thermal performance, fission product release, clad properties and pellet clad mechanical interaction. It includes also experimental data relevant to high burn-up behaviour. IFA-432: Measurements of fuel temperature response, fission gas release and mechanical interaction on BWR-type fuel rods up to high burn-ups. The assembly featured several variations in rod design parameters, including fuel type, fuel/cladding gap size, fill gas composition (He and Xe) and fuel stability. It contained 6 BWR-type fuel rods with fuel centre thermocouples at two horizontal planes, rods were also equipped with pressure transducers and cladding extensometers. Only data from 6 rods are compiled here

Kurumsal Sürdürülebilirlik Performansının Ölçümü İçin Çok Kriterli Bir Çerçeve: Henkel Örneği

OpenAIRE

Ahmet Öztel; Mehmet Said Köse; İhsan Aytekin

2012-01-01

Kurumsal sürdürülebilirlik performans ölçümü, kurumsal sürdürülebilirliğin çevresel, sosyal ve ekonomik yönlerini ele almayı amaçlamaktadır. Bu üç boyutun tek bir boyuta indirgenmesinde sorunlar ortaya çıkmaktadır. Çok kriterli karar verme yöntemleri, bu değişkenlerin birlikte değerlendirilmesi için kullanışlı bir çerçeve sunmaktadır. Bu çalışmada, çok kriterli karar verme yöntemlerinden uzlaşık programlama (compromise programing) çerçevesi kullanılarak Henkel firmasının kurumsal sürdürülebil...

The period analysis of V418 AQL, SU BOO, RV CVn, CR CAS, GV CYG, V432 PER, and BD+42 2782

International Nuclear Information System (INIS)

Zasche, P.; Wolf, M.; Kučáková, H.; Uhlař, R.

2014-01-01

The minimum timings of eclipsing binaries V418 Aql, SU Boo, RV CVn, CR Cas, GV Cyg, V432 Per, and BD+42 2782 were collected and analyzed. Their long-term behavior was studied via period analysis, revealing a periodic term in eclipse times. We derived 576 new times of minimum. Hence, to describe the periodic variation, a third-body hypothesis was proposed and the resulting orbital periods are as follows: 70, 7.4, 53, 37, 27, 53, and 18 yr, respectively. For the system V432 Per an additional 9.5 yr variation was also found. The predicted minimum masses of these distant bodies were calculated and their detectability discussed. The light curves of SU Boo and RV CVn were analyzed using the PHOEBE program, resulting in physical parameters of the components. New variable stars in the field of V418 Aql were discovered.

Güneş enerjisi destekli çok fonksiyonlu trijenerasyon sisteminin termodinamik analizi

Directory of Open Access Journals (Sweden)

Önder KIZILKAN

2016-02-01

Full Text Available Bu çalışmada güneş enerjisi destekli çok fonksiyonlu bir trijenerasyon sisteminin modellemesi ve termodinamik analizleri yapılmıştır. Sistemde, gaz türbinleri için yeni bir teknoloji olan güneş kulesi vasıtasıyla gaz çevrimi ve buhar çevirimi için gerekli termal enerji sağlanmaktadır. Ayrıca, sisteme absorbsiyonlu soğutma sistemi, buhar üretim prosesi, kurutma prosesi ve kullanım sıcak suyu ısıtma prosesi entegre edilmiştir. Trijenerasyon sisteminin birinci kanun ve ikinci kanun analizleri yapılarak enerji ve ekserji verimleri tespit edilmiştir. Analizler sonucunda gaz çevrimi verimi %31, buhar çevrimi verimi %28, soğutma sisteminin performans katsayısı (COP değeri ise 0.77 olarak tespit edilmiştir. Ekserji kayıpları incelendiğinde ise en yüksek ekserji kaybının 4154 kW ile güneş kulesinde meydana geldiği tespit edilmiştir.Anahtar Kelimeler: Güneş kulesi, Trijenerasyon, Gaz çevrimi, Buhar çevrimi, Enerji, Ekserji

Biodegradation of Mexel 432 By Bacteria From the Seine River

International Nuclear Information System (INIS)

Allonier, A.S.; Khalanski, M.

1996-01-01

This report deals with a study of the biodegradation of a filmogenic organic product (Mexel 432) usable in the fight against corrosion, scale and fouling, presenting a certain interest in the research of processes enabling a functional and environmental efficiency for the cooling systems of thermal power stations. The study of the degradation of this product is followed by a global colorimetric method. It shows that the product is stable on the long-term in demineralized water. On the other hand, its rate of disappearance in river waters is significant (50 % in 2 or 3 days). In this phenomenon of disappearance, biodegradation seems to play a part. Some bacteria from the natural environment (river Seine) have been isolated. Two of them seem to play a significant part, since they can degrade the product in three weeks. During the degradation, the amines with long chains (more than six carbons) of the Mexel, measured by the colorimetric method, disappear. The other compounds generated by the biodegradation process are not identified. (authors)

The version control service for ATLAS data acquisition configuration filesDAQ ; configuration ; OKS ; XML

CERN Document Server

Soloviev, Igor; The ATLAS collaboration

2012-01-01

To configure data taking session the ATLAS systems and detectors store more than 160 MBytes of data acquisition related configuration information in OKS XML files. The total number of the files exceeds 1300 and they are updated by many system experts. In the past from time to time after such updates we had experienced problems caused by XML syntax errors or inconsistent state of files from a point of view of the overall ATLAS configuration. It was not always possible to know who made a modification causing problems or how to go back to a previous version of the modified file. Few years ago a special service addressing these issues has been implemented and deployed on ATLAS Point-1. It excludes direct write access to XML files stored in a central database repository. Instead, for an update the files are copied into a user repository, validated after modifications and committed using a version control system. The system's callback updates the central repository. Also, it keeps track of all modifications providi...

75 FR 15419 - Notice of Intent To Grant Exclusive License of U.S. Patent Application No. 12/432,842 Filed April...

Science.gov (United States)

2010-03-29

... Exclusive License of U.S. Patent Application No. 12/432,842 Filed April 30, 2009 Entitled: ``A Soil Stabilization Soil Comprising Same, and a Method of Stabilizing Soil'' AGENCY: Department of the Army, U.S. Army... climates with sandy, gravelly soils where emulsions and hydraulic cements will not effectively cure. If...

One-step Conversion of Levulinic Acid to Succinic Acid Using I2/t-BuOK System: The Iodoform Reaction Revisited.

Science.gov (United States)

Kawasumi, Ryosuke; Narita, Shodai; Miyamoto, Kazunori; Tominaga, Ken-Ichi; Takita, Ryo; Uchiyama, Masanobu

2017-12-21

The iodoform reaction has long been used as a qualitative test for acetyl and/or ethanol units in organic molecules. However, its synthetic applications are quite limited. Here, we describe a tuned iodoform reaction for oxidative demethylation reaction with I 2 and t-BuOK in t-BuOH, in which in situ-generated t-BuOI serves as the chemoselective iodinating agent. This system enables one-step conversion of levulinic acid to succinic acid, a major four-carbon chemical feedstock. This oxidative demethylation is also applicable to other compounds containing an acetyl group/ethanol unit, affording the corresponding carboxylic acids in a selective manner.

Morphologic and functional alterations induced by low doses of mercuric chloride in the kidney OK cell line: ultrastructural evidence for an apoptotic mechanism of damage

International Nuclear Information System (INIS)

Carranza-Rosales, Pilar; Said-Fernandez, Salvador; Sepulveda-Saavedra, Julio; Cruz-Vega, Delia E.; Gandolfi, A. Jay

2005-01-01

Mercury produces acute renal failure in experimental animal models, but the mechanism of tubular injury has not completely been clarified. There is an increased interest in the role of apoptosis in the pathogenesis of renal diseases that result primarily from injury to renal tubular epithelial cells. However, detailed studies of morpho-functional alterations induced by mercuric chloride in kidney cell lines are scarce. This work characterizes these alterations in OK cell cultures. Morphological alterations were profiled using light microscopy, transmission electron microscopy, and confocal microscopy, as well as mitochondrial functional assays in the cells exposed to low concentrations of HgCl 2 . At concentrations of 1 and 10 μM of HgCl 2 there were no morphological or ultrastructural alterations, but the mitochondrial function (MTT assay) and intracellular ATP content was increased, especially at longer incubation times (6 and 9 h). At 15 μM HgCl 2 , both the mitochondrial activity and the endogenous ATP decreased significantly. At this concentration the OK cells rounded up, had increased number of cytoplasmic vacuoles, and detached from the cell monolayer. At 15 μM HgCl 2 ultrastructural changes were characterized by dispersion of the ribosomes, dilatation of the cisterns of the rough endoplasmic reticulum, increase of number of cytoplasmic vacuoles, chromatin condensation, invaginations of the nuclear envelope, presence of cytoplasmic inclusion bodies, and alterations in the size and morphology of mitochondria. At 15 μM HgCl 2 apoptotic signs included membrane blebbing, chromatin condensation, mitochondrial alterations, apoptotic bodies, and nuclear envelope rupture. Using confocal microscopy and the mitochondrial specific dye MitoTracker Red, it was possible to establish qualitative changes induced by mercury on the mitochondrial membrane potential after incubation of the cells for 6 and 9 h with 15 μM HgCl 2 . This effect was not observed at short times

Phase formation in K2O(K2CO3)-CdO-MoO3 system

International Nuclear Information System (INIS)

Tsirenova, G.D.; Tsybikova, B.A.; Bazarova, Zh.G.; Solodovnikov, S.F.; Zolotova, E.S.

2000-01-01

Phase formation in K 2 O(K 2 CO 3 )-CdO-MoO 3 system are studied by the methods of x-ray diffraction, thermal and crystal optical analyses. Three potassium-cadmium molybdates are detected: K 4 Cd(MoO 4 ) 3 with a new structure, alluodite-like K 4-2x Cd 1+x (MoO 4 ) 3 (0.26≤x≤0.38 at 470 Deg C) and K 4 CdMo 4 O 15 of K 4 MnMo 4 O 15 type. First of them decomposes in solid phase at 580 Deg C, and others melt incongruently at 720 and 515 Deg C correspondingly. It is established that K 4-2x Cd 1+x (MoO 4 ) 3 compound undergoes phase transition of the second type in the temperature interval of 500-550 Deg C. Phase diagram of quasibinary cross section K 2 MoO 4 -CdMoO 4 is plotted [ru

Nagasaki cooperative group study of radio-chemo-immunotherapy following surgery for glioma

International Nuclear Information System (INIS)

Shibata, Shobu; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.

1984-01-01

The purpose of this interinstitutional controlled study was to assess the usefulness of radio-chemo-immunotherapy following surgery for glioma. Immediately after surgery for glioma, patients were randomly allocated into the group A with radiotherapy (5,000 to 6,000 rad), ACNU, and OK-432 and the group B with radiotherapy and ACNU. Fifty-one patients consisting of 24 in the froup A and 27 in the group B entered the study from January 1981 to December 1983. No significant differences in one-year, two-year, and three-year survival rates were observed between the groups. Protective effects on leukopenia were observed in the group A, compared with the group B, with a significant difference. (Namekawa, K.)

Evaluation of the in-pile pressure data from instrumented fuel assemblies IFA-431 and IFA-432

International Nuclear Information System (INIS)

Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Williford, R.E.

1979-10-01

This report includes results of the examination of the in-pile pressure data from instrumented test assemblies IFA-431 and 432. The pressure data have been used to estimate the fission gas release fraction as a function of fuel burnup. Included are comparisons of the estimated release functions and those predicted by three fission gas release models using the experimental temperature histories of the fuel rods. These comparisons show that fuel temperature is the primary factor in determining fission gas release and that burnup-enhanced fission gas release is not important in UO 2 fuels irradiated to 1700 GJ/kgU

Characterisation and Properties of Lithium Disilicate Glass Ceramics in the SiO2-Li2O-K2O-Al2O3 System for Dental Applications

Directory of Open Access Journals (Sweden)

Naruporn Monmaturapoj

2013-01-01

Full Text Available This work proposes four different glass formulas derived from the SiO2-Li2O-K2O-Al2O3 system to investigate the effect of glass composition on their crystal formations and properties. Glass LD1 was SiO2-Li2O-K2O-Al2O3 system with the addition of P2O5 and CaF2 as nucleating agents. In Glass LD2, a slight amount of MgO was mixed in order to increase the viscosity of the melting glass. Finally, the important factor of Si : Li ratio was increased in Glasses LD3 and LD4 with compositions otherwise the same as LD1 and LD2. The results found that P2O5 and CaF2 served as a nucleating site for lithium phosphate and fluorapatite to encourage heterogenous nucleation and produce a fine-grained interlocking microstructure of lithium disilicate glass ceramics. MgO content in this system seemed to increase the viscosity of the melting glass and thermal expansion coefficient including the chemical solubility. Increasing the Si : Li ratio in glass compositions resulted in the change of the microstructure of Li2Si2O5 crystals.

A density functional theory study of models for the N3 and OK1 EPR centres in diamond

International Nuclear Information System (INIS)

Etmimi, K M; Goss, J P; Briddon, P R; Gsiea, A M

2010-01-01

The defects observed in natural and synthetic diamonds provide a fingerprint of their differing growth conditions, as well as the thermal and mechanical processes they have experienced. Of the first row elements it is perhaps surprising that little evidence exists for oxygen in the form of distributed point-defects. Paramagnetic centres labelled N3 and OK1 have been assigned to two structural arrangements of pairs of substitutional nitrogen and oxygen, but there is no direct evidence for the involvement of the oxygen. In this paper we present the results of density functional simulations of N-O pairs in diamond, and review them in light of the experimental evidence. We also present analysis for other structures proposed in the literature (Ti-N, Ti-V-N, NV 2 and NVO), and show that none are particularly plausible.

EVALUACIÓN DEL POTENCIAL EÓLICO PARA LA GENERACIÓN DE ENERGÍA ELÉCTRICA EN EL ESTADO DE VERACRUZ, MÉXICO

Directory of Open Access Journals (Sweden)

QUETZALCOATL HERNÁNDEZ-ESCOBEDO

2012-01-01

Full Text Available El objetivo de este artículo es la evaluación del recurso eólico para su posible utilización en la generación de energía eléctrica en el Estado de Veracruz, México. Para ello se llevaron a cabo mediciones de viento registradas cada 10 minutos a 50m de altura durante los años 2008 y 2009 en 16 estaciones anemométricas distribuidas dentro del Estado. Se encontró que existen regiones en donde la velocidad promedio del viento es 5.45 m/s, valor que se ajusta para producir energía eléctrica de 14,432 kW mientras la velocidad se mantenga en ese rango. Para evaluar la potencia eléctrica que puede entregar un dispositivo comercial, se utilizó un aerogenerador marca ACCIONA modelo AW 70/1500 Class I que según el fabricante tiene una capacidad 1500kW, el estudió arrojó que instalando un aerogenerador por cada zona estudiada se suministraría energía eléctrica a la red de 10,694 MWh/año, con lo cual se podrán ahorrar 9,933.1 de Toneladas Equivalentes de Petróleo (TEP, y una reducción anual bruta de emisiones de Gases de Efecto Invernadero (GEI equivalentes a 28,806.1 toneladas de CO2 (tCO2. Adicionalmente, se obtuvo la estacionalidad anual de la velocidad media del viento, esto se realizó para observar la variabilidad del viento con respecto a las estaciones del año en el Estado.

Peces del Noroeste del Ecuador

OpenAIRE

Barriga, Ramiro

1994-01-01

La ictiofauna del occidente del Ecuador es poco conocida. Los peces del noroccidente son diferentes a los del suroccidente del Ecuador. 34 familias y 82 especies fueron colectadas que equivale al 11 % de las especies de peces continentales registradas en el Ecuador. Icteogeográficamente se sabe que la costa ecuatoriana posee dos provincias: la del Pacifico Norte y la del Guayas, se determinó que el límite de las dos provincias es el río Santiago ya que las especies del mencionado río so...

Bütünleşik Tedarik Zinciri Ağında Tesis Yeri Seçimi için Bulanık Çok Amaçlı Programlama Modeli

Directory of Open Access Journals (Sweden)

Hüseyin Ali Sarıkaya

2014-05-01

Full Text Available Geleneksel tedarik zinciri ağı tasarım problemleri genellikle tek amaçlı olarak ele alınmıştır. Ancak, tedarik zincirleri gerçek hayatta birbirleri ile çelişen amaçları olan organizasyonların meydana getirdiği karmaşık ağlardır. Bu çalışmada, piyasa taleplerinin belirsiz olduğu bütünleşik bir tedarik zinciri ağındaki birden fazla ölçülemeyen amacı gerçekleştirmek için çok ürünlü, çok aşamalı ve çok dönemli planlama modeli önerilmiştir. Tedarik zinciri planlama modeli, birbiriyle çelişen birkaç amacı doyurmak için karışık tam sayılı doğrusal olmayan programlama problemi olarak bina edilmiştir. Önerilen model iki amaç fonksiyonundan oluşmaktadır. Birincisi, tedarik zincirindeki sabit tesis açma ve işletme maliyetleri ile mesafelere bağlı olarak belirlenen taşıma maliyetlerinin en azlanmasıdır. İkincisi, Ekonomik Üretim Miktarı (EÜM modeline göre satın alma, sipariş verme, stok bulundurma ve yok satma maliyetlerinin en azlanmasıdır. Önerilen modelde, karar vericilerin kesin olmayan hedef değerlerini dahil edebilmek için bulanık hedef programlama yaklaşımı kullanılmıştır. Model, GAMS optimizasyon programı kullanılarak çözülmüştür. Çalışmada sunulan uygulama sonuçları, bulanık modelleme ve çözüm yaklaşımlarının daha gerçekçi tedarik zinciri modelleri oluşturulmasında kullanılabileceğini göstermiştir.

Determinación del costo de construcción de las diferentes clasificaciones para una vivienda sustentable en la ciudad de Cuenca, Ecuador.

Directory of Open Access Journals (Sweden)

Jorge Rene Vasquez Palacios

2017-12-01

Full Text Available En Ecuador existe un elevado porcentaje de viviendas con problemas ambientales, debido a la falta de una práctica habitual de incorporar criterios de confort y eficiencia energética, que patentiza la necesidad de implementar estrategias sustentables en los procesos de construcción. El estudio aquí expuesto analiza una vivienda unifamiliar en la ciudad de Cuenca (Ecuador y determina los costos referenciales de construcción (por metro cuadrado de los diferentes niveles sustentables que pudiera alcanzar la vivienda con respecto a su semejante convencional. El trabajo se desarrolla en tres etapas: (1 desarrollo de una metodología apropiada para identificar los costos; (2 estudio cualitativo sobre la percepción de la vivienda sustentable; (3 estudio cuantitativo de los costos de construcción y el valor agregado ecuatoriano (VAE. A las distintas opciones de viviendas sustentables se las clasifica en una escala de A a C, dependiendo de la cantidad de estrategias que se incorporen, mientras que a la vivienda convencional se le asigna la clasificación D. Se concluye que las viviendas sustentables presentan un incremento de costo, con respecto a la convencional, del 33.14% (A, 15.56% (B y 4.32% (C, con una reducción del VAE del 15.75%, 4.01% y 3.74%, respectivamente.

Data report for the NRC/PNL Halden Assembly IFA-432

International Nuclear Information System (INIS)

Hann, C.R.; Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Marshall, R.K.; Williford, R.E.

1978-08-01

The report presents the in-reactor data collected from the NRC/PNL Halden Assembly IFA-432 as a part of the program entitled ''Experimental Vertification of Steady State Fuel Codes,'' sponsored by the Fuel Behavior Research Branch of the USNRC. The purpose of this program is to reduce the uncertainties of calculating the thermal stored energy in an operating nuclear fuel rod. The report presents fuel centerline thermocouple readings, cladding elongation monitor readings, rod internal pressure readings, and neutron detector readings. The neutron detector readings were corrected to represent rod local powers at the thermocouple locations. These data are presented in the form of plots of the variables versus time during the portion of the irradiation period from December 1975 to January 1978. Also included are descriptions of the test rationale, assembly and rod designs, test facility, instrument array and calibration, and data processing methods. Topical reports discussing specific aspects and results of the data analysis are referenced. As of May 1978, the assembly burnup had reached its design goal of 20,000 MWd/MTM. However, it has been decided to leave the assembly in core to collect high burnup fission gas release data. The xenon-filled Rod 4 was replaced with the non-instrumented Rod 8 (Rod 1 design) after the first cycle. Six of the twelve original thermocouples, four of the six cladding elongation monitors, all SPND'S and all pressure transducers remain operable at this writing

Clinical response, drug survival and predictors thereof in 432 patients with ankylosing spondylitis switching anti tumor necrosis factor α therapy: Results from the Danish nationwide Danbio registry

DEFF Research Database (Denmark)

Glintborg, Bente; Østergaard, Mikkel; Krogh, N.

2012-01-01

, 432 patients (30%) switched to a second and 137 (10%) to a third biological drug. Compared with non-switchers, switchers were more frequently women (33%/22%), had shorter disease duration (3 years/5 years) and higher BASDAI (62(52-76) mm/56(43-69) mm (median(interquartile-range))), Bath AS Functional...

Evaluación de pérdidas postcosecha del lulo (Solanum quitoense lam., comercializado en un empaque tradicional

Directory of Open Access Journals (Sweden)

Juan Carlos Muñoz

1999-05-01

Full Text Available Con el fin de evaluar la incidencia del empaque tradicional colombiano sobre la calidad del lulo, se llevó a cabo el estudio de las causas del deterioro postcosecha y la cuantificación de las pérdidas por factores de manejo, empaque y condiciones de transporte, entre fincas ubicadas en el departamento del Huila y la Corporación de Abastos de Bogotá, CORABASTOS. Para ello se identificaron los diferentes empaques regionales comercializados en la central y se caracterizó el más común, así como la calidad de la fruta en ellos contenida, determinando el porcentaje de daños de precosecha y mecánicos postcosecha. También se cuantificó el daño causado por la profundidad de llenado. Se encontró que el empaque tradicional más utilizado en el país es el guacal de dimensiones 40 cm x 45 cm x 50 cm, y capacidad promedia de 28 kg, teniendo como única ventaja la resistencia al manipuleo y como desventajas, el ser desechable, de alta relación de peso, RP, empaque/producto y alto daño mecánico por compresión. El lulo se caracterizó físicamente como una fruta liviana, con pesos entre 55 g Y70 g, redondez de 0,95, esfericidad de 0,96, diámetro promedio de 4,9 cm y área superficial de 76 cm2, La madurez del lulo en el guacal fue: maduro 43,2%, pintón 37,3% y sobremaduro 13,6%. La calidad varió de producto bueno en 27,1% (fondo a 67,9% (capa superior, en lulos pintones y maduros. El porcentaje promedio de daños precosecha fue de 12,7% del total, con una intensidad del 1,8% del área superficial. El daño mecánico aumentó de la superficie al fondo del empaque. La evaluación global del empaque a los tres días de cosecha mostró un producto con elevado daño (53,9%, del cual el 42% por mal manejo y empaque, valor duplicado a los 11 días, con 91,08% de los lulos solo con el daño mecánico, 5,69% con daños de precosecha y solo el 3,39% con lulos buenos. Se concluyo que el guacal no protege la calidad ni la integridad física del

Retrospective of CO{sub 2} emissions of the Mexican industrial sector; Retrospectiva de emisiones de CO{sub 2} del sector industrial mexicano

Energy Technology Data Exchange (ETDEWEB)

Gonzalez, Domingo; Martinez, Manuel [Universidad Nacional Autonoma de Mexico (UNAM), Mexico, D.F. (Mexico)

2006-11-15

The carbon dioxide emissions of the Mexican Industrial Sector throughout the period of 1965-2003 are analyzed, in terms of 16 branches of the industrial economic activity, as it is marked by the proposed disintegration of the Sistema de Cuentas Nacionales of the Intituto Nacional de Estadistica, Geografia e Informatica (INEGI) and the National Balance of Energy 2003 (BNE-2003). The CO{sub 2} emissions by the energy use have a behavior very similar to the one of the consumption of the final energy, which reflects that non significant changes in the composition of used fuels have existed. During this period the CO{sub 2} emissions increased 230%. The industrial branches that have shown significant changes in the CO{sub 2} emission are Construction, Bottled Water, Rubber, Cement, Beer and Malta and Chemistry. In order to evaluate the effects of the Activity, Structure, Power Intensity, fuel Mixture of final use and fuel Mixture used in electricity generation the decomposition model of CO{sub 2} is used based on the Laspeyres index. The calculated effects show that the main increase of total carbon dioxide of the SIM is referred to the Activity with an average rate of annual growth (TMCA) of 4.32%; whereas the effect that mitigates more the CO{sub 2} emission is the one described by the power Intensity and is equivalent to a TMCA of -0.85%. [Spanish] Se analizan las emisiones de bioxido de carbono del Sector Industrial Mexicano a lo largo del periodo de 1965-2003, en termino de 16 ramas de actividad economica industrial como lo marca la desagregacion propuesta por el Sistema de Cuentas Nacionales del Instituto Nacional de Estadistica, Geografia e Informatica (INEGI) y el Balance Nacional de Energia 2003 (BNE-2003). Las emisiones de CO{sub 2} por el uso de energia tienen un comportamiento muy similar al de consumo de energia final, lo que refleja que no han existido cambios significativos en la composicion de los combustibles empleados. Durante este periodo las

La superaci??n del modelo del ??ngel del hogar:

OpenAIRE

Hurtado Mu??oz, M??nica

2012-01-01

La Tesis Doctoral titulada "La superaci??n del modelo del "??ngel del hogar". Recuperaci??n de la escritora Leonor Canalejas y Fustegueras (1869-1945)" aborda, en primer lugar, un an??lisis sociol??gico de las circunstancias que rodearon a la mujer espa??ola en el cambio de siglo en el ??mbito social y educativo, en un intento de esclarecer las caracter??sticas propias del contexto en el que la mujer accede a la intelectualidad en general y a la literatura en particular. Esta parte concluye q...

Percepción ambiental de productores agropecuarios y docentes rurales del partido de Arrecifes, Buenos Aires (Argentina

Directory of Open Access Journals (Sweden)

Graciela Maria Sardi

2012-12-01

Full Text Available En la región pampeana el avance de la agricultura sobre los suelos ganaderos, la incorporación de tecnología en la agricultura con creciente uso de agroquímicos y el deficiente manejo de efluentes en las producciones intensivas ganaderas, incrementan el riesgo de contaminación del agua. Se analizó la percepción ambiental de productores agropecuarios y docentes del ámbito rural del partido de Arrecifes (Buenos Aires, Argentina para planificar el desarrollo  de acciones de capacitación que puedan ser implementadas con cada uno de los grupos de actores sociales entrevistados. En un proyecto de gestión del agua (2001-2004 se recopiló información por medio de encuestas (2002 abarcando las siguientes temáticas: -Identificación de los principales problemas ambientales regionales, -Su ponderación por escala de gravedad, -Identificación de sus  consecuencias ambientales y  soluciones, - Percepción y conocimiento sobre los beneficios que aportan y perjuicios que afectan al agua superficial y subterránea, -Actitudes diarias que puedan perjudicar o favorecer la calidad del agua  e -Interés por recibir capacitación e información sobre los aspectos vinculados al cuidado y utilización de este recurso. Para el análisis de resultados se utilizó estadística descriptiva y  prueba de Fisher (?= 5%. Los encuestados (n=95 43.2 % productores 56.8 % docentes perciben problemas, proponen soluciones y actúan de acuerdo al grupo social al que pertenecen. Los productores poseen una mirada produccionista, ignorando las causas reales de la problemática del agua incriminando muchas veces a factores climáticos, como causantes de la degradación de los recursos naturales y proponiendo soluciones de índole educativas. Los docentes tienen una mirada más amplia y social, proponen soluciones económicas y tecnológicas, y creen que éstas son funciones privativas de los tomadores de decisiones.  Conocer la percepción de aquellos que hacen al

SOBRE LA SITUACIÓN DEL FONDO DE INVESTIGACIONES EN SALUD (FIS: COMUNICADO DEL COLEGIO MÁXIMO DE LAS ACADEMIAS DE COLOMBIA

Directory of Open Access Journals (Sweden)

Colegio Máximo de las Academias

2016-11-01

Full Text Available

Durante el período de 1975 – 2005, el financiamiento de la investigación en Colombia se hizo fundamentalmente con base en préstamos externos mediante los créditos de ciencia y tecnología: BID [I]; BID [II] y BID [III]. A partir del último crédito del BID, el financiamiento de la investigación en general se estancó y disminuyó en términos reales durante varios años, no necesariamente secuenciales.

En el año 2000, el Ministerio de Salud, las directivas de Colciencias y, especialmente, el Programa de Ciencia y Tecnología de la Salud, preocupados por esta disminución de recursos para la financiación de las importantes propuestas de investigación que se presentaban y que no era posible financiar, y después de una ardua tarea, lograron la aprobación de la Ley 643 del 6 de enero de 2001, por la cual: “se fija el régimen propio del monopolio rentístico de juegos de suerte y azar”, con el artículo 42 que creó el Fondo de Investigación en Salud (FIS: “Los recursos del FIS están constituidos por los dineros provenientes del 7% de las rentas obtenidas por la explotación del monopolio de juegos de suerte y azar diferentes del Lotto, la Lotería Preimpresa y la Instantánea, los cuales deberán ser girados mensualmente en los términos que dispone la Ley 643 de 2001. Estos recursos pertenecen a la Nación y están exclusivamente destinados a financiar los proyectos de investigación en salud de los departamentos y el Distrito Capital”.

Los resultados de esta financiación han impactado positivamente la investigación en salud en Colombia como lo demuestran los siguientes indicadores: desde el año 2001 se han financiado alrededor de 1.196 proyectos por un valor de $763.608.933.432 de los cuales el 52% han sido sufragados con recursos del FIS, es decir, $393.557.675.570, y el restante corresponde al aporte de las Instituciones ejecutoras; además ha permitido el fortalecimiento de las capacidades

Geología y geoquímica del granito de Montánchez (Cáceres

Directory of Open Access Journals (Sweden)

Arribas Moreno, A.

1989-12-01

Full Text Available The granite of Montánchez (Cáceres, Spain is located to the S.E. of the Albalá granite and is separated from it by a strongly tectonized zone. According to the mica content, three perografic facies have been distinguished in the Montánchez granite. Facies 1, is made up of medium to coarse grained, two mica granites richer in muscovite, which occupy the northern half of the granite and have been extremely deformed. Facies II, consiting of coarse to very coarse grained, sometimes porphyrblastic, two-mica granites, richer in biotite, has not been deformed, or very little. Facies III is made up of aplitic muscovite granties which are poor in biotite and rich in tourmaline. The Montánchez granite frecuently contains tonalitic xenolith, sometimes quitee large. Regarding the geochemistry of the Montánchez granite the major and some trace elements have been analyzed on 22 samples belonging to the three different facies and the tonalitic xenoliths. As for the major elements, the chemical-mineralogical parameters of la Roche, the binary diagrams of Harker, Larsen, la Roche and Deban and Le Fort, and the ternary diagrams Na2O, K2O, CaO, Na2O+K2O, Al2O3, CaO and AFM have been calculted. They indicate that these granties are made up alkaline rocks richer in Na than K, poor in Ca, and with a markedly peraluminous character. Concerning the distribution of the trace elements in the Montánchez granite the average conten in Rb, Ba, Sr, Zr and Nb lower and those in Sn and Zn higher, than the values reported by different autors for several world granites considered to be standard.El macizo granítico de Montánchez (Cáceres, España está situado al SE del granito de Albalá, del que le separa una banda fuertemente tectonizada. De acuerdo con su contenido en micas se han distinguido en él tres facies petrográficas. Facies 1, formada por grantios de dos micas, con moscovita dominante, ocupa la parte norte del macizo; es una facies muy deformada y con tama

Frequency Spectrum of Liquids and Cold Neutron Scattering; Spectre de frequences des liquides et diffusion de neutrons froids; Chastotnyj spektr zhidkostej i rasseyanie kholodnykh nejtronov; Espectro de frecuencias de los liquidos y dispersion de neutrones frios

Energy Technology Data Exchange (ETDEWEB)

Singwi, K S; Sjolander, A; Rahman, A [Argonne National Laboratory, Argonne, IL (United States)

1963-01-15

neutrons lents par les liquides comme l'ont souligne Egelstaff et ses colllaborateurs. Les auteurs calculent, a l'aide d'un modele stochastique, le spectre des frequences f({omega}) de la fonction d'auto-correlation des vitesses dans l'eau a 300{sup o}K et dans le plomb liquide a 620{sup o}K. Dans le cas de l'eau ils prevoient un maximum de la fonction f({omega}) correspondant a {Dirac_h} {omega}75{sup o}K. Dans le plomb, le maximum se manifeste a une valeur a peu pres analogue. II existe aussi un minimum de la fonction f({omega}) dans les deux cas. Larsson et Dahlborg ont observe un maximum de la fonction f({omega}) a la valeur d'{omega} prevue ci-dessus. Des observations faites recemment dans du plomb liquide par Cotter et al. confirment vraisemblablement les previsions des auteurs. (author) [Spanish] Una cuestion importante que se plantea respecto de la dispersion de neeutrones lentos por los liquidos es la siguiente: Existe un espectro de frecuencia de los liquidos analogo al de los solidos? para contestar a esta pregunta, basta demostrar que la funcion de amplitud {gamma}(t) de la funcion gaussiana de autocorrelacion espacio G{sup s}(r,t) puede expresarse, utilizando el espectro de frecuencias de la funcion de autocorreclation de velocidad, en form identica a la correspondiente a un solido armonico. Es decir, si se conoce el especro de frecuencias de la funcion de autocorrelacion de velocidad, se debe poder calcular la dispersion de neutrones lentos por los liquidos, como han senalado Egelstaff y colaboradores. Los autores calculan, utilizando un modelo estocastico de liquido, el espectro de frecuencia f({omega}) de la funcion de autocorrelacion de velocidad, en el caso del agua a 300{sup o}K y del plomo liquido a 620{sup o}K. Predicen para la primera un maximo de f({omega}) correspondiente a {Dirac_h}{omega} 75{sup o}K. Enel caso del plomo, el maximo se presenta tambien para el mismo valor de oj, aproximadamente. Ademas, en ambos casos f({omega})pasa por un minimo

Historia del Pádel = History of Padel

Directory of Open Access Journals (Sweden)

Bernardino Javier Sánchez-Alcaraz Martínez

2013-10-01

Full Text Available El presente trabajo resume la historia del deporte del pádel. Existen dos versiones sobre el origen del pádel. La primera versión relaciona los antecedentes del pádel con los de otros deportes de raqueta como el tenis o el bádminton, siendo su origen común el jeu de la paume francés. Posteriormente, surgen variantes en Estados Unidos como el Paddle Tennis y el Platform Tennis, siendo versiones reducidas del tenis, pero con elementos muy comunes al pádel actual. La segunda versión, aprobada por la Federación Internacional de Pádel, afirma que este deporte nació en México, en 1969, a través del empresario Enrique Corcuera.--------------------------------------------------------------------This research summarizes the history of paddle sport. There are two versions about the origin of paddle. The first version relates the history of paddle with other racket sports like tennis or badminton, and its common origin of the Jeu de Paume French. Later, in in the United States, appear two sports called Paddle Tennis and Platform Tennis, which are reduced versions of tennis sport, but these have lot of common characteristics with paddle. The second version, approved by the International Padel Federation, said the sport was born in Mexico in 1969, through the businessman Enrique Corcuera.

El cultivo de esputo para el diagnóstico de la tuberculosis pulmonar

Directory of Open Access Journals (Sweden)

Luis Carlos Orozco

1985-06-01

Full Text Available El presente trabajo demuestra claramente que la técnica de Kudoh del escobillón impregnado en esputo, decontaminado por 1-2 minutos en NaOH 4% y sembrado en el medio de Ogawa, modificado por Kudoh (O-K da resultados similares de positividad y contaminación al procedimiento de Petroff, sembrando en Lowenstein-Jensen (L-J.

El plan del delta - Holanda

Directory of Open Access Journals (Sweden)

Editorial, Equipo

1963-09-01

étodos constructivos en ellas empleados. De estas últimas obras merece especial atención el puente Nabla, situado en el Delta: es de hormigón pretensado, y cuenta con 17 tramos de 60 m de luz cada uno. Esta enorme estructura, además de su extensa longitud y servir de apoyo a una calzada de 22,80 m de anchura, se halla sometida a los tremendos empujes que 1 s aguas del mar ejercen, por un lado, y por el otro, las aguas dulces del brazo Haringvliet, estuario común de los ríos Rin y Mosa, ya que el puente sirve de soporte para las compuertas que han de regular los caudales de agua dulce y cerrar el paso al agua del mar. Las pilas que soportan el tablero con interposición de articulaciones de caucho, son las encargadas de transmitir los empujes de aguas al terreno. El pretensado está constituido por 193 cables, de trazado parabólico, trenzados con 51 alambres de 6 mm de diámetro cada uno, que se hallan sometidos a un esfuerzo de 136,8 t. El pretensado transversal se ha realizado con cables tipo Freyssinet de 12 alambres, de 7 mm de diámetro, trabajando a 43,2 t por cable y de trazado rectilíneo. Las vigas del tablero son del tipo prefabricado, con lo que se han conseguido notorias ventajas. Se tuvo muy en cuenta la corrosión para el estudio de cables. En el cálculo resistente de las vigas fue objeto de consideración la teoría en piezas prismáticas y su posible validez en este caso particular. Para mayor seguridad se preparó un modelo reducido. Los resultados obtenidos en los ensayos mostraron que, tanto con la teoría de piezas prismáticas como admitiendo la estructura como placa plegada, el análisis teórico no difirió más del 10 por 100 de los resultados experimentales. El segundo problema consistió en la posibilidad de aplicar la teoría de transmisión de empujes o de reacciones en las zonas de fuerzas concentradas, en las que las teorías de viga o placa de diferencia relativa resultaba de consideración. Para el caso de rotura se estudiaron distintas

Potencial del Agua del suelo

Directory of Open Access Journals (Sweden)

Bustamante Heliodoro

1986-12-01

Full Text Available La energía potencial del agua presenta diferencias de un punto del suelo a otro; esas diferencias son las que originan el movimiento del agua de acuerdo a la tendencia universal de la materia en el sentido de moverse de donde la energía potencial es mayor a donde dicha energía es menor. En el suelo el agua en consecuencia se mueve hacia donde su energía decrece hasta lograr su estado de equilibrio. Se desprende entonces que la cantidad de energía potencial absoluta contenida en el agua, no es importante por sí misma, sino por su relación con la energía en diferentes lugares dentro del suelo. El concepto Potencial de agua del suelo es un criterio para esta energía.

Efecto del silicio y plaguicidas en la fertilidad del suelo y rendimiento del arroz

OpenAIRE

Furcal-Beriguete, Parménides; Herrera-Barrantes, Alejandra

2013-01-01

Efecto del silicio y plaguicidas en la fertilidad del suelo y rendimiento del arroz. El objetivo de este trabajo fue evaluar el efecto del silicio en la fertilidad del suelo, la incidencia de enfermedades y plagas insectiles, el rendimiento y la calidad de granos del cultivo de arroz. El estudio se realizó en La Vega, Florencia, San Carlos, Costa Rica entre mayo y octubre en los años 2010 y 2011, en el mismo lote con la variedad CR 4477. Se establecieron cinco tratamientos: silicio al suelo, ...

Infusion sclerotherapy of microcystic lymphatic malformation: Clinico-radiological mid-term results

Energy Technology Data Exchange (ETDEWEB)

Lee, Jong Min; Lee, Seok Jong; Chung, Ho Yun; Huh, Seung; Kim, Hyung Kee [Dept. of urgery, Kyungpook National University Hospital, Daegu (Korea, Republic of)

2016-01-15

A new sclerotherapy technique by slow mechanical infusion of sclerosant was validated for treatment of microcystic lymphatic malformation (mLM). Seventeen consecutive patients with mLM in extremities, cervicofacial area, and trunk were included (21.8 ± 21.5 years old, male:female = 5:12). All patients diagnosed as mLM were included. A total 4-32 mL 20-38% OK-432 solution was mechanically infused at the rate of 10 mL/hour into the mLM lesions. The treatment effect was estimated clinic-radiologically at the 4-month follow-up. Repeated sclerotherapy followed in the 6th month, if required. The therapeutic effect was evaluated using quantitative ultrasonographic examination including soft tissue thickness, cyst size and number. In 17 patients, total 31 infusion sclerotherapy sessions were performed and monitored for 425 ± 266 days. Fifteen patients (88%) showed improvement in all symptoms, signs, and ultrasonographic findings. In all cases, at least one finding presented improvement. The maximal number of cysts per ultrasonographic window and maximal diameter of the largest cyst decreased by 57 ± 57% and 51 ± 67%, respectively (p = 0.102, 0.004). The soft tissue thickness decreased by 18 ± 15% (p < 0.01). No significant complications such as distal lymphedema or skin necrosis occurred. Infusion sclerotherapy is a safe and effective treatment technique for microcystic LM, with improved outcome.

The Scattering Law for Room Temperature Light Water; Loi de diffusion dans l'eau legere a la temperature ambiante; Zakon rasseyaniya nejtronov legkoj vodoj komnatnoj temperatury; Ley de dispersion del agua ligera a temperatura ambiente

Energy Technology Data Exchange (ETDEWEB)

Kottwitz, D A; Leonard, Jr, B R [Hanford Laboratories, General Electric Company, Richland, WA (United States)

1963-01-15

par le plus bas niveau de vibrations moleculaires, qui se trouve dans le voisinage de {beta} = 8. Dans cette region, la distribution p({beta}) mesuree comporte un domaine a pente douce, ce qui indique que le pic de vibrations a ete efface a cause de la resolution large des instruments. L'integrale de normalisation de la distribution p({beta}) mesuree est plus elevee que sa valeur theorique. (author) [Spanish] Los autores han utilizado el espectrometro de cristal triaxial de Hanford para determinar la ley de dispersion de Egelstaff en el caso del agua ligera a 22{sup o}C, con variacion del vector de onda neuttonica hasta 14A{sup -1} y transferencias de energia del orden de 0,05 a 0,25 eV. Los valores de la energfa neuttonica inicial fueron 0,15, 0,20, 0,30 y 0,40 eV, y los angulos de dispersion variaron de 4{sup o} a 72{sup o}. La dispersion por una muestra de vanadio a 77{sup o}K (25{sup o}C) ha servido para determinar el poder de resolucion del espectrometro y las funciones de rendimiento. La ley de dispersion S({alpha},{beta}) y la distribucion de frecuencia generalizada p({beta}) derivada de la misma concuerdan esencialmente en la region de superposicion con los resultados obtenidos por Haywood y Thorson en Chalk River. La funcion p({beta}) se ha ampliado hasta {beta} {approx} 10 a fin de incluir la region ocupada por los niveles de vibracion molecular mues bajos, en las proximidades de {beta} = 8. En este intervalo, la distribucion p({beta}) medida presenta un rellano de pendiente poco acusada que indica que los picos de vibracion han sido difuminados por el escaso poder de resolucion del instrumento. La integral de normalizacion de los valores medidos de p({beta}) es superior a su valor teorico.

Determinantes del trabajo infantil y la escolaridad: el caso del Valle del Cauca en Colombia

Directory of Open Access Journals (Sweden)

Sebastián Urueña Abadía

2009-10-01

Full Text Available Colombia, al igual que la mayoría de países latinoamericanos, consciente de las repercusiones sociales y económicas negativas del trabajo infantil, se ha comprometido en la lucha por la erradicación de este fenómeno. Prueba de ello es la ratificación por parte del gobierno colombiano en el año 2007, del Convenio 182 de la OIT sobre la Prohibición de las Peores Formas de Trabajo Infantil y la Acción Inmediata para su Eliminación. En el plano regional, como parte del Plan de Desarrollo del Departamento del Valle del Cauca 2008-2011, se está implementando actualmente una estrategia territorial de erradicación del trabajo infantil en sus 42 municipios. Considerando este panorama, este trabajo indaga cuáles son los determinantes del trabajo infantil y la escolaridad en el departamento del Valle a partir de los datos de la Encuesta Nacional de Calidad de Vida del año 2003. Para el análisis se emplea un modelo econométrico Probit Bivariado, que permite el estudio conjunto e interrelacionado de decisiones diferentes, en este caso la asistencia escolar y el trabajo.

La superación del modelo del ángel del hogar:

OpenAIRE

Hurtado Muñoz, Mónica

2013-01-01

La Tesis Doctoral titulada "La superación del modelo del "ángel del hogar". Recuperación de la escritora Leonor Canalejas y Fustegueras (1869-1945)" aborda, en primer lugar, un análisis sociológico de las circunstancias que rodearon a la mujer española en el cambio de siglo en el ámbito social y educativo, en un intento de esclarecer las características propias del contexto en el que la mujer accede a la intelectualidad en general y a la literatura en particular. Esta parte concluye que la cr...

Culturas del Mundo

DEFF Research Database (Denmark)

Benwell, Ann Fenger; Costa, Alberto; Waehle, Espen

2006-01-01

’Culturas del mundo. Colecciones del Museo Nacional de Dinamarca’ with Ann Fenger Benwell in Culturas del Mundo. Colecciones del Museo Nacional de Dinamarca, ed. Silvia Sauquet, Fundación "la Caixa", Barcelona 2006, pp. 31-39......’Culturas del mundo. Colecciones del Museo Nacional de Dinamarca’ with Ann Fenger Benwell in Culturas del Mundo. Colecciones del Museo Nacional de Dinamarca, ed. Silvia Sauquet, Fundación "la Caixa", Barcelona 2006, pp. 31-39...

MODELACIÓN HIDROLÓGICA DEL HUMEDAL DE JABOQUE – BOGOTÁ, D.C. (COLOMBIA

Directory of Open Access Journals (Sweden)

Beltrán Julio

2013-07-01

Full Text Available Se propone un modelo de simulación dinámico para explicar los procesos hidrológicosdel humedal Jaboque – Bogotá D.C., Colombia, en tres secciones con característicasfísicas y químicas particulares. El modelo incluye los caudales de entrada y salidade agua para cada una de las secciones del humedal. La modelación dinámica sebasó en ecuaciones diferenciales. Se utilizó el método Euler de integración con elprograma computacional Stella 9.1®. El comportamiento hidrológico del humedaltiene una alta dependencia de los aportes de la cuenca aferente que a su vez obedecenfundamentalmente a las condiciones climáticas de la cuenca. En el año 1992 (añoNiño la precipitación fue 432.7 mm/año con una descarga de agua estimada de lacuenca aferente de 905 225 m3/año, siendo el valor más bajo en los últimos 39 años.En el 2010 (año Niña la precipitación anual fue de 1251.3. mm, con una descargade la cuenca aferente de 2 471 634 m3/año, que corresponde al dato más alto para elmismo periodo. La comparación entre los caudales de entrada y salida del humedalJaboque muestran una diferencia bruta de 82 165 m3/mes para un total anual de 985980 m3/año. El tiempo hidráulico de retención modelado (THR se estimó en quincepara la primera sección, 36 y 42 días para la segunda y tercera sección. El promedioen el humedal fue de 93 días/año. El análisis de sensibilidad mostró que entre loslimites de 800 mm/año y 900 mm/año, valores entre los cuales oscila el promediomultianual de la precipitación, el comportamiento del THR es de 13 a 15 días/año enla primera sección, en la segunda de 32 a 36 días/año y la tercera de 38 a 43 días. Secorrobora así la relación que existe entre la precipitación y los factores morfométricosdel humedal.

抽动障碍患儿432例血铅水平对脑电图活动的影响%Influence of Blood Lead Level on Electrical Activity of Brain in 432 Children with Tic Disorder

Institute of Scientific and Technical Information of China (English)

田广燕; 梁向荣; 高在芬; 刘勇

2011-01-01

目的 探讨抽动障碍患儿血铅水平变化对脑电活动的影响及其发病机制的研究,对比不同血铅水平患儿脑电图变化的特点.方法 对本院2005年1月- 2011年4月临床确诊的432例抽动障碍患儿进行血铅水平及脑电图检测.采用原子吸收光谱分析法测定其血铅水平,并进行t检验.将432例抽动障碍患儿分为3组,Ⅰ组:血铅水平＜50μg·L-1；Ⅱ组:血铅水平50 ～ 100μg·L-1；Ⅲ组:血铅水平＞ 100 μg·L-1.结果 1.Ⅰ组患儿脑电图异常发生率为7.14％(2/28例),Ⅱ组患儿脑电图异常发生率为14.23％(40/281例),Ⅲ组患儿脑电图异常发生率为46.34％(57/123例).Ⅰ组与Ⅱ组脑电图异常发生率比较差异无统计学意义(P＞0.05),Ⅰ组与Ⅲ组脑电图异常发生率比较差异有统计学意义(P＜0.01),Ⅱ组与Ⅲ组脑电图异常发生率比较差异有统计学意义(P＜0.01).2.除年龄≤4岁患儿外,脑电图异常患儿较脑电图正常患儿血铅水平明显升高(P＜0.01,0.05).结论 血铅水平升高会加重抽动障碍患儿的脑功能损伤.及早进行驱铅治疗可能对抽动障碍患儿脑功能损伤的恢复有重要意义.%Objective To study the influence and pathogenesis of blood lead level on electrical activity of brain in children with tic disorder, and to research the characteristics of electroencephalogram (EEG) in children with different concentrations of blood lead. Methods The level of blood lead and EEG were assessed in 432 children with tic disorder from Jan. 2005 to Apr. 2011. The level of blood lead were examined by atomic absorption spectrophotometry method. Statistical analysis were performed by t - test. According to the blood lead level, the children were divided into 3 groups, group Ⅰ :blood lead 100 μg · L-1. Results 1. The EEG abnormal statistics results showed abnormal rate in group Ⅰ ,group Ⅱ and group Ⅲ were 7. 14% (2/28 cases) , 14.23% (40/ 281 cases) and 46. 34% (57/123 cases

[An intractable gastric cancer showing an extremely effective response to immunochemotherapy].

Science.gov (United States)

Takashima, S; Komaki, H; Yokota, H; Kiriyama, M; Kinami, Y

1988-07-01

Reported herein is the case of a terminal patient with advanced gastric cancer who was shown an extremely effective response to immunochemotherapy. The patient, a 62-year-old female, was determined as having a gastric cancer, Borr. type 2, originating in the pyloric antrum. The tumor was found to be H3P3S2N2 (stage IV), and its histology revealed a mucus-producing papillary adeno-carcinoma, ss gamma, n(+), ly2, and V1. Thus the patient underwent a distal gastrectomy, and was given an operative administration of MMC, followed by postoperative immunochemotherapy with FT 207 and OK 432. Consequently, no ascites were noticed throughout the recuperative course, and repeated CT scannings of the hepatic metastatic lesions, revealed a remarkable regression. Two years after this operation, she resumed normal daily life. Further, her preoperatively elevated tumor markers have returned to normal.

Mucosal melanoma of the head and neck. A treatment result of 25 cases

International Nuclear Information System (INIS)

Asakura, Kohji; Kataura, Akikatsu; Harabuchi, Yasuaki; Himi, Tetsuo; Hamamoto, Makoto; Hareyama, Masato; Sakata, Kouichi

2001-01-01

A retrospective review of 25 primary patients with head and neck mucosal melanoma, treated at Sapporo Medical University from 1970 to 1996, was performed. The disease-specific 5-year cumulative survival rate was 37.2% for all the cases, and 39.6% for cases with nasal cavity melanoma. The patients with tumors confined within one anatomical site showed a better prognosis than those with more advanced tumors. In relation to the treatment methods, the 5-year survival rate was 75% in the patients that received pre-operative radiotherapy, and 100% in those that received an adjuvant immunotherapy of daily intratumorous injections of OK432 during radiotherapy. The patients with poor prognoses tended to show a high incidence of residual tumors and earlier local recurrences than those with good prognoses. No recurrences have been noted in the long-term survivors that received adjuvant immunotherapy during radiotherapy. (author)

Determinación del requerimiento hídrico del pimentón en el municipio de Candelaria, departamento del Valle del Cauca

Directory of Open Access Journals (Sweden)

Estrada Salazar Edgar Iván

2010-12-01

Full Text Available Se realizó un ensayo con el fin de determinar el requerimiento hídrico del pimentón Capsicum annuum variedad Unapal-Serrano, en la zona de Candelaria-Valle del Cauca (Colombia. Se determinó que el pimentón requiere 425mm de agua durante su ciclo vegetativo, obteniendo una eficiencia del uso del agua de 5.32 kg/m3 de fruto fresco y de 0.5 kg/m3 en términos de materia seca. Además, se comprobó la eficiencia del microevaporímetro "MIEVHR" como herramienta para programación del riego y estudios hidrológicos.

Las fluctuaciones del nivel del mar durante el Cuaternario

OpenAIRE

Pousa, Jorge Lorenzo; Isla, Federico Ignacio; Schnack, Enrique Jorge

2002-01-01

Los cambios del nivel del mar han ejercido una fuerte influencia en la evolución del planeta y en la historia de la humanidad. En una escala de tiempo geológico, las variaciones de los niveles oceánicos han dejado un registro ampliamente distribuido en la forma de depósitos sedimentarios. El descenso del nivel del mar durante la Ultima Glaciación, que alcanzó unos 120 metros hace 18.000 años, permitió la emergencia del estrecho de Bering y la migración humana desde Eurasia hacia América. Se e...

EFECTO DEL SILICIO Y PLAGUICIDAS EN LA FERTILIDAD DEL SUELO Y RENDIMIENTO DEL ARROZ

Directory of Open Access Journals (Sweden)

Parm\\u00E9nides Furcal-Beriguete

2013-01-01

Full Text Available El objetivo de este trabajo fue evaluar el efecto del silicio en la fertilidad del suelo, la incidencia de enfermedades y plagas insectiles, el rendimiento y la calidad de granos del cultivo de arroz. El estudio se realizó en La Vega, Florencia, San Carlos, Costa Rica entre mayo y octubre en los años 2010 y 2011, en el mismo lote con la variedad CR 4477. Se establecieron cinco tratamientos: silicio al suelo, silicio al suelo más plaguicidas (alternativas químicas, silicio foliar, silicio foliar más plaguicidas y testigo comercial. Como fuente se utilizaron si- licio en polvo al 70% de SiO2, aplicado quince días antes de siembra en dosis de 100 kg SiO2/ha, y líquido concentrado 40% SiO2 y 36% MgO, aplicado al follaje en dosis de 4 l/ha a los 17 y 30 días después de la siembra. El suelo del orden inceptisol de formación aluvial, al inicio del experimento tenía pH 4,9, valores de P y Si disponibles de 29 ppm y 44,7 ppm, respectivamente, acidez intercambiable 1,2 cmol(+/l y suma de bases 19,11 cmol(+/l. No hubo diferencia estadística significativa del silicio en la fertilidad del suelo, la incidencia de plagas y enfermedades, y en la calidad molinera; sin embargo, la combinación del silicio aplicado al suelo y el uso de plaguicidas incrementaron el contenido de zinc y cobre en el suelo, y del zinc y magnesio en las hojas de arroz, pero este efecto no se tradujo en rendimiento y calidad de granos. La aplicación de plaguicidas influyó positivamente en el peso y rendimiento del arroz en granza (p≤0,05.

Catàleg dels Miridae (Heteroptera) del Massís del Garraf

OpenAIRE

Goula Goula, Marta

1989-01-01

Per a la redacció d'aquest catàleg, s'aporten dades d'observació pròpia al llarg dels anys 1980-1984, així com les troballes publicades per CUNI (1889a,1889b,1889c,1891) i per RIBES (1978a,1978b,1980,1984). Totes aquestes observacions s'han fet en localitats del Massis del Garraf, que será objecte d'una curta descripció.

La Orden de Medidas Provisionales del Tribunal Internacional del Derecho del Mar en el caso del buque de guerra ARA Libertad

Directory of Open Access Journals (Sweden)

Martin Cabrera Mirassou

2013-06-01

Full Text Available El presente comentario tiene por finalidad describir la reciente orden de medidas provisionales emitida por el Tribunal Internacional del Derecho del Mar en el caso relativo a la detención de la Fragata ARA Libertad. La controversia contiene un complejo trasfondo político, económico y jurídico, en el cual se destaca el alcance de la inmunidad de los buques de guerra, el funcionamiento del sistema de solución de controversias de la Convención de Naciones Unidas sobre Derecho del Mar y, en particular, la competencia del Tribunal. Con la finalidad de lograr un entendimiento más profundo de su jurisprudencia se abordan los principales aspectos que permitan comprender el valor de la decisión para los actores del régimen de los océanos.

Funciones del estilo personal del terapeuta en profesionales del campo de las adicciones

Directory of Open Access Journals (Sweden)

Leandro Casari

2017-01-01

Full Text Available Objetivo. Comparar el estilo personal del terapeuta entre dos grupos de profesionales, uno dedicado a la atención de pacientes drogodependientes (grupo adicciones y otro a la atención clínica en general (grupo clínico. Método. La muestra estuvo formada por 100 psicoterapeutas que trabajan en instituciones públicas y privadas de tres provincias del interior de Argentina, pareados por las variables socioprofesionales (sexo, edad, años de experiencia profesional, enfoque teórico, grupo etario de trabajo, tipo de abordaje predominante, duración del tratamiento y grado de especialización. El instrumento empleado fue el Cuestionario de Estilo Personal del Terapeuta. Resultados. Para el análisis de datos se emplearon pruebas de comparación de medias y se analizó su tamaño del efecto. Se obtuvieron diferencias signifi cativas en la función expresiva: grupo clínico (M = 40.36 y grupo adicciones (M = 29.86; así como también en la función instruccional: grupo clínico (M = 28.01 y grupo adicciones (M = 32.67. Esto indica una mayor distancia emocional y un incremento en la rigidez del encuadre terapéutico en los terapeutas de pacientes adictos. Conclusión. Se discuten estos resultados en función de postulados previos que señalan la complejidad del vínculo terapéutico y el énfasis en las características del encuadre terapéutico, tal como la puesta de límites.

Calidad del servicio de taxis del municipio Maracaibo

Directory of Open Access Journals (Sweden)

Joheni A. Urdaneta G.

2011-05-01

Full Text Available El presente trabajo tiene como objetivo describir la calidad del servicio de los taxis en el municipio Maracaibo, ya que los mismos forman parte del sistema de transporte urbano de la ciudad, y es un servicio público fundamental para la convivencia de la sociedad; para lograr este objetivo se realizó una adaptación del modelo SERVPERF, diseñando un instrumento tipo cuestionario, con 32 ítems en 6 dimensiones, adecuado a las características propias del servicio de taxi, con la finalidad de confirmar que los ítems de los instrumentos se correspondían con las dimensiones adaptadas se aplicó la técnica de análisis factorial resultando un nuevo instrumento con 24 ítems en 3 dimensiones. Se utilizó la escala de Likert con tres (3 alternativas de respuesta. La investigación es de tipo descriptiva y aplicada, bajo diseño no experimental de tipo transeccional descriptiva y de campo. La población quedó conformada por los usuarios de las líneas de taxis del municipio Maracaibo. Se aplicó muestreo aleatorio por conglomerado. La confiabilidad del instrumento se midió a través del coeficiente alfa de Cronbach resultando de 0,82 lo cual se considera aceptable. Los resultados revelan que la calidad del servicio de taxis del municipio Maracaibo es mediana por lo tanto este servicio es susceptible a mejoras, las cuales son necesarias para elevar la calidad de vida de los marabinos. Este resultado se obtuvo con el instrumento originalmente adaptado de 32 ítems y con el cuestionario resultante del análisis factorial, de 24 ítems; esto confirma lo apropiado de esta técnica, ya que se redujo el número de ítems y de las dimensiones originalmente adaptadas y no se encontraron diferencias significativas en los resultados con ambos instrumentos; de esta manera se puede medir la calidad del servicio de taxis en el municipio Maracaibo a través de las dimensiones: confiabilidad del servicio, socialización y responsabilidad.

En busca del concepto de gerencia del cuidado

Directory of Open Access Journals (Sweden)

Ligia Teresa Mora-Delgado

2005-12-01

Full Text Available Este articulo, presenta los conceptos de gerencia del cuidado de enfermería, desarrollado por las enfermeras profesionales que laboran en le Empresa social del estado Hospital Universitario Erasmo Meoz de las Ciudad de Cúcuta, desde su desempeño en la asistencia, administración y docencia. Se pretende además precisar los elementos gerenciales, sociales, humanísticos y éticos que deben hacer parte del concepto de gerencia del cuidado.

Ruptura del projecte parental i disposició dels preembrions

OpenAIRE

Farnós Amorós, Esther

2010-01-01

La tesi doctoral "Ruptura del projecte parental i disposició dels preembrions" analitza els efectes del consentiment a les tècniques de reproducció assistida prestat en el marc d'un projecte parental. La tesi ofereix una resposta als conflictes que enfronten exesposos o exconvivents en relació al destí dels preembrions sobrants d'un cicle de fecundació "in vitro" iniciat durant la relació. Aquests conflictes constitueixen un grup de casos al voltant del qual no hi ha solucions legislatives qu...

Oriental medicine Kyung-Ok-Ko prevents and alleviates dehydroepiandrosterone-induced polycystic ovarian syndrome in rats.

Directory of Open Access Journals (Sweden)

Minhee Jang

Full Text Available Kyung-Ok-Ko (KOK, a traditional herbal prescription composed of Rehmannia glutinosa Liboschitz var. purpurae, Lycium chinense, Aquillaria agallocha, Poria cocos, Panax ginseng, and honey, has been widely used in traditional Oriental medicine as a vitalizing medicine or as the prescription for patients with age-associated disorders such as amnesia and stroke. However, the potential protective value of KOK for the treatment of polycystic ovarian syndrome (PCOS is largely unknown. We investigated whether pre-administration (daily from 2 hours before PCOS induction and post-administration (daily after induction of PCOS of KOK (0.5, 1.0, and 2.0 g/kg/day, p.o. could have a protective effect in a dehydroepiandrosterone (DHEA, s.c.-induced PCOS rat model. Pre-administration of KOK significantly decreased the elevated body weight and ovary weight, elevated size and number of follicular cysts, elevated level of serum glucose, and estradiol after DHEA injection. KOK reduced the elevated percentage of CD8 (+ T lymphocytes in lymph nodes, the elevated mRNA expression of CD11b and CD3 in ovaries, and infiltration of macrophages in ovarian tissue with PCOS. KOK diminished the increased mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, chemokines (IL-8, MCP-1, and iNOS in the ovaries, and increased the reduced mRNA expression of growth factors (EGF, TGF-β by DHEA injection. Post-administration of KOK also improved the DHEA-induced PCOS-like symptoms, generally similar to those evident from pre-administration of KOK. KOK may effectively prevent and improve DHEA-induced PCOS via anti-inflammatory action, indicating its preventive and therapeutic potential for suppressing PCOS.

Determinantes del ingreso y del gasto corriente de los hogares

OpenAIRE

Muñoz C., Manuel

2004-01-01

Este ensayo de investigación empírica analiza los determinantes del ingreso y del gasto en los hogares colombianos. Utilizando un modelo del ciclo de vida con datos de la encuesta de hogares de 1994 y 1995, muestra que el comportamiento del ingreso está afectado principalmente por las características demográficas del hogar y los rasgos socio ocupacionales de sus miembros. El comportamiento del gasto está determinado ante todo por el ingreso y, en menor medida, por las características sociales...

Gestión del riesgo del cambio (segunda parte)

OpenAIRE

Zorrilla Salgador, Juan Pablo

2004-01-01

Segunda parte del artículo acerca del uso de futuros sobre el tipo de cambio. Esta continuación abarca estrategias, definiciones, metodología y explicaciones sobre todo lo relacionado con el Ratio de cobertura de los futuros y la aparición del riesgo base.Segunda parte del artículo acerca del uso de futuros sobre el tipo de cambio. Esta continuación abarca estrategias, definiciones, metodología y explicaciones sobre todo lo relacionado con el Ratio de cobertura de los futuros y la aparición d...

HACIA UNA CONCEPTUALIZACIÓN DEL LEGADO DEL TRADUCTOR

Directory of Open Access Journals (Sweden)

María Constanza Guzmán

2009-06-01

Full Text Available Este artículo se propone investigar el aporte de perspectivas traductológicas para el estudio de la figura del traductor y su legado. Se centra en enfoques teóricos contemporáneos, principalmente aquellos basados en perspectivas postestructuralistas, que consideran el papel del sujeto traductor como un aspecto crucial en la traducción y los estudios literarios, y proponen maneras interesantes de abordarlo. A lo largo del artículo se cuestionan nociones como la idea de un original sacralizado, la relación entre autoría y propiedad, el ideal del significado transparente, y la tensión entre la traducción y la escritura del "original". Se presta especial atención a la importancia de ubicar históricamente la práctica del traductor, reconocer su papel como agente visible, y conceptualizar la traducción como una forma de escritura que se desarrolla en medio de complejas interacciones y negociaciones.

HACIA UNA CONCEPTUALIZACIÓN DEL LEGADO DEL TRADUCTOR

Directory of Open Access Journals (Sweden)

María Constanza Guzmán

2009-01-01

Full Text Available Este artículo se propone investigar el aporte de perspectivas traductológicas para el estudio de la figura del traductor y su legado. Se centra en enfoques teóricos contemporáneos, principalmente aquellos basados en perspectivas postestructuralistas, que consideran el papel del sujeto traductor como un aspecto crucial en la traducción y los estudios literarios, y proponen maneras interesantes de abordarlo. A lo largo del artículo se cuestionan nociones como la idea de un original sacralizado, la relación entre autoría y propiedad, el ideal del significado transparente, y la tensión entre la traducción y la escritura del "original". Se presta especial atención a la importancia de ubicar históricamente la práctica del traductor, reconocer su papel como agente visible, y conceptualizar la traducción como una forma de escritura que se desarrolla en medio de complejas interacciones y negociaciones.

Behaviour of semiconductor nuclear-particle detectors; Comportement des semi-conducteurs comme detecteurs de particules nucleaires; Povedenie detektorov yadernykh chastits na poluprovodnikakh; Propiedades de los detectores de particulas nucleares a base de semiconductores

Energy Technology Data Exchange (ETDEWEB)

Walter, F J; Dabbs, J W.T.; Roberts, L D [Oak Ridge National Laboratory, Oak Ridge, TN (United States)

1962-04-15

jouer un role important. Les auteurs presentent une description quantitative de l'effet des parametres des detecteurs et des amplificateurs sur les formes et les temps de montee des impulsions. Ils etudient les avantages et les defauts des detecteurs a barriere de surface utilises dans des experiences d'alignement nucleaire a basse temperature invariable. Ces experiences comprennent l'etude des distributions angulaires des fragments de fission et de la resolution - stable a long terme - des structures fines des particules alpha. On decrit egalement les techniques de fabrication, selon des coefficients de developpement adaptes, qui ont ete utilisees avec succes pour realiser des detecteurs de surface active pouvant aller jusqu'a 8 cm{sup 2}. (author) [Spanish] Los autores han realizado estudios experimentales y teoricos del comportamiento de los detectores de particulas nucleares a base de semiconductores, en el intervalo de temperaturas de 0,2{sup o}K a 300{sup o}K. Presentan un modelo teorico muy sencillo para las caracteristicas del detector, que describe las propiedades observadas experimentalmente para un amplio margen de parametros. Discuten la importancia de la pureza del semiconductor y de la tension de polarizacion en relacion con la amplitud'del impulso, con su tiempo de elevacion y con el area del detector. Los estudios empiricos del ruido y de la resolucion energetica indican que, en el caso de particulas alfa, las menores anchuras observadas en los maximos son sensiblemente mayores de lo que cabe esperar del ruido del detector y del amplificador. Para un detector de silicio de barrera superficial, de 40 mm{sup 2}, han encontrado para el ruido a 77{sup o}K valores {<=} 3 keV (anchura total al semimaximo). Los detectores basados en semiconductores dan un para los fragmentos de fision. Existen pruebas de que dicho defecto no se debe a una . Si los responsables del defecto fueran campos electricos incapaces de

AÇIK VE UZAKTAN EĞİTİM SİSTEMİ SEÇİMİ İÇİN ÇOK ÖLÇÜTLÜ BİR KARAR VERME YAKLAŞIMININ KULLANILMASI

Directory of Open Access Journals (Sweden)

Zehra KAMIŞLI ÖZTÜRK

2014-02-01

Full Text Available Bugün, dünya çapında çeşitli açık ve uzaktan eğitim (ODL sistemleri bulunmaktadır. Bu noktada, yaşam boyu öğrenme kapsamında kariyer yolundaki yeteneklerini geliştirmek isteyen bir öğrenen için bir ODL programını nasıl seçeceği önemli bir soru haline gelmektedir. Bu ise birbirine bağlı ölçütlerden oluşan karmaşık bir karar problemidir. Analitik Serim Süreci (ANP , bu bağlılıkları ele alan çok ölçütlü bir karar verme yöntemidir. ANP’deki serimler en iyi kararı vermek için hem nitel hem de nicel tüm faktör ve ölçütleri içermektedir. Bu çalışmada, ODL sistemlerini etkileyen ölçütleri araştırmak ve önceliklendirmek ile öğrenenlere bir ODL programı seçiminde yardımcı olmak amacıyla bir ANP modeli kurulmuştur. Çalışma sonucunda, lisans programları en çok tercih edilen ODL programı olmuştur. Ayrıca önerilen ANP modeli, her bir program türünün yürütülmesi için hangi ölçüt ve/veya ölçütlere dikkat edilmesi konusunda da uzaktan eğitim kurumlarına yardımcı olacaktır. Bu nedenle bu çalışma, ODL politikası geliştirme açısından da kurumlara destek verecektir.

Effect of a Traditional Herbal Prescription, Kyung-Ok-Ko, on Male Mouse Spermatogenic Ability after Heat-Induced Damage

Directory of Open Access Journals (Sweden)

Deok-Sang Hwang

2015-01-01

Full Text Available Kyung-Ok-Ko (KOK, a well-known traditional Korean medicinal formula, has long been used to invigorate the essential qi. This use of KOK may be associated with reproductive ability as a more modern concept. The protective effect of KOK was evaluated against deterioration of testicular function induced by heat exposure in male mice. Male fertility was disrupted by scrotal heat stress at 43°C for 5 weeks. KOK (0.25, 0.50, and 2.00 g/kg/day was administered orally at 3 h after the stress. To evaluate the protective effect of KOK, body weight, testicular weight, sperm count, sperm motility, and histopathological changes in the testes were evaluated. KOK-treated mice significantly recovered their general health, as evidenced by body weight. KOK-treated mice also showed significantly higher testes weights, sperm counts, and sperm motility than did the heat stress group. KOK-treated mice significantly recovered the morphological appearance of the seminiferous tubules and seminiferous epithelium. Furthermore, KOK-treated mice significantly increased antioxidant enzyme activities and reduced the protein expressions of apoptosis in the testes. KOK significantly protects against heat-induced damage to testicular function in male mice by inhibiting oxidative stress and apoptosis, indicating that KOK may be an effective agent for treatment of heat-induced male infertility.

Componente Cultura del Agua del PMGRH: plan de trabajo

OpenAIRE

Autoridad Nacional del Agua; Proyecto de Modernización de la Gestión de Recursos Hídricos

2012-01-01

Describe el plan de trabajo del Componente Cultura del Agua del Proyecto de Modernización de la Gestión de Recursos Hídricos (PMGRH) en relacion a dos aspectos estructurales del proyecto: 1. Mejora de la capacidad de la Gestión Integrada de Recursos Hídricos (GIRH) a nivel nacional y 2. Fortalecimiento de las capacidades de GIRH en las cuencas.

Response of the rare biosphere to environmental stressors in a highly diverse ecosystem (Zodletone spring, OK, USA).

Science.gov (United States)

Coveley, Suzanne; Elshahed, Mostafa S; Youssef, Noha H

2015-01-01

Within highly diverse ecosystems, the majority of bacterial taxa are present in low abundance as members of the rare biosphere. The rationale for the occurrence and maintenance of the rare biosphere, and the putative ecological role(s) and dynamics of its members within a specific ecosystem is currently debated. We hypothesized that in highly diverse ecosystems, a fraction of the rare biosphere acts as a backup system that readily responds to environmental disturbances. We tested this hypothesis by subjecting sediments from Zodletone spring, a sulfide- and sulfur-rich spring in Southwestern OK, to incremental levels of salinity (1, 2, 3, 4, and 10% NaCl), or temperature (28°, 30°, 32°, and 70 °C), and traced the trajectories of rare members of the community in response to these manipulations using 16S rRNA gene analysis. Our results indicate that multiple rare bacterial taxa are promoted from rare to abundant members of the community following such manipulations and that, in general, the magnitude of such recruitment is directly proportional to the severity of the applied manipulation. Rare members that are phylogenetically distinct from abundant taxa in the original sample (unique rare biosphere) played a more important role in the microbial community response to environmental disturbances, compared to rare members that are phylogenetically similar to abundant taxa in the original sample (non-unique rare biosphere). The results emphasize the dynamic nature of the rare biosphere, and highlight its complexity and non-monolithic nature.

You're OK, I'm OK

Science.gov (United States)

Kelleher, Joanne

2016-01-01

The author looks through Albert Bandura's self-efficacy lens onto the effects it likely has on school principals' effectiveness. Self-efficacy should be viewed as a principal's belief in his or her capabilities to structure a particular course of action in order to produce desired outcomes. Principal self-efficacy has been linked with effective…

Determinantes del ingreso y del gasto corriente de los hogares

Directory of Open Access Journals (Sweden)

Muñoz C., Manuel

2004-06-01

Full Text Available Este ensayo de investigación empírica analiza los determinantes del ingreso y del gasto en los hogares colombianos. Utilizando un modelo del ciclo de vida con datos de la encuesta de hogares de 1994 y 1995, muestra que el comportamiento del ingreso está afectado principalmente por las características demográficas del hogar y los rasgos socio ocupacionales de sus miembros. El comportamiento del gasto está determinado ante todo por el ingreso y, en menor medida, por las características sociales del hogar y el gasto de otros hogares con características similares. También examina la influencia de la incertidumbre acerca de los ingresos en el gasto de los hogares para comprobar si estos actúan con motivos de precaución.

Análisis del "Curso sobre la Evolución del Pensamiento Juslaboralista" del Profesor Emérito Héctor-Hugo Barbagelata (El espejo retrovisor del Derecho del Trabajo y los Principios del Dr. H. H. Barbagelata

Directory of Open Access Journals (Sweden)

Helios Sarthou

2014-01-01

Full Text Available Los que sabíamos que el profesor Emérito de “Derecho del Trabajo y de la Seguridad Social" Dr. Hector Hugo Barbagelata, tenía en preparación un libro sobre Evolución del pensamiento Juslaboralista –de algún modo en la senda del Curso que había fundado en nuestra Facultad de Derecho- lo considerábamos de altísima importancia, no sólo en el plano técnico-jurídico, sino también por las implicancias históricas, sociales y políticas que la temática implicaba.- Y esto es así en esta época, en que el pensamiento neoliberal no obstante el camino ya recorrido, continúa buscando incidir en el Derecho del Trabajo, recurriendo a excusas para el retorno al Derecho Civil, o para alcanzar la flexibilidad con mengua del respeto a los principios de tuitividad y justicia social que debe garantizar el Derecho del Trabajo o, en otros casos directamente promoviendo la irrelevancia técnica de la disciplina en beneficio del Derecho Civil o del Derecho Procesal, en su caso.-

Características del consumo y aporte de energía y nutrientes de una papilla a la dieta de niños de 6 a 36 meses de edad beneficiarios de un programa de complementación alimentaria

Directory of Open Access Journals (Sweden)

Carlos Rojas D

2004-07-01

Full Text Available Objetivo: Describir las características del consumo y aporte de energía y nutrientes de una papilla en la dieta de niños de 6 a 36 meses de edad beneficiarios de un Programa de Complementación Alimentaria. Materiales y Métodos: El diseño fue descriptivo y transversal. Se aplicó el método retrospectivo de recordatorio del consumo de alimentos de 24 horas. La muestra estuvo conformada por 432 niños beneficiarios del programa. Los requerimientos y recomendaciones de energía y nutrientes fueron determinados a partir de lo establecido por FAO/OMS/ONU para energía y proteínas, y por RDA para hierro y vitamina A. Resultados: El 42,1% de los beneficiarios de 6 a 11 meses cubrieron en promedio menos de 90% de sus requerimientos energéticos, esta proporción fue 47% entre los beneficiarios de 12 a 23 meses y 64,4% entre los beneficiarios de 24 a 36 meses. La brecha calórica fue directamente proporcional a la edad de los beneficiarios. La mediana del consumo de la papilla osciló entre 30 y 90 g en el grupo de 6 a 11 meses, 45 y 69 g en el grupo de 12 a 23 meses y de 34 a 90 g en el grupo de 24 a 36 meses. Conclusiones: Se evidenció que la papilla mejoró el aporte de energía, vitamina A y hierro en la dieta del niño, llegando a cubrir los requerimientos en la mayoría de los grupos etáreos.

RASGOS GEOGRÁFICOS DEL VALLE DEL RIO AGRIO INFERIOR.

Directory of Open Access Journals (Sweden)

Celia Torren

1993-12-01

Full Text Available El presente artículo es una síntesis del trabajo "Rasgos Geográficos del Valle del Río Agrio Inferior, el cual es un estudio de base para el conocimiento de la geografía de la región: - apoyando el esfuerzo que está realizando la población del área para lograr una identidad propia y una definitiva integración al contexto provincial; - aportando al proyecto "Rescate Arqueológico en Quili Malal, Neuquén" (subsidiado por CONICET y UNESCO, cuya dirección está a cargo de la profesora Susana Rodríguez de la U.N.C., a través de la confección del mapa geomorfológico del área; y - contribuyendo a los estudios que resultan necesarios ante la construcción de una obra hidroeléctrica de la magnitud de "El Chihuido I", emprendimiento que será llevado a cabo por Agua y Energía eléctrica de la Nación. Los límites del área estudiada fueron establecidos teniendo en cuenta el área del valle inferior del Río Agrio que será completamente inundada por el futuro embalse de la represa "El Chihuido I", a emplazarse 5,5 Km aguas abajo de la confluencia de los ríos Agrio y Neuquén. Además de esta área de afectación directa se tomó también una zona de perilago estrechamente vinculada a la anterior. De esta manera los límites este y oeste quedaron establecidos por la confluencia de los ríos antes mencionados y la localidad de Bajada del Agrio, respectivamente.

Memòries del santuari del Mont (final s. XVIII-1953)

OpenAIRE

Gifre i Ribas, Pere; Puig Pla, Santi; Tremoleda Trilla, Joaquim

2011-01-01

Transcripció del text inèdit de memòries del santuari del Mont. El text va ser escrit, bàsicament, pels preveres custodis i administradors del santuari. Es recull, primerament, els costums litúrgics de la parròquia de Sous, a la manera de les consuetes. A partir de 1791 s’anoten els fets més importants, a parer del custodi administrador, ocorreguts al santuari: obres de reforma i restauració del santuari i les seves dependències, adquisicions de mobiliari i parament de la casa, donacions al s...

Más allá del telar: el mundo del trabajo femenino en la Asturias del siglo XVIII

Directory of Open Access Journals (Sweden)

Patricia Suárez Álvarez

2011-06-01

Full Text Available En el Siglo de la Razón proliferaron los tratados dónde, por primera vez en la historia, se ponía de relieve la necesidad de educar de forma conveniente a las mujeres. Sin embargo, a pesar del reconocimiento que los Ilustrados otorgaron al sexo femenino, siguieron relegando a éstas a las paredes del hogar, exhortándoles a quedarse fuera del mundo del trabajo extra-doméstico, reservado sólo para los hombres de la familia. No obstante, la necesidad obligaba, y cuando los recursos u hombres de una casa escaseaban, la mujer tenía que salir a buscarse el sustento. Este es el caso de cientos de mujeres del Principado de Asturias, dónde, a mediados del siglo XVIII, la realidad femenina difería de lo que lo que se consideraba ideal. Este trabajo arrojará pues luz, en un campo hasta ahora desconocido: el del mundo profesional de las mujeres asturianas del Setecientos, dónde comprobaremos cómo en ocasiones llegaban a adquirir, gracias a su status profesional, papeles relevantes dentro de la sociedad.

Examen del fenómeno del turismo contemporáneo y la Competitividad en la Frontera del Conocimiento

Directory of Open Access Journals (Sweden)

Carlos Mario Amaya Molinar

2015-01-01

Full Text Available A partir del inicio del presente siglo, el estudio de la competitividad turística es un tema que ha llamado la atención tanto de académicos del área como de organizaciones públicas y privadas de diversas categorías, con la expectativa de que su comprensión permita a países y destinos turísticos obtener ventajas en captación de visitantes, ingresos y sostenibilidad de su operación turística, de cara a la intensa contienda internacional por la preferencia del turista. El presente trabajo se deriva de la discusión que tuvo lugar en el Panel Competitividad y Turismo, en el marco de la 5ª Cátedra Patrimonial en Turismo Sergio Molina-Estrategias del Turismo en la Frontera del Conocimiento, organizado por el Departamento de Ciencias Administrativas del Instituto de Ciencias Sociales y Administración de la Universidad Autónoma de Ciudad Juárez, efectuado en el mes de abril del año 2013. Para este fin, se analizaron un conjunto de trabajos académicos e institucionales, a fin de identificar sus marcos de referencia, definiciones y modelos teóricos, con la perspectiva de obtener una visión panorámica del estado del arte en la materia.

Fractura triple del complejo suspensorio del hombro

Directory of Open Access Journals (Sweden)

Eraclio Delgado Rifá

2015-06-01

Full Text Available El complejo suspensorio del hombro es una estructura sumamente importante, compuesta por un anillo de huesos y tejidos blandos. Las lesiones aisladas de este complejo anatómico son frecuentes y no afectan su estabilidad. La interrupción doble conduce a la inestabilidad de esta estructura y usualmente requiere tratamiento quirúrgico. La triple interrupción, por su parte, es sumamente rara y es encontrada en casos de trauma de alta energía a menudo en asociación con otras lesiones. Se presenta una triple lesión del complejo suspensorio del hombro en un paciente de 46 años de edad, con una fractura de la glenoides, del acromion tipo III de Kuhn y de la coracoides tipo II de Ogawa. En este caso, la fractura del acromion fue tratada con fijación percutánea con alambres de Kirschner, por tener asociado lesiones de partes blandas que contraindicaron la reducción abierta. La fractura de la glenoides y de la apófisis coracoides fueron tratadas conservadoramente. Después de 6 meses de evolución, el paciente tuvo un resultado funcional aceptable, con una abducción de 90 grados, los 30 grados de rotación externa y 70 de rotación interna, además asintomático y consolidación de todas las fracturas. A pesar de ser catalogada de una lesión grave del cinturón escapular y estar asociada a otras lesiones se obtuvo un resultado satisfactorio al final del tratamiento.

OBJETIVO DEL DESARROLLO DEL MILENIO 7

Directory of Open Access Journals (Sweden)

Margarita M. Pérez O.

2013-10-01

Full Text Available Los Objetivos de Desarrollo del Milenio, también conocidos como los Objetivos del Milenio, constituyeron las metas finales que aprobaron los dirigentes mundiales, 189 jefes de estado y de gobierno en la Cumbre del Milenio de las Naciones Unidas celebrada en Nueva York en el año 2000, en la cual los Estados miembros de la organización reafirmaron su compromiso de luchar por un mundo en el que el desarrollo sostenible y la eliminación de la pobreza tuvieran máxima prioridad1 . En la cumbre se definió la Declaración del Milenio, la cual detalla los objetivos, principios, valores, metas y acciones para erradicar la pobreza Mundial hacia el año 2015, todos ellos ratificados con alto interés y acción estratégica de carácter global, como marco para la medición de los progresos en materia de desarrollo.

Estrategias del Teatro del Oprimido para la formación permanente del profesorado

Directory of Open Access Journals (Sweden)

Tomás Motos-Teruel

2012-01-01

Full Text Available Este artículo relata una experiencia y su valoración de formación permanente del profesorado basada en el aprendizaje vivencial utilizando como estrategia metodológica el Teatro del Oprimido (TO para estimular y favorecer la reflexión sobre la práctica educativa. Sus objetivos básicos fueron dar a conocer la formulación teórica y la metodología del TO y hacer la transferencia de las estrategias metodológicas vivenciadas a la práctica docente. El estudio se ha planteado desde una óptica cualitativa con el estudio de caso único. Y como resultados más destacables hay que reseñar el interés y la percepción de la utilidad personal y profesional del TO como instrumento de reflexión sobre la acción y generador de clima positivo. El Teatro del Oprimido es una formulación teórica y un método estético cuya teoría y praxis están inspiradas en la Pedagogía del Oprimido de Paulo Freire, utiliza las técnicas dramáticas como un instrumento eficaz para la comprensión y la búsqueda de alternativas a problemas sociales, interpersonales e individuales.

DelPhi: a comprehensive suite for DelPhi software and associated resources

Directory of Open Access Journals (Sweden)

Li Lin

2012-05-01

Full Text Available Abstract Background Accurate modeling of electrostatic potential and corresponding energies becomes increasingly important for understanding properties of biological macromolecules and their complexes. However, this is not an easy task due to the irregular shape of biological entities and the presence of water and mobile ions. Results Here we report a comprehensive suite for the well-known Poisson-Boltzmann solver, DelPhi, enriched with additional features to facilitate DelPhi usage. The suite allows for easy download of both DelPhi executable files and source code along with a makefile for local installations. The users can obtain the DelPhi manual and parameter files required for the corresponding investigation. Non-experienced researchers can download examples containing all necessary data to carry out DelPhi runs on a set of selected examples illustrating various DelPhi features and demonstrating DelPhi’s accuracy against analytical solutions. Conclusions DelPhi suite offers not only the DelPhi executable and sources files, examples and parameter files, but also provides links to third party developed resources either utilizing DelPhi or providing plugins for DelPhi. In addition, the users and developers are offered a forum to share ideas, resolve issues, report bugs and seek help with respect to the DelPhi package. The resource is available free of charge for academic users from URL: http://compbio.clemson.edu/DelPhi.php.

Hacia una conceptualización del legado del traductor

Directory of Open Access Journals (Sweden)

Guzmán María Constanza

2009-06-01

Full Text Available Este artículo se propone investigar el aporte de perspectivas traductológicas para el estudio de la figura del traductor y su legado. Se centra en enfoques teóricos contemporáneos, principalmente aquellos basados en perspectivas postestructuralistas, que consideran el papel del sujeto traductor como un aspecto crucial en la traducción y los estudios literarios, y proponen maneras interesantes de abordarlo. A lo largo del artículo se cuestionan nociones como la idea de un original sacralizado, la relación entre autoría y propiedad, el ideal del significado transparente, y la tensión entre la traducción y la escritura del "original". Se presta especial atención a la importancia de ubicar históricamente la práctica del traductor, reconocer su papel como agente visible, y conceptualizar la traducción como una forma de escritura que se desarrolla en medio de complejas interacciones y negociaciones.

La equinoterapia en las distintas alteraciones del desarrollo del menor.

OpenAIRE

Chamorro González, Mireya

2015-01-01

La equinoterapia consiste en la utilización del caballo como un método terapéutico para rehabilitar a personas con discapacidad. Esta terapia es considerada una gran alternativa para aumentar el autoestima de los que sufren algún tipo de discapacidad, también a través de esta terapia se mejora y fortalece el estado emocional, así del mismo modo ayuda a mejorar la manera de desenvolverse en su entorno social. Esta terapia se realiza a través de la trasmisión del calor corporal del caballo, del...

Gestión del talento humano y competencias laborales del personal del hospital Hermilio Valdizán 2016

OpenAIRE

Serpa Reyes, Elisa Soledad

2016-01-01

La presente investigación tuvo como objetivo general, Conocer la relación que existe entre gestión del talento humano y las competencias laborales del personal del hospital Hermilio Valdizán en el año 2016. El tipo de investigación es no experimental, de diseño descriptivo correlacional. La población fue de 709 trabajadores, y la muestra de 217 trabajadores del hospital Hermilio Valdizán, la muestra es probabilística aleatoria simple. Se aplicó el cuestionario de gestión del...

Seccional del Lago Lleu Lleu extracto del resumen ejecutivo del estudio

Directory of Open Access Journals (Sweden)

Manuel Durán

2000-08-01

Full Text Available En el siguiente reportaje se presentan los estudios contratados por el MINVU Planes Seccionales del Lago Lleu Lleu y del Lago Pangue; realizados por las oficinas de Manuel Durán y Lira y Peña Asoc. A continuación entrevistamos al Sr. Tito Rojas, ex Director Regional de SERNATUR y actual Gobernador de la Provincia de Arauco, y a Patricio Aguirre, Director de la Carrera de Turismo del DUOC-UC sede Concepción. Mientras que los instrumentos de planificación desarrollan estrategias específicas para potenciar el turismo aprovechando las potencialidades del recurso lacustre; los entrevistados nos dan su opinión en cuanto a diversos aspectos relacionados con el turismo y los lagos de esta zona: el delicado equilibrio entre turismo y protección de los recursos; las potencialidades de las áreas aledañas a los lagos Pangue y Lleu Lleu; el patrimonio paisajístico y cultural de la provincia de Arauco, entre otros, son los aspectos que se exponen en las próximas páginas.

Comportamiento del servicio Diselin en la Gestión del Conocimiento de la Delegación del CITMA, en el. período 2003- octubre del 2005

Directory of Open Access Journals (Sweden)

Matilde Palacios Jiménez

2005-01-01

Full Text Available Se aborda el comportamiento del servicio Diselin durante el período 2003 hasta octubre del 2005, en la Gestión del Conocimiento de la Delegación del CITMA, a partir de los contenidos cuantitativos y cualitativos generados en la base de datos Diselin, correspondientes a la estadística general del servicio, relacionada con los indicadores de desempeño bibliotecario: suministro de documentos y satisfacción del cliente a través del talón de retroacoplamiento, como indicadores de desempeño bibliotecario que permiten hacer una valoración más exhaustiva de la evolución de este servicio tradicional con modalidad electrónica que es lo novedoso, aprovechando las tecnologías de información instaladas. Se presentan tablas y gráficos que demuestran la gestión y el impacto del servicio desde el punto de vista organizacional.

Sobre el significado del descubrimiento del gen FOXP2

OpenAIRE

Longa Martínez, Víctor Manuel

2006-01-01

El reciente descubrimiento del gen FOXP2 ha ofrecido la primera evidencia clara de la base genética del lenguaje, mostrando una correlación inequívoca desde la perspectiva genética entre una versión mutada de F0XP2 y los trastornos lingüísticos de diferente tipo sufridos por una familia inglesa, conocida como KE. El objetivo central del presente trabajo es discutir diferentes aspectos relacionados con tal descubrimiento; especialmente, la discusión del significado de FOXP2 con ...

Entrenamiento funcional del core: eje del entrenamiento inteligente

Directory of Open Access Journals (Sweden)

Iván Dario Pinzón Ríos

2015-06-01

Full Text Available Antecedentes: La evolución del entrenamiento físico busca la optimización de la salud y el bienestar, como piedra angular de todo programa de ejercicio. El Entrenamiento Funcional (EF es recomendable para optimizar el control postural del core, mejorando el balance y la ejecución de actividades de la vida diaria.  Objetivo: Revisar la definición, elementos constitutivos, características e implicaciones del EF del core en el movimiento corporal humano (MCH y la salud desde la perspectiva del fisioterapeuta. Metodología: Se incluyeron artículos en inglés y español de las bases Pubmed, Scielo y Ebsco; adicionalmente se incluyeron fuentes electrónicas e impresas y libros. Resultados: 56 documentos cumplieron los criterios de inclusión. La definición más adoptada de EF fue entrenar con un propósito buscando obtener un efecto positivo en la aptitud física. Las implicaciones del EF en el MCH, se relacionan con la ganancia y mejoría de la estabilidad. La propuesta de EF enfocada a las actividades de la vida diaria incluye fases que permiten adquirir la estabilidad hasta lograr el desarrollo de movimiento que demanden más agilidad. En la planificación del EF se deben estructurar los procesos a ejecutar considerando el criterio de funcionalidad. Para organizar la sesión del EF, el fisioterapeuta cuenta con tres maneras de planificar la sesión: globales, por hemisferios y por grupos musculares. Conclusión: La fundamentación teórica sobre el EF permite al fisioterapeuta comprender y determinar cómo esta modalidad de intervención repercute de manera positiva sobre el desempeño funcional y calidad de vida de los sujetos.

Anti-platelet and anti-thrombotic effect of a traditional herbal medicine Kyung-Ok-Ko.

Science.gov (United States)

Kim, Tae-Ho; Lee, Kyoung Mee; Hong, Nam Doo; Jung, Yi-Sook

2016-02-03

Kyung-Ok-Ko (KOK), a traditional herbal prescription, contains six main ingredients; Rehmannia glutinosa var. purpurae, Lycium chinense, Aquillaria agallocha, Poria cocos, Panax ginseng, and honey. KOK has been widely taken as a traditional oriental medicine for improving blood circulation or age-related symptoms, such as dementia and stroke. However, the effect of KOK on platelet activity has not been clarified. To evaluate the effect of KOK on platelet function, we evaluated its effect on functional markers of platelet activation such as aggregation and shape change. As a mechanism study for the effect of KOK, we examined its effect on granule secretion, intracellular Ca(2+) increase, and PLCγ and Akt activation. To investigate the effect of orally administered KOK (0.5, 1, 2 g/kg), we examined its ex vivo effect on platelet aggregation in rat, and its in vivo anti-thrombotic effect in mice thromboembolism model. Furthermore, the effect of KOK on bleeding time was examined to estimate its potential side effect. KOK (0.3, 1, 3, 10 mg/ml) inhibited collagen-induced platelet aggregation and shape change in rat platelets in a concentration-dependent manner. The mechanism for the anti-platelet effect of KOK seems to involve the inhibition of ATP release, intracellular Ca(2+) elevation, and the phosphorylation of PLCγ and Akt. In rat ex vivo study, KOK (2 g/kg, p.o. for 1 day, and 0.5, 1, 2 g/kg, p.o. for 7 days) also had significant inhibitory effects on collagen-induced platelet aggregation. In addition, KOK showed a significant protective effect against thrombosis attack in mice. The prolongation of bleeding time by KOK was much less than that by ASA, suggesting a beneficial potential of KOK than ASA in view of side effect. These findings suggest that KOK elicits remarkable anti-platelet and anti-thrombotic effects with less side effect of bleeding, and therefore, it may have a therapeutic potential for the prevention of platelet-associated cardiovascular diseases

Source characteristics of the Fairview, OK, earthquake sequence and its relationship to industrial activities

Science.gov (United States)

Yeck, W. L.; Weingarten, M.; Benz, H.; McNamara, D. E.; Herrmann, R. B.; Rubinstein, J. L.; Earle, P. S.; Bergman, E.

2016-12-01

We characterize the spatio-temporal patterns of seismicity surrounding the February 13, 2016, Mw 5.1 Fairview, Oklahoma earthquake. This earthquake sequence accounts for the largest moment release in the central and eastern US since the November 06, 2011 Mw 5.6 Prague, OK earthquake sequence. To improve the location accuracy of the sequence and measure near-source ground motions, the United States Geological Survey (USGS) deployed eight seismometers and accelerometers in the epicentral region. With the added depth control from these stations, we show that earthquakes primarily occur in the Precambrian basement, at depths of 6-10 km below sea level. The Mw 5.1 mainshock, the largest event in the cluster, locates near the base of the seismicity. Relocated aftershocks delineate a partially unmapped, 14-km-long fault segment that strikes approximately N40°E, partially bridging the gap between previously mapped basement faults to the southwest and northeast. Gas production and hydraulic fracking data from the region show no evidence that either of these activities correlates spatio-temporally with the Fairview sequence. Instead, we suggest that a series of high-rate, Arbuckle injection wells (> 300,000 bbls/month) 8-25 km northeast of this sequence pressurized the reservoir in the far field. Regional injection into the Arbuckle formation increased 7-fold in the 24 months before the initiation of the sequence with some wells operating at rates greater than 1 million barrels per month. Seismicity in the proximity of the high-rate wells is diffuse whilst the energetic Fairview sequence occurs more than 15 km from this region. Our observations point to the critical role pre-existing geologic structures play in the occurrence of large induced earthquakes. This study demonstrates the need for a better understanding of the role of far-field pressurization. High-quality data sets such as this facilitate the USGS mission to improve earthquake hazard identification, especially

Desarrollo de la Habilidad de Administración del Tiempo en directivas del primer nivel del MITRANS.

OpenAIRE

García Remus, Mayelín

2009-01-01

Valoración de cómo administran el tiempo las mujeres directivas del sector del transporte en Ciudad de La Habana. Establece las competencias individuales que pueden influir en el desarrollo de la habilidad de administración del tiempo.

LAS NEURONAS DEL SEPTUM LATERAL MODIFICAN LA ACTIVIDAD DE LAS NEURONAS DEL NUCLEO TUBEROMAMILAR DEL HIPOTALAMO

OpenAIRE

FARIAS RODRIGUEZ, PAULA ANDREA; FARIAS RODRIGUEZ, PAULA ANDREA

2012-01-01

El septum lateral (SL), es un núcleo del cerebro anterior, que, procesa la información sensorial afectiva procedente del hipocampo y dirige sus respuestas, importantes para la supervivencia, hacia las zonas del hipotálamo importantes para la motivación, como lo es el núcleo tuberomamilar del hipotálamo (TMN). El TMN contiene las neuronas histaminérgicas en el cerebro, la cual relacionamos con la vigilia y alerta en conductas motivadas y así puede dirigir y reforzar el comportamiento. El TM...

Rotura del Bíceps Distal. Evaluación de resultados con técnica de doble fijación. [Distal biceps rupture: evaluation of results with double fixation technique

Directory of Open Access Journals (Sweden)

Miguel Ángel Capomassi

2013-11-01

Full Text Available In­tro­duc­ción La rotura del bíceps distal es una lesión poco frecuente producida por la aplicación de una fuerza excéntrica sobre el codo flexionado. El objetivo de este trabajo es analizar los resultados obtenidos para la reinserción del bíceps distal mediante técnica de doble fijación con botón de anclaje cortical y tornillo interferencial de biotenodesis a través de una incisión anterior única. Materiales­ y­ Métodos Entre agosto de 2008 y febrero de 2013, registramos 19 casos de rotura del bíceps distal tratados quirúrgicamente por vía anterior limitada. Los 17 últimos casos consecutivos fueron tratados con doble fijación utilizando botón extracortical y tornillo de biotenodesis, y forman parte del estudio. Todos eran hombres, con una mediana de la edad de 41 años (rango 27-59. Los pacientes fueron evaluados con el Cuestionario DASH y el Puntaje Subjetivo/Objetivo de Andrews y Carson, y la fuerza de flexión y supinación se controló con la escala del British Medical Research Council modificada por Mackinnon y Dellon (M0-M5. Resultados El cuestionario DASH arrojó un valor mediano de 1,7 (0-5,83 y el de Andrews y Carson, de 195 (170-200 para el total; con 15 resultados excelentes y 2 buenos. Todos consiguieron una fuerza M5 para flexión y supinación de antebrazo. El seguimiento tuvo una mediana de 12 meses (4-32. En dos pacientes, se registraron complicaciones, ambas con recuperación ad íntegrum. Conclusión La técnica descrita ha demostrado ser confiable y eficaz, y permitió lograr resultados satisfactorios y una baja tasa de complicaciones.

Caracterización del mercado laboral del sector hotelero del estado Mérida, Venezuela

OpenAIRE

Villasmil R., María A.; Andrade, Henry

2009-01-01

Esta investigación trata sobre modelos que permiten caracterizar Mercados Laborales Locales (MLL), ya que en Venezuela el manejo de los mismos es casi inexistente. En este sentido, se plantea como objetivo caracterizar al mercado laboral del sector hotelero del estado Mérida-Venezuela en función del conocimiento de las particularidades económicas, institucionales, políticas, sociales, educativas y culturales de la zona así como las condiciones que se tengan en materia de empleo, oferta de for...

Analysis of fuel relocation for the NRC/PNL Halden assemblies IFA-431, IFA-432, and IFA-513. Interim report

International Nuclear Information System (INIS)

Williford, R.E.; Mohr, C.L.; Lanning, D.D.; Cunningham, M.E.; Rausch, W.N.

1980-06-01

The effects of the thermally-induced cracking and subsequent relocation of UO2 fuel pellets on the thermal and mechanical behavior of light-water reactor fuel rods during irradiation are quantified in this report. Data from the Nuclear Regulatory Commission/Pacific Northwest Laboratory Halden experiments on instrumented fuel assemblies (IFA) IFA-431, IFA-432, and IFA-513 are analyzed. Beginning-of-life in-reactor measurements of fuel center temperatures, linear heat ratings, and cladding axial elongations are used in a new model to solve for the effective thermal conductivity and elastic moduli of the cracked fuel column. The primary assumptions of the new model are that (1) the cracked fuel is in a hydrostatic state of stress in the (r,theta) plane, and that (2) there is no axial slipping between fuel and cladding. Three basic parameters are used to describe the cracked fuel: (1) the crack pattern, (2) the crack roughness, and (3) the fuel surface (gap) roughness. Recommendations are made on refining the model

CONSIDERACIONES SOBRE EL ESTADO DEL ARTE DEL DESARROLLO ECONÓMICO

Directory of Open Access Journals (Sweden)

Néstor Juan Sanabria

2003-07-01

Full Text Available Este artículo ofrece una síntesis del estado del arte sobre los temas del desarrollo y es parte integrante de la investigación sobre los pymes y el desarrollo económico. Desde los enfoques clásicos hasta los modelos contemporáneos se ha debatido ampliamente la relación entre crecimiento y desarrollo económico. Para muchos autores el desarrollo está vinculado a los problemas de distribución. Para otros el desarrollo es sinónimo de disminución y eliminación de la pobreza o se resuelve a través de aumentar la producción. Otros enfoques se centran en la importancia de minimizar los costos de transacción o en la generación de una mejor calidad de vida. Ahora bien, las teorías del desarrollo predominantes hasta la década de los ochenta, asumen que el proceso del desarrollo no es más que la ruta de homogenización de los mercados duales. Para otros autores el problema se explica por la diferencia de tecnologías, capital social, capital intelectual y humano. Esta síntesis revisa entre otros enfoques los modelos con los que se ha intentado explicar la peculiaridad del desarrollo en los países del tercer mundo, en las economías en proceso de industrialización y la complejidad del caso particular del desarrollo en Latinoamérica y su modelo de sustitución de importaciones.

Los métodos de fijación del salario en el Uruguay y los particularismos del Derecho del Trabajo

Directory of Open Access Journals (Sweden)

Álvaro Rodríguez Azcúe

2014-01-01

Full Text Available El salario y la jornada de trabajo han sido en nuestro país, seguramente, los dos temas que forjaron el nacimiento del Derecho del trabajo1. Dentro del primero, el método de fijación del salario predominante, generalmente, refleja algo mucho más amplio que la política salarial de un gobierno. En realidad pone de manifiesto un eje central de la política laboral, o, más aún, una determinada forma de abordar la cuestión social.Por ese motivo nos proponemos analizar el tema a partir de su evolución histórica y de algunos de los particularismos que, en la concepción de Barbagelata, posee el Derecho del trabajo: la subyacencia del conflicto en las relaciones laborales y la significación del tiempo social.En esa perspectiva se confirma, según enseña Ermida Uriarte, el indudable papel protagónico que han desempeñado los Consejos de Salarios en el Derecho del trabajo y el sistema laboral uruguayo.Presentación. Referencia a los particularismos del Derecho del Trabajo. Los métodos teóricos de fijación del salario. Evolución histórica de los métodos a la luz de los particularismos. Algunas reflexiones finales

Ensayo del lisado de amebocitos del Limulus (LAL

Directory of Open Access Journals (Sweden)

Rolando Perdomo Morales

2004-04-01

Full Text Available En los últimos años, los principales organismos reguladores de productos farmacéuticos (Farmacopeas exigen cada vez más en sus monografías la aplicación del método del lisado de amebocitos de Limulus (LAL para la liberación de pirógenos en productos terminados parenterales. El análisis de pirógenos constituye uno de los principales ensayos en el control de calidad de la fabricación de inyectables por su repercusión en la salud humana, puesto que la presencia y administración de los mismos, es capaz de provocar una serie de respuestas fisiológicas, en su mayoría de carácter perjudicial y en casos extremos, la muerte del paciente. Por las razones anteriores, existe un creciente interés en el conocimiento y dominio de estos métodos. El presente trabajo muestra una revisión bibliográfica del método del LAL, se tratan aspectos como su descubrimiento y estandarización, aparición en la industria farmacéutica y razones para su triunfo, y los basamentos de los principales métodos o variaciones comerciales del LAL (gelificación, turbidimétricos y cromogénicos que se describen en las Farmacopeas.

Ensayo del lisado de amebocitos del Limulus (LAL

Directory of Open Access Journals (Sweden)

Rolando Perdomo Morales

Full Text Available En los últimos años, los principales organismos reguladores de productos farmacéuticos (Farmacopeas exigen cada vez más en sus monografías la aplicación del método del lisado de amebocitos de Limulus (LAL para la liberación de pirógenos en productos terminados parenterales. El análisis de pirógenos constituye uno de los principales ensayos en el control de calidad de la fabricación de inyectables por su repercusión en la salud humana, puesto que la presencia y administración de los mismos, es capaz de provocar una serie de respuestas fisiológicas, en su mayoría de carácter perjudicial y en casos extremos, la muerte del paciente. Por las razones anteriores, existe un creciente interés en el conocimiento y dominio de estos métodos. El presente trabajo muestra una revisión bibliográfica del método del LAL, se tratan aspectos como su descubrimiento y estandarización, aparición en la industria farmacéutica y razones para su triunfo, y los basamentos de los principales métodos o variaciones comerciales del LAL (gelificación, turbidimétricos y cromogénicos que se describen en las Farmacopeas.

Indicadores de desempeño del sistema de riego del Rio Dulce, Santiago del Estero, Argentina

NARCIS (Netherlands)

Prieto, D.; Angella, G.; Angueira, M.C.; Pérez Carrera, A.; Moscuzza, C.

2005-01-01

Mucha atención se ha puesto en el estudio del desempeño de los sistemas de riego a partir de la década de 1990, al tomarse conciencia de los bajos resultados de muchos de ellos, y su impacto ambiental negativo. El Sistema de Riego del Río Dulce en Santiago del Estero (PRD), no es la excepción,

La motivación del veredicto en la jurisprudencia del Tribunal Supremo

OpenAIRE

Vegas Torres, Jaime

2006-01-01

1. Introducción. 2. Alcance de la exigencia de motivación del veredicto. 2.1. Extensión de la motivación. 2.1.1. Hechos no controvertidos. 2.1.2. Hechos que el jurado encuentra no probados. 2.2. Profundidad de la motivación. 2.2.1. Admisibilidad de la explicación conjunta de todas las respuestas del jurado a las cuestiones del objeto del veredicto. 2.2.2. Contenido de la motivación. 3. Motivación del veredicto y prueba por indicios. 3.1. Motivación del veredicto basado en prueba de indicios. ...

Del Charco del Agua Amarga (Alcañiz

Directory of Open Access Journals (Sweden)

Tomás MAIGI

2009-10-01

Full Text Available En agosto de 1947, habiendo llegado a la excelentísima Diputación Provincial de Teruel rumores de recientes deterioros en el friso pintado del abrigo rupestre del "Charco del Agua Amarga", nos fué requerida oficialmente, por dicha Corporación, la presentación de un informe sobre la realidad de los hechos expuestos, así como el planeamiento de las medidas adecuadas para salvaguardar en forma eficaz, en el futuro, las referidas pinturas.

Concentraciones del activador tisular del plasminógeno y del inhibidor del activador del plasminógeno en pacientes con homocistinuria clásica

Directory of Open Access Journals (Sweden)

Beatriz Meneses

2001-04-01

Full Text Available El aumento moderado o severo de Homocisteína (Hcy en sangre y las alteraciones en el sistema fibrinolítico, se asocian con enfermedad vascular que afecta venas y arterias de todos los calibres. Los pacientes con homocistinuria clásica padecen con mucha frecuencia eventos tromboembólicos, que son su principal causa de mortalidad. El objetivo de este estudio fue determinar las concentraciones de Hcy, Inhibidor del Activador del Plasminógeno tipo 1 (PAI-1 y Activador tisular del Plasminógeno (tPA en pacientes con homocistinuria clásica, en familiares de éstos y en población control sana.

Gestión del riesgo del cambio (primera parte

Directory of Open Access Journals (Sweden)

Juan Pablo Zorrilla

2007-07-01

Full Text Available A partir de la desaparición del sistema Bretton-Woods, y la libre flotación del tipo de cambio, el mundo se volvió más susceptible a todo tipo de riesgos. El presente artículo pretende explicar a los gestores financieros o empresarios interesados en el tema de instrumentos financieros derivados, a conocer lo más relevante y necesario acerca del uso de futuros sobre el tipo de cambio, instrumento útil para cubrir riesgos derivados del tipo de cambio para las empresas que se dedican a importar, exportar o para protegerse de un crédito otorgado en moneda extranjera.

Calculo del valor en riesgo del futuro de energia e internacionalizacion del sector energetico en Colombia

OpenAIRE

Esquivel Fonseca, Leidy Gioanna

2013-01-01

El presente trabajo de grado busca definir cuál es el mejor método para determinar el valor en riesgo del contrato de futuro de energía eléctrica que se transa en Colombia, para cumplir con este objetivo se toma como referencia el marco histórico del VaR y de los futuros seguido de las características de la fijación de precios, la estructura del contrato, que políticas y métodos hay para cubrirse del riesgo y como se realiza en otros países, realizando algunos cálculos de los modelos más trad...

EFECTO DEL SILICIO Y PLAGUICIDAS EN LA FERTILIDAD DEL SUELO Y RENDIMIENTO DEL ARROZ

OpenAIRE

Parm\\u00E9nides Furcal-Beriguete; Alejandra Herrera-Barrantes

2013-01-01

El objetivo de este trabajo fue evaluar el efecto del silicio en la fertilidad del suelo, la incidencia de enfermedades y plagas insectiles, el rendimiento y la calidad de granos del cultivo de arroz. El estudio se realizó en La Vega, Florencia, San Carlos, Costa Rica entre mayo y octubre en los años 2010 y 2011, en el mismo lote con la variedad CR 4477. Se establecieron cinco tratamientos: silicio al suelo, silicio al suelo más plaguicidas (alternativas químicas), silicio foliar, silicio fol...

Competitividad sectorial internacional. Caso: sector del cuero y del calzado

Directory of Open Access Journals (Sweden)

Diana Carolina Villegas Álvarez

2007-01-01

Full Text Available El presente escrito se origina en un trabajo de investigación cuya pretensión fue indagar sobre el nivel de competitividad internacional (C.I, del sector del cuero y del calzado colombiano, mediante la aplicación de indicadores que, a partir de la información estadística de las variables de comercio exterior permiten establecer ciertas relaciones que dan cuenta de la importancia del producto en los mercados de los países de la Comunidad Andina de Naciones (CAN, seleccionados para la comparación.

Sobre el fragment dels Catasterismes d'Eratòstenes del manuscrit Parisinus Graecus 1310: el nom dels planetes Saturn i Júpiter

OpenAIRE

Pàmias i Massana, Jordi

1998-01-01

El ms. Parisinus Graecus 1310 inclou un breu fragment de l'Epítom dels Catasterismes, obra atribuïda a Eratòstenes. A banda d'alguna variant respecte del textus receptus, presenta un capítol (43) del tot reelaborat, en què l'excepcional irregularitat de l'Epítom dels Catasterismes, pel que fa a les correspondències divines dels dos primers planetes de la nòmina de cinc, ha estat corregida per tal d'adequar els noms dels planetes Faiuou i Faethou a Saturn i a Júpiter respectivament. The man...

Cryo-electron Microscopy Reconstruction and Stability Studies of the Wild Type and the R432A Variant of Adeno-associated Virus Type 2 Reveal that Capsid Structural Stability Is a Major Factor in Genome Packaging.

Science.gov (United States)

Drouin, Lauren M; Lins, Bridget; Janssen, Maria; Bennett, Antonette; Chipman, Paul; McKenna, Robert; Chen, Weijun; Muzyczka, Nicholas; Cardone, Giovanni; Baker, Timothy S; Agbandje-McKenna, Mavis

2016-10-01

The adeno-associated viruses (AAV) are promising therapeutic gene delivery vectors and better understanding of their capsid assembly and genome packaging mechanism is needed for improved vector production. Empty AAV capsids assemble in the nucleus prior to genome packaging by virally encoded Rep proteins. To elucidate the capsid determinants of this process, structural differences between wild-type (wt) AAV2 and a packaging deficient variant, AAV2-R432A, were examined using cryo-electron microscopy and three-dimensional image reconstruction both at an ∼5.0-Å resolution (medium) and also at 3.8- and 3.7-Å resolutions (high), respectively. The high resolution structures showed that removal of the arginine side chain in AAV2-R432A eliminated hydrogen bonding interactions, resulting in altered intramolecular and intermolecular interactions propagated from under the 3-fold axis toward the 5-fold channel. Consistent with these observations, differential scanning calorimetry showed an ∼10°C decrease in thermal stability for AAV2-R432A compared to wt-AAV2. In addition, the medium resolution structures revealed differences in the juxtaposition of the less ordered, N-terminal region of their capsid proteins, VP1/2/3. A structural rearrangement in AAV2-R432A repositioned the βA strand region under the icosahedral 2-fold axis rather than antiparallel to the βB strand, eliminating many intramolecular interactions. Thus, a single amino acid substitution can significantly alter the AAV capsid integrity to the extent of reducing its stability and possibly rendering it unable to tolerate the stress of genome packaging. Furthermore, the data show that the 2-, 3-, and 5-fold regions of the capsid contributed to producing the packaging defect and highlight a tight connection between the entire capsid in maintaining packaging efficiency. The mechanism of AAV genome packaging is still poorly understood, particularly with respect to the capsid determinants of the required capsid

Factores de riesgo implicados en el comportamiento agresivo del perro y del gato

OpenAIRE

Amat Grau, Marta

2011-01-01

El presente trabajo se centra en el estudio de algunos aspectos de la agresividad del perro y del gato. El estudio de la agresividad canina y felina es importante por varios motivos. En primer lugar, los problemas de agresividad del perro y del gato son muy frecuentes y, al menos en los centros de referencia, son el principal problema de comportamiento. La agresividad del perro y del gato también es importante, porque constituye una de las principales causas de eutanasia y abandono de perros ...

Enfermedad del virus del Ébola (Ebola Virus Disease)

Centers for Disease Control (CDC) Podcasts

Este podcast proporciona información general sobre la enfermedad del virus del Ébola y el brote en África Occidental. El programa contiene declaraciones del director de los CDC, Dr. Tom Frieden, así como una breve descripción de las actividades de respuesta de los CDC.

LA LEY DEL SUELO DEL PAÍS VASCO: UN PASO MÁS HACIA LA PROTECCIÓN DEL SUELO RURAL

Directory of Open Access Journals (Sweden)

J.C. Alberdi Collantes

2011-01-01

Full Text Available La Ley del suelo del País Vasco del 2007 nace con el objeto de favorecer el acceso a una vivienda digna. Sin embargo, en la medida en que apuesta por frenar la especulación y la sostenibilidad del medio legisla sobre el tratamiento que se le ha de aportar al suelo no urbanizable. En este caso, no altera sustancialmente la regulación del suelo rural pero sí incorpora nuevas obligaciones dirigidas a frenar la intensidad de la urbanización en este suelo. Se regula la construcción de nueva vivienda, el desarrollo urbanístico de núcleos y barrios rurales y se obliga a profundizar en la calificación del suelo no urbanizable. La aplicación de los nuevos contenidos quedan en manos de los municipios e instituciones sectoriales y los primeros resultados parecen denotar un cambio de tendencia en municipios que han observado la pérdida de calidad paisajística del medio rural, la creciente especulación y la desagrarización de este entorno.

Environmentally friendly wood preservatives formulated with enzymatic-hydrolyzed okara, copper and/or boron salts

International Nuclear Information System (INIS)

Ahn, Sye Hee; Oh, Sei Chang; Choi, In-gyu; Han, Gyu-seong; Jeong, Han-seob; Kim, Ki-woo; Yoon, Young-ho; Yang, In

2010-01-01

Novel biocides, such as copper azole (CuAz) and ammoniacal copper quaternary (ACQ), are extensively used as substitutes for chromate copper arsenate (CCA) in wood preservation. However, the expense of these biocides has necessitated the development of cost-effective and environmentally friendly wood preservatives. This study was conducted to investigate the effectiveness against decaying fungi of the preservatives formulated with enzymatic-hydrolyzed okara (OK), which is an organic waste produced from the manufacture of tofu, CuCl 2 (CC) and/or Na 2 B 4 O 7 .10H 2 O (B). With the addition of NH 4 OH as a dissociating agent, the addition of OK facilitated the target retention of most of the OK/CC and OK/CC/B preservative formulations in wood blocks. The OK-based wood preservatives (OK-WPs) were stable against hot-water leaching. When compared with control and CC-treated wood blocks, the leached wood blocks treated with OK/CC and OK/CC/B formulations showed excellent decay resistance against both Postia placenta and Gloeophyllum trabeum, especially when OK was hydrolyzed by Celluclast at a loading level of 0.1 ml/g. Scanning electron microscopy (SEM) and SEM-energy dispersive X-ray (SEM-EDX) spectrometry analyses demonstrated that preservative complexes, such as OK-CC and OK-CC-B, existed in the wood blocks treated with OK/CC and OK/CC/B formulations. This study results support the potential application of OK-WPs as environmentally friendly wood preservatives capable of replacing CuAz and ACQ.

Environmentally friendly wood preservatives formulated with enzymatic-hydrolyzed okara, copper and/or boron salts

Energy Technology Data Exchange (ETDEWEB)

Ahn, Sye Hee; Oh, Sei Chang [Department of Forest Resources, Daegu University, Gyeongsan 712-714 (Korea, Republic of); Choi, In-gyu [Department of Forest Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Han, Gyu-seong [Department of Wood and Paper Sciences, Chungbuk National University, Cheongju 361-763 (Korea, Republic of); Jeong, Han-seob [Department of Forest Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Kim, Ki-woo [National Instrumentation Center for Environmental Management, Seoul National University, Seoul 151-921 (Korea, Republic of); Yoon, Young-ho [KCI Co. Ltd., Seosan, Chungcheongnam-do 356-874 (Korea, Republic of); Yang, In, E-mail: dahadad2000@yahoo.com [Research Institute for Agriculture and Life Sciences, Seoul National University, San 56-1 Sillim-Dong, Kwanak-gu, Seoul 151-921 (Korea, Republic of)

2010-06-15

Novel biocides, such as copper azole (CuAz) and ammoniacal copper quaternary (ACQ), are extensively used as substitutes for chromate copper arsenate (CCA) in wood preservation. However, the expense of these biocides has necessitated the development of cost-effective and environmentally friendly wood preservatives. This study was conducted to investigate the effectiveness against decaying fungi of the preservatives formulated with enzymatic-hydrolyzed okara (OK), which is an organic waste produced from the manufacture of tofu, CuCl{sub 2} (CC) and/or Na{sub 2}B{sub 4}O{sub 7}.10H{sub 2}O (B). With the addition of NH{sub 4}OH as a dissociating agent, the addition of OK facilitated the target retention of most of the OK/CC and OK/CC/B preservative formulations in wood blocks. The OK-based wood preservatives (OK-WPs) were stable against hot-water leaching. When compared with control and CC-treated wood blocks, the leached wood blocks treated with OK/CC and OK/CC/B formulations showed excellent decay resistance against both Postia placenta and Gloeophyllum trabeum, especially when OK was hydrolyzed by Celluclast at a loading level of 0.1 ml/g. Scanning electron microscopy (SEM) and SEM-energy dispersive X-ray (SEM-EDX) spectrometry analyses demonstrated that preservative complexes, such as OK-CC and OK-CC-B, existed in the wood blocks treated with OK/CC and OK/CC/B formulations. This study results support the potential application of OK-WPs as environmentally friendly wood preservatives capable of replacing CuAz and ACQ.

Evolución del desarrollo del color en sistema modelo de composición similar al dulce de leche. Influencia del tiempo de calentamiento y del Ph

Directory of Open Access Journals (Sweden)

Analía Rodríguez Blanco

2013-01-01

Full Text Available El color es un atributo importante en la elección del producto dulce de leche por parte del consumidor. El mismo se desarrolla en el proceso de elaboración debido principalmente a las reacciones de pardeamiento no enzimático, las cuales se ven influenciadas por varios factores. En este trabajo se evaluó el desarrollo de color, con el tiempo de tratamiento térmico y el pH inicial como variables tecnológicas, en un sistema modelo compuesto de caseinato, lactosa, sacarosa y agua destilada cuya composición fue similar a la del dulce de leche comercial. El estudio del color se realizó utilizando los parámetros de medición de color del sistema CIELAB y el índice de Kubelka Munk (K/S. Con ambos métodos se constató un aumento significativo del dE*ab y del K/S con el tiempo de tratamiento térmico y el pH inicial. Con el sistema CIELAB además se observó una tendencia a disminuir la luminosidad con el tiempo y el aumento del pH inicial, y el aumento de a* con el tiempo.

Acerca del moho

Science.gov (United States)

El moho forma parte del medio ambiente natural. Afuera del hogar, el moho juega un papel en la naturaleza al desintegrar materias organicas tales como las hojas que se han caido o los arboles muertos. El moho puede crecer adentro del hogar cuando las espor

La teoria del ciclo vitale del risparmio di Modigliani cinquant’anni dopo

Directory of Open Access Journals (Sweden)

Mauro Baranzini

2005-06-01

Full Text Available Nei primi anni ’50 Franco Modigliani, insieme a Richard Brumberg e ad Albert Ando, formulò lateoria del ciclo vitale del consumo e del risparmio, che ha riscosso un enorme e indiscussosuccesso per almeno tre decenni. Tuttavia, a partire dai primi anni ’80 la teoria del ciclo vitale èstata criticata in modo sempre più serrato, per almeno quattro ragioni. La prima consistenell’esistenza di una significativa trasmissione intergenerazionale della ricchezza, da ricondurre acause esogene al modello del ciclo vitale. La seconda ragione è rappresentata dalla crescenteevidenza che i ricchi continuano a risparmiare in misura maggiore rispetto ai meno fortunati,come, in effetti, Keynes sosteneva. Il terzo motivo è che vi sono prove sempre più evidenti,almeno nell’Europa occidentale e in Giappone, che le famiglie giovani, durante i venti e i trentaanni di età, risparmiano una quota positiva e crescente del proprio reddito, e ciò si pone indeciso contrasto con la versione originaria della teoria del ciclo vitale. Infine, numerosi lavoriempirici hanno rilevato che i pensionati accantonano una parte elevata del proprio reddito. Ciòimpone un serio ripensamento dell’approccio della teoria del ciclo vitale, che interessa sia l’analisieconomica sia la politica economica.

Max Weber o el enigma emocional del origen del capitalismo

OpenAIRE

EDUARDO BERICAT ALASTUEY

2001-01-01

Se analiza el trabajo clave de Max Weber, La ética protestante y el espíritu del capitalismo, desde la perspectiva de la Sociología de las Emociones. Aunque la inclusión de las emociones de los fenómenos sociales es clave para entender la idea de Weber sobre el dogma de la predestinación, los sociólogos han trivializado el papel de la emoción. Tras detallar la creencia de Weber en que el espíritu del capitalismo parte del conocimiento de que el destino del hombre está predeterminado (la ética...

Produccion Gaseosa del Cometa Halley: Erupciones Y Fotodisociacion del Radical OH

Science.gov (United States)

Silva, A. M.; Mirabel, I. F.

1990-11-01

RESUMEN:En este trabajo informamos la detecci6n de 20 erupciones en la li'nea de =18cm (1667MHz) del radical OH en el Cometa Halley.Las observaciones incluyen todos los monitoreos existentes y se extienden desde 120 dias antes del perihelio hasta 90 dias despues.Se detectan bruscos crecimientos en el flujo medido,hasta un factor 1O,seguidos por decaimientos lentos asociados con la fotodisociaci6n del OH. Se obtuvieron valores para el tiempo de vida fotoquimico del OH y del H2O basandose en el modelo desarrollado previamente por Silva(1988). Esos tiempos de vida estan de acuerdo con predicciones teoricas y con las observaciones en el Ultravioleta, y los resultados, los que son fuertemente dependientes de la velocidad heliocentrica del Coineta (variando hasta un factor 6), han sido calculados para varios rangos de velocidad entre +28 y -28 km/seg. Key wo'L :

DIAGNÓSTICO DEL SECTOR TURÍSTICO DEL CANTÓN BOLÍVAR

Directory of Open Access Journals (Sweden)

Johnny Patricio Bayas Escudero

2013-12-01

Full Text Available Con el propósito de realizar el diagnóstico del sector turístico del cantón Bolívar, se partió, inicialmente, de la identificación de los recursos y atractivos turísticos existentes, asi como su nivel de incidencia en el desarrollo de esta jurisdicción, para posteriormente, proponer los potenciales productos turísticos que permitan la implementación de planes y programas de desarrollo del turismo. Para el cumplimiento de estos objetivos, se realizó una caracterización general del territorio, identificando e inventariando los recursos y atractivos turísticos del cantón, basándose en las fichas de inventario del Ministerio de Turismo y una propuesta de valoración de atractivos que dejaron como resultado un nuevo inventario de atractivos turísticos; se analizó la superestructura turística y la política turística cantonal; se caracterizó la infraestructura y servicios relativos al turismo; se analizó la oferta y demanda turística actual del cantón, determinando y analizando a su vez, la competencia directa que tiene el cantón para el desarrollo de esta actividad, se realizó el análisis FODA del componente turismo del cantón, que permitió proponer estrategias de desarrollo turístico para Bolívar. Se establecieron 13 potencialidades turísticas del cantón, cuantificando y cualificando su carácter y atributos; de los cuales, cuatro se consideran como las más significativas; en base a las potencialidades determinadas se caracterizaron las actividades turísticas potenciales a desarrollarse en base a categorías, redes de producto y niveles de intervención.

Elementos del sistema electoral del Congreso Mexicano

Directory of Open Access Journals (Sweden)

Aldo Medina García

2013-08-01

Full Text Available El presente artículo es un estudio de los componentes del sistema electoral, diseñado por el legislador mexicano para integrar al parlamento federal. Estudio desarrollado a sabiendas de la importancia que reviste el sistema electoral como un medio que permite a los ciudadanos convertir su voto expresado en las urnas en escaños a favor de determinado candidato o partido. En dicho análisis tomamos en cuenta la evolución constitucional del sistema electoral mexicano, la participación de las fuerzas minoritarias en la integración del Senado y de la Cámara de Diputados, la división que se hace del territorio en circunscripciones electorales, la barrera electoral que se fija a los partidos políticos para acceder a la representación en el Parlamento, la fórmula de asignación que se aplica a la votación obtenida, para finalmente concluir que el sistema electoral mexicano es esencialmente mayoritario aun cuando se vista de proporcional.

Dimensión integral e interdisciplinaria del concepto de comportamiento del consumidor

OpenAIRE

Gil Hernández, Cleysi Yumara; Torres Estrada, Isabel Cristina; López Torres, Zulima Azeneth

2013-01-01

Este artículo busca analizar el aporte teórico que la economía, la antropología,la psicología, la sociología y la estética hacen al estudio del concepto decomportamiento del consumidor.El estudio del comportamiento del consumidor debe buscar una miradaintegral, que permita, desde diferentes saberes y disciplinas, comprender alsujeto, su entorno y sus prácticas de consumo.El estudio del consumidor no debe supeditarse exclusivamente a los momentosdel consumo; su comprensión implica un análisis ...

Identificación del genotipo del virus del papiloma humano en pacientes portadoras de lesiones cérvico uterinas

Directory of Open Access Journals (Sweden)

Alexander Morales Fontaine

2016-02-01

Full Text Available Fundamento: en los últimos años se ha observado un elevado predominio de mujeres infestadas por genotipos del  Virus del Papiloma Humano considerados de alto riesgo por su elevada oncogenicidad.Objetivo: identificar los genotipos del Virus del Papiloma Humano en pacientes portadoras de este con lesiones cervicales, cuyas biopsias fueron analizadas en el departamento de anatomía patológica, perteneciente al Hospital General Docente ¨Ernesto Guevara de la Serna¨, en el período comprendido entre enero de 2013 a diciembre de 2014.Métodos: se realizó un estudio descriptivo, de corte transversal, en 45 pacientes cuyas biopsias fueron tomadas de forma aleatoria de un total de 456 casos en los que se encontraron evidencias histopatológicas de infección por el  Virus del Papiloma Humano, en el período referido período de estudio. Las biopsias fueron enviadas al Laboratorio de Biología Molecular del departamento de Virología del Instituto de Medicina Tropical ´´Pedro Kourí´, a fin de aislar e identificar los tipos de este virus, involucrados en la patogénesis de las lesiones premalignas en estudio. Se utilizaron fuentes secundarias dadas por los resultados de la identificación del genotipo del virus aislado enviados desde dicha institución. Los datos se procearon según la estadística descriptiva, mediante el análisis porcentual.Resultados: en el 88,8 % de la muestra se obtuvo infestación por el Virus del Papiloma Humano, de alto riesgo de oncogenicidad, de ellos hay una preponderancia del genotipo 16, con 26 casos (57,7 % seguido del 31 con 12 aislamientos (26,6 % y 2 pacientes presentaron el genotipo 52 para el 4,4 %. El 6,6 % de la muestra resultó estar infestadas por el genotipo 11, el cual es considerado de bajo riesgo y en 2 casos no fue posible realizar la tipificación.Conclusiones: Existió gran predominio de pacientes afectadas por Virus de Papiloma Humano de alto riesgo de oncogenicidad.

Estudio de la relación del ascenso del nivel del Mar Caspio con el regadio en la Cuenca del Mar de Aral

OpenAIRE

Vidal Cruz, Rafael

2004-01-01

El nivel del Mar Caspio ha venido subiendo desde mediados de los años 60. Se plantea la conjetura de que este ascenso sea debido al augmento de las extensiones de cultivo situadas en las cuencas de regadío del Mar de Aral. Ello provoca un aumento de humedad atmosférica, que es transportada hacia la cuenca del Mar Caspio. El objetivo de la tesina es estudiar dicha conjetura.

POTENCIAL ENERGÉTICO DE RESIDUOS AGROINDUSTRIALES DEL DEPARTAMENTO DEL CAUCA, A PARTIR DEL PODER CALORÍFICO INFERIOR

Directory of Open Access Journals (Sweden)

DEYANIRA MUÑOZM

2013-12-01

Full Text Available Se determinaron los valores energéticos de los residuos agroindustriales del departamento del Cauca, mediante análisis del poder calorífico, datos técnicos reportados en las tablas estadísticas del Anuario Estadístico del Sector Agropecuario y Pesquero 2011 y con las expresiones simples presentadas en la metodología de Antolín G.G para el cálculo de variables energéticas.Los valores obtenidos del poder caloríficoen base seca fueron: 116187,97kJ/kgpara bagacillo de caña, 15419,95kJ/kg para polvillo de fique y 15262,18kJ/kg para afrecho de yuca.El valor promediodelas mezcla fue de 15623,35kJ/kg.Se concluye que 15623,35 kJ/kg representa la energía promedio que puede liberarse en un proceso de combustión deestos residuos y es comparable con la energía liberada por otras fuentes de biomasa. El potencial energético del bagacillo de caña con el valor de 163.45TJ/año, contribuye con el 35.73% de la energía, por lo cual ofrece mayores ventajas energéticas en comparación alvalor del afrecho de yuca,que tiene un potencial de 0.91 TJ/año. La mezcla con la mejor característica energética esta compuesta por 33.3% bagacillo de caña, 33.3% polvillo de fique y 33.3% afrecho de yuca y tiene un potencial energético de 48.39 TJ/año.

Habermas y Parsons: La búsqueda del reencantamiento del mundo

Directory of Open Access Journals (Sweden)

JOSÉ ENRIQUE RODRÍGUEZ IBÁÑEZ

1981-01-01

Full Text Available Se comparan las tradiciones críticas y analíticas a través de un análisis del concepto de Habermas sobre el "universal pragmático" (Comunicación y la evolución de la sociedad y la noción de Talcott Parson del "paradigma de la condición humana" (Teoría de la Acción y la condición humana. Habermas y Parsons insisten fuertemente en el elemento simbólico del lenguaje en la sociedad, tendente al misterio y el reencantamiento de las categorías epistemológicas fundamentales. Sus posiciones deben su identidad y sentido del futuro a la sociedad industrial avanzada. La recuperación por parte de Habermas del diálogo entre las esferas teórica ("universal pragmático" e histórica ("paradigma reconstructivo", rompiendo con las posiciones del marxismo y los creadores de la Escuela de Frankfurt, abren un camino esperanzador para la investigación. Se analiza el normativismo epistemológico oculto del "paradigma de la condición humana" de Parson a través de sus primeros trabajos. El conflicto entre las tradiciones analítica y crítica se atribuye a diferentes grados de énfasis normativo-subjetivos y generativo-intersubjetivos.

La psicología del ejercicio y del deporte en Brasil y América del Sur

OpenAIRE

Becker Júnior, Benno

2001-01-01

Es difícil determinar el inicio exacto de la Psicología del Ejercicio y Deporte en un país, mayormente en América del Sur, sin correr el riesgo de cometer varias injusticias, pues estos eventos tienen poca o ninguna divulgación. Los registros oficiales realizados por Feige (1977) muestran que la Psicología del Ejercicio y Deporte, en América del Sur, se inició en Brasil, en 1954 en el Departamento de Árbitros de la Federación Paulista de Fútbol. Ahora está en su quinta década, con 47 anos. Es...

Factores psicosociales del presentismo en trabajadores del Sistema de Salud chileno

Directory of Open Access Journals (Sweden)

Aldo Vera-Calzaretta

2015-01-01

Full Text Available Este estudio analizó los factores psicosociales que explicaban el presentismo o deterioro laboral autopercibido asociado a trabajar enfermo. La muestra fue de 676 trabajadores del sistema de salud chileno (84% de mujeres, M = 35.9 anos, en su mayoría enfermeras y técnicos paramédicos. Se aplicó un cuestiona- ˜ rio sociodemográfico, el Job Content Questionnaire, el Effort-Reward Imbalance, el Health Performance Questionnaire y una escala de interferencia del trabajo en la vida familiar. La regresión lineal explicó el 21% de la varianza del deterioro laboral percibido. Este último se asoció a asistir a trabajar enfermo. Los resultados sugieren que el deterioro del desempeno y asistir a trabajar enfermo son dos aspectos del ˜ mismo proceso. El ausentismo por razones de salud, la interferencia del trabajo en la vida familiar y la sintomatología emocional predijeron el deterioro laboral. Éste último se asoció negativamente a trabajar en turnos, controlando edad y salario. Los resultados sugieren que el presentismo es explicado por factores del contexto de trabajo y el conflicto trabajo-familia.

Acciones intersectoriales en la estimulación temprana del desarrollo del lenguaje

Directory of Open Access Journals (Sweden)

Déborah Magaly López Salas

Full Text Available Se realizó un análisis del proyecto "Acciones intersectoriales en la estimulación temprana del desarrollo del lenguaje" con el objetivo propiciar un estudio social sobre la gestión del conocimiento y la innovación tecnológica en la dirección de programas para la estimulación del desarrollo de menores en edad preescolar, desde la visión de ciencia, tecnología y sociedad. Se muestran conceptos afines al tema, necesarios en la comprensión de la idea de reorganización de los servicios vinculados a la estimulación y atención temprana del desarrollo del lenguaje desde la comunidad, con la participación de profesionales de diferentes instituciones, y se demuestra la necesidad de comprender los estudios de Ciencia, Tecnología y Sociedad como un campo de acción en la actualidad en Cuba.

Eficacia del difusor de feromona de procesionaria del pino Pherocon PPM®

OpenAIRE

Durán, María; Rodrigo Santamalia, Mª Eugenia; Pérez Laorga, Eduardo; Mas i Gisbert, Hugo

2012-01-01

Los resultados de este trabajo forman parte del trabajo de fin de carrera presentado en la Universidad Politecnica de Valencia por Maria Duran Lázaro y dirigido por la Dra. Eugenia Rodrigo Santamalia y Eduardo Perez Laorga con el titulo "Influencia del tipo de trampa en la captura de mariposas de la procesionaria del pino (Thaumetopoea pityocampa Schiff.) en la sierra Calderona" [ES] Se ha ensayado la eficacia de un difusor de la feromona de la procesionaria del pino fabricado por la em...

La luz del origen del universo

Directory of Open Access Journals (Sweden)

Casas, Alberto

2015-10-01

Full Text Available Penzias and Wilson discovered the cosmic microwave background, a luminous echo of the Big Bang, in 1965. The amount of information encoded in this relic of the early universe is truly extraordinary. At present, the most precise data about the origin and structure of the universe comes from the study of this primordial light, the full potential of which has yet to be explored.En 1965 se descubrió el fondo de radiación de microondas, un eco luminoso de la Gran Explosión (Big Bang. La cantidad de información contenida en esta reliquia del universo primitivo es verdaderamente extraordinaria. En la actualidad los datos más precisos sobre el origen y estructura del universo provienen del estudio de esta luz primigenia, que aún no ha sido explorada en todo su potencial.

Diámetro transverso del cerebelo fetal en la restricción del crecimiento intrauterino

OpenAIRE

Salazar de Dugarte, Guillermina

2011-01-01

Objetivo: Evaluar el comportamiento de la biometría del cerebelo fetal en su diámetro transverso, en los casos con restricción del crecimiento intrauterino. Ambiente: Servicio de Perinatología, Hospital "Dr. Adolfo Prince Lara", Puerto Cabello. Métodos: Estudio transversal, de correlación. En 1 569 fetos se realizó la biometría del diámetro transverso del cerebelo, para la construcción del nomograma del mismo. Se estableció una comparación entre los valores del diámetro transverso del cerebel...

Identificación del genotipo del virus del papiloma humano en pacientes portadoras de lesiones cérvico uterinas

OpenAIRE

Alexander Morales Fontaine; Odalys Rufina Peña Pérez; Alicia María Yabor Palomo; Vicente de Jesús Alvarez Yabor

2016-01-01

Fundamento: en los últimos años se ha observado un elevado predominio de mujeres infestadas por genotipos del  Virus del Papiloma Humano considerados de alto riesgo por su elevada oncogenicidad.Objetivo: identificar los genotipos del Virus del Papiloma Humano en pacientes portadoras de este con lesiones cervicales, cuyas biopsias fueron analizadas en el departamento de anatomía patológica, perteneciente al Hospital General Docente ¨Ernesto Guevara de la Serna¨, en el período comprendido entre...

Liderazgo del director y el compromiso organizacional de los docentes del nivel secundario de las Instituciones Educativas del distrito de Chancay, 2014

OpenAIRE

Velásquez García, Luis Alberto

2015-01-01

El presente estudio se centra en describir cómo se relaciona el liderazgo del director y el compromiso organizacional de los docentes del nivel secundario de las Instituciones Educativas del distrito de Chancay, 2014. El nivel de la presente investigación es cuantitativo de tipo descriptivo correlacional. La muestra es probabilística de 117 docentes del nivel secundario de las Instituciones Educativas del distrito de Chancay, 2014. Los instrumentos utilizados para observar ...

Consideraciones preliminares entorno del pensamiento pedagógico del Profesor

Directory of Open Access Journals (Sweden)

JEFFER HARVEY CABEZAS

2011-01-01

Full Text Available El pensamiento pedagógico del profesor, como un mar insondable, es hoy en día, un referente primordial dentro del devenir propio de la Educación, adquiere sentido a partir de lo que el profesor siente, piensa, dice y hace. Por eso, esta reflexión surge como producto de la necesidad de establecer un miramiento entorno del pensamiento pedagógico del profesor desde algunas tipologías pedagógicas que en marcan la práctica pedagógica del profesor, las cuales sugieren una manera de cómo el profesor asume la pedagogía, y por tanto, se visibiliza en las acciones de aula, en donde ella se piensa desde las posibilidades individuales y colectivas del profesor. En donde la pedagogía es la oportunidad de la reflexión, para aminorar la brecha existente entre la teoría y la práctica, para tejer las relaciones que se enmarcan en los ambientes de aprendizaje; es decir, en ese espacio conceptual, donde estudiantes y profesores son sujetos epistemológicos, éticos y políticos que conforman parte activa de la sociedad.

Análisis del efecto del fuego y de la presencia de contaminantes sobre la actividad y biodiversidad microbiana del suelo

OpenAIRE

Turmero Hidalgo, Adriana Isabel

2013-01-01

La salud de un suelo se puede definir como la capacidad del mismo para funcionar como un sistema vivo dentro de un ecosistema, sustentar la productividad biológica, promover la calidad ambiental y mantener la salud de plantas, animales y del hombre. El concepto de salud del suelo se relaciona, por tanto, con las características biológicas, químicas y físicas del mismo, que son esenciales para una productividad agrícola sostenible a largo plazo, con un mínimo impacto ambiental. El estudio del...

Efectividad del uso del mate de coca en la reducción del estrés laboral en

OpenAIRE

Rivera-Encinas, María Teresa

2016-01-01

Objetivo: Evaluar la efectividad del uso del mate de coca en la reducción del estrés laboral en administrativos de una universidad y determinar sus principales características sociodemográficas.Material y métodos: Se aplicó el cuestionario para la detección del estrés laboral de la OIT/OMS a dos grupos de trabajadores, experimental (10) y control (10), empleando randomización simple. Se hizo un experimento cruzado en 31 días, utilizando mate de coca y agua para cada grupo. Se utilizó el análi...

Microempresas del sector formal de comercio en Cuernavaca, Morelos, y contratación del capital humano (2000-2006. El aprovechamiento del régimen del riesgo

Directory of Open Access Journals (Sweden)

Philippe Dautrey

2009-01-01

Full Text Available Las transformaciones del entorno, como la apertura comercial y la difusión de las nuevas tecnologías de la información y de la comunicación (TIC pueden explicar las prácticas nuevas de contratación en las microempresas del sector formal de comercio, el más dinámico en la zona metropolitana de Cuernavaca, capital del estado de Morelos. ¿Cuál es entonces e nivel educativo que requiere el capital humano para ser contratado?, ¿son la competencia comercial y el uso de la informática los únicos factores explicativos de dichas prácticas? De hecho, la extensión del régimen del riesgo global, esto es, el incremento de la precariedad laboral y del desempleo hace que se contrate a personas que sean "empleables" de inmediato, y que parte de la capacitación en el trabajo sea externa, limitándola así a ciertas categorías de trabajadores.

L'ampliamento della teoria del linguaggio letterario e l'analisi del fatto letterario

OpenAIRE

Albaladejo Mayordomo, Tomás; Chico Rico, Francisco

2010-01-01

El presente estudio aborda el problema de la ampliación de la teoría del lenguaje literario hacia lo que podemos llamar una «teoría del hecho literario» a lo largo del siglo XX. Dicha ampliación ha tenido lugar gracias al desarrollo de la Poética lingüística como teoría del texto literario de amplitud semiótica y abarcadora, por tanto, del conjunto del hecho literario y mediante el empleo de otras perspectivas teórico-críticas de raigambre no lingüístico-inmanentista que potencian la atención...

Reconstrucción del enfoque del aumento y generación del efectivo para la Pyme de manufactura

Directory of Open Access Journals (Sweden)

Igor Rivera González

2011-01-01

Full Text Available Este artículo parte de la hipótesis de que el aumento continuo del efectivo es el objetivo principal dentro de las pequeñas y medianas empresas privadas de manufactura3. Nuestra finalidad es realizar una propuesta teórica acerca de cómo definir la paramétrica referida al aumento del efectivo en un periodo a través del análisis de la forma en que se genera el efectivo dentro de las pequeñas y medianas empresas (Pyme de trasformación; para ello, se resalta la importancia de tres elementos clave que intervienen en la generación del efectivo: a el proceso de transformación, b la optimización del flujo de materiales y de información y c la creación de valor.

del alcoholismo

Directory of Open Access Journals (Sweden)

Rodrigo Arias Duque

2005-01-01

Full Text Available Desde el punto de vista farmacológico, es importante comprender qué es el alcohol y cómo actúa en el organismo. No existe una causa simple, sino una interacción complicada de factores neuroquímicos, fisiológicos, psicológicos y sociales que originan y desarrollan esta grave enfermedad fármaco-dependiente. La acción psicofisiológica y farmacodinámica del alcohol es fundamentalmente depresiva, por la reducción de la transmisión sináptica en el sistema nervioso humano. Es un hecho conocido que el consumo excesivo de alcohol causa una disfunción aguda y crónica del cerebro, produciendo trastornos en el sistema nervioso central, presentando alteraciones en la memoria y en las funciones intelectuales como cálculo, comprensión y aprendizaje. A nivel hepático tiene lugar, en su mayoría, el metabolismo del alcohol, produciéndose un hígado graso alcohólico, aumentando el tamaño, terminando en necrosis e inflamación grave del hígado; esto se llama hepatitis alcohólica, y si se sigue consumiendo alcohol se desarrollará la cirrosis. El alcohol también ha estado relacionado con alteraciones del miocardio; se ha constatado en animales de experimentación sanos que tanto la velocidad de contracción del músculo cardiaco y su máxima tensión disminuyen en presencia del alcohol, como consecuencia, la fuerza de cada contracción y el aumento de presión en el ventrículo izquierdo son menores, perdiendo eficacia el corazón como bomba.

La aplicación del principio del equilibrio económico a contratos estatales sometidos al régimen normativo del derecho privado

Directory of Open Access Journals (Sweden)

Manuela Canal-Silva

2016-06-01

Full Text Available En vista de la importancia del equilibrio económico del contrato dentro del marco de la contratación pública, el presente artículo pretende demostrar la procedencia de su aplicación a los contratos estatales sometidos al régimen del derecho privado. Mediante la reflexión y el estudio de la jurisprudencia sobre el tema se presentarán los principales motivos expuestos por las providencias que apoyan la tesis planteada. Se exponen así los temas del interés colectivo y los preceptos constitucionales como bases de este principio del equilibrio económico. Para luego examinar la conmutatividad del contrato y el debate frente a la consideración del equilibrio económico como un principio transversal al derecho público y privado.

Imaginarios persistentes en las narrativas sobre la invasión del Tawantinsuyu : estudio del caso del secuestro y magnicidio del Hanan Inka Atawallpa, ocurridos en Cajamarca (Perú: 1532 y 1533)

OpenAIRE

Ontiveros, Asunción

2014-01-01

Ontiveros, Asunción. (2015). Imaginarios persistentes en las narrativas sobre la invasión del Tawantinsuyu. Estudio del caso del secuestro y magnicidio del Hanan Inka Atawallpa, ocurridos en Cajamarca (Perú: 1532 y 1533) (Tesis de posgrado). Universidad Nacional de Quilmes, Bernal, Argentina: Repositorio Institucional Digital de Acceso Abierto. Disponible en: http://ridaa.demo.unq.edu.ar La producción de narrativas y o formas simbólicas relacionadas a los acontecimientos del secuestro y m...

Determinantes del acceso al internet: Evidencia de los hogares del Ecuador

OpenAIRE

Botello-Peñaloza, Héctor Alberto

2015-01-01

El objetivo del artículo se centra en investigar los determinantes del uso de Iinternet en los hogares ecuatorianos en 2013, incorporando sus características socioeconómicas dentro de un modelo de elección discreta que realiza estimaciones sobre la probabilidad del uso de internet dentro del hogar con base en los microdatos de la encuesta de uso de TIC. Los principales hallazgos sugieren que el ingreso y el grado de educación de los individuos ejercen las mayores influencias positivas en el u...

DIAGNÓSTICO DEL SECTOR TURÍSTICO DEL CANTÓN BOLÍVAR

OpenAIRE

Johnny Patricio Bayas Escudero; Carmen Adriana Álvarez Bermúdez; David Reinaldo García Moreira; José Rafael Vera Vera

2013-01-01

Con el propósito de realizar el diagnóstico del sector turístico del cantón Bolívar, se partió, inicialmente, de la identificación de los recursos y atractivos turísticos existentes, asi como su nivel de incidencia en el desarrollo de esta jurisdicción, para posteriormente, proponer los potenciales productos turísticos que permitan la implementación de planes y programas de desarrollo del turismo. Para el cumplimiento de estos objetivos, se realizó una caracterización general del territorio, ...

Unexpected Behavior of Enaminones: Interesting New Routes to 1,6-Naphthyridines, 2-Oxopyrrolidines and Pyrano[4,3,2-de][1,6]naphthyridines

Directory of Open Access Journals (Sweden)

Herbert Meier

2012-12-01

Full Text Available Reaction of enaminones 1a–d with 2-aminoprop-1-ene-1,1,3-tricarbonitrile (2 in the presence of AcOH/NH4OAc afforded 7-amino-5-oxo-5,6-dihydro-1,6-naphthyridine-8-carbonitrile derivatives 9a–d. On the other hand, 2-aminopyrano[4,3,2-de] [1,6]naphthyridine-3-carbonitriles 20a–c,e were the only obtained products from the reactions of 1a–d with 2 in the presence of AcOH/NaOAc, while 1d afforded [3,5-bis-(4-chloro-benzoyl-phenyl]-(4-chloro-phenyl-methanone 21 under the same condition. The reaction of 2 with diethyl acetylenedicarboxylate in the presence of AcOH/NH4OAc afforded (4-cyano-5-dicyanomethylene-2-oxo-2,5-dihydro-1H-pyrrol-3-yl-acetic acid ethyl ester 15B.

Alcance del principio de eficacia directa del derecho comunitario andino en el ámbito de la propiedad industrial y del derecho del consumidor en el ordenamiento jurídico colombiano

OpenAIRE

Pachón Guerrero, Juan Sebastián

2017-01-01

Tesis sobre el alcance del principio de eficacia directa del derecho comunitario andino en el ámbito de la propiedad industrial y del derecho del consumidor en el ordenamiento jurídico colombiano Thesis related to the scope of the principle of direct effectiveness of andean community law in the field of industrial property and consumer law in the Colombian legal system

Acerca del nombre del Perú en la actual Colombia

Directory of Open Access Journals (Sweden)

Juan Friede

1962-03-01

Full Text Available Como es sabido, la adaptación del nombre "Perú" al Imperio Incaico es de origen netamente español. Los indios del Perú no llamaban así a su territorio, como lo confirman Valera, Cieza de León, Montesinos, Garcilaso y otros. Tenían nombres para designar las distintas provincias pero no para la totalidad del imperio de los incas.

Consistencia interna del cuestionario autoadministrado de la Entrevista Clínica Estructurada para Trastornos del Eje II del DSM-IV*

OpenAIRE

Campo-Arias, Adalberto; Díaz-Martínez, Luis Alfonso; Barros-Bermúdez, Jaider Alfonso

2008-01-01

Introducción: Es infrecuente identificar posibles casos de trastornos de personalidad en la población general, debido a la carencia de instrumentos autoadministrados con buena validez y confiabilidad. Hasta la fecha no se ha explorado la confiabilidad del cuestionario autoadministrado de la Entrevista Clínica Estructurada para Diagnósticos del eje II (SDID-II) del DSM-IV en la población colombiana. Objetivo: Determinar la consistencia interna de las subescalas del cuestionario autoadministrad...

Determinantes en el proceso del despliegue del valor para la innovación

Directory of Open Access Journals (Sweden)

Juan Mejía Trejo

2016-03-01

Full Text Available El estudio tiene como objetivo hallar las determinantes en el proceso del despliegue del valor para la innovación de productos. la metodología, basada en investigación documental, descubre tres áreas: I: qfd modificado, donde se consideran las percepciones ponderadas del consumidor de necesidades, satisfacción y desempeño de los diferentes atributos y características de los productos y servicios a través de voces denominadas: del consumidor, la mercadotecnia, la tecnología, los requerimientos y la firma; área II: valorprecio y costo de retención del consumidor, en la que se calcula el precio justo del producto objetivo a innovar respecto de sus competidores y costo de retener al consumidor; área III: difusión de la innovación, que permite visualizar el mercado de adoptadores del producto objetivo a innovar. El proceso es posible visualizarlo en un solo plano, por lo que se propone su denominación como despliegue del valor para la innovación de productos (dvip.

Análisis del documental “Las raices del conflicto: Palestina- Israel”

OpenAIRE

Espinosa Seguí, Ana

2011-01-01

El documental "Las raices del conflicto: Palestina- Israel" nos va a servir para analizar diversos elementos del conflicto entre Israel y Palestina, como la evolución histórica del conflicto, las fronteras exteriores e interiores de Israel y Palestina, los conflictos de Israel con los países vecinos, el conflicto por el agua, la creación del estado de Israel y su crecimiento posterior o el problema de los refugiados palestinos.

Vigencia del Darwinismo

OpenAIRE

Lessa, Enrique P

2009-01-01

En este ensayo se presenta una revisión histórica del signifcado y legado del darwinismo, con énfasis en el último siglo. La principal conclusión es que la visión darwiniana de la evolución, con las modifcaciones requeridas para dar cuenta de los grandes desarrollos de la disciplina, se ha impuesto y mantiene vigencia en nuestros días. En particular, el papel del azar, la evolución como proceso de “descendencia con modifcación” a lo largo de diversas ramas del árbol de la vida, el pensamiento...

Determinantes del acceso al internet: Evidencia de los hogares del Ecuador

Directory of Open Access Journals (Sweden)

Héctor Alberto Botello-Peñaloza

2015-01-01

Full Text Available El objetivo del artículo se centra en investigar los determinantes del uso de Iinternet en los hogares ecuatorianos en 2013, incorporando sus características socioeconómicas dentro de un modelo de elección discreta que realiza estimaciones sobre la probabilidad del uso de internet dentro del hogar, con base en los microdatos de la encuesta de uso de TIC. Los principales hallazgos sugieren que el ingreso y el grado de educación de los individuos ejercen las mayores influencias positivas en el uso de internet, al igual que se evidencian brechas significativas de género, con un asentamiento en las áreas rurales más que en las urbanas, especialmente por la falta de infraestructura. Estos resultados destacan la importancia de la intervención pública en el aumento del acceso a las nuevas tecnologías, a la vez que el papel del capital humano en la reducción de las brechas sociales en Ecuador.

SISTEMA INFORMÁTICO PARA LA GESTIÓN DEL TALENTO HUMANO DEL GOBIERNO MUNICIPAL DEL CANTÓN BOLÍVAR

OpenAIRE

Angel Cristian Mera Macías; Daniela Vera Vélez

2016-01-01

Esta investigación tuvo como objetivo la creación e implementación de un sistema informático para la gestión del talento humano del Gobierno Autónomo Descentralizado Municipal del cantón Bolívar. Durante el estudio se determinó cómo la organización en mención gestiona la información del talento humano y la manera en la que se podría mejorar dicha tarea, es así que mediante la aplicación de encuestas a los clientes internos y externos se determinó que existían dificultades en dicho pr...

El movimiento estudiantil chileno del 2011 en intervenciones discursivas del Presidente Piñera

Directory of Open Access Journals (Sweden)

Claudio Araya Seguel

2014-06-01

Full Text Available Este artículo muestra evidencia lingüístico-discursiva del intento del Presidente Piñera por acallar las influencias sociales del movimiento estudiantil chileno del año 2011. Desde una mirada crítica se da cuenta del comportamiento discursivo de este hablante en el marco del primer conflicto social que enfrentó el nuevo gobierno de derecha en Chile. El valor teórico-metodológico de este estudio radica en la mirada triangular a las intervenciones discursivas. A través del análisis de un corpus de cuatro intervenciones presidenciales desde las perspectivas de las funciones estratégicas del discurso político, la teoría de la valoración y la lingüística de corpus se observa cómo Piñera deslegitima al movimiento social asociando las demandas referidas a educación con la violencia y el desorden público generado en el contexto de las crecientes marchas a lo largo del país.

Vigilando la Calidad del Agua de los Grandes Rios de la Nacion: El Programa NASQAN del Rio Grande (Rio Bravo del Norte)

Science.gov (United States)

Lurry, Dee L.; Reutter, David C.; Wells, Frank C.; Rivera, M.C.; Munoz, A.

1998-01-01

La Oficina del Estudio Geologico de los Estados Unidos (U.S. Geological Survey, 0 USGS) ha monitoreado la calidad del agua de la cuenca del Rio Grande (Rio Bravo del Norte) desde 1995 como parte de la rediseiiada Red Nacional para Contabilizar la Calidad del Agua de los Rios (National Stream Quality Accounting Network, o NASOAN) (Hooper and others, 1997). EI programa NASOAN fue diseiiado para caracterizar las concentraciones y el transporte de sedimento y constituyentes quimicos seleccionados, encontrados en los grandes rios de los Estados Unidos - incluyendo el Misisipi, el Colorado y el Columbia, ademas del Rio Grande. En estas cuatro cuencas, el USGS opera actualmente (1998) una red de 40 puntos de muestreo pertenecientes a NASOAN, con un enfasis en cuantificar el flujo en masa (la cantidad de material que pasa por la estacion, expresado en toneladas por dial para cada constituyente. Aplicacando un enfoque consistente, basado en la cuantificacion de flujos en la cuenca del Rio Grande, el programa NASOAN esta generando la informacion necesaria para identificar fuentes regionales de diversos contaminantes, incluyendo sustancias qui micas agricolas y trazas elementos en la cuenca. EI efecto de las grandes reservas en el Rio Grande se puede observar segun los flujos de constituyentes discurren a 10 largo del rio. EI analisis de los flujos de constituyentes a escala de la cuenca proveera los medios para evaluar la influencia de la actividad humana sobre las condiciones de calidad del agua del Rio Grande.

Resultados del tratamiento a pacientes con tríada terrible del codo

Directory of Open Access Journals (Sweden)

Héctor Gabriel Díaz Carrillo

2015-04-01

Full Text Available La luxación del codo, asociada a la fractura del proceso coronoideo y a la fractura de la cabeza radial, es denominada “tríada terrible del codo”, debido a la complejidad al abordar el tratamiento correcto y lo desalentador de los resultados que se obtienen con el mismo. Se realizó un estudio prospectivo, donde se recogen los resultados postoperatorios, obtenidos en cuatro pacientes con inestabilidad traumática aguda del codo, tratados entre enero de 2012 y mayo de 2013, que acudieron inicialmente al cuerpo de guardia del Hospital General Docente “Dr. Ernesto Guevara de La Serna” y tuvieron un seguimiento medio de ocho meses. El proceder consistió en reparación de la coronoides, del ligamento lateral externo, reparación de la cúpula radial, cupulectomía y colocación de pin endomedular; la técnica operatoria a emplear se definió por los estudios radiográficos realizados y los hallazgos en el transcurso del proceder. Los pacientes, tres hombres y una mujer, tuvieron cinco codos lesionados y un promedio de edad de 34 años. Como resultado del tratamiento la flexión fue normal entre 130-135° en 4 codos y limitada en uno a 110°, la extensión se encontró limitada de 8 a 21° en todos los pacientes, la pronosupinación se mantuvo limitada en todos los casos entre 5 y 22°. La intervención quirúrgica mediante fijación y reparación de los estabilizadores del codo proporcionó a corto plazo una funcionabilidad del codo cercana a la normalidad, los pacientes evolucionaron positivamente. Las complicaciones fueron: reluxación, infección local y aflojamiento de la osteosíntesis

DİŞ HEKİMLİĞİNDE ORAL CERRAHİ İŞLEMLER SONRASINDA EN ÇOK TERCİH EDİLEN ANALJEZİK İLAÇLAR (NSAİ) VE ETKİNLİKLERİ

OpenAIRE

KÖSE, İbrahim; KOPARAL, Mahmut; ALAN, Hilal; KIRTAY, Mustafa; ÇİÇEK, Yasin

2015-01-01

Diş hekimliğinde özellikle oral cerrahi müdahaleler neticesinde  ağrı, şişlik ve trismus gibi rahatsızlıklar meydana gelebilmektedir. Kuşkusuz, meydana gelen problemler ve inflamatuvar süreci farmakolojik olarak kontrol altına almak amacıyla birçok analjezik ilaç kullanılmaktadır. Bu çalışmanın amacı; oral cerrahi müdahaleler sonrası kullanılan ağrı kesici ilaçların, kullanımı ve etkinliği konusundaki mevcut bilgileri güncellemek ve daha önce yapılmış çalışmaların ışığı altında uygulama yönte...

Gerencia del cuidado-gerencia del servicio

Directory of Open Access Journals (Sweden)

Marta Palmet Jiménez

2016-01-01

Full Text Available La gerencia de este siglo debe estar plenamente identificada con la administración para planear, organizar, decidir y obtener resultados definidos, evaluados y alcanzados a través de las personas. Para poder gerenciar el cuidado se debe saber administrar. El objetivo de enfermería es cuidar; el objetivo de la gerencia es la conducción de la producción de bienes o servicios en las organizaciones. La gerencia del cuidado implica: motivación, creatividad, responsabilidad y ética por parte del cuidador y de quien cuida, claridad de actitud frente al ser y al qué hacer por parte del cuidador. Se puede concluir que la gerencia (administración, el cuidado (producto de calidad, el servicio (valor intangible, querer servir son un trinomio que deben ir de la mano de manera integrada para el logro de los objetivos propuestos por la organización de salud y de enfermería.

LA GESTIÓN DEL SUPERMERCADO VIRTUAL: TIPIFICACIÓN DEL COMPORTAMIENTO DEL CLIENTE ONLINE

Directory of Open Access Journals (Sweden)

Marimon Viadiu, Frederic

2011-01-01

Full Text Available Este artículo analiza diferentes elementos que influyen en el comportamiento de compra del cliente de un supermercado online. Estos elementos están relacionados tanto con aspectos estéticos del sitio web, como con los procesos que tienen lugar en el momento de realizar la compra. A partir de este análisis, se estudian los distintos grupos de consumidores con comportamientos homogéneos y se posicionan en función de sus actitudes. El análisis también permite definir la calidad del servicio prestado por este tipo de establecimientos, así como las principales dimensiones en que se despliega. En las conclusiones se citan aspectos en los que el gestor de un supermercado online debe incidir para mejorar la calidad de su servicio.

Guía del investigador americanista para San Luís del Potosí novohispano

OpenAIRE

Montoya, Ramón Alejandro

2012-01-01

El trabajo aborda uno de los temas menos abarcados por la historiografía del norte de la Nueva España : la familiarización de la heurística sobre una región minera septentrional del México Colonial. El objetivo del trabajo es dar a conocer las vetas documentales para los estudiosos del norte de la Nueva España y no necesariamente de la jurisdicción de San Luis Potosí. Para eso proponemos una enumeración detallada de acervos y colecciones documentales del interior del país y del extranjero con...

Agendas visuales y procesos, elementos básicos en la vida del alumnado con Trastorno del Espectro del Autismo

OpenAIRE

Rodríguez Molino, Joana

2014-01-01

Este Trabajo Fin de Grado comienza haciendo un repaso de las definiciones y características asociadas a los Trastornos del Espectro del Autismo para poder considerar las pautas de intervención más acertadas a seguir con este alumnado. También se hace hincapié en los Sistemas Alternativos y Aumentativos de Comunicación como medio de comunicación y aprendizaje para estos niños/as. Se presenta una propuesta de intervención educativa llevada a cabo con un niño con Trastorno del Espectro del A...

Asociación del trastorno del desarrollo de la coordinación con otros trastornos del desarrollo infantil en la ciudad de Cali

OpenAIRE

Riascos Alpala, Alexander; Velez Correa, Diana Lizeth; Acosta Alvarez, Yuri Andrea

2016-01-01

INTRODUCCION. El trastorno del Desarrollo de la Coordinación TDC en la infancia es una problemática importante desde la salud pública, ya que tiene repercusiones importantes desde las diferentes esferas del desarrollo: motora, cognitiva, psicosocial y emocional, por lo mismo, es frecuente la presencia de comorbilidad con otros trastornos del desarrollo infantil. Se presenta un estudio multicéntrico que caracteriza la asociación del TDC con otros trastornos del desarrollo. OBJETIVO. Determ...

Antonio Zambrana Lara, docente y pintor. Técnica y procedimientos dentro del Realismo Sevillano del último tercio del siglo XX

OpenAIRE

Domínguez Moreno, Gustavo

2012-01-01

El trabajo que aquí se presenta, cuyo título es Antonio Zambrana Lara, docente y pintor. Técnica y procedimiento dentro del Realismo Sevillano del último tercio del siglo XX, procurará analizar en profundidad las cuestiones relacionadas con la personalidad artística de Antonio Zambrana, a través de diversos asuntos, como por ejemplo su contextualización, intentando profundizar en un momento apasio nante del arte sevillano y especialmente en aquellos apartados que de manera más concreta se ref...

El sentido cultural del cuidado en casa del enfermo

Directory of Open Access Journals (Sweden)

Marina Sánches-Sanabria

2008-12-01

Full Text Available Esta investigación tiene un diseño cualitativo descriptivo, transversal para comprender las diferencias existentes en los conocimientos, actitudes y prácticas influidas por la percepción o sentido cultural de cuidar del cuidador primario, como elemento básico para caracterizar elementos culturales presentes en el ambiente de cuidado al enfermo o discapacitado que está en casa a través de la indagación profunda de la percepción y sentimientos que tiene tanto el cuidador primario como el ser cuidado en casa. Se realizó con los usuarios inscritos del Programa de Promoción y Prevención de la indagación profunda de la percepción y sentimientos Universidad Popular del Cesar (IPS-UPC de los enfermos crónicos y discapacitados a nivel comunitario del grupo extramural de la comuna cinco y del Hospital Eduardo Arredondo Daza de la ciudad de Valledupar, Colombia. El valor de realizar este proyecto, está en desocultar los múltiples significados que en la realidad vivida por los seres cuidadores primarios y en los seres cuidados; son esas distintas formas de percibir la existencia, influido por el conocimiento de lo ancestral, los sentimientos y la sabiduría de la cultura que cada uno posee para expresarse en las múltiples formas que el cuidado lo acontece y lo requiere para dar el sentido cultural característico y diferenciado que se percibe en el modo de cuidar y la satisfacción de quien lo recibe y lo ofrece. Este aspecto fue valioso para la comunidad académica del programa de enfermería, porque ubicó epistémicamente la transculturalidad del cuidado como una mirada y forma de enseñar transdisciplinariamente, enseñando y ofreciendo el cuidado desde la cultura, sentimientos y pensamientos del ser cuidado para el mantenimiento de la vida y la salud, en la que estudiantes de enfermeria desde sus primeras experiencias formativas deben incursionar en la intervención holística que se requiere en el cuidado de la salud y de la vida.

Las reformas del Estado, de las políticas sociales y de salud: Un balance del final del milenio

Directory of Open Access Journals (Sweden)

Gerschman Silvia

1999-01-01

Full Text Available El presente trabajo se propone reflexionar sobre las reformas de los sistemas de salud y de políticas sociales en el marco de las así llamadas reformas del Estado. Com esta finalidad, se busca como punto de partida condensar distintas visiones explicativas de la crisis del Estado de Bienestar, presentes en la bibliografía produzida en la década de los 90. En el corazón de la crisis, las políticas sociales se encuentran profundamente cuestionadas. Lo que pretendemos mostrar es que este argumento posee una función específica, que es la de introducir mudanzas de carácter neoliberal en la política económica y para las cuales los instrumentos económicos utilizados van a generar la abstención del Estado en el plano social, la desregulación de las economías nacionales en favor del libre mercado y, fundamentalmente, el papel sobredimensionado del mercado financiero internacional. En este contexto, son analizadas las reformas de la seguridad social y de los sistemas de salud. La última parte del trabajo tuvo por objetivo enfrentar las dificultades que las políticas sociales presentan en el contexto actual, trayendo al centro del debate un mapeamiento de las alternativas posibles para el desarrollo de las políticas sociales y de salud.

Psicodrama del duelo.

OpenAIRE

José Antonio Espina Barrio; Marisol Filgueira Bouza

1997-01-01

La pérdida de rituales agrava y alarga la reacción del duelo. Se define el Psicodrama Antropológico y su intervención en el proceso del duelo. El Psicodrama Focal del Duelo es una psicoterapia breve centrada en el proceso de Duelo. Se comentan varios casos y resultados. Se concluye con un programa sencillo para el duelo en Atención Primaria.

La Cultura del Vino, motor del desarrollo sostenible de las regiones vitivinícolas

Directory of Open Access Journals (Sweden)

Luisa González-SanJosé Ma

2017-01-01

Full Text Available Existen bastantes evidencias para vincular la cultura del vino con el entorno y el desarrollo sostenible. En primer lugar, destaca que la cultura del vino es el reflejo del aprovechamiento vitivinícola del medio y, por tanto, refleja su efecto sobre el desarrollo social y económico de las regiones, lo que es plausible a través del devenir histórico de las mismas. Más recientemente, el aprovechamiento de la cultura del vino para su explotación a través de las experiencias enoturísticas, ha supuesto una revalorización de muchos territorios, impulsando el desarrollo social y económico. La cultura del vino no es sólo el eje temático de la actividad enoturística, sino que es su base y pilar esencial, por tanto, se relaciona directamente con la sostenibilidad ambiental, económica y social que subyace tras el enoturismo. Además, es importante tener en cuenta que gran parte de la importancia de la cultura del vino se centra en las señas de entidad asociadas a cada territorio, que aportan características distintivas y singulares, contribuyendo a la sostenibilidad cultural. En España, ACEVIN y el Rutas del Vino de España son claros ejemplos de como la cultura del vino es un motor del desarrollo sostenible de las regiones vitivinícolas.

Ecuador y los objetivos del milenio : inversiones para la conservación del agua

Directory of Open Access Journals (Sweden)

Fabián Rodríguez

2013-09-01

Full Text Available El presente estudio analiza si se justifica la inversión en la protección del Sistema Nacional de Áreas Protegidas (SNAP. El nivel de inversión del Estado ecuatoriano fue estimado a partir de las necesidades de financiamiento del SNAP. Los beneficios económicos fueron estimados a partir de la oferta de agua de las áreas protegidas que se encuentran a lo largo de la Cordillera de los Andes. La metodología para evaluar si es conveniente o no la inversión del Estado en la protección del SNAP fue la relación beneficio - costo (B/C. Los resultados del estudio demuestran que solo los valores piso de la relación B/C justifican la inversión del Estado.

Determinación del requerimiento hídrico del pimentón en el municipio de Candelaria, departamento del Valle del Cauca Water requeriments of pepper in Candelaria, Valle del Cauca, Colombia

Directory of Open Access Journals (Sweden)

Adriana Gómez Enríquez

2010-10-01

Full Text Available Se realizó un ensayo con el fin de determinar el requerimiento hídrico del pimentón Capsicum annuum variedad Unapal-Serrano, en la zona de Candelaria-Valle del Cauca (Colombia. Se determinó que el pimentón requiere 425mm de agua durante su ciclo vegetativo, obteniendo una eficiencia del uso del agua de 5.32 kg/m³ de fruto fresco y de 0.5 kg/m³ en términos de materia seca. Además, se comprobó la eficiencia del microevaporímetro 'MIEVHR' como herramienta para programación del riego y estudios hidrológicos.A trial was carried out in order to determining the water requirement of the pepper Capsicum annuum variety UNAPAL- Serrano in the zone of Candelaria -Valley of the Cauca (Colombia and to evaluate the efficiency of the microevaporímeter 'MIEVHR' as estimator of the evaporation. It was determined that the pepper requires 425mm of water during the cycle vegetative obtaining an efficiency of the use of the water of 5.32 Kg/m³ of fresh fruit and 0.5 kg/m³ in terms of dry matter. Besides, it was verified the microevaporímeter efficiency 'MIEVHR' as tool for programming of the irrigation.

Detección, transmisión y caracterización del fitoplasma asociado a la enfermedad del decaimiento del peral

OpenAIRE

Garcia i Chapa, Meritxell

2004-01-01

Consultable des del TDX Títol obtingut de la portada digitalitzada Se ha realizado una prospección en 1500 parcelas de cultivo de peral, para evaluar la extensión de la enfermedad del Decaimiento del peral (PD) en el Nordeste de España. Un 7% de las parcelas observadas presentaron síntomas de la enfermedad. Paralelamente, se ha evaluado la incidencia de la enfermedad en 45 de estas parcelas, por inspección visual de 500 árboles, en cada una de ellas. La presencia del fitoplasma fue conf...

Gestión del subsistema Activos Fijos Tangibles del sistema Cedrux.

Directory of Open Access Journals (Sweden)

Larisa González Álvarez

2009-12-01

Full Text Available En aras del fortalecimiento de la gestión de entidades y la informatización de la sociedad, Cuba se encuentra inmersa en la creación del producto Cedrux, basado en los principios de independencia tecnológica y en las particularidades de la economía cubana. Esta solución nacional incluye un subsistema para el control de los activos fijos tangibles (AFT, que pretende servir de apoyo a la toma de decisiones en las entidades. El subsistema es capaz de gestionar activos de forma dinámica, tributa mediante operaciones al sistema contable de la empresa y estandariza el tratamiento de los AFT a nivel nacional. Incluye además temas como la multimoneda, la agrupación de activos y la generación de documentos, prestaciones del sistema que responden a necesidades del país, actualmente no satisfechas de manera conjunta por los sistemas existentes. A partir de la puesta en marcha del sistema, la economía del país se verá favorecida y el control de los AFT será confiable, estable y legalmente correcto.

Estado del Medio Ambiente Marino y Costero del Pacífico Sudeste.

OpenAIRE

Andrade V., Héctor; Guitiérres S., Sixto; Andrade C., Héctor

2014-01-01

El presente documento contiene los antecedentes sistematizados sobre el Estado del Medio Ambiente Marino Costero del Pacífico Sudeste en base a los informes nacionales de consultoría elaborados entre 2011 y 2012 en Panamá, Colombia, Ecuador, Perú y Chile y cuya finalidad fue establecer un estado actualizado del medio marino a nivel regional, en el marco del Programa CONPACSE III de la Comisión Permanente de Pacífico Sur. Los principales contaminantes presentes en las aguas marinas costeras de...

PHMB: Utilización del apósito de espuma antimicrobiana (AMD KendallTM (PHMB 0,5% en el tratamiento de las heridas crónicas PHMB: The role ok KendallTM AMD Antimicrobial Foam Dressing (0.5% PHMB in the treatment of wounds

Directory of Open Access Journals (Sweden)

John Timmons

2010-03-01

Full Text Available Abordamos la parte más problemática del tratamiento de las heridas crónicas o agudas, de acuerdo con los profesionales especializados es la infección de la herida. La sobrecarga bacteriana puede retardar la curación de la herida y disminuir la calidad del paciente como consecuencia del aumento del dolor, del exudado y del posible mal olor. Se han recopilado casos clínicos durante los últimos 6 meses en una unidad especializada en el cuidado de heridas de los hospitales Doncaster y Bassetlaw, RU. Estos casos ilustran la variedad de tipos de herida que pueden tratarse con éxito con el nuevo apósito de Espuma antimicrobiano KendallTM AMD (PHMB 0,5%. Se pudo concluir que el apósito de Espuma KendallTM AMD actúa bien como antimicrobiano y como producto de vendaje moderno. Su utilización disminuye la carga bacteriana al tiempo que consigue la absorción del exudado y el mantenimiento de un ambiente óptimo para la curación de la herida.The most troublesome part of wound healing according to the care practitioners is the Wound infection. The presence of excess bacteria in the wound can lead to delayed healing that lead to a reduced quality of life for the patient due to increased pain, higher exudates levels and potential malodor. The following patient case report have been collated over the past six months in a specialist wound care clinic in Doncaster and Bassetlaw, UK. These cases illustrate the range of wound types that have been successfully treated with the new KendallTM AMD Antimicrobial Foam dressing (PHMB 0,5%. The conclusion was that KendallTM AMD Foam dressing functions well as an antimicrobial and a modern wound dressing product. This resulted in consistent lowering of the wound bioburden, absorption of exudates and maintenance of an optimal wound healing environment.

Caracterización del potencial de abuso del flunitracepam

OpenAIRE

Martí de la Llave, Cecilia

1997-01-01

Con el presente estudio se pretende caracterizar el potencial de abuso del flunitracepam. La pauta de administración del flunitracepam está ajustada para alcanzar concentraciones máximas plasmáticas similares entre los dos regímenes de administración del fármaco activo, aunque a diferente velocidad; con la dosis única se alcanza la concentración máxima plasmática más rápidamente que con la dosis dividida. Cuando el voluntario recibe el fármaco activo a dosis única toma cinco cápsulas que ...

Historia del desarrollo institucional turístico del Meta

Directory of Open Access Journals (Sweden)

Ramón Vergel

2002-11-01

el primer plan de desarrollo turístico departamental, se comienza a visualizar diferentes tipologías de turismo que se podían desarrollar como el Ecoturismo y a trabajar en pro de ello. Surge luego el segundo Plan Sectorial del Meta visualizando al turismo como producto. Posteriormente se realiza un Estudio Exploratorio sobre el Potencial Turístico del Meta y la promoción turística del departamento comienza a surgir con la participación en ferias y vitrinas turísticas importantes logrando así fijar un mercado turístico: Bogotá.

ESTUDIOS MACRO Y MICROSCOPICO DEL SACO ANAL DEL COIPO (Myocastor coypus)

OpenAIRE

Rafasquino, Marta E.; Ramos, Pablo A.; Alonso, Cristina R.; Idiart, Julio R.

1998-01-01

RESUMEN:Fue realizada la disección del saco anal de 44 coipos, de ambos sexos, de distintas edades y procedencias, observándose algunas características similares a los sacos anales del perro y gato, aunque es impar y está ubicado en ventral del ano. Es ovoídeo o piriforme, siendo más grande en los adultos y, entre éstos, más aún en los machos que en las hembras; posee un conducto que desemboca en el canal anal a un centímetro del ano y que se exterioriza en el momento de secretar el producto ...

Fenomenología del prejuicio

Directory of Open Access Journals (Sweden)

Montero Moliner, Fernando

1992-05-01

Full Text Available Not available.

Este trabajo expone la defensa del «prejuicio » llevada a cabo por Gadamer, mostrando su efectividad histórica y confrontándola con la crítica husserliana del «prejuicio» desde el apriorismo. Se pone de relieve, además, la historicidad del «mundo de la vida» y su incidencia en la teoría del a priori, para terminar con un estudio de la racionalidad del a priori y la facticidad del prejuicio.

La crisi del diritto del lavoro

Directory of Open Access Journals (Sweden)

Alessandro Garilli

2012-01-01

Full Text Available Riassunto - L’Autore ripercorre in chiave critica l’evoluzione delle politiche legislative in materia di lavoro, alla luce dell’attuale fase di crisi economico finanziaria. Nell’esaminare i principali interventi normativi attuati da inizio secolo, l’Autore mette in evidenza le scelte di metodo e gli elementi di continuità che accomunano i vari provvedimenti, individuandoli nell’affannosa ricerca del punto di equilibrio tra flessibilità e garantismo. La riflessione si chiude con alcuni interrogativi sulle ultime linee di riforma del mercato del lavoro e con l’auspicio che, anche al cospetto delle imprescindibili ragioni dell’economia, il diritto del lavoro possa continuare a svolgere il proprio tradizionale ruolo di disciplina di tutela della persona.   Abstract - The author analyzes, with a critically oriented approach, the development of the employment law, in the light of the current economic and financial crisis. In examining the main regulatory measures implemented since the beginning of the century, the author highlights the methodological choices and the elements of continuity that unite the various measures, focusing them in a hard research of a point of balance between flexibility and security. The discussion concludes with some questions about the last lines of the reform of the labor market and with the hope that, even in the face of compelling reasons of economy, labor law can continue to play its traditional role of governing the protection of person.

Il dono del racconto

DEFF Research Database (Denmark)

Polito, Paola

1998-01-01

L'articolo indaga a vari livelli strutturali del romanzo "Il coraggio del pettirosso" (rete metaforica, dialogismo diegetico, dialogismo come fenomeno di voce, strategie discorsive messe in atto dalla voce narrante, stile colloquiale) la complessa realizzazione testuale del genere narrativo...

COMPOSICIÓN DEL ENSAMBLE DE INSECTOS DEL DOSEL DE BOSQUES SUBTROPICALES SECOS DEL CHACO SEMIÁRIDO, ARGENTINA

OpenAIRE

Liliana Diodato; Andrea Fuster

2016-01-01

El dosel arbóreo constituye un complejo hábitat con gran diversidad de insectos. Los estudios sobre insectos del dosel están mayormente concentrados en bosques húmedos tropicales y son escasos en bosques secos subtropicales. El propósito de este trabajo fue caracterizar la entomofauna del dosel de bosques secos subtropicales, analizando su diversidad regional y localmente. Para ello se muestrearon cinco sitios localizados en la región fitogeográfica del Chaco Semiárido Argentino. Las recolecc...

Reconstrucción del límite superior del bosque en la parte norte del Ecuador: algunos resultados del proyecto RUFLE

NARCIS (Netherlands)

Sevink, J.; Tonneijck, F.; Jansen, B.; Hooghiemstra, H.; Cuesta, F.; Sevink, J.; Llambí, L.D.; De Bièvre, B.; Posner, J

2014-01-01

Resumen Se estudiaron los suelos, los registros de polen y los marcadores biológicos en transectos entre bosque y páramo en la reserva natural Guandera al norte del Ecuador para reconstruir el límite superior del bosque y establecer sus características y dinámicas. Se encontró que los suelos estaban

Dirección del proyecto para la construcción del casco habitable del edificio multifamiliar Pramin, aplicando estándares del PMI

OpenAIRE

Cabrejos Canevaro, Omar; Garrido Lovón, Johan; Herrera Stoll, Alberto; Ramírez Apón, Ernesto

2017-01-01

La presente tesis tiene como objetivo principal el desarrollo de la Dirección de un proyecto para la construcción del Casco Habitable del Edificio Multifamiliar Pramin, ejecutado por la empresa Construcciones Corbus S.A., aplicando los estándares de la Guía del PMBOK, quinta edición, se busca lograr una ventaja competitiva sostenible en el tiempo a través de un modelo de dirección eficiente en sus procesos que sirva como base actualizable para la ejecución de cada proyecto de la empresa a fin...

Del internacionalismo al nacionalismo: rumbos del conflicto armado en Colombia

Directory of Open Access Journals (Sweden)

Mónica Zuleta P.

2003-10-01

Full Text Available Este ensayo tiene por propósito sugerir una interpretación del desarrollo del conflicto armado colombiano durante la última década del siglo XX mediante el uso de la concepción de poder de Michel Foucault. Ello con miras a presentar alternativas analíticas frente a la relación entre lo global y lo local donde se consideren algunas de las hipótesis contemporáneas sobre la cuestión del nacionalismo. El ensayo utiliza el término nacionalismo como sustantivo (lo que es en lugar de como adjetivo (lo que debe ser y ordena los conjuntos de acciones que, en torno al proyecto de lo nacional, han sido puestos en práctica por las guerrillas en Colombia.

Gestión del marketing sensorial sobre la experiencia del consumidor

Directory of Open Access Journals (Sweden)

Leonardo Ortegón-Cortázar

2016-01-01

Full Text Available El rápido desarrollo de mercados con productos competitivos de difícil diferenciación y consumidores mejor informados que demandan experiencias memorables, justifican estudiar los elementos sensoriales que pueden potenciar e influir positivamente sobre dichas experiencias. El objetivo de este artículo es analizar el estado del arte respecto a la gestión y uso del marketing sensorial sobre la experiencia del consumidor. El diseño de investigación es no experimental documental, con un tipo de estudio descriptivo, empleando fuentes de recolección de información secundarias, mediante un arqueo bibliográfico de revistas de impacto que figuran en bases de datos de libre acceso. Los resultados revelan la dominancia del sentido de la visión sobre la persuasión y las actividades de marketing, mientras que el sentido del olfato demuestra mayor influencia sobre el nivel de recuerdo y evocación de información. Se concluye la utilidad de jerarquizar por nivel de influencia las actividades de estimulación sensorial en marketing a partir del funcionamiento y participación de los sentidos humanos y poder combinar dichas estimulaciones como medio para maximizar la experiencia del consumidor y distinguir la oferta de valor, considerando el grado de diferenciación, la favorabilidad y la fuerza de la actividad sensorial basada en planeación estratégica empresarial.

Avances del mejoramiento genético participativo del frijol en Cuba

Directory of Open Access Journals (Sweden)

Rodobaldo Ortiz-P\\u00E9rez

2006-01-01

Full Text Available Las actividades de Fitomejoramiento Participativo fueron conducidas con agricultores del municipio de San Antonio de los Baños de la provincia La Habana y campesinos de la comunidad la Palma de la provincia de Pinar del Río durante 2001 al 2004. En la fase de diagnóstico en las áreas de intervención del proyecto, más del 80 % de los agricultores no utilizaban la semilla del sistema formal; por lo tanto, las variedades obtenidas por los programas de mejoramiento no llegaban a la mayoría de los agricultores. Se buscó un mecanismo alternativo para introducir diversidad genética a las localidades mediante las ferias de diversidad, cuyo objetivo principal ha estado dirigido a facilitar el flujo de semilla de los institutos de investigaciones hacia el agricultor y viceversa. Posterior al desarrollo de las ferias de diversidad se continúa con la experimentación campesina en fincas y cooperativas, desarrollándose una amplia red experimental difícil de lograrse sin la participación de los productores. La experimentación campesina, el aumento de la eficiencia en la finca, incluyendo el aumento del rendimiento de sus parcelas, el aumento de la diversidad por el uso de mayor número de variedades, y una mayor proporción de área dedicada a estas variedades; todo lo cual redunda en un mejoramiento de la vida del campesino y su familia

Adaptive Surface Modeling of Soil Properties in Complex Landforms

Directory of Open Access Journals (Sweden)

Wei Liu

2017-06-01

Full Text Available Abstract: Spatial discontinuity often causes poor accuracy when a single model is used for the surface modeling of soil properties in complex geomorphic areas. Here we present a method for adaptive surface modeling of combined secondary variables to improve prediction accuracy during the interpolation of soil properties (ASM-SP. Using various secondary variables and multiple base interpolation models, ASM-SP was used to interpolate soil K+ in a typical complex geomorphic area (Qinghai Lake Basin, China. Five methods, including inverse distance weighting (IDW, ordinary kriging (OK, and OK combined with different secondary variables (e.g., OK-Landuse, OK-Geology, and OK-Soil, were used to validate the proposed method. The mean error (ME, mean absolute error (MAE, root mean square error (RMSE, mean relative error (MRE, and accuracy (AC were used as evaluation indicators. Results showed that: (1 The OK interpolation result is spatially smooth and has a weak bull's-eye effect, and the IDW has a stronger ‘bull’s-eye’ effect, relatively. They both have obvious deficiencies in depicting spatial variability of soil K+. (2 The methods incorporating combinations of different secondary variables (e.g., ASM-SP, OK-Landuse, OK-Geology, and OK-Soil were associated with lower estimation bias. Compared with IDW, OK, OK-Landuse, OK-Geology, and OK-Soil, the accuracy of ASM-SP increased by 13.63%, 10.85%, 9.98%, 8.32%, and 7.66%, respectively. Furthermore, ASM-SP was more stable, with lower MEs, MAEs, RMSEs, and MREs. (3 ASM-SP presents more details than others in the abrupt boundary, which can render the result consistent with the true secondary variables. In conclusion, ASM-SP can not only consider the nonlinear relationship between secondary variables and soil properties, but can also adaptively combine the advantages of multiple models, which contributes to making the spatial interpolation of soil K+ more reasonable.

Variedades del voto: hacia una sociología plural del sufragio particular

OpenAIRE

Sonnleitner, Willibald

2017-01-01

Resumen En México, las relaciones inestables entre las bases socio-territoriales del desarrollo socio-económico y del voto desafían las teorías clásicas de la modernización. Para comprender el comportamiento contradictorio de la participación electoral hay que explorar las variedades del sufragio en distintos contextos, niveles y escalas, y considerar la diversidad de formas de movilización ciudadana. Como lo muestra la sociología empírica del voto, éste puede apoyarse en dispositivos de tipo...

VALORACIÓN Y EFECTOS PUZOLÁNICOS DEL MATERIAL VOLCÁNICO DEL PURACÉ

Directory of Open Access Journals (Sweden)

Diana Marcela Burgos Galindo

Full Text Available En este artículo se presentan los resultados experimentales de caracterización y evaluación puzolánica del material volcánico del Puracé (MVP. El MVP fue analizado mediante microscopía electrónica de barrido, fluorescencia de rayos X, difracción de rayos X, petrografía de secciones delgadas, análisis termo-gravimétricos, entre otros. La reactividad puzolánica fue evaluada por medio del Índice de Actividad Puzolánica y el ensayo de Frattini. Además, se evaluó el efecto de la incorporación del MVP en la resistencia a compresión de morteros donde el cemento Portland se remplazó por MVP en un rango del 0-40 %. Los resultados demostraron que el MVP presentó todas las características para ser considerado una puzolana natural y su porcentaje óptimo de incorporación como puzolana en remplazo del cemento es del 10 %, pero el diseño demostró que puede incorporarse hasta un 20 % con una pequeña desviación en la resistencia media reportada por el diseño.

Hacia una caracterización del lugar y el perfil del elector colombiano

Directory of Open Access Journals (Sweden)

Víctor Arteaga Villa

2011-01-01

Full Text Available El artículo presenta una aproximación a la caracterización del lugar que se le ha dado y del perfil con que se ha configurado el elector colombiano. A partir de la metodología del estado de arte, analiza la literatura más relevante que se ha producido en torno a la relación elecciones-partidos políticos-elector y señala las categorías de énfasis que se han privilegiado. Además, a partir del establecimiento de las razones de la decisión y de la orientación del voto, enlista algunos de los factores que, desde motivaciones muy particulares -cívicas (deber ser del ciudadano, cínicas (ser de la contraprestación-, inducen al elector a su participación.

Las implicaciones del imaginario dominante “Barrios del Sur” en la producción del espacio urbano

Directory of Open Access Journals (Sweden)

Roberto Villalobos Vega

2016-07-01

Full Text Available La ciudad y lo que se entiende como su realidad, es una dinámica de producción territorial compleja e infinita que se teje recíprocamente entre su dimensión imaginaria (memoria, ideas, sentidos, emociones, etc., su dimensión empírica (edificaciones, infraestructura, acontecimientos, y la manera en que sus ciudadanos, tanto la sociedad civil como quienes ostentan el poder, amalgaman las distintas variables que la componen para simbolizarla y construirla constantemente (dimensión social. Ante esta premisa, el presente artículo esboza, como problemática urbana, la construcción mediática del territorio, desde el fenómeno de las representaciones de los “Barrios del Sur”, un imaginario dominante que se designa bajo generalizaciones negativas del territorio sur del casco central de la ciudad de San José, Costa Rica (Distrito Hospital y Catedral; y su profundo impacto en la producción de la ciudad a nivel de organización territorial (ubicación de miedos y culpas en la urbe, planificación, diseño e inversión urbana, y vivencia socio-espacial del entorno designado.

Una caza del tesoro para aprender la pronunciación del español

Directory of Open Access Journals (Sweden)

Xose Padilla García

2012-08-01

Full Text Available El grupo Pronuncia bien surgió en el seno del Máster de Enseñanza de español einglés como L2/LE de la Universidad de Alicante bajo la dirección del profesor Xose A.Padilla. El objetivo de nuestro grupo es elaborar instrumentos de aprendizaje quepermitan mejorar la pronunciación de estudiantes de E/LE de manera eficaz y divertida.A día de hoy, el grupo ha creado materiales didácticos dirigidos especialmente aestudiantes cuya lengua de origen sea el inglés o el italiano. La creación de lasherramientas didácticas y de evaluación propiamente dichas se basa en los principios delMétodo Verbo-Tonal (MVT, en las propuestas del enfoque comunicativo, y en el usode las nuevas tecnologías (TICs. Tenemos en cuenta, asimismo, las directrices delMarco Común Europeo de Referencia para las lenguas (MCER y los consejos del PlanCurricular del Instituto Cervantes (PCIC sobre la enseñanza del español.

Una alabarda procedente del valle del Manzanares (Madrid

Directory of Open Access Journals (Sweden)

Miguel Ángel de BLAS CORTINA

2009-12-01

Full Text Available RESUMEN: Se estudia una alabarda metálica procedente —sin datos precisos de su localización— del valle del Manzanares (Madrid. Posiblemente apareciera con otros materiales (¿puntas Palmela?, pero el hecho no pudo ser comprobado. Fundida en un molde monovalvo que proporciona un acabado homogéneo a una sola de las caras, se integra metalúrgicamente en el grupo E 01 (cobres arsenicales propio de la Península Ibérica durante el Calcolítico y el Bronce Antiguo. Tipológicamente puede ser clasificada como integrante del grupo Carrapatas al que pertenecen un conjunto de alabardas procedentes del N.E. de Portugal (Bragança y Tras os Montes del que se conocen escasos testimonios fuera del área característica. Especialmente significativo es el hallazgo de la finca de la Paloma (Pantoja, Toledo que muestra la asociación entre las alabardas Carrapatas y elementos propios del campaniforme tardío de España y Portugal, circunstancia que permite fechar el tipo entre el 1700-1500 a. de J.C., datación similar a las fechas admitidas para las alabardas irlandesas con las que algunos autores ven posibles relaciones. La existencia de alabardas grabadas en estelas más tardías o en rocas al aire libre plantea el problema de su perduración. No obstante, el carácter simbólico de las armas grabadas puede hacer que sea solamente la imagen representada la que superviva, aunque el arma como tal haya perdido vigencia. La alabarda del Manzanares, junto con las de Pantoja, señala la presencia en la Meseta Sur de elementos metalúrgicos propios del N.W. de la Península en un momento sincrónico con las fases finales del campaniforme.ABSTRACT: We study a metallic halberd found in an indeterminate place in the valley of the river Manzanares (Madrid. It might have appeared with other materials (Palmela Points?, although this fact could not be confirmed. Made in a single-faced mould which allows a homogeneous finish to only one of the sides, it belongs from

Influencia del yeso sobre la velocidad de hidratación del cemento portland

Directory of Open Access Journals (Sweden)

Yamaguchi, G.

1961-12-01

Full Text Available Not availablePara esclarecer la Influencia del yeso sobre el fraguado y endurecimiento del cemento, los autores estudiaron el grado de hidratación de los cuatro principales minerales del clínker de cemento Portland y el efecto del yeso sobre ellas. Haciendo uso del análisis cuantitativo de rayos X, se determinó la porción no hidratada. Simultáneamente, se determinaron los tiempos de fraguado y las resistencias. Los ensayos se llevaron a cabo sobre tres clínkeres sintéticos de diferentes composiciones y sobre dos clínkeres de cemento Portland comerciales.

El legado del Movimiento Moderno. Conjuntos de vivienda masiva en ciudades europeas del Oeste y del Este. No tan diferentes…

Directory of Open Access Journals (Sweden)

Javier Monclús

2015-05-01

Full Text Available El objetivo de este artículo es comparar y contrastar algunos conjuntos de vivienda modernos en ciudades europeas del Oeste (“capitalistas” y del Este (“socialistas”. Nuestro trabajo se centra en conjuntos de vivienda masiva construidos en el periodo de crecimiento urbano acelerado que tuvo lugar en Europa principalmente en las décadas de los años 60 y 70 del pasado siglo. El punto de partida más obvio es que las ciudades socialistas son diferentes de las europeas occidentales por la distinta naturaleza de sus políticas urbanas, el sistema de planificación económica socialista centralizada, la ausencia de un mercado del suelo libre, el impacto de la industrial­ización en el sector de la construcción, etc. Sin embargo, hay muchos conceptos en urbanismo, así como en los procesos urbanos, que fueron compartidos en ambos sistemas políticos e ideológicos. El artículo ofrece una perspectiva comparada de la naturaleza de esos conjuntos residenciales modernos construidos a ambos lados del Telón de Acero –Housing Es­tates en UK, Grands Ensembles en Francia, Großsiedlungen en Alemania, Polígonos en España o los grandes conjuntos residenciales socialistas en los países del Bloque del Este– con el fin de entender mejor si –y hasta qué punto– las formas urbanas de dichos conjuntos son el resultado de la cultura internacional del urbanismo moderno.

Gestión del talento humano y compromiso organizacional de los docentes del nivel primario en las instituciones educativas del Cercado de Huaral, 2014

OpenAIRE

Huapalla Paredes, Javier Mitchel

2015-01-01

El presente estudio se centra en describir cómo se relaciona Gestión del talento humano y compromiso organizacional de los docentes del nivel primario en las Instituciones Educativas del Cercado de Huaral, 2014. El nivel de la presente investigación es cuantitativo de tipo descriptivo correlacional. La muestra es probabilística de 125 docentes del nivel primario de las Instituciones Educativas del Cercado de Huaral. Los instrumentos utilizados para observar y recabar inform...

Gestión del riesgo

OpenAIRE

Duque Escobar, Gonzalo

2014-01-01

Documento Anexo del Manual de Geología para Ingenieros, con temas asociados a la gestión integral del riesgo de interés para la ecorregión cafetera y Colombia. Parte de los temas ha sido tomada del módulo “Diálogos con el Territorio y Gestión del Riesgo Natural, a mi cargo en la Especialización en Geografía, Ordenamiento Territorial y Manejo del Riesgo Natural en la Universidad de Caldas. Otros, provienen del compendio de temas sobre la materia, elaborado en el marco de mis actividades académ...

LA MATEMÁTICA ELEMENTAL DEL PROCESO DE VALORIZACIÓN DEL CAPITAL

Directory of Open Access Journals (Sweden)

Henry Manuel Mora Jiménez

2011-09-01

Full Text Available La economía es (o aspira a ser una ciencia social que, por su particular objeto de estudio, permite y requiere la cuantificación de las expresiones objetivadas de los procesos sociales en que centra su interés; y aunque probablemente se han cometido (y se siguen cometiendo muchos abusos en este campo, no podemos renunciar a una tarea que es requisito para el desarrollo de una teoría científica del capitalismo.Se pretende en este trabajo, utilizar instrumentos de la matemática elemental para formalizar importantes tesis marxianas, relacionadas con la teoría del plusvalor absoluto. Aunque la matemática que se utiliza es simple, el planteamiento es sugestivo, y se centra en formalizar con ayuda del álgebra y del cálculo elemental, los principales resultados teóricos de la sección tercera (especialmente el capítulo nueve del Libro I de El Capital de Karl Marx, susceptibles de tratamiento cuantitativo.Nuestra pretensión es aclarar la teoría del proceso de valorización del capital (creación de nuevo valor mediante el consumo productivo de fuerza de trabajo y de medios de producción, como un requisito parcial para entender mejor lo que en un artículo posterior denominaremos “proceso de desvalorización del capital”, el cual se desarrolla paralelamente y se entrecruza con el primero. La exposición se centra en el método de producción de plusvalor conocido como plusvalor absoluto, por ser la forma general y básica de creación capitalista de excedente.

DE LA MUERTE DEL AUTOR A LA MUERTE DEL ARTISTA: REFLEXIÓN CRÍTICA PARA UN DEBATE EN TORNO A LA FIGURA DEL AUTOR

Directory of Open Access Journals (Sweden)

Ricardo Arcos-Palma

2011-04-01

Full Text Available La "muerte del autor" se ha convertido en el paradima de la postmodernidad. El siguiente ensayo realiza un análisis crítico de tal expresión y las consecuencias de su aplicación en el mundo del arte contemporáneo. La tesis planteada es la siguiente: la muerte del autor trae consigo la muerte del artista y del crítico, figuras representativas de la autoridad. Tales muertes generan el nacimiento de una nueva figura de poder que es el curador. Con este texto se pretende aportar elementos de reflexion para un debate, que apenas comienza, en torno a la figura del curador.

Consideraciones alrededor del Libro del Almismo, el Libro del Pensar.

Directory of Open Access Journals (Sweden)

MartaLucía Tamayo Fernandez

1999-12-01

Full Text Available

La doctora MarthaLucía Tamayo comparte muchas inquietudes alrededor del Libro del Almismo, el Libro del Pensar; de dónde salió ese nombre; de juntar en medicina y en genética a tres escritores como lo son Jorge Luis Borges, Macedonio Fernández y Julio Cortázar. Su conferencia dice así:

El término almismo fue ideado por Macedonio Fernández porque defendía mucho el ensimismamiento y el pensamiento hacia el interior, mirar hacia adentro; cada uno somos un “sí mismo” que nos hace diferentes aunque al mismo tiempo podemos ser iguales. Todos tenemos esa parte interior que la medicina debe trabajar y que no puede olvidar.

“El Libro del Almismo, el libro del pensar” nos lleva a replantear y a repensar un poco la medicina que queremos, una medicina vuelta a pensar.

Quiero contarles la historia de cómo se llegó a este libro y por qué y para qué se sigue trabajando en estos temas: Después de mi internado y de un trabajo un poco triste de rural, volví al Instituto de Genética y a la Universidad Javeriana en donde encontré al doctor Bernal y un espacio que estaba buscando para esa medicina diferente que quería, con un grupo de personas que me permitía no sólo ver la medicina sino ver muchas otras cosas más; había espacio para la literatura, para Mafalda, para hablar de niños, de locos, había incluso tiempo para hablar de medicina dentro del golf, de carros antiguos y de todo eso fui aprendiendo.

Eso era lo que estaba buscando. Una medicina que diera espacios diferentes, que fuera más humanizada. Rápidamente me ubiqué y me quedé! No me arrepiento en lo absoluto de haberme quedado porque fue, ha sido y sigue siendo, una experiencia enriquecedora, de muchas vivencias importantes. Sabía exactamente dónde estaba y sabía que había que seguir rápido y había que trabajar muchos aspectos de esa medicina que estábamos buscando y de esa genética especial.

Rápidamente empezamos a trabajar

Las guerras olvidadas del Perú: formación del Estado e imaginario nacional

Directory of Open Access Journals (Sweden)

Cecilia Méndez G.

2012-06-01

Full Text Available A diferencia de otros países americanos, el Perú carece de una memoria nacional de sus guerras civiles decimonónicas. Estas han sido opacadas por la avasalladora memoria de la Guerra del Pacífico, que el Perú y Bolivia perdieron ante Chile (1879-1883. El presente ensayo se propone rescatar del olvido a las guerras civiles peruanas del siglo XIX, empezando por las guerras de la independencia. Las preguntas que planteamos están motivadas por la guerra reciente que desató el Sendero Luminoso entre 1980 y fines de la década de 1990, en la que los campesinos andinos asumieron las funciones represivas del Estado al tomar las armas para derrotar a la insurgencia senderista. Esta situación exhibe interesantes paralelos con las guerras civiles del siglo XIX. Proponemos que el estudio de las guerras civiles decimonónicas del Perú, a la luz de la reciente guerra interna, ofrece una oportunidad fecunda para discutir las nociones de ciudadanía y pertenencia, la relación entre guerra y la constitución del Estado, así como los alcances y límites del concepto weberiano del Estado como el ente que monopoliza la violencia legítima. Subrayamos la importancia de la organización civil de las poblaciones rurales en el devenir de la guerra y, más ampliamente, en la construcción del Estado.

Medición del valor agregado del hogar: nuevos enfoques para el caso peruano

OpenAIRE

Arlette Beltrán; Pablo Lavado

2013-01-01

Aun cuando las diferentes medidas convencionales del Producto Bruto Interno (PBI) muestran el desempeño económico del país, el cálculo de éstas no considera el significativo valor de los bienes y servicios producidos dentro del hogar. A través de la Encuesta Nacional del Uso de Tiempo (ENUT) 2010, la presente investigación trata de estimar el valor asociado al tiempo dedicado a las labores del hogar en el Perú bajo distintos enfoques discutidos en la literatura académica. Los resultados arroj...

Objeto de aprendizaje abierto de la Competencia del manejo del idioma inglés

OpenAIRE

Baltazar Gutierrez, Alejandro; Flores Carrillo, Cristina; Garcia Moran, Gregory Alfonso; Macias Acosta, Paulina; Campa Mariño, Maria Alejandra

2011-01-01

1. Portada 2. Resumen 3. Información General a. Introducción b. Objetivos c. Temario 4. Evaluación Diagnóstica 5. Temas a. Tema 1. ¿Qué significa la competencia del manejo del inglés? i. Actividad Inicial ii. Contenido iii. Actividad Final iv. Recursos del TEMOA b. Tema 2. ¿Por qué es relevante para mi formación que adquiera la competencia del idioma inglés? i. Actividad Inicial ii. Contenido iii. Actividad Final iv. Recursos del TEMOA c. ...

SISTEMA INFORMÁTICO PARA LA GESTIÓN DEL TALENTO HUMANO DEL GOBIERNO MUNICIPAL DEL CANTÓN BOLÍVAR

Directory of Open Access Journals (Sweden)

Angel Cristian Mera Macías

2016-06-01

Full Text Available Esta investigación tuvo como objetivo la creación e implementación de un sistema informático para la gestión del talento humano del Gobierno Autónomo Descentralizado Municipal del cantón Bolívar. Durante el estudio se determinó cómo la organización en mención gestiona la información del talento humano y la manera en la que se podría mejorar dicha tarea, es así que mediante la aplicación de encuestas a los clientes internos y externos se determinó que existían dificultades en dicho proceso, por otra parte también se determinó la predisposición y la necesidad de implementar un sistema informático para mejorar la gestión del talento humano. Una vez conocida la problemática se planteó como solución, dinamizar la gestión del talento humano mediante un sistema informático desarrollado, utilizando la metodología de “Desarrollo Rápido de Aplicaciones” que integre los datos del personal en un banco de datos central, donde la información que se genere se vaya registrando de forma organizada para agilizar el acceso a la misma y de esta manera optimizar los recursos de la entidad, llegando a la conclusión de que con el trabajo planificado y ordenado es posible construir un sistema informático lo suficientemente robusto para gestionar el talento humano en los gobiernos municipales en el Ecuador.

El análisis económico del derecho de autor y del copyright, un estudio del equilibrio entre los intereses público y privado

Directory of Open Access Journals (Sweden)

Ana María Pérez Gómez Tétrel

2007-01-01

Full Text Available La propiedad intelectual ha sido concebida para responder, tanto a la necesidad de protección del autor de una obra del intelecto, como al beneficio que la sociedad pueda sacar del acceso a dichas creaciones intelectuales, generando así un equilibrio entre los diferentes actores. Los sistemas digitales de comunicación han puesto en jaque dicho equilibrio. Conviene preguntarse ¿es capaz la protección otorgada por el derecho a la creación intelectual, de establecer un equilibrio en las relaciones entre creador (autor y la sociedad (consumidor? ¿En qué medida el análisis económico comparado del derecho de autor y del copyright puede contribuir al modelo económico de este equilibrio? ¿Hasta qué punto, el rol desempeñado por las industrias de la comunicación está rompiendo este equilibrio? El objetivo de este artículo es analizar diversos aspectos del derecho de autor y del copyright, a la luz del análisis económico del derecho.

El análisis económico del derecho de autor y del copyright, un estudio del equilibrio entre los intereses público y privado

Directory of Open Access Journals (Sweden)

Ana María Pérez Gómez Tétrel

2007-11-01

Full Text Available La propiedad intelectual ha sido concebida para responder, tanto a la necesidad de protección del autor de una obra del intelecto, como al beneficio que la sociedad pueda sacar del acceso a dichas creaciones intelectuales, generando así un equilibrio entre los diferentes actores. Los sistemas digitales de comunicación han puesto en jaque dicho equilibrio. Conviene preguntarse ¿es capaz la protección otorgada por el derecho a la creación intelectual, de establecer un equilibrio en las relaciones entre creador (autor y la sociedad (consumidor? ¿En qué medida el análisis económico comparado del derecho de autor y del copyright puede contribuir al modelo económico de este equilibrio? ¿Hasta qué punto, el rol desempeñado por las industrias de la comunicación está rompiendo este equilibrio? El objetivo de este artículo es analizar diversos aspectos del derecho de autor y del copyright, a la luz del análisis económico del derecho.

Epidemiologia del parasitismo intestinal infantil en el Valle del Guadalquivir

Directory of Open Access Journals (Sweden)

Pérez Armengol Cristina

1997-01-01

Full Text Available FUNDAMENTO: Las parasitosis intestinales en los niños constituyen un problema de salud pública que debe ser valorado periódicamente en cada región. En este trabajo se aborda, por primera vez en la región natural del Valle del Guadalquivir, un estudio amplio sobre la prevalencia del parasitismo intestinal en la población infantil de la zona. MÉTODOS: Durante el período 1994-1996, mediante análisis coprológico y método de Graham, se ha estudiado a 1.917 niños y niñas asintomáticos, con edades comprendidas entre seis y diez años, residentes en veinte localidades del Valle del Guadalquivir. RESULTADOS: El índice global de parasitación ha sido del 27,12 %. Las especies parásitas detectadas, así como sus prevalencias fueron: Enterobius vermicularis (20,44%, Giardia lamblia (5,05%, Entamoeba coli (2,45%, Endolimax nana (1,61%, Entamoeba histolytica (0,31%, Entamoeba hartmanni (0,05%, Iodamoeba bütschlii (0,05%. CONCLUSIONES: La prevalencia global encontrada es similar a la de otras regiones españolas, aunque quizás pueda considerarse algo más favorable. No se detectan geohelmintos, debido posiblemente a la mejora de la infraestructura higiénico-sanitaria y a los efectos de la prolongada sequía en la zona. La giardiasis, a diferencia de las restantes protozoosis, mantiene una prevalencia relativamente alta.

Descripción del funcionamiento del sector eléctrico colombiano

Directory of Open Access Journals (Sweden)

Santiago Alvarez Sierra

2006-04-01

Full Text Available Se ha considerado el comportamiento del sector eléctrico como un factor de gran trascendencia en desenvolvimiento de la economía de un país. Sin embargo, es notable el desconocimiento de algunas personas no especialistas es esta temática, de los conceptos básicos y de la organización intrínseca de este sector. Por lo tanto, resulta conveniente la realización de un artículo que informe de manera descriptiva sobre la naturaleza y funcionamiento del sector eléctrico en Colombia, como punto de partida para posteriores estudios y profundos análisis de temas relacionados con este sector. Entre los aspectos básicos que una persona debe conocer para estar en capacidad de entender y argumentar sobre el comportamiento del sector eléctrico en Colombia podemos citar, entre otros, los siguientes: antecedentes e historia del sector, agentes e instituciones del mercado, variables importantes en la toma de decisiones, contratos de corto y largo plazo, y finalmente algunos procedimientos que actualmente se encuentran en discusión, los cuales podrían cambiar el funcionamiento del Mercado de Energía Mayorista en Colombia

Panorama europeo del control de calidad del hormigón

Directory of Open Access Journals (Sweden)

García Meseguer, Álvaro

1974-02-01

Full Text Available The present state of the problem is presented with some detail, taking into account the work in course of the Editorial Committee CEB-CIB-FIP-RILEM on Statistical Quality Control of Concrete. In a comparative way the modus operandi, recently introduced in Spain through the new Code of Concrete EH 73, is also presented. The paper concludes commenting on the influence which the decrease of concrete strength has on the safety of the structure, a problem which is more complicated than it might appear at first sight.Se presenta con cierto detalle el estado actual del tema, a partir de los trabajos en curso del Comité Editorial CEB-CIB-FIP-RILEM sobre Control Estadístico de Calidad del Hormigón. De forma comparativa, se presenta también el modus operandi recientemente introducido en España por la nueva Instrucción del Hormigón EH 73. El artículo termina comentando la influencia que tiene un descenso de resistencia del hormigón en la seguridad de la estructura, tema éste más complejo de lo que puede parecer a primera vista.

Groundwater Governance and the Growth of Center Pivot Irrigation in Cimarron County, OK and Union County, NM: Implications for Community Vulnerability to Drought

Directory of Open Access Journals (Sweden)

Kathryn Wenger

2017-01-01

Full Text Available Cimarron County, Oklahoma and Union County, New Mexico, neighboring counties in the Southern High Plains, are part of a vital agricultural region in the United States. This region experiences extended periods of cyclical drought threatening its ability to produce, creating an incentive for extensive center pivot irrigation (CPI. Center pivots draw from the rapidly depleting High Plains Aquifer System. As a result, the prospect of long-term sustainability for these agricultural communities is questionable. We use Remote Sensing and Geographic Information Systems to quantify growth in land irrigated by CPI between the 1950s and 2014, and key informant interviews to explore local perspectives on the causes and impact of such growth. In Cimarron County, OK, CPI increased by the mid-1980s, and has continually increased since. Results suggest adaptation to drought, a depleting aquifer, high corn prices, and less rigid groundwater regulations contribute to CPI growth. Conversely, CPI in Union County, NM, increased until 2010, and then declined. Results also suggest that drought-related agricultural changes and more aggressive well drilling regulations contribute to this decrease. Nevertheless, in both counties, there is a growing concern over the depleting aquifer, the long-term sustainability of CPI, and the region’s economic future.

Prevalencia de helmintos intestinales en caninos del departamento del Quindío.

Directory of Open Access Journals (Sweden)

María Isabel Giraldo

2005-09-01

Full Text Available Introducción. Los helmintos intestinales son agentes patógenos que afectan animales domésticos y que a través de ellos pueden infectar humanos. Objetivo. El objetivo del trabajo fue determinar la prevalencia de helmintos intestinales en perros con dueño del departamento del Quindío. Materiales y métodos. Estudio descriptivo prospectivo. Se aplicó una encuesta epidemiológica a los propietarios de los perros. Se recolectaron muestras de heces de los caninos registrados en la jornada de vacunación antirrábica del 2003 en el departamento del Quindío. Las muestras de materia fecal frescas fueron analizadas utilizando la técnica de diagnóstico de Ritchie. Resultados. Se analizaron 324 muestras de heces caninas; el 67,6% de los perros eran de razas puras y el 32,4% razas mestizas. Se encontró una prevalencia del 22,2%; Ancylostoma caninum fue el parásito más frecuente, 13,9%. También se observó Trichuris vulpis, 4,3%; Toxocara canis, 2,5%, y Strongyloides stercoralis, 4,0%. El 2,46% de las mascotas se encontraron multiparasitadas. Conclusión. La frecuencia de helmintos intestinales en el departamento del Quindío fue de 22,2% y la presencia de estos parásitos coincide con factores como la edad y la permanencia del canino en la calle, entre otros. Por esta razón, es necesario establecer programas de vigilancia y prevención en la población humana y canina.

el Valle del Cauca

Directory of Open Access Journals (Sweden)

Carlos Humberto Ortiz

2007-01-01

Full Text Available Este artículo se enfoca en la identi- ficación de aquellos factores estructurales que explican la pérdida de dinamismo económico de largo plazo en Colombia y, en particular, en el Valle del Cauca. Se examina la competitividad del Valle en relación con Colombia y con el resto del mundo. Se cuestiona la insistencia en una estrategia exportadora como dinamizadora del desarrollo económico. Se identifica que una gran parte de la población está excluida de los beneficios del desarrollo económico. Para construir un modelo de desarrollo que incluya a esta población se recomienda recuperar la senda de la industrialización, invertir en el capital humano (educación de alta calidad, salud, salubridad y nutrición, e invertir en infraestructura. La participación del Estado en estas inversiones sociales es necesaria para disminuir la desigualdad y aumentar el crecimiento económico.

DE LA SOCIEDAD DEL CONOCIMIENTO A LA SOCIEDAD DEL RIESGO

OpenAIRE

Abdala Cardona, Alejandro

2013-01-01

El tiempo en el que vivimos: el siglo XXI, presenta a la vez, retos y exigencias al conjunto global de los habitantes del mundo, puesto que, no solo se nos presenta la actualidad como aquella coyuntura histórica en los que el cambio de los acontecimientos gira en torno al rol central del conocimiento, sino también, en torno al potencial que dicho conocimiento trae tras de sí; es decir, el presente siglo impone al conjunto de personas el rótulo de "sociedad del conocimiento" donde se puede enc...

Las Competencias Legales del Racional en la Organización Administrativa y Contable del Municipio de Valencia (Comienzos del Siglo XVII)

OpenAIRE

Francisco Mayordomo García-Chicote

2005-01-01

La organización administrativa y contable de los mayores municipios españoles, a comienzos del XVII, es un tema que apenas ha sido abordado por los investigadores de la historia de la Contabilidad y del Derecho. En este trabajo se estudian los textos legales (Capitols del Quitament y Ordenanzas de la Taula de Canvis) que regulaban aquellas cuestiones en relación con la ciudad de Valencia, y sobre todo se hace un detenido análisis del cargo municipal (el Racional) que se responsabilizaba de la...

Nuevos datos paleontológicos del Pleistoceno en el Valle del Manzanares (Madrid, España: Los micromamíferos del yacimiento del Arenero de Arriaga

Directory of Open Access Journals (Sweden)

Sesé, Carmen

2013-12-01

Full Text Available The micromammals from the archaeological site of the Arenero de Arriaga from the Manzanares Valley are here described. They are the Soricomorpha: Crocidura sp. and Talpa sp., the Rodentia: Eliomys quercinus quercinus, Apodemus sp., Microtus brecciensis, Microtus arvalis, Microtus duodecimcostatus and Arvicola aff. sapidus, and the Lagomorpha: Oryctolagus cuniculus. The faunal association and the evolutionary state of Microtus brecciensis and Arvicola aff. sapidus, suggest an age of the end of the Middle Pleistocene. It also indicates the existence of different biotopes: riparian, moist and dry meadows, and forest, and a temperate climate similar to the present-day climate of the Meseta.Se describe la asociación de micromamíferos del yacimiento achelense del Arenero de Arriaga del valle del Manzanares constituida por los soricomorfos: Crocidura sp. y Talpa sp., los roedores: Eliomys quercinus quercinus, Apodemus sp., Microtus brecciensis, Microtus arvalis, Microtus duodecimcostatus y Arvicola aff. sapidus, y el lagomorfo: Oryctolagus cuniculus. La asociación faunística y el estadio evolutivo de Microtus brecciensis y Arvicola aff. sapidus, indican una edad del final del Pleistoceno Medio. La asociación de micromamíferos sugiere la existencia de varios biotopos representados: ripícola, praderas húmedas y secas, y bosque, y un clima templado similar al actual de la Meseta.

RESPIRACIÓN DEL SUELO EN UNA COMUNIDAD SUCESIONAL DE PASTIZAL DEL BOSQUE ALTOANDINO EN LA CUENCA DEL RÍO PAMPLONITA, COLOMBIA

Directory of Open Access Journals (Sweden)

MURCIA-RODRÍGUEZ MIGUEL ANTONIO

2008-12-01

Full Text Available Se determinó la respiración del suelo (RS en una comunidad sucesional de pastizal de Holcus lanatus y Anthoxanthum odoratum en la franja altoandina de la cuenca del río Pamplonita, Norte de Santander, Colombia. Las medias mensuales de la RS fueron unimodales de día y de noche; la anual diurna fue de 118,44 mg CO2 m-2 h-1; y la nocturna, de 140,57 mg CO2 m-2 h-1. La diferencia entre estos dos valores se atribuyó a un incremento del brillo solar y a una disminución del recorrido del viento entre septiembre y diciembre de 2006 que condujo a un aumento de la tasa de evaporación. La RS nocturna se correlacionó con la humedad relativa y la temperatura máxima del aire y la diurna con el recorrido del viento. La RS acumulada (diurna y nocturna mostró una tendencia lineal con respecto al tiempo. La producción anual diurna de carbono, con base en la RS acumulada anual, se estimó entre 32,67 y 40,73 y la nocturna entre 35,65 y 43,02 g de C m-2.

RESPIRACIÓN DEL SUELO Y CAÍDA DE HOJARASCA EN EL MATORRAL DEL BOSQUE ALTOANDINO (CUENCA DEL RÍO PAMPLONITA, COLOMBIA

Directory of Open Access Journals (Sweden)

Murcia Miguel

2012-06-01

Full Text Available Se estudiaron la respiración del suelo (RS y la caída de hojarasca (CH en un matorral de Hypericum phellos y Monochaetum strigosum en la franja altoandina del Nororiente de Colombia. Los muestreos mensuales de la RS se realizaron entre enero y diciembre de 2006; la CH se recolectó entre agosto de 2004 y diciembre de 2006. El comportamiento de la respiración del suelo diurna (RSD fue bimodal con picos en mayo y septiembre (177,65-172,73 mg CO2 m-2 h-1, relacionándose exponencialmente con la temperatura media del aire (R2=0,48; p=0,013 y la humedad relativa (R2=0,40; p=0,028. La respiración del suelo nocturna (RSN fue trimodal con valores máximos en octubre, agosto y mayo (268,87-181,49-162,79 mg CO2 m-2 h-1. Las tasas anuales de la respiración del suelo diurnas y nocturnas se estimaron entre 35,14 - 39,28 g C m-2 y entre 42,48 - 47,42 g C m-2, respectivamente. Con base en el área del matorral (9,1 ha, la liberación de carbono edáfico se calculó entre 3,08 y 3,72 Mg C año-1 para el periodo diurno y nocturno. Las fluctuaciones mensuales de la temperatura media del aire y de la caída de detritus (Dt determinaron (R2=0,66; p<0,001 la dinámica de la respiración diurna (RSD=77,94TMEDIA+36,45Dt-1142,8 y nocturna (RSN=99,05TMEDIA+57,44Dt-1470,3, permitiendo retroinferir que las tasas de respiración en 2005 podrían ser 50% mayores que en 2006. El catabolismo edáfico del matorral dependió menos de las oscilaciones de las variables meteorológicas que el del pastizal.

Anfibios y reptiles del valle del Mezquital, Hidalgo, México Amphibians and reptiles from the Valle del Mezquital, Hidalgo, Mexico

Directory of Open Access Journals (Sweden)

Leonardo Fernández-Badillo

2010-12-01

Full Text Available El valle del Mezquital, Hidalgo, México, es un área de gran riqueza biológica; sin embargo, se desconoce mucho sobre su herpetofauna, por lo que se realizó una lista de anfibios y reptiles de 3 zonas del valle. Se analizó su distribución por tipo de vegetación, se registraron los microhábitats utilizados, así como la abundancia relativa. Se llevaron a cabo 12 salidas mensuales durante 1 año, con 108 días de muestreo. Se realizaron recorridos sobre transectos, en 9 tipos de vegetación. La herpetofauna del área de estudio está integrada por 37 especies (7 anfibios y 30 reptiles, de las cuales 8 se registran por primera vez para el valle del Mezquital. La mayoría de las especies se presentaron en las zonas de cultivo (26, 14 especies en los de la zona templada y 13 en los de la zona de riego. La herpetofauna del valle del Mezquital utiliza un total de 27 tipos de microhábitats, siendo "bajo roca" donde se registró el mayor número de especies (22. La mayoría de las especies tanto de anfibios como de reptiles fueron consideradas raras.Valle del Mezquital Hidalgo, Mexico is known for its high biological richness, but little is known about its herpetofauna. A study to list the amphibians and reptiles of 3 different zones at the Valle del Mezquital was carried out. We analyzed their distribution in different types of vegetation, their microhabitat and relative abundance in 12 monthly trips during 1 year for a total of 108 days. We sampled transects over 9 types of vegetation. Thirty species have been reported for this area (7 amphibians, 30 reptiles, 8 reported for the first time from Valle del Mezquital. Most of the species were present within crops (26, 14 within the temperate zone and 13 within the irrigation zone. The herpetofauna at Valle del Mezquital uses 27 different microhabitat, being "under rock" the most used by 22 species. Most of the species, both amphibians and reptiles were considered rare.

Una caza del tesoro para aprender la pronunciación del español

Directory of Open Access Journals (Sweden)

Xose Padilla García

2009-01-01

Full Text Available El grupo Pronuncia bien surgió en el seno del Máster de Enseñanza de español e inglés como L2/LE de la Universidad de Alicante bajo la dirección del profesor Xose A.Padilla. El objetivo de nuestro grupo es elaborar instrumentos de aprendizaje que permitan mejorar la pronunciación de estudiantes de E/LE de manera eficaz y divertida.A día de hoy, el grupo ha creado materiales didácticos dirigidos especialmente a estudiantes cuya lengua de origen sea el inglés o el italiano. La creación de las herramientas didácticas y de evaluación propiamente dichas se basa en los principios del Método Verbo-Tonal (MVT, en las propuestas del enfoque comunicativo, y en el uso de las nuevas tecnologías (TICs. Tenemos en cuenta, asimismo, las directrices del Marco Común Europeo de Referencia para las lenguas (MCER y los consejos del Plan Curricular del Instituto Cervantes (PCIC sobre la enseñanza del español.

PROBLEMÁTICA ESPACIAL DEL SUR DEL DEPARTAMENTO DEL ATLÁNTICO Y LA PLANEACIÓN TERRITORIAL ESTRATÉGICA

Directory of Open Access Journals (Sweden)

Efraín Llanos Henríquez

2017-06-01

Full Text Available Una parte considerable de los problemas espaciales que afectan a muchos entes territoriales en Colombia se debe en gran medida a la inexistencia de adecuadas políticas de ordenamiento y planeación del territorio. En este trabajo se hace una caracterización de los principales problemas espaciales de los municipios del sur del Atlántico, se analizan los factores que han incidido en su surgimiento y continuidad y se plantean algunas alternativas de solución, desde la Nueva Planeación Territorial Estratégica. El trabajo se sustenta en una amplia utilización de fuentes secundarias (investigación bibliográfica, uso de cartografía -mapas, planos, fotografías e imágenes satelitales- y estadísticas económicas, políticas y sociales, entre otras, así como en la realización de entrevistas y encuestas a habitantes de los municipios del área, en trabajos de campo y en la experiencia personal del autor en la zona estudiada. El trabajo se soporta teóricamente en la concepción del espacio como construcción social, planteada, entre otros, por Santos (2000, en los análisis y métodos de la Geografía Histórica (Tovar, 1986, y en especial en el llamado por Harvey (2003 Materialismo Histórico Geográfico y en los aportes de la Nueva Planeación Territorial Estratégica. Es una investigación de tipo descriptivo y explicativo.

Monitorización del proceso emprendedor a través del modelo de negocio

Directory of Open Access Journals (Sweden)

Rosa M. Batista-Canino

2017-01-01

Full Text Available El presente trabajo aborda un doble objetivo: desde un punto de vista teórico, profundizar en el conocimiento del proceso emprendedor en la fase incipiente y, desde un punto de vista metodológico, evidenciar el potencial del modelo de negocio como herramienta de prospección y estudio del proceso emprendedor en dicha fase. Con este fin se propone la adaptación del marco teórico sobre modelos de negocio, al tiempo que se desarrolla una metodología para el análisis longitudinal en esta primera etapa de la vida de una empresa, utilizando un caso revelador. Ello permite confirmar muchos de los hallazgos teóricos del campo de estudio e identificar nuevas cuestiones de investigación. Así, se pone de manifiesto la importancia de desvelar qué factores influyen en la evolución del proceso emprendedor a través del análisis de la evolución del modelo de negocio que subyace, y cómo se ajustan los elementos internos de la empresa con los del entorno para ir configurando un proyecto empresarial en su fase temprana. El trabajo contribuye a mitigar la necesidad de desarrollar estudios de corte longitudinal, al incluir la dimensión temporal en el modelo de negocio, cuestión escasamente abordada en la literatura.

Anexo: Fibras de lino en las piletas del poblado ibérico del Coll del Moro (Gandesa, Terra Alta: estudio paleoetnobotánico

Directory of Open Access Journals (Sweden)

Alonso i Martínez, Natàlia

1994-12-01

Full Text Available In this paper we offer the results of research on flax fibres discovered in water-bassins of the Iberian settlement of Coll del Moro (Gandesa, Spain

En el presente estudio presentamos los resultados obtenidos en las investigaciones realizadas sobre la funcionalidad de las piletas del poblado ibérico del Coll del Moro (Gandesa, en las cuales detectamos una importante presencia de fibras de lino.

Memorias para armar: Las conmemoraciones del 24 de Marzo en escuelas primarias del conurbano bonaerense

OpenAIRE

Amézola, Gonzalo de; D'Achary, Claudia

2009-01-01

Este artículo se ocupa del problema del tratamiento del pasado reciente en la escuela. Describe las distintas representaciones de la última dictadura militar que se encuentran presentes en los discursos pronunciados en las conmemoraciones realizadas en 2008 para recordar el golpe de Estado del 24 de marzo de 1976 en escuelas primarias del partido de Malvinas Argentinas, ubicado en el Conurbano Bonaerense. Se analiza en esos discursos la presencia de distintas narraciones de la memoria colecti...

Identificación del agente causal del anillo rojo del agave tequilero (Agave tequilana Weber var. Azul).

OpenAIRE

Mezo Villalobos, Miriam

2014-01-01

El cultivo del agave tequilero es parte de una larga tradición del estado de Jalisco, México. Esta actividad que culmina con la obtención del tequila, un tipo de mezcal tan característico, que se ha legislado su producción bajo la Denominación de Origen. La cadena producto agave-tequila es de suma importancia económica y social, no sólo para la región productora, sino para el país, dadas las elevadas cantidades de tequila que se exportan a todo el mundo. Esta investigación tuvo como objetivo ...

El contrato de agencia comercial. Análisis dentro del contexto del derecho romano

Directory of Open Access Journals (Sweden)

María Elisa Camacho López

2009-06-01

Full Text Available Sumario: Premisa. Principios derivados del sistema jurídico romano-germánico aplicables al contrato de agencia comercial. i. Algunas figuras de la actividad mercantil en el derecho romano. ii. Cláusulas de no competencia. A. Posibles fuentes de la obligación de no competencia en el derecho romano. 1. Obsequium. 2. Operae iuratae. 3. Operae stipulatae. 4. Stipulatio. 5. Contratos innominados. 6. Lex mancipii. B. Licitud o ilicitud de la obligación de no competencia en el derecho romano. C. Condena por el incumplimiento de la obligación de no competir. iii. Consecuencias de la terminación del contrato. A. Revocación del mandato por parte del mandante. B. Renuncia del mandato por parte del mandatario. iv. Conclusiones

Estudio de asociación del trastorno del desarrollo de la coordinación con otros trastornos del desarrollo infantil en la ciudad de Bucaramanga

OpenAIRE

Salinas Velasco, Rossana Iveth; Díaz Plata, Lyda Maritza

2016-01-01

INTRODUCCION. El trastorno del Desarrollo de la Coordinación TDC en la infancia es una problemática importante desde la salud pública, ya que tiene repercusiones importantes desde las diferentes esferas del desarrollo: motora, cognitiva, psicosocial y emocional, por lo mismo, es frecuente la presencia de comorbilidad con otros trastornos del desarrollo infantil. Se presenta un estudio multicéntrico que caracteriza la asociación del TDC con otros trastornos del desarrollo. OBJETIVO. Determ...

Calidad del software: camino hacia una verdadera industria del software

Directory of Open Access Journals (Sweden)

Saulo Ernesto Rojas Salamanca

1999-07-01

Full Text Available El software es quizá uno de los productos de la ingeniería que más ha evolucionado en muy poco tiempo, pasando desde el software empírico o artesanal hasta llegar al software desarrollado bajo los principios y herramientas de la ingeniería del software. Sin embargo, dentro de estos cambios, las personas encargadas de la elaboración del software se han enfrentado a problemas muy comunes: unos debido a la exigencia cada vez mayor en la capacidad de resultados del software, debido al permanente cambio de condiciones lo que aumenta su complejidad y obsolescencia; y otros, debido a la carencia de herramientas adecuadas y estándares de tipo organizacional encaminados al mejoramiento de los procesos en el desarrollo del software. Hacia la búsqueda de mecanismos de solución de estos últimos problemas se orienta este artículo...

Carta del Editor

Directory of Open Access Journals (Sweden)

Luis Eladio Proaño

2015-01-01

Full Text Available La millonaria contratación del futbolista David Beckham, un fenómeno del mercado, ha provocado cuestionamientos a los que se busca respuesta. Es tema de análisis el por qué el betseller "Harry Potter" ha causado tanta conmoción en la opinión pública. Respecto al periodista cibernético, se señalan los contornos del presente y atisban las posibilidades del futuro de esta nueva profesión. El tratamiento de los mitos de la prensa, los temores de la Ley mordaza venezolana y la brutalidad de los video juegos e Internet son temas de enorme interés. Se comenta las pocas veces que la prensa reflexiona sobre la comunicación corporal y la anorexia.

Influencia del evento el niño-oscilacion del sur sobre las precipitaciones en cinco ciudades del litoral ecuatoriano

OpenAIRE

Espol; Rodriguez Aguilar, Jose Antonio; Luna Rodriguez, Javier Alejandro

2017-01-01

La investigación se realizó con el objetivo de evaluar la influencia del fenómeno enos, caracterizado por los índices oni e icen, sobre las precipitaciones ocurridas en el período de 1975-2016 en ciudades del litoral ecuatoriano, con la finalidad de que contribuya al diseño de lineamientos para mejorar la respuesta de la población ante la posible presencia del evento Guayaquil MAGISTER EN CAMBIO CLIMATICO

El reconocimiento del arte mobilar cantábrico : la aportación del H. Alcalde del Río

Directory of Open Access Journals (Sweden)

Ignacio Barandiarán Maestu

2008-01-01

Full Text Available Se presenta el primer reconocimiento del arte mobiliar cantábrico por H. Alcalde del Río: obras muy importantes recuperadas en sus excavaciones de las cuevas de Altamira (1904 y Hornos de la Peña (con J. Bouyssonie, H. Breuil y H. Obermaier, en 1909-1910. Se analizan sus interpretaciones (publicadas en 1906 y 1911 por Alcalde del Río y H. Breuil para asentar la aproximación arte mobiliar/arte rupestre en tres casos: las figuras de signos cerrados; las figuras de ciervas de trazo estriado; el estilo de las figuras animales ‘auriñacienses’.We introduce the earliest recognition of Cantabrian portable art by H. Alcalde del Río: the very important art pieces retrieved at his excavations at the caves of Altamira (1904 and Hornos de la Peña (alongwith J. Bouyssonie, H. Breuil y H. Obermaier, in 1909-1910. Their interpretations (published in 1906 and 1911 by Alcalde del Río and H. Breuil in order to fix the relationships between portable and rock art are analysed: the closed signs (tectiformes; the hind figures of multiple engravings; and the “aurignacian” style.

Del bit al qubit

OpenAIRE

Torras Font, Josep

2011-01-01

Aquest document pretén donar una visió del desenvolupament dels computadors electrònics i dels components que els han fet possibles. Dintre de les opcions de futur en computació, també intenta donar una visió de les bases en que es fonamenta la computació quàntica.

El valor del consejo en el Libro del caballero Zifar

Directory of Open Access Journals (Sweden)

Patricia ROCHWERT-ZUILI

2011-11-01

Full Text Available El propósito de este artículo es mostrar el valor que cobra en el Libro del caballero Zifar la definición del consejo como elemento fundamental del molinismo. El análisis permite distinguir no solo la afirmación de una palabra linajística ejemplar sino también la importancia del consejo del verdadero amigo, y en particular, el de la mujer o del caballero. A través de la valoración de la prueba que le tiene que imponer el rey al consejero se vislumbra además la imagen de este consejo privado que se impuso bajo el reinado de Alfonso XI y cuyo papel no fue sino confortar el poder de la realeza.Le propos de cet article est de montrer l’importance que revêt dans le Livre du chevalier Zifar la définition du conseil comme trait essentiel du molinisme. L’analyse permet non seulement de mettre en évidence l’affirmation d’une parole lignagère exemplaire mais aussi de distinguer le conseil de l’ami véritable, en particulier celui de la femme ou du chevalier. À travers la valorisation de l’épreuve que le roi se doit d’imposer au conseiller, on entrevoit en outre l’image du conseil privé qui s’imposa sous le règne d’Alphonse XI et dont le rôle fut de conforter le pouvoir de la royauté.

Memorias para armar. Las conmemoraciones del 24 de Marzo en escuelas primarias del conurbano bonaerense

OpenAIRE

Gonzalo de Amézola; Claudia D\\u2019Achary

2009-01-01

Este artículo se ocupa del problema del tratamiento del pasado reciente en la escuela. Describe las distintas representaciones de la última dictadura militar que se encuentran presentes en los discursos pronunciados en las conmemoraciones realizadas en 2008 para recor - dar el golpe de Estado del 24 de marzo de 1976 en escuelas primarias del partido de Malvinas Argentinas, ubicado en el Conurbano Bonae - rense. Se analiza en esos discursos la presencia de distintas narracio - nes de la memori...

Perfil histológico e inmunohistoquímico del desarrollo del mesenquima de la extremidad del embrión y feto

OpenAIRE

Gosálbez García, Javier

2016-01-01

El presente trabajo de tesis doctoral se centra en el estudio del mesémquima de la extremidad de embriones y fetos obtenidos de 50 muestras procedentes de abortos recogidas del archivo del Servicio de Anatomía Patológica del H.U.C.A. Tras la clasificación de las muestras según el tamaño y edad de gestación probable, el procesamiento de los tejidos se realizó según la técnica habitual de preparación de muestras para su estudio histológico con microscopio óptico. Las tinciones se realizaron ...

Los policías como detectores del engaño: Investigación en torno al efecto del sesgo del investigador

OpenAIRE

Alonso Dosouto, Hernán

2011-01-01

[ES] En esta Tesis se trata la profundización en el estudio del investigator bias effect (que traduciremos como “efecto del sesgo del investigador1”), que ha sido definido por Meissner y Kassin (2002) como la tendencia o sesgo de los policías (“profesionales” de la detección del engaño) a emitir un mayor porcentaje de juicios de mentira2 cuando se enfrentan a una tarea de evaluación de la veracidad. Meissner y Kassin (2002) han planteado que en la raíz de este sesgo se encontrarían tanto el ...

Midiendo los resultados del comercio agropecuario mexicano en el contexto del TLCAN

Directory of Open Access Journals (Sweden)

Belem Dolores Avendaño Ruiz

2009-01-01

Full Text Available La integración comercial del TLCAN puede tener efectos positivos y negativos en las economías que la promueven, dependiendo en gran medida del grado de apertura, el tipo de competencia que se genere y el nivel de desarrollo de los países. El propósito de este trabajo es medir los resultados del comercio agropecuario en el contexto del TLCAN. Se prueba el análisis en los indicadores de creación y desviación de comercio, de especialización comercial y competitividad y el impacto por el cambio en las exportaciones e importaciones agropecuarias y productos seleccionados.

Desarrollo del ensilado del alga Gracilaria chilensis para la alimentación del abalón rojo Haliotis rufescens

Directory of Open Access Journals (Sweden)

Alfonso Mardones

2015-05-01

Full Text Available En Chile, el principal insumo usado como alimento para abalones son las algas Gracilaria chilensis y Macrocystis pyrifera. Estas algas experimentan una notable baja de disponibilidad en otoño e invierno, lo cual trae consigo un aumento considerable de los precios, al tener que depender del abastecimiento desde áreas cada vez más alejadas de los centros de cultivo de abalones y, eventualmente, generando impactos ecológicos indirectos en sus poblaciones. El objetivo fue elaborar y evaluar un ensilado del alga G. chilensis para la alimentación de abalón rojo (Haliotis rufescens, determinando la cantidad de lixiviados generados durante el proceso, el cambio en la composición proximal del alga, la preferencia y consumo del abalón rojo de ensilado de G. chilensis. Se logró un producto ensilado de buenas características físicas, químicas y de conservación, así como una buena aceptación por parte del abalón.

Relación entre el Grado de Aplicación del Agua del Riego y la Estructura del Suelo.

Directory of Open Access Journals (Sweden)

Bustamante B. Fabio

1975-06-01

Full Text Available Algunos suelos sueltos, sin estructura, tienden a consolidarse como un resultado del artefacto que produce el riego o la lluvia. Una de las manifestaciones de la estructura del suelo es la densidad aparente, la cual está relacionada con la consolidación y reducción de espacios porosos en el suelo. La consolidación causada por la adición de agua al suelo puede tener el mismo efecto de la compactación causado por la labranza o por los equipos agrícolas. Se hicieron ensayos para determinar la relación entre los diferentes grados de aplicación del agua y la consolidación del suelo debida al riego, y se determinó para cada caso, la densidad y la porosidad. Se encontró que la resistencia del suelo, o sea, el mantenimiento de una estructura dada, es muy sensible al contenido y cambios en el incremento de la humedad, haciendo que se disminuya la macroporosidad con el consecuente aumento de la densidad aparente. 

Transferencia microquirúrgica hemipulpar del hallux en la reconstrucción del pulgar

Directory of Open Access Journals (Sweden)

José-Manuel Rodríguez-Vegas

Full Text Available Introducción y Objetivo. La transferencia hemipulpar del hallux permite excelentes reconstrucciones de pulgar porque ofrece tejidos blandos de alta calidad, contorno pulpar casi normal y recuperación sensitiva satisfactoria sin necesidad de reorientación cortical. Además, a diferencia de colgajos locales y regionales, evita la agresión adicional a una mano ya lesionada, optimizando así el período de rehabilitación y el resultado final. El artículo revisa la experiencia del autor en la técnica y compara el procedimiento con otras opciones reconstructivas. Material y Método. Realizamos una revisión retrospectiva de 16 pacientes sometidos a transferencia hemipulpar del hallux en el período 2007-2013. Todos los pacientes fueron varones, con una edad media de 34 años y una alta demanda funcional (trabajadores manuales con traumatismo laboral. La técnica fue indicada en defectos mayores del 50% de la superficie pulpar del pulgar en pacientes sin factores de riesgo asociados relevantes. En 3 de los casos el defecto pulpar asoció un defecto óseo de falange distal de tamaño suficiente para aconsejar la transferencia combinada osteo-pulpar. Resultados. Quince de los 16 colgajos sobrevivieron sin incidencias postoperatorias. Un colgajo sufrió trombosis arterial con retirada del colgajo y cirugía adicional de cobertura. En 2 pacientes se realizó revisión estética del colgajo de manera diferida. Excepto en el caso fallido, todos los pacientes volvieron a su actividad laboral previa con excelente recuperación funcional de la mano. El cierre de la zona donante se realizó mediante cierre directo (12 pacientes o injerto cutáneo (4 pacientes. Ninguno de los pacientes, independientemente del tipo de cierre del defecto en el pie, refirió problemas en la deambulación o apariencia estética del pie. Conclusiones. La reconstrucción de defectos pulpares del pulgar mediante transferencia hemipulpar del hallux permite un excelente resultado

Utilización de especies nativas del bosque seco para la recuperación del paisaje en el proceso de cierre del botadero a cielo abierto del distrito Las Lomas-Piura

OpenAIRE

Montoro Negrón, Barbara Elizabeth; Montoro Negrón, Barbara Elizabeth; Montoro Negrón, Barbara Elizabeth

2011-01-01

La presente investigación estudia la fragmentación del paisaje del distrito de Las Lomas en Piura, afectado por la existencia de un botadero a cielo abierto, y la posible restauración del paisaje durante el proceso de clausura. Para lo cual se estudiaron las especies vegetales nativas del bosque seco piurano seleccionando las más resistentes y útiles en el proceso de recuperación, las mismas que fueron colocadas paisajísticamente sobre la cobertura final. Este proceso denominado Fitorremediac...

La naturaleza de la responsabilidad del productor a la luz del derecho norteamericano

Directory of Open Access Journals (Sweden)

Olenka Woolcott

2007-01-01

Full Text Available La existencia de un ingrediente contractual en el origen de la responsabilidad del productor en el presente siglo sugiere una necesaria referencia al derecho contractual del S. XIX. A diferencia del S. XVIII en el cual, resulta sumamente difícil alcanzar un conocimiento pleno del common law, debido al escaso n úmero de demandas judiciales y a la casi inexistente trascendencia del precedente judicial, en el S. XIX se asiste a un cambio profundo debido a la expansión económica. Este fenómeno determinó un incremento paralelo de las demandas judiciales, gran parte de las cuales tenía como fundamento la mala calidad del producto vendido. Este período, caracterizado por el movimiento en las operaciones económicas que suscita el desarrollo industrial, se convierte en el contexto ad hoc para la difusión y la consolidación del principio de la privity of contract que en los sistemas de derecho escrito viene a corresponder al principio de la ‘relatividad contractual’. La verificación de profundos cambios en el ámbito socioeconómico dará inicio a toda una etapa de transformación de la responsabilidad del productor, destacando los casos que han sentado precedentes en esta evolución con una orientación clara hacia la tutela de las víctimas de daños derivados de productos defectuosos.

Breve fenomenologia del lettore ai confini del nonsense (o Il lettore provocato

Directory of Open Access Journals (Sweden)

Laura Lucia Rossi

2012-12-01

Full Text Available In questo articolo esaminiamo alcuni generi letterari che sono stati spesso accostati al nonsense letterario. In particolare prendiamo in considerazione il ruolo del lettore all’interno di questi testi e ne proponiamo una sorta di fenomenologia. Invitiamo, infine, a riflettere su come considerare la dimensione del lettore all’interno di un genere letterario possa condurre a risultati rilevanti circa la definizione del genere stesso.