Fonseca, Fátima; Chudyk, Ewa I; van der Kamp, Marc W; Correia, António; Mulholland, Adrian J; Spencer, James
2012-11-07
Carbapenems are the most potent β-lactam antibiotics and key drugs for treating infections by Gram-negative bacteria. In such organisms, β-lactam resistance arises principally from β-lactamase production. Although carbapenems escape the activity of most β-lactamases, due in the class A enzymes to slow deacylation of the covalent acylenzyme intermediate, carbapenem-hydrolyzing class A β-lactamases are now disseminating in clinically relevant bacteria. The reasons why carbapenems are substrates for these enzymes, but inhibit other class A β-lactamases, remain to be fully established. Here, we present crystal structures of the class A carbapenemase SFC-1 from Serratia fonticola and of complexes of its Ser70 Ala (Michaelis) and Glu166 Ala (acylenzyme) mutants with the carbapenem meropenem. These are the first crystal structures of carbapenem complexes of a class A carbapenemase. Our data reveal that, in the SFC-1 acylenzyme complex, the meropenem 6α-1R-hydroxyethyl group interacts with Asn132, but not with the deacylating water molecule. Molecular dynamics simulations indicate that this mode of binding occurs in both the Michaelis and acylenzyme complexes of wild-type SFC-1. In carbapenem-inhibited class A β-lactamases, it is proposed that the deacylating water molecule is deactivated by interaction with the carbapenem 6α-1R-hydroxyethyl substituent. Structural comparisons with such enzymes suggest that in SFC-1 subtle repositioning of key residues (Ser70, Ser130, Asn132 and Asn170) enlarges the active site, permitting rotation of the carbapenem 6α-1R-hydroxyethyl group and abolishing this contact. Our data show that SFC-1, and by implication other such carbapenem-hydrolyzing enzymes, uses Asn132 to orient bound carbapenems for efficient deacylation and prevent their interaction with the deacylating water molecule.
Conserved water molecules in bacterial serine hydroxymethyltransferases.
Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano
2015-10-01
Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Water-assisted dehalogenation of thionyl chloride in the presence of water molecules.
Yeung, Chi Shun; Ng, Ping Leung; Guan, Xiangguo; Phillips, David Lee
2010-04-01
A second-order Møller-Plesset perturbation theory (MP2) and density functional theory (DFT) investigation of the dehalogenation reactions of thionyl chloride is reported, in which water molecules (up to seven) were explicitly involved in the reaction complex. The dehalogenation processes of thionyl chloride were found to be dramatically catalyzed by water molecules. The reaction rate became significantly faster as more water molecules became involved in the reaction complex. The dehalogenation processes can be reasonably simulated by the gas-phase water cluster models, which reveals that water molecules can help to solvate the thionyl chloride molecules and activate the release of the Cl(-) leaving group. The computed activation energies were used to compare the calculations to available experimental data.
Towards ligand docking including explicit interface water molecules.
Directory of Open Access Journals (Sweden)
Gordon Lemmon
Full Text Available Small molecule docking predicts the interaction of a small molecule ligand with a protein at atomic-detail accuracy including position and conformation the ligand but also conformational changes of the protein upon ligand binding. While successful in the majority of cases, docking algorithms including RosettaLigand fail in some cases to predict the correct protein/ligand complex structure. In this study we show that simultaneous docking of explicit interface water molecules greatly improves Rosetta's ability to distinguish correct from incorrect ligand poses. This result holds true for both protein-centric water docking wherein waters are located relative to the protein binding site and ligand-centric water docking wherein waters move with the ligand during docking. Protein-centric docking is used to model 99 HIV-1 protease/protease inhibitor structures. We find protease inhibitor placement improving at a ratio of 9:1 when one critical interface water molecule is included in the docking simulation. Ligand-centric docking is applied to 341 structures from the CSAR benchmark of diverse protein/ligand complexes [1]. Across this diverse dataset we see up to 56% recovery of failed docking studies, when waters are included in the docking simulation.
Molecular dynamics study of water molecule diffusion in oil-paper insulation materials
International Nuclear Information System (INIS)
Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan
2011-01-01
Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.
Molecular dynamics study of water molecule diffusion in oil-paper insulation materials
Energy Technology Data Exchange (ETDEWEB)
Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)
2011-03-01
Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.
On the Several Molecules and Nanostructures of Water
Directory of Open Access Journals (Sweden)
Cynthia Kolb Whitney
2012-01-01
Full Text Available This paper investigates the water molecule from a variety of viewpoints. Water can involve different isotopes of Hydrogen and Oxygen, it can form differently shaped isomer molecules, and, when frozen, it occupies space differently than most other substances do. The tool for conducting the investigation of all this is called ‘Algebraic Chemistry’. This tool is a quantitative model for predicting the energy budget for all sorts of changes between different ionization states of atoms that are involved in chemical reactions and in changes of physical state. The model is based on consistent patterns seen in empirical data about ionization potentials, together with rational scaling laws that can interpolate and extrapolate for situations where no data are available. The results of the investigation of the water molecule include comments, both positive and negative, about technologies involving heavy water, poly water, Brown’s gas, and cold fusion.
Autodissociation of a water molecule in liquid water
Energy Technology Data Exchange (ETDEWEB)
Geissler, Phillip L.; Dellago, Christoph; Chandler, David; Hutter, Jurg; Parrinello, Michele
2000-04-01
The dissociation of a water molecule in liquid water is the fundamental event in acid-base chemistry, determining the pH of water.Because the microscopic dynamics of this autodissociation are difficult to probe, both by experiment and by computer simulation, its mechanism has been unknown. Here we report several autodissociation trajectories generated by ab initio molecular dynamics [1]. These trajectories, which were harvested using transition path sampling [2-4], reveal the mechanism for the first time. Rare fluctuations in solvation energies destabilize an oxygen-hydrogen bond. Through the transfer of one or more protons along a hydrogen bond.
Rapid and accurate prediction and scoring of water molecules in protein binding sites.
Directory of Open Access Journals (Sweden)
Gregory A Ross
Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.
The role of water molecules in computational drug design.
de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris
2010-01-01
Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.
Energy Technology Data Exchange (ETDEWEB)
Stia, C.R.; Fojon, O.A. [Instituto de Fisica Rosario - CONICET-Universidad Nacional de Rosario, Rosario (Argentina); Gaigeot, M.P. [Laboratoire Analyse et Modelisation pour la Biologie et l' Environnement, LAMBE, UMR-CNRS 8587, Universite d' Evry-Val-d' Essonne, 91 - Evry (France); Institut Universitaire de France, 75 - Paris (France); Vuilleumier, R. [Departement de chimie, Ecole Normale Superieure, 75 - Paris (France); Herve du Penhoat, M.A.; Politis, M.F. [Institut de Mineralogie et de Physique des Milieux Condenses, IMPMC, UMR-CNRS 7590, Universite Pierre et Marie Curie, 75 - Paris (France)
2010-10-15
We present a series of ab initio density functional based calculations of the fragmentation dynamics of core-ionized biomolecules. The computations are performed for pure liquid water, aqueous and isolated Uracil. Core ionization is described by replacing the 1s{sup 2} pseudopotential of one atom of the target molecule (C, N or O) with a pseudopotential for a 1s{sup 1} core-hole state. Our results predict that the dissociation of core-ionized water molecules may be reached during the lifetime of inner-shell vacancy (less than 10 fs), leading to OH bond breakage as a primary outcome. We also observe a second fragmentation channel in which total Coulomb explosion of the ionized water molecule occurs. Fragmentation pathways are found similar for pure water or when the water molecule is in the primary hydration shell of the uracil molecule. In the latter case, the proton may be transferred towards the uracil oxygen atoms. When the core hole is located on the uracil molecule, ultrafast dissociation is only observed in the aqueous environment and for nitrogen-K vacancies, resulting in proton transfers towards the hydrogen-bonded water molecule. (authors)
Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.
Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin
2013-06-20
When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.
Density, distribution, and orientation of water molecules inside and outside carbon nanotubes.
Thomas, J A; McGaughey, A J H
2008-02-28
The behavior of water molecules inside and outside 1.1, 2.8, 6.9, and 10.4 nm diameter armchair carbon nanotubes (CNTs) is predicted using molecular dynamics simulations. The effects of CNT diameter on mass density, molecular distribution, and molecular orientation are identified for both the confined and unconfined fluids. Within 1 nm of the CNT surface, unconfined water molecules assume a spatially varying density profile. The molecules distribute nonuniformly around the carbon surface and have preferred orientations. The behavior of the unconfined water molecules is invariant with CNT diameter. The behavior of the confined water, however, can be correlated to tube diameter. Inside the 10.4 nm CNT, the molecular behavior is indistinguishable from that of the unconfined fluid. Within the smaller CNTs, surface curvature effects reduce the equilibrium water density and force water molecules away from the surface. This effect changes both the molecular distribution and preferred molecular orientations.
Structures of water molecules in carbon nanotubes under electric fields
International Nuclear Information System (INIS)
Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji
2015-01-01
Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate
Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations
International Nuclear Information System (INIS)
Markovic, M.I.
1974-01-01
Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy
Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl
Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.
2018-02-01
Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.
Distribution of binding energies of a water molecule in the water liquid-vapor interface
Energy Technology Data Exchange (ETDEWEB)
Chempath, Shaji [Los Alamos National Laboratory; Pratt, Lawrence R [TULANE UNIV
2008-01-01
Distributions of binding energies of a water molecule in the water liquid-vapor interface are obtained on the basis of molecular simulation with the SPC/E model of water. These binding energies together with the observed interfacial density profile are used to test a minimally conditioned Gaussian quasi-chemical statistical thermodynamic theory. Binding energy distributions for water molecules in that interfacial region clearly exhibit a composite structure. A minimally conditioned Gaussian quasi-chemical model that is accurate for the free energy of bulk liquid water breaks down for water molecules in the liquid-vapor interfacial region. This breakdown is associated with the fact that this minimally conditioned Gaussian model would be inaccurate for the statistical thermodynamics of a dilute gas. Aggressive conditioning greatly improves the performance of that Gaussian quasi-chemical model. The analogy between the Gaussian quasi-chemical model and dielectric models of hydration free energies suggests that naive dielectric models without the conditioning features of quasi-chemical theory will be unreliable for these interfacial problems. Multi-Gaussian models that address the composite nature of the binding energy distributions observed in the interfacial region might provide a mechanism for correcting dielectric models for practical applications.
Dynamics of water molecules in the active-site cavity of human cytochromes P450
DEFF Research Database (Denmark)
Rydberg, Patrik; Rod, Thomas Holm; Olsen, Lars
2007-01-01
We have studied the dynamics of water molecules in six crystal structures of four human cytochromes P450, 2A6, 2C8, 2C9, and 3A4, with molecular dynamics simulations. In the crystal structures, only a few water molecules are seen and the reported sizes of the active-site cavity vary a lot....... In the simulations, the cavities are completely filled with water molecules, although with approximately 20% lower density than in bulk water. The 2A6 protein differs from the other three in that it has a very small cavity with only two water molecules and no exchange with the surroundings. The other three proteins...... channels, through which there is a quite frequent exchange of water molecules (one molecule is exchanged every 30-200 ps), except in 2A6. Most of the channels are observed also in the crystal structures, but two to three channels in each protein open only during the simulations. There are no water...
International Nuclear Information System (INIS)
Kim, Eunae; Yeom, Min Sun
2014-01-01
Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge
Vibrational properties of water molecules adsorbed in different zeolitic frameworks
International Nuclear Information System (INIS)
Crupi, V; Longo, F; Majolino, D; Venuti, V
2006-01-01
The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different
Integration or segregation: how do molecules behave at oil/water interfaces?
Moore, F G; Richmond, G L
2008-06-01
It has been over 250 years since Benjamin Franklin, fascinated with the wave-stilling effect of oil on water, performed his famous oil-drop experiments; nevertheless, the behavior of water molecules adjacent to hydrophobic surfaces continues to fascinate today. In the 18th century, the calming of the seas seemed the most pertinent application of such knowledge; today, we understand that oil-on-water phenomena underlie a range of important chemical, physical, and biological processes, including micelle and membrane formation, protein folding, chemical separation, oil extraction, nanoparticle formation, and interfacial polymerization. Beyond classical experiments of the oil-water interface, recent interest has focused on deriving a molecular-level picture of this interface or, more generally, of water molecules positioned next to any hydrophobic surface. This Account summarizes more than a decade's work from our laboratories aimed at understanding the nature of the hydrogen bonding occurring between water and a series of organic liquids in contact. Although the common perception is that water molecules and oil molecules positioned at the interface between the immiscible liquids want nothing to do with one another, we have found that weak interactions between these hydrophilic and hydrophobic molecules lead to interesting interfacial behavior, including highly oriented water molecules and layering of the organic medium that extends several molecular layers deep into the bulk organic liquid. For some organic liquids, penetration of oriented water into the organic layer is also apparent, facilitated by molecular interactions established at the molecularly thin region of first contact between the two liquids. The studies involve a combined experimental and computational approach. The primary experimental tool that we have used is vibrational sum frequency spectroscopy (VSFS), a powerful surface-specific vibrational spectroscopic method for measuring the molecular
Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures
Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.
2018-05-01
Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.
Hydroxyl and water molecule orientations in trypsin: Comparison to molecular dynamics structures
Energy Technology Data Exchange (ETDEWEB)
McDowell, R.S.; Kossiakoff, A.A. [Genentech, Inc., South San Francisco, CA (United States)
1994-12-31
A comparison is presented of experimentally observed hydroxyl and water hydrogens in trypsin determined from neutron density maps with the results of a 140ps molecular dynamics (MD) simulation. Experimental determination of hydrogen and deuterium atom positions in molecules as large as proteins is a unique capability of neutron diffraction. The comparison addresses the degree to which a standard force-field approach can adequately describe the local electrostatic and van der Waals forces that determine the orientations of these hydrogens. Neutron densities, derived from 2.1{Angstrom} D{sub 2}O-H{sub 2}O difference Fourier maps, provide a database of 27 well-ordered hydroxyl hydrogens. Most of the simulated hydroxyl orientations are within a standard deviation of the experimentally-observed positions, including several examples in which both the simulation and the neutron density indicate that a hydroxyl group is shifted from a {open_quote}standard{close_quote} rotamer. For the most highly ordered water molecules, the hydrogen distributions calculated from the trajectory were in good agreement with neutron density; simulated water molecules that displayed multiple hydrogen bonding networks had correspondingly broadened neutron density profiles. This comparison was facilitated by development of a method to construct a pseudo 2{Angstrom} density map based on the hydrogen atom distributions from the simulation. The degree of disorder of internal water molecules is shown to result primarily from the electrostatic environment surrounding that water molecule as opposed to the cavity size available to the molecule. A method is presented for comparing the discrete observations sampled in a dynamics trajectory with the time- averaged data obtained from X-ray or neutron diffraction studies. This method is particularly useful for statically-disordered water molecules, in which the average location assigned from a trajectory may represent a site of relatively low occupancy.
Transport of water molecules through noncylindrical pores in multilayer nanoporous graphene.
Shahbabaei, Majid; Kim, Daejoong
2017-08-09
In this study, molecular dynamics (MD) simulations are used to examine the water transport properties through asymmetric hourglass-shaped pores in multilayer nanoporous graphene with a constant interlayer separation of 6 Å. The properties of the tested asymmetric hourglass-shaped pores [with the models having long cone (l 1 , -P) and short cone (l 2 , +P) entrances] are compared to a symmetric pore model. The study findings indicate that the water occupancy increases across the asymmetric pore (l 1 , -P) compared to (l 2 , +P), because of the length effect. The asymmetric pore, (l 1 , -P), yields higher flux compared to (l 2 , +P) and even the symmetric model, which can be attributed to the increase in the hydrogen bonds. In addition, the single-file water molecules across the narrowest pore diameter inside the (l 2 , +P) pore exhibit higher viscosity compared to those in the (l 1 , -P) pore because of the increase in the water layering effect. Moreover, it is found that the permeability inside the multilayer hourglass-shaped pore depends on the length of the flow path of the water molecules before approaching the layer with the smallest pore diameter. The probability of dipole orientation exhibits wider distribution inside the (l 1 , -P) system compared to (l 2 , +P), implying an enhanced formation of hydrogen bonding of water molecules. This results in the fast flow of water molecules. The MD trajectory shows that the dipole orientation across the single-layer graphene has frequently flipped compared to the dipole orientation across the pores in multilayer graphene, which is maintained during the whole simulation time (although the dipole orientation has flipped for a few picoseconds at the beginning of the simulation). This can be attributed to the energy barrier induced by the individual layer. The diffusion coefficient of water molecules inside the (l 2 , +P) system increases with pressure difference, however, it decreases inside the (l 1 , -P) system because
International Nuclear Information System (INIS)
Lin, Jau-Wen
2014-01-01
This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied
Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site
Directory of Open Access Journals (Sweden)
Hymavati
2012-01-01
Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.
International Nuclear Information System (INIS)
Markovic, M. I.; Radunovic, J. B.
1976-01-01
Determination of spatial distribution of neutron flux in water, most frequently used moderator in thermal reactors, demands microscopic scattering kernels dependence on cosine of thermal neutrons scattering angle when solving the Boltzmann equation. Since spatial orientation of water molecules influences this dependence it is necessary to perform orientation averaging or rotation-vibrational intermediate scattering function for water molecules. The calculations described in this paper and the obtained results showed that methods of orientation averaging do not influence the anisotropy of thermal neutrons scattering on water molecules, but do influence the inelastic scattering
Investigation of the Hydantoin Monomer and its Interaction with Water Molecules
Gruet, Sébastien; Perez, Cristobal; Schnell, Melanie
2017-06-01
Hydantoin (Imidazolidine-2,4-dione, C_3H_4N_2O_2) is a five-membered heterocyclic compound of astrobiological interest. This molecule has been detected in carbonaceous chondrites [1], and its formation can rise from the presence of glycolic acid and urea, two prebiotic molecules [2]. The hydrolysis of hydantoin under acidic conditions can also produce glycine [3], an amino acid actively searched for in the interstellar medium. Spectroscopic data of hydantoin is very limited and mostly dedicated to the solid phase. The high resolution study in gas phase is restricted to the work recently published by Ozeki et al. reporting the pure rotational spectra of the ground state and two vibrational states of the molecule in the millimeter-wave region (90-370 GHz)[4]. Using chirped-pulse Fourier-transform microwave (CP-FTMW) spectroscopy, we recorded the jet-cooled rotational spectra of hydantoin with water between 2 to 8 GHz. We observed the ground state of hydantoin monomer and several water complexes with one or two water molecules. All the observed species exhibit a hyperfine structure due to the two nitrogen atoms present in the molecule, which were fully resolved and analyzed. Additional experiments with a ^{18}O enriched water sample were realized to determine the oxygen-atom positions of the water monomers. These experiments yielded accurate structural information on the preferred water binding sites. The observed complexes and the interactions that hold them together, mainly strong directional hydrogen bonds, will be presented and discussed. [1] Shimoyama, A. and Ogasawara, R., Orig. Life Evol. Biosph., 32, 165-179, 2002. DOI:10.1023/A:1016015319112. [2] Menor-Salván, C. and Marín-Yaseli, M.R., Chem. Soc. Rev., 41(16), 5404-5415, 2012. DOI:10.1039/c2cs35060b. [3] De Marcellus P., Bertrand M., Nuevo M., Westall F. and Le Sergeant d'Hendecourt L., Astrobiology. 11(9), 847-854, 2011. DOI:10.1089/ast.2011.0677. [4] Ozeki, H., Miyahara R., Ihara H., Todaka S., Kobayashi
Femtosecond spectroscopic study of the solvation of amphiphilic molecules by water
Rezus, Y.L.A.; Bakker, H.J.
2008-01-01
We use polarization-resolved mid-infrared pump-probe spectroscopy to study the aqueous solvation of proline and N-methylacetamide. These molecules serve as models to study the solvation of proteins. We monitor the orientational dynamics of partly deuterated water molecules (HDO) that are present at
Photoionization of water molecules by high energy photons
Directory of Open Access Journals (Sweden)
Lara Martini
2017-07-01
Full Text Available We theoretically study the photoionization of water molecules by high energy photon impact. We develop a model in which the final state wavefunction is given by a Coulomb continuum wavefunction with effective charges and the water molecule bound states are represented using the Moccia's monocentric wavefunctions. We obtain analytical expressions for the transition matrix element that enable the computation of cross sections by numerical quadratures. We compare our predictions for photon energies between 20 and 300 eV with more elaborated theoretical results and experiments. We obtain a very good agreement with experiments, in particular, at enough high energies where there is a lack of elaborated results due to their high computational cost. Received: 15 March 2017, Accepted: 25 June 2017; Edited by: S. Kais; DOI: http://dx.doi.org/10.4279/PIP.090006 Cite as: L Martini, D I R Boll, O A Fojón, Papers in Physics 9, 090006 (2017
Scattering of thermal neutron by the water molecule
International Nuclear Information System (INIS)
Rosa, L.P.
The calculation of the differenctial cross section for scattering of thermal neutrons by water, taking into account the translational, rotational and vibrational motions of the water molecule, is presented according to Nelkin' model. Some modifications are presented which have been introduced in the original method to improve the results and an application has been made to reactor physics, by calculating the thermal neutron flux in a homogenous medium containing water and absorver. Thirty thermal energy groups have been used to compute the spectra. Within the limits of error, better agreement has been obtained between theory and experiments by using a modified Nelkin kernel consisting of substituting the asymptotic formulae for the rotational and vibrational motions by more exact expressions, similar to the Buttler model for heavy water
Preparation and Characterization of Novel Gellan Gum Hydrogels Suitable for Modified Drug Release
Directory of Open Access Journals (Sweden)
Pietro Matricardi
2009-09-01
Full Text Available Innovative hydrogels obtained by physical and chemical crosslinking of deacylated Gellan gum have been characterized in terms of water uptake, rheological properties and compressibility, and the behaviour of the tested materials, according to the type of the obtained network, is thoroughly discussed. The release from the various gels of loaded model molecules of different steric hindrance was also investigated and the trend of the release profiles has been related to the structures proposed for the physical and the chemical hydrogel.
Water molecule-enhanced CO2 insertion in lanthanide coordination polymers
International Nuclear Information System (INIS)
Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang
2009-01-01
Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.
Electric dipole moments of nanosolvated acid molecules in water clusters.
Guggemos, Nicholas; Slavíček, Petr; Kresin, Vitaly V
2015-01-30
The electric dipole moments of (H2O)nDCl (n=3-9) clusters have been measured by the beam-deflection method. Reflecting the (dynamical) charge distribution within the system, the dipole moment contributes information about the microscopic structure of nanoscale solvation. The addition of a DCl molecule to a water cluster results in a strongly enhanced susceptibility. There is evidence for a noticeable rise in the dipole moment occurring at n≈5-6. This size is consistent with predictions for the onset of ionic dissociation. Additionally, a molecular-dynamics model suggests that even with a nominally bound impurity an enhanced dipole moment can arise due to the thermal and zero-point motion of the proton and the water molecules. The experimental measurements and the calculations draw attention to the importance of fluctuations in defining the polarity of water-based nanoclusters and generally to the essential role played by motional effects in determining the response of fluxional nanoscale systems under realistic conditions.
Influence of the effective mass of water molecule on thermal neutron scattering
International Nuclear Information System (INIS)
Markovic, M.
1981-01-01
The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E o = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)
Li, Fabing; Li, Zhanlong; Wang, Ying; Wang, Shenghan; Wang, Xiaojun; Sun, Chenglin; Men, Zhiwei
2018-05-01
The structural forms of water/deuterated water molecules located on the surface of borosilicate capillaries have been first investigated in this study on the basis of the Raman spectral data obtained at different temperatures and under atmospheric pressure for molecules in bulk and also for molecules absorbed by borosilicate glass surface. The strongest two fundamental bands locating at 3063 cm-1 (2438 cm-1) in the recorded Raman spectra are assigned here to the Osbnd H (Osbnd D) bond stretching vibrations and they are compared with the corresponding bands observed at 3124 cm-1 (2325 cm-1) in the Raman spectrum of ice Ih. Our spectroscopic observations have indicated that the structure of water and deuterated water molecules on borosilicate surface is similar to that of ice Ih (hexagonal phase of ice). These observations have also indicated that water molecules locate on the borosilicate surface so as to construct a bilayer structure and that strong and weak intermolecular hydrogen bonds are formed between water/deuterated molecules and silanol groups on borosilicate surface. In accordance with these findings, water and deuterated water molecules at the interface of capillary have a higher melting temperature.
Transport behavior of water molecules through two-dimensional nanopores
International Nuclear Information System (INIS)
Zhu, Chongqin; Li, Hui; Meng, Sheng
2014-01-01
Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules
Energy Technology Data Exchange (ETDEWEB)
Mugarza, Aitor; Shimizu, Tomoko K.; Ogletree, D. Frank; Salmeron, Miquel
2009-05-07
Tunneling electrons in a scanning tunneling microscope were used to excite specific vibrational quantum states of adsorbed water and hydroxyl molecules on a Ru(0 0 0 1) surface. The excited molecules relaxed by transfer of energy to lower energy modes, resulting in diffusion, dissociation, desorption, and surface-tip transfer processes. Diffusion of H{sub 2}O molecules could be induced by excitation of the O-H stretch vibration mode at 445 meV. Isolated molecules required excitation of one single quantum while molecules bonded to a C atom required at least two quanta. Dissociation of single H{sub 2}O molecules into H and OH required electron energies of 1 eV or higher while dissociation of OH required at least 2 eV electrons. In contrast, water molecules forming part of a cluster could be dissociated with electron energies of 0.5 eV.
Hydrogen bonding characterization in water and small molecules
Silvestrelli, Pier Luigi
2017-06-01
The prototypical hydrogen bond in water dimer and hydrogen bonds in the protonated water dimer, in other small molecules, in water cyclic clusters, and in ice, covering a wide range of bond strengths, are theoretically investigated by first-principles calculations based on density functional theory, considering not only a standard generalized gradient approximation functional but also, for the water dimer, hybrid and van der Waals corrected functionals. We compute structural, energetic, and electrostatic (induced molecular dipole moments) properties. In particular, hydrogen bonds are characterized in terms of differential electron density distributions and profiles, and of the shifts of the centres of maximally localized Wannier functions. The information from the latter quantities can be conveyed to a single geometric bonding parameter that appears to be correlated with the Mayer bond order parameter and can be taken as an estimate of the covalent contribution to the hydrogen bond. By considering the water trimer, the cyclic water hexamer, and the hexagonal phase of ice, we also elucidate the importance of cooperative/anticooperative effects in hydrogen-bonding formation.
Water-mediated influence of a crowded environment on internal vibrations of a protein molecule.
Kuffel, Anna; Zielkiewicz, Jan
2016-02-14
The influence of crowding on the protein inner dynamics is examined by putting a single protein molecule close to one or two neighboring protein molecules. The presence of additional molecules influences the amplitudes of protein fluctuations. Also, a weak dynamical coupling of collective velocities of surface atoms of proteins separated by a layer of water is detected. The possible mechanisms of these phenomena are described. The cross-correlation function of the collective velocities of surface atoms of two proteins was decomposed into the Fourier series. The amplitude spectrum displays a peak at low frequencies. Also, the results of principal component analysis suggest that the close presence of an additional protein molecule influences the high-amplitude, low-frequency modes in the most prominent way. This part of the spectrum covers biologically important protein motions. The neighbor-induced changes in the inner dynamics of the protein may be connected with the changes in the velocity power spectrum of interfacial water. The additional protein molecule changes the properties of solvation water and in this way it can influence the dynamics of the second protein. It is suggested that this phenomenon may be described, at first approximation, by a damped oscillator driven by an external random force. This model was successfully applied to conformationally rigid Choristoneura fumiferana antifreeze protein molecules.
Slow neutron scattering by water molecules
Energy Technology Data Exchange (ETDEWEB)
Stancic, V [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)
1970-07-01
In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)
Slow neutron scattering by water molecules
International Nuclear Information System (INIS)
Stancic, V.
1970-01-01
In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)
Tachibana, Kunihide; Nakamura, Toshihiro; Kawasaki, Mitsuo; Morita, Tatsuo; Umekawa, Toyofumi; Kawasaki, Masahiro
2018-01-01
We measured water molecule (H2O) density by tunable diode-laser absorption spectroscopy (TDLAS) for applications in dielectric barrier discharges (DBDs) with a gas-water interface. First, the effects of water temperature and presence of gas flow were tested using a Petri dish filled with water and a gas injection nozzle. Second, the TDLAS system was applied to the measurements of H2O density in two types of DBDs; one was a normal (non-inverted) type with a dielectric-covered electrode above a water-filled counter electrode and the other was an inverted type with a water-suspending mesh electrode above a dielectric-covered counter electrode. The H2O density in the normal DBD was close to the density estimated from the saturated vapor pressure, whereas the density in the inverted DBD was about half of that in the former type. The difference is attributed to the upward gas flow in the latter type, that pushes the water molecules up towards the gas-water interface.
STICKING OF MOLECULES ON NONPOROUS AMORPHOUS WATER ICE
Energy Technology Data Exchange (ETDEWEB)
He, Jiao; Vidali, Gianfranco [Physics Department, Syracuse University, Syracuse, NY 13244 (United States); Acharyya, Kinsuk, E-mail: gvidali@syr.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)
2016-05-20
Accurate modeling of physical and chemical processes in the interstellar medium (ISM) requires detailed knowledge of how atoms and molecules adsorb on dust grains. However, the sticking coefficient, a number between 0 and 1 that measures the first step in the interaction of a particle with a surface, is usually assumed in simulations of ISM environments to be either 0.5 or 1. Here we report on the determination of the sticking coefficient of H{sub 2}, D{sub 2}, N{sub 2}, O{sub 2}, CO, CH{sub 4}, and CO{sub 2} on nonporous amorphous solid water. The sticking coefficient was measured over a wide range of surface temperatures using a highly collimated molecular beam. We showed that the standard way of measuring the sticking coefficient—the King–Wells method—leads to the underestimation of trapping events in which there is incomplete energy accommodation of the molecule on the surface. Surface scattering experiments with the use of a pulsed molecular beam are used instead to measure the sticking coefficient. Based on the values of the measured sticking coefficient, we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy. We use this formula in a simulation of ISM gas–grain chemistry to find the effect of sticking on the abundance of key molecules both on grains and in the gas phase.
The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows
International Nuclear Information System (INIS)
Shen Zigang; Huang Yibo; Li Bin; Zhang Yi
2007-01-01
Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)
Zhu, Hanyu; Ma, Xin; Kong, John Y.; Zhang, Minli; Kenttämaa, Hilkka I.
2017-10-01
Tandem mass spectrometry based on ion-molecule reactions has emerged as a powerful tool for structural elucidation of ionized analytes. However, most currently used reagents were designed to react with protonated analytes, making them suboptimal for acidic analytes that are preferentially detected in negative ion mode. In this work we demonstrate that the phenoxide, carboxylate, and phosphate functionalities can be identified in deprotonated molecules by use of a combination of two reagents, diethylmethoxyborane (DEMB) and water. A novel reagent introduction setup that allowed DEMB and water to be separately introduced into the ion trap region of the mass spectrometer was developed to facilitate fundamental studies of this reaction. A new reagent, diethylhydroxyborane (DEHB), was generated inside the ion trap by hydrolysis of DEMB on introduction of water. Most carboxylates and phenoxides formed a DEHB adduct, followed by addition of one water molecule and subsequent ethane elimination (DEHB adduct +H2O - CH3CH3) as the major product ion. Phenoxides with a hydroxy group adjacent to the deprotonation site and phosphates formed a DEHB adduct, followed by ethane elimination (DEHB adduct - CH3CH3). Deprotonated molecules with strong intramolecular hydrogen bonds or without the aforementioned functionalities, including sulfates, were unreactive toward DEHB/H2O. Reaction mechanisms were explored via isotope labeling experiments and quantum chemical calculations. The mass spectrometry method allowed the differentiation of phenoxide-, carboxylate-, phosphate-, and sulfate-containing analytes. Finally, it was successfully coupled with high-performance liquid chromatography for the analysis of a mixture containing hymecromone, a biliary spasm drug, and its three possible metabolites. [Figure not available: see fulltext.
Su, Jiaye; Guo, Hongxia
2011-01-25
The transport of water molecules through nanopores is not only crucial to biological activities but also useful for designing novel nanofluidic devices. Despite considerable effort and progress that has been made, a controllable and unidirectional water flow is still difficult to achieve and the underlying mechanism is far from being understood. In this paper, using molecular dynamics simulations, we systematically investigate the effects of an external electric field on the transport of single-file water molecules through a carbon nanotube (CNT). We find that the orientation of water molecules inside the CNT can be well-tuned by the electric field and is strongly coupled to the water flux. This orientation-induced water flux is energetically due to the asymmetrical water-water interaction along the CNT axis. The wavelike water density profiles are disturbed under strong field strengths. The frequency of flipping for the water dipoles will decrease as the field strength is increased, and the flipping events vanish completely for the relatively large field strengths. Most importantly, a critical field strength E(c) related to the water flux is found. The water flux is increased as E is increased for E ≤ E(c), while it is almost unchanged for E > E(c). Thus, the electric field offers a level of governing for unidirectional water flow, which may have some biological applications and provides a route for designing efficient nanopumps.
Adsorption of ethyl xanthate on ZnS(110) surface in the presence of water molecules: A DFT study
Energy Technology Data Exchange (ETDEWEB)
Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Guangxi Colleges and University Key Laboratory of Minerals Engineering, 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)
2016-05-01
Graphical abstract: - Highlights: • Adsorption of water molecules decreases the reactivity of surface Zn atom. • Copper impurities decrease the band gap of ZnS surface. • Copper impurities enhance the adsorption of xanthate on the ZnS surface. • Water molecules have little influence on the properties of Cu-substituted ZnS surface. • The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface. - Abstracts: The interaction of collector with the mineral surface plays a very important role in the froth flotation of sphalerite. The adsorptions occurred at the interface between the mineral surface and waters; however most of DFT simulations are performed in vacuum, without consideration of water effect. Semiconductor surface has an obvious proximity effect, which will greatly influence the surface reactivity. To understand the mechanism of xanthate interacting with sphalerite surface in the presence of water molecules, the ethyl xanthate molecule adsorption on un-activated and Cu-activated ZnS(110) surface in the absence and presence of water molecules were performed using the density functional theory (DFT) method. The calculated results show that the adsorption of water molecules dramatically changes the properties of ZnS surface, resulting in decreasing the reactivity of surface Zn atoms with xanthate. Copper activation of ZnS surface changes the surface properties, leading to the totally different adsorption behaviors of xanthate. The presence of waters has little influence on the properties of Cu-activated ZnS surface. The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface, which would result in the formation of dixanthogen.
Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S
1994-09-23
The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
Continuum simulations of water flow past fullerene molecules
DEFF Research Database (Denmark)
Popadic, A.; Praprotnik, M.; Koumoutsakos, P.
2015-01-01
We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently by continuum flow...
The spontaneous synchronized dance of pairs of water molecules
Energy Technology Data Exchange (ETDEWEB)
Roncaratti, Luiz F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade de Brasília, 70910-900 Brasília (Brazil); Cappelletti, David, E-mail: david.cappelletti@unipg.it; Pirani, Fernando [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy)
2014-03-28
Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions.
The spontaneous synchronized dance of pairs of water molecules
International Nuclear Information System (INIS)
Roncaratti, Luiz F.; Cappelletti, David; Pirani, Fernando
2014-01-01
Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions
Zhang, Linyao; Yang, Li; Zhao, Yijun; Zhang, Jiaxu; Feng, Dongdong; Sun, Shaozeng
2017-07-06
The water dilute oxy-fuel combustion is a clean combustion technology for near-zero emission power; and the presence of water molecule could have both kinetic and dynamic effects on combustion reactions. The reaction OH + CO → CO 2 + H, one of the most important elementary reactions, has been investigated by extensive electronic structure calculations. And the effects of a single water molecule on CO oxidation have been studied by considering the preformed OH(H 2 O) complex reacts with CO. The results show little change in the reaction pathways, but the additional water molecule actually increases the vibrationally adiabatic energy barriers (V a G ). Further thermal rate constant calculations in the temperature range of 200 to 2000 K demonstrate that the total low-pressure limit rate constant for the water assisted OH(H 2 O) + CO → CO 2 + H 2 O + H reaction is 1-2 orders lower than that of the water unassisted one, which is consistent with the change of V a G . Therefore, the hydrated radical OH(H 2 O) would actually slow down the oxidation of CO. Meanwhile, comparisons show that the M06-2X/aug-cc-pVDZ method gives a much better estimation in energy and thus is recommended to be employed for direct dynamics simulations.
Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite
Yoon, Seyoon
2013-01-01
The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current knowledge of the refined structure. The MD simulations provide detailed information on the position and mobility of the hydrogen and oxygen of interlayer water, as well as its self-diffusion coefficient, through the interlayer of 14 Å tobermorite. Comparison of the MD simulation results at 100 and 300 K demonstrates that water molecules in the interlayer maintain their structure but change their mobility. The dominant configuration and self-diffusion coefficient of interlayer water are obtained in this study. Copyright © 2013 Japan Concrete Institute.
International Nuclear Information System (INIS)
Nahili, M.
2004-01-01
A protection method for the primary loops metals of nuclear power plants from corrosion was investigated. Hydrogen molecules were added to the primary circuit to eliminate oxygen molecules produced by radiolysis of coolant at the reactor core. The hydrogen molecules were produced by electrolyses of water and then added when the coolant water was passing through the primary coolant circuit. Thermodynamical process and the protection methods from corrosion were discussed, the discussion emphasized on the removal of oxygen molecules as one of the protection methods, and compared with other methods. The amount of hydrogen molecules needed for complete removal of oxygen was estimated in two cases: in the case without passing the water through the oxygen removal system, and in the case of passing water through the system. A pressurized water reactor VVER was chosen to be investigated in this study. The amount of hydrogen molecules was estimated so as to eliminate completely the oxygen molecules from coolant water. The estimated value was found to be less than the permissible range for coolant water for such type of reactors. A simulation study for interaction mechanism between hydrogen and oxygen molecules as water flowing in a tube similar to that of coolant water was performed with different water flow velocities. The interaction between the molecules of hydrogen and oxygen was described. The gas diffusion at the surface of the tube was found to play a major role in the interaction. A mathematical model was found to give full description of the change of oxygen concentration through the tube, as well as, to calculate the length of the tube where the concentration of oxygen reduced to few order of magnitude. (Author)
Haslan, Ezgi; Kimiran-Erdem, Ayten
2013-09-01
In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.
International Nuclear Information System (INIS)
Wang, Qiang; Gao, Jun; Zhang, Dongju; Liu, Chengbu
2015-01-01
Highlights: • We theoretical studied peptide bond formation reaction mechanism with two water molecules. • The first water molecule can decrease the reaction barriers by forming hydrogen bonds. • The water molecule mediated three-proton transfer mechanism is the favorable mechanism. • Our calculation supports the two-step and eight membered ring mechanism. - Abstract: The ribosome is the macromolecular machine that catalyzes protein synthesis. The kinetic isotope effect analysis reported by Strobel group supports the two-step mechanism. However, the destination of the proton originating from the nucleophilic amine is uncertain. A computational simulation of different mechanisms including water molecules is carried out using the same reaction model and theoretical level. Formation the tetrahedral intermediate with proton transfer from nucleophilic nitrogen, is the rate-limiting step when two water molecules participate in peptide bond formation. The first water molecule forming hydrogen bonds with O9′ and H15′ in the A site can decrease the reaction barriers. Combined with results of the solvent isotope effects analysis, we conclude that the three-proton transfer mechanism in which water molecule mediate the proton shuttle between amino and carbon oxygen in rate-limiting step is the favorable mechanism. Our results will shield light on a better understand the reaction mechanism of ribosome
Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo
2012-01-01
We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.
Selective control of photodissociation in deutereted water molecule HOD
International Nuclear Information System (INIS)
Adhikari, S.; Deshpande, Sarin; Sarma, Manabendra; Kurkal, Vandana; Mishra, M.K.
2006-01-01
Bond dissociation in the deutereted water molecule HOD has been investigated to explore the possibility of selective control of dissociation of O-H and O-D bonds using simple field profiles and initial states that do not require high overtone excitations. Preliminary results indicate that considerable selectivity in dissociation of O-H and O-D bonds can be achieved using fundamental and first overtone excitations only and use of field optimized initial state (FOIST) based scheme with appropriate choice of field parameters and initial states may enhance both selectivity and yield
Galvão, B R L; Rodrigues, S P J; Varandas, A J C
2008-07-28
A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.
Ikeguchi, Mitsunori; Doi, Junta
1995-09-01
The Ornstein-Zernike integral equation (OZ equation) has been used to evaluate the distribution function of solvents around solutes, but its numerical solution is difficult for molecules with a complicated shape. This paper proposes a numerical method to directly solve the OZ equation by introducing the 3D lattice. The method employs no approximation the reference interaction site model (RISM) equation employed. The method enables one to obtain the spatial distribution of spherical solvents around solutes with an arbitrary shape. Numerical accuracy is sufficient when the grid-spacing is less than 0.5 Å for solvent water. The spatial water distribution around a propane molecule is demonstrated as an example of a nonspherical hydrophobic molecule using iso-value surfaces. The water model proposed by Pratt and Chandler is used. The distribution agrees with the molecular dynamics simulation. The distribution increases offshore molecular concavities. The spatial distribution of water around 5α-cholest-2-ene (C27H46) is visualized using computer graphics techniques and a similar trend is observed.
Molecular multipole moments of water molecules in ice Ih
International Nuclear Information System (INIS)
Batista, E.R.; Xantheas, S.S.; Jonsson, H.
1998-01-01
We have used an induction model including dipole, dipole endash quadrupole, quadrupole endash quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments to study the electric field in ice. The self-consistent induction calculations gave an average total dipole moment of 3.09 D, a 67% increase over the dipole moment of an isolated water molecule. A previous, more approximate induction model study by Coulson and Eisenberg [Proc. R. Soc. Lond. A 291, 445 (1966)] suggested a significantly smaller average value of 2.6 D. This value has been used extensively in recent years as a reference point in the development of various polarizable interaction potentials for water as well as for assessment of the convergence of water cluster properties to those of bulk. The reason for this difference is not due to approximations made in the computational scheme of Coulson and Eisenberg but rather due to the use of less accurate values for the molecular multipoles in these earlier calculations. copyright 1998 American Institute of Physics
2013-01-01
Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study
Finite-bias electronic transport of molecules in a water solution
Rungger, Ivan
2010-06-04
The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.
Finite-bias electronic transport of molecules in a water solution
Rungger, Ivan; Chen, X.; Sanvito, Stefano; Schwingenschlö gl, Udo
2010-01-01
The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.
Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics
International Nuclear Information System (INIS)
Yoshida, Koji
2001-01-01
Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)
Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes
International Nuclear Information System (INIS)
Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.
2016-01-01
Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3
Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes
Energy Technology Data Exchange (ETDEWEB)
Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)
2016-04-14
Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1
Shinagawa, Tatsuya
2015-01-01
Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed constant current behaviors at near neutral pH reflect the intrinsic electrocatalytic reactivity of the metal electrodes for water reduction. This journal is © the Owner Societies.
Shinagawa, Tatsuya; Takanabe, Kazuhiro
2015-01-01
Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed
Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes
DEFF Research Database (Denmark)
Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing
2016-01-01
Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...
Energy Technology Data Exchange (ETDEWEB)
Markovic, M I [Elektrothenicki fakultet, Belgrade (Yugoslavia)
1974-07-01
Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy.
International Nuclear Information System (INIS)
Oueslati, W.; Meftah, M.; Ben Rhaiem, H.; Ben Haj Amara, A.
2010-01-01
Document available in extended abstract form only. Several theoretical models are proposed to describe hydration process for Wyoming-montmorillonite clay exchanged Na + or Cu 2+ . They propose some theoretical distribution and disposition for water molecule in the inter-lamellar space in the case of homogeneous and inter-stratified hydration states. For example, Ben Brahim et al. (1983a) studied the interlayer structure (atomic positions of interlayer cations) and associated H 2 O molecules of Na-saturated montmorillonite and beidellite samples. Moore and Hower (1986) studied ordered structures composed of mono-hydrated and collapsed interlayers in montmorillonite, and Cuadros (1996) estimated the H 2 O content of smectite as a function of the interlayer cation. Using similar approach, Ferrage et al (2005b) proposed a discreet distribution of water molecule layer in the same z coordinate of the exchangeable cation with inhomogeneous distribution. This heterogeneity was attributed to the surface charge. The main objective of this study is to characterize the structural changes in the theoretical XRD profile, induced by different water molecule distribution, used to simulate experimental XRD patterns in the case of Na-montmorillonite exchanged Cu 2+ . This problem was achieved by quantitative XRD analysis using an indirect method based on the comparison of the experimental 001 reflections obtained from oriented films patterns with those calculated from structural models. The starting materials were Ca-montmorillonite originated from bentonites of Wyoming (USA). The XRD patterns were obtained by reflection setting with a D8 ADVANCE Bruker installation using Cu-Kα radiation and equipped with solid state detector. Intensities were measured at an interval of 2Θ 0.04 deg. and 40-50 s counting time per step. The diffracted intensity was calculated according to the matrix formalism detailed by Drits and Tchoubar, (1990). The fitting strategies was detailed by Ferrage et
QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods
Directory of Open Access Journals (Sweden)
Assia Belhassan
2017-10-01
Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978
International Nuclear Information System (INIS)
Kakiuchi, M.; Matsuo, S.
1985-01-01
Ratios of D/H and 18 O/ 16 O in the vapor phase in equilibrium with aqueous urea solution with different urea molalities were measured at 15 and 25 0 C. Under the assumption that urea solutions consist of two species, i.e., the urea-water cluster and free water, the results are interpreted to give the average hydration number, i.e., the number of water molecules per urea molecule in the urea-water cluster. Good agreement was obtained for the hydration number estimated independently from hydrogen and oxygen isotopic fractions. On the basis of hydrogen isotopic data at 25 0 C, the average hydration number of urea in the cluster is 6.3 +/- 0.8 at 2.1 m and 2.75 +/- 0.08 at saturation (20.15 m). The corresponding average hydration numbers based on oxygen isotopic data were calculated to be 6.7 +/- 2.4 at 2.1 m and 2.75 +/- 0.25 at urea saturation. HD 16 O is enriched in the urea-water cluster and H 2 18 O is enriched in free water. Isotopic partitioning between the cluster and free water is markedly different from those between hydration spheres and free water in aqueous electrolyte solutions. 29 references, 6 figures, 5 tables
Continuum Navier-Stokes modelling of water ow past fullerene molecules
DEFF Research Database (Denmark)
Walther, J. H.; Popadic, A.; Koumoutsakos, P.
We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...
Continuum Navier-Stokes modelling of water flow past fullerene molecules
DEFF Research Database (Denmark)
Walther, J. H.; Popadic, A.; Koumoutsakos, P.
We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...
Influence of the water molecules near surface of viral protein on virus activation process
Energy Technology Data Exchange (ETDEWEB)
O, Shepelenko S; S, Salnikov A; V, Rak S; P, Goncharova E; B, Ryzhikov A, E-mail: shep@vector.nsc.r, E-mail: shep@ngs.r [Federal State Research Institution State Research Center of Virology and Biotechnology VECTOR of the Federal Service for Surveillance in Consumer Rights Protection and Human Well-being (FSRI SRC VB VECTOR) Koltsovo, Novosibirsk Region (Russian Federation)
2009-06-01
The infection of a cell with influenza virus comprises the stages of receptor binding to the cell membrane, endocytosis of virus particle, and fusion of the virus envelope and cell endosome membrane, which is determined by the conformational changes in hemagglutinin, a virus envelope protein, caused by pH decrease within the endosome. The pH value that induces conformation rearrangements of hemagglutinin molecule considerably varies for different influenza virus strains, first and foremost, due to the differences in amino acid structure of the corresponding proteins. The main goal of this study was to construct a model making it possible to assess the critical pH value characterizing the fusogenic activity of influenza virus hemagglutinin from the data on hemagglutinin structure and experimental verification of this model. Under this model, we assume that when the electrostatic force between interacting hemagglutinin molecules in the virus envelop exceeds a certain value, the hemagglutinin HA1 subunits are arranged so that they form a cavity sufficient for penetration of water molecules. This event leads to an irreversible hydration of the inner fragments of hemagglutinin molecule in a trimer and to the completion of conformational changes. The geometry of electrostatic field in hemagglutinin trimer was calculated taking into account the polarization effects near the interface of two dielectrics, aqueous medium and protein macromolecule. The critical pH values for the conformational changes in hemagglutinin were measured by the erythrocyte hemolysis induced by influenza virus particles when decreasing pH. The critical pH value conditionally separating the pH range into the regions with and without the conformational changes was calculated for several influenza virus H1N1 and H3N2 strains based on the data on the amino acid structure of the corresponding hemagglutinin molecules. Comparison of the theoretical and experimental values of critical pH values for
Orbiting Water Molecules Dance to Tune Of Galaxy's "Central Engine," Astronomers Say
2000-01-01
A disk of water molecules orbiting a supermassive black hole at the core of a galaxy 60 million light-years away is "reverberating" in response to variations in the energy output from the galaxy's powerful "central engine" close to the black hole, astronomers say. The team of astronomers used the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope in New Mexico and the 100-meter-diameter radio telescope of the Max Planck Institute for Radio Astronomy at Effelsberg, Germany, to observe the galaxy NGC 1068 in the constellation Cetus. They announced their findings today at the American Astronomical Society's meeting in Atlanta. The water molecules, in a disk some 5 light-years in diameter, are acting as a set of giant cosmic radio-wave amplifiers, called masers. Using energy radiated by the galaxy's "central engine," the molecules strengthen, or brighten, radio emission at a particular frequency as seen from Earth. "We have seen variations in the radio 'brightness' of these cosmic amplifiers that we believe were caused by variations in the energy output of the central engine," said Jack Gallimore, an astronomer at the National Radio Astronomy Observatory (NRAO) in Charlottesville, VA. "This could provide us with a valuable new tool for learning about the central engine itself," he added. Gallimore worked with Stefi Baum of the Space Telescope Science Institute in Baltimore, MD; Christian Henkel of the Max Planck Institute for Radio Astronomy in Bonn, Germany; Ian Glass of the South African Astronomical Observatory; Mark Claussen of the NRAO in Socorro, NM; and Almudena Prieto of the European Southern Observatory in Munich, Germany. "Our observations show that NGC 1068 is the second-known case of a giant disk of water molecules orbiting a supermassive black hole at a galaxy's core," Gallimore said. The first case was the galaxy NGC 4258 (Messier 106), whose disk of radio-amplifying water molecules was measured by the NSF's Very Long Baseline
Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface
Energy Technology Data Exchange (ETDEWEB)
Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)
2005-01-01
Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.
Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes
Energy Technology Data Exchange (ETDEWEB)
Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)
2012-12-19
Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.
International Nuclear Information System (INIS)
Dutta, Bipan; De, Rina; Chowdhury, Joydeep
2015-01-01
Highlights: • The tautomerism of 4-MTTN molecule in solvent water medium has been investigated. • CPMD presage the possibility of PT reactions through the solvent water medium. • Concerted PT processes in 4-MTTN have been estimated from the DFT and NBO analyses. • Percentage evolution and breaking of the concerned bonds are estimated. - Abstract: The ground state prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium has been investigated with the aid of DFT and Car–Parrinello molecular dynamics (CPMD) simulation studies. The CPMD simulations envisage the possibility of proton transfer reactions of the molecule through the solvent water medium. Probable proton transfer pathways have been predicted from the DFT calculations which are substantiated by the natural bond orbital analyses. The evolution and breaking of the concerned bonds of the molecule for different proton transfer reaction pathways are also estimated.
Carvalheda, Catarina A; Campos, Sara R R; Baptista, António M
2015-10-26
Pulmonary surfactant protein C (SP-C) is a small peptide with two covalently linked fatty acyl chains that plays a crucial role in the formation and stabilization of the pulmonary surfactant reservoirs during the compression and expansion steps of the respiratory cycle. Although its function is known to be tightly related to its highly hydrophobic character and key interactions maintained with specific lipid components, much is left to understand about its molecular mechanism of action. Also, although it adopts a mainly helical structure while associated with the membrane, factors as pH variation and deacylation have been shown to affect its stability and function. In this work, the conformational behavior of both the acylated and deacylated SP-C isoforms was studied in a DPPC bilayer under different pH conditions using constant-pH molecular dynamics simulations. Our findings show that both protein isoforms are remarkably stable over the studied pH range, even though the acylated isoform exhibits a labile helix-turn-helix motif rarely observed in the other isoform. We estimate similar tilt angles for the two isoforms over the studied pH range, with a generally higher degree of internalization of the basic N-terminal residues in the deacylated case, and observe and discuss some protonation-conformation coupling effects. Both isoforms establish contacts with the surrounding lipid molecules (preferentially with the sn-2 ester bonds) and have a local effect on the conformational behavior of the surrounding lipid molecules, the latter being more pronounced for acylated SP-C.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.
DEFF Research Database (Denmark)
Lundsgaard, Rasmus; Kontogeorgis, Georgios; Economou, Ioannis G.
2011-01-01
coefficient can be estimated for both a small hydrophilic and a hydrophobic organic molecules between squalane (used here to mimic low density poly ethylene) and water/ethanol solutes using thermodynamic integration to calculate the free energy of solvation. Molecular dynamics simulations are performed, using...... the GROMACS software, by slowly decoupling of firstly the electrostatic and then the Lennard–Jones interactions between molecules in the simulation box. These calculations depend very much on the choice of force field. Two force fields have been tested in this work, the TraPPE-UA (united-atom) and the OPLS...
Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers
Directory of Open Access Journals (Sweden)
Stephan Loew
2011-01-01
Full Text Available Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1 high drug loading of donor liposomes, (2 attractive interactions between drug molecules within the liposomes, and (3 slow transfer of drugs between the inner and outer leaflets of the liposomes.
Multipole moments of water molecules in clusters and ice Ih from first principles calculations
International Nuclear Information System (INIS)
Batista, E.R.; Xantheas, S.S.; Jonsson, H.
1999-01-01
We have calculated molecular multipole moments for water molecules in clusters and in ice Ih by partitioning the charge density obtained from first principles calculations. Various schemes for dividing the electronic charge density among the water molecules were used. They include Bader close-quote s zero flux surfaces and Voronoi partitioning schemes. A comparison was also made with an induction model including dipole, dipole-quadrupole, quadrupole-quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments. We have found that the different density partitioning schemes lead to widely different values for the molecular multipoles, illustrating how poorly defined molecular multipoles are in clusters and condensed environments. For instance, the magnitude of the molecular dipole moment in ice Ih ranges between 2.3 D and 3.1 D depending on the partitioning scheme used. Within each scheme, though, the value for the molecular dipole moment in ice is larger than in the hexamer. The magnitude of the molecular dipole moment in the clusters shows a monotonic increase from the gas phase value to the one in ice Ih, with the molecular dipole moment in the water ring hexamer being smaller than the one in ice Ih for all the partitioning schemes used. copyright 1999 American Institute of Physics
International Nuclear Information System (INIS)
Liepinsh, Edvards; Sodano, Patrick; Tassin, Severine; Marion, Didier; Vovelle, Francoise; Otting, Gottfried
1999-01-01
Intermolecular nuclear Overhauser effects (NOEs) were measured between the protons of various small solvent or gas molecules and the non-specific lipid transfer protein (ns-LTP) from wheat. Intermolecular NOEs were observed with the hydrophobic pocket in the interior of wheat ns-LTP, which grew in intensity in the order cyclopropane (saturated solution) < methane (140 bar) < ethane (40 bar) < acetonitrile (5% in water) < cyclohexane (saturated solution) < benzene (saturated solution). No intermolecular NOEs were observed with dioxane (5% in water). The intermolecular NOEs were negative for all of the organic molecules tested. Intermolecular NOEs between wheat ns-LTP and water were weak or could not be distinguished from exchange-relayed NOEs. As illustrated by the NOEs with cyclohexane versus dioxane, the hydrophobic pocket in wheat ns-LTP preferably binds non-polar molecules. Yet, polar molecules like acetonitrile can also be accommodated. The pressure dependence of the NOEs between methane and wheat ns-LTP indicated incomplete occupancy, even at 190 bar methane pressure. In general, NOE intensities increased with the size of the ligand molecule and its vapor pressure. NMR of the vapor phase showed excellent resolution between the signals from the gas phase and those from the liquid phase. The vapor concentration of cyclohexane was fivefold higher than that of the dioxane solution, supporting the binding of cyclohexane versus uptake of dioxane
Water and oxygen induced degradation of small molecule organic solar cells
DEFF Research Database (Denmark)
Hermenau, Martin; Riede, Moritz; Leo, Karl
2011-01-01
Small molecule organic solar cells were studied with respect to water and oxygen induced degradation by mapping the spatial distribution of reaction products in order to elucidate the degradation patterns and failure mechanisms. The active layers consist of a 30 nm bulk heterojunction formed......,4′-diamine p-doped with C60F36 (MeO-TPD:C60F36), which acted as hole transporting layer. Indium-tin-oxide (ITO) and aluminum served as hole and electron collecting electrode, respectively. Time-of-flight secondary ion mass spectrometry (TOF-SIMS) and X-ray photoelectron spectroscopy (XPS) in conjunction...... of aluminum oxide at the BPhen/Al interface, and diffusion of water into the ZnPc:C60 layer where ZnPc becomes oxidized. Finally, diffusion from the electrodes was found to have no or a negligible effect on the device lifetime....
Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J
2015-01-22
The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.
Therrien, Eric; Weill, Nathanael; Tomberg, Anna; Corbeil, Christopher R; Lee, Devin; Moitessier, Nicolas
2014-11-24
The use of predictive computational methods in the drug discovery process is in a state of continual growth. Over the last two decades, an increasingly large number of docking tools have been developed to identify hits or optimize lead molecules through in-silico screening of chemical libraries to proteins. In recent years, the focus has been on implementing protein flexibility and water molecules. Our efforts led to the development of Fitted first reported in 2007 and further developed since then. In this study, we wished to evaluate the impact of protein flexibility and occurrence of water molecules on the accuracy of the Fitted docking program to discriminate active compounds from inactive compounds in virtual screening (VS) campaigns. For this purpose, a total of 171 proteins cocrystallized with small molecules representing 40 unique enzymes and receptors as well as sets of known ligands and decoys were selected from the Protein Data Bank (PDB) and the Directory of Useful Decoys (DUD), respectively. This study revealed that implementing displaceable crystallographic or computationally placed particle water molecules and protein flexibility can improve the enrichment in active compounds. In addition, an informed decision based on library diversity or research objectives (hit discovery vs lead optimization) on which implementation to use may lead to significant improvements.
(e,3e) and (e,3-1e) differential cross sections for the double ionization of water molecule
International Nuclear Information System (INIS)
Mansouri, A.; Dal Cappello, C.; Kada, I.; Champion, C.; Roy, A.C.
2009-01-01
We report new results for differential cross sections for the double ionization of water molecule by 1 keV electron impact. The present calculation is based on the first Born approximation. We describe the water molecule by a single centre wave function of Moccia. For the final state, an approximation of the well-known 3C wave function is used. An extensive study has been made by varying the angles of detection and the energies of each ejected electron. We have investigated the double ionization of each molecular state (1b 1 , 3a 1 , 1b 2 and 2a 1 ) and identified the mechanisms of this process.
VRIEND, G; BERENDSEN, HJC; VANDERZEE, [No Value; VANDENBURG, B; VENEMA, G; EIJSINK, VGH
1991-01-01
Using site-directed mutagenesis, Ala166 in the neutral protease of Bacillus stearothermophilus was changed into Ser. Model building and molecular dynamics simulations of the mutant enzyme indicated that the Ser hydroxyl group fits well in a cavity which contains a water molecule in the wild-type
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Marianski, Mateusz; Dannenberg, J J
2012-02-02
We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum of their individual dipole moments. These waters are found to be more stable than in bulk solvent. On the other hand, individual water molecules that interact with the backbone lower the dipole moment of the helix/water complex to below that of the helix itself. Small clusters of waters at the termini increase the dipole moments of the helix/water aggregates, but the effect diminishes as more waters are added. We discuss the somewhat complex behavior of the helix with the discrete waters in the continuum models.
Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi
2017-01-01
In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.
Mondal, Saptarsi; Biswas, Biswajit; Nandy, Tonima; Singh, Prashant Chandra
2017-09-20
The local structures between water-water, alcohol-water and alcohol-alcohol have been investigated for aqueous mixtures of ethanol (ETH) and monofluoroethanol (MFE) by the deconvolution of IR bands in the OH stretching region, molecular dynamics simulation and quantum chemical calculations. It has been found that the addition of a small amount of ETH into the aqueous medium increases the strength of the hydrogen bonds between water molecules. In an aqueous mixture of MFE, the substitution of a single fluorine induces a change in the orientation as well as the hydrogen bonding site of water molecules from the oxygen to the fluorine terminal of MFE. The switching of the hydrogen bonding site of water in the aqueous mixture of MFE results in comparatively strong hydrogen bonds between MFE and water molecules as well as less clustering of water molecules, unlike the case of the aqueous mixture of ETH. These findings about the modification of a hydrogen bond network by the hydrophobic fluorine group probably make fluorinated molecules useful for pharmaceutical as well as biological applications.
Han, Su-Yong; Lee, Ki-Ho
2013-09-01
Bisphenol A (BPA) is an estrogenic endocrine disrupter. However, depending on a way of treatment, the harmful effects of BPA have not been confirmed. Also, trans-generational effects of BPA on male reproduction are still controversial. Because the reabsorption of testicular fluid in the efferent ductules (ED) and initial segment (IS) is important for sperm maturation, the present study was designed to determine trans-generational effect of BPA administrated orally on expression of water transport-related molecules in the mouse ED and IS. Ethanol-dissolved BPA was diluted in water to be 100 ng (low), 10 μg (medium), and 1 mg/Ml water (high). BPA-containing water was provided for two generations. Expression of ion transporters and water channels in the ED and IS were measured by relative real-time PCR analysis. In the ED, BPA treatment caused expressional increases of carbonic anhydrase II, cystic fibrosis transmembrane regulator, Na(+)/K(+) ATPase α1 subunit, and aquaporin (AQP) 1. No change of Na(+)/H(+) exchange (NHE) 3 expression was detected. BPA treatment at medium dose resulted in an increase of AQP9 expression. In the IS, the highest expressional levels of all molecules tested were observed in medium-dose BPA treatment. Generally, high-dose BPA treatment resulted in a decrease or no change of gene expression. Fluctuation of NHE3 gene expression by BPA treatment at different concentrations was detected. These findings suggest that trans-generational exposure to BPA, even at low dose, could affect gene expression of water-transport related molecules. However, such effects of BPA would be differentially occurred in the ED and IS.
International Nuclear Information System (INIS)
Dezhi, I.; Krumshtejn, Z.V.; Molnar, B.; Petrukhin, V.I.; Rybakov, V.N.; Suvorov, V.M.; Khorvat, D.; Tsisek, Z.; Yutlandov, I.A.
1980-01-01
Using the effect of electron shell state on π-meson capture by chemically bound hydrogen studied has been change of electron density in hydrogen atoms of water molecules bound into aquocomplexes. The fact of depression of π-meson capture probability by hydrogen of water in aquocomplexes has been established. The magnitudes of depression indicate essential decrease of electron density in a hydrogen atom of coordinated water. Interaction of ligands with oxygen-containing anions also essentially contributes to a magnitude of depression
Directory of Open Access Journals (Sweden)
Cheng-Siang Wong
2013-09-01
Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.
Energy Technology Data Exchange (ETDEWEB)
Al-Hamdani, Yasmine S. [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom); Alfè, Dario [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Earth Sciences, University College London, Gower Street, London WC1E 6BT (United Kingdom); Lilienfeld, O. Anatole von [Institute of Physical Chemistry and National Center for Computational Design and Discovery of Novel Materials (MARVEL), Department of Chemistry, University of Basel, Klingelbergstrasse 80, CH-4056 Basel (Switzerland); Michaelides, Angelos, E-mail: angelos.michaelides@ucl.ac.uk [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)
2016-04-21
Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.
Directory of Open Access Journals (Sweden)
Loay A. Elalfy
2013-01-01
Full Text Available Density functional theory calculations using B3LYP/3-21G level of theory have been implemented on 6 carbon nanotubes (CNTs structures (3 zigzag and 3 armchair CNTs to study the energetics of the reverse osmosis during water desalination process. Calculations of the band gap, interaction energy, highest occupied molecular orbital, lowest unoccupied molecular orbital, electronegativity, hardness, and pressure of the system are discussed. The calculations showed that the water molecule that exists inside the CNT is about 2-3 Å away from its wall. The calculations have proven that the zigzag CNTs are more efficient for reverse osmosis water desalination process than armchair CNTs as the reverse osmosis process requires pressure of approximately 200 MPa for armchair CNTs, which is consistent with the values used in molecular dynamics simulations, while that needed when using zigzag CNTs was in the order of 60 MPa.
Energy Technology Data Exchange (ETDEWEB)
Markovic, M [Belgrade Univ. (Yugoslavia). Elektrotehnicki Fakultet
1981-07-01
The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E{sub o} = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)
Marianski, Mateusz; Dannenberg, J. J.
2012-01-01
We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum...
Nomura, Yurika; Ito, Shota; Teranishi, Miwako; Ono, Hikaru; Inoue, Keiichi; Kandori, Hideki
2018-01-31
Light-driven H + , Na + and Cl - pumps have been found in eubacteria, which convert light energy into a transmembrane electrochemical potential. A recent mutation study revealed asymmetric functional conversion between the two pumps, where successful functional conversions are achieved exclusively when mutagenesis reverses the evolutionary amino acid sequence changes. Although this fact suggests that the essential structural mechanism of an ancestral function is retained even after gaining a new function, questions regarding the essential structural mechanism remain unanswered. Light-induced difference FTIR spectroscopy was used to monitor the presence of strongly hydrogen-bonded water molecules for all eubacterial H + , Na + and Cl - pumps, including a functionally converted mutant. This fact suggests that the strongly hydrogen-bonded water molecules are maintained for these new functions during evolution, which could be the reason for successful functional conversion from Na + to H + , and from Cl - to H + pumps. This also explains the successful conversion of the Cl - to the H + pump only for eubacteria, but not for archaea. It is concluded that water-containing hydrogen-bonding networks constitute one of the essential structural mechanisms in eubacterial light-driven ion pumps.
Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody
2012-03-01
Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.
Free and binary rotation of polyatomic molecules
International Nuclear Information System (INIS)
Konyukhov, V K
2003-01-01
A modification of the quantum-mechanical theory of rotation of polyatomic molecules (binary rotation) is proposed, which is based on the algebra and representations of the SO(4) group and allows the introduction of the concept of parity, as in atomic spectroscopy. It is shown that, if an asymmetric top molecule performing binary rotation finds itself in a spatially inhomogeneous electric field, its rotational levels acquire the additional energy due to the quadrupole moment. The existence of the rotational states of polyatomic molecules that cannot transfer to the free rotation state is predicted. In particular, the spin isomers of a water molecule, which corresponds to such states, can have different absolute values of the adsorption energy due to the quadrupole interaction of the molecule with a surface. The difference in the adsorption energies allows one to explain qualitatively the behaviour of the ortho- and para-molecules of water upon their adsorption on the surface of solids in accordance with experimental data. (laser applications and other topics in quantum electronics)
Bond rearrangement caused by sudden single and multiple ionization of water molecules
International Nuclear Information System (INIS)
Ben-Itzhak, I.; Sayler, A. Max; Leonard, M.; Maseberg, J.W.; Hathiramani, D.; Wells, E.; Smith, M.A.; Xia, Jiangfan; Wang, Pengqian; Carnes, K.D.; Esry, B.D.
2005-01-01
Bond rearrangement, namely the dissociation of water into H 2 + +O q+ following ionization by fast proton and highly charged ion impact, was investigated. Single ionization by fast proton impact exhibits a strong isotopic effect, the dissociation of H 2 O + ->H 2 + +O being about twice as likely as D 2 O + ->D 2 + +O, with HDO + ->HD + +O in between. This suggests that the bond rearrangement does not happen during the slow dissociation, but rather during the very fast ionization, and thus H 2 + should also be produced when the water molecule is multiply ionized. We observed that the H 2 + +O + and H 2 + +O 2+ production in 1MeV/amu F 7+ +H 2 O collisions are 0.209+/-0.006% and 0.0665+/-0.003%, respectively, of the main double-ionization dissociation product, H 2 O 2+ ->H + +OH + . This ratio is similar to the triple to double ionization ratio in similar collisions with atomic targets thus suggesting that the bond-rearrangement fraction out of each ionization level is approximately constant. Similar dissociation channels in the heavier water isotopes, which are expected to be smaller, are under study. Finally, the fragmentation of HDO exhibits very strong isotopic preference for breaking the OH bond over the OD bond
Two-dimensional crystallography of amphiphilic molecules at the air-water interface
DEFF Research Database (Denmark)
Jacquemain, D.; Grayer Wolf, S.; Leveiller, F.
1992-01-01
The advent of well-collimated, high-intensity synchrotron X-ray sources and the consequent development of surface-specific X-ray diffraction and fluorescence techniques have recently revolutionized the study of Langmuir monolayers at the air-liquid interface. These methods allowed for the first......, and review recent results obtained from them for Langmuir films. The methods have been successfully applied in the elucidation of the structure of crystalline aggregates of amphiphilic molecules such as alcohols, carboxylic acids and their salts, alpha-amino acids, and phospholipids at the water surface....... In addition, it became possible to monitor by diffraction the growth and dissolution of the crystalline self-aggregates as well as structural changes occurring by phase transitions. Furthermore, the surface X-ray methods shed new light on the structure of the underlying ionic layer of attached solvent...
Palmgren, Madelene; Hernebring, Malin; Eriksson, Stefanie; Elbing, Karin; Geijer, Cecilia; Lasič, Samo; Dahl, Peter; Hansen, Jesper S; Topgaard, Daniel; Lindkvist-Petersson, Karin
2017-12-01
Orthodox aquaporins are transmembrane channel proteins that facilitate rapid diffusion of water, while aquaglyceroporins facilitate the diffusion of small uncharged molecules such as glycerol and arsenic trioxide. Aquaglyceroporins play important roles in human physiology, in particular for glycerol metabolism and arsenic detoxification. We have developed a unique system applying the strain of the yeast Pichia pastoris, where the endogenous aquaporins/aquaglyceroporins have been removed and human aquaglyceroporins AQP3, AQP7, and AQP9 are recombinantly expressed enabling comparative permeability measurements between the expressed proteins. Using a newly established Nuclear Magnetic Resonance approach based on measurement of the intracellular life time of water, we propose that human aquaglyceroporins are poor facilitators of water and that the water transport efficiency is similar to that of passive diffusion across native cell membranes. This is distinctly different from glycerol and arsenic trioxide, where high glycerol transport efficiency was recorded.
Uhlemann, Thomas; Seidel, Sebastian; Müller, Christian W
2018-03-07
To determine the preferred water molecule binding sites of the polybasic sulfa drugs sulfamethoxazole (SMX) and sulfisoxazole (SIX), we have studied their monomers and monohydrated complexes through laser-desorption conformer-specific UV and IR spectroscopy. Both the SMX and SIX monomer adopt a single conformer in the molecular beam. On the basis of their conformer-specific IR spectra in the NH stretch region, these conformers were assigned to the SMX and SIX global minimum structures, both exhibiting a staggered sulfonamide group and an intramolecular C-HO[double bond, length as m-dash]S hydrogen bond. The SMX-H 2 O and SIX-H 2 O complexes each adopt a single isomer in the molecular beam. Their isomeric structures were determined based on their isomer-specific IR spectra in the NH/OH stretch region. Quantum Theory of Atoms in Molecules analysis of the calculated electron densities revealed that in the SMX-H 2 O complex the water molecule donates an O-HN hydrogen bond to the heterocycle nitrogen atom and accepts an N-HO hydrogen bond from the sulfonamide NH group. In the SIX-H 2 O complex, however, the water molecule does not bind to the heterocycle but instead donates an O-HO[double bond, length as m-dash]S hydrogen bond to the sulfonamide group and accepts an N-HO hydrogen bond from the sulfonamide NH group. Both water complexes are additionally stabilized by a C ph -HOH 2 hydrogen bond. Interacting Quantum Atoms analysis suggests that all intermolecular hydrogen bonds are dominated by the short-range exchange-correlation contribution.
Moussi, Sofiane; Ouamerali, Ourida
2014-06-01
Carbohydrates have multiples roles in biological systems. It has been found that the glycoside bond is fundamentally important in many aspects of chemistry and biology and forms the basis of carbohydrate chemistry. That means the stereochemical information, namely, glycosidic linkages α or β, gives an significant features of the carbohydrate glycosidation position of the glycosylic acceptor. For these reasons, much effort was made for the synthesis and analysis of the glycoside bond. Vibrational circular dichroism VCD has some advantages over conventional electronic circular dichroism (ECD) due to the applicability to all organic molecules and the reliability of ab initio quantum calculation. However, for a molecule with many chiral centers such as carbohydrates, determination of the absolute configuration tends to be difficult because the information from each stereochemical center is mixed and averaged over the spectrum. In the CH stretching region, only two VCD studies on carbohydrates have been reported and spectra--structure correlation, as determined for the glycoside band, remains to be investigated. T. Taniguchi and collaborators report that methyl glycosides exhibit a characteristic VCD peak, the sign of which solely reflects the C-1 absolute configuration. This work is a theoretical contribution to study the behaviour of VCD spectrum's of the monosaccharides when the water molecules are taken explicitly. This study is focused on six different monosaccharides in theirs absolute configuration R and S. We used the method of density functional theory DFT by means of the B3LYP hybrid functional and 6-31G * basis set.
Effect of organic molecules on hydrolysis of peptide bond: A DFT study
International Nuclear Information System (INIS)
Makshakova, Olga; Ermakova, Elena
2013-01-01
Highlights: ► DFT study of the effects of small organic molecules on the hydrolysis reactions of peptide bonds. ► Organic molecules can activate nonenzymatic hydrolysis reaction. ► Influence of organic acids on activation energy barrier correlates with their electronegativity. - Abstract: The activation and inhibition effects of small organic molecules on peptide hydrolysis have been studied using a model compound dialanine and DFT approach. Solvent-assisted and non-assisted concerted mechanisms were analyzed. Several transition states for the systems: alanine dipeptide–water molecule in complexes with alcohol molecules, acetonitrile, dimethylsulfoxide, propionic, lactic and pyruvic acids and water molecules were localized. The formation of hydrogen bonds between dipeptide, reactive water molecule and molecules of solvents influences the activation energy barrier of the peptide bond hydrolytic reaction. Strong effect of organic acids on the activation energy barrier correlates with their electronegativity. Acetonitrile can act as an inhibitor of reaction. Mechanisms of regulation of the activation energy barrier are discussed in the terms of donor-acceptor interactions
Activation of a water molecule coordinated to manganese: four study cases
International Nuclear Information System (INIS)
Lassalle-Kaiser, B.
2008-10-01
The daunting energy consumption of western societies calls for the development of renewable energies. Among them, hydrogen stands as a major candidate. The cleanest way of producing hydrogen is water electro- or photolysis. This reaction is carried out in natural photosynthesis by a manganese-oxo cluster, the functioning of which remains unknown. Insight into this mechanism would greatly help the search for low-cost water splitting catalysts. Our contribution to this field is the understanding of the fundamental processes that govern the activation of water by manganese complexes. This manuscript describes our attempts to generate electrochemically mononuclear manganese(IV) complexes bearing a fully deprotonated water molecule (oxo ligand). We have studied four different cases, which reflect different possible coordination spheres capable of stabilizing such species. In the first chapter, we will give a brief overview of the present energetic challenges faced by western societies. In the second chapter, we will present general considerations about manganese chemistry and a description of the structure and functioning of the water oxidizing enzyme. We will also describe the basic requirements for the splitting of water and present the goals of our work. In the third chapter, we will present the synthesis of a new family of tetradentate ligands, together with the synthesis and full characterization of the corresponding nickel(II) complexes. The first results obtained with the manganese analogue will also be shown. Chapter four presents the formation and the full characterization of a mononuclear manganese(IV)-oxo complex, by electrochemical oxidation of a manganese(II)-aqua complex. We will present different pathways to generate this species and show which intermediates are involved in this 2 e - , 2 H + reaction. Chapter five describes the formation of a mononuclear manganese(IV) complex, by electrochemical oxidation of a manganese(III)-hydroxo complex. The
The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach
Energy Technology Data Exchange (ETDEWEB)
Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)
2017-01-15
Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.
Ethanol oxidation reactions catalyzed by water molecules: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2)
Takahashi, H.; Hisaoka, S.; Nitta, T.
2002-09-01
Ab initio density functional theory calculations have been performed to investigate the catalytic role of water molecules in the oxidation reaction of ethanol: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2) . The results show that the potential energy barrier for the reaction is 88.0 kcal/mol in case of n=0, while it is reduced by ˜34 kcal/mol when two water molecules are involved ( n=2) in the reaction. As a result, the rate constant increases to 3.31×10 -4 s-1, which shows a significant catalytic role of water molecules in the ethanol oxidation reactions.
International Nuclear Information System (INIS)
Wahab, Hilal S.; Bredow, Thomas; Aliwi, Salah M.
2008-01-01
In this work, we studied the adsorption of water molecule onto the (1 0 0), (0 1 0) and (0 0 1) surfaces of nano-sized anatase TiO 2 with semiempirical SCF MO method, MSINDO. The anatase TiO 2 particles are modeled with free clusters (TiO 2 ) n, where n = 20-80. Whereas, the surfaces have been modeled with two saturated clusters, Ti 21 O 58 H 32 and Ti 36 O 90 H 36 . The surface lattice fivefold coordinated titanium atoms (Ti 5C ), which represent the Lewis acid sites, are selected as adsorption centers. We also investigated the effect of TiO 2 cluster size on the computed band gap energy. Results reveal that the electronic properties of a cluster in the lowest excited state differ from that of the ground state. Furthermore, the MSINDO band gap energies of 3.68-3.77 eV for the anatase TiO 2 are in a fair accordance with other literature data. In agreement with other computational and experimental studies, the dissociated form of water molecule adsorption on anatase TiO 2 surfaces is always more stabilized than the molecular form
Solvation in supercritical water
International Nuclear Information System (INIS)
Cochran, H.D.; Cummings, P.T.; Karaborni, S.
1991-01-01
The aim of this work is to determine the solvation structure in supercritical water composed with that in ambient water and in simple supercritical solvents. Molecular dynamics studies have been undertaken of systems that model ionic sodium and chloride, atomic argon, and molecular methanol in supercritical aqueous solutions using the simple point charge model of Berendsen for water. Because of the strong interactions between water and ions, ionic solutes are strongly attractive in supercritical water, forming large clusters of water molecules around each ion. Methanol is found to be a weakly-attractive solute in supercritical water. The cluster of excess water molecules surrounding a dissolved ion or polar molecule in supercritical aqueous solutions is comparable to the solvent clusters surrounding attractive solutes in simple supercritical fluids. Likewise, the deficit of water molecules surrounding a dissolved argon atom in supercritical aqueous solutions is comparable to that surrounding repulsive solutes in simple supercritical fluids. The number of hydrogen bonds per water molecule in supercritical water was found to be about one third the number in ambient water. The number of hydrogen bonds per water molecule surrounding a central particle in supercritical water was only mildly affected by the identify of the central particle--atom, molecule, or ion. These results should be helpful in developing a qualitative understanding of important processes that occur in supercritical water. 29 refs., 6 figs
Atoms, Molecules, and Compounds
Manning, Phillip
2007-01-01
Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.
Lucht, Karsten; Loose, Dirk; Ruschmeier, Maximilian; Strotkötter, Valerie; Dyker, Gerald; Morgenstern, Karina
2018-01-26
Low-temperature scanning tunneling microscopy was used to follow the formation of a solvation shell around an adsorbed functionalized azo dye from the attachment of the first water molecule to a fully solvated molecule. Specific functional groups bind initially one water molecule each, which act as anchor points for additional water molecules. Further water attachment occurs in areas close to these functional groups even when the functional groups themselves are already saturated. In contrast, water molecules surround the hydrophobic parts of the molecule only when the two-dimensional solvation shell closes around them. This study thus traces hydrophilic and hydrophobic properties of an organic molecule down to a sub-molecular length scale. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Deciphering the acylation pattern of Yersinia enterocolitica lipid A.
Reinés, Mar; Llobet, Enrique; Dahlström, Käthe M; Pérez-Gutiérrez, Camino; Llompart, Catalina M; Torrecabota, Nuria; Salminen, Tiina A; Bengoechea, José A
2012-01-01
Pathogenic bacteria may modify their surface to evade the host innate immune response. Yersinia enterocolitica modulates its lipopolysaccharide (LPS) lipid A structure, and the key regulatory signal is temperature. At 21°C, lipid A is hexa-acylated and may be modified with aminoarabinose or palmitate. At 37°C, Y. enterocolitica expresses a tetra-acylated lipid A consistent with the 3'-O-deacylation of the molecule. In this work, by combining genetic and mass spectrometric analysis, we establish that Y. enterocolitica encodes a lipid A deacylase, LpxR, responsible for the lipid A structure observed at 37°C. Western blot analyses indicate that LpxR exhibits latency at 21°C, deacylation of lipid A is not observed despite the expression of LpxR in the membrane. Aminoarabinose-modified lipid A is involved in the latency. 3-D modelling, docking and site-directed mutagenesis experiments showed that LpxR D31 reduces the active site cavity volume so that aminoarabinose containing Kdo(2)-lipid A cannot be accommodated and, therefore, not deacylated. Our data revealed that the expression of lpxR is negatively controlled by RovA and PhoPQ which are necessary for the lipid A modification with aminoarabinose. Next, we investigated the role of lipid A structural plasticity conferred by LpxR on the expression/function of Y. enterocolitica virulence factors. We present evidence that motility and invasion of eukaryotic cells were reduced in the lpxR mutant grown at 21°C. Mechanistically, our data revealed that the expressions of flhDC and rovA, regulators controlling the flagellar regulon and invasin respectively, were down-regulated in the mutant. In contrast, the levels of the virulence plasmid (pYV)-encoded virulence factors Yops and YadA were not affected in the lpxR mutant. Finally, we establish that the low inflammatory response associated to Y. enterocolitica infections is the sum of the anti-inflammatory action exerted by pYV-encoded YopP and the reduced activation of
Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep
2010-01-01
We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than
Attosecond electron dynamics in molecules and liquids
WöRner, Hans Jakob
The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.
Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules
International Nuclear Information System (INIS)
Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je
2014-01-01
Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)
Anomalous diffusion of water molecules at grain boundaries in ice Ih.
Moreira, Pedro Augusto Franco Pinheiro; Veiga, Roberto Gomes de Aguiar; Ribeiro, Ingrid de Almeida; Freitas, Rodrigo; Helfferich, Julian; de Koning, Maurice
2018-05-23
Using ab initio and classical molecular dynamics simulations, we study pre-melting phenomena in pristine coincident-site-lattice grain boundaries (GBs) in proton-disordered hexagonal ice Ih at temperatures just below the melting point Tm. Concerning pre-melt-layer thicknesses, the results are consistent with the available experimental estimates for low-disorder impurity-free GBs. With regard to molecular mobility, the simulations provide a key new insight: the translational motion of the water molecules is found to be subdiffusive for time scales from ∼10 ns up to at least 0.1 μs. Moreover, the fact that the anomalous diffusion occurs even at temperatures just below Tm where the bulk supercooled liquid still diffuses normally suggests that it is related to the confinement of the GB pre-melt layers by the surrounding crystalline environment. Furthermore, we show that this behavior can be characterized by continuous-time random walk models in which the waiting-time distributions decay according to power-laws that are very similar to those describing dynamics in glass-forming systems.
Intercalated Water and Organic Molecules for Electrode Materials of Rechargeable Batteries.
Lee, Hyeon Jeong; Shin, Jaeho; Choi, Jang Wook
2018-03-24
The intrinsic limitations of lithium-ion batteries (LIBs) with regard to safety, cost, and the availability of raw materials have promoted research on so-called "post-LIBs". The recent intense research of post-LIBs provides an invaluable lesson that existing electrode materials used in LIBs may not perform as well in post-LIBs, calling for new material designs compliant with emerging batteries based on new chemistries. One promising approach in this direction is the development of materials with intercalated water or organic molecules, as these materials demonstrate superior electrochemical performance in emerging battery systems. The enlarged ionic channel dimensions and effective shielding of the electrostatic interaction between carrier ions and the lattice host are the origins of the observed electrochemical performance. Moreover, these intercalants serve as interlayer pillars to sustain the framework for prolonged cycles. Representative examples of such intercalated materials applied to batteries based on Li + , Na + , Mg 2+ , and Zn 2+ ions and supercapacitors are considered, along with their impact in materials research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis of ZnO particles using water molecules generated in esterification reaction
Šarić, Ankica; Gotić, Marijan; Štefanić, Goran; Dražić, Goran
2017-07-01
Zinc oxide particles were synthesized without the addition of water by autoclaving (anhydrous) zinc acetate/alcohol and zinc acetate/acetic acid/alcohol solutions at 160 °C. The solvothermal synthesis was performed in ethanol or octanol. The structural, optical and morphological characteristics of ZnO particles were investigated by X-ray diffraction (XRD), UV-Vis spectroscopy, FE-SEM and TEM/STEM microscopy. 13C NMR spectroscopy revealed the presence of ester (ethyl- or octyl-acetate) in the supernatants which directly indicate the reaction mechanism. The formation of ester in this esterification reaction generated water molecule in situ, which hydrolyzed anhydrous zinc acetate and initiated nucleation and formation of ZnO. It was found that the size and shape of ZnO particles depend on the type of alcohol used as a solvent and on the presence of acetic acid in solution. The presence of ethanol in the ;pure; system without acetic acid favoured the formation of fine and uniform spherical ZnO nanoparticles (∼20 nm). With the addition of small amount of acetic acid the size of these small nanoparticles increased significantly up to a few hundred nanometers. The addition of small amount of acetic acid in the presence of octanol caused even more radical changes in the shape of ZnO particles, favouring the growth of huge rod-like particles (∼3 μm).
International Nuclear Information System (INIS)
Nagy, J.B.; Bodart-Ravet, I.; Derouane, E.G.; Gourgue, A.; Verfaillie, J.P.
1989-01-01
Multinuclear NMR is a very valuable tool to characterize micellar systems or microemulsions. It allows one to determine c.m.c. values, to study the dissolution of organic molecules, the solvation of cations and anions, the structural changes occurring in a ternary diagram, the mobility of the molecules, etc. This review paper essentially deals with the characterization of cationic (CTAB-hexanol-water), anionic (sodium oleate-butanol-water) and neutral (Triton X-100-decanol-water) reversed micelles. The use of paramagnetic ions [Ni(II), CO(II), Fe(III), etc.] is particularly emphasized to characterize the site of solubilization and their interaction with surfactant and cosurfactant molecules 13 C-NMR). It is concluded, that the metallic ions are basically solvated in the inner water cores and one or more hexanol molecules are included in their first coordination shells in the CTAB-hexanol-water microemulsions. In the Triton X-100-decanol-water microemulsions, both decanol and Triton X-100 molecules enter the first coordination shell of Co(II) ions which are dissolved in both aqeous water cores and the organic medium. 19 F-NMR of a fluorinated probe molecule is particularly useful to study the size of the inner water cores. The method is based on the partition of the molecules between the interface and the organic medium. However, this method has to be applied with great care, and the computed data have to be compared to other physico-chemical results. Both 19 F- and 23 Na-NMR results show a great variation of the behaviour of the sodium oleate-butanol-water system in the so-called bicontinuous region. The Na + ions are oriented independently on a hypothetical inverse micellar droplet. (author). 43 refs.; 18 figs.; 7 tabs
The Role of Molecule Clustering by Hydrogen Bond in Hydrous Ethanol on Laminar Burning Velocity
Directory of Open Access Journals (Sweden)
I Made Suarta
2016-01-01
Full Text Available The role of hydrogen bond molecule clustering in laminar burning velocities was observed. The water in hydrous ethanol can change the interaction between water-ethanol molecules. A certain amount of water can become oxygenated which increases the burning velocity. The hydrogen bond interaction pattern of ethanol and water molecules was modeled. Based on the molecular model, azeotropic behavior emerges from ethanol-water hydrogen bond, which is at a 95.1%v composition. The interaction with water molecule causes the ethanol molecule to be clustered with centered oxygenated compound. So, it supplies extra oxygen and provides intermolecular empty spaces that are easily infiltrated by the air. In the azeotropic composition, the molecular bond chain is the shortest, so hypothetically the burning velocity is anticipated to increase. The laminar burning velocity of ethanol fuel was tested in a cylindrical explosion bomb in lean, stoichiometric, and rich mixtures. The experimental result showed that the maximum burning velocity occurred at hydrous ethanol of 95.5%v composition. This discrepancy is the result of the addition of energy from 7.7% free ethanol molecules that are not clustered. At the rich mixture, the burning velocity of this composition is higher than that of anhydrous ethanol.
The bubble method of water purification
Smirnov, B. M.; Babaeva, N. Yu.; Naidis, G. V.; Panov, V. A.; Saveliev, A. S.; Son, E. E.; Tereshonok, D. V.
2018-02-01
The processes of water purification from admixture molecules are analyzed. The purification rate is limited due to a low diffusion coefficient of the admixture molecules in water. At non-small concentrations of the admixture molecules, the water purication can proceed through association of molecules in condensed nanoparticles which fall on the bottom of the water volume. The rate of association may be increased in an external electric field, but in reality this cannot change significantly the rate of the purification process. The bubble method of water purification is considered, where air bubbles formed at the bottom of the water volume, transfer admixture molecules to the interface. This method allows one to clean small water volumes fast. This mechanism of water purification is realized experimentally and exhibits the promises of the bubble purification method.
Energy Technology Data Exchange (ETDEWEB)
Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Xu, Zhenghe; Liu, Qingxia [Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB T6G 2V4 (Canada); Du, Zheng [National Supercomputing Center in Shenzhen, Shenzhen 518055 (China)
2016-12-15
Highlights: • Water adsorption has a greater effect on the electron distribution of ZnS surface than PbS surface. • Water adsorption decreases the reactivity of ZnS surface atoms but improves that of PbS. • Thiol collectors cannot interact with the hydrated ZnS surface. • The hydration has little influence on the interaction of thiol collectors with PbS surface. - Abstracts: In froth flotation the molecular interaction between reagents and mineral surfaces take place at the solid liquid interface. In this paper, the effect of water molecule on the three typical thiol collectors (xanthate, dithiocarbomate and dithiophosphate) interactions at the galena (PbS) and sphalerite (ZnS) surfaces has been studied adopting density functional theory (DFT). The results suggests that the presence of water molecule shows a greater influence on the electron distribution of ZnS surface than PbS surface, and reduce the reactivity of ZnS surface atoms but improves the reactivity of PbS surface atoms during the reaction with xanthate. Water adsorption could also reduce the covalent binding between Zn and S atoms but have little influence on Pb-S bond. In the presence of water, xanthate, dithiocarbomate (DTC) and dithiophosphate (DTP) could not adsorb on the sphalerite surface. And for galena (PbS) surface, the interaction of DTP is the strongest, then the DTC and the interaction of xanthate is the weakest. These results agree well with the flotation practice.
Water permeation through the internal water pathway in activated GPCR rhodopsin.
Directory of Open Access Journals (Sweden)
Katsufumi Tomobe
Full Text Available Rhodopsin is a light-driven G-protein-coupled receptor that mediates signal transduction in eyes. Internal water molecules mediate activation of the receptor in a rhodopsin cascade reaction and contribute to conformational stability of the receptor. However, it remains unclear how internal water molecules exchange between the bulk and protein inside, in particular through a putative solvent pore on the cytoplasmic. Using all-atom molecular dynamics simulations, we identified the solvent pore on cytoplasmic side in both the Meta II state and the Opsin. On the other hand, the solvent pore does not exist in the dark-adapted rhodopsin. We revealed two characteristic narrow regions located within the solvent pore in the Meta II state. The narrow regions distinguish bulk and the internal hydration sites, one of which is adjacent to the conserved structural motif "NPxxY". Water molecules in the solvent pore diffuse by pushing or sometimes jumping a preceding water molecule due to the geometry of the solvent pore. These findings revealed a total water flux between the bulk and the protein inside in the Meta II state, and suggested that these pathways provide water molecules to the crucial sites of the activated rhodopsin.
Vaquero, Vanesa; Sanz, M Eugenia; Peña, Isabel; Mata, Santiago; Cabezas, Carlos; López, Juan C; Alonso, José L
2014-04-10
Two complexes of alanine with water, alanine-(H2O)n (n = 1,2), have been generated by laser ablation of the amino acid in a supersonic jet containing water vapor and characterized using Fourier transform microwave spectroscopy. In the observed complexes, water molecules bind to the carboxylic group of alanine acting as both proton donors and acceptors. In alanine-H2O, the water molecule establishes two intermolecular hydrogen bonds forming a six-membered cycle, while in alanine-(H2O)2 the two water molecules establish three hydrogen bonds forming an eight-membered ring. In both complexes, the amino acid moiety is in its neutral form and shows the conformation observed to be the most stable for the bare molecule. The microsolvation study of alanine-(H2O)n (n = 1,2) can be taken as a first step toward understanding bulk properties at a microscopic level.
Shaitan, K V; Armeev, G A; Shaytan, A K
2016-01-01
We discuss the effect of isothermal and adiabatic evaporation of water on the state of a water-protein droplet. The discussed problem is of current importance due to development of techniques to perform single molecule experiments using free electron lasers. In such structure-dynamic experiments the delivery of a sample into the X-ray beam is performed using the microdroplet injector. The time between the injection and delivery is in the order of microseconds. In this paper we developed a specialized variant of all-atom molecular dynamics simulations for the study of irreversible isothermal evaporation of the droplet. Using in silico experiments we determined the parameters of isothermal evaporation of the water-protein droplet with the sodium and chloride ions in the concentration range of 0.3 M at different temperatures. The energy of irreversible evaporation determined from in silico experiments at the initial stages of evaporation virtually coincides with the specific heat of evaporation for water. For the kinetics of irreversible adiabatic evaporation an exact analytical solution was obtained in the limit of high thermal conductivity of the droplet (or up to the droplet size of -100 Å). This analytical solution incorporates parameters that are determined using in silico. experiments on isothermal droplet evaporation. We show that the kinetics of adiabatic evaporation and cooling of the droplet scales with the droplet size. Our estimates of the water-protemi droplet. freezing rate in the adiabatic regime in a vacuum chamber show that additional techniques for stabilizing the temperature inside the droplet should be used in order to study the conformational transitions of the protein in single molecules. Isothermal and quasi-isothermal conditions are most suitable for studying the conformational transitions upon object functioning. However, in this case it is necessary to take into account the effects of dehydration and rapid increase of ionic strength in an
Deciphering the acylation pattern of Yersinia enterocolitica lipid A.
Directory of Open Access Journals (Sweden)
Mar Reinés
Full Text Available Pathogenic bacteria may modify their surface to evade the host innate immune response. Yersinia enterocolitica modulates its lipopolysaccharide (LPS lipid A structure, and the key regulatory signal is temperature. At 21°C, lipid A is hexa-acylated and may be modified with aminoarabinose or palmitate. At 37°C, Y. enterocolitica expresses a tetra-acylated lipid A consistent with the 3'-O-deacylation of the molecule. In this work, by combining genetic and mass spectrometric analysis, we establish that Y. enterocolitica encodes a lipid A deacylase, LpxR, responsible for the lipid A structure observed at 37°C. Western blot analyses indicate that LpxR exhibits latency at 21°C, deacylation of lipid A is not observed despite the expression of LpxR in the membrane. Aminoarabinose-modified lipid A is involved in the latency. 3-D modelling, docking and site-directed mutagenesis experiments showed that LpxR D31 reduces the active site cavity volume so that aminoarabinose containing Kdo(2-lipid A cannot be accommodated and, therefore, not deacylated. Our data revealed that the expression of lpxR is negatively controlled by RovA and PhoPQ which are necessary for the lipid A modification with aminoarabinose. Next, we investigated the role of lipid A structural plasticity conferred by LpxR on the expression/function of Y. enterocolitica virulence factors. We present evidence that motility and invasion of eukaryotic cells were reduced in the lpxR mutant grown at 21°C. Mechanistically, our data revealed that the expressions of flhDC and rovA, regulators controlling the flagellar regulon and invasin respectively, were down-regulated in the mutant. In contrast, the levels of the virulence plasmid (pYV-encoded virulence factors Yops and YadA were not affected in the lpxR mutant. Finally, we establish that the low inflammatory response associated to Y. enterocolitica infections is the sum of the anti-inflammatory action exerted by pYV-encoded YopP and the
Li, Zuo-Sheng; Zou, Lu-Yi; Min, Chun-Gang; Ren, Ai-Min
2013-10-05
Despite the fact that the luminescence reaction mechanism of aequorin has been intensively investigated, details in luminescence such as the effect of important amino acids residues and explicit water molecules on spectroscopic properties of coelenteramide remain unclear. In this work, the effect of amino acids residues His16, Tyr82, Trp86, Phe113, Trp129, Tyr132, explicit water molecules Wat505 and Wat405 on the spectral properties of CLM(-) has been studied by CAM-B3LYP, TD M06L and TD CAM-B3LYP methods in hydrophobic environment and aqueous solution. In hydrophobic environment, the amino acids or water molecules have no significant effect on the absorption. Tyr82 and Trp86 move close to CLM(-) changes the hydrogen bond network, and thus, the spectral properties is significantly affected by the hydrogen bonds between His16H(+)+Tyr82+Trp86 and CLM(-). Tyr82, Trp86 hydrogen bonding to CLM(-) upshifts the excited energy and helps emission spectra shift to blue region. Therefore, it is concluded that His16H(+)+Tyr82+Trp86 modify the emission spectra. The molecular electrostatic potential indicated that the greater electron density is located at the oxygen atom of 6-p-hydroxyphenyl group of CLM(-), and it facilitates the formation of hydrogen bond with His16H(+)+Tyr82+Trp86. It is a critical condition for the modification of emission spectra. It is expected to help to understand the interactions between emitter and amino acids in the micro environment. Copyright © 2013 Elsevier B.V. All rights reserved.
Water-induced ethanol dewetting transition.
Ren, Xiuping; Zhou, Bo; Wang, Chunlei
2012-07-14
The dewetting transitions of two hydrophobic plates immersed in pure water, aqueous ethanol solutions with concentrations from 25% to 90%, and pure ethanol were investigated by molecular dynamics simulations, where the dewetting transition was analogous to a first-order phase transition from liquid to vapor. It was found that the dewetting transitions occurred except that in the pure ethanol system. Although the ethanol molecules prefer to locate in the vicinity of the two plates, the inter-plate region is unfavorable for water molecules, due to losing more than one hydrogen bond. Moreover, each inter-plate water molecule forms hydrogen bonds on average with about two ethanol molecules. These intermolecular hydrogen bonds cause water and ethanol to cooperatively fill or exit the inter-plate region. Thus, water molecules play a more important role in the inter-plate filling/empty process, and induce the ethanol dewetting transition. Our results provide insight into the effect of water on the ethanol dewetting phenomena.
Attosecond dynamics of electrons in molecules and liquids
Woerner, Hans Jakob
2016-05-01
The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss two recent experiments carried out in our group that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18 s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. We advance high-harmonic spectroscopy to resolve spatially and temporally the migration of an electron hole immediately following ionization of iodoacetylene, while simultaneously demonstrating extensive control over the process. A multidimensional approach, based on the measurement of both even and odd harmonic orders, enables us to reconstruct both quantum amplitudes and phases of the electronic states with a resolution of ~ 100 as. We separately reconstruct quasi-field-free and laser-controlled charge migration as a function of the spatial orientation of the molecule and determine the shape of the hole created by ionization. The second experiment is carried out on a free-flowing microjet of liquid water. We use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from liquid water using the RABBIT technique. We measure a delay on the order of 50 as between electrons emitted from the HOMO of liquid water compared to that of gas-phase water and a substantially reduced modulation contrast of the corresponding sidebands. Since our measurements on solvated water molecules are referenced to isolated ones, the measured delays reflect (i) the photoionization delays caused by electron transport through the aqueous environment and (ii) the effect of solvation on the parent molecule. The relative modulation contrast, in turn, contains information on (iii) the modification of transition amplitudes and (iv) dephasing processes. These experiments make the liquid phase and its fascinating
Inactivation of Salmonella spp. on tomatoes by plant molecules.
Mattson, Tyler E; Johny, Anup Kollanoor; Amalaradjou, Mary Anne Roshni; More, Karen; Schreiber, David T; Patel, Jitu; Venkitanarayanan, Kumar
2011-01-05
The efficacy of carvacrol (CAR), trans-cinnamaldehyde (TC), eugenol (EUG) and β-resorcylic acid (BR) as a wash treatment for reducing Salmonella spp. on tomatoes was investigated. Plum tomatoes inoculated with a six-serotype mixture of Salmonella (10⁸CFU) were subjected to washing in sterile deionized water (control) or deionized water containing chlorine (100 ppm), CAR (0.25 and 0.75%), TC (0.5 and 0.75%), EUG (0.25 and 0.75%), or BR (0.75 and 1.0%) for 15 sec, 1 min, and 3 min. The plant molecules were more effective (Pwashing in water and chlorine. Both concentrations of CAR and TC, and 0.75% EUG decreased Salmonella counts on tomatoes by~6.0 log CFU/ml at 1 min. Both concentrations of BR decreased the pathogen on tomatoes to undetectable levels at 3 min of exposure. Washing of tomatoes in deionized water and chlorine for 3 min reduced Salmonella by ca. 2.0 and 4.0 log CFU/ml, respectively. No Salmonella was detected in the wash water containing the plant molecules or chlorine, whereas a substantial population of the pathogen survived in the control wash water. Moreover, none of the dipping treatments had any effect on the red color of tomatoes (P>0.05). Results indicate that CAR, TC, EUG and BR could effectively be used to kill Salmonella on tomatoes, but additional studies on sensory and quality characteristics of tomatoes treated with plant molecules are warranted. Copyright © 2010 Elsevier B.V. All rights reserved.
Kawasaki, Kengo; Muroyama, Koutarou; Yamamoto, Norio; Murosaki, Shinji
2015-01-01
The recruitment of arterial leukocytes to endothelial cells is an important step in the progression of various inflammatory diseases. Therefore, its modulation is thought to be a prospective target for the prevention or treatment of such diseases. Adhesion molecules on endothelial cells are induced by proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), and contribute to the recruitment of leukocytes. In the present study, we investigated the effect of hot water extract of Curcuma longa (WEC) on the protein expression of adhesion molecules, monocyte adhesion induced by TNF-α in human umbilical vascular endothelial cells (HUVECs). Treatment of HUVECs with WEC significantly suppressed both TNF-α-induced protein expression of adhesion molecules and monocyte adhesion. WEC also suppressed phosphorylation and degradation of nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκBα) induced by TNF-α in HUVECs, suggesting that WEC inhibits the NF-κB signaling pathway.
Pathak, Arup Kumar
2012-01-01
Microhydration of SeO42-·nH2O (n = 1-5) clusters are reported at B3LYP/Aug-cc-pvtz level of theory. Lower size hydrated clusters are stabilized by only double-hydrogen-bonding arrangements and the most stable conformer for higher size cluster (n > 3) contains a cyclic water ring. It is observed that at least one water molecule is necessary to stabilize the dianion in the gas phase against spontaneous electron loss. The microscopic theory based expression provides a route to predict the instability of bare SeO42- and to obtain the VDE for a wide range of cluster sizes including the bulk from the knowledge of the same for a few stable hydrated clusters.
Sol-gel method for encapsulating molecules
Brinker, C. Jeffrey; Ashley, Carol S.; Bhatia, Rimple; Singh, Anup K.
2002-01-01
A method for encapsulating organic molecules, and in particular, biomolecules using sol-gel chemistry. A silica sol is prepared from an aqueous alkali metal silicate solution, such as a mixture of silicon dioxide and sodium or potassium oxide in water. The pH is adjusted to a suitably low value to stabilize the sol by minimizing the rate of siloxane condensation, thereby allowing storage stability of the sol prior to gelation. The organic molecules, generally in solution, is then added with the organic molecules being encapsulated in the sol matrix. After aging, either a thin film can be prepared or a gel can be formed with the encapsulated molecules. Depending upon the acid used, pH, and other processing conditions, the gelation time can be from one minute up to several days. In the method of the present invention, no alcohols are generated as by-products during the sol-gel and encapsulation steps. The organic molecules can be added at any desired pH value, where the pH value is generally chosen to achieve the desired reactivity of the organic molecules. The method of the present invention thereby presents a sufficiently mild encapsulation method to retain a significant portion of the activity of the biomolecules, compared with the activity of the biomolecules in free solution.
Molecule Matters van der Waals Molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...
International Nuclear Information System (INIS)
Song, K. H.; Tian, W. L.; Hou, B. Z.; Guo, J. X.; Mei, X. R.; Li, Y. Z.
2015-01-01
Much progress has been made towards understanding the role of serine/threonine phosphatases type 2C (PP2Cs) in abscisic acid (ABA) signaling transduction. However, how the negative regulator, PP2Cs, responds to plant water loss remains unclear. Here, we used a series of relative soil moisture (RSM: 85 percentage (well watered), 65 percentage (moderate stress), 45 percentage (severe stress) potted winter wheat (Triticum aestivum L.) and the detached leaves to detect ABA levels and transcripts of PP2Cs, including PP2C40, PP2C45, PP2C59 and PP2C6 as well as the core downstream signals of ABA, including ABF, SnRK2.4 and SnRK2.5. The results showed that the continual loss of water led to a consistent increase in ABA levels, and that the mRNA expression levels of PP2Cs were dependent on plant water condition. PP2Cs expression could be induced by a slight loss of water, and inhibited under severe loss of water. These results were further confirmed by the transcripts of ABF, SnRK2.4 and SnRK2.5. Furthermore, in slight loss of water, 100 μM exogenous ABA could promote PP2Cs expression; in severe loss of water, it inhibited PP2Cs expression. In conclusion, ABA accumulation is controlled by water condition and the PP2C expression is dependent on plant water condition, suggesting that PP2Cs might be served as an early signal molecule for water stress in wheat. (author)
Phenazine–naphthalene-1,5-diamine–water (1/1/2
Directory of Open Access Journals (Sweden)
Maria Gdaniec
2009-12-01
Full Text Available The asymmetric unit of the title compound, C12H8N2·C10H10N2·2H2O, contains one half-molecule of phenazine, one half-molecule of naphthalene-1,5-diamine and one water molecule. The phenazine and naphthalene-1,5-diamine molecules are located on inversion centers. The water molecules serve as bridges between the naphthalene-1,5-diamine molecules and also between the naphthalene-1,5-diamine and phenazine molecules. The naphthalene-1,5-diamine and water molecules are connected via N—H...O and O—H...N hydrogen bonds, forming a T4(2 motif. They are arranged into a two-dimensional polymeric structure parallel to (10overline{1} in which the water molecule is a single donor and a double acceptor, whereas the amino group is a double donor and a single acceptor in the hydrogen bonding. These two-dimensional assemblies alternate with the layers of phenazine molecules arranged into a herringbone motif. Each phenazine molecule is hydrogen bonded to two water molecules and thus a three-dimensional framework of hydrogen-bonded molecules is generated.
Molecule Matters van der Waals Molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:
INMS measures an influx of molecules from Saturn's rings
Perry, M. E.
2017-12-01
In 1984, Connerney and Waite proposed water influx from Saturn's rings to explain the low electron densities measured during Pioneer and Voyager radio occultation experiments. Charge exchange with this minor species depleted the H+ ions and provided a faster path to electron recombination. With ice the primary constituent of the rings, water was the most likely in-falling molecule. During the Grand Finale orbits, Cassini's Ion and Neutral Mass Spectrometer (INMS) detected and quantified an influx from the rings. Unexpectedly, the primary influx molecules are CH4 and a heavier carbon-bearing species. Water was detected, but quantities were factors of ten lower than these other species. Distribution in both altitude and latitude are consistent with a ring influx. The concentration of the minor species in Saturn's atmosphere shows that they enter Saturn's atmosphere from the top. Both molecules have their highest concentrations at the highest altitudes, with concentrations >0.4% at 3,500 km altitude and only 0.02% at 2,700 km. Molecules from the rings deorbit to Saturn's atmosphere at altitudes near 4,000 km, consistent with the INMS measurements. The latitudinal dependence of the minor species indicates that their source is near the equatorial plane. At high altitudes, the minor species were observed primarily at zero latitude, where the 28u species was six times more concentrated than at 5° latitude. At lower altitudes, the peaking ratio was 1, indicating that the species had diffused and was fully mixed into Saturn's H2 atmosphere. The lighter molecule, CH4, diffuses more rapidly than the 28u species. INMS also detected both of these species during the earlier F-ring passes, finding that the neutrals were centered at the ring plane and extended 3,000 km (half width, half max) north and south.
Directory of Open Access Journals (Sweden)
V. G. Soukhovolsky
2016-06-01
Full Text Available Features of external environmental factors (such as electromagnetic radiation in certain spectral bands influencing pheromone molecules, which are carriers of information for forest insects in the search of the opposite sex, were examined. Stability of pheromone molecules for external influences has been studied for siberian moth Dendrolimus superans sibiricus Tschetv., pine moth Dendrilimus pini L., gypsy moth Lymantria dispar L., for xylophages Ips typographus L., Monochamus urussovi Fish. and Monochamus galloprovincialis Oliv. Properties of pheromone molecules were evaluated by calculations using quantum-chemical method B3LYP. Existing methods of quantum-chemical calculations are useful for analyzing the properties of quite small and uncomplicated molecules of forest insect pheromones. The calculations showed that the molecules of insect pheromones are able to absorb light in the ultraviolet range and move into an excited state. The values of dipole moments, the wavelengths of the absorption, atomic and molecular electronic properties of pheromones in the ground and excited states were calculated. The calculations showed that for the reaction of pheromones with oxygen an energy barrier is somewhat higher than for reactions of pheromones with water vapor. The worst reaction of pheromones with water molecules likely to pheromones such molecules whose dipole moment is comparable to the dipole moment of water. Quantum-chemical characteristics of the pheromone molecules can be linked to specific behavior of the insects.
DEFF Research Database (Denmark)
Krauss, M; Olsen, Lars; Antony, J
2002-01-01
Models of the metal ion binding sites of native ZnZn and of cadmium-substituted ZnCd and CdCd phosphotriesterase, including full amino acid side chains, were geometry optimized with quantum mechanical methods, with effective fragment potentials (EFP) representing the protein environment surroundi...... to the Od1 of the carboxylate of the first-shell aspartate designated M 1, but the energy difference between Cd1Zn2 and the lowest energy Zn1Cd2 structure is only about 2 kcal/mol and decreasing with the addition of water molecules. The Zn1Cd2 arrangement is found experimentally....
A geometry-based simulation of the hydration of ions and small molecules
International Nuclear Information System (INIS)
Plumridge, T.H.
2001-01-01
The behaviour of solutes in water is of universal significance, but still not fully understood. This thesis provides details of a new computer simulation technique used to investigate the hydration of ions and small molecules. In contrast to conventional techniques such as molecular dynamics, this is a purely geometric method involving no forcefield or energy terms. Molecules of interest are modelled using crystallographic data to ensure that the structures are accurate. Water molecules are added randomly at any hydrogen bonding site in chains. At each addition the chain is rotated through all available space testing for the possibility of ring formation. The constraints used by the program to decide whether a ring should be conserved, i.e. whether the ring-forming hydrogen bond is viable were derived from a survey of (i) all available ice and clathrate hydrate structures and (ii) the hydrates of small biological molecules from the Cambridge Crystallographic Data Centre. If a ring forms, it is conserved and the process restarted with the addition of another random water. If the chain reaches a certain length and no hydrogen bonding opportunities are detected, the water chain is dissolved, and the process restarted. Using these techniques structure makers such as sulfate will readily allow structured water to form around them leading to large networks, whereas structure breakers such as urea will not allow any water chains to bridge the hydrogen bonding groups. The software has been tested with a set of twenty widely varying solutes and has produced results which generally agree with experimental data for structure makers and breakers, and also agrees well with traditional techniques such as molecular dynamics and Monte Carlo techniques. (author)
Statistical survey of the buried waters in the Protein Data Bank.
Carugo, Oliviero
2016-01-01
The structures of buried water molecules were studied in an ensemble of high-quality and non-redundant protein crystal structures. Buried water molecules were clustered and classified in lake-like clusters, which are completely isolated from the bulk solvent, and bay-like clusters, which are in contact with the bulk solvent through a surface water molecule. Buried water molecules are extremely common: lake-like clusters are found in 89 % of the protein crystal structures and bay-like clusters in 93 %. Clusters with only one water molecule are much more common than larger clusters. Both cluster types incline to be surrounded by loop residues, and to a minor extent by residues in extended secondary structure. Helical residues on the contrary do not tend to surround clusters of buried water molecules. One buried water molecule is found every 30-50 amino acid residues, depending on the secondary structures that are more abundant in the protein. Both main- and side-chain atoms are in contact with buried waters; they form four hydrogen bonds with the first water and 1-1.5 additional hydrogen bond for each additional water in the cluster. Consequently, buried water molecules appear to be firmly packed and rigid like the protein atoms. In this regard, it is remarkable to observe that prolines often surround water molecules buried in the protein interior. Interestingly, clusters of buried water molecules tend to be just beneath the protein surface. Moreover, water molecules tend to form a one-dimensional wire rather than more compact arrangements. This agrees with recent evidence of the mechanisms of solvent exchange between internal cavities and bulk solvent.
Method to separate and enrich molecules containing deuterium
International Nuclear Information System (INIS)
Benson, S.W.
1978-01-01
Organic molecules having a normal H and D content and the general formula RX, in which R is chosen from ethyl, isopropyl, tert. butyl or cyclopentenyl groups and X is a functional group such as F, Cl, Br or OH and can even be H in the special case of cyclopentene, are exposed to an infra-red laser radiation. By careful adjustment, bundling and pulsing of an infrared laser, D-contained RX molecules exposed to the laserbeam, can dissociate or decompose. A D-contained olefin and HX is formed under suitable conditions after exposure to laser radiation. The D-contained olefin is drawn off and combusted to obtain D-contained water or D-contained hydrogen. The non-decomposed or non-reacted RX molecules which are deuterium-impoverished can be decomposed to deuterium impoverished olefins and HX in a further process step by heating on a catalyst. The latter products can then be separated off and be catylytically exchanged with normal water in order to reproduce the normal isotopic composition. They may then where necessary be catalytically recombined to form normal RX which can be recycled. (GG) [de
Magnetic field modification of ultracold molecule-molecule collisions
International Nuclear Information System (INIS)
Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V
2009-01-01
We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.
Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria
2012-06-05
Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.
Liu, Wei; Zou, Zui; Huang, Xin; Shen, Hui; He, Li Juan; Chen, Si Min; Li, Li Ping; Yan, Lan; Zhang, Shi Qun; Zhang, Jun Dong; Xu, Zheng; Xu, Guo Tong; An, Mao Mao; Jiang, Yuan Ying
2016-01-01
Glycosylphosphatidyl inositol anchored proteins (GPI-APs) on fungal cell wall are essential for invasive infections. While the function of inositol deacylation of GPI-APs in mammalian cells has been previously characterized the impact of inositol deacylation in fungi and implications to host infection remains largely unexplored. Herein we describe our identification of BST1, an inositol deacylase of GPI-Aps in Candida albicans, was critical for GPI-APs cell wall attachment and host infection. BST1-deficient C. albicans (bst1Δ/Δ) was associated with severely impaired cell wall anchorage of GPI-APs and subsequen unmasked β-(1,3)-glucan. Consistent with the aberrant cell wall structures, bst1Δ/Δ strain did not display an invasive ability and could be recognized more efficiently by host immune systems. Moreover, BST1 null mutants or those expressing Bst1 variants did not display inositol deacylation activity and exhibited severely attenuated virulence and reduced organic colonization in a murine systemic candidiasis model. Thus, Bst1 can facilitate cell wall anchorage of GPI-APs in C. albicans by inositol deacylation, and is critical for host invasion and immune escape. PMID:27708385
Temperini, Claudia; Cecchi, Alessandro; Scozzafava, Andrea; Supuran, Claudiu T
2009-02-01
Thiazide and high ceiling diuretics were recently shown to inhibit all mammalian isoforms of carbonic anhydrase (CA, EC 4.2.1.1) with a very different profile as compared to classical inhibitors, such as acetazolamide, methazolamide, and ethoxzolamide. Some of these structurally related compounds have a very different behavior against the widespread isozyme CA II, with chlorthalidone, trichloromethiazide, and furosemide being efficient inhibitors against CA II (K(I)s of 65-138 nM), whereas indapamide is a much weaker one (K(I) of 2520 nM). Furthermore, some of these diuretics are quite efficient (low nanomolar) inhibitors of other isoforms, for example, chlorthalidone against hCA VB, VII, IX, and XIII; indapamide against CA VII, IX, XII, and XIII, trichloromethiazide against CA VII and IX, and furosemide against CA I and XIV. Examining the four X-ray crystal structures of their CA II adducts, we observed several (2-3) active site water molecules interacting with the chlorthalidone, trichloromethiazide, and furosemide scaffolds which may be responsible for this important difference of activity. Indeed, indapamide bound to CA II has no interactions with active site water molecules. Chlorthalidone bound within the CA II active site is in an enolic (lactimic) tautomeric form, with the enolic OH also participating in two strong hydrogen bonds with Asn67 and a water molecule. The newly evidenced binding modes of these diuretics may be exploited for designing better CA II inhibitors as well as compounds with selectivity/affinity for various isoforms with medicinal chemistry applications.
Possible heterogeneity of centres of binding 1,8-ANS in molecules of oxygenated hemoglobin
International Nuclear Information System (INIS)
Parul', D.A.; Bokut', S.B.; Milyutin, A.A.; Petrov, E.P.; Nemkovich, N.A.; Sobchuk, A.N.; Dzhagarov, B.M.
1999-01-01
Forming of oxygenated hemoglobin is one of effects of ionizing radiation action on organism. It was revealed heterogeneity of centers of binding of 1,8-ANS in intact molecule of oxygenated hemoglobin. Two types of binding centers possible reflect the existence of two regions in protein molecule with different accessibility to molecules of water
Single molecule microscopy and spectroscopy: concluding remarks.
van Hulst, Niek F
2015-01-01
Chemistry is all about molecules: control, synthesis, interaction and reaction of molecules. All too easily on a blackboard, one draws molecules, their structures and dynamics, to create an insightful picture. The dream is to see these molecules in reality. This is exactly what "Single Molecule Detection" provides: a look at molecules in action at ambient conditions; a breakthrough technology in chemistry, physics and biology. Within the realms of the Royal Society of Chemistry, the Faraday Discussion on "Single Molecule Microscopy and Spectroscopy" was a very appropriate topic for presentation, deliberation and debate. Undoubtedly, the Faraday Discussions have a splendid reputation in stimulating scientific debates along the traditions set by Michael Faraday. Interestingly, back in the 1830's, Faraday himself pursued an experiment that led to the idea that atoms in a compound were joined by an electrical component. He placed two opposite electrodes in a solution of water containing a dissolved compound, and observed that one of the elements of the compound accumulated on one electrode, while the other was deposited on the opposite electrode. Although Faraday was deeply opposed to atomism, he had to recognize that electrical forces were responsible for the joining of atoms. Probably a direct view on the atoms or molecules in his experiment would have convinced him. As such, Michael Faraday might have liked the gathering at Burlington House in September 2015 (). Surely, with the questioning eyes of his bust on the 1st floor corridor, the non-believer Michael Faraday has incited each passer-by to enter into discussion and search for deeper answers at the level of single molecules. In these concluding remarks, highlights of the presented papers and discussions are summarized, complemented by a conclusion on future perspectives.
Dielectric properties of water in Triton X-100 (nonionic detergent)-water mixtures
International Nuclear Information System (INIS)
Asami, Koji
2007-01-01
Dielectric measurements were carried out for mixtures of Triton X-100 (TX, a nonionic detergent with a poly(ethylene oxide) chain) and water with or without electrolytes over a frequency range of 1 MHz to 10 GHz to study the structure and dynamics of water molecules in the mixtures. Dielectric relaxation was found above 100 MHz, being assigned to the dielectric relaxation of water. The intensity of the dielectric relaxation was proportional to the water content above 0 deg. C. Below the freezing temperature of bulk water, the relaxation intensity decreased at TX concentrations (C TX ) below 50 wt% at -10 deg. Cand below 60 wt% at -20 deg. Cbecause frozen water shifts the dielectric relaxation to a frequency region far below 1 MHz. This indicated that there is no bulk water at C TX above 50 wt% and that at least two water molecules per ethylene oxide (EO) unit are tightly associated with the ethylene oxide chain. The low-frequency conductivity of the mixtures of TX and electrolyte solutions was well represented by Bruggeman's mixture equation at C TX below 40 wt%, if two water molecules per EO unit form an insulating shell surrounding TX micelles
Cold guided beams of polar molecules
International Nuclear Information System (INIS)
Motsch, Michael
2010-01-01
This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion
Adsorptionof polar organic molecules at oil/water interfaces
Energy Technology Data Exchange (ETDEWEB)
Aveyard, R; Chapman, J
1975-03-15
A study has been made of the adsorption of several esters of dicarboxylic acids at the alkane/water and the air/water interface. The adsorption of n-butanol and n-heptanol at the air/water surface also has been investigated. The surface pressure (pi) -surface area (A) isotherms are compared for the various films, and standard free energies of adsorption have been determined. Attempts have been made to fit the pi, A isotherms using surface equations of state based on the models, of both a 2-dimensional gas and a 2-dimensional solution. The solution model has proved reasonably successful for fairly dilute films at the air/water surface. At higher coverages, an equation derived by Smith for liquid expanded monolayers gives a moderately good description of films of heptanol on water. A simple application of the solution model on adsorbed monolayers at the liquid; liquid interface met with little success. However, it is found that 2-dimensional gas equations describe such systems surprisingly well for fairly low surface concentrations. (20 refs.)
Molecular Design of Branched and Binary Molecules at Ordered Interfaces
Energy Technology Data Exchange (ETDEWEB)
Genson, Kirsten Larson [Iowa State Univ., Ames, IA (United States)
2005-01-01
This study examined five different branched molecular architectures to discern the effect of design on the ability of molecules to form ordered structures at interfaces. Photochromic monodendrons formed kinked packing structures at the air-water interface due to the cross-sectional area mismatch created by varying number of alkyl tails and the hydrophilic polar head group. The lower generations formed orthorhombic unit cell with long range ordering despite the alkyl tails tilted to a large degree. Favorable interactions between liquid crystalline terminal groups and the underlying substrate were observed to compel a flexible carbosilane dendrimer core to form a compressed elliptical conformation which packed stagger within lamellae domains with limited short range ordering. A twelve arm binary star polymer was observed to form two dimensional micelles at the air-water interface attributed to the higher polystyrene block composition. Linear rod-coil molecules formed a multitude of packing structures at the air-water interface due to the varying composition. Tree-like rod-coil molecules demonstrated the ability to form one-dimensional structures at the air-water interface and at the air-solvent interface caused by the preferential ordering of the rigid rod cores. The role of molecular architecture and composition was examined and the influence chemically competing fragments was shown to exert on the packing structure. The amphiphilic balance of the different molecular series exhibited control on the ordering behavior at the air-water interface and within bulk structures. The shell nature and tail type was determined to dictate the preferential ordering structure and molecular reorganization at interfaces with the core nature effect secondary.
Capacitive Sensing of Intercalated H2O Molecules Using Graphene.
Olson, Eric J; Ma, Rui; Sun, Tao; Ebrish, Mona A; Haratipour, Nazila; Min, Kyoungmin; Aluru, Narayana R; Koester, Steven J
2015-11-25
Understanding the interactions of ambient molecules with graphene and adjacent dielectrics is of fundamental importance for a range of graphene-based devices, particularly sensors, where such interactions could influence the operation of the device. It is well-known that water can be trapped underneath graphene and its host substrate; however, the electrical effect of water beneath graphene and the dynamics of how the interfacial water changes with different ambient conditions has not been quantified. Here, using a metal-oxide-graphene variable-capacitor (varactor) structure, we show that graphene can be used to capacitively sense the intercalation of water between graphene and HfO2 and that this process is reversible on a fast time scale. Atomic force microscopy is used to confirm the intercalation and quantify the displacement of graphene as a function of humidity. Density functional theory simulations are used to quantify the displacement of graphene induced by intercalated water and also explain the observed Dirac point shifts as being due to the combined effect of water and oxygen on the carrier concentration in the graphene. Finally, molecular dynamics simulations indicate that a likely mechanism for the intercalation involves adsorption and lateral diffusion of water molecules beneath the graphene.
Detecting high-density ultracold molecules using atom–molecule collision
International Nuclear Information System (INIS)
Chen, Jun-Ren; Kao, Cheng-Yang; Chen, Hung-Bin; Liu, Yi-Wei
2013-01-01
Utilizing single-photon photoassociation, we have achieved ultracold rubidium molecules with a high number density that provides a new efficient approach toward molecular quantum degeneracy. A new detection mechanism for ultracold molecules utilizing inelastic atom–molecule collision is demonstrated. The resonant coupling effect on the formation of the X 1 Σ + g ground state 85 Rb 2 allows for a sufficient number of more deeply bound ultracold molecules, which induced an additional trap loss and heating of the co-existing atoms owing to the inelastic atom–molecule collision. Therefore, after the photoassociation process, the ultracold molecules can be investigated using the absorption image of the ultracold rubidium atoms mixed with the molecules in a crossed optical dipole trap. The existence of the ultracold molecules was then verified, and the amount of accumulated molecules was measured. This method detects the final produced ultracold molecules, and hence is distinct from the conventional trap loss experiment, which is used to study the association resonance. It is composed of measurements of the time evolution of an atomic cloud and a decay model, by which the number density of the ultracold 85 Rb 2 molecules in the optical trap was estimated to be >5.2 × 10 11 cm −3 . (paper)
International Nuclear Information System (INIS)
Hayashi, Makoto
2003-12-01
Bibliographies of original and review reports of experiments or theories of electron and photon cross sections and also electron swarm data are presented for atomic or molecular species with specified targets. These works covered 17 atoms and 51 molecules. The present bibliography is only for water vapour (H 2 O, D 2 O and HDO). About 1200 papers were compiled. A comprehensive author index is included. The bibliography covers the period 1915 through 2000 for H 2 O. Finally, author's comments for electron collision cross sections and photodissociation processes of H 2 O are given. (author)
Directory of Open Access Journals (Sweden)
Emmanuel Aubert
2016-11-01
Full Text Available The coordination polymer {[Cu(SiF6(C10H8N22]·2C10H8N2·5H2O}n, systematic name: poly[[bis(μ2-4,4′-bipyridine(μ2-hexafluoridosilicatocopper(II] 4,4′-bipyridine disolvate pentahydrate], contains pores which are filled with water and 4,4′-bipyridine molecules. As a result of the presence of these ordered species, the framework changes its symmetry from P4/mmm to P21/c. The 4,4′-bipyridine guest molecules form chains inside the 6.5 × 6.9 Å pores parallel to [100] in which the molecules interact through π–π stacking. Ordered water molecules form infinite hydrogen-bonded chains inside a second pore system (1.6 × 5.3 Å free aperture perpendicular to the 4,4′-bipyridine channels.
Adsorption Mechanism of Inhibitor and Guest Molecules on the Surface of Gas Hydrates.
Yagasaki, Takuma; Matsumoto, Masakazu; Tanaka, Hideki
2015-09-23
The adsorption of guest and kinetic inhibitor molecules on the surface of methane hydrate is investigated by using molecular dynamics simulations. We calculate the free energy profile for transferring a solute molecule from bulk water to the hydrate surface for various molecules. Spherical solutes with a diameter of ∼0.5 nm are significantly stabilized at the hydrate surface, whereas smaller and larger solutes exhibit lower adsorption affinity than the solutes of intermediate size. The range of the attractive force is subnanoscale, implying that this force has no effect on the macroscopic mass transfer of guest molecules in crystal growth processes of gas hydrates. We also examine the adsorption mechanism of a kinetic hydrate inhibitor. It is found that a monomer of the kinetic hydrate inhibitor is strongly adsorbed on the hydrate surface. However, the hydrogen bonding between the amide group of the inhibitor and water molecules on the hydrate surface, which was believed to be the driving force for the adsorption, makes no contribution to the adsorption affinity. The preferential adsorption of both the kinetic inhibitor and the spherical molecules to the surface is mainly due to the entropic stabilization arising from the presence of cavities at the hydrate surface. The dependence of surface affinity on the size of adsorbed molecules is also explained by this mechanism.
Is high-pressure water the cradle of life?
International Nuclear Information System (INIS)
Bassez, Marie-Paule
2003-01-01
Several theories have been proposed for the synthesis of prebiotic molecules. This letter shows that the structure of supercritical water, or high-pressure water, could trigger prebiotic synthesis and the origin of life deep in the oceans, in hydrothermal vent systems. Dimer geometries of high-pressure water may have a point of symmetry and a zero dipole moment. Consequently, simple apolar molecules found in submarine hydrothermal vent systems will dissolve in the apolar environment provided by the apolar form of the water dimer. Apolar water could be the medium which helps precursor molecules to concentrate and react more efficiently. The formation of prebiotic molecules could thus be linked to the structure of the water inside chimney nanochannels and cavities where hydrothermal piezochemistry and shock wave chemistry could occur. (letter to the editor)
De Vooght-Johnson, Ryan
2011-03-01
An evening symposium was held at the Museu de Historia de Catalunya (Barcelona, Spain) as a precursor to the European Bioanalysis Forum meeting, as part of the Waters Corporation Bioanalysis World Tour. The symposium was chaired by Robert Plumb and Jing Lin (Waters Corporation, MA, USA) with a focus on the future of the DMPK laboratory and its role in addressing large-molecule therapeutics and biomarkers. Lieve Dillen (Johnson and Johnson, Belgium) spoke on ultra-sensitive peptide quantification, Richard Kay (Quotient Bioresearch, UK) discussed quantifying proteins and peptides in plasma, Ian Wilson (AstraZeneca, UK) covered metabolic biomarkers and Robert Plumb concluded the evening with a presentation on the future of MS in DMPK studies. Following the presentations, all the speakers took questions from the audience and continued lively discussion over a cocktails and canapés reception.
Terrestrial atmosphere, water and astrobiology
Directory of Open Access Journals (Sweden)
Coradini M.
2010-12-01
Full Text Available Primitive life, defined as a chemical system capable to transfer its molecular information via self-replication and also capable to evolve, originated about 4 billion years ago from the processing of organic molecules by liquid water. Terrestrial atmosphere played a key role in the process by allowing the permanent presence of liquid water and by participating in the production of carbon-based molecules. Water molecules exhibit specific properties mainly due to a dense network of hydrogen bonds. The carbon-based molecules were either home made in the atmosphere and/or in submarine hydrothermal systems or delivered by meteorites and micrometeorites. The search for possible places beyond the earth where the trilogy atmosphere/water/life could exist is the main objective of astrobiology. Within the Solar System, exploration missions are dedicated to Mars, Europa, Titan and the icy bodies. The discovery of several hundreds of extrasolar planets opens the quest to the whole Milky Way.
Osmotic water transport in aquaporins
DEFF Research Database (Denmark)
Zeuthen, Thomas; Alsterfjord, Magnus; Beitz, Eric
2013-01-01
Abstract We test a novel, stochastic model of osmotic water transport in aquaporins. A solute molecule present at the pore mouth can either be reflected or permeate the pore. We assume that only reflected solute molecules induce osmotic transport of water through the pore, while permeating solute...... molecules give rise to no water transport. Accordingly, the rate of water transport is proportional to the reflection coefficient σ, while the solute permeability, P(S), is proportional to 1 - σ. The model was tested in aquaporins heterologously expressed in Xenopus oocytes. A variety of aquaporin channel...... sizes and geometries were obtained with the two aquaporins AQP1 and AQP9 and mutant versions of these. Osmotic water transport was generated by adding 20 mM of a range of different-sized osmolytes to the outer solution. The osmotic water permeability and the reflection coefficient were measured...
Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.
2017-01-01
Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364
Growing interstellar molecules with ion-molecule reactions
International Nuclear Information System (INIS)
Bohme, D.K.
1989-01-01
Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present
DEFF Research Database (Denmark)
Engelund, Emil Tang
2011-01-01
Predicting the performance of wood for decades ahead is important when using the material for structural purposes. The performance is closely related to the hierarchical material structure of wood and the dependent interaction with water in the structure. Accurately predicting wood performance...... therefore requires an understanding of material structure from molecular to macroscopic level as well as of the impact of water molecules. The objective of this work is to investigate the performance of wood in terms of mechanical response of the material and effect of water. To understand the latter, one...... must first know in which parts of the wood structure, water is located. If parts of the water in wood are held in capillaries in the wood structure, these water molecules interact with the material differently than those held within wood cell walls. In this study, the occurrence of capillary water...
Electro-induced reactions of biologically important molecules
International Nuclear Information System (INIS)
Kocisek, J.
2010-01-01
The thesis presents the results of research activities in the field of electron interactions with biologically relevant molecules which was carried out during my PhD studies at the Department of Experimental Physics, Comenius University in Bratislava. Electron induced interactions with biologically relevant molecules were experimentally studied using crossed electron-molecule beams experiment. The obtained results, were presented in four publications in international scientific journals. First study of deals with electron impact ionisation of furanose alcohols [see 1. in list of author publications on page 22]. It has been motivated by most important works in the field of electron induced damages of DNA bases [4]. Studied 3-hydroxytetrahydrofuran and tetrahydrofurfuryl alcohol, are important model molecules for more complex biological systems (e.g. deoxyribose).The influence of hydroxyl group on stabilisation of the positive ions of the molecules, together with the stability of furan ring in ionized form are main themes of the study. The studies of small amides and aminoacids are connected to scientific studies in the field of formation of the aminoacids and other biologically relevant molecules in space and works trying to explain electron induced processes in more complex molecules[12, 13, 24]. The most important results were obtained for aminoacid Serine [see 2. in list of author publications on page 22]. We have showed that additional OH group of Serine considerably lower the reaction enthalpy limit of reactions resulting to formation of neutral water molecules, in comparison to other amino acids. Also the study of (M-H)- reaction channel using the electron beam with FWHM under 100 meV is of high importance in the field. The last part of the thesis is focused on the electron interactions with organosilane compounds. Materials prepared from organosilane molecules in plasmas have wide range of applications in both biology and medicine. We have studied electron
Dielectric and gravimetric studies of water binding to lysozyme
International Nuclear Information System (INIS)
Bone, S.
1996-01-01
Time domain dielectric spectroscopy and hydration isotherm measurements as a function of temperature have been applied to hydrated lysozyme powder. Two dielectric dispersions were identified, the first centred at approximately 8 MHz and a second above 1 GHz. The higher dispersion is considered to be the result of rotational relaxation of water molecules bound to the enzyme. In this case the results indicate the existence of a population of 32 water molecules per lysozyme molecule which are irrotationally bound to the lysozyme structure. A larger population of water molecules is relatively free to respond to the electric field and exhibits a dipole moment close to that of vapour phase water molecules. Multi-temperature hydration isotherm measurements are used to calculate enthalpies and entropies associated with the binding of water to lysozyme. Discontinuities both in dielectric and in thermodynamic characteristics in the range 10-14% hydration are interpreted as a re-ordering of the water structure on the enzyme surface
Stabilities of protonated water-ammonia clusters
Sundén, A. E. K.; Støchkel, K.; Hvelplund, P.; Brøndsted Nielsen, S.; Dynefors, B.; Hansen, K.
2018-05-01
Branching ratios of water and ammonia evaporation have been measured for spontaneous evaporation from protonated mixed clusters H+(H2O)n(NH3)m in the size range 0 ≤ n ≤ 11 and 0 ≤ m ≤ 7. Mixed clusters evaporate water except for clusters containing six or more ammonia molecules, indicating the formation of a stable core of one ammonium ion surrounded by four ammonia molecules and a second shell consisting predominantly of water. We relate evaporative branching ratios to free energy differences between the products of competing channels and determine the free energy differences for clusters with up to seven ammonia molecules. Clusters containing up to five ammonia molecules show a very strong scaling of these free energy differences.
Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL
2009-03-10
A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.
Structural properties of water around uncharged and charged carbon nanotubes
International Nuclear Information System (INIS)
Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour
2013-01-01
Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules
Femtosecond laser irradiation of the fluorescent molecules-loaded poly(lactic-co-glycolic acid)
Umemoto, Taiga; Shibata, Akimichi; Terakawa, Mitsuhiro
2017-09-01
Molecular release from scaffolds is desired for tailoring cell-compatible tissue engineering. Several methods have been proposed to control molecular release, such as annealing, plasma treatment, and laser processing. In this study, we describe the alteration of Rhodamine B (RhB)-loaded poly(lactic-co-glycolic acid) (PLGA) after femtosecond laser irradiation, which was evaluated on the basis of the water absorption and mass remaining. Fluorescence measurement of released RhB molecules revealed the acceleration of the molecular release upon 400-nm laser irradiation, whereas 800-nm laser irradiation did not induce a comparable degree of change compared with non-irradiated samples. The result of the water absorption measurement indicates that the large amount of water absorption of 400-nm laser-irradiated PLGA sample may accelerate the diffusion of the loaded molecules through absorbing water, which resulted in the faster molecular release.
Hada, Masaki; Hasegawa, Yoichi; Nagaoka, Ryota; Miyake, Tomoya; Abdullaev, Ulugbek; Ota, Hiromi; Nishikawa, Takeshi; Yamashita, Yoshifumi; Hayashi, Yasuhiko
2018-02-01
We have developed a vacuum-compatible chamber for in-situ X-ray diffraction (XRD) studies and have used it to characterize the changing crystal structure of an inorganic-organic hybrid perovskite material, CH3NH3PbI3 (MAPbI3), during interactions with water vapor at room temperature. In the XRD spectra, we have observed the degradation of MAPbI3 and the creation of MAPbI3 hydrates, which follow simple rate equations. The time constant for the degradation of MAPbI3 during accelerated aging suggests that multiple collisions of water molecules with the MAPbI3 crystal trigger the degradation of the crystal.
Roles of water molecules in bacteria and viruses
Cox, C. S.
1993-02-01
In addition to water, microbes mainly comprise lipids, carbohydrates, proteins and nucleic acids. Their structure and function singularly and conjointly is affected by water activity. Desiccation leads to dramatic lipid phase changes whereas carbohydrates, proteins and nucleic acids initially suffer spontaneous, reversible low activation energy Maillard reactions forming products that more slowly re-arrange, cross-link etc. to give non-native states. While initial products spontaneously may reverse to native states by raising water activity, later products only do so through energy consumption and enzymatic activity eg. repair. Yet, native states of lipid membranes and associated enzymes are required to generate energy. Consequently, good reserves of high energy compounds (e.g. ATP) and of membrane stabilisers (e.g. trehalose) may be expected to enhance survival following drying and rehydration (e.g. anhydrobiotic organisms).
The primary processes by impact of ionizing radiations with water
International Nuclear Information System (INIS)
Znamirovschi, V.; Mastan, I.; Cozar, O.
1976-01-01
The problem concerning primary processes in radiolysis of water is discussed. The results on the excitation and ionization of water molecule, dissociation of the parent-molecular ion of water and dissociation of excited molecule of water are presented. (author)
Functionalized single walled carbon nanotubes as template for water storage device
Energy Technology Data Exchange (ETDEWEB)
Paul, Sanjib; Taraphder, Srabani, E-mail: srabani@chem.iitkgp.ernet.in
2016-11-10
Single walled carbon nanotubes, endohedrally functionalized with a protonated/unprotonated carboxylic acid group, are examined as potential templates for water storage using classical molecular dynamics simulation studies. Following a spontaneous entry of water molecules into the core of model functionalized carbon nanotubes (FCNTs), a large fraction of water molecules are found to be trapped inside FCNTs of lengths 50 and 100 Å. Only water molecules near the two open ends of the nanotube are exchanged with the bulk solvent. The residence times of water molecules inside FCNTs are investigated by varying the length of the tube, the length of suspended functional group and the protonation state of the carboxylic acid group. Favorable energetic interactions between the functional group and water, assisted by a substantial gain in rotational entropy, are found to compensate for the entropy loss resulting from restricted translational diffusion of trapped water molecules.
Diffusion and infrared properties of molecules in ice mantles
International Nuclear Information System (INIS)
Schmitt, B.; Grim, R.; Greenberg, J.M.
1989-01-01
Within dense molecular clouds the formation of frozen icy mantles on interstellar dust grains is thought to be the result of various growth conditions. The molecules, which make up the ice mantles are probably completely mixed. To study the physical properties of such ice mixtures the experiments were performed on the evaporation processes and on the spectroscopic properties of CO, CO2, and CH4 in water rich ices. The decrease in concentration of volatile molecules in ice samples deposited at 10 K and subsequently heated is found to occur essentially in two steps. The first one, corresponding to an evaporation of part of the volatile molecules, starts at about 25 K for CO, 32 K for CH4, and 70 K for CO2. During the crystallization of H2O ice at temperatures greater than 120 K a second evaporation occurs leading to the complete disappearance of the volatile molecules in the solid phase. The main astrophysical implications of the diffusion and spectroscopic behaviors are presented. The possible effects of a heating source on the fraction of volatile molecules, such as CO trapped in grain mantles, are discussed
2008-11-01
ISTC Project No. #1592P The Comparative Study of The Effects of Extremely Low Frequency Electromagnetic Fields and Infrasound on Water Molecule...performed under the agreement with the International Science and Technology Center ( ISTC ), Moscow. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704...dissociation and generation of reactive oxygen spaces. 5a. CONTRACT NUMBER ISTC Registration No: A-1592p 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Five molecules we would take to a remote island.
Mayer, Thomas U; Marx, Andreas
2010-06-25
Which five molecules would you take to a remote island? If you imagine yourself as a castaway on an island you might pick water, glucose, penicillin, and ethanol in combination with aspirin. However, as a scientist, you may ask yourself which molecules impressed you most by their chemical or biological property, their impact on science, or the ingenuity and/or serendipity behind their discovery. Here, we present our personal short list comprising FK506, colchicine, imatinib, Quimi-Hib, and cidofovir. Obviously, our selection is highly subjective and, therefore, we apologize up front to our colleagues for not mentioning their favorite compounds.
Second-order Born approximation for the ionization of molecules by electron and positron impact
Energy Technology Data Exchange (ETDEWEB)
Dal Cappello, C. [Universite Paul Verlaine-Metz, Laboratoire de Physique Moleculaire et des Collisions, Institut Jean Barriol (FR2843), 1 Boulevard Arago, F-57078 Metz Cedex 3 (France); Rezkallah, Z.; Houamer, S. [Laboratoire de Physique Quantique et Systemes Dynamiques, Departement de Physique, Faculte des Sciences Universite Ferhat Abbas, Setif 19000 (Algeria); Charpentier, I. [Universite Paul Verlaine-Metz, Laboratoire de Physique et Mecanique des Materiaux UMR 7554, Ile du Saulcy, F-57045 Metz Cedex 1 (France); Hervieux, P. A. [Institut de Physique et Chimie des Materiaux de Strasbourg, 23 Rue du Loess, BP 43, F-67034 Strasbourg Cedex 2 (France); Ruiz-Lopez, M. F. [Nancy-University, Equipe de Chimie et Biochimie Theoriques, UMR CNRS-UHP 7565, BP 239, F-54506 Vandoeuvre-les-Nancy (France); Dey, R. [Max-Planck Institut fuer Plasmaphysik, Boltzmannstr. 2, D-85748 Garching (Germany); Roy, A. C. [School of Mathematical Sciences, Ramakrishna Mission Vivekananda University, Belur Math 711202, West Bengal (India)
2011-09-15
Second-order Born approximation is applied to study the ionization of molecules. The initial and final states are described by single-center wave functions. For the initial state a Gaussian wave function is used while for the ejected electron it is a distorted wave. Results of the present model are compared with recent (e,2e) experiments on the water molecule. Preliminary results are also presented for the ionization of the thymine molecule by electrons and positrons.
Directory of Open Access Journals (Sweden)
Ignacio Boron
2015-07-01
Full Text Available Mycobacterium tuberculosis, the causative agent of human tuberculosis, has two proteins belonging to the truncated hemoglobin (trHb family. Mt-trHbN presents well-defined internal hydrophobic tunnels that allow O2 and •NO to migrate easily from the solvent to the active site, whereas Mt-trHbO possesses tunnels interrupted by a few bulky residues, particularly a tryptophan at position G8. Differential ligand migration rates allow Mt-trHbN to detoxify •NO, a crucial step for pathogen survival once under attack by the immune system, much more efficiently than Mt-trHbO. In order to investigate the differences between these proteins, we performed experimental kinetic measurements, •NO decomposition, as well as molecular dynamics simulations of the wild type Mt-trHbN and two mutants, VG8F and VG8W. These mutations affect both the tunnels accessibility as well as the affinity of distal site water molecules, thus modifying the ligand access to the iron. We found that a single mutation allows Mt-trHbN to acquire ligand migration rates comparable to those observed for Mt-trHbO, confirming that ligand migration is regulated by the internal tunnel architecture as well as by water molecules stabilized in the active site.
Surface functionalization of aluminosilicate nanotubes with organic molecules
Directory of Open Access Journals (Sweden)
Wei Ma
2012-02-01
Full Text Available The surface functionalization of inorganic nanostructures is an effective approach for enriching the potential applications of existing nanomaterials. Inorganic nanotubes attract great research interest due to their one-dimensional structure and reactive surfaces. In this review paper, recent developments in surface functionalization of an aluminosilicate nanotube, “imogolite”, are introduced. The functionalization processes are based on the robust affinity between phosphate groups of organic molecules and the aluminol (AlOH surface of imogolite nanotubes. An aqueous modification process employing a water soluble ammonium salt of alkyl phosphate led to chemisorption of molecules on imogolite at the nanotube level. Polymer-chain-grafted imogolite nanotubes were prepared through surface-initiated polymerization. In addition, the assembly of conjugated molecules, 2-(5’’-hexyl-2,2’:5’,2’’-terthiophen-5-ylethylphosphonic acid (HT3P and 2-(5’’-hexyl-2,2’:5’,2’’-terthiophen-5-ylethylphosphonic acid 1,1-dioxide (HT3OP, on the imogolite nanotube surface was achieved by introducing a phosphonic acid group to the corresponding molecules. The optical and photophysical properties of these conjugated-molecule-decorated imogolite nanotubes were characterized. Moreover, poly(3-hexylthiophene (P3HT chains were further hybridized with HT3P modified imogolite to form a nanofiber hybrid.
Proton Resonance Lines of Water in Heulandite, Mordenite and Clinoptilolite
International Nuclear Information System (INIS)
Cruz Inclan, C.; Diaz Quintanilla, D.; Diaz Ruano, A.
1986-01-01
It is reported for the first time the proton magnetic resonance spectra of the clinoptilolite and mordenite between 220 K and 440 K. In mordenite it was observed that all water molecules have so an intensive diffusive movement, that they are completely delocalized. In clinoptilolite below 390 K, only a part of the water molecules are completely delocalized. Over 390 K all water molecules become delocalized. This particular behavior of the water molecules in clinoptilolite and mordenite is confronted with those structural models proposed by D.W. Breck. The concept of non-localized quantum state is introduced in order to explain the difference observed with the structural models. (author)
Araki, Takahiro; Kondo, Atsushi; Maeda, Kazuyuki
2015-04-13
Novel isomorphous pillared-layer-type crystalline lanthanide 1,3,5-benzenetriphosphonates were prepared with bpy and dbo as organic pillars (LnBP-bpy and LnBP-dbo; Ln: Ce, Pr, and Nd). Ab initio crystal structure solution using synchrotron X-ray powder diffraction data revealed that the organic pillars do not exist as neutral coordinating ligands but as cationic molecules. Especially the LnBP-dbo phases have ordered interlayer space filled with water molecules between the dbo pillars, and the interlayer water is successfully removed by heating under vacuum with slightly distorted but basically retained pillared layer structures. Microporosity of the materials is confirmed by adsorption of nitrogen, carbon dioxide, and hydrogen gases. Such microporous layered metal phosphonates pillared with cationic molecules should be unprecedented and should offer new strategies to design ordered microporous materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Spyrakis, Francesca; Cavasotto, Claudio N
2015-10-01
Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.
Filtering Water by Use of Ultrasonically Vibrated Nanotubes
Gavalas, Lillian Susan
2009-01-01
Devices that could be characterized as acoustically driven molecular sieves have been proposed for filtering water to remove all biological contaminants and all molecules larger than water molecules. Originally intended for purifying wastewater for reuse aboard spacecraft, these devices could also be attractive for use on Earth in numerous settings in which there are requirements to obtain potable, medical-grade, or otherwise pure water from contaminated water supplies. These devices could also serve as efficient means of removing some or all water from chemical products . for example, they might be useful as adjuncts or substitutes for stills in the removal of water from alcohols and alcoholic beverages. These devices may be constructed using various materials, such as ceramics, metallics, or polymers, depending on end-use requirements. A representative device of this type (see figure) would include a polymeric disk, about 1 mm in diameter and between 1 and 40 microns thick, within which would be embedded single-wall carbon nanotubes aligned along the thickness axis. The polymeric disk would be part of a unitary polymeric ring assembly. An acoustic transducer in the form of a piezoelectric-film-and-electrode subassembly - typically 9 microns thick and made of poly(vinylidene fluoride) coated with copper 150 nm thick -. would be affixed to the outside of the outer polymeric ring by means of an electrically nonconductive epoxy. The nanotubes would be chosen to have diameters between about 8 and about 13.5 A because water molecules could fit into the nanotubes, but larger molecules could not. Water to be purified would be placed in contact with one face (typically, the upper face) of the filter disk. The surface tension of water is low enough that water molecules should enter and travel along the nanotubes, and computational simulations of molecular dynamics and experimental measurements have shown that the water molecules inside the nanotubes in this size range can
Directory of Open Access Journals (Sweden)
Schatzschneider U.
2013-03-01
Full Text Available Ultraviolet irradiation of CO-releasing molecules (CORMs in water eventually leads to the loss of several carbon monoxide ligands.We show for an exemplary manganese tricarbonyl CORM that only one ligand is photolyzed off on an ultrafast timescale and that some molecules may undergo geminate recombination.
Transphosphatidylation and base-exchange in the membranes of clostridium butyricum
International Nuclear Information System (INIS)
Walton, P.A.; Goldfine, H.
1987-01-01
Membrane particles from C. butyricum, incubated with phosphatidylserine (PS) and Triton X-100, produced three labelled phospholipids in addition to phosphatidylethanolamine (PE) formed by decarboxylation. These lipid were also formed when PE or phosphatidylglycerol (PG) was employed as substrate. 2D-TLC of intact lipids and their deacylation products showed that these lipids are phosphatidic acid, cardiolipid (CL), and previously unreported phosphatidyltriton (PT). Triton X-100 acts as both activator and substrate of the reaction. With radiolabel in different portions of the substrate phospholipid we demonstrated that the phosphatidyl moiety was transferred with the loss of the head-group in a phospholipase D-like manner. The acceptor molecule can be water or primary alcohols. Addition of exogenous unlabelled PG resulted in the formation of CL with concomitant decrease in the level of PT formed. Labelled PS, PE, and PG could also be formed upon addition of their corresponding alcoholic head group to incubations containing a labelled phosphatidyl donor and Triton X-100. These results indicate that, in C. butyricum, enzymic steps exists that would allow remodelling of the membrane phospholipids, without requiring de novo biosynthesis
Adaptive resolution simulation of an atomistic protein in MARTINI water
International Nuclear Information System (INIS)
Zavadlav, Julija; Melo, Manuel Nuno; Marrink, Siewert J.; Praprotnik, Matej
2014-01-01
We present an adaptive resolution simulation of protein G in multiscale water. We couple atomistic water around the protein with mesoscopic water, where four water molecules are represented with one coarse-grained bead, farther away. We circumvent the difficulties that arise from coupling to the coarse-grained model via a 4-to-1 molecule coarse-grain mapping by using bundled water models, i.e., we restrict the relative movement of water molecules that are mapped to the same coarse-grained bead employing harmonic springs. The water molecules change their resolution from four molecules to one coarse-grained particle and vice versa adaptively on-the-fly. Having performed 15 ns long molecular dynamics simulations, we observe within our error bars no differences between structural (e.g., root-mean-squared deviation and fluctuations of backbone atoms, radius of gyration, the stability of native contacts and secondary structure, and the solvent accessible surface area) and dynamical properties of the protein in the adaptive resolution approach compared to the fully atomistically solvated model. Our multiscale model is compatible with the widely used MARTINI force field and will therefore significantly enhance the scope of biomolecular simulations
Capacitive Sensing of Intercalated H2O Molecules Using Graphene
Olson, Eric J.; Ma, Rui; Sun, Tao; Ebrish, Mona A.; Haratipour, Nazila; Min, Kyoungmin; Aluru, Narayana R.; Koester, Steven J.
2015-01-01
Understanding the interactions of ambient molecules with graphene and adjacent dielectrics is of fundamental importance for a range of graphene-based devices, particularly sensors, where such interactions could influence the operation of the device. It is well-known that water can be trapped underneath graphene and its host substrate, however, the electrical effect of water beneath graphene and the dynamics of how it changes with different ambient conditions has not been quantified. Here, usi...
Stability of metal organic frameworks and interaction of small gas molecules in these materials
Tan, Kui
The work in this dissertation combines spectroscopy ( in-situ infrared absorption and Raman), powder X-ray diffraction and DFT calculations to study the stability of metal organic frameworks materials (MOFs) in the presence of water vapor and other corrosive gases (e.g., SO 2, NO2 NO), and the interaction and competitive co-adsorption of several gases within MOFs by considering two types of prototypical MOFs: 1) a MOF with saturated metal centers based on paddlewheel secondary building units: M(bdc)(ted)0.5 [M=Cu, Zn, Ni, Co, bdc = 1,4-benzenedicarboxylate, ted = triethylenediamine], and 2) a MOF with unsaturated metal centers: M2(dobdc) [M=Mg2+, Zn2+, Ni2+, Co2+ and dobdc = 2,5-dihydroxybenzenedicarboxylate]. We find that the stability of MOFs to water vapor critically depends on their structure and the specific metal cation in the building units. For M(bdc)(ted)0.5, the metal-bdc bond is the most vulnerable for Cu(bdc)(ted)0.5, while the metal-ted bond is first attacked for the Zn and Co analogs. In contrast, Ni(bdc)(ted)0.5 remains stable under the same conditions. For M2(dobdc), or MOF-74, the weak link is the dobdc-metal bond. The water molecule is dissociatively adsorbed at the metal-oxygen group with OH adsorption directly on the metal center and H adsorption on the bridging O of the phenolate group in the dobdc linker. Other technologically important molecules besides water, such as NO, NO2, SO2, tend to poison M2(dobdc) through dissociative or molecular adsorption onto the open metal sites. A high uptake SO2 capacity was measured in M(bdc)(ted)0.5, attributed to multipoint interactions between the guest SO2 molecule and the MOF host. In the case of competitive co-adsorption between CO2 and other small molecules, we find that binding energy alone is not a good indicator of molecular site occupation within the MOF (i.e., it cannot successfully predict and evaluate the displacement of CO2 by other molecules). Instead, we show that the kinetic barrier for the
Electrochemistry of conjugated planar anticancer molecules: Irinotecan and Sunitinib
International Nuclear Information System (INIS)
Zotti, Gianni; Berlin, Anna; Vercelli, Barbara
2017-01-01
The evaluation of drug levels is important for personalized therapeutic approaches particularly in cancer care. To this end electrochemistry provides simplicity, low cost, high sensitivity and possibility of miniaturization. Here we report the electrochemistry and UV-visible spectroscopy of two extensively used planar conjugated anticancer molecules, Irinotecan (ITC) and Sunitinib (SUN), in aprotic medium and water. Comparison is made with model compounds without amine ends. The electronic spectra of ITC and SUN in dimethylsulfoxide show similar vibronic patterns (0.2 eV vibrational energy for both) with energy gaps of 3.1 and 2.5 eV respectively. Cyclic voltammetry in acetonitrile shows the same one-electron reduction peak (-1.9 V vs Ag/Ag + ) and oxidation peaks at 1.45 and 0.65 V, both beyond the oxidation of the amine ends (0.45 V). In water the optical energy gaps are unchanged but the vibronic structure is almost lost and the oxidation processes are eased by 0.45 V for SUN and 1.10 V for ITC. The number of oxidatively exchanged electrons in water is two for ITC but four in two subsequent two-electron steps for SUN. The overall oxidation process for ITC likely involves the nucleophilic attack of a water molecule to the quinoline moiety. The first two-electron oxidation of SUN, involving the pyrrole moiety, leads possibly to the conjugated imine ring which is further oxidized to the N-oxide form. Lowering of the electron-transfer activation energy by water is assigned in part to release of molecular rigidity but in ITC the major role is assigned to a nucleophilic attack of water already in the activated state.
Atkins, Peters
2003-01-01
Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.
Accelerated evaporation of water on graphene oxide.
Wan, Rongzheng; Shi, Guosheng
2017-03-29
Using molecular dynamics simulations, we show that the evaporation of nanoscale volumes of water on patterned graphene oxide is faster than that on homogeneous graphene oxide. The evaporation rate of water is insensitive to variation in the oxidation degree of the oxidized regions, so long as the water film is only distributed on the oxidized regions. The evaporation rate drops when the water film spreads onto the unoxidized regions. Further analysis showed that varying the oxidation degree observably changed the interaction between the outmost water molecules and the solid surface, but the total interaction for the outmost water molecules only changed a very limited amount due to the correspondingly regulated water-water interaction when the water film is only distributed on the oxidized regions. When the oxidation degree is too low and some unoxidized regions are also covered by the water film, the thickness of the water film decreases, which extends the lifetime of the hydrogen bonds for the outmost water molecules and lowers the evaporation rate of the water. The insensitivity of water evaporation to the oxidation degree indicates that we only need to control the scale of the unoxidized and oxidized regions for graphene oxide to regulate the evaporation of nanoscale volumes of water.
Thermal ion-molecule reactions in oxygen-containing molecules
International Nuclear Information System (INIS)
Kumakura, Minoru
1981-02-01
The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)
Single-Molecule Interfacial Electron Transfer
Energy Technology Data Exchange (ETDEWEB)
Ho, Wilson [Univ. of California, Irvine, CA (United States)
2018-02-03
Interfacial electron transfer (ET) plays an important role in many chemical and biological processes. Specifically, interfacial ET in TiO2-based systems is important to solar energy technology, catalysis, and environmental remediation technology. However, the microscopic mechanism of interfacial ET is not well understood with regard to atomic surface structure, molecular structure, bonding, orientation, and motion. In this project, we used two complementary methodologies; single-molecule fluorescence spectroscopy, and scanning-tunneling microscopy and spectroscopy (STM and STS) to address this scientific need. The goal of this project was to integrate these techniques and measure the molecular dependence of ET between adsorbed molecules and TiO2 semiconductor surfaces and the ET induced reactions such as the splitting of water. The scanning probe techniques, STM and STS, are capable of providing the highest spatial resolution but not easily time-resolved data. Single-molecule fluorescence spectroscopy is capable of good time resolution but requires further development to match the spatial resolution of the STM. The integrated approach involving Peter Lu at Bowling Green State University (BGSU) and Wilson Ho at the University of California, Irvine (UC Irvine) produced methods for time and spatially resolved chemical imaging of interfacial electron transfer dynamics and photocatalytic reactions. An integral aspect of the joint research was a significant exchange of graduate students to work at the two institutions. This project bridged complementary approaches to investigate a set of common problems by working with the same molecules on a variety of solid surfaces, but using appropriate techniques to probe under ambient (BGSU) and ultrahigh vacuum (UCI) conditions. The molecular level understanding of the fundamental interfacial electron transfer processes obtained in this joint project will be important for developing efficient light harvesting
Raithel, Georg; Zhao, Jianming
2017-04-01
Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).
Molecular recognition of chromophore molecules to amine terminated surfaces
International Nuclear Information System (INIS)
Flores-Perez, Rosangelly; Ivanisevic, Albena
2007-01-01
We report the design and characterization of quartz surfaces that can bind to three retinal based chromophores. The amine terminated surfaces were engineered in order to mimic the environment of the opsin protein that accommodates binding of chromophore molecules in the human eye. Each surface coupling step was characterized by water contact angle measurements, ellipsometry, atomic force microscopy, X-ray photoelectron spectroscopy, and transmission infrared spectroscopy. The spectroscopic techniques confirmed that the three chromophore molecules can bind to the surface using a Schiff base mode. Our data suggests that the availability of the amine groups on the surface is critical in the accommodation of the binding of different chromophores
Active-Site Hydration and Water Diffusion in Cytochrome P450cam: A Highly Dynamic Process
Energy Technology Data Exchange (ETDEWEB)
Miao, Yinglong [ORNL; Baudry, Jerome Y [ORNL
2011-01-01
Long-timescale molecular dynamics simulations (300 ns) are performed on both the apo- (i.e., camphor-free) and camphor-bound cytochrome P450cam (CYP101). Water diffusion into and out of the protein active site is observed without biased sampling methods. During the course of the molecular dynamics simulation, an average of 6.4 water molecules is observed in the camphor-binding site of the apo form, compared to zero water molecules in the binding site of the substrate-bound form, in agreement with the number of water molecules observed in crystal structures of the same species. However, as many as 12 water molecules can be present at a given time in the camphor-binding region of the active site in the case of apo-P450cam, revealing a highly dynamic process for hydration of the protein active site, with water molecules exchanging rapidly with the bulk solvent. Water molecules are also found to exchange locations frequently inside the active site, preferentially clustering in regions surrounding the water molecules observed in the crystal structure. Potential-of-mean-force calculations identify thermodynamically favored trans-protein pathways for the diffusion of water molecules between the protein active site and the bulk solvent. Binding of camphor in the active site modifies the free-energy landscape of P450cam channels toward favoring the diffusion of water molecules out of the protein active site.
Characterization of metal-bound water in bioactive Fe(III)-cyclophane complexes
Salazar-Medina, A. J.; Gámez-Corrales, R.; Ramírez, J. Z.; González-Aguilar, G. A.; Velázquez-Contreras, E. F.
2018-02-01
Binuclear Fe(III) complexes, Fe2PO and Fe2PC, have functions of antioxidants as well as superoxide dismutase and peroxidase mimickers. The role of water molecules in the non-cytotoxic properties of these complexes have been studied by thermogravimetric and IR/Raman-spectroscopic methods. The thermogravimetric analysis of Fe2PO shows the presence of nine water molecules (Fe2PO·9H2O), three of which are directly coordinated to the metallic ion; the remaining six molecules occupy the secondary coordination sphere. For Fe2PC, eight water molecules were detected (Fe2PC·8H2O), and only one of them directly coordinates to the metallic ion. IR/Raman spectrum analyses corroborate the presence of water molecules in both metallic complexes and the mode of coordination to the ligand, on the basis of bands characteristic of hydration water at ∼3300 cm-1 and bands of adsorbed water between 430 and 490 cm-1. A pentacoordinate geometry is proposed for Fe2PO and a hexacoordinated geometry for Fe2PC. Those results are consistent with theoretical calculations performed through a semiempirical PM7 method. The presence of coordinated water molecules is closely related to the reactivity of Fe2PO and Fe2PC in solution.
Water in the presence of inert Lennard-Jones obstacles
Kurtjak, Mario; Urbic, Tomaz
2014-04-01
Water confined by the presence of a 'sea' of inert obstacles was examined. In the article, freely mobile two-dimensional Mercedes-Benz (MB) water put to a disordered, but fixed, matrix of Lennard-Jones disks was studied by the Monte Carlo computer simulations. For the MB water molecules in the matrix of Lennard-Jones disks, we explored the structures, hydrogen-bond-network formation and thermodynamics as a function of temperature and size and density of matrix particles. We found that the structure of model water is perturbed by the presence of the obstacles. Density of confined water, which was in equilibrium with the bulk water, was smaller than the density of the bulk water and the temperature dependence of the density of absorbed water did not show the density anomaly in the studied temperature range. The behaviour observed as a consequence of confinement is similar to that of increasing temperature, which can for a matrix lead to a process similar to capillary evaporation. At the same occupancy of space, smaller matrix molecules cause higher destruction effect on the absorbed water molecules than the bigger ones. We have also tested the hypothesis that at low matrix densities the obstacles induce an increased ordering and 'hydrogen bonding' of the MB model molecules, relative to pure fluid, while at high densities the obstacles reduce MB water structuring, as they prevent the fluid to form good 'hydrogen-bonding' networks. However, for the size of matrix molecules similar to that of water, we did not observe this effect.
Paolantoni, Marco; Sassi, Paola; Morresi, Assunta; Santini, Sergio
2007-07-01
The effect of glucose on the relaxation process of water at picosecond time scales has been investigated by depolarized Rayleigh scattering (DRS) experiments. The process is assigned to the fast hydrogen bonding dynamics of the water network. In DRS spectra this contribution can be safely separated from the slower relaxation process due to the sugar. The detected relaxation time is studied at different glucose concentrations and modeled considering bulk and hydrating water contributions. As a result, it is found that in diluted conditions the hydrogen bond lifetime of proximal water molecules becomes about three times slower than that of the bulk. The effect of the sugar on the hydrogen bond water structure is investigated by analyzing the low-frequency Raman (LFR) spectrum sensitive to intermolecular modes. The addition of glucose strongly reduces the intensity of the band at 170cm-1 assigned to a collective stretching mode of water molecules arranged in cooperative tetrahedral domains. These findings indicate that proximal water molecules partially lose the tetrahedral ordering typical of the bulk leading to the formation of high density environments around the sugar. Thus the glucose imposes a new local order among water molecules localized in its hydration shell in which the hydrogen bond breaking dynamics is sensitively retarded. This work provides new experimental evidences that support recent molecular dynamics simulation and thermodynamics results.
Structure of the floating water bridge and water in an electric field.
Skinner, Lawrie B; Benmore, Chris J; Shyam, Badri; Weber, J K R; Parise, John B
2012-10-09
The floating water bridge phenomenon is a freestanding rope-shaped connection of pure liquid water, formed under the influence of a high potential difference (approximately 15 kV). Several recent spectroscopic, optical, and neutron scattering studies have suggested that the origin of the bridge is associated with the formation of anisotropic chains of water molecules in the liquid. In this work, high energy X-ray diffraction experiments have been performed on a series of floating water bridges as a function of applied voltage, bridge length, and position within the bridge. The two-dimensional X-ray scattering data showed no direction-dependence, indicating that the bulk water molecules do not exhibit any significant preferred orientation along the electric field. The only structural changes observed were those due to heating, and these effects were found to be the same as for bulk water. These X-ray scattering measurements are supported by molecular dynamics (MD) simulations which were performed under electric fields of 10(6) V/m and 10(9) V/m. Directional structure factor calculations were made from these simulations parallel and perpendicular to the E-field. The 10(6) V/m model showed no significant directional-dependence (anisotropy) in the structure factors. The 10(9) V/m model however, contained molecules aligned by the E-field, and had significant structural anisotropy.
Water at silica/liquid water interfaces investigated by DFT-MD simulations
Gaigeot, Marie-Pierre
This talk is dedicated to probing the microscopic structural organization of water at silica/liquid water interfaces including electrolytes by first principles DFT-based molecular dynamics simulations (DFT-MD). We will present our very recent DFT-MD simulations of electrolytic (KCl, NaCl, NaI) silica/liquid water interfaces in order to unravel the intertwined structural properties of water and electrolytes at the crystalline quartz/liquid water and amorphous silica/liquid water interfaces. DFT-MD simulations provide direct knowledge of the structural organization of water and the H-Bond network formed between the water molecules within the different water layers above the silica surface. One can furthermore extract vibrational signatures of the water molecules within the interfacial layers from the DFT-MD simulations, especially non-linear SFG (Sum Frequency generation) signatures that are active at solid/liquid interfaces. The strength of the simulated spectra is that a detailed analysis of the signatures in terms of the water/water H-Bond networks formed within the interfacial water layers and in terms of the water/silica or water/electrolytes H-Bond networks can be given. Comparisons of SFG spectra between quartz/water/electrolytes and amorphous silica/water/electrolytes interfaces allow us to definitely conclude on how the structural arrangements of liquid water at these electrolytic interfaces modulate the final spectroscopic signatures. Invited speaker.
Electron-excited molecule interactions
International Nuclear Information System (INIS)
Christophorou, L.G.; Tennessee Univ., Knoxville, TN
1991-01-01
In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs
TRIMOLECULAR REACTIONS OF URANIUM HEXAFLUORIDE WITH WATER
Energy Technology Data Exchange (ETDEWEB)
Westbrook, M.; Becnel, J.; Garrison, S.
2010-02-25
The hydrolysis reaction of uranium hexafluoride (UF{sub 6}) is a key step in the synthesis of uranium dioxide (UO{sub 2}) powder for nuclear fuels. Mechanisms for the hydrolysis reactions are studied here with density functional theory and the Stuttgart small-core scalar relativistic pseudopotential and associated basis set for uranium. The reaction of a single UF{sub 6} molecule with a water molecule in the gas phase has been previously predicted to proceed over a relatively sizeable barrier of 78.2 kJ {center_dot} mol{sup -1}, indicating this reaction is only feasible at elevated temperatures. Given the observed formation of a second morphology for the UO{sub 2} product coupled with the observations of rapid, spontaneous hydrolysis at ambient conditions, an alternate reaction pathway must exist. In the present work, two trimolecular hydrolysis mechanisms are studied with density functional theory: (1) the reaction between two UF{sub 6} molecules and one water molecule, and (2) the reaction of two water molecules with a single UF{sub 6} molecule. The predicted reaction of two UF{sub 6} molecules with one water molecule displays an interesting 'fluorine-shuttle' mechanism, a significant energy barrier of 69.0 kJ {center_dot} mol{sup -1} to the formation of UF{sub 5}OH, and an enthalpy of reaction ({Delta}H{sub 298}) of +17.9 kJ {center_dot} mol{sup -1}. The reaction of a single UF{sub 6} molecule with two water molecules displays a 'proton-shuttle' mechanism, and is more favorable, having a slightly lower computed energy barrier of 58.9 kJ {center_dot} mol{sup -1} and an exothermic enthalpy of reaction ({Delta}H{sub 298}) of -13.9 kJ {center_dot} mol{sup -1}. The exothermic nature of the overall UF{sub 6} + 2 {center_dot} H{sub 2}O trimolecular reaction and the lowering of the barrier height with respect to the bimolecular reaction are encouraging; however, the sizable energy barrier indicates further study of the UF{sub 6} hydrolysis reaction
Rapid Evaporation of Water on Graphene/Graphene-Oxide: A Molecular Dynamics Study.
Li, Qibin; Xiao, Yitian; Shi, Xiaoyang; Song, Shufeng
2017-09-07
To reveal the mechanism of energy storage in the water/graphene system and water/grapheme-oxide system, the processes of rapid evaporation of water molecules on the sheets of graphene and graphene-oxide are investigated by molecular dynamics simulations. The results show that both the water/graphene and water/grapheme-oxide systems can store more energy than the pure water system during evaporation. The hydroxyl groups on the surface of graphene-oxide are able to reduce the attractive interactions between water molecules and the sheet of graphene-oxide. Also, the radial distribution function of the oxygen atom indicates that the hydroxyl groups affect the arrangement of water molecules at the water/graphene-oxide interface. Therefore, the capacity of thermal energy storage of the water/graphene-oxide system is lower than that of the water/graphene system, because of less desorption energy at the water/graphene-oxide interface. Also, the evaporation rate of water molecules on the graphene-oxide sheet is slower than that on the graphene sheet. The Leidenfrost phenomenon can be observed during the evaporation process in the water/grapheme-oxide system.
Xia, Danyu; Wang, Pi; Shi, Bingbing
2017-09-20
Photochemistry plays an important role in our lives. It has also been a common tool in the laboratory to construct complicated systems from small molecules. Supramolecular chemistry provides an opportunity to solve some of the problems in controlling photochemical reactions via non-covalent interactions. By using confining media and weak interactions between the medium and the reactant molecule, the excited state behavior of molecules has been successfully manipulated. Pillararenes, a new class of macrocyclic hosts, have rarely been used in the field of photochemical investigations, such as the controlling of photo-induced reactions. Herein, we explore a synthetic macrocyclic host, a water-soluble pillar[6]arene, as a controlling tool to manipulate the photo-induced reactions (hydration) in water. A host-guest system in water based on a water-soluble pillar[6]arene and an azastilbene derivative, (E)-4,4'-dimethyl-4,4'-diazoniastilbene diiodide, has been constructed. Then this water-soluble pillar[6]arene was successfully employed to control the photohydration of the azastilbene derivative in water as a "protective agent".
Seeing real-space dynamics of liquid water through inelastic x-ray scattering.
Iwashita, Takuya; Wu, Bin; Chen, Wei-Ren; Tsutsui, Satoshi; Baron, Alfred Q R; Egami, Takeshi
2017-12-01
Water is ubiquitous on earth, but we know little about the real-space motion of molecules in liquid water. We demonstrate that high-resolution inelastic x-ray scattering measurement over a wide range of momentum and energy transfer makes it possible to probe real-space, real-time dynamics of water molecules through the so-called Van Hove function. Water molecules are found to be strongly correlated in space and time with coupling between the first and second nearest-neighbor molecules. The local dynamic correlation of molecules observed here is crucial to a fundamental understanding of the origin of the physical properties of water, including viscosity. The results also suggest that the quantum-mechanical nature of hydrogen bonds could influence its dynamics. The approach used here offers a powerful experimental method for investigating real-space dynamics of liquids.
Manganese(III) Formate: A Three-Dimensional Framework That Traps Carbon Dioxide Molecules.
Cornia, Andrea; Caneschi, Andrea; Dapporto, Paolo; Fabretti, Antonio C; Gatteschi, Dante; Malavasi, Wanda; Sangregorio, Claudio; Sessoli, Roberta
1999-06-14
Carbon dioxide, formic acid, and water molecules are trapped in the crystal lattice of manganese(III) formate (see 1), which was obtained by reducing permanganate with formic acid. Each CO 2 guest molecule exhibits four C-H⋅⋅⋅O-C-O interactions with the three-dimensional host framework of Mn(HCOO) 3 units. Compound 1 undergoes an antiferromagnetic phase transition at 27 K. © 1999 WILEY-VCH Verlag GmbH, Weinheim, Fed. Rep. of Germany.
Water in the physiology of plant: thermodynamics and kinetic
Directory of Open Access Journals (Sweden)
Maurizio Cocucci
2011-02-01
Full Text Available Molecular properties of water molecule determine its role in plant physiology. At molecular level the properties of water molecules determine the behaviour of other plant molecules; in particular its physic characteristics are important in the operativeness of macromolecules and in plant thermoregulation. Plant water supply primarily dependent on thermodynamics properties in particular water chemical potential and its components, more recently there are evidences that suggest an important role in the water kinetic characteristics, depending, at cell membrane level, in particular plasmalemma, on the presence of specific water channel, the aquaporines controlled in its activity by a number of physiological and biochemical factors. Thermodynamics and kinetic factors controlled by physiological, biochemical properties and molecular effectors, control water supply and level in plants to realize their survival, growth and differentiation and the consequent plant production.
Single Molecule Nanoelectrochemistry in Electrical Junctions.
Nichols, Richard J; Higgins, Simon J
2016-11-15
It is now possible to reliably measure single molecule conductance in a wide variety of environments including organic liquids, ultrahigh vacuum, water, ionic liquids, and electrolytes. The most commonly used methods deploy scanning probe microscopes, mechanically formed break junctions, or lithographically formed nanogap contacts. Molecules are generally captured between a pair of facing electrodes, and the junction current response is measured as a function of bias voltage. Gating electrodes can also be added so that the electrostatic potential at the molecular bridge can be independently controlled by this third noncontacting electrode. This can also be achieved in an electrolytic environment using a four-electrode bipotentiostatic configuration, which allows independent electrode potential control of the two contacting electrodes. This is commonly realized using an electrochemical STM and enables single molecule electrical characterization as a function of electrode potential and redox state of the molecular bridge. This has emerged as a powerful tool in modern interfacial electrochemistry and nanoelectrochemistry for studying charge transport across single molecules as a function of electrode potential and the electrolytic environments. Such measurements are possible in electrolytes ranging from aqueous buffers to nonaqueous ionic liquids. In this Account, we illustrate a number of examples of single molecule electrical measurements under electrode potential control use a scanning tunneling microscope (STM) and demonstrate how these can help in the understanding of charge transport in single molecule junctions. Examples showing charge transport following phase coherent tunneling to incoherent charge hopping across redox active molecular bridges are shown. In the case of bipyridinium (or viologen) molecular wires, it is shown how electrochemical reduction leads to an increase of the single molecule conductance, which is controlled by the liquid electrochemical
Vibrational and orientational dynamics of water in aqueous hydroxide solutions.
Hunger, Johannes; Liu, Liyuan; Tielrooij, Klaas-Jan; Bonn, Mischa; Bakker, Huib
2011-09-28
We report the vibrational and orientational dynamics of water molecules in isotopically diluted NaOH and NaOD solutions using polarization-resolved femtosecond vibrational spectroscopy and terahertz time-domain dielectric relaxation measurements. We observe a speed-up of the vibrational relaxation of the O-D stretching vibration of HDO molecules outside the first hydration shell of OH(-) from 1.7 ± 0.2 ps for neat water to 1.0 ± 0.2 ps for a solution of 5 M NaOH in HDO:H(2)O. For the O-H vibration of HDO molecules outside the first hydration shell of OD(-), we observe a similar speed-up from 750 ± 50 fs to 600 ± 50 fs for a solution of 6 M NaOD in HDO:D(2)O. The acceleration of the decay is assigned to fluctuations in the energy levels of the HDO molecules due to charge transfer events and charge fluctuations. The reorientation dynamics of water molecules outside the first hydration shell are observed to show the same time constant of 2.5 ± 0.2 ps as in bulk liquid water, indicating that there is no long range effect of the hydroxide ion on the hydrogen-bond structure of liquid water. The terahertz dielectric relaxation experiments show that the transfer of the hydroxide ion through liquid water involves the simultaneous motion of ~7 surrounding water molecules, considerably less than previously reported for the proton. © 2011 American Institute of Physics
A Classical Potential to Model the Adsorption of Biological Molecules on Oxidized Titanium Surfaces.
Schneider, Julian; Ciacchi, Lucio Colombi
2011-02-08
The behavior of titanium implants in physiological environments is governed by the thin oxide layer that forms spontaneously on the metal surface and mediates the interactions with adsorbate molecules. In order to study the adsorption of biomolecules on titanium in a realistic fashion, we first build up a model of an oxidized Ti surface in contact with liquid water by means of extensive first-principles molecular dynamics simulations. Taking the obtained structure as reference, we then develop a classical potential to model the Ti/TiOx/water interface. This is based on the mapping with Coulomb and Lennard-Jones potentials of the adsorption energy landscape of single water and ammonia molecules on the rutile TiO2(110) surface. The interactions with arbitrary organic molecules are obtained via standard combination rules to established biomolecular force fields. The transferability of our potential to the case of organic molecules adsorbing on the oxidized Ti surface is checked by comparing the classical potential energy surfaces of representative systems to quantum mechanical results at the level of density functional theory. Moreover, we calculate the heat of immersion of the TiO2 rutile surface and the detachment force of a single tyrosine residue from steered molecular dynamics simulations, finding good agreement with experimental reference data in both cases. As a first application, we study the adsorption behavior of the Arg-Gly-Asp (RGD) peptide on the oxidized titanium surface, focusing particularly on the calculation of the free energy of desorption.
Concerted orientation induced unidirectional water transport through nanochannels.
Wan, Rongzheng; Lu, Hangjun; Li, Jinyuan; Bao, Jingdong; Hu, Jun; Fang, Haiping
2009-11-14
The dynamics of water inside nanochannels is of great importance for biological activities as well as for the design of molecular sensors, devices, and machines, particularly for sea water desalination. When confined in specially sized nanochannels, water molecules form a single-file structure with concerted dipole orientations, which collectively flip between the directions along and against the nanotube axis. In this paper, by using molecular dynamics simulations, we observed a net flux along the dipole-orientation without any application of an external electric field or external pressure difference during the time period of the particular concerted dipole orientations of the molecules along or against the nanotube axis. We found that this unique special-directional water transportation resulted from the asymmetric potential of water-water interaction along the nanochannel, which originated from the concerted dipole orientation of the water molecules that breaks the symmetry of water orientation distribution along the channel within a finite time period. This finding suggests a new mechanism for achieving high-flux water transportation, which may be useful for nanotechnology and biological applications.
The interaction of CsCl with films of solid water
Borodin, A; Krischok, S; Kempter, V
2003-01-01
The interaction of CsCl molecules with films of solid water (three layers thick, typically), deposited on a tungsten crystal at 130 K, was studied. Metastable impact electron spectroscopy (MIES) and UPS(HeI) were applied to study the emission from Cl3p and Cs5p and the highest occupied states 1b sub 1 , 3a sub 1 and 1b sub 2 of molecular water. Below a critical stoichiometry of about CsCl centre dot nH sub 2 O with n=6 the UPS spectra are quite similar to those from chlorides solvated in liquid water in as much as the relative positions and intensities of the water and salt features are concerned; very little emission from the ionization of Cl3p and Cs5p is observed with MIES. We conclude that the CsCl molecules become solvated in the water film. As long as n>6, the water spectrum remains characteristic for condensed water; at n6, water molecules not involved directly into the hydration of the salt molecules desorb around 140 K. Around 160 K all water has disappeared from the surface. Above this temperature o...
Ultra-cold molecule production
International Nuclear Information System (INIS)
Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.
2005-01-01
The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled
International Nuclear Information System (INIS)
Tsuji, T.
1986-01-01
Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra
International Nuclear Information System (INIS)
Otsuka, Ichiro; Yaoita, Masashi; Higano, Michi; Nagashima, Seiiichi; Kataoka, Ryoichi
2004-01-01
We have investigated a surface-induced unfolding dynamics of a single glucose oxidase (GO) molecule on Au(1 1 1) in air-saturated water, using tapping mode atomic force microscopy (TMAFM). We followed the unfolding process by measuring the maximum height of a well-isolated GO molecule on a terrace near a step-edge of the surface as a function of contact time. We find three linear portions with two intersections in a power-law fit to the selected values of the observed heights. The kinetic TMAFM result implies that there exist at least two distinct dynamic regimes in the unfolding
Probing Interfacial Water on Nanodiamonds in Colloidal Dispersion.
Petit, Tristan; Yuzawa, Hayato; Nagasaka, Masanari; Yamanoi, Ryoko; Osawa, Eiji; Kosugi, Nobuhiro; Aziz, Emad F
2015-08-06
The structure of interfacial water layers around nanoparticles dispersed in an aqueous environment may have a significant impact on their reactivity and on their interaction with biological species. Using transmission soft X-ray absorption spectroscopy in liquid, we demonstrate that the unoccupied electronic states of oxygen atoms from water molecules in aqueous colloidal dispersions of nanodiamonds have a different signature than bulk water. X-ray absorption spectroscopy can thus probe interfacial water molecules in colloidal dispersions. The impacts of nanodiamond surface chemistry and concentration on interfacial water electronic signature are discussed.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...
Directory of Open Access Journals (Sweden)
Minghong Liu
2010-01-01
Full Text Available The deacylation of glucose, galactose and mannose pentaacetates, galactose and mannose penta(3-bromobenzoates, as well as the dealkylation of 2,3,4,6-tetra-O-acetyl and 2,3,4,6-tetra-O-(3-bromobenzoyl methyl α-D-glucopyranosides have been studied. In addition, a computational study on the deacylation of β-D-glucose pentaacetate has been carried out with density functional theory (B3LYP/6-31G*. The anomeric effect during deacetylation and dealkylation has been clearly demonstrated in both experimental and computational results.
Adhesion of Model Molecules to Metallic Surfaces, the Implications for Corrosion Protection
International Nuclear Information System (INIS)
De Wit, J. H. W.; Van den Brand, J.; De Wit, F. M.; Mol, J. M. C.
2008-01-01
The majority of the described experimental results deal with relatively pure aluminium. Variations were made in the pretreatment of the aluminum substrates and an investigation was performed on the resulting changes in oxide layer composition and chemistry. Subsequently, the bonding behavior of the surfaces was investigated by using model adhesion molecules. These molecules were chosen to represent the bonding functionality of an organic polymer. They were applied onto the pretreated surfaces as a monolayer and the bonding behavior was studied using infrared reflection absorption spectroscopy. A direct and clear relation was found between the hydroxyl fraction on the oxide surfaces and the amount of molecules that subsequently bonded to the surface. Moreover, it was found that most bonds between the oxide surface and organic functional groups are not stable in the presence of water. The best performance was obtained using molecules, which are capable of chemisorption with the oxide surface. Finally, it was found that freshly prepared relatively pure aluminum substrates, which are left in air, rapidly lose their bonding capacity towards organic functional groups. This can be attributed to the adsorption of contamination and water to the oxide surface. in addition the adhesion of a typical epoxy-coated aluminum system was investigated during exposure to water at different temperatures. The coating was found to quite rapidly lose its adhesion upon exposure to water. This rapid loss of adhesion corresponds well with the data where it was demonstrated that the studied epoxy coating only bonds through physisorptive hydrogen bonding, these bonds not being stable in the presence of water. After the initial loss the adhesion of the coating was however found to recover again and even exceeded the adhesion prior to exposure. The improvement could be ascribed to the growth of a thin oxyhydroxide layer on the aluminum substrate, which forms a new, water-stable and stronger bond
Interfacial behavior of alkaline protease at the air-water and oil-water interfaces
Zhang, Jian; Li, Yanyan; Wang, Jing; Zhang, Yue
2018-03-01
The interfacial behavior of alkaline protease at the air-water and n-hexane-water interfaces was investigated using interfacial tension, dilatational rheology and dynamic light scattering. Additionally, different adsorption models which are Langmuir, Frumkin, Reorientation-A and Reorientation-R were used to fitting the data of equilibrium interfacial tension for further understanding the interfacial behavior of alkaline protease. Data fitting of the equilibrium interfacial tension was achieved by IsoFit software. The results show that the molecules arrangement of the alkaline protease at the n-hexane-water interface is more tightly than at the air-water interface. The data were further analyzed to indicate that the hydrophobic chains of alkaline protease penetrate into oil phase deeper than the air phase. Also data indicate that the electrostatic interactions and hydrophobic interactions at the n-hexane-water interface are stronger than at the air-water interface within molecules of the alkaline protease. Based on comprehensive analysis of the adsorption kinetics and interfacial rheological properties, interfacial structures mechanism of alkaline protease at n-hexane-water and air-water interfaces was proposed.
Langmuir- Blodgett layers of amphiphilic molecules investigated by Atomic Force Microscopy
Zdravkova, Aneliya Nikolova
2007-01-01
Langmuir - Blodgett technique and Atomic Force Microscopy were used to study the phase behaviour of organic molecules (fatty alcohols and monoacid saturated triglycerides) at air-water and air-solid interfaces. The structure of binary mixed LB monolayers of fatty alcohols was reported. The
Wojciechowski, Kamil; Orczyk, Marta; Marcinkowski, Kuba; Kobiela, Tomasz; Trapp, Marcus; Gutberlet, Thomas; Geue, Thomas
2014-05-01
Adsorption of a natural glycoside surfactant Quillaja bark saponin ("QBS", Sigma Aldrich 84510) was studied at the air/water and Si/water interfaces using a combination of surface pressure (SP), surface dilatational rheology, neutron reflectivity (NR), Infra-Red Attenuated Total Reflection Spectroscopy (IR ATR) and Quartz Crystal Microbalance (QCM). The adsorbed layers formed at the air/water interface are predominantly elastic, with the dilatational surface storage modulus reaching the maximum value of E'=184 mN/m. The NR results point to a strong hydration of the adsorbed layers (about 65% hydration, corresponding to about 60 molecules of water per one QBS molecule), most likely related to the presence of multiple sugar groups constituting the glycone part of the QBS molecules. With a layer thickness of 19 Å, the adsorbed amount obtained from NR seems largely underestimated in comparison to the value obtained from the surface tension isotherm. While this high extent of hydration does not prevent formation of dense and highly elastic layers at the air-water surface, QBS adsorption at the Si/water interface is much weaker. The adsorption isotherm of QBS on Si obtained from the QCM study reflects much lower affinity of highly hydrated and negatively charged saponin molecules to the Si/water interface. We postulate that at the air/water interface, QBS adsorbs through the triterpene aglycone moiety. In contrast, weak hydrogen bonding between the glycone part and the surface silanol groups of Si is responsible for QBS adsorption on more polar Si/water interface. Copyright © 2014 Elsevier B.V. All rights reserved.
Production of heavy water by photodesorption
International Nuclear Information System (INIS)
Gangwer, T.; Goldstein, M.K.
1976-01-01
Research has recently brought attention to the laser as a tool for isotope enrichment. So far the main thrust of this effort has been toward uranium enrichment; however, numerous successes in other areas have been demonstrated. Isotopes of boron, sulfur, chlorine, and carbon have been separated. A new technique is proposed for laser isotope enrichment. The technique, referred to as photodesorption, involves selective isotopic excitation of molecules adsorbed on a surface such that an enrichment results from subsequent physical or chemical events undergone by the excited molecules. The specific processes of concern are the physical photodesorption enrichment of heavy water from light water and tritiated water from heavy water. The ability to work directly with water molecules has significant advantages for a commercial process. A photodesorption enrichment process has been forumulated and some analyses have been performed. This process is described and some preliminary cost estimates are made which assume successful accomplishment of the major R and D objectives of the new process. The results indicate that the process has the promise of a significant reduction in the cost of heavy water and that further study is warranted
Biswas, Biswajit; Singh, Prashant Chandra
2015-11-11
The effect of hydration on the fluorine free organo-noble gas compound HKrCCH and the role of krypton in the stabilization of the hydrated HKrCCH complexes have been investigated using the quantum chemical calculations on the HKrCCH-(H2O)n=1-6 clusters. Structure and energetics calculations show that water stabilizes HKrCCH through the π hydrogen bond in which the OH group of water interacts with the C[triple bond, length as m-dash]C group of HKrCCH. A maximum of four water molecules can directly interact with the C[triple bond, length as m-dash]C of HKrCCH and after that only inter-hydrogen bonding takes place between the water molecules indicating that the primary hydration shell contains four water molecules. Atom in molecule analysis depicts that π hydrogen bonded complexes of the hydrated HKrCCH are cyclic structures in which the OKr interaction cooperates in the formation of strong O-HC[triple bond, length as m-dash]C interaction. Structure, energetics and charge analysis clearly established that krypton plays an important role in the stabilization as well as the formation of the primary hydration shell of hydrated HKrCCH complexes.
Formation of Ultracold Molecules
Energy Technology Data Exchange (ETDEWEB)
Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)
2016-01-28
Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.
Water states and types of water in materials from different argillaceous formations
International Nuclear Information System (INIS)
Fernandez, A.M.; Melon, A.
2010-01-01
Document available in extended abstract form only. Depending of their structure and degree of compaction, clays can be hydrated by a variable amount of water molecules in the inter-lamellar space and on external surfaces. Due to the fact that the structure and nature of water molecules (properties of liquid water) is influenced by the clay surfaces; different types of waters are involved in clayey systems (internal/external water, adsorbed/free water) giving a double porosity structure. The water volume accessible to ions is a key parameter in order to determine the pore water chemistry affecting the radionuclide transport in clay-rocks. In the case of argillaceous formations, natural consolidation induces significant physical and structural changes to clays as a function of time, leading to a progressive compaction and agglomeration of particles, reduction of crystallinity and an increase of micro-strain, which affects both the tetrahedral and octahedral layers. Structure and dynamics of water are modified when water molecules are close to interfaces or confined in porous spaces. At high degrees of compaction, the diffusive transport of the solvated ions and the solvent molecules in clays is substantially retarded compared with the free electrolyte solution because of the surface complexation of ions and the strong ordering of solvent molecules at the solid-liquid interface. Besides, mud-rocks contain a variable amount of different types of clays, such as illite, kaolinite, chlorites, smectite and illite/smectite mixed layers; as well as other main and accessory minerals which influence also the amount of water adsorbed and types of waters in these systems. Structural and dynamic properties of water confined among basal planes of clays have been extensively studied by means of water adsorption isotherms, neutron scattering, molecular dynamics (MD) and Monte- Carlo simulations. However, most of the works are related to purified clays and dispersed systems. In real
Rudberg, Elias
2012-02-01
Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals.
International Nuclear Information System (INIS)
Rudberg, Elias
2012-01-01
Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals. (fast track communication)
Solvation structures of lithium halides in methanol–water mixtures
International Nuclear Information System (INIS)
Sarkar, Atanu; Dixit, Mayank Kumar; Tembe, B.L.
2015-01-01
Highlights: • Potentials of mean force for Li + -halides are calculated in methanol–water mixtures. • Stable CIP for x methanol = 1.0 becomes unstable at and below x methanol = 0.75. • The Li + ion is preferentially solvated by methanol molecules. • The halide ions are preferentially solvated by water molecules. - Abstract: The potentials of mean force (PMFs) for the ion pairs, Li + −Cl − , Li + −Br − and Li + −I − have been calculated in five methanol–water compositions. The results obtained are verified by trailing the trajectories and calculating the ion pair distance residence times. Local structures around the ions are studied using the radial distribution functions, density profiles, orientational correlation functions, running coordination numbers and excess coordination numbers. The major change in PMF is observed as the methanol mole fraction (x methanol ) is changed from 1.0 to 0.75. The stable contact ion pair occurring for x methanol = 1.0 becomes unstable at and below x methanol = 0.75. The preferential solvation data show that the halide ions are always preferentially solvated by water molecules. Although the lithium ion is preferentially solvated by methanol molecules, there is significant affinity towards water molecules as well
Exotic helium molecules; Molecules exotiques d'helium
Energy Technology Data Exchange (ETDEWEB)
Portier, M
2007-12-15
We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)
Flores, Mario E; Shibue, Toshimichi; Sugimura, Natsuhiko; Nishide, Hiroyuki; Moreno-Villoslada, Ignacio
2017-11-09
Upon titration of n-hexanol/cyclohexane mixtures of different molar compositions with water, water/n-hexanol clusters are formed in cyclohexane. Here, we develop a new method to estimate the water and n-hexanol aggregation numbers in the clusters that combines integration analysis in one-dimensional 1 H NMR spectra, diffusion coefficients calculated by diffusion-ordered NMR spectroscopy, and further application of the Stokes-Einstein equation to calculate the hydrodynamic volume of the clusters. Aggregation numbers of 5-15 molecules of n-hexanol per cluster in the absence of water were observed in the whole range of n-hexanol/cyclohexane molar fractions studied. After saturation with water, aggregation numbers of 6-13 n-hexanol and 0.5-5 water molecules per cluster were found. O-H and O-O atom distances related to hydrogen bonds between donor/acceptor molecules were theoretically calculated using density functional theory. The results show that at low n-hexanol molar fractions, where a robust hydrogen-bond network is held between n-hexanol molecules, addition of water makes the intermolecular O-O atom distance shorter, reinforcing molecular association in the clusters, whereas at high n-hexanol molar fractions, where dipole-dipole interactions dominate, addition of water makes the intermolecular O-O atom distance longer, weakening the cluster structure. This correlates with experimental NMR results, which show an increase in the size and aggregation number in the clusters upon addition of water at low n-hexanol molar fractions, and a decrease of these magnitudes at high n-hexanol molar fractions. In addition, water produces an increase in the proton exchange rate between donor/acceptor molecules at all n-hexanol molar fractions.
International Nuclear Information System (INIS)
Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN
1994-06-01
This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)
Electron-induced hydrogen loss in uracil in a water cluster environment
International Nuclear Information System (INIS)
Smyth, M.; Kohanoff, J.; Fabrikant, I. I.
2014-01-01
Low-energy electron-impact hydrogen loss due to dissociative electron attachment (DEA) to the uracil and thymine molecules in a water cluster environment is investigated theoretically. Only the A ′ -resonance contribution, describing the near-threshold behavior of DEA, is incorporated. Calculations are based on the nonlocal complex potential theory and the multiple scattering theory, and are performed for a model target with basic properties of uracil and thymine, surrounded by five water molecules. The DEA cross section is strongly enhanced when the attaching molecule is embedded in a water cluster. This growth is due to two effects: the increase of the resonance lifetime and the negative shift in the resonance position due to interaction of the intermediate negative ion with the surrounding water molecules. A similar effect was earlier found in DEA to chlorofluorocarbons
Strategy to discover diverse optimal molecules in the small molecule universe.
Rupakheti, Chetan; Virshup, Aaron; Yang, Weitao; Beratan, David N
2015-03-23
The small molecule universe (SMU) is defined as a set of over 10(60) synthetically feasible organic molecules with molecular weight less than ∼500 Da. Exhaustive enumerations and evaluation of all SMU molecules for the purpose of discovering favorable structures is impossible. We take a stochastic approach and extend the ACSESS framework ( Virshup et al. J. Am. Chem. Soc. 2013 , 135 , 7296 - 7303 ) to develop diversity oriented molecular libraries that can generate a set of compounds that is representative of the small molecule universe and that also biases the library toward favorable physical property values. We show that the approach is efficient compared to exhaustive enumeration and to existing evolutionary algorithms for generating such libraries by testing in the NKp fitness landscape model and in the fully enumerated GDB-9 chemical universe containing 3 × 10(5) molecules.
Gormly, Sherwin J. (Inventor); Flynn, Michael T. (Inventor)
2010-01-01
Method and system for processing of a liquid ("contaminant liquid") containing water and containing urine and/or other contaminants in a two step process. Urine, or a contaminated liquid similar to and/or containing urine and thus having a relatively high salt and urea content is passed through an activated carbon filter to provide a resulting liquid, to remove most of the organic molecules. The resulting liquid is passed through a semipermeable membrane from a membrane first side to a membrane second side, where a fortified drink having a lower water concentration (higher osmotic potential) than the resulting liquid is positioned. Osmotic pressure differential causes the water, but not most of the remaining inorganic (salts) contaminant(s) to pass through the membrane to the fortified drink. Optionally, the resulting liquid is allowed to precipitate additional organic molecules before passage through the membrane.
New measurements on water ice photodesorption and product formation under ultraviolet irradiation
Cruz-Diaz, Gustavo A.; Martín-Doménech, Rafael; Moreno, Elena; Muñoz Caro, Guillermo M.; Chen, Yu-Jung
2018-03-01
The photodesorption of icy grain mantles has been claimed to be responsible for the abundance of gas-phase molecules towards cold regions. Being water a ubiquitous molecule, it is crucial to understand its role in photochemistry and its behaviour under an ultraviolet field. We report new measurements on the ultraviolet (UV) photodesorption of water ice and its H2, OH, and O2 photoproducts using a calibrated quadrupole mass spectrometer. Solid water was deposited under ultra-high-vacuum conditions and then UV-irradiated at various temperatures starting from 8 K with a microwave discharged hydrogen lamp. Deuterated water was used for confirmation of the results. We found a photodesorption yield of 1.3 × 10-3 molecules per incident photon for water and 0.7 × 10-3 molecules per incident photon for deuterated water at the lowest irradiation temperature, 8 K. The photodesorption yield per absorbed photon is given and comparison with astrophysical scenarios, where water ice photodesorption could account for the presence of gas-phase water towards cold regions in the absence of a thermal desorption process, is addressed.
Directory of Open Access Journals (Sweden)
Shigeto Nakashima
2011-11-01
Full Text Available We investigated the effect of the environment on the electrical conductance of a single benzene-1,4-diamine (BDA molecule bridging Au electrodes, using the scanning tunneling microscope (STM. The conductance of the single BDA molecule junction decreased upon a change in the environment from tetraglyme, to mesitylene, to water, and finally to N2 gas, while the spread in the conductance value increased. The order of the conductance values of the single BDA molecule junction was explained by the strength of the interaction between the solvent molecules and the Au electrodes. The order of the spread in the conductance values was explained by the diversity in the coverage of the BDA molecule at metal electrodes and atomic and molecular motion of the single-molecule junction.
Interaction of Caffeine Molecular Associates with Water: Theory and Experiment
Shestopalova, Anna V.
1990-01-01
Results of a Monte Carlo simulation of the association process of caffeine (1,3,7-trimethyl-2,6-dioxipurine) in water are presented. Simulation was performed in a cluster approximation ; the system contained 200 water molecules. The nature of the stabilization of caffeine stacking associates in water was considered. Hydrophobic behaviour of methyl group s during association of caffeine molecules in water is shown. The peculiarity of interaction of caffeine associates with wa...
Thermodynamic properties of water solvating biomolecular surfaces
Heyden, Matthias
Changes in the potential energy and entropy of water molecules hydrating biomolecular interfaces play a significant role for biomolecular solubility and association. Free energy perturbation and thermodynamic integration methods allow calculations of free energy differences between two states from simulations. However, these methods are computationally demanding and do not provide insights into individual thermodynamic contributions, i.e. changes in the solvent energy or entropy. Here, we employ methods to spatially resolve distributions of hydration water thermodynamic properties in the vicinity of biomolecular surfaces. This allows direct insights into thermodynamic signatures of the hydration of hydrophobic and hydrophilic solvent accessible sites of proteins and small molecules and comparisons to ideal model surfaces. We correlate dynamic properties of hydration water molecules, i.e. translational and rotational mobility, to their thermodynamics. The latter can be used as a guide to extract thermodynamic information from experimental measurements of site-resolved water dynamics. Further, we study energy-entropy compensations of water at different hydration sites of biomolecular surfaces. This work is supported by the Cluster of Excellence RESOLV (EXC 1069) funded by the Deutsche Forschungsgemeinschaft.
Electric Field Fluctuations in Water
Thorpe, Dayton; Limmer, David; Chandler, David
2013-03-01
Charge transfer in solution, such as autoionization and ion pair dissociation in water, is governed by rare electric field fluctuations of the solvent. Knowing the statistics of such fluctuations can help explain the dynamics of these rare events. Trajectories short enough to be tractable by computer simulation are virtually certain not to sample the large fluctuations that promote rare events. Here, we employ importance sampling techniques with classical molecular dynamics simulations of liquid water to study statistics of electric field fluctuations far from their means. We find that the distributions of electric fields located on individual water molecules are not in general gaussian. Near the mean this non-gaussianity is due to the internal charge distribution of the water molecule. Further from the mean, however, there is a previously unreported Bjerrum-like defect that stabilizes certain large fluctuations out of equilibrium. As expected, differences in electric fields acting between molecules are gaussian to a remarkable degree. By studying these differences, though, we are able to determine what configurations result not only in large electric fields, but also in electric fields with long spatial correlations that may be needed to promote charge separation.
In silico studies of the properties of water hydrating a small protein
International Nuclear Information System (INIS)
Sinha, Sudipta Kumar; Chakraborty, Kausik; Bandyopadhyay, Sanjoy; Jana, Madhurima
2014-01-01
Atomistic molecular dynamics simulation of an aqueous solution of the small protein HP-36 has been carried out with explicit solvent at room temperature. Efforts have been made to explore the influence of the protein on the relative packing and ordering of water molecules around its secondary structures, namely, three α-helices. The calculations reveal that the inhomogeneous water ordering and density distributions around the helices are correlated with their relative hydrophobicity. Importantly, we have identified the existence of a narrow relatively dehydrated region containing randomly organized “quasi-free” water molecules beyond the first layer of “bound” waters at the protein surface. These water molecules with relatively weaker binding energies form the transition state separating the “bound” and “free” water molecules at the interface. Further, increased contribution of solid-like caging motions of water molecules around the protein is found to be responsible for reduced fluidity of the hydration layer. Interestingly, we notice that the hydration layer of helix-3 is more fluidic with relatively higher entropy as compared to the hydration layers of the other two helical segments. Such characteristics of helix-3 hydration layer correlate well with the activity of HP-36, as helix-3 contains the active site of the protein
In silico studies of the properties of water hydrating a small protein
Energy Technology Data Exchange (ETDEWEB)
Sinha, Sudipta Kumar; Chakraborty, Kausik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur - 721302 (India); Jana, Madhurima [Molecular Simulation Laboratory, Department of Chemistry, National Institute of Technology, Rourkela - 769008 (India)
2014-12-14
Atomistic molecular dynamics simulation of an aqueous solution of the small protein HP-36 has been carried out with explicit solvent at room temperature. Efforts have been made to explore the influence of the protein on the relative packing and ordering of water molecules around its secondary structures, namely, three α-helices. The calculations reveal that the inhomogeneous water ordering and density distributions around the helices are correlated with their relative hydrophobicity. Importantly, we have identified the existence of a narrow relatively dehydrated region containing randomly organized “quasi-free” water molecules beyond the first layer of “bound” waters at the protein surface. These water molecules with relatively weaker binding energies form the transition state separating the “bound” and “free” water molecules at the interface. Further, increased contribution of solid-like caging motions of water molecules around the protein is found to be responsible for reduced fluidity of the hydration layer. Interestingly, we notice that the hydration layer of helix-3 is more fluidic with relatively higher entropy as compared to the hydration layers of the other two helical segments. Such characteristics of helix-3 hydration layer correlate well with the activity of HP-36, as helix-3 contains the active site of the protein.
Electron-induced hydrogen loss in uracil in a water cluster environment
Energy Technology Data Exchange (ETDEWEB)
Smyth, M.; Kohanoff, J. [Atomistic Simulation Centre, Queen' s University Belfast, Belfast BT7 1NN, Northern Ireland (United Kingdom); Fabrikant, I. I., E-mail: ifabrikant1@unl.edu [Department of Physics and Astronomy, University of Nebraska, Lincoln, Nebraska 68588, USA and Department of Physical Sciences, The Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom)
2014-05-14
Low-energy electron-impact hydrogen loss due to dissociative electron attachment (DEA) to the uracil and thymine molecules in a water cluster environment is investigated theoretically. Only the A{sup ′}-resonance contribution, describing the near-threshold behavior of DEA, is incorporated. Calculations are based on the nonlocal complex potential theory and the multiple scattering theory, and are performed for a model target with basic properties of uracil and thymine, surrounded by five water molecules. The DEA cross section is strongly enhanced when the attaching molecule is embedded in a water cluster. This growth is due to two effects: the increase of the resonance lifetime and the negative shift in the resonance position due to interaction of the intermediate negative ion with the surrounding water molecules. A similar effect was earlier found in DEA to chlorofluorocarbons.
Bahrami, Homayoon; Zahedi, Mansour; Moosavi-Movahedi, Ali Akbar; Azizian, Homa; Amanlou, Massoud
2011-03-01
The nature of protein-sorbitol-water interaction in solution at the molecular level, has been investigated using molecular dynamics simulations. In order to do this task, two molecular dynamics simulations of the protein ADH in solution at room temperature have been carried out, one in the presence (about 0.9 M) and another in the absence of sorbitol. The results show that the sorbitol molecules cluster and move toward the protein, and form hydrogen bonds with protein. Also, coating by sorbitol reduces the conformational fluctuations of the protein compared to the sorbitol-free system. Thus, it is concluded that at moderate concentration of sorbitol solution, sorbitol molecules interact with ADH via many H-bonds that prevent the protein folding. In fact, at more concentrated sorbitol solution, water and sorbitol molecules accumulate around the protein surface and form a continuous space-filling network to reduce the protein flexibility. Namely, in such solution, sorbitol molecules can stabilize a misfolded state of ADH, and prevent the protein from folding to its native structure.
The solvation of carbohydrates in dimethylsulfoxide and water
International Nuclear Information System (INIS)
Berger, S.; Diaz, M.D.; Horwat, Ch.
1999-01-01
The solvation of sucrose and other carbohydrates in DMSO and water is probed by intermolecular NOE measurements. The NOE effects are interpreted in terms of specific binding of the solvent to certain sites of the molecules. It is shown that DMSO attaches to specific sites of the sucrose molecule, whereas for water such a clear differentiation cannot be proven. (author)
Dynamics of Activated Molecules
Energy Technology Data Exchange (ETDEWEB)
Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)
2016-11-16
Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.
Solvated protein-protein docking using Kyte-Doolittle-based water preferences
Kastritis, P.; Visscher, K.M.; van Dijk, A.D.J.; Bonvin, A.M.J.J.
2013-01-01
HADDOCK is one of the few docking programs that can explicitly account for water molecules in the docking process. Its solvated docking protocol starts from hydrated molecules and a fraction of the resulting interfacial waters is subsequently removed in a biased Monte Carlo procedure based on
Solvated protein-protein docking using Kyte-Doolittle-based water preferences
Kastritis, Panagiotis L.; Visscher, Koen M.; van Dijk, Aalt D.J.; Bonvin, Alexandre M.J.J.
HADDOCK is one of the few docking programs that can explicitly account for water molecules in the docking process. Its solvated docking protocol starts from hydrated molecules and a fraction of the resulting interfacial waters is subsequently removed in a biased Monte Carlo procedure based on
Where's water? The many binding sites of hydantoin.
Gruet, Sébastien; Pérez, Cristóbal; Steber, Amanda L; Schnell, Melanie
2018-02-21
Prebiotic hydantoin and its complexes with one and two water molecules are investigated using high-resolution broadband rotational spectroscopy in the 2-8 GHz frequency range. The hyperfine structure due to the nuclear quadrupole coupling of the two 14 N atoms is analysed for the monomer and the complexes. This characteristic hyperfine structure will support a definitive assignment from low frequency radioastronomy data. Experiments with H 2 18 O provide accurate experimental information on the preferred binding sites of water, which are compared with quantum-chemically calculated coordinates. In the 2-water complexes, the water molecules bind to hydantoin as a dimer instead of individually, indicating the strong water-water interactions. This information provides first insight on how hydantoin interacts with water on the molecular level.
Water distribution function across the curved lipid bilayer: SANS study
International Nuclear Information System (INIS)
Kiselev, M.A.; Zemlyanaya, E.V.; Ryabova, N.Y.; Hauss, T.; Dante, S.; Lombardo, D.
2008-01-01
The neutron scattering length density across the membrane is simulated on the basis of fluctuated model of lipid bilayer. The use of a separated form factors method has been applied for the identification of the structural features of the polydispersed unilamellar DMPC vesicle system. The hydration of vesicle is described by sigmoid distribution function of the water molecules. The application of the model to the obtained SANS spectra allow the determination of the main parameters of the system, such as the average vesicle radius (and its polydispersity), the membrane thickness, the thickness of hydrocarbon chain region, the number of water molecules located per lipid molecule, and the phospholipid surface area. Moreover the approach allow the calculation of some relevant parameters connected with the water distribution function across the bilayer system. The main features of the obtained results furnish an explanation of why lipid membrane is easily penetrated by the water molecules of the solution
AGOA: A Hydration Procedure and Its Application to the 1-Phenyl-beta-Carboline Molecule
Hernandes, Marcelo Z.; Silva, João B. P. da; Longo, Ricardo L.
2002-01-01
A new procedure, named AGOA, has been developed and implemented in a computer program written in FORTRAN 77 to explore the hydration structures of polar solutes using its molecular electrostatic potential (MEP). This procedure can be generalized to polar solvents other than water. It has been tested for several small molecules, and applied to complex molecules of pharmacological interest, such as the beta-carbolinic systems derived from indole. This is a stringent, but not general, test of th...
Melaminium nitrate–melamine–water (1/1/1
Directory of Open Access Journals (Sweden)
Farook Adam
2010-11-01
Full Text Available In the crystal structure of the title salt, C3H7N6+·NO3−·C3H6N6·H2O, the asymmetric unit consists of two neutral melamine (1,3,5-triazine-2,4,6-triamine molecules, two melaminium cations, two nitrate anions and two solvent water molecules. One of the nitrate anions is disordered over two sets of positions, with a refined occupancy ratio of 0.909 (3:0.091 (3. The cations and neutral molecules are approximately planar, with maximum deviations of 0.018 (2, 0.024 (2, 0.019 (2 and 0.007 (2 Å for each, respectively. In the crystal structure, melaminium cations and netural melamine molecules self-assemble via N—H...N hydrogen bonds to form a supramolecular hexagonal-shaped motif. In addition, the nitrate anions and water molecules are connected by N—H...O hydrogen bonds to form a three-dimensional network.
Directory of Open Access Journals (Sweden)
Mukosha Lloyd
2015-01-01
Full Text Available The environmental discharge of inefficiently treated waste solutions of the strong biocide glutaraldehyde (GA from hospitals has potential toxic impact on aquatic organisms. The adsorption characteristics of mixed polarized monomeric and polymeric molecules of GA from water on mesoporous acid-amine modified low-cost activated carbon (AC were investigated. It was found that the adsorption strongly depended on pH and surface chemistry. In acidic pH, the adsorption mechanism was elaborated to involve chemical sorption of mainly hydroxyl GA monomeric molecules on acidic surface groups, while in alkaline pH, the adsorption was elaborated to involve both chemical and physical sorption of GA polymeric forms having mixed functional groups (aldehyde, carboxyl, and hydroxyl on acidic and amine surface groups. The optimum pH of adsorption was about 12 with significant contribution by cooperative adsorption, elucidated in terms of hydrogen bonding and aldol condensation. Freundlich and Dubinin-Radushkevich models were fitted to isotherm data. The adsorption kinetics was dependent on initial concentration and temperature and described by the Elovich model. The adsorption was endothermic, while the intraparticle diffusion model suggested significant contribution by film diffusion. The developed low-cost AC could be used to supplement the GA alkaline deactivation process for efficient removal of residual GA aquatic toxicity.
Evaporation of tiny water aggregation on solid surfaces with different wetting properties.
Wang, Shen; Tu, Yusong; Wan, Rongzheng; Fang, Haiping
2012-11-29
The evaporation of a tiny amount of water on the solid surface with different wettabilities has been studied by molecular dynamics simulations. From nonequilibrium MD simulations, we found that, as the surface changed from hydrophobic to hydrophilic, the evaporation speed did not show a monotonic decrease as intuitively expected, but increased first, and then decreased after it reached a maximum value. The analysis of the simulation trajectory and calculation of the surface water interaction illustrate that the competition between the number of water molecules on the water-gas surface from where the water molecules can evaporate and the potential barrier to prevent those water molecules from evaporating results in the unexpected behavior of the evaporation. This finding is helpful in understanding the evaporation on biological surfaces, designing artificial surfaces of ultrafast water evaporating, or preserving water in soil.
International Nuclear Information System (INIS)
Shimamura, I.; Takayanagi, K.
1984-01-01
The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry
Bound states of water in gelatin discriminated by near-infrared spectroscopy
Otsuka, Yukiko; Shirakashi, Ryo; Hirakawa, Kazuhiko
2017-11-01
By near-infrared spectroscopy, we classified water molecules in hydrated gelatin membranes in a drying process. Absorbance spectra in the frequency range of 4500-5500 cm-1 were resolved into three peaks, S0, S1, and S2, that correspond to water molecules with different hydrogen bond states. From the areas of the absorbance peaks as a function of the water content of gelatin, together with the information on the freezing properties of water measured by differential scanning calorimetry, we found that, when the water content is less than 20%, free water disappears and only weakly and strongly bound waters remain. We also found that the weakly bound water consists of S0, S1, and S2 water molecules with a simple composition of \\text{S}0:\\text{S}1:\\text{S}2 ≈ 1:2:0. Using this information, most of the freezable water was determined to be free water. Our classification provides a simple method of estimating the retention and freezing properties of processed foods or drugs by infrared spectroscopy.
Exotic helium molecules; Molecules exotiques d'helium
Energy Technology Data Exchange (ETDEWEB)
Portier, M
2007-12-15
We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)
Equilibrium partitioning of drug molecules between aqueous and amino acid ester-based ionic liquids
International Nuclear Information System (INIS)
Jing, Jun; Li, Zhiyong; Pei, Yuanchao; Wang, Huiyong; Wang, Jianji
2013-01-01
Highlights: ► Partition coefficients of twelve drug molecules in ILs have been determined. ► The possible mechanism has been investigated from 13 C NMR measurements. ► Hydrophobic π–π interaction is the main driving force for the partitioning of drug molecules. -- Abstract: In this work, a series of novel room temperature ionic liquids (ILs) have been synthesized with cheap, naturally α-amino acid ester as cations and bis(trifluoromethylsulfonyl)imide as anion. The glass transition temperature and thermal decomposition temperature of these ILs, partition coefficients of some coumarins and purine alkaloids between water and the amino acid ester-based ILs at T = 298.15 K, and Gibbs energy, enthalpy and entropy changes for the transfer of caffeine and 6,7-dihydroxycoumarin from water to [LeuC 2 ][Tf 2 N] have been determined. It is shown that these ILs are highly effective materials for the extraction of drug compounds like coumarin, 4-hydroxycoumarin, 7-hydroxycoumarin, 3-aminocoumarin, coumarin-3-carboxylic acid, 6,7-dihydroxycoumarin, 6,7-dihydroxy-4-methylcoumarin, caffeine, theobromine, theophylline, inosine, and 2,6-diaminopurine. The partition process is driven by enthalpy term, and partition coefficients of the drug molecules increase with the increase of hydrophobicity of both the drug molecules and the ILs. Furthermore, the possible partition mechanism has been investigated from 13 C NMR measurements
Microfluidic Extraction of Biomarkers using Water as Solvent
Amashukeli, Xenia; Manohara, Harish; Chattopadhyay, Goutam; Mehdi, Imran
2009-01-01
A proposed device, denoted a miniature microfluidic biomarker extractor (mu-EX), would extract trace amounts of chemicals of interest from samples, such as soils and rocks. Traditionally, such extractions are performed on a large scale with hazardous organic solvents; each solvent capable of dissolving only those molecules lying within narrow ranges of specific chemical and physical characteristics that notably include volatility, electric charge, and polarity. In contrast, in the mu-EX, extractions could be performed by use of small amounts (typically between 0.1 and 100 L) of water as a universal solvent. As a rule of thumb, in order to enable solvation and extraction of molecules, it is necessary to use solvents that have polarity sufficiently close to the polarity of the target molecules. The mu-EX would make selection of specific organic solvents unnecessary, because mu-EX would exploit a unique property of liquid water: the possibility of tuning its polarity to match the polarity of organic solvents appropriate for extraction of molecules of interest. The change of the permittivity of water would be achieved by exploiting interactions between the translational states of water molecules and an imposed electromagnetic field in the frequency range of 300 to 600 GHz. On a molecular level, these interactions would result in disruption of the three-dimensional hydrogen-bonding network among liquid-water molecules and subsequent solvation and hydrolysis of target molecules. The mu-EX is expected to be an efficient means of hydrolyzing chemical bonds in complex macromolecules as well and, thus, enabling analysis of the building blocks of these complex chemical systems. The mu-EX device would include a microfluidic channel, part of which would lie within a waveguide coupled to an electronically tuned source of broad-band electromagnetic radiation in the frequency range from 300 to 600 GHz (see figure). The part of the microfluidic channel lying in the waveguide would
Perspective on the structure of liquid water
International Nuclear Information System (INIS)
Nilsson, A.; Pettersson, L.G.M.
2011-01-01
Graphical abstract: Liquid water can be described in a fluctuating inhomogeneous picture with two local structural motifs that are spatially separated. At ambient temperatures most molecules favor a closer packing than tetrahedral, with strongly distorted hydrogen bonds giving higher density (yellow), which allows the quantized librational modes to be excited and contribute to the entropy, but with enthalpically favored tetrahedrally bonded water patches appearing as fluctuations (blue), i.e. a competition between entropy and enthalpy. Upon cooling water the amount of molecules participating in tetrahedral structures and the size of the tetrahedral patches increase. Highlights: ► Two components maximizing either enthalpy (tetrahedral, low-density) or entropy (non-specific H-bonding, higher density). ► Interconvert discontinuously and ratio depends on temperature. ► Density fluctuations on 1 nm length scale. ► Increasing size in supercooled region. ► Connection to Widom line and 2nd critical point. - Abstract: We present a picture that combines discussions regarding the thermodynamic anomalies in ambient and supercooled water with recent interpretations of X-ray spectroscopy and scattering data of water in the ambient regime. At ambient temperatures most molecules favor a closer packing than tetrahedral, with strongly distorted hydrogen bonds, which allows the quantized librational modes to be excited and contribute to the entropy, but with enthalpically favored tetrahedrally bonded water patches appearing as fluctuations, i.e. a competition between entropy and enthalpy. Upon cooling water the amount of molecules participating in tetrahedral structures and the size of the tetrahedral patches increase. The two local structures are connected to the liquid–liquid critical point hypothesis in supercooled water corresponding to high density liquid and low density liquid. We will discuss the interpretation of X-ray absorption spectroscopy, X-ray emission
Wang, Dongqi; Böckmann, Anja; Dolenc, Jožica; Meier, Beat H; van Gunsteren, Wilfred F
2013-10-03
NMR experiments have shown that water molecules in the crystal of the protein Crh are still mobile at temperatures well below 273 K. In order to investigate this water anomaly, a molecular dynamics (MD) simulation study of crystalline Crh was carried out to determine the mobility of water in this crystal. The simulations were carried out at three temperatures, 150, 200, and 291 K. Simulations of bulk water at these temperatures were also done to obtain the properties of the simple point charge (SPC) water model used at these temperatures and to allow a comparison of the properties of water in the Crh crystal with those of bulk water at the same temperatures. According to the simulations, water is immobilized at 150 K both in crystal and in bulk water. As expected, at 291 K it diffuses and rotates more slowly in the protein crystal than in bulk water. However, at 200 K, the translational and rotational mobility of the water molecules is larger in the crystal than in bulk water. The enhancement of water mobility in the crystal at 200 K was further investigated by MD simulations in which the backbone or all protein atoms were positionally restrained, and in which additionally the electrostatic protein-water interactions were removed. Of these changes in the environment of the water molecules, rigidifying the protein backbones slightly enhanced water diffusion, while it slowed down rotation. In contrast, removal of electrostatic protein-water interactions did not change water diffusion but enhanced rotational motion significantly. Further investigations are required to delineate particular features of the protein crystal that induce the anomalous behavior of water at 200 K.
Water Dynamics in the Hydration Shells of Biomolecules
2017-01-01
The structure and function of biomolecules are strongly influenced by their hydration shells. Structural fluctuations and molecular excitations of hydrating water molecules cover a broad range in space and time, from individual water molecules to larger pools and from femtosecond to microsecond time scales. Recent progress in theory and molecular dynamics simulations as well as in ultrafast vibrational spectroscopy has led to new and detailed insight into fluctuations of water structure, elementary water motions, electric fields at hydrated biointerfaces, and processes of vibrational relaxation and energy dissipation. Here, we review recent advances in both theory and experiment, focusing on hydrated DNA, proteins, and phospholipids, and compare dynamics in the hydration shells to bulk water. PMID:28248491
Isotope separation using vibrationally excited molecules
International Nuclear Information System (INIS)
Woodroffe, J.A.; Keck, J.C.
1979-01-01
Vibrational excitation of molecules having components of a selected isotope type is used to produce a conversion from vibrational to translational excitation of the molecules by collision with the molecules of a heavy carrier gas. The resulting difference in translaton between the molecules of the selected isotope type and all other molecules of the same compound permits their separate collection. When applied to uranium enrichment, a subsonic cryogenic flow of molecules of uranium hexafluoride in combination with an argon carrier gas is directed through a cooled chamber that is illuminated by laser radiaton tuned to vibrationally excite the uranium hexafluoride molecules of a specific uranium isotope. The excited molecules collide with carrier gas molecules, causing a conversion of the excitation energy into a translation of the excited molecule, which results in a higher thermal energy or diffusivity than that of the other uranium hexafluoride molecules. The flowing molecules including the excited molecules directly enter a set of cryogenically cooled channels. The higher thermal velocity of the excited molecules increases the probability of their striking a collector surface. The molecules which strike this surface immediately condense. After a predetermined thickness of molecules is collected on the surface, the flow of uranium hexafluoride is interrupted and the chamber heated to the point of vaporization of the collected hexafluoride, permitting its removal. (LL)
The Roles of Water in the Protein Matrix: A Largely Untapped Resource for Drug Discovery.
Spyrakis, Francesca; Ahmed, Mostafa H; Bayden, Alexander S; Cozzini, Pietro; Mozzarelli, Andrea; Kellogg, Glen E
2017-08-24
The value of thoroughly understanding the thermodynamics specific to a drug discovery/design study is well known. Over the past decade, the crucial roles of water molecules in protein structure, function, and dynamics have also become increasingly appreciated. This Perspective explores water in the biological environment by adopting its point of view in such phenomena. The prevailing thermodynamic models of the past, where water was seen largely in terms of an entropic gain after its displacement by a ligand, are now known to be much too simplistic. We adopt a set of terminology that describes water molecules as being "hot" and "cold", which we have defined as being easy and difficult to displace, respectively. The basis of these designations, which involve both enthalpic and entropic water contributions, are explored in several classes of biomolecules and structural motifs. The hallmarks for characterizing water molecules are examined, and computational tools for evaluating water-centric thermodynamics are reviewed. This Perspective's summary features guidelines for exploiting water molecules in drug discovery.
Insight into the molecular mechanism of water evaporation via the finite temperature string method.
Musolino, Nicholas; Trout, Bernhardt L
2013-04-07
The process of water's evaporation at its liquid/air interface has proven challenging to study experimentally and, because it constitutes a rare event on molecular time scales, presents a challenge for computer simulations as well. In this work, we simulated water's evaporation using the classical extended simple point charge model water model, and identified a minimum free energy path for this process in terms of 10 descriptive order parameters. The measured free energy change was 7.4 kcal/mol at 298 K, in reasonable agreement with the experimental value of 6.3 kcal/mol, and the mean first-passage time was 1375 ns for a single molecule, corresponding to an evaporation coefficient of 0.25. In the observed minimum free energy process, the water molecule diffuses to the surface, and tends to rotate so that its dipole and one O-H bond are oriented outward as it crosses the Gibbs dividing surface. As the water molecule moves further outward through the interfacial region, its local density is higher than the time-averaged density, indicating a local solvation shell that protrudes from the interface. The water molecule loses donor and acceptor hydrogen bonds, and then, with its dipole nearly normal to the interface, stops donating its remaining hydrogen bond. At that point, when the final, accepted hydrogen bond is broken, the water molecule is free. We also analyzed which order parameters are most important in the process and in reactive trajectories, and found that the relative orientation of water molecules near the evaporating molecule, and the number of accepted hydrogen bonds, were important variables in reactive trajectories and in kinetic descriptions of the process.
DEFF Research Database (Denmark)
Bai, M.; Miskowiec, A.; Hansen, F. Y.
2012-01-01
High-energy-resolution quasielastic neutron scattering has been used to elucidate the diffusion of water molecules in proximity to single bilayer lipid membranes supported on a silicon substrate. By varying sample temperature, level of hydration, and deuteration, we identify three different types...... of diffusive water motion: bulk-like, confined, and bound. The motion of bulk-like and confined water molecules is fast compared to those bound to the lipid head groups (7-10 H2O molecules per lipid), which move on the same nanosecond time scale as H atoms within the lipid molecules. Copyright (C) EPLA, 2012...
Differential and total cross sections for the ionization of water molecule by electron impact
International Nuclear Information System (INIS)
Houamer, S.; Dal Cappello, C.; Mansouri, A.
2007-01-01
A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:
Ion-Molecule Reaction Dynamics.
Meyer, Jennifer; Wester, Roland
2017-05-05
We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.
Diffusion of water adsorbed in hydrotalcite: neutron scattering Study
Energy Technology Data Exchange (ETDEWEB)
Mitra, S [Solid State Physics Division, Bhabha Atomic Research Centre, Mumbai (India); Pramanik, A [Unilever Research India, Bangalore 500 066 (India); Chakrabarty, D [Godrej Sara Lee Limited, Research and Development Centre, Mumbai 400 079 (India); Juranyi, F [Laboratory for Neutron Scattering, ETHZ and PSI, CH-5232 Villigen PSI (Switzerland); Gautam, S [Solid State Physics Division, Bhabha Atomic Research Centre, Mumbai (India); Mukhopadhyay, R [Solid State Physics Division, Bhabha Atomic Research Centre, Mumbai (India)
2007-12-15
Layered double hydroxides (LDH) are a class of ionic lamellar solids with positively charged layers of two kinds of metallic cations and exchangeable hydrated anions. Quasi-elastic neutron scattering (QENS) measurements are performed in this type of LDH structured hydrated hydrotalcite sample to study the dynamical behaviour of the water in geometric confinement within the layers. Dynamical parameters correspond to the confined water molecules revealed that depending on the amount of excess water present, behaves differently and approaches bulk values at high concentration. Both translational and rotational dynamical parameters showed that at very low concentration of excess water, water molecules are attached to the surfaces and show the confinement effect.
Electron Accumulative Molecules.
Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc
2018-02-28
With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can
Water adsorption induced in-plane domain switching on BaTiO{sub 3} surface
Energy Technology Data Exchange (ETDEWEB)
Li, X.; Bai, Y.; Su, Y. J., E-mail: yjsu@ustb.edu.cn [Corrosion and Protection Center, Key Laboratory for Environmental Fracture (MOE), University of Science and Technology Beijing, Beijing 100083 (China); Wang, B. C. [Corrosion and Protection Center, Key Laboratory for Environmental Fracture (MOE), University of Science and Technology Beijing, Beijing 100083 (China); Multiscale Materials Modelling group, Department of Materials and Engineering, Royal Institute of Technology, SE-10044 Stockholm (Sweden)
2015-09-07
In this study, the influences of the adsorption of water molecules on the changes in the atomic and electric structures of BaTiO{sub 3} surface were investigated using ab initio calculation. Water molecules are molecularly and dissociatively adsorbed on the BaTiO{sub 3} surface, which makes electrons transfer from water molecules to the BaTiO{sub 3} surface. The redistribution of electrons in the BaTiO{sub 3} surface layers weakens the Ba-O interactions and strengthens the Ti-O interactions, so that the Ti atom shifts in TiO{sub 2} plane, i.e., an in-plane domain switching. The adsorption of water molecules on BaTiO{sub 3} surfaces also results in a reduction in the surface rumpling.
Willems, R.
2008-01-01
This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and
Water transport by the Na+/glucose cotransporter under isotonic conditions
DEFF Research Database (Denmark)
Zeuthen, T; Meinild, A K; Klaerke, D A
1997-01-01
Solute cotransport in the Na+/glucose cotransporter is directly coupled to significant water fluxes. The water fluxes are energized by the downhill fluxes of the other substrates by a mechanism within the protein itself. In the present paper we investigate the Na+/glucose cotransporter expressed ...... of water molecules and the number of Na+ ions transported, equivalent to 390 water molecules per glucose molecule. Unstirred layer effects are ruled out on the basis of experiments on native oocytes incubated with the ionophores gramicidin D or nystatin.......Solute cotransport in the Na+/glucose cotransporter is directly coupled to significant water fluxes. The water fluxes are energized by the downhill fluxes of the other substrates by a mechanism within the protein itself. In the present paper we investigate the Na+/glucose cotransporter expressed...... in Xenopus oocytes. We present a method which allows short-term exposures to sugar under voltage clamp conditions. We demonstrate that water is cotransported with the solutes despite no osmotic differences between the external and intracellular solutions. There is a fixed ratio of 195:1 between the number...
Maiti, Prabal K.; Bagchi, Biman
2009-12-01
In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.
The Molecule Cloud - compact visualization of large collections of molecules
Directory of Open Access Journals (Sweden)
Ertl Peter
2012-07-01
Full Text Available Abstract Background Analysis and visualization of large collections of molecules is one of the most frequent challenges cheminformatics experts in pharmaceutical industry are facing. Various sophisticated methods are available to perform this task, including clustering, dimensionality reduction or scaffold frequency analysis. In any case, however, viewing and analyzing large tables with molecular structures is necessary. We present a new visualization technique, providing basic information about the composition of molecular data sets at a single glance. Summary A method is presented here allowing visual representation of the most common structural features of chemical databases in a form of a cloud diagram. The frequency of molecules containing particular substructure is indicated by the size of respective structural image. The method is useful to quickly perceive the most prominent structural features present in the data set. This approach was inspired by popular word cloud diagrams that are used to visualize textual information in a compact form. Therefore we call this approach “Molecule Cloud”. The method also supports visualization of additional information, for example biological activity of molecules containing this scaffold or the protein target class typical for particular scaffolds, by color coding. Detailed description of the algorithm is provided, allowing easy implementation of the method by any cheminformatics toolkit. The layout algorithm is available as open source Java code. Conclusions Visualization of large molecular data sets using the Molecule Cloud approach allows scientists to get information about the composition of molecular databases and their most frequent structural features easily. The method may be used in the areas where analysis of large molecular collections is needed, for example processing of high throughput screening results, virtual screening or compound purchasing. Several example visualizations of large
Hydration of ammonia, methylamine, and methanol in amorphous solid water
Souda, Ryutaro
2016-02-01
Interactions of polar protic molecules with amorphous solid water (ASW) have been investigated using temperature-programmed desorption and time-of-flight secondary ion mass spectrometry. The ammonia and methylamine are incorporated into the interior of porous ASW films. They are caged by water molecules and are released during water crystallization. In contrast, the methanol-water interaction is not influenced by pores of ASW. The methanol additives tend to survive water crystallization and are released during ASW film evaporation. The hydration of n-hexane in ASW is influenced significantly by methanol additives because n-hexane is accommodated in a methanol-induced hydration shell.
Molecular hydrogen solvated in water – A computational study
International Nuclear Information System (INIS)
Śmiechowski, Maciej
2015-01-01
The aqueous hydrogen molecule is studied with molecular dynamics simulations at ambient temperature and pressure conditions, using a newly developed flexible and polarizable H 2 molecule model. The design and implementation of this model, compatible with an existing flexible and polarizable force field for water, is presented in detail. The structure of the hydration layer suggests that first-shell water molecules accommodate the H 2 molecule without major structural distortions and two-dimensional, radial-angular distribution functions indicate that as opposed to strictly tangential, the orientation of these water molecules is such that the solute is solvated with one of the free electron pairs of H 2 O. The calculated self-diffusion coefficient of H 2 (aq) agrees very well with experimental results and the time dependence of mean square displacement suggests the presence of caging on a time scale corresponding to hydrogen bond network vibrations in liquid water. Orientational correlation function of H 2 experiences an extremely short-scale decay, making the H 2 –H 2 O interaction potential essentially isotropic by virtue of rotational averaging. The inclusion of explicit polarizability in the model allows for the calculation of Raman spectra that agree very well with available experimental data on H 2 (aq) under differing pressure conditions, including accurate reproduction of the experimentally noted trends with solute pressure or concentration
International Nuclear Information System (INIS)
Sakka, Tetsuo; Saito, Kotaro; Ogata, Yukio H.
2002-01-01
Emission spectra of C 2 molecules produced at the water-graphite interface by pulsed laser irradiation were obtained at various delay times from the irradiation. Vibrational temperature was determined by the Boltzmann plot based on the vibrational bands in Δν=-1 branch of the Swan system. The results show that it was ca. 5000 K and did not change significantly with the delay time. With increasing the delay time up to ca. 500 ns the signal from the Swan band disappeared before the decrease of the vibrational temperature. The results were explained by the formation of a gas cavity and its collapse at several hundreds of nanoseconds from the laser pulse
Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution
Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.
2016-01-01
We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell
Xenon-Water Interaction in Bacterial Suspensions as Studied by NMR
DEFF Research Database (Denmark)
Rodin, V.; Ponomarev, Alexander; Gerasimov, Maxim
2017-01-01
suspensions of Escherichia coli in the presence of xenon using nuclear magnetic resonance (NMR). The work studied how the spin-lattice relaxation times of water protons in suspension change under xenon conditions. Xenon is able to form clathrate hydrates with water molecules at a temperature above the melting...... point of ice. The work studied NMR relaxation times which reflect the rotation freedom of water molecules in suspension. Lower relaxation times indicate reduced rotational freedom of water. Single exponential behavior of spin-lattice relaxation of protons in the suspensions of microorganisms has been...
Enoki, Toshiaki; Kiguchi, Manabu
2018-03-01
Interest in utilizing organic molecules to fabricate electronic materials has existed ever since organic (molecular) semiconductors were first discovered in the 1950s. Since then, scientists have devoted serious effort to the creation of various molecule-based electronic systems, such as molecular metals and molecular superconductors. Single-molecule electronics and the associated basic science have emerged over the past two decades and provided hope for the development of highly integrated molecule-based electronic devices in the future (after the Si-based technology era has ended). Here, nanographenes (nano-sized graphene) with atomically precise structures are among the most promising molecules that can be utilized for electronic/spintronic devices. To manipulate single small molecules for an electronic device, a single molecular junction has been developed. It is a powerful tool that allows even small molecules to be utilized. External electric, magnetic, chemical, and mechanical perturbations can change the physical and chemical properties of molecules in a way that is different from bulk materials. Therefore, the various functionalities of molecules, along with changes induced by external perturbations, allows us to create electronic devices that we cannot create using current top-down Si-based technology. Future challenges that involve the incorporation of condensed matter physics, quantum chemistry calculations, organic synthetic chemistry, and electronic device engineering are expected to open a new era in single-molecule device electronic technology.
Directory of Open Access Journals (Sweden)
Lorenzo Cotrozzi
2017-06-01
Full Text Available Understanding the interactions between drought and acute ozone (O3 stress in terms of signaling molecules and cell death would improve the predictions of plant responses to climate change. The aim was to investigate whether drought stress influences the responses of plants to acute episodes of O3 exposure. In this study, the behavior of 84 Mediterranean evergreen Quercus ilex plants was evaluated in terms of cross-talk responses among signaling molecules. Half of the sample was subjected to drought (20% of the effective daily evapotranspiration, for 15 days and was later exposed to an acute O3 exposure (200 nL L-1 for 5 h. First, our results indicate that in well-water conditions, O3 induced a signaling pathway specific to O3-sensitive behavior. Second, different trends and consequently different roles of phytohormones and signaling molecules (ethylene, ET; abscisic acid, ABA; salycilic acid, SA and jasmonic acid, JA were observed in relation to water stress and O3. A spatial and functional correlation between these signaling molecules was observed in modulating O3-induced responses in well-watered plants. In contrast, in drought-stressed plants, these compounds were not involved either in O3-induced signaling mechanisms or in leaf senescence (a response observed in water-stressed plants before the O3-exposure. Third, these differences were ascribable to the fact that in drought conditions, most defense processes induced by O3 were compromised and/or altered. Our results highlight how Q. ilex plants suffering from water deprivation respond differently to an acute O3 episode compared to well-watered plants, and suggest new effect to be considered in plant responses to environmental changes. This poses the serious question as to whether or not multiple high-magnitude O3 events (as predicted can change these cross-talk responses, thus opening it up possible further investigations.
Permeability of uncharged organic molecules in reverse osmosis desalination membranes.
Dražević, Emil; Košutić, Krešimir; Svalina, Marin; Catalano, Jacopo
2017-06-01
Reverse osmosis (RO) membranes are primarily designed for removal of salts i.e. for desalination of brackish and seawater, but they have also found applications in removal of organic molecules. While it is clear that steric exclusion is the dominant removal mechanism, the fundamental explanation for how and why the separation occurs remains elusive. Until recently there was no strong microscopic evidences elucidating the structure of the active polyamide layers of RO membranes, and thus they have been conceived as "black boxes"; or as an array of straight capillaries with a distribution of radii; or as polymers with a small amount of polymer free domains. The knowledge of diffusion and sorption coefficients is a prerequisite for understanding the intrinsic permeability of any organic solute in any polymer. At the same time, it is technically challenging to accurately measure these two fundamental parameters in very thin (20-300 nm) water-swollen active layers. In this work we have measured partition and diffusion coefficients and RO permeabilities of ten organic solutes in water-swollen active layers of two types of RO membranes, low (SWC4+) and high flux (XLE). We deduced from our results and recent microscopic studies that the solute flux of organic molecules in polyamide layer of RO membranes occurs in two domains, dense polymer (the key barrier layer) and the water filled domains. Copyright © 2017 Elsevier Ltd. All rights reserved.
Noda, Yumi
2014-08-01
The human body is two-thirds water. The ability of ensuring the proper amount of water inside the body is essential for the survival of mammals. The key event for maintenance of body water balance is water reabsorption in the kidney collecting ducts, which is regulated by aquaporin-2 (AQP2). AQP2 is a channel that is exclusively selective for water molecules and never allows permeation of ions or other small molecules. Under normal conditions, AQP2 is restricted within the cytoplasm of the collecting duct cells. However, when the body is dehydrated and needs to retain water, AQP2 relocates to the apical membrane, allowing water reabsorption from the urinary tubule into the cell. Its impairments result in various water balance disorders including diabetes insipidus, which is a disease characterized by a massive loss of water through the kidney, leading to severe dehydration in the body. Dysregulation of AQP2 is also a common cause of water retention and hyponatremia that exacerbate the prognosis of congestive heart failure and hepatic cirrhosis. Many studies have uncovered the regulation mechanisms of AQP2 at the single-molecule level, the whole-body level, and the clinical level. In clinical practice, urinary AQP2 is a useful marker for body water balance (hydration status). Moreover, AQP2 is now attracting considerable attention as a potential therapeutic target for water balance disorders which commonly occur in many diseases.
Takayanagi, Kazuo
1984-01-01
Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...
Preparation of translationally cold neutral molecules.
Di Domenicantonio, Giulia; Bertsche, Benjamin; Osterwalder, Andreas
2011-01-01
Efforts at EPFL to obtain translationally cold neutral molecules are described. Active deceleration of polar molecules is performed by confining the molecules in moving three-dimensional electrostatic traps, and by appropriately choosing the velocity of those traps. Alternatively, cold molecules can be obtained by velocity filtering. Here, the velocity of the molecules is not changed, but instead the cold molecules are extracted from a thermal sample by using the competition between the electrostatic force and the centrifugal force inside a bent electrostatic guide for polar molecules.
Investigation of the Structures and Energy Landscapes of Thiocyanate-Water Clusters
Directory of Open Access Journals (Sweden)
Lewis C. Smeeton
2017-03-01
Full Text Available The Basin Hopping search method is used to find the global minima (GM and map the energy landscapes of thiocyanate-water clusters, (SCN−(H2On with 3–50 water molecules, with empirical potentials describing the ion-water and water-water interactions. (It should be noted that beyond n = 23, the lowest energy structures were only found in 1 out of 8 searches so they are unlikely to be the true GM but are indicative low energy structures. As for pure water clusters, the low energy isomers of thiocyanate-water clusters show a preponderance of fused water cubes and pentagonal prisms, with the weakly solvated thiocyanate ion lying on the surface, replacing two water molecules along an edge of a water polyhedron and with the sulfur atom in lower coordinated sites than nitrogen. However, by comparison with Density Functional Theory (DFT calculations, the empirical potential is found to overestimate the strength of the thiocyanate-water interaction, especially O–H⋯S, with low energy DFT structures having lower coordinate N and (especially S atoms than for the empirical potential. In the case of these finite ion-water clusters, the chaotropic (“disorder-making” thiocyanate ion weakens the water cluster structure but the water molecule arrangement is not significantly changed.
Water accelerated transformation of d-limonene induced by ultraviolet irradiation and air exposure.
Li, Li Jun; Hong, Peng; Jiang, Ze Dong; Yang, Yuan Fan; Du, Xi Ping; Sun, Hao; Wu, Li Ming; Ni, Hui; Chen, Feng
2018-01-15
d-Limonene is a fragrant chemical that widely exists in aromatic products. Isotopic labelling of water molecules plus GC-MS and GC-PCI-Q-TOF analyses were used to investigate the influence of water molecules on chemical transformation of d-limonene induced by UV irradiation and air exposure. The results showed that the synergistic effect of UV irradiation, air exposure and water presence could facilitate d-limonene transformation into the limonene oxides: p-mentha-2,8-dienols, hydroperoxides, carveols, l-carvone and carvone oxide. UV irradiation, air exposure, or water alone, however, caused negligible d-limonene transformation. With the aid of isotopic labelling of water and oxygen molecules, it was found that water molecules were split into hydrogen radicals and hydroxyl radicals, and the hydrogen radicals, in particular, promoted the transformation reactions. This study has elucidated the mechanism and factors that influence the transformation of d-limonene, which will benefit industries involved in production and storage of d-limonene-containing products. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Jørgensen, Jacob Lykkebo
Abstract The idea of using single-molecules as components in electronic devices is fas- cinating. For this idea to come into fruition, a number of technical and theo- retical challenges must be overcome. In this PhD thesis, the electron-phonon interaction is studied for a special class of molecules......, which is characterised by destructive quantum interference. The molecules are cross-conjugated, which means that the two parts of the molecules are conjugated to a third part, but not to each other. This gives rise to an anti-resonance in the trans- mission. In the low bias and low temperature regime......-conjugated molecules. We nd that the vibrational modes that would be expected to dominate, following the propensity, rules are very weak. Instead, other modes are found to be the dominant ones. We study this phenomenon for a number of cross-conjugated molecules, and link these ndings to the anti...
Single Molecule Electronics and Devices
Tsutsui, Makusu; Taniguchi, Masateru
2012-01-01
The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345
Isothermal dehydration of thin films of water and sugar solutions
Energy Technology Data Exchange (ETDEWEB)
Heyd, R. [Centre de Recherche sur la Matière Divisée, University of Orleans and CNRS, rue de la Férollerie 1B, 45071 Orléans Cedex 2 (France); Rampino, A. [Centre de Recherche sur la Matière Divisée, University of Orleans and CNRS, rue de la Férollerie 1B, 45071 Orléans Cedex 2 (France); Laboratory of Physical and Macromolecular Chemistry, University of Trieste, Via Giorgieri 1, 34127 Trieste (Italy); Bellich, B.; Elisei, E. [Laboratory of Physical and Macromolecular Chemistry, University of Trieste, Via Giorgieri 1, 34127 Trieste (Italy); Cesàro, A. [Laboratory of Physical and Macromolecular Chemistry, University of Trieste, Via Giorgieri 1, 34127 Trieste (Italy); Elettra Sincrotrone Trieste, Area Science Park, I-34149 Trieste (Italy); Saboungi, M.-L. [Centre de Recherche sur la Matière Divisée, University of Orleans and CNRS, rue de la Férollerie 1B, 45071 Orléans Cedex 2 (France); Institut de Minéralogie, de Physique des Matériaux, et de Cosmochimie (IMPMC), Sorbonne Univ-UPMC, Univ Paris 06, UMR CNRS 7590, Museum National d’Histoire Naturelle, IRD UMR 206, 4 Place Jussieu, F-75005 Paris (France)
2014-03-28
The process of quasi-isothermal dehydration of thin films of pure water and aqueous sugar solutions is investigated with a dual experimental and theoretical approach. A nanoporous paper disk with a homogeneous internal structure was used as a substrate. This experimental set-up makes it possible to gather thermodynamic data under well-defined conditions, develop a numerical model, and extract needed information about the dehydration process, in particular the water activity. It is found that the temperature evolution of the pure water film is not strictly isothermal during the drying process, possibly due to the influence of water diffusion through the cellulose web of the substrate. The role of sugar is clearly detectable and its influence on the dehydration process can be identified. At the end of the drying process, trehalose molecules slow down the diffusion of water molecules through the substrate in a more pronounced way than do the glucose molecules.
Countercurrent exchange of water in canine jejunum
International Nuclear Information System (INIS)
Ryu, K.H.; Grim, E.
1985-01-01
The possibility of countercurrent exchange of water molecules in canine intestinal villi has been examined. Tritium-labeled water ( 3 H 2 O) molecules were introduced either into the fluid lavaging the intestinal lumen or into the arterial blood supply for varying periods of time. Quickly frozen samples of intestinal tissue were sectioned such that isotopic concentrations at the villus tip, midvillus, villus base, and underlying submucosa and muscle could be determined. The villus concentration gradients observed were consistent with the existence of a countercurrent exchange but could also be explained by alternative arrangements. More convincing evidence of a countercurrent was obtained from experiments in which [ 14 C]inulin was introduced simultaneously with 3 H 2 O into the intestinal artery. The villus tip-to-base concentration ratio for 3 H 2 O was less than one while the ratio for inulin was greater than one, thus vitiating the alternative explanations and leading to the conclusion that the labeled water molecules must have undergone a countercurrent exchange
Electron Impact Excitation-Ionization of Molecules
Ali, Esam Abobakr A.
In the last few decades, the study of atomic collisions by electron-impact has made significant advances. The most difficult case to study is electron impact ionization of molecules for which many approximations have to be made and the validity of these approximations can only be checked by comparing with experiment. In this thesis, I have examined the Molecular three-body distorted wave (M3DW) or Molecular four-body distorted wave (M4DW) approximations for electron-impact ionization. These models use a fully quantum mechanical approach where all particles are treated quantum mechanically and the post collision interaction (PCI) is treated to all orders of perturbation. These electron impact ionization collisions play central roles in the physics and chemistry of upper atmosphere, biofuel, the operation of discharges and lasers, radiation induced damage in biological material like damage to DNA by secondary electrons, and plasma etching processes. For the M3DW model, I will present results for electron impact single ionization of small molecules such as Water, Ethane, and Carbon Dioxide and the much larger molecules Tetrahydrofuran, phenol, furfural, 1-4 Benzoquinone. I will also present results for the four-body problem in which there are two target electrons involved in the collision. M4DW results will be presented for dissociative excitation-ionization of orientated D2. I will show that M4DW calculations using a variational wave function for the ground state that included s- and p- orbital states give better agreement to the experimental measurements than a ground state approximated as a product of two 1s-type Dyson orbitals.
Hydrogen/deuterium substitution methods: understanding water structure in solution
International Nuclear Information System (INIS)
Soper, A.K.
1993-01-01
The hydrogen/deuterium substitution method has been used for different applications, such as the short range order between water molecules in a number of different environments (aqueous solutions of organic molecules), or to study the partial structure factors of water at high pressure and temperature. The absolute accuracy that can be obtained remains uncertain, but important qualitative information can be obtained on the local organization of water in aqueous solution. Some recent results with pure water, methanol and dimethyl sulphoxide (DMSO) solutions are presented. It is shown that the short range water structure is not greatly affected by most solutes except at high concentrations and when the solute species has its own distinctive interaction with water (such as a dissolved small ion). 3 figs., 14 refs
EDITORIAL: Focus on Cold and Ultracold Molecules FOCUS ON COLD AND ULTRACOLD MOLECULES
Carr, Lincoln D.; Ye, Jun
2009-05-01
Cold and ultracold molecules are the next wave of ultracold physics, giving rise to an exciting array of scientific opportunities, including many body physics for novel quantum phase transitions, new states of matter, and quantum information processing. Precision tests of fundamental physical laws benefit from the existence of molecular internal structure with exquisite control. The study of novel collision and reaction dynamics will open a new chapter of quantum chemistry. Cold molecules bring together researchers from a variety of fields, including atomic, molecular, and optical physics, chemistry and chemical physics, quantum information science and quantum simulations, condensed matter physics, nuclear physics, and astrophysics, a truly remarkable synergy of scientific explorations. For the past decade there have been steady advances in direct cooling techniques, from buffer-gas cooling to cold molecular beams to electro- and magneto-molecular decelerators. These techniques have allowed a large variety of molecules to be cooled for pioneering studies. Recent amazing advances in experimental techniques combining the ultracold and the ultraprecise have furthermore brought molecules to the point of quantum degeneracy. These latter indirect cooling techniques magnetically associate atoms from a Bose-Einstein condensate and/or a quantum degenerate Fermi gas, transferring at 90% efficiency highly excited Fano-Feshbach molecules, which are on the order of 10 000 Bohr radii in size, to absolute ground state molecules just a few Bohr across. It was this latter advance, together with significant breakthroughs in internal state manipulations, which inspired us to coordinate this focus issue now, and is the reason why we say the next wave of ultracold physics has now arrived. Whether directly or indirectly cooled, heteronuclear polar molecules offer distinct new features in comparison to cold atoms, while sharing all of their advantages (purity, high coherence
Cappel, Daniel; Sherman, Woody; Beuming, Thijs
2017-01-01
The ability to accurately characterize the solvation properties (water locations and thermodynamics) of biomolecules is of great importance to drug discovery. While crystallography, NMR, and other experimental techniques can assist in determining the structure of water networks in proteins and protein-ligand complexes, most water molecules are not fully resolved and accurately placed. Furthermore, understanding the energetic effects of solvation and desolvation on binding requires an analysis of the thermodynamic properties of solvent involved in the interaction between ligands and proteins. WaterMap is a molecular dynamics-based computational method that uses statistical mechanics to describe the thermodynamic properties (entropy, enthalpy, and free energy) of water molecules at the surface of proteins. This method can be used to assess the solvent contributions to ligand binding affinity and to guide lead optimization. In this review, we provide a comprehensive summary of published uses of WaterMap, including applications to lead optimization, virtual screening, selectivity analysis, ligand pose prediction, and druggability assessment. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Study of water role during the complexing of uranyl aquanitrate compounds with cyclic polyethers
International Nuclear Information System (INIS)
Belomestnykh, V.I.; Sveshnikova, L.B.; Shabel'nik, K.S.
1990-01-01
By the method of vibrational spectroscopy and thermogravimetry the determining role of water molecules during complexing of uranyl aquonitrate compounds with macrocyclic polyethers is confirmed. It is ascertained that in the synthesized complexes of the composition UO 2 (NO 3 ) 2 (H 2 O) 2 ·mH 2 O·nL (m=0,1,2; L-18-crown-6, 15-crown-5, dibenzo-18-crown-6; n=1,2) molecules of macrocyclic ligand are joined at the expense of strong hydrogen bonds with participation of protons of crystallographically nonequivalent water molecules. In the compounds hydrogen bonds of water-water and water-nitrato group type are also realized. Energies of the above-mentioned bonds are calculated
Single-Molecule Photocurrent at a Metal-Molecule-Semiconductor Junction.
Vezzoli, Andrea; Brooke, Richard J; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-11-08
We demonstrate here a new concept for a metal-molecule-semiconductor nanodevice employing Au and GaAs contacts that acts as a photodiode. Current-voltage traces for such junctions are recorded using a STM, and the "blinking" or "I(t)" method is used to record electrical behavior at the single-molecule level in the dark and under illumination, with both low and highly doped GaAs samples and with two different types of molecular bridge: nonconjugated pentanedithiol and the more conjugated 1,4-phenylene(dimethanethiol). Junctions with highly doped GaAs show poor rectification in the dark and a low photocurrent, while junctions with low doped GaAs show particularly high rectification ratios in the dark (>10 3 for a 1.5 V bias potential) and a high photocurrent in reverse bias. In low doped GaAs, the greater thickness of the depletion layer not only reduces the reverse bias leakage current, but also increases the volume that contributes to the photocurrent, an effect amplified by the point contact geometry of the junction. Furthermore, since photogenerated holes tunnel to the metal electrode assisted by the HOMO of the molecular bridge, the choice of the latter has a strong influence on both the steady state and transient metal-molecule-semiconductor photodiode response. The control of junction current via photogenerated charge carriers adds new functionality to single-molecule nanodevices.
Zhang, Ye
2013-04-03
The integration of a tripeptide derivative, which is a versatile self-assembly motif, with a ruthenium(II)tris(bipyridine) complex affords the first supramolecular metallo-hydrogelator that not only self assembles in water to form a hydrogel but also exhibits gel-sol transition upon oxidation of the metal center. Surprisingly, the incorporation of the metal complex in the hydrogelator results in the nanofibers, formed by the self-assembly of the hydrogelator in water, to have the width of a single molecule of the hydrogelator. These results illustrate that metal complexes, besides being able to impart rich optical, electronic, redox, or magnetic properties to supramolecular hydrogels, also offer a unique geometrical control to prearrange the self-assembly motif prior to self-assembling. The use of metal complexes to modulate the dimensionality of intermolecular interactions may also help elucidate the interactions of the molecular nanofibers with other molecules, thus facilitating the development of supramolecular hydrogel materials for a wide range of applications. © 2013 American Chemical Society.
Water permeation through the sodium-dependent galactose cotransporter vSGLT.
Choe, Seungho; Rosenberg, John M; Abramson, Jeff; Wright, Ernest M; Grabe, Michael
2010-10-06
It is well accepted that cotransporters facilitate water movement by two independent mechanisms: osmotic flow through a water channel in the protein and flow driven by ion/substrate cotransport. However, the molecular mechanism of transport-linked water flow is controversial. Some researchers believe that it occurs via cotransport, in which water is pumped along with the transported cargo, while others believe that flow is osmotic in response to an increase in intracellular osmolarity. In this letter, we report the results of a 200-ns molecular dynamics simulation of the sodium-dependent galactose cotransporter vSGLT. Our simulation shows that a significant number of water molecules cross the protein through the sugar-binding site in the presence as well as the absence of galactose, and 70-80 water molecules accompany galactose as it moves from the binding site into the intracellular space. During this event, the majority of water molecules in the pathway are unable to diffuse around the galactose, resulting in water in the inner half of the transporter being pushed into the intracellular space and replaced by extracellular water. Thus, our simulation supports the notion that cotransporters act as both passive water channels and active water pumps with the transported substrate acting as a piston to rectify the motion of water. Copyright © 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Preedy, Victor R
2016-01-01
This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.
Cosolvent effect on the dynamics of water in aqueous binary mixtures
Zhang, Xia; Zhang, Lu; Jin, Tan; Zhang, Qiang; Zhuang, Wei
2018-04-01
Water rotational dynamics in the mixtures of water and amphiphilic molecules, such as acetone and dimethyl sulfoxide (DMSO), measured by femtosecond infrared, often vary non-monotonically as the amphiphilic molecule's molar fraction changes from 0 to 1. Recent study has attributed the non-ideal water rotation with concentration in DMSO-water mixtures to different microscopic hydrophilic-hydrophobic segregation structure in water-rich and water-poor mixtures. Interestingly, the acetone molecule has very similar molecular structure to DMSO, but the extremum of the water rotational time in the DMSO-water mixtures significantly shifts to lower concentration and the rotation of water is much faster than those in acetone-water mixtures. The simulation results here shows that the non-ideal rotational dynamics of water in both mixtures are due to the frame rotation during the interval of hydrogen bond (HB) switchings. A turnover of the frame rotation with concentration takes place as the structure transition of mixture from the hydrogen bond percolation structure to the hydrophobic percolation structure. The weak acetone-water hydrogen bond strengthens the hydrophobic aggregation and accelerates the relaxation of the hydrogen bond, so that the structure transition takes places at lower concentration and the rotation of water is faster in acetone-water mixture than in DMSO-water mixture. A generally microscopic picture on the mixing effect on the water dynamics in binary aqueous mixtures is presented here.
Understanding water: Molecular dynamics simulations of solubilized and crystallized myoglobin
Energy Technology Data Exchange (ETDEWEB)
Wei Gu; Garcia, A.E.; Schoenborn, B.P. [Los Alamos National Laboratory, NM (United States)
1994-12-31
Molecular dynamics simulations were performed on CO myoglobin to evaluate the stability of the bound water molecules as determined in a neutron diffraction analysis. The myoglobin structure derived from the neutron analysis provided the starting coordinate set used in the simulations. The simulations show that only a few water molecules are tightly bound to protein atoms, while most solvent molecules are labile, breaking and reforming hydrogen bonds. Comparison between myoglobin in solution and in a single crystal highlighted some of the packing effects on the solvent structure and shows that water solvent plays an indispensable role in protein dynamics and structural stability. The described observations explain some of the differences in the experimental results of protein hydration as observed in NMR, neutron and X-ray diffraction studies.
Understanding water: Molecular dynamics simulations of solubilized and crystallized myoglobin
International Nuclear Information System (INIS)
Wei Gu; Garcia, A.E.; Schoenborn, B.P.
1994-01-01
Molecular dynamics simulations were performed on CO myoglobin to evaluate the stability of the bound water molecules as determined in a neutron diffraction analysis. The myoglobin structure derived from the neutron analysis provided the starting coordinate set used in the simulations. The simulations show that only a few water molecules are tightly bound to protein atoms, while most solvent molecules are labile, breaking and reforming hydrogen bonds. Comparison between myoglobin in solution and in a single crystal highlighted some of the packing effects on the solvent structure and shows that water solvent plays an indispensable role in protein dynamics and structural stability. The described observations explain some of the differences in the experimental results of protein hydration as observed in NMR, neutron and X-ray diffraction studies
Stability of matter-antimatter molecules
International Nuclear Information System (INIS)
Wong, Cheuk-Yin; Lee, Teck-Ghee
2011-01-01
Highlights: → We examine stability of matter-antimatter molecules with four constituents. → The binding of matter-antimatter molecules is a common phenomenon. → Molecules have bound states if ratio of constituent masses greater than ∼4. → We evaluate molecular binding energies and annihilation lifetimes. - Abstract: We examine the stability of matter-antimatter molecules by reducing the four-body problem into a simpler two-body problem with residual interactions. We find that matter-antimatter molecules with constituents (m 1 + ,m 2 - ,m-bar 2 + ,m-bar 1 - ) possess bound states if their constituent mass ratio m 1 /m 2 is greater than about 4. This stability condition suggests that the binding of matter-antimatter molecules is a rather common phenomenon. We evaluate the binding energies and eigenstates of matter-antimatter molecules (μ + e - )-(e + μ - ),(π + e - )-(e + π - ),(K + e - )-(e + K - ),(pe - )-(e + p-bar),(pμ - )-(μ + p-bar), and (K + μ - ) - (μ + K - ), which satisfy the stability condition. We estimate the molecular annihilation lifetimes in their s states.
Felodipine-diazabicyclo 2.2.2 octane-water (1/1/1)
DEFF Research Database (Denmark)
Solanko, K. A.; Surov, A. O.; Perlovich, G. L.
2012-01-01
into chains around 2(1) screw axes, while the felodipine molecules form N-H center dot center dot center dot O hydrogen bonds to the water molecules. The felodipine molecules adopt centrosymmetric back-to-back arrangements that are similar to those present in all of its four reported polymorphs...
Blinking effect and the use of quantum dots in single molecule spectroscopy
International Nuclear Information System (INIS)
Rombach-Riegraf, Verena; Oswald, Peter; Bienert, Roland; Petersen, Jan; Domingo, M.P.; Pardo, Julian; Gräber, P.; Galvez, E.M.
2013-01-01
Highlights: ► It is possible to eliminate the blinking effect of a water-soluble QD. ► We provide a direct method to study protein function and dynamics at the single level. ► QD, potent tool for single molecule studies of biochemical and biological processes. -- Abstract: Luminescent semiconductor nanocrystals (quantum dots, QD) have unique photo-physical properties: high photostability, brightness and narrow size-tunable fluorescence spectra. Due to their unique properties, QD-based single molecule studies have become increasingly more popular during the last years. However QDs show a strong blinking effect (random and intermittent light emission), which may limit their use in single molecule fluorescence studies. QD blinking has been widely studied and some hypotheses have been done to explain this effect. Here we summarise what is known about the blinking effect in QDs, how this phenomenon may affect single molecule studies and, on the other hand, how the “on”/“off” states can be exploited in diverse experimental settings. In addition, we present results showing that site-directed binding of QD to cysteine residues of proteins reduces the blinking effect. This option opens a new possibility of using QDs to study protein–protein interactions and dynamics by single molecule fluorescence without modifying the chemical composition of the solution or the QD surface.
Blinking effect and the use of quantum dots in single molecule spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Rombach-Riegraf, Verena; Oswald, Peter; Bienert, Roland; Petersen, Jan [Albert-Ludwigs-Universitaet Freiburg, Institut fuer Physikalische Chemie, Albertstrasse 23a, 79104 Freiburg (Germany); Domingo, M.P. [Instituto de Carboquimica (CSIC), Miguel Luesma 4, 50018 Zaragoza (Spain); Pardo, Julian [Grupo Apoptosis, Inmunidad y Cancer, Departamento Bioquimica y Biologia Molecular y Celular, Fac. Ciencias, Universidad de Zaragoza, Zaragoza (Spain); Fundacion Aragon I-D (ARAID), Gobierno de Aragon, Zaragoza (Spain); Immune Effector Cells Group, Aragon Health Research Institute (IIS Aragon), Biomedical Research Centre of Aragon (CIBA) Fundacion Aragon I-D - ARAID, Gobierno de Aragon, Zaragoza (Spain); Graeber, P. [Albert-Ludwigs-Universitaet Freiburg, Institut fuer Physikalische Chemie, Albertstrasse 23a, 79104 Freiburg (Germany); Galvez, E.M., E-mail: eva@icb.csic.es [Instituto de Carboquimica (CSIC), Miguel Luesma 4, 50018 Zaragoza (Spain); Immune Effector Cells Group, Aragon Health Research Institute (IIS Aragon), Biomedical Research Centre of Aragon (CIBA) Fundacion Aragon I-D - ARAID, Gobierno de Aragon, Zaragoza (Spain)
2013-01-04
Highlights: Black-Right-Pointing-Pointer It is possible to eliminate the blinking effect of a water-soluble QD. Black-Right-Pointing-Pointer We provide a direct method to study protein function and dynamics at the single level. Black-Right-Pointing-Pointer QD, potent tool for single molecule studies of biochemical and biological processes. -- Abstract: Luminescent semiconductor nanocrystals (quantum dots, QD) have unique photo-physical properties: high photostability, brightness and narrow size-tunable fluorescence spectra. Due to their unique properties, QD-based single molecule studies have become increasingly more popular during the last years. However QDs show a strong blinking effect (random and intermittent light emission), which may limit their use in single molecule fluorescence studies. QD blinking has been widely studied and some hypotheses have been done to explain this effect. Here we summarise what is known about the blinking effect in QDs, how this phenomenon may affect single molecule studies and, on the other hand, how the 'on'/'off' states can be exploited in diverse experimental settings. In addition, we present results showing that site-directed binding of QD to cysteine residues of proteins reduces the blinking effect. This option opens a new possibility of using QDs to study protein-protein interactions and dynamics by single molecule fluorescence without modifying the chemical composition of the solution or the QD surface.
Huang, Jing; Liu, Tong-Peng; Huo, Li-Hua; Deng, Zhao-Peng; Gao, Shan
2017-01-01
Assembly of six isomeric pyridine-diamine-based molecules, N,N‧-bis(pyridin-4-ylmethyl)ethane-1,2-diamine (M1), N,N‧-bis(pyridin-3-ylmethyl)ethane-1,2-diamine (M2), N,N‧-bis(pyridin-2-ylmethyl)ethane-1,2-diamine (M3), N,N‧-bis(pyridin-4-ylmethyl)propane-1,3-diamine (M4), N,N‧-bis(pyridin-3-ylmethyl)propane-1,2-diamine (M5), and N,N‧-bis(pyridin-2-ylmethyl)propane-1,3-diamine (M6), with phosphoric acid (H3PO4) in different ratio (1:2 and 1:4), leads to the formation of nine salts, H2M12+·2H2PO4-·4H2O (1), H2M22+·2H2PO4-·2H2O (2), H2M32+·2H2PO4-·2H2O (3), H4M14+·4H2PO4- (4), H4M24+·4H2PO4- (5), H4M34+·4H2PO4- (6), H2M42+·2H2PO4-·3H2O (7), 2H2M52+·4H2PO4-·2H3PO4 (8), and H2M62+·2H2PO4- (9), which have been characterized by elemental analysis, IR, TG, PL, powder and single-crystal X-ray diffraction. Structural analyses indicate that hydrogen-bonding patterns of H2PO4- anions, conformation of protonated cations can effectively influence the supramolecular architectures through diverse non-covalent interactions. Hydrous salts 1-3 and 7 present 2D and 3D host-guest supramolecular networks, in which the connection of H2PO4- anions and water molecules generates diverse tape and layer motifs. H2PO4- anions in anhydrous salts 4-6 interconnect with each other through hydrogen bonds to form two types of layers, which are joined by discrete H4M4+ cations into 3D inorganic-organic hybrid supramolecular networks. Salts 8-9 also present 2D and 3D host-guest supramolecular networks where the interconnection of H2PO4- anions and its combination with H3PO4 molecules leads to diverse layers. Luminescent analyses indicate that salts 1-9 exhibit violet and blue emission maximum in the range of 390-467 nm at room temperature.
Discrimination of mineral waters using near infrared spectroscopy and aquaphotomics
Directory of Open Access Journals (Sweden)
Munćan Jelena S.
2014-01-01
Full Text Available Despite that water is one of the most studied materials today its dynamic properties are still not well understood. Water state in human organism is of high importance for normal healthy functioning of human body. Different kinds of water are usually classified according to its present solutes, and concentrations of these solutes, but though it is known that water molecules can form clusters around present solutes, classification of waters based on types of water molecular organization and present clusters is not present in current literature. In this study we used multivariate analysis for classification of commercial mineral waters based on their near infrared spectra (NIR. Further, we applied Aquaphotomics, a new approach for interpretation of near infrared spectra of water, which gives insight into organization of water molecules in each of these waters.
Modelling of energetic molecule-surface interactions
International Nuclear Information System (INIS)
Kerford, M.
2000-09-01
This thesis contains the results of molecular dynamics simulations of molecule-surface interactions, looking particularly at fullerene molecules and carbon surfaces. Energetic impacts of fullerene molecules on graphite create defect craters. The relationship between the parameters of the impacting molecule and the parameters of the crater axe examined and found to be a function of the energy and velocity of the impacting molecule. Less energetic fullerene molecules can be scattered from a graphite surface and the partitioning of energy after a scattering event is investigated. It is found that a large fraction of the kinetic energy retained after impact is translational energy, with a small fraction of rotational energy and a number of vibrational modes. At impact energies where the surface is not broken and at normal incidence, surface waves axe seen to occur. These waves axe used to develop a method of desorbing molecules from a graphite surface without damage to either the surface or the molecules being desorbed. A number of fullerene molecules are investigated and ways to increase the desorption yield are examined. It is found that this is a successful technique for desorbing large numbers of intact molecules from graphite. This technique could be used for desorbing intact molecules into a gas phase for mass spectrometric analysis. (author)
The selective addition of water
Resch, V.; Hanefeld, U.
2014-01-01
Water is omnipresent and essential. Yet at the same time it is a rather unreactive molecule. The direct addition of water to C[double bond, length as m-dash]C double bonds is therefore a challenge not answered convincingly. In this perspective we critically evaluate the selectivity and the
Dependence of partial molecules surface area on the third component in lyotropic liquid crystals
International Nuclear Information System (INIS)
Badalyan, H.G.; Ghazaryan, Kh.M.; Yayloyan, S.M.
2015-01-01
Free surface of one amphiphilic molecule head of a lyotropic liquid crystal has been investigated by X-Ray diffraction method, at small and large angles, in the presence of the third component. The pentadecilsulphonat-water system in the presence of cholesterol as well as the lecithin-water system in the presence of decanol were investigated. It is shown that the above mentioned free surface decreases if the cholesterol concentration increases, while this surface increases in the case of water concentration increase. However, it increases slower than in the case of the two-component system. The same is observed for the lecithin-water-decanol system
Quantitative measurement of water diffusion lifetimes at a protein/DNA interface by NMR
International Nuclear Information System (INIS)
Gruschus, James M.; Ferretti, James A.
2001-01-01
Hydration site lifetimes of slowly diffusing water molecules at the protein/DNA interface of the vnd/NK-2 homeodomain DNA complex were determined using novel three-dimensional NMR techniques. The lifetimes were calculated using the ratios of ROE and NOE cross-relaxation rates between the water and the protein backbone and side chain amides. This calculation of the lifetimes is based on a model of the spectral density function of the water-protein interaction consisting of three timescales of motion: fast vibrational/rotational motion, diffusion into/out of the hydration site, and overall macromolecular tumbling. The lifetimes measured ranged from approximately 400 ps to more than 5 ns, and nearly all the slowly diffusing water molecules detected lie at the protein/DNA interface. A quantitative analysis of relayed water cross-relaxation indicated that even at very short mixing times, 5 ms for ROESY and 12 ms for NOESY, relay of magnetization can make a small but detectable contribution to the measured rates. The temperature dependences of the NOE rates were measured to help discriminate direct dipolar cross-relaxation from chemical exchange. Comparison with several X-ray structures of homeodomain/DNA complexes reveals a strong correspondence between water molecules in conserved locations and the slowly diffusing water molecules detected by NMR. A homology model based on the X-ray structures was created to visualize the conserved water molecules detected at the vnd/NK-2 homeodomain DNA interface. Two chains of water molecules are seen at the right and left sides of the major groove, adjacent to the third helix of the homeodomain. Two water-mediated hydrogen bond bridges spanning the protein/DNA interface are present in the model, one between the backbone of Phe8 and a DNA phosphate, and one between the side chain of Asn51 and a DNA phosphate. The hydrogen bond bridge between Asn51 and the DNA might be especially important since the DNA contact made by the invariant
Ultrafast Librational Relaxation of H2O in Liquid Water
DEFF Research Database (Denmark)
Petersen, Jakob; Møller, Klaus Braagaard; Rey, Rossend
2013-01-01
The ultrafast librational (hindered rotational) relaxation of a rotationally excited H2O molecule in pure liquid water is investigated by means of classical nonequilibrium molecular dynamics simulations and a power and work analysis. This analysis allows the mechanism of the energy transfer from...... the excited H2O to its water neighbors, which occurs on a sub-100 fs time scale, to be followed in molecular detail, i.e., to determine which water molecules receive the energy and in which degrees of freedom. It is found that the dominant energy flow is to the four hydrogen-bonded water partners in the first...
On the photophysics and photochemistry of the water dimer
Energy Technology Data Exchange (ETDEWEB)
Segarra-Marti, Javier; Merchan, Manuela [Instituto de Ciencia Molecular, Universitat de Valencia, P.O. Box 22085, 46071 Valencia (Spain); Roca-Sanjuan, Daniel; Lindh, Roland [Department of Chemistry - Angstroem, Theoretical Chemistry Program, Uppsala University, Box 518, 75120 Uppsala (Sweden)
2012-12-28
The photochemistry of the water dimer irradiated by UV light is studied by means of the complete active space perturbation theory//complete active space self-consistent field (CASPT2//CASSCF) method and accurate computational approaches like as minimum energy paths. Both electronic structure computations and ab initio molecular dynamics simulations are carried out. The results obtained show small shifts relative to a single water molecule on the vertical excitation energies of the dimer due to the hydrogen bond placed between the water donor (W{sub D}) and the water acceptor (W{sub A}). A red-shift and a blue-shift are predicted for the W{sub D} and W{sub A}, respectively, supporting previous theoretical and experimental results. The photoinduced chemistry of the water dimer is described as a process occurring between two single water molecules in which the effect of the hydrogen bond plays a minor role. Thus, the photoinduced decay routes correspond to two photodissociation processes, one for each water molecule. The proposed mechanism for the decay channels of the lowest-lying excited states of the system is established as the photochemical production of a hydrogen-bonded H{sub 2}O Horizontal-Ellipsis HO species plus a hydrogen H atom.
Microencapsulation of nanoemulsions: novel Trojan particles for bioactive lipid molecule delivery.
Li, Xiang; Anton, Nicolas; Ta, Thi Minh Chau; Zhao, Minjie; Messaddeq, Nadia; Vandamme, Thierry F
2011-01-01
Nanoemulsions consist of very stable nanodroplets of oil dispersed in an aqueous phase, typically below 300 nm in size. They can be used to obtain a very fine, homogeneous dispersion of lipophilic compounds in water, thus facilitating their handling and use in nanomedicine. However, the drawback is that they are suspended in an aqueous media. This study proposes a novel technique for drying lipid nanoemulsion suspensions to create so-called Trojan particles, ie, polymer microparticles (around 2 μm) which very homogeneously "entrap" the nano-oil droplets (around 150 nm) in their core. Microencapsulation of the nanoemulsions was performed using a spray-drying process and resulted in a dried powder of microparticles. By using a low-energy nanoemulsification method and relatively gentle spray-drying, the process was well suited to sensitive molecules. The model lipophilic molecule tested was vitamin E acetate, encapsulated at around 20% in dried powder. We showed that the presence of nanoemulsions in solution before spray-drying had a significant impact on microparticle size, distribution, and morphology. However, the process itself did not destroy the oil nanodroplets, which could easily be redispersed when the powder was put back in contact with water. High-performance liquid chromatography follow-up of the integrity of the vitamin E acetate showed that the molecules were intact throughout the process, as well as when conserved in their dried form. This study proposes a novel technique using a spray-drying process to microencapsulate nanoemulsions. The multiscale object formed, so-called Trojan microparticles, were shown to successfully encapsulate, protect, and release the lipid nanodroplets.
Valverde, Danillo; da Costa Ludwig, Zélia Maria; da Costa, Célia Regina; Ludwig, Valdemir; Georg, Herbert C.
2018-01-01
At physiological conditions, myriads of biomolecules (e.g., amino acids, peptides, and proteins) exist predominantly in the zwitterionic structural form and their biological functions will result in these conditions. However these geometrical structures are inaccessible energetically in the gas phase, and at this point, stabilization of amino-acids in physiological conditions is still under debate. In this paper, the electronic properties of a glycine molecule in the liquid environment were studied by performing a relaxation of the glycine geometry in liquid water using the free energy gradient method combined with a sequential quantum mechanics/molecular mechanics approach. A series of Monte Carlo Metropolis simulations of the glycine molecule embedded in liquid water, followed by only a quantum mechanical calculation in each of them were carried out. Both the local and global liquid environments were emphasized to obtain nuclear magnetic resonance (NMR) parameters for the glycine molecule in liquid water. The results of the equilibrium structure in solution and the systematic study of the hydrogen bonds were used to discard the direct proton transfer from the carboxyl group to the ammonium group of the glycine molecule in water solution. The calculations of the Density Functional Theory (DFT) were performed to study the polarization of the solvent in the parameters of nuclear magnetic resonance of the glycine molecule in liquid water. DFT calculations predicted isotropic chemical changes on the H, C, N, and O atoms of glycine in liquid water solution which agree with the available experimental data.
Directory of Open Access Journals (Sweden)
Danielle C. A. S. de Santana
2017-01-01
Full Text Available Ruthenium (Ru complexes have been studied as promising anticancer agents. Ru nitrosyl complex (Ru-NO is one which acts as a pro-drug for the release of nitric oxide (NO. The Ru-aqueous complex formed by the exchange of NO for a water molecule after NO release could also possess therapeutic effects. This study evaluates the influence of iontophoresis on enhancing the skin penetration of Ru-NO and Ru-aqueous and assesses its applicability as a tool in treating diverse skin diseases. Passive and iontophoretic (0.5 mA·cm−2 skin permeation of the complexes were performed for 4 h. The amount of Ru and NO in the stratum corneum (SC, viable epidermis (VE, and receptor solution was quantified while the influence of iontophoresis and irradiation on NO release from Ru-NO complex was also evaluated. Iontophoresis increased the amount of Ru-NO and Ru-aqueous recovered from the receptor solution by 15 and 400 times, respectively, as compared to passive permeation. Iontophoresis produced a higher accumulation of Ru-aqueous in the skin layers as compared to Ru-NO. At least 50% of Ru-NO penetrated the SC was stable after 4 h. The presence of Ru-NO in this skin layer suggests that further controlled release of NO can be achieved by photo-stimulation after iontophoresis.
Gnanasekaran, Ramachandran; Xu, Yao; Leitner, David M
2010-12-23
Water confined in proteins exhibits dynamics distinct from the dynamics of water in the bulk or near the surface of a biomolecule. We examine the water dynamics at the interface of the two globules of the homodimeric hemoglobin from Scapharca inaequivalvis (HbI) by molecular dynamics (MD) simulations, with focus on water-protein hydrogen bond lifetimes and rotational anisotropy of the interfacial waters. We find that relaxation of the waters at the interface of both deoxy- and oxy-HbI, which contain a cluster of 17 and 11 interfacial waters, respectively, is well described by stretched exponentials with exponents from 0.1 to 0.6 and relaxation times of tens to thousands of picoseconds. The interfacial water molecules of oxy-HbI exhibit slower rotational relaxation and hydrogen bond rearrangement than those of deoxy-HbI, consistent with an allosteric transition from unliganded to liganded conformers involving the expulsion of several water molecules from the interface. Though the interfacial waters are translationally and rotationally static on the picosecond time scale, they contribute to fast communication between the globules via vibrations. We find that the interfacial waters enhance vibrational energy transport across the interface by ≈10%.
Water structure around trehalose
Energy Technology Data Exchange (ETDEWEB)
Pagnotta, S.E. [Dipartimento di Fisica ' E. Amaldi' , Universita di Roma Tre, Via della Vasca Navale 84, 00146 Roma (Italy); CNISM-CNR, Unita di Roma Tre, Via della Vasca Navale 84, 00146 Roma (Italy)], E-mail: pagnotta@fis.uniroma3.it; Ricci, M.A.; Bruni, F. [Dipartimento di Fisica ' E. Amaldi' , Universita di Roma Tre, Via della Vasca Navale 84, 00146 Roma (Italy); McLain, S. [ISIS Facility, Rutherford Appleton Laboratories, Chilton, Didcot, Oxon OX11 0QX (United Kingdom); Magazu, S. [Dipartimento di Fisica, Universita di Messina, C. da Papardo 31, 98166 Messina (Italy)
2008-04-18
A diluted solution of trehalose in water has been investigated by means of neutron diffraction with isotopic H/D substitution of the water hydrogens. Data have been analyzed in terms of site-site radial distribution functions, via the EPSR simulation code. This is the first time that the capabilities of this data refinement method are tested against neutron diffraction data of a complex carbohydrate molecule. A small perturbation of water hydration shell and short hydrogen bonds between trehalose oxygens and water hydrogens has been evidenced.
Energy Technology Data Exchange (ETDEWEB)
Guo, G.J.; Zhang, Y.G.; Li, M.; Wu, C.H. [Chinese Academy of Sciences, Inst. of Geology and Geophysics, Beijing (China). Key Laboratory of the Study of Earth' s Deep Interior
2008-07-01
In hydrate research fields, the hydrate nucleation mechanism still remains as an unsolved question. The static lifetimes of cagelike water clusters (CLWC) immersed in bulk liquid water have recently been measured by performing molecular dynamics simulations in the methane-water system, during which the member-water molecules of CLWCs are not allowed to exchange with their surrounding water molecules. This paper presented a study that measured the dynamic lifetimes of CLWCs permitting such water exchanges. The study involved re-analysis of previous simulation data that were used to study the effect of methane adsorption on the static lifetimes of a dodecahedral water cluster (DWC). The dynamic lifetimes of the DWC were calculated. The results of lifetime measurements of DWC in different systems were provided. The implications of this study for hydrate nucleation were also discussed. It was found that the dynamic lifetimes of CLWCs were not less than the static lifetimes previously obtained, and their ratio increased with the lifetime values. The results strengthened that CLWCs are metastable structures in liquid water and the occurrence probability of long-lived CLWCs will increase if one uses the dynamic lifetimes instead of the static lifetimes. 13 refs., 1 tab., 3 figs.
Single-molecule dynamics in nanofabricated traps
Cohen, Adam
2009-03-01
The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.
Single molecules and nanotechnology
Vogel, Horst
2007-01-01
This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.
International Nuclear Information System (INIS)
Wu, N.; Wang, Q.
2012-01-01
The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.
UV-visible and resonance Raman spectroscopy of halogen molecules in clathrate hydrates
Energy Technology Data Exchange (ETDEWEB)
Janda, K.C.; Kerenskaya, G.; Goldsheleger, I.U.; Apkarian, V.A.; Fleischer, E.B. [California Univ., Irvine, CA (United States). Dept. of Chemistry
2008-07-01
Resonance Raman spectroscopy was used to study halogen clathrate hydrate solids. In particular, this paper presented an ultraviolet-visible spectra for a polycrystalline sample of chlorine clathrate hydrate and two single crystal samples of bromine clathrate hydrate. UV-visible spectroscopy was used to study the interactions between the halogen guest molecule and the host water lattice. The spectrum for chlorine hydrate had a strong temperature dependence, while the spectra for bromine clathrate hydrate single crystals had a stable cubic type 2 structure as well as a tetragonal structure. A metastable cubic type 1 structure was also observed. Resonance Raman spectroscopy showed how the molecules fit into the host cages. 25 refs., 2 tabs., 7 figs.
Organizing and addressing magnetic molecules.
Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta
2009-04-20
Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.
Water-mediated variability in the structure of relaxed-state haemoglobin
International Nuclear Information System (INIS)
Kaushal, Prem Singh; Sankaranarayanan, R.; Vijayan, M.
2008-01-01
Partial dehydration of high-salt horse methaemoglobin crystals tends to shift the structure from the R state to the R2 state, in agreement with previous observations that movements in the molecule resulting from changes in water content mimic those involved in protein action. The crystal structure of high-salt horse methaemoglobin has been determined at environmental relative humidities (r.h.) of 88, 79, 75 and 66%. The molecule is in the R state in the native and the r.h. 88% crystals. At r.h. 79%, the water content of the crystal is reduced and the molecule appears to move towards the R2 state. The crystals undergo a water-mediated transformation involving a doubling of one of the unit-cell parameters and an increase in water content when the environmental humidity is further reduced to r.h. 75%. The water content is now similar to that in the native crystals and the molecules are in the R state. The crystal structure at r.h. 66% is similar, but not identical, to that at r.h. 75%, but the solvent content is substantially reduced and the molecules have a quaternary structure that is in between those corresponding to the R and R2 states. Thus, variation in hydration leads to variation in the quaternary structure. Furthermore, partial dehydration appears to shift the structure from the R state to the R2 state. This observation is in agreement with the earlier conclusion that the changes in protein structure that accompany partial dehydration are similar to those that occur during protein action
Molecule-by-Molecule Writing Using a Focused Electron Beam
DEFF Research Database (Denmark)
Van Dorp, Willem F.; Zhang, Xiaoyan; Feringa, Ben L.
2012-01-01
atoms also be written with an electron beam? We verify this with focused electron-beam-induced deposition (FEBID), a direct-write technique that has the current record for the smallest feature written by (electron) optical lithography. We show that the deposition of an organometallic precursor...... on graphene can be followed molecule-by-molecule with FEBID. The results show that mechanisms that are inherent to the process inhibit a further increase in control over the process. Hence, our results present the resolution limit of (electron) optical lithography techniques. The writing of isolated...
Observation of pendular butterfly Rydberg molecules
Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig
2016-01-01
Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143
Passing Current through Touching Molecules
DEFF Research Database (Denmark)
Schull, G.; Frederiksen, Thomas; Brandbyge, Mads
2009-01-01
The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...
Enzyme Molecules in Solitary Confinement
Directory of Open Access Journals (Sweden)
Raphaela B. Liebherr
2014-09-01
Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.
Conformation and Aggregation of LKα14 Peptide in Bulk Water and at the Air/Water Interface.
Dalgicdir, Cahit; Sayar, Mehmet
2015-12-10
Historically, the protein folding problem has mainly been associated with understanding the relationship between amino acid sequence and structure. However, it is known that both the conformation of individual molecules and their aggregation strongly depend on the environmental conditions. Here, we study the aggregation behavior of the model peptide LKα14 (with amino acid sequence LKKLLKLLKKLLKL) in bulk water and at the air/water interface. We start by a quantitative analysis of the conformational space of a single LKα14 in bulk water. Next, in order to analyze the aggregation tendency of LKα14, by using the umbrella sampling technique we calculate the potential of mean force for pulling a single peptide from an n-molecule aggregate. In agreement with the experimental results, our calculations yield the optimal aggregate size as four. This equilibrium state is achieved by two opposing forces: Coulomb repulsion between the lysine side chains and the reduction of solvent accessible hydrophobic surface area upon aggregation. At the vacuum/water interface, however, even dimers of LKα14 become marginally stable, and any larger aggregate falls apart instantaneously. Our results indicate that even though the interface is highly influential in stabilizing the α-helix conformation for a single molecule, it significantly reduces the attraction between two LKα14 peptides, along with their aggregation tendency.
A Mott-like State of Molecules
International Nuclear Information System (INIS)
Duerr, S.; Volz, T.; Syassen, N.; Bauer, D. M.; Hansis, E.; Rempe, G.
2006-01-01
We prepare a quantum state where each site of an optical lattice is occupied by exactly one molecule. This is the same quantum state as in a Mott insulator of molecules in the limit of negligible tunneling. Unlike previous Mott insulators, our system consists of molecules which can collide inelastically. In the absence of the optical lattice these collisions would lead to fast loss of the molecules from the sample. To prepare the state, we start from a Mott insulator of atomic 87Rb with a central region, where each lattice site is occupied by exactly two atoms. We then associate molecules using a Feshbach resonance. Remaining atoms can be removed using blast light. Our method does not rely on the molecule-molecule interaction properties and is therefore applicable to many systems
Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions
Weber, J. Mathias; Adams, Christopher L.
2010-06-01
We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.
Dissociation in small molecules
International Nuclear Information System (INIS)
Dehmer, P.M.
1982-01-01
The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2
Synchrotron and small bio-molecules in gas phase and liquid environment: new opportunities in Brazil
Energy Technology Data Exchange (ETDEWEB)
Naves de Brito, A. [State University of Campinas (UNICAMP), SP (Brazil). Dept. of Applied Physics
2011-07-01
Full text: Two techniques are critically related to the photoelectric law, namely: photoelectron spectroscopy and photoelectron-photoion coincidence spectroscopy. Both are strongly used now a day within synchrotron laboratories. Our group is employing both to investigate fragmentation of bio-molecules in gas phase such as amino acids and DNA basis using V UV and soft x-ray photons. In the near future lager scale instruments developed in Brazil will allow unique opportunities to apply these two spectroscopic methods to molecules immersed in liquids such as water. We will present details from this advanced x-ray source and experimental stations with capabilities not present in other places in the world. Experiments connected to the molecular origin of live will be shown. Among them an experiment where we mimic the atmosphere at Titan moon producing bio- molecules will discussed. Another experiment will be presented where we test the Panspermia viability using special bacteria. We will also present experiments where frozen simple molecules connected to pre-biotic mate- rial are bombardment by UV photons and energetic particles showing interesting trends. Spectroscopic studies of gas phase photo-fragmentation of bio-molecules may be critical to understand in the future these molecules immersed in liquids. We plan to spend some time showing our recent results in this area. (author)
Hydride Molecules towards Nearby Galaxies
Monje, Raquel R.; La, Ngoc; Goldsmith, Paul
2018-06-01
Observations carried out by the Herschel Space Observatory revealed strong spectroscopic signatures from light hydride molecules within the Milky Way and nearby active galaxies. To better understand the chemical and physical conditions of the interstellar medium, we conducted the first comprehensive survey of hydrogen fluoride (HF) and water molecular lines observed through the SPIRE Fourier Transform Spectrometer. By collecting and analyzing the sub-millimeter spectra of over two hundred sources, we found that the HF J = 1 - 0 rotational transition which occurs at approximately 1232 GHz was detected in a total of 39 nearby galaxies both in absorption and emission. The analysis will determine the main excitation mechanism of HF in nearby galaxies and provide steady templates of the chemistry and physical conditions of the ISM to be used in the early universe, where observations of hydrides are more scarce.
Encaged molecules in external electric fields: A molecular "tug-of-war"
Gurav, Nalini D.; Gejji, Shridhar P.; Bartolotti, Libero J.; Pathak, Rajeev K.
2016-08-01
Response of polar molecules CH3OH and H2O2 and a non-polar molecule, CO2, as "guests" encapsulated in the dodecahedral water cage (H2O)20 "host," to an external, perturbative electric field is investigated theoretically. We employ the hybrid density-functionals M06-2X and ωB97X-D incorporating the effects of damped dispersion, in conjunction with the maug-cc-pVTZ basis set, amenable for a hydrogen bonding description. While the host cluster (cage) tends to confine the embedded guest molecule through cooperative hydrogen bonding, the applied electric field tends to rupture the cluster-composite by stretching it; these two competitive effects leading to a molecular "tug-of-war." The composite remains stable up to a maximal sustainable threshold electric field, beyond which, concomitant with the vanishing of the HOMO-LUMO gap, the field wins over and the cluster breaks down. The electric-field effects are gauged in terms of the changes in the molecular geometry of the confined species, interaction energy, molecular electrostatic potential surfaces, and frequency shifts of characteristic normal vibrations in the IR regime. Interestingly, beyond the characteristic threshold electric field, the labile, distorted host cluster fragmentizes, and the guest molecule still tethered to a remnant fragment, an effect attributed to the underlying hydrogen-bonded networks.
Bejagam, Karteek K; Singh, Samrendra; Deshmukh, Sanket A
2018-05-05
New Lennard-Jones parameters have been developed to describe the interactions between atomistic model of graphene, represented by REBO potential, and five commonly used all-atom water models, namely SPC, SPC/E, SPC/Fw, SPC/Fd, and TIP3P/Fs by employing particle swarm optimization (PSO) method. These new parameters were optimized to reproduce the macroscopic contact angle of water on a graphene sheet. The calculated line tension was in the order of 10 -11 J/m for the droplets of all water models. Our molecular dynamics simulations indicate the preferential orientation of water molecules near graphene-water interface with one OH bond pointing toward the graphene surface. Detailed analysis of simulation trajectories reveals the presence of water molecules with ≤∼1, ∼2, and ∼4 hydrogen bonds at the surface of air-water interface, graphene-water interface, and bulk region of the water droplet, respectively. Presence of water molecules with ≤∼1 and ∼2 hydrogen bonds suggest the existence of water clusters of different sizes at these interfaces. The trends observed in the libration, bending, and stretching bands of the vibrational spectra are closely associated with these structural features of water. The inhomogeneity in hydrogen bond network of water at the air-water and graphene-water interface is manifested by broadening of the peaks in the libration band for water present at these interfaces. The stretching band for the molecules in water droplet shows a blue shift as compared to the pure bulk water, which conjecture the presence of weaker hydrogen bond network in a droplet. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Burnham, Christian J.; Futera, Zdenek; English, Niall J.
2018-03-01
The force-matching method has been applied to parameterise an empirical potential model for water-water and water-hydrogen intermolecular interactions for use in clathrate-hydrate simulations containing hydrogen guest molecules. The underlying reference simulations constituted ab initio molecular dynamics (AIMD) of clathrate hydrates with various occupations of hydrogen-molecule guests. It is shown that the resultant model is able to reproduce AIMD-derived free-energy curves for the movement of a tagged hydrogen molecule between the water cages that make up the clathrate, thus giving us confidence in the model. Furthermore, with the aid of an umbrella-sampling algorithm, we calculate barrier heights for the force-matched model, yielding the free-energy barrier for a tagged molecule to move between cages. The barrier heights are reasonably large, being on the order of 30 kJ/mol, and are consistent with our previous studies with empirical models [C. J. Burnham and N. J. English, J. Phys. Chem. C 120, 16561 (2016) and C. J. Burnham et al., Phys. Chem. Chem. Phys. 19, 717 (2017)]. Our results are in opposition to the literature, which claims that this system may have very low barrier heights. We also compare results to that using the more ad hoc empirical model of Alavi et al. [J. Chem. Phys. 123, 024507 (2005)] and find that this model does very well when judged against the force-matched and ab initio simulation data.
Fragmentation of small molecules induced by 46 keV/amu N+ and N2+ projectiles
International Nuclear Information System (INIS)
Kovacs, S.T.S.; Juhasz, Z.; Herczku, P.; Sulik, B.
2012-01-01
Complete text of publication follows. Collisional molecule fragmentation experiments has gain increasing attention in several research and applied fields. In order to understand the fundamental processes of molecule fragmentation one has to start with collisions of small few-atomic molecules. Moreover, fragments of small molecules such as water can cause damages of large molecules (DNA) very effectively in living tissues. In the last few years a new experimental setup was developed at Atomki. It was designed especially for molecule fragmentation experiments. Now the measurements using this system are running routinely. In 2012 the studied targets were water vapor, methane and nitrogen gases, injected into the collision area by an effusive molecular gas jet system. 650 keV N + and 1,3 MeV N 2 + ions were used as projectiles produced by the VdG-5 electrostatic accelerator. The velocity of the two types of projectiles was the same. Energy and angular distribution of the produced fragments was measured by an energy dispersive electrostatic spectrometer. For atomic ionization a symmetric, diatomic molecular projectile (e.g. N 2 + ) yields about twice more electrons compared to those of singly charged ion projectiles of the same atom (N + ) at the same velocity. In such cases the two atomic centers in the molecular ion can be considered as two individual atomic centers. For the fragmentation of molecular targets the picture is not so simple because in this case close collision of two extended systems is investigated. As figure 1 and 2 show, the measured yields for molecular projectile is not simply twice of the ones for atomic projectile. The shape of the energy spectra are different. The measured data are under evaluation. Acknowledgements. This work was supported by the Hungarian National Science Foundation OTKA (Grant: K73703) and by the TAMOP-4.2.2/B-10/1-2010-0024 project. The project is cofinanced by the European Union and the European Social Fund.
Small-molecule inhibitors of toxT expression in Vibrio cholerae.
Anthouard, Rebecca; DiRita, Victor J
2013-08-06
Vibrio cholerae, a Gram-negative bacterium, infects humans and causes cholera, a severe disease characterized by vomiting and diarrhea. These symptoms are primarily caused by cholera toxin (CT), whose production by V. cholerae is tightly regulated by the virulence cascade. In this study, we designed and carried out a high-throughput chemical genetic screen to identify inhibitors of the virulence cascade. We identified three compounds, which we named toxtazin A and toxtazin B and B', representing two novel classes of toxT transcription inhibitors. All three compounds reduce production of both CT and the toxin-coregulated pilus (TCP), an important colonization factor. We present evidence that toxtazin A works at the level of the toxT promoter and that toxtazins B and B' work at the level of the tcpP promoter. Treatment with toxtazin B results in a 100-fold reduction in colonization in an infant mouse model of infection, though toxtazin A did not reduce colonization at the concentrations tested. These results add to the growing body of literature indicating that small-molecule inhibitors of virulence genes could be developed to treat infections, as alternatives to antibiotics become increasingly needed. V. cholerae caused more than 580,000 infections worldwide in 2011 alone (WHO, Wkly. Epidemiol. Rec. 87:289-304, 2012). Cholera is treated with an oral rehydration therapy consisting of water, glucose, and electrolytes. However, as V. cholerae is transmitted via contaminated water, treatment can be difficult for communities whose water source is contaminated. In this study, we address the need for new therapeutic approaches by targeting the production of the main virulence factor, cholera toxin (CT). The high-throughput screen presented here led to the identification of two novel classes of inhibitors of the virulence cascade in V. cholerae, toxtazin A and toxtazins B and B'. We demonstrate that (i) small-molecule inhibitors of virulence gene production can be
Molecular dynamics study of the solvation of calcium carbonate in water.
Bruneval, Fabien; Donadio, Davide; Parrinello, Michele
2007-10-25
We performed molecular dynamics simulations of diluted solutions of calcium carbonate in water. To this end, we combined and tested previous polarizable models. The carbonate anion forms long-living hydrogen bonds with water and shows an amphiphilic character, in which the water molecules are expelled in a region close to its C(3) symmetry axis. The calcium cation forms a strongly bound ion pair with the carbonate. The first hydration shell around the CaCO(3) pair is found to be very similar to the location of the water molecules surrounding CaCO(3) in ikaite, the hydrated mineral.
Burham, Norhafizah; Azlan Hamzah, Azrul; Yunas, Jumril; Yeop Majlis, Burhanuddin
2017-07-01
This paper presents a technique for separating biological molecules in mixture using nanoporous silicon membrane. Nanopores were formed using electrochemical etching process (ECE) by etching a prefabricated silicon membrane in hydrofluoric acid (HF) and ethanol, and then directly bonding it with PDMS to form a complete filtration system for separating biological molecules. Tygon S3™ tubings were used as fluid interconnection between PDMS molds and silicon membrane during testing. Electrochemical etching parameters were manipulated to control pore structure and size. In this work, nanopores with sizes of less than 50 nm, embedded on top of columnar structures have been fabricated using high current densities and variable HF concentrations. Zinc oxide was diluted with deionized (DI) water and mixed with biological molecules and non-biological particles, namely protein standard, serum albumin and sodium chloride. Zinc oxide particles were trapped on the nanoporous silicon surface, while biological molecules of sizes up to 12 nm penetrated the nanoporous silicon membrane. The filtered particles were inspected using a Zetasizer Nano SP for particle size measurement and count. The Zetasizer Nano SP results revealed that more than 95% of the biological molecules in the mixture were filtered out by the nanoporous silicon membrane. The nanoporous silicon membrane fabricated in this work is integratable into bio-MEMS and Lab-on-Chip components to separate two or more types of biomolecules at once. The membrane is especially useful for the development of artificial kidney.
Neutral molecules in tokamak edge plasma - role of vibrationally excited hydrogen molecules
International Nuclear Information System (INIS)
Cadez, I.; Cercek, M.; Pelicon, P.; Razpet, A.
2003-01-01
The role of neutral molecules in edge plasma is discussed with special emphasis on the vibrationally excited hydrogen. Neutral molecules are formed mostly by surface processes on the walls and then released to the edge plasma where they take part in volumetric reactions with other particles. Typically these molecules are formed in excited states and data are needed for their reactions on the wall and in the volume. Processes in edge plasma determine particle and energy flux what is especially critical issue in tokamak divertor region. Various cross sections and reaction rates are needed for modelling edge plasma and its interaction with walls. (author)
Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite
Yoon, Seyoon; Monteiro, Paulo J.M.
2013-01-01
The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current
Prediction of Water Binding to Protein Hydration Sites with a Discrete, Semiexplicit Solvent Model.
Setny, Piotr
2015-12-08
Buried water molecules are ubiquitous in protein structures and are found at the interface of most protein-ligand complexes. Determining their distribution and thermodynamic effect is a challenging yet important task, of great of practical value for the modeling of biomolecular structures and their interactions. In this study, we present a novel method aimed at the prediction of buried water molecules in protein structures and estimation of their binding free energies. It is based on a semiexplicit, discrete solvation model, which we previously introduced in the context of small molecule hydration. The method is applicable to all macromolecular structures described by a standard all-atom force field, and predicts complete solvent distribution within a single run with modest computational cost. We demonstrate that it indicates positions of buried hydration sites, including those filled by more than one water molecule, and accurately differentiates them from sterically accessible to water but void regions. The obtained estimates of water binding free energies are in fair agreement with reference results determined with the double decoupling method.
Directory of Open Access Journals (Sweden)
Max Greenfeld
Full Text Available Single molecule studies have expanded rapidly over the past decade and have the ability to provide an unprecedented level of understanding of biological systems. A common challenge upon introduction of novel, data-rich approaches is the management, processing, and analysis of the complex data sets that are generated. We provide a standardized approach for analyzing these data in the freely available software package SMART: Single Molecule Analysis Research Tool. SMART provides a format for organizing and easily accessing single molecule data, a general hidden Markov modeling algorithm for fitting an array of possible models specified by the user, a standardized data structure and graphical user interfaces to streamline the analysis and visualization of data. This approach guides experimental design, facilitating acquisition of the maximal information from single molecule experiments. SMART also provides a standardized format to allow dissemination of single molecule data and transparency in the analysis of reported data.
Water polygons in high-resolution protein crystal structures.
Lee, Jonas; Kim, Sung-Hou
2009-07-01
We have analyzed the interstitial water (ISW) structures in 1500 protein crystal structures deposited in the Protein Data Bank that have greater than 1.5 A resolution with less than 90% sequence similarity with each other. We observed varieties of polygonal water structures composed of three to eight water molecules. These polygons may represent the time- and space-averaged structures of "stable" water oligomers present in liquid water, and their presence as well as relative population may be relevant in understanding physical properties of liquid water at a given temperature. On an average, 13% of ISWs are localized enough to be visible by X-ray diffraction. Of those, averages of 78% are water molecules in the first water layer on the protein surface. Of the localized ISWs beyond the first layer, almost half of them form water polygons such as trigons, tetragons, as well as expected pentagons, hexagons, higher polygons, partial dodecahedrons, and disordered networks. Most of the octagons and nanogons are formed by fusion of smaller polygons. The trigons are most commonly observed. We suggest that our observation provides an experimental basis for including these water polygon structures in correlating and predicting various water properties in liquid state.
DEFF Research Database (Denmark)
Hammer, Bjørk; Wendt, Stefan; Besenbacher, Flemming
2010-01-01
Scanning Tunneling Microscopy (STM) studies and Density Functional Theory (DFT) investigations of the interaction of water with the rutile TiO2 (110) surface are summarized. From high-resolution STM the following reactions have been revealed: water adsorption and diffusion in the Ti troughs, water...... dissociation in bridging oxygen vacancies, assembly of adsorbed water monomers into rapidly diffusing water dimers, and formation of water dimers by reduction of oxygen molecules. The STM results are rationalized based on DFT calculations, revealing the bonding geometries and reaction pathways of the water...
Kinetics of water-mediated proton transfer in our atmosphere
International Nuclear Information System (INIS)
Loerting, T.
2000-07-01
Variational transition state theory and multidimensional tunneling methods on hybrid density functional theory generated hypersurfaces have been used to investigate the temperature dependence of the reaction rate constants of water-mediated proton transfer reactions relevant to the chemistry of our atmosphere, namely the hydration of sulfur dioxide and sulfur trioxide and the decomposition of chlorine nitrate. Highly accurate reaction barriers were calculated using ab initio methods taking into account most of the electron correlation, namely CCSD(T)/aug-cc-pVDZ//MP2/aug-cc-pVDZ and G2(MP2). On comparing the determined rate constants with laboratory and atmospheric data, the following points could be established: All of the investigated reactions are highly sensitive to changes in humidity, as water acts as efficient catalyst, i.e., the barrier to the reaction is reduced drastically. Present-day atmospheric chemistry can only be explained when a limited number of water molecules is available for the formation of molecular clusters. Both in the troposphere and in the stratosphere SO 3 is hydrated rather than SO 2 . SO 2 emissions have to be oxidized, therefore, before being subject to hydration. A mechanism involving two or three water molecules is relevant for the production of sulfate aerosols, which play a decisive role in the context of global climate change and acid rain. A third water molecule has the function of assisting double-proton transfer rather than acting as active participant in triple-proton transfer in the case of the hydration of sulfur oxides. The observed ozone depletion above Arctica and Antarctica can be explained either by decomposition of chlorine nitrate in the presence of three water molecules (triple proton transfer) or by decomposition of chlorine nitrate in the presence of one molecule of HCl and one molecule of water (double proton transfer). The preassociation reaction required for homogeneous gas-phase conversion of chlorine
Aqueous heterogeneity at the air/water interface revealed by 2D-HD-SFG spectroscopy.
Hsieh, Cho-Shuen; Okuno, Masanari; Hunger, Johannes; Backus, Ellen H G; Nagata, Yuki; Bonn, Mischa
2014-07-28
Water molecules interact strongly with each other through hydrogen bonds. This efficient intermolecular coupling causes strong delocalization of molecular vibrations in bulk water. We study intermolecular coupling at the air/water interface and find intermolecular coupling 1) to be significantly reduced and 2) to vary strongly for different water molecules at the interface--whereas in bulk water the coupling is homogeneous. For strongly hydrogen-bonded OH groups, coupling is roughly half of that of bulk water, due to the lower density in the near-surface region. For weakly hydrogen-bonded OH groups that absorb around 3500 cm(-1), which are assigned to the outermost, yet hydrogen-bonded OH groups pointing towards the liquid, coupling is further reduced by an additional factor of 2. Remarkably, despite the reduced structural constraints imposed by the interfacial hydrogen-bond environment, the structural relaxation is slow and the intermolecular coupling of these water molecules is weak. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Portier, M.
2007-12-01
We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)
International Nuclear Information System (INIS)
Hu Sheng; Wang Heyi; Luo Shunzhong
2009-04-01
Based on electron and vibration approximate means and the density function theory B3LYP, the ΔG degree and equilibrium pressures of adsorption and dissociation reactions of H 2 and water vapor on Pt surface have been calculated. The adsorption, dissociation and coadsorption actions of H 2 and water were analyzed. According to the ΔG degree, hydrogen molecule combines with metal atoms in single atom, and water vapor molecule has no tendency to dissociate on Pt surface. The dissociation of hydrogen molecule would hold back the direct adsorption of water vapor molecules on Pt surface. The structures of Pt-H (OH 2 ) n + (n=1, 2, 3) hydroniums were optimized. According to the mulliken overlap populations, Pt-H (OH 2 ) + is not stable or produced. Hydrogen isotope exchange occurs between hydration layer and D atoms which adsorb on Pt surface via intermediates (H 2 O) n D + (ads) (n≥2). (authors)
Water-soluble carbon nanotube compositions for drug delivery and medicinal applications
Tour, James M.; Lucente-Schultz, Rebecca; Leonard, Ashley; Kosynkin, Dmitry V.; Price, Brandi Katherine; Hudson, Jared L.; Conyers, Jr., Jodie L.; Moore, Valerie C.; Casscells, S. Ward; Myers, Jeffrey N.; Milas, Zvonimir L.; Mason, Kathy A.; Milas, Luka
2014-07-22
Compositions comprising a plurality of functionalized carbon nanotubes and at least one type of payload molecule are provided herein. The compositions are soluble in water and PBS in some embodiments. In certain embodiments, the payload molecules are insoluble in water. Methods are described for making the compositions and administering the compositions. An extended release formulation for paclitaxel utilizing functionalized carbon nanotubes is also described.
Influence of fine water droplets to temperature and humidity
Hafidzal, M. H. M.; Hamzah, A.; Manaf, M. Z. A.; Saadun, M. N. A.; Zakaria, M. S.; Roslizar, A.; Jumaidin, R.
2015-05-01
Excessively dry air can cause dry skin, dry eyes and exacerbation of medical conditions. Therefore, many researches have been done in order to increase humidity in our environment. One of the ways is by using water droplets. Nowadays, it is well known in market stand fan equipped with water mister in order to increase the humidity of certain area. In this study, the same concept is applied to the ceiling fan. This study uses a model that combines a humidifier which functions as cooler, ceiling fan and scaled down model of house. The objective of this study is to analyze the influence of ceiling fan humidifier to the temperature and humidity in a house. The mechanism of this small model uses batteries as the power source, connected to the fan and the humidifier. The small water tank's function is to store and supply water to the humidifier. The humidifier is used to cool the room by changing water phase to fine water droplets. Fine water droplets are created from mechanism of the humidifier, which is by increasing the kinetic energy of water molecule using high frequency vibration that overcome the holding force between water molecules. Thus, the molecule of water will change to state of gas or mist. The fan is used to spread out the mist of water to surrounding of the room in order to enhance the humidity. Thermocouple and humidity meter are used to measure temperature and humidity in some period of times. The result shows that humidity increases and temperature decreases with time. This application of water droplet can be applied in the vehicles and engine in order to decrease the temperature.
Indian Academy of Sciences (India)
Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...
Emergence of the Coherent Structure of Liquid Water
Directory of Open Access Journals (Sweden)
Ivan Bono
2012-07-01
Full Text Available We examine in some detail the interaction of water molecules with the radiative electromagnetic field and find the existence of phase transitions from the vapor phase to a condensed phase where all molecules oscillate in unison, in tune with a self-trapped electromagnetic field within extended mesoscopic space regions (Coherence Domains. The properties of such a condensed phase are examined and found to be compatible with the phenomenological properties of liquid water. In particular, the observed value of critical density is calculated with good accuracy.
Theoretical Study of Sodium-Water Surface Reaction Mechanism
Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro
Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR).
Theoretical study of sodium-water surface reaction mechanism
International Nuclear Information System (INIS)
Kikuchi, Shin; Kurihara, Akikazu; Ohshima, Hiroyuki; Hashimoto, Kenro
2012-01-01
Computational study of the sodium-water reaction at the gas (water) - liquid (sodium) interface has been carried out using the ab initio (first-principle) method. A possible reaction channel has been identified for the stepwise OH bond dissociations of a single water molecule. The energetics including the binding energy of a water molecule on the sodium surface, the activation energies of the bond cleavages, and the reaction energies, have been evaluated, and the rate constants of the first and second OH bond-breakings have been compared. It was found that the estimated rate constant of the former was much larger than the latter. The results are the basis for constructing the chemical reaction model used in a multi-dimensional sodium-water reaction code, SERAPHIM, being developed by Japan Atomic Energy Agency (JAEA) toward the safety assessment of the steam generator (SG) in a sodium-cooled fast reactor (SFR). (author)
Water-Protein Interactions: The Secret of Protein Dynamics
Directory of Open Access Journals (Sweden)
Silvia Martini
2013-01-01
Full Text Available Water-protein interactions help to maintain flexible conformation conditions which are required for multifunctional protein recognition processes. The intimate relationship between the protein surface and hydration water can be analyzed by studying experimental water properties measured in protein systems in solution. In particular, proteins in solution modify the structure and the dynamics of the bulk water at the solute-solvent interface. The ordering effects of proteins on hydration water are extended for several angstroms. In this paper we propose a method for analyzing the dynamical properties of the water molecules present in the hydration shells of proteins. The approach is based on the analysis of the effects of protein-solvent interactions on water protons NMR relaxation parameters. NMR relaxation parameters, especially the nonselective (R1NS and selective (R1SE spin-lattice relaxation rates of water protons, are useful for investigating the solvent dynamics at the macromolecule-solvent interfaces as well as the perturbation effects caused by the water-macromolecule interactions on the solvent dynamical properties. In this paper we demonstrate that Nuclear Magnetic Resonance Spectroscopy can be used to determine the dynamical contributions of proteins to the water molecules belonging to their hydration shells.
Dissociation and decay of ultracold sodium molecules
International Nuclear Information System (INIS)
Mukaiyama, T.; Abo-Shaeer, J.R.; Xu, K.; Chin, J.K.; Ketterle, W.
2004-01-01
The dissociation of ultracold molecules was studied by ramping an external magnetic field through a Feshbach resonance. The observed dissociation energies directly yielded the strength of the atom-molecule coupling. They showed nonlinear dependence on the ramp speed. This was explained by a Wigner threshold law which predicts that the decay rate of the molecules above threshold increases with the density of states. In addition, inelastic molecule-molecule and molecule-atom collisions were characterized
Directory of Open Access Journals (Sweden)
Arindam Chakraborty
2006-03-01
Full Text Available In order to settle the issue of equivalence or non-equivalence of the two lone pairsof electrons on oxygen atom in water molecule, a quantum chemical study of the dipolecorrelation of the electronic structure of the molecule as a function of conformationsgenerated following the normal modes of vibrations between the two extremeconformations, C2v (∠HOH at 90o and DâˆÂh (∠HOH at 180o, including the equilibrium one,has been performed. The study invokes quantum mechanical partitioning of moleculardipoles into bond moment and lone pair moment and localization of delocalized canonicalmolecular orbitals, CMO’s into localized molecular orbitals, LMO’s. An earlier suggestion,on the basis of photoelectron spectroscopy, that one lone pair is in p-type and the other is ins-type orbital of O atom of water molecule at its equilibrium shape, and also the qualitative“Squirrel Ears†structure are brought under serious scrutiny. A large number ofconformations are generated and the charge density matrix, dipole moment of eachconformation is computed in terms of the generated canonical molecular orbitals, CMO’sand then Sinanoğlu’s localization method is invoked to localize the CMO’s of eachconformation and the quantum mechanical hybridizations of all the bonds and lone pairs onO center are evaluated in terms of the localized molecular orbitals. Computed datademonstrate that the electronic structures i.e. two bond pairs and two lone pairs and itshybridization status of all conformations of water molecule are straightforward in terms ofthe LMO’s. It is further revealed that the pattern of orbital hybridization changescontinuously as a function of evolution of molecular shape. The close analysis of thegenerated LMO’s reveals that one lone pair is accommodated in a pure p orbital and anotherlone pair is in a hybrid
Energy Technology Data Exchange (ETDEWEB)
Nilsson, Anders
2009-02-24
Water, H2O, is familiar to everyone - it shapes our bodies and our planet. But despite its abundance, water has remained a mystery, exhibiting many strange properties that are still not understood. Why does the liquid have an unusually large capacity to store heat? And why is it denser than ice? Now, using the intense X-ray beams from particle accelerators, investigations into water are leading to fundamental discoveries about the structure and arrangement of water molecules. This lecture will elucidate the many mysteries of water and discuss current studies that are revolutionizing the way we see and understand one of the most fundamental substances of life.
Single-Molecule Interfacial Electron Transfer
Energy Technology Data Exchange (ETDEWEB)
Lu, H. Peter [Bowling Green State Univ., Bowling Green, OH (United States). Dept. of Chemistry and Center for Photochemical Sciences
2017-11-28
This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static and dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO2 nanoparticle surfaces by using ultrafast single-molecule
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...
Glass transition and intermixing of amorphous water and methanol
International Nuclear Information System (INIS)
Souda, Ryutaro
2004-01-01
The diffusion of molecules in amorphous water and methanol films has been investigated on the basis of time-of-flight secondary ion mass spectrometry as a function of temperature. The glass-liquid transition of the amorphous water film occurs at 130-145 K as confirmed from the surface segregation of embedded methanol molecules. The morphology of the pure amorphous water film changes drastically at 160 K as a consequence of dewetting induced by the surface tension and the strongly decreased viscosity of the film. The morphology of the amorphous methanol film changes at 115 K following the self-diffusion onset at 80 K. The binary films of water and heavy methanol are intermixed completely at 136 K as evidenced by the occurrence of the H/D exchange
Structural and dynamical properties of water confined between two hydrophilic surfaces
Energy Technology Data Exchange (ETDEWEB)
Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)
2009-10-01
The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.
Structural and dynamical properties of water confined between two hydrophilic surfaces
International Nuclear Information System (INIS)
Di Napoli, Solange; Gamba, Zulema
2009-01-01
The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.
A study of small molecule ingress into planar and cylindrical materials using ion beam analysis
International Nuclear Information System (INIS)
Smith, R.W.
2001-12-01
Ion beam analysis techniques have been developed to allow profiling of small molecules diffused into materials at depths ranging from 10 -7 to 10 -1 m. A model DPS/PS/DPS triple-layer film and D( 3 He,p) 4 He nuclear reaction analysis was used to test the applicability of a novel data processing program - the IBA DataFurnace - to nuclear reaction data. The same reaction and program were used to depth profile the diffusion of heavy water into cellophane. A scanning 3 He micro-beam technique was developed to profile the diffusion of small molecules into both planar and cylindrical materials. The materials were exposed to liquids containing deuterium labelled molecules. A cross-section was exposed by cutting the material perpendicular to the surface and this was bombarded by a scanning 3 He micro-beam. Nuclear reaction analysis was used to profile the diffusing molecules, particle induced X-ray emission (in most cases) to locate the matrix and Rutherford backscattering for normalisation. Two-dimensional maps showing the molecular distribution over the cross-section were obtained. From these one-dimensional concentration profiles were produced. Water diffusion was studied into a planar and a cylindrical polymer, three different planar fibre optic grade glasses and both a fibre optic pressure sensor and communication fibre. The diffusion of dye into hair was also investigated. These studies have provided information about the diffusion mechanisms that take place, and where relevant diffusion coefficients have been obtained using either a semi-infinite medium Fickian planar diffusion model or a cylindrical Fickian diffusion model. (author)
Preface: Special Topic on Single-Molecule Biophysics.
Makarov, Dmitrii E; Schuler, Benjamin
2018-03-28
Single-molecule measurements are now almost routinely used to study biological systems and processes. The scope of this special topic emphasizes the physics side of single-molecule observations, with the goal of highlighting new developments in physical techniques as well as conceptual insights that single-molecule measurements bring to biophysics. This issue also comprises recent advances in theoretical physical models of single-molecule phenomena, interpretation of single-molecule signals, and fundamental areas of statistical mechanics that are related to single-molecule observations. A particular goal is to illustrate the increasing synergy between theory, simulation, and experiment in single-molecule biophysics.
Ajrian, E A; Sidorenko, S N
2002-01-01
The effect of the ion-molecule and intermolecular interactions on the formation of inter-ion average force potentials is investigated within the framework of a classical ion-dipole model of electrolyte solutions. These potentials are shown to possess the Coulomb asymptotics at large distances while in the region of mean distances they reveal creation and disintegration of solvent-shared ion pairs. The calculation results provide a qualitatively authentic physical picture which is experimentally observed in strong electrolytes solutions. In particular, an increased interaction between an ion and a molecule enhances formation of ion pairs in which the ions are separated by one solvent molecule
Characterizing water-metal interfaces and machine learning potential energy surfaces
Ryczko, Kevin
In this thesis, we first discuss the fundamentals of ab initio electronic structure theory and density functional theory (DFT). We also discuss statistics related to computing thermodynamic averages of molecular dynamics (MD). We then use this theory to analyze and compare the structural, dynamical, and electronic properties of liquid water next to prototypical metals including platinum, graphite, and graphene. Our results are built on Born-Oppenheimer molecular dynamics (BOMD) generated using density functional theory (DFT) which explicitly include van der Waals (vdW) interactions within a first principles approach. All calculations reported use large simulation cells, allowing for an accurate treatment of the water-electrode interfaces. We have included vdW interactions through the use of the optB86b-vdW exchange correlation functional. Comparisons with the Perdew-Burke-Ernzerhof (PBE) exchange correlation functional are also shown. We find an initial peak, due to chemisorption, in the density profile of the liquid water-Pt interface not seen in the liquid water-graphite interface, liquid watergraphene interface, nor interfaces studied previously. To further investigate this chemisorption peak, we also report differences in the electronic structure of single water molecules on both Pt and graphite surfaces. We find that a covalent bond forms between the single water molecule and the platinum surface, but not between the single water molecule and the graphite surface. We also discuss the effects that defects and dopants in the graphite and graphene surfaces have on the structure and dynamics of liquid water. Lastly, we introduce artificial neural networks (ANNs), and demonstrate how they can be used to machine learn electronic structure calculations. As a proof of principle, we show the success of an ANN potential energy surfaces for a dimer molecule with a Lennard-Jones potential.
Energy Technology Data Exchange (ETDEWEB)
Nocera, Daniel G. [Harvard Univ., Cambridge, MA (United States)
2013-03-15
The weakest link for the large-scale deployment of solar energy and for that matter, any renewable energy source, is its storage. The energy needs of future society demands are so large that storage must be in the form of fuels owing to their high energy density. Indeed, society has intuitively understood this disparity in energy density as it has developed over the last century as all large-scale energy storage in our society is in the form of fuels. But these fuels are carbon-based. The imperative for the discipline of chemistry, and more generally science, is to develop fuel storage methods that are easily scalable, carbon-neutral and sustainable. These methods demand the creation of catalysts to manage the multi-electron, multi-proton transformations of the conversion of small molecules into fuels. The splitting of water using solar light is a fuel-forming reaction that meets the imperative of large scale energy storage. As light does not directly act on water to engender its splitting into its elemental components, we have designed “hangman” catalysts to effect the energy conversion processes needed for the fuel forming reactions. The hangman construct utilizes a pendant acid/base functionality within the secondary coordination sphere that is “hung” above the redox platform onto which substrate binds. In this way, we can precisely control the delivery of a proton to the substrate, thus ensuring efficient coupling between the proton and electron. An emphasis was on the coupling of electron and proton in the hydrogen evolution reaction (HER) on Ni, Co and Fe porphyrin platforms. Electrokinetic rate laws were developed to define the proton-coupled electron transfer (PCET) mechanism. The HER of Co and Fe porphyrins was metal-centered. Surprisingly, HER this was not the case for Ni porphyrins. In this system, the PCET occurred at the porphyrin platform to give rise to a phlorin. This is one of the first examples of an HER occurring via ligand non
International Nuclear Information System (INIS)
Agundez, Marcelino; Cernicharo, Jose; Guelin, Michel
2010-01-01
A mechanism based on the penetration of interstellar ultraviolet photons into the inner layers of clumpy circumstellar envelopes (CSEs) around asymptotic giant branch stars is proposed to explain the non-equilibrium chemistry observed in such objects. We show through a simple modeling approach that in CSEs with a certain degree of clumpiness or with moderately low mass loss rates (a few 10 -7 M sun yr -1 ) a photochemistry can take place in the warm and dense inner layers, inducing important changes in the chemical composition. In carbon-rich objects water vapor and ammonia would be formed with abundances of 10 -8 -10 -6 relative to H 2 , while in oxygen-rich envelopes ammonia and carbon-bearing molecules such as HCN and CS would form with abundances of 10 -9 -10 -7 relative to H 2 . The proposed mechanism would explain the recent observation of warm water vapor in the carbon-rich envelope IRC+10216 with the Herschel Space Observatory and predict that H 2 O should be detectable in other carbon-rich objects.
Labelled molecules, modern research implements
International Nuclear Information System (INIS)
Pichat, L.; Langourieux, Y.
1974-01-01
Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14 CO 2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed [fr
Control of the selectivity of the aquaporin water channel family by global orientational tuning
DEFF Research Database (Denmark)
Jensen, Morten Østergaard; Tajkhorshid, E.; Nollert, P.
2002-01-01
and orientation of a single file of seven to nine water molecules inside the channel. Two conserved asparagines force a central water molecule to serve strictly as a hydrogen bond donor to its neighboring water molecules. Assisted by the electrostatic potential generated by two half-membrane spanning loops......Aquaporins are transmembrane channels found in cell membranes of all life forms. We examine their apparently paradoxical property, facilitation of efficient permeation of water while excluding protons, which is of critical importance to preserving the electrochemical potential across the cell...... membrane. We have determined the structure of the Escherichia coli aquaglyceroporin GlpF with bound water, in native (2.7 angstroms) and in W48F/F200T mutant (2.1 angstroms) forms, and carried out 12-nanosecond molecular dynamics simulations that define the spatial and temporal probability distribution...
Picosecond orientational dynamics of water in living cells.
Tros, Martijn; Zheng, Linli; Hunger, Johannes; Bonn, Mischa; Bonn, Daniel; Smits, Gertien J; Woutersen, Sander
2017-10-12
Cells are extremely crowded, and a central question in biology is how this affects the intracellular water. Here, we use ultrafast vibrational spectroscopy and dielectric-relaxation spectroscopy to observe the random orientational motion of water molecules inside living cells of three prototypical organisms: Escherichia coli, Saccharomyces cerevisiae (yeast), and spores of Bacillus subtilis. In all three organisms, most of the intracellular water exhibits the same random orientational motion as neat water (characteristic time constants ~9 and ~2 ps for the first-order and second-order orientational correlation functions), whereas a smaller fraction exhibits slower orientational dynamics. The fraction of slow intracellular water varies between organisms, ranging from ~20% in E. coli to ~45% in B. subtilis spores. Comparison with the water dynamics observed in solutions mimicking the chemical composition of (parts of) the cytosol shows that the slow water is bound mostly to proteins, and to a lesser extent to other biomolecules and ions.The cytoplasm's crowdedness leads one to expect that cell water is different from bulk water. By measuring the rotational motion of water molecules in living cells, Tros et al. find that apart from a small fraction of water solvating biomolecules, cell water has the same dynamics as bulk water.
Hybrid molecule/superconductor assemblies
International Nuclear Information System (INIS)
McDevitt, J.T.; Haupt, S.G.; Riley, D.R.; Zhao, J.; Zhou, J.P., Jones, C.
1993-01-01
The fabrication of electronic devices from molecular materials has attracted much attention recently. Schottky diodes, molecular transistors, metal-insulator-semiconductor diodes, MIS field effect transistors and light emitting diodes have all been prepared utilizing such substances. The active elements in these devices have been constructed by depositing the molecular phase onto the surface of a metal, semiconductor or insulating substrate. With the recent discovery of high temperature superconductivity, new opportunities now exist for the study of molecule/superconductor interactions as well as for the construction of novel hybrid molecule/superconductor devices. In this paper, methods for preparing the initial two composite molecule/semiconductor devices will be reported. Consequently, light sensors based on dye-coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor microbridges will be discussed. Moreover, molecule/superconductor energy and electron transfer phenomena will be illustrated also for the first time
First principles calculation on the adsorption of water on lithium-montmorillonite (Li-MMT)
International Nuclear Information System (INIS)
Wungu, Triati Dewi Kencana; Agusta, Mohammad Kemal; Saputro, Adhitya Gandaryus; Kasai, Hideaki; Dipojono, Hermawan Kresno
2012-01-01
The interaction of water molecules and lithium-montmorillonite (Li-MMT) is theoretically investigated using density functional theory (DFT) based first principles calculation. The mechanism of water adsorption at two different water concentrations on Li-MMT as well as their structural and electronic properties are investigated. It is found that the adsorption stability in Li-MMT is higher in higher water concentration. It is also found that an adsorbed water molecule on Li-MMT causes the Li to protrude from the MMT surface, so it is expected that Li may be mobile on H 2 O/Li-MMT.
First principles calculation on the adsorption of water on lithium-montmorillonite (Li-MMT).
Wungu, Triati Dewi Kencana; Agusta, Mohammad Kemal; Saputro, Adhitya Gandaryus; Dipojono, Hermawan Kresno; Kasai, Hideaki
2012-11-28
The interaction of water molecules and lithium-montmorillonite (Li-MMT) is theoretically investigated using density functional theory (DFT) based first principles calculation. The mechanism of water adsorption at two different water concentrations on Li-MMT as well as their structural and electronic properties are investigated. It is found that the adsorption stability in Li-MMT is higher in higher water concentration. It is also found that an adsorbed water molecule on Li-MMT causes the Li to protrude from the MMT surface, so it is expected that Li may be mobile on H(2)O/Li-MMT.
DEFF Research Database (Denmark)
Zhang, Jingdong; Chi, Qijin; Ulstrup, Jens
The structure, two-dimensional organization, and function of molecules immobilized on solid surfaces can be addressed in a degree of detail that has reached the level of the single-molecule. In this context redox molecules are “smart” molecules adding sophisticated electronic function. Redox meta...
Lotter, Andreas
2006-01-01
Water vapor plays an important role in Earth's radiative budget since water molecules strongly absorb the incoming solar shortwave and the outgoing thermal infrared radiation. Superimposed on the water monomer absorption, a water continuum absorption has long been recognized, but its true nature still remains controversial. On the one hand, this absorption is explained by a deformation of the line shape of the water monomer absorption lines as a consequence of a molecular collision. One the o...
Energy Technology Data Exchange (ETDEWEB)
Assary, R. S.; Curtiss, L. A. (Center for Nanoscale Materials); ( MSD); (Northwestern Univ.)
2012-02-01
Efficient chemical conversion of biomass is essential to produce sustainable energy and industrial chemicals. Industrial level conversion of glucose to useful chemicals, such as furfural, hydroxymethylfurfural, and levulinic acid, is a major step in the biomass conversion but is difficult because of the formation of undesired products and side reactions. To understand the molecular level reaction mechanisms involved in the decomposition of glucose and fructose, we have carried out high-level quantum chemical calculations [Gaussian-4 (G4) theory]. Selective 1,2-dehydration, keto-enol tautomerization, isomerization, retro-aldol condensation, and hydride shifts of glucose and fructose molecules were investigated. Detailed kinetic and thermodynamic analyses indicate that, for acyclic glucose and fructose molecules, the dehydration and isomerization require larger activation barriers compared to the retro-aldol reaction at 298 K in neutral medium. The retro-aldol reaction results in the formation of C2 and C4 species from glucose and C3 species from fructose. The formation of the most stable C3 species, dihydroxyacetone from fructose, is thermodynamically downhill. The 1,3-hydride shift leads to the cleavage of the C-C bond in the acyclic species; however, the enthalpy of activation is significantly higher (50-55 kcal/mol) than that of the retro-aldol reaction (38 kcal/mol) mainly because of the sterically hindered distorted four-membered transition state compared to the hexa-membered transition state in the retro-aldol reaction. Both tautomerization and dehydration are catalyzed by a water molecule in aqueous medium; however, water has little effect on the retro-aldol reaction. Isomerization of glucose to fructose and glyceraldehyde to dihydroxyacetone proceeds through hydride shifts that require an activation enthalpy of about 40 kcal/mol at 298 K in water medium. This investigation maps out accurate energetics of the decomposition of glucose and fructose molecules
Adsorption, folding, and packing of an amphiphilic peptide at the air/water interface.
Engin, Ozge; Sayar, Mehmet
2012-02-23
Peptide oligomers play an essential role as model compounds for identifying key motifs in protein structure formation and protein aggregation. Here, we present our results, based on extensive molecular dynamics simulations, on adsorption, folding, and packing within a surface monolayer of an amphiphilic peptide at the air/water interface. Experimental results suggest that these molecules spontaneously form ordered monolayers at the interface, adopting a β-hairpin-like structure within the surface layer. Our results reveal that the β-hairpin structure can be observed both in bulk and at the air/water interface. However, the presence of an interface leads to ideal partitioning of the hydrophobic and hydrophilic residues, and therefore reduces the conformational space for the molecule and increases the stability of the hairpin structure. We obtained the adsorption free energy of a single β-hairpin at the air/water interface, and analyzed the enthalpic and entropic contributions. The adsorption process is favored by two main factors: (1) Free-energy reduction due to desolvation of the hydrophobic side chains of the peptide and release of the water molecules which form a cage around these hydrophobic groups in bulk water. (2) Reduction of the total air/water contact area at the interface upon adsorption of the peptide amphiphile. By performing mutations on the original molecule, we demonstrated the relative role of key design features of the peptide. Finally, by analyzing the potential of mean force among two peptides at the interface, we investigated possible packing mechanisms for these molecules within the surface monolayer. © 2012 American Chemical Society
Turgman-Cohen, Salomon; Araque, Juan C.; Hoek, Eric M. V.; Escobedo, Fernando A.
2013-01-01
We consider an atomistic model to investigate the flux of water through thin Linde type A (LTA) zeolite membranes with differing surface chemistries. Using molecular dynamics, we have studied the flow of water under hydrostatic pressure through a fully hydrated LTA zeolite film (∼2.5 nm thick) capped with hydrophilic and hydrophobic moieties. Pressure drops in the 50-400 MPa range were applied across the membrane, and the flux of water was monitored for at least 15 ns of simulation time. For hydrophilic membranes, water molecules adsorb at the zeolite surface, creating a highly structured fluid layer. For hydrophobic membranes, a depletion of water molecules occurs near the water/zeolite interface. For both types of membranes, the water structure is independent of the pressure drop established in the system and the flux through the membranes is lower than that observed for the bulk zeolitic material; the latter allows an estimation of surface barrier effects to pressure-driven water transport. Mechanistically, it is observed that (i) bottlenecks form at the windows of the zeolite structure, preventing the free flow of water through the porous membrane, (ii) water molecules do not move through a cage in a single-file fashion but rather exhibit a broad range of residence times and pronounced mixing, and (iii) a periodic buildup of a pressure difference between inlet and outlet cages takes place which leads to the preferential flow of water molecules toward the low-pressure cages. © 2013 American Chemical Society.
Turgman-Cohen, Salomon
2013-10-08
We consider an atomistic model to investigate the flux of water through thin Linde type A (LTA) zeolite membranes with differing surface chemistries. Using molecular dynamics, we have studied the flow of water under hydrostatic pressure through a fully hydrated LTA zeolite film (∼2.5 nm thick) capped with hydrophilic and hydrophobic moieties. Pressure drops in the 50-400 MPa range were applied across the membrane, and the flux of water was monitored for at least 15 ns of simulation time. For hydrophilic membranes, water molecules adsorb at the zeolite surface, creating a highly structured fluid layer. For hydrophobic membranes, a depletion of water molecules occurs near the water/zeolite interface. For both types of membranes, the water structure is independent of the pressure drop established in the system and the flux through the membranes is lower than that observed for the bulk zeolitic material; the latter allows an estimation of surface barrier effects to pressure-driven water transport. Mechanistically, it is observed that (i) bottlenecks form at the windows of the zeolite structure, preventing the free flow of water through the porous membrane, (ii) water molecules do not move through a cage in a single-file fashion but rather exhibit a broad range of residence times and pronounced mixing, and (iii) a periodic buildup of a pressure difference between inlet and outlet cages takes place which leads to the preferential flow of water molecules toward the low-pressure cages. © 2013 American Chemical Society.
Boltzmann equation analysis of electron-molecule collision cross sections in water vapor and ammonia
International Nuclear Information System (INIS)
Yousfi, M.; Benabdessadok, M.D.
1996-01-01
Sets of electron-molecule collision cross sections for H 2 O and NH 3 have been determined from a classical technique of electron swarm parameter unfolding. This deconvolution method is based on a simplex algorithm using a powerful multiterm Boltzmann equation analysis established in the framework of the classical hydrodynamic approximation. It is well adapted for the simulation of the different classes of swarm experiments (i.e., time resolved, time of flight, and steady state experiments). The sets of collision cross sections that exist in the literature are reviewed and analyzed. Fitted sets of cross sections are determined for H 2 O and NH 3 which exhibit features characteristic of polar molecules such as high rotational excitation collision cross sections. The hydrodynamic swarm parameters (i.e., drift velocity, longitudinal and transverse diffusion coefficients, ionization and attachment coefficients) calculated from the fitted sets are in excellent agreement with the measured ones. These sets are finally used to calculate the transport and reaction coefficients needed for discharge modeling in two cases of typical gas mixtures for which experimental swarm data are very sparse or nonexistent (i.e., flue gas mixtures and gas mixtures for rf plasma surface treatment). copyright 1996 American Institute of Physics
International Nuclear Information System (INIS)
Gordon, R.J.
1990-01-01
An explanation is proposed for the qualitatively different types of behavior that have been reported for the vibrational relaxation of highly excited diatomic and polyatomic molecules. It is argued that all of the diatomic molecules that have been studied in bulk relax adiabatically at room temperature. In contrast, large polyatomic molecules have low frequency modes which act at ''doorway'' modes for the rest of the molecules, producing an impulsive relaxation mechanism. The theoretical work of Nesbitt and Hynes showed that impulsive collisions result in an exponential decay of the average vibrational energy of a Morse oscillator, whereas adiabatic collisions produce nonexponential power law behavior. We propose that this result explains a large body of data for the vibrational relaxation of small and large molecules
Asada, Toshio; Ando, Kanta; Bandyopadhyay, Pradipta; Koseki, Shiro
2016-09-08
A widely applicable free energy contribution analysis (FECA) method based on the quantum mechanical/molecular mechanical (QM/MM) approximation using response kernel approaches has been proposed to investigate the influences of environmental residues and/or atoms in the QM region on the free energy profile. This method can evaluate atomic contributions to the free energy along the reaction path including polarization effects on the QM region within a dramatically reduced computational time. The rate-limiting step in the deactivation of the β-lactam antibiotic cefalotin (CLS) by β-lactamase was studied using this method. The experimentally observed activation barrier was successfully reproduced by free energy perturbation calculations along the optimized reaction path that involved activation by the carboxylate moiety in CLS. It was found that the free energy profile in the QM region was slightly higher than the isolated energy and that two residues, Lys67 and Lys315, as well as water molecules deeply influenced the QM atoms associated with the bond alternation reaction in the acyl-enzyme intermediate. These facts suggested that the surrounding residues are favorable for the reactant complex and prevent the intermediate from being too stabilized to proceed to the following deacylation reaction. We have demonstrated that the free energy contribution analysis should be a useful method to investigate enzyme catalysis and to facilitate intelligent molecular design.
Stillinger, Frank H.
1980-07-01
Liquid water consists of a macroscopically connected, random network of hydrogen bonds, with frequent strained and broken bonds, that is continually undergoing topological reformation. Anomalous properties of water arise from the competition between relatively bulky ways of connecting molecules into local patterns characterized by strong bonds and nearly tetrahedral angles and more compact arrangements characterized by more strain and bond breakage. However, these alternatives constitute virtually a continuum of architectural possibilities rather than a discrete pair of options. The singular behavior of supercooled water near -45 degrees C and the ``hydrophobic'' attraction between nonpolar entities are due to the same underlying phenomenon, namely, the clumping tendency of relatively strain-free convex cages or polyhedra.
Hydrostatic pressure effect on PNIPAM cononsolvency in water-methanol solutions.
Pica, Andrea; Graziano, Giuseppe
2017-12-01
When methanol is added to water at room temperature and 1atm, poly (N-isopropylacrylamide), PNIPAM, undergoes a coil-to-globule collapse transition. This intriguing phenomenon is called cononsolvency. Spectroscopic measurements have shown that application of high hydrostatic pressure destroys PNIPAM cononsolvency in water-methanol solutions. We have developed a theoretical approach that identifies the decrease in solvent-excluded volume effect as the driving force of PNIPAM collapse on increasing the temperature. The same approach indicates that cononsolvency, at room temperature and P=1atm, is caused by the inability of PNIPAM to make all the attractive energetic interactions that it could be engaged in, due to competition between water and methanol molecules. The present analysis suggests that high hydrostatic pressure destroys cononsolvency because the coil state becomes more compact, and the quantity measuring PNIPAM-solvent attractions increases in magnitude due to the solution density increase, and the ability of small water molecules to substitute methanol molecules on PNIPAM surface. Copyright © 2017 Elsevier B.V. All rights reserved.
Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO
International Nuclear Information System (INIS)
Pal, Subrata; Maiti, Prabal K; Bagchi, Biman
2005-01-01
We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics
Jha, Santosh Kumar; Ji, Minbiao; Gaffney, Kelly J.; Boxer, Steven G.
2012-01-01
Little is known about the reorganization capacity of water molecules at the active sites of enzymes and how this couples to the catalytic reaction. Here, we study the dynamics of water molecules at the active site of a highly proficient enzyme, Δ5-3-ketosteroid isomerase (KSI), during a light-activated mimic of its catalytic cycle. Photo-excitation of a nitrile containing photo-acid, coumarin183 (C183), mimics the change in charge density that occurs at the active site of KSI during the first step of the catalytic reaction. The nitrile of C183 is exposed to water when bound to the KSI active site, and we used time-resolved vibrational spectroscopy as a site-specific probe to study the solvation dynamics of water molecules in the vicinity of the nitrile. We observed that water molecules at the active site of KSI are highly rigid, during the light-activated catalytic cycle, compared to the solvation dynamics observed in bulk water. Based upon this result we hypothesize that rigid water dipoles at the active site might help in the maintenance of the pre-organized electrostatic environment required for efficient catalysis. The results also demonstrate the utility of nitrile probes in measuring the dynamics of local (H-bonded) water molecules in contrast to the commonly used fluorescence methods which measure the average behavior of primary and subsequent spheres of solvation. PMID:22931297
International Nuclear Information System (INIS)
Pang Xiaofeng; Deng Bo
2008-01-01
Influences of magnetic field on microscopic structures and macroscopic properties of water are studied by the spectrum techniques of infrared, Raman, visible, ultraviolet lights and X-ray. From these investigations, we know that the magnetic fields change the distribution of molecules and electrons, cause displacements and polarization of molecules and atoms, result in changes of dipole-moment transition and vibrational states of molecules and variation of transition probability of electrons, but does not alter the constitution of molecules and atoms. These are helpful in seeking the mechanism of magnetization of water. Meanwhile, we also measure the changed rules of the surface tension force, soaking effect or angle of contact, viscosity, rheology features, refraction index, dielectric constant and electric conductivity of magnetized water relative to that of pure water. The results show that the magnetic fields increase the soaking degree and hydrophobicity of water to materials, depress its surface-tension force, diminish the viscosity of war, enhance the feature of plastic flowing of water, and increase the refraction index, dielectric constant and electric conductivity of water after magnetization. These changes are caused by the above changes of microscopic structures under the action of magnetic field. Therefore, our studies are significant in science and has practical value of applications
Luminescence stability of porous Si terminated by hydrophilic organic molecules
Matsumoto, Kimihisa; Kamiguchi, Masao; Kamiya, Kazuhide; Nomura, Takashi; Suzuki, Shinya
2016-02-01
The effects of the surface termination of a porous Si surface by propionic acid and by undecylenic acid on their hydrophilicity and luminescence stability were studied. In the measurements of the contact angle of water droplets on porous Si films, the hydrophilicity of porous Si is improved by the surface termination each types of organic molecule. The PL intensity of as-prepared porous Si decreased with increasing aging time in ambient air. As PL quenching involves PL blue shift and increasing Si-O bonds density, nonradiative recombination centers are formed in the surface oxide. After the hydrosilylation process of propionic acid and undecylenic acid, PL intensity decreased and became 30% that of as-prepared porous Si film. However, the PL intensity was stable and exceeded that of the as-prepared film after 1000 min of aging in the ambient air. The PL stabilities are contributed to the termination by organic molecules that inhibits surface oxidation.
Indian Academy of Sciences (India)
Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...
Spectroscopy and Chemistry of Cold Molecules
Momose, Takamasa
2012-06-01
Molecules at low temperatures are expected to behave quite differently from those at high temperatures because pronounced quantum effects emerge from thermal averages. Even at 10 K, a significant enhancement of reaction cross section is expected due to tunneling and resonance effects. Chemistry at this temperature is very important in order to understand chemical reactions in interstellar molecular clouds. At temperatures lower than 1 K, collisions and intermolecular interactions become qualitatively different from those at high temperatures because of the large thermal de Broglie wavelength of molecules. Collisions at these temperatures must be treated as the interference of molecular matter waves, but not as hard sphere collisions. A Bose-Einstein condensate is a significant state of matter as a result of coherent matter wave interaction. Especially, dense para-H_2 molecules are predicted to become a condensate even around 1 K. A convenient method to investigate molecules around 1 K is to dope molecules in cold matrices. Among various matrices, quantum hosts such as solid para-H_2 and superfluid He nano-droplets have been proven to be an excellent host for high-resolution spectroscopy. Rovibrational motion of molecules in these quantum hosts is well quantized on account of the weak interactions and the softness of quantum environment. The linewidths of infrared spectra of molecules in the quantum hosts are extremely narrow compared with those in other matrices. The sharp linewidths allow us to resolve fine spectral structures originated in subtle interactions between guest and host molecules. In this talk, I will describe how the splitting and lineshape of high-resolution spectra of molecules in quantum hosts give us new information on the static and dynamical interactions of molecules in quantum medium. The topics include dynamical response of superfluid environment upon rotational excitation, and possible superfluid phase of para-H_2 clusters. I will also
Isotope separation using vibrationally excited molecules
International Nuclear Information System (INIS)
Woodroffe, J.A.; Keck, J.C.
1977-01-01
A system for isotope separation or enrichment wherein molecules of a selected isotope type in a flow of molecules of plural isotope types are vibrationally excited and collided with a background gas to provide enhanced diffusivity for the molecules of the selected isotope type permitting their separate collection. The system typically is for the enrichment of uranium using a uranium hexafluoride gas in combination with a noble gas such as argon. The uranium hexafluoride molecules having a specific isotope of uranium are vibrationally excited by laser radiation. The vibrational energy is converted to a translation energy upon collision with a particle of the background gas and the added translation energy enhances the diffusivity of the selected hexafluoride molecules facilitating its condensation on collection surfaces provided for that purpose. This process is periodically interrupted and the cryogenic flow halted to permit evaporation of the collected molecules to provide a distinct, enriched flow
Conserved water-mediated H-bonding dynamics of catalytic Asn ...
Indian Academy of Sciences (India)
Prakash
Extensive energy minimization and molecular dynamics simulation studies up to 2 ns ... Conserved water in molecular recognition; MD simulation; plant cysteine protease ..... Mustata G and Briggs J M 2004 Cluster analysis of water molecules.
Water-dispersible nanoparticles via interdigitation of sodium ...
Indian Academy of Sciences (India)
Unknown
Abstract. This paper describes the formation of water-dispersible gold nano- particles capped with a bilayer of sodium dodecylsulphate (SDS) and octadecylamine. (ODA) molecules. Vigorous shaking of a biphasic mixture consisting of ODA-capped gold nanoparticles in chloroform and SDS in water results in the rapid ...
Lipoteichoic acid is an important microbe-associated molecular pattern of Lactobacillus rhamnosus GG
Directory of Open Access Journals (Sweden)
Claes Ingmar JJ
2012-12-01
Full Text Available Abstract Background Probiotic bacteria are increasingly used as immunomodulatory agents. Yet detailed molecular knowledge on the immunomodulatory molecules of these bacteria is lagging behind. Lipoteichoic acid (LTA is considered a major microbe-associated molecular pattern (MAMP of Gram-positive bacteria. However, many details and quantitative data on its immune signalling capacity are still unknown, especially in beneficial bacteria. Recently, we have demonstrated that a dltD mutant of the model probiotic Lactobacillus rhamnosus GG (LGG, having modified LTA molecules, has an enhanced probiotic efficacy in a DSS-induced colitis model as compared to wild-type. Results In this study, the importance of D-alanylated and acylated LTA for the pro-inflammatory activity of LGG was studied in vitro. Purified native LTA of LGG wild-type exhibited a concentration-dependent activation of NF-κB signalling in HEK293T cells after interaction with TLR2/6, but not with TLR2 alone. Chemical deacylation of LTA interfered with the TLR2/6 interaction, while a moderate effect was observed with chemical dealanylation. Similarly, the dltD mutant of LGG exhibited a significantly reduced capacity to activate TLR2/6-dependent NF-κB signalling in a HEK293T reporter cell line compared to wild-type. In addition, the dltD mutant of LGG showed a reduced induction of mRNA of the chemokine IL-8 in the Caco-2 epithelial cell line compared to wild-type. Experiments with highly purified LTA of LGG confirmed that LTA is a crucial factor for IL-8 mRNA induction in Caco-2 epithelial cells. Chemical dealanylation and deacylation reduced IL-8 mRNA expression. Conclusions Taken together, our results indicate that LTA of LGG is a crucial MAMP with pro-inflammatory activities such as IL-8 induction in intestinal epithelial cells and NF-κB induction in HEK293T cells via TLR2/6 interaction. The lipid chains of LGG LTA are needed for these activities, while also the D-alanine substituents
Energy Technology Data Exchange (ETDEWEB)
Roy, S.; Gruenbaum, S. M.; Skinner, J. L. [Theoretical Chemistry Institute and Department of Chemistry, 1101 University Ave., University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States)
2014-11-14
Understanding the structure of water near cell membranes is crucial for characterizing water-mediated events such as molecular transport. To obtain structural information of water near a membrane, it is useful to have a surface-selective technique that can probe only interfacial water molecules. One such technique is vibrational sum-frequency generation (VSFG) spectroscopy. As model systems for studying membrane headgroup/water interactions, in this paper we consider lipid and surfactant monolayers on water. We adopt a theoretical approach combining molecular dynamics simulations and phase-sensitive VSFG to investigate water structure near these interfaces. Our simulated spectra are in qualitative agreement with experiments and reveal orientational ordering of interfacial water molecules near cationic, anionic, and zwitterionic interfaces. OH bonds of water molecules point toward an anionic interface leading to a positive VSFG peak, whereas the water hydrogen atoms point away from a cationic interface leading to a negative VSFG peak. Coexistence of these two interfacial water species is observed near interfaces between water and mixtures of cationic and anionic lipids, as indicated by the presence of both negative and positive peaks in their VSFG spectra. In the case of a zwitterionic interface, OH orientation is toward the interface on the average, resulting in a positive VSFG peak.
Kinetics of proton migration in liquid water.
Chen, Hanning; Voth, Gregory A; Agmon, Noam
2010-01-14
We have utilized multistate empirical valence bond (MS-EVB3) simulations of protonated liquid water to calculate the relative mean-square displacement (MSD) and the history-independent time correlation function, c(t), of the hydrated proton center of excess charge (CEC) with respect to the water molecule on which it has initially resided. The MSD is nonlinear for the first 15 ps, suggesting that the relative diffusion coefficient increases from a small value, D(0), at short separations to its larger bulk value, D(infinity), at large separations. With the ensuing distance-dependent diffusion coefficient, D(r), the time dependence of both the MSD and c(t) agrees quantitatively with the solution of a diffusion equation for reversible geminate recombination. This suggests that the relative motion of the CEC is not independent from the nearby water molecules, in agreement with theoretical and experimental observations that large water clusters participate in the mechanism of proton mobility.
Directory of Open Access Journals (Sweden)
Dede R. Adawiyah
2012-06-01
Full Text Available The idea of water interaction with chemicals in the food dry matter or solid was inspired from gas interaction with surface active chemicals, almost a hundred years ago, such as association of gases with active carbon. However, until now the mechanisms and consequences of water molecule associated with chemicals in food solid is still in debate among the food scientists. The concept of water interaction or association with chemicals in the food solid or dry matter was initially introduced as water activity (aw, then in the terminology of “Bound Water”. Water activity concept was further developed by Labuza in 1960s. The concept or idea of glass transition temperature (Tg from Polymers Science discipline was applied to foods in decade of 1980 by Slade & Levine, who denied or negated the earlier concepts of bound water and water activity. In glass transition concept of food products, water functions as a plasticizer related to the textural properties and safety of the products. Knowledge of structure and behaviours of water molecule is required to understand how water interacts or associates with chemicals in food solid. The unique nature of water molecule is a tetrahedral structure with 4 polar angles, which behaves strongly binding or being bound by polar or ionic chemicals in food solid. A number of physicochemical forces act how water molecules interact in complex ways with chemicals in food solid, and the interaction among water molecules in foods. Both types of water interaction lead to the consept of three fractions of bound water as well as to the varities of food characteristics, including preservability and food qualities, either appraisable or unacceptable by consummers. Relationship analyses among various parameter data of associated water in foods such as aw, Me, Tg, and enriched by NMR data, specific weight and specific heat of bound water, indicated that among the different concepts of water interaction in foods were
Trapping molecules in two and three dimensions
International Nuclear Information System (INIS)
Pinkse, PW.H.; Junglen, T.; Rieger, T.; Rangwala, S.A.; Windpassinger, P.; Rempe, G.
2005-01-01
Full text: Cold molecules offer a new testing ground for quantum-physical effects in nature. For example, producing slow beams of large molecules could push experiments studying the boundary between quantum interference and classical particles up towards ever heavier particles. Moreover, cold molecules, in particular YbF, seem an attractive way to narrow down the constraints on the value of the electron dipole moment and finally, quantum information processing using chains of cold polar molecules or vibrational states in molecules have been proposed. All these proposals rely on advanced production and trapping techniques, most of which are still under development. Therefore, novel production and trapping techniques for cold molecules could offer new possibilities not found in previous methods. Electric traps hold promise for deep trap potentials for neutral molecules. Recently we have demonstrated two-dimensional trapping of polar molecules in a four-wire guide using electrostatic and electrodynamic trapping techniques. Filled from a thermal effusive source, such a guide will deliver a beam of slow molecules, which is an ideal source for interferometry experiments with large molecules, for instance. Here we report about the extension of this work to three-dimensional trapping. Polar molecules with a positive Stark shift can be trapped in the minimum of an electrostatic field. We have successfully tested a large volume electrostatic trap for ND3 molecules. A special feature of this trap is that it can be loaded continuously from an electrostatic guide, at a temperature of a few hundred mK. (author)
Measuring the internal energy content of molecules transported across the liquid-gas interface
International Nuclear Information System (INIS)
Maselli, Olivia J; Gascooke, Jason R; Buntine, Mark A; Lawrance, Warren D
2009-01-01
Many details concerning the mechanism associated with the liberation of molecules from a liquid surface remain to be elucidated. We use the liquid microjet technique coupled with laser spectroscopy to measure the rotational and vibrational energy content of benzene spontaneously evaporating from a water-ethanol solution. These measurements provide molecular level insight into the mass and energy transfer processes associated with evaporation.
Measuring the internal energy content of molecules transported across the liquid-gas interface
Energy Technology Data Exchange (ETDEWEB)
Maselli, Olivia J; Gascooke, Jason R; Buntine, Mark A [School of Chemistry and Physics, University of Adelaide, SA 5005 (Australia); Lawrance, Warren D, E-mail: m.buntine@curtin.edu.a [School of Chemistry, Physics and Earth Sciences, Flinders University, GPO Box 2100, Adelaide SA 5000 (Australia)
2009-09-01
Many details concerning the mechanism associated with the liberation of molecules from a liquid surface remain to be elucidated. We use the liquid microjet technique coupled with laser spectroscopy to measure the rotational and vibrational energy content of benzene spontaneously evaporating from a water-ethanol solution. These measurements provide molecular level insight into the mass and energy transfer processes associated with evaporation.
The water dimer II: Theoretical investigations
Energy Technology Data Exchange (ETDEWEB)
Mukhopadhyay, Anamika; Xantheas, Sotiris S.; Saykally, Richard J.
2018-03-29
As the archetype of hydrogen bonding between water molecules, the water dimer has been extensively studied by both theory and experiment for nearly seven decades. In this article, we present a detailed chronological review of the theoretical advances using electronic structure methods pertaining to the structure, hydrogen bonding and vibrational spectroscopy of the water dimer as well as the role of its potential energy surface in the development of classical force fields to describe intermolecular interaction in clusters and liquid water.
Theoretical Investigations Regarding Single Molecules
DEFF Research Database (Denmark)
Pedersen, Kim Georg Lind
Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...
Gao, Fengfeng
2014-12-18
Carboxyl asphaltene is commonly discussed in the petroleum industry. In most conditions, electroneutral carboxyl asphaltene molecules can be deprotonated to become carboxylate asphaltenes. Both in crude oil and at the oil/water interface, the characteristics of anionic carboxylate asphaltenes are different than those of the carboxyl asphaltenes. In this paper, molecular dynamics (MD) simulations are utilized to study the structural features of different asphaltene molecules, namely, C5 Pe and anionic C5 Pe, at the molecular level. In crude oil, the electroneutral C5 Pe molecules prefer to form a steady face-to-face stacking, while the anionic C5 Pe molecules are inclined to form face-to-face stacking and T-shaped II stacking because of the repulsion of the anionic headgroups. Anionic C5 Pe has a distinct affinity to the oil/water interface during the simulation, while the C5 Pe molecules persist in the crude oil domain. A three-stage model of anionic C5 Pe molecules adsorbed at the oil/water interface is finally developed.
Structure of bound water and refinement of acid metmyoglobin
International Nuclear Information System (INIS)
Raghaven, N.V.; Schoenborn, B.P.
1982-06-01
The structure of myoglobin has been determined by x-ray diffraction for the acidmet, deoxy, and the oxy forms. Neutron diffraction work, done in this laboratory, has demonstrated that hydrogen and deuterium positions can be located. In addition to the localization of H and D, neutron diffraction provides a unique method for studying the water structure because of the strong scattering ability of D 2 O. The scattering factor of deuterium is nearly twice as large as that of hydrogen, and it increases the visibility of water molecules in Fourier maps, so that in a neutron map a water molecule appears about three times as strong as in an equivalent electron-density map. (DT)
Water Evaporation and Conformational Changes from Partially Solvated Ubiquitin
Directory of Open Access Journals (Sweden)
Saravana Prakash Thirumuruganandham
2010-01-01
Full Text Available Using molecular dynamics simulation, we study the evaporation of water molecules off partially solvated ubiquitin. The evaporation and cooling rates are determined for a molecule at the initial temperature of 300 K. The cooling rate is found to be around 3 K/ns, and decreases with water temperature in the course of the evaporation. The conformation changes are monitored by studying a variety of intermediate partially solvated ubiquitin structures. We find that ubiquitin shrinks with decreasing hydration shell and exposes more of its hydrophilic surface area to the surrounding.
A study on the contact angles of a water droplet on smooth and rough solid surfaces
International Nuclear Information System (INIS)
Park, Ju Young; Ha, Man Yeong; Choi, Ho Jin; Hong, Seung Do; Yoon, Hyun Sik
2011-01-01
We investigated the wetting characteristics such as contact angle, wetting radius and topography of water droplets on smooth and random solid surfaces. Molecular dynamic simulation is employed to analyze the wetting behavior of water droplets on smooth and rough surfaces by considering different potential energy models of bond, angle, Lennard-Jones and Coulomb to calculate the interacting forces between water molecules. The Lennard-Jones potential energy model is adopted as an interaction model between water molecules and solid surface atoms. The randomly rough surface is generated by changing the standard deviation of roughness height from 1 A to 3 A with the fixed autocorrelation length. The size of water droplet considered is in the range from 2,000 to 5,000 molecules. The contact angles increase generally with increasing number of water molecules. For a hydrophobic surface whose characteristic energy is 0.1 kcal/mol, the contact angles depend rarely on the standard deviation of the roughness height. However, when the surface energy is 0.5 and 1.0 kcal/mol, the contact angles depend on both the roughness height of surfaces and droplet size
The hydrogen-bond network of water supports propagating optical phonon-like modes.
Elton, Daniel C; Fernández-Serra, Marivi
2016-01-04
The local structure of liquid water as a function of temperature is a source of intense research. This structure is intimately linked to the dynamics of water molecules, which can be measured using Raman and infrared spectroscopies. The assignment of spectral peaks depends on whether they are collective modes or single-molecule motions. Vibrational modes in liquids are usually considered to be associated to the motions of single molecules or small clusters. Using molecular dynamics simulations, here we find dispersive optical phonon-like modes in the librational and OH-stretching bands. We argue that on subpicosecond time scales these modes propagate through water's hydrogen-bond network over distances of up to 2 nm. In the long wavelength limit these optical modes exhibit longitudinal-transverse splitting, indicating the presence of coherent long-range dipole-dipole interactions, as in ice. Our results indicate the dynamics of liquid water have more similarities to ice than previously thought.
Djikaev, Yuri S; Ruckenstein, Eli
2015-07-01
Liquid water in a hydrophobic confinement is the object of high interest in physicochemical sciences. Confined between two macroscopic hydrophobic surfaces, liquid water transforms into vapor if the distance between surfaces is smaller than a critical separation, referred to as the evaporation lengthscale. To investigate the temperature dependence of the evaporation lengthscale of water confined between two hydrophobic parallel plates, we use the combination of the density functional theory (DFT) with the probabilistic hydrogen bond (PHB) model for water-water hydrogen bonding. The PHB model provides an analytic expression for the average number of hydrogen bonds per water molecule as a function of its distance to a hydrophobic surface and its curvature. Knowing this expression, one can implement the effect of hydrogen bonding between water molecules on their interaction with the hydrophobe into DFT, which is then employed to determine the distribution of water molecules between two macroscopic hydrophobic plates at various interplate distances and various temperatures. For water confined between hydrophobic plates, our results suggest the evaporation lengthscale to be of the order of several nanometers and a linearly increasing function of temperature from T=293 K to T=333 K, qualitatively consistent with previous results. Copyright © 2015 Elsevier Inc. All rights reserved.
Electron-molecule interactions and their applications
Christophorou, L G
1984-01-01
Electron-Molecule Interactions and Their Applications, Volume 2 provides a balanced and comprehensive account of electron-molecule interactions in dilute and dense gases and liquid media. This book consists of six chapters. Chapter 1 deals with electron transfer reactions, while Chapter 2 discusses electron-molecular positive-ion recombination. The electron motion in high-pressure gases and electron-molecule interactions from single- to multiple-collision conditions is deliberated in Chapter 3. In Chapter 4, knowledge on electron-molecule interactions in gases is linked to that on similar proc
Directory of Open Access Journals (Sweden)
Mostafa H Ahmed
Full Text Available There is a great interest in understanding and exploiting protein-protein associations as new routes for treating human disease. However, these associations are difficult to structurally characterize or model although the number of X-ray structures for protein-protein complexes is expanding. One feature of these complexes that has received little attention is the role of water molecules in the interfacial region.A data set of 4741 water molecules abstracted from 179 high-resolution (≤ 2.30 Å X-ray crystal structures of protein-protein complexes was analyzed with a suite of modeling tools based on the HINT forcefield and hydrogen-bonding geometry. A metric termed Relevance was used to classify the general roles of the water molecules.The water molecules were found to be involved in: a (bridging interactions with both proteins (21%, b favorable interactions with only one protein (53%, and c no interactions with either protein (26%. This trend is shown to be independent of the crystallographic resolution. Interactions with residue backbones are consistent for all classes and account for 21.5% of all interactions. Interactions with polar residues are significantly more common for the first group and interactions with non-polar residues dominate the last group. Waters interacting with both proteins stabilize on average the proteins' interaction (-0.46 kcal mol(-1, but the overall average contribution of a single water to the protein-protein interaction energy is unfavorable (+0.03 kcal mol(-1. Analysis of the waters without favorable interactions with either protein suggests that this is a conserved phenomenon: 42% of these waters have SASA ≤ 10 Å(2 and are thus largely buried, and 69% of these are within predominantly hydrophobic environments or "hydrophobic bubbles". Such water molecules may have an important biological purpose in mediating protein-protein interactions.
Electrically tunable spatially variable switching in ferroelectric liquid crystal/water system
Choudhary, A.; Coondoo, I.; Prakash, J.; Sreenivas, K.; Biradar, A. M.
2009-04-01
An unusual switching phenomenon in the region outside conducting patterned area in ferroelectric liquid crystal (FLC) containing about 1-2 wt % of water has been observed. The presence of water in the studied heterogeneous system was confirmed by Fourier transform infrared spectroscopy. The observed optical studies have been emphasized on the "spatially variable switching" phenomenon of the molecules in the nonconducting region of the cell. The observed phenomenon is due to diffusion of water between the smectic layers of the FLC and the interaction of the curved electric field lines with the FLC molecules in the nonconducting region.
Domain-based small molecule binding site annotation
Directory of Open Access Journals (Sweden)
Dumontier Michel
2006-03-01
Full Text Available Abstract Background Accurate small molecule binding site information for a protein can facilitate studies in drug docking, drug discovery and function prediction, but small molecule binding site protein sequence annotation is sparse. The Small Molecule Interaction Database (SMID, a database of protein domain-small molecule interactions, was created using structural data from the Protein Data Bank (PDB. More importantly it provides a means to predict small molecule binding sites on proteins with a known or unknown structure and unlike prior approaches, removes large numbers of false positive hits arising from transitive alignment errors, non-biologically significant small molecules and crystallographic conditions that overpredict ion binding sites. Description Using a set of co-crystallized protein-small molecule structures as a starting point, SMID interactions were generated by identifying protein domains that bind to small molecules, using NCBI's Reverse Position Specific BLAST (RPS-BLAST algorithm. SMID records are available for viewing at http://smid.blueprint.org. The SMID-BLAST tool provides accurate transitive annotation of small-molecule binding sites for proteins not found in the PDB. Given a protein sequence, SMID-BLAST identifies domains using RPS-BLAST and then lists potential small molecule ligands based on SMID records, as well as their aligned binding sites. A heuristic ligand score is calculated based on E-value, ligand residue identity and domain entropy to assign a level of confidence to hits found. SMID-BLAST predictions were validated against a set of 793 experimental small molecule interactions from the PDB, of which 472 (60% of predicted interactions identically matched the experimental small molecule and of these, 344 had greater than 80% of the binding site residues correctly identified. Further, we estimate that 45% of predictions which were not observed in the PDB validation set may be true positives. Conclusion By
Solomon, Philip M.
1973-01-01
Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)
Synergism of Saturn, Enceladus and Titan and Formation of HCNO Prebiotic Molecules
Sittler, Edward C.; Cooper, John F.
2011-01-01
Saturn as a system has two very exotic moons Titan and Enceladus. Titan, taking in energy from Saturn's magnetosphere, solar UV irradiation, and cosmic rays, can make HCN based molecules as discussed in earlier paper by Raulin and Owen. Space radiation effects at both moons, and as coupled by the Saturn magnetosphere, could cause an unexpected series of events potentially leading to prebiotic chemical evolution at Titan with HCNO from magnetospheric oxygen as the new ingredient. The "Old Faithful" model suggests that Enceladus, highly irradiated by Saturn magnetospheric electrons and thus having a source of chemical energy from radiolytic gas production, has episodic ejections of water vapor, carbon dioxide, and various hydrocarbons into Saturn's magnetosphere. The hydrocarbons do not survive transport through the plasma environment, but oxygen ions from Enceladus water molecules become the dominant ion species in the outer magnetosphere. At Titan, Cassini discovered that 1) keV oxygen ions, evidently from Enceladus, are bombarding Titan's upper atmosphere and 2) heavy positive and negative ions exist in significant abundances within Titan's upper atmosphere. Initial models of heavy ion formation in Titan's upper atmosphere invoked polymerization of aromatics such as benzenes and their radicals to make polycyclic aromatic hydrocarbons (PAH) , while a more recent model by Sittler et al., has raised the possibility of carbon chains forming from the polymerization of acetylene and its radicals to make fullerenes. Laboratory measurements indicate that fullerenes, which are hollow carbon shells, can trap keV oxygen ions. Clustering of the fullerenes with aerosol mixtures from PAHs and the dominant nitrogen molecules could form larger aerosols enriched in trapped oxygen. Aerosol precipitation could then convey these chemically complex structures deeper into the atmosphere and to the moon surface. Ionizing solar UV, magnetospheric electron, and galactic cosmic ray
Contamination of boreholes water by 76 pesticides molecules in the ...
African Journals Online (AJOL)
user2
to be the cause of the degradation of the quality of sur- face and ground waters ... network and the nature of the soil generally clay lateritic with high permeability. .... 0.006 0.008 0.004 0.004 0.004 0.007 0.008 0.004 0.004 0.004 Malathion.
Molecular motion of water molecules in lyotropic mesophases formed from fatty acid soaps
International Nuclear Information System (INIS)
Olszewski, K.J.; Pislewski, N.
1980-01-01
The results of study of self-diffusion coefficients and relaxation times for the mesophases formed from water mixtures of potassium laurate (denoted by C 12 K), myristate (C 14 K), and palmitate (C 16 K), are presented. The samples containing by weight 70% of soaps and 30% of water as well as samples containing 30% of soaps and 70% of water were examined. It allowed to obtain lamellar and middle phase respectively. (author)
Electrochemically-gated single-molecule electrical devices
International Nuclear Information System (INIS)
Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael
2013-01-01
In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour
Directory of Open Access Journals (Sweden)
Hironobu Saito
2018-06-01
Full Text Available Dynamics of solvent molecules restricted in poly (acryl amide gels immersed in solvent mixtures of acetone–, 1,4-dioxane–, and dimethyl sulfoxide–water were analyzed by the time domain reflectometry method of dielectric spectroscopy and the pulse field gradient method of nuclear magnetic resonance. Restrictions of dynamic behaviors of solvent molecules were evaluated from relaxation parameters such as the relaxation time, its distribution parameter, and the relaxation strength obtained by dielectric measurements, and similar behaviors with polymer concentration dependences for the solutions were obtained except for the high polymer concentration in collapsed gels. Scaling analyses for the relaxation time and diffusion coefficient respectively normalized by those for bulk solvent suggested that the scaling exponent determined from the scaling variable defined as a ratio of the size of solvent molecule to mesh size of polymer networks were three and unity, respectively, except for collapsed gels. The difference in these components reflects characteristic molecular interactions in the rotational and translational diffusions, and offered a physical picture of the restriction of solvent dynamics. A universal treatment of slow dynamics due to the restriction from polymer chains suggests a new methodology of characterization of water structures.
FlavorDB: a database of flavor molecules.
Garg, Neelansh; Sethupathy, Apuroop; Tuwani, Rudraksh; Nk, Rakhi; Dokania, Shubham; Iyer, Arvind; Gupta, Ayushi; Agrawal, Shubhra; Singh, Navjot; Shukla, Shubham; Kathuria, Kriti; Badhwar, Rahul; Kanji, Rakesh; Jain, Anupam; Kaur, Avneet; Nagpal, Rashmi; Bagler, Ganesh
2018-01-04
Flavor is an expression of olfactory and gustatory sensations experienced through a multitude of chemical processes triggered by molecules. Beyond their key role in defining taste and smell, flavor molecules also regulate metabolic processes with consequences to health. Such molecules present in natural sources have been an integral part of human history with limited success in attempts to create synthetic alternatives. Given their utility in various spheres of life such as food and fragrances, it is valuable to have a repository of flavor molecules, their natural sources, physicochemical properties, and sensory responses. FlavorDB (http://cosylab.iiitd.edu.in/flavordb) comprises of 25,595 flavor molecules representing an array of tastes and odors. Among these 2254 molecules are associated with 936 natural ingredients belonging to 34 categories. The dynamic, user-friendly interface of the resource facilitates exploration of flavor molecules for divergent applications: finding molecules matching a desired flavor or structure; exploring molecules of an ingredient; discovering novel food pairings; finding the molecular essence of food ingredients; associating chemical features with a flavor and more. Data-driven studies based on FlavorDB can pave the way for an improved understanding of flavor mechanisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Structure and stability of spiro-cyclic water clusters
Indian Academy of Sciences (India)
Administrator
Abstract. The structure and stability of spiro-cyclic water clusters containing up to 32 water molecules have been ... due to its importance in various real life systems. 1–8. High level ... It is well-known from the crystal structure data- base that the ...
International Nuclear Information System (INIS)
Bigelow, N.P.; Haimberger, C.; Kleinert, J.; Tscherneck, M.; Holmes, M.E.
2005-01-01
In the last 12 months several groups have demonstrated the use of photo association to create cold heteronuclear (polar) molecules. We report on the formation of translationally cold NaCs molecules starting from a laser-cooled atomic vapor of Na and Cs atoms. Colliding atoms are transferred into bound molecular states in a two-step photoactivated process. We find a translational temperature of T ≅ 260 mK. To increase the density and number of trapped atoms, dark-spot techniques are used on the MOT and a Zeeman slowed sodium beam is used to load the sodium atoms into the trap. Spectroscopy of these molecules is underway using time-of-flight ion detection and trap-loss. Initial REMPI measurements indicate that both singlet and triplet states are being populated by the spontaneous-decay driven process. We measure a rate constant for molecule formation of K NaCs = 7.43 · 10 15 cm 3 s -1 . (author)
Influence of Adsorbed Water on the Oxygen Evolution Reaction on Oxides
DEFF Research Database (Denmark)
Siahrostami, Samira; Vojvodic, Aleksandra
2015-01-01
We study the interface between adsorbed water and stoichiometric, defect-free (110) rutile oxide surfaces of TiO2, RuO2, and IrO2 in order to understand how water influences the stabilities of the intermediates of the oxygen evolution reaction (OER). In our model the water is treated as explicitly...... molecules binding to bridging oxygens. The third chain interacts weakly and predominantly with the H2O molecules of the second layer, resembling bulk water. We find that the stability of the water layer close to the oxide surface is almost the same as the one found on flat metal surfaces, such as the Pt(111...... of RuO2 and IrO2, while it is increased by similar to 0.4 eV for TiO2....
Formation of ultracold NaRb Feshbach molecules
International Nuclear Information System (INIS)
Wang, Fudong; He, Xiaodong; Li, Xiaoke; Zhu, Bing; Chen, Jun; Wang, Dajun
2015-01-01
We report the creation of ultracold bosonic 23 Na 87 Rb Feshbach molecules via magneto-association. By ramping the magnetic field across an interspecies Feshbach resonance (FR), at least 4000 molecules can be produced out of the near degenerate ultracold mixture. Fast loss due to inelastic atom–molecule collisions is observed, which limits the pure molecule number, after residual atoms removal, to 1700. The pure molecule sample can live for 21.8(8) ms in the optical trap, long enough for future molecular spectroscopy studies toward coherently transferring to the singlet ro-vibrational ground state, where these molecules are stable against chemical reaction and have a permanent electric dipole moment of 3.3 Debye. We have also measured the Feshbach molecule’s binding energy near the FR by the oscillating magnetic field method and found these molecules have a large closed-channel fraction. (paper)
Quantum transport through organic molecules
International Nuclear Information System (INIS)
Maiti, Santanu K.
2007-01-01
We investigate the electronic transport for the model of benzene-1, 4-dithiolate (BDT) molecule and some other geometric models of benzene molecule attached with two semi-infinite metallic electrodes by the use of Green's function technique. An analytic approach for the electronic transport through the molecular bridges is presented, based on the tight-binding model. Transport of electrons in such molecular bridges is strongly affected by the geometry of the molecules and their coupling strength with the electrodes. Conductance (g) shows resonance peaks associated with the molecular energy eigenstates. In the weak molecule-to-electrodes coupling limit current (I) passing through the molecules shows staircase-like behavior with sharp steps, while, it varies quite continuously in the limit of strong molecular coupling with the applied bias voltage (V). In presence of the transverse magnetic field conductance gives oscillatory behavior with flux φ, threaded by the molecular ring, showing φ 0 ( = ch/e) flux-quantum periodicity. Though conductance changes with the application of transverse magnetic field, but the current-voltage characteristics remain same in presence of this magnetic field for these molecular bridge systems
The tritium labelling of organic molecules by heterogeneous catalytic exchange
International Nuclear Information System (INIS)
Angoso, M.; Kaiser, F.
1977-01-01
The influence of the temperature at 65degC and 120degC on the labelling of three organic molecules with tritium was studied. The compounds were: benzoic acid, diphenyl glioxal and 2,3-tetramethylene-4-phenylthien-7-oxodiacetin. The method employed was the heterogeneous catalytic exchange between tritiaded water and the organic compound. The purification was made by thin-layer chromatography and the concentration, purity and specific activity of the products were determined by counting and ultraviolet techniques. The thermal stability and the radiolitic effects on labelled benzoic acid were also considered. (author) [es
Fluorescent Biosensors Based on Single-Molecule Counting.
Ma, Fei; Li, Ying; Tang, Bo; Zhang, Chun-Yang
2016-09-20
Biosensors for highly sensitive, selective, and rapid quantification of specific biomolecules make great contributions to biomedical research, especially molecular diagnostics. However, conventional methods for biomolecular assays often suffer from insufficient sensitivity and poor specificity. In some case (e.g., early disease diagnostics), the concentration of target biomolecules is too low to be detected by these routine approaches, and cumbersome procedures are needed to improve the detection sensitivity. Therefore, there is an urgent need for rapid and ultrasensitive analytical tools. In this respect, single-molecule fluorescence approaches may well satisfy the requirement and hold promising potential for the development of ultrasensitive biosensors. Encouragingly, owing to the advances in single-molecule microscopy and spectroscopy over past decades, the detection of single fluorescent molecule comes true, greatly boosting the development of highly sensitive biosensors. By in vitro/in vivo labeling of target biomolecules with proper fluorescent tags, the quantification of certain biomolecule at the single-molecule level is achieved. In comparison with conventional ensemble measurements, single-molecule detection-based analytical methods possess the advantages of ultrahigh sensitivity, good selectivity, rapid analysis time, and low sample consumption. Consequently, single-molecule detection may be potentially employed as an ideal analytical approach to quantify low-abundant biomolecules with rapidity and simplicity. In this Account, we will summarize our efforts for developing a series of ultrasensitive biosensors based on single-molecule counting. Single-molecule counting is a member of single-molecule detection technologies and may be used as a very simple and ultrasensitive method to quantify target molecules by simply counting the individual fluorescent bursts. In the fluorescent sensors, the signals of target biomolecules may be translated to the
Water in Room Temperature Ionic Liquids
Fayer, Michael
2014-03-01
Room temperature ionic liquids (or RTILs, salts with a melting point below 25 °C) have become a subject of intense study over the last several decades. Currently, RTIL application research includes synthesis, batteries, solar cells, crystallization, drug delivery, and optics. RTILs are often composed of an inorganic anion paired with an asymmetric organic cation which contains one or more pendant alkyl chains. The asymmetry of the cation frustrates crystallization, causing the salt's melting point to drop significantly. In general, RTILs are very hygroscopic, and therefore, it is of interest to examine the influence of water on RTIL structure and dynamics. In addition, in contrast to normal aqueous salt solutions, which crystallize at low water concentration, in an RTIL it is possible to examine isolated water molecules interacting with ions but not with other water molecules. Here, optical heterodyne-detected optical Kerr effect (OHD-OKE) measurements of orientational relaxation on a series of 1-alkyl-3-methylimidazolium tetrafluoroborate RTILs as a function of chain length and water concentration are presented. The addition of water to the longer alkyl chain RTILs causes the emergence of a long time bi-exponential orientational anisotropy decay. Such decays have not been seen previously in OHD-OKE experiments on any type of liquid and are analyzed here using a wobbling-in-a-cone model. The orientational relaxation is not hydrodynamic, with the slowest relaxation component becoming slower as the viscosity decreases for the longest chain, highest water content samples. The dynamics of isolated D2O molecules in 1-butyl-3-methylimidazolium hexafluorophosphate (BmImPF6) were examined using two dimensional infrared (2D IR) vibrational echo spectroscopy. Spectral diffusion and incoherent and coherent transfer of excitation between the symmetric and antisymmetric modes are examined. The coherent transfer experiments are used to address the nature of inhomogeneous
Water Treatment Systems for Long Spaceflights
FLynn, Michael T.
2012-01-01
Space exploration will require new life support systems to support the crew on journeys lasting from a few days to several weeks, or longer. These systems should also be designed to reduce the mass required to keep humans alive in space. Water accounts for about 80 percent of the daily mass intake required to keep a person alive. As a result, recycling water offers a high return on investment for space life support. Water recycling can also increase mission safety by providing an emergency supply of drinking water, where another supply is exhausted or contaminated. These technologies also increase safety by providing a lightweight backup to stored supplies, and they allow astronauts to meet daily drinking water requirements by recycling the water contained in their own urine. They also convert urine into concentrated brine that is biologically stable and nonthreatening, and can be safely stored onboard. This approach eliminates the need to have a dedicated vent to dump urine overboard. These needs are met by a system that provides a contaminant treatment pouch, referred to as a urine cell or contaminant cell, that converts urine or another liquid containing contaminants into a fortified drink, engineered to meet human hydration, electrolyte, and caloric requirements, using a variant of forward osmosis (FO) to draw water from a urine container into the concentrated fortified drink as part of a recycling stage. An activated carbon pretreatment removes most organic molecules. Salinity of the initial liquid mix (urine plus other) is synergistically used to enhance the precipitation of organic molecules so that activated carbon can remove most of the organics. A functional osmotic bag is then used to remove inorganic contaminants. If a contaminant is processed for which the saline content is different than optimal for precipitating organic molecules, the saline content of the liquid should be adjusted toward the optimal value for that contaminant. A first urine
International Nuclear Information System (INIS)
Shin, Jeong Rae
1987-02-01
This book deals with the medicine of water handling, which includes medicine for dispersion and cohesion, zeta-potential, congelation with Shalze Hardy's law, inorganic coagulants, inorganic high molecule coagulants, aid coagulant such as fly ash and sodium hydroxide, and effect of aluminum and iron on cohesion of clay suspension, organic coagulants like history of organic coagulants, a polyelectrolyte, coagulants for cation, and organic polymer coagulant, heavy metal and cyan exfoliants, application of drugs of water treatment.
Protein-based nanostructures as carriers for photo-physically active molecules in biosystems
Delcanale, Pietro
2017-01-01
In nature, many proteins function as carriers, being able to bind, transport and possibly release a ligand within a biological system. Protein-based carriers are interesting systems for drug delivery, with the remarkable advantage of being water-soluble and, as inherent components of biosystems, highly bio-compatible. This work focuses on the use of protein-based carriers for the delivery of hydrophobic photo-physically active molecules, whose structure and chemical properties lead to spontan...
Energy storage and redistribution in molecules
International Nuclear Information System (INIS)
Hinze, J.
1983-01-01
This book presents information on the following topics: chemistry and spectroscopy of molecules at high levels of excitation; energy and phase randomization in large molecules as probed by laser spectroscopy; intramolecular processes in isolated polyatomic molecules; pulse-probe measurements in low-temperature, low-pressure SF 6 ; the photodissociation dynamics of H 2 S and CF 3 NO; photofragment spectroscopy of the NO 2 dissociation; preparation, laser spectroscopy and predissociation of alkali dimers in supersonic nozzle beams; excited states of small molecules - collisional quenching and photodissociation; quantum-state-resolved scattering of lithium hydride; and molecular negative ions
Sequence Classification: 891959 [
Lifescience Database Archive (English)
Full Text Available Non-TMB TMH Non-TMB Non-TMB Non-TMB TMB >gi|6323581|ref|NP_013652.1| Serine esterase that deacylates exogeno...us lysophospholipids, homolog of human neuropathy target esterase (NTE); mammalian
Molecule-oriented programming in Java
Bergstra, J.A.
2002-01-01
Molecule-oriented programming is introduced as a programming style carrying some perspective for Java. A sequence of examples is provided. Supporting the development of the molecule-oriented programming style several matters are introduced and developed: profile classes allowing the representation
International Nuclear Information System (INIS)
Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.
2012-01-01
We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.
Polymer Structure and Water States in Salt-Containing Polyampholyte Hydrogels
Li, Xinda; Elliott, Janet A. W.; Lee, Byeongdu; Chung, Hyun-Joong
The phase behavior of water in hydrogels has broad impact on various applications, such as lubrication, adhesion, and electrical conductivity, as well as the hydrogel's low temperature properties. The status of the water molecules is correlated to the structure of the polymer chains in the hydrogel. In this study, the structure and water status of a model charge-balanced polyampholyte poly(4-vinylbenzenesulfonate-co-[3-(methacryloylamino) propyl] trimethylammonium chloride), were investigated by using differential scanning calorimetry (DSC) and small-angle x-ray scattering (SAXS). A globular network structure suggested by SAXS results dictated the depression of the freezing point of water in the hydrogel, as supported by the DSC results. The polyampholyte chains undergo an irreversible collapse during dialysis in deionized water. Such collapsed hydrogels are not able to prevent freezing of water molecules. The results of both synthesis condition and post-synthesis treatments for polyampholyte hydrogels provide us insights to design optimal polyampholyte hydrogels for low temperature applications.
International Nuclear Information System (INIS)
Zhou, Liping; Zhu, Anna; Lou, Xuening; Song, Dan; Yang, Rong; Shi, Hanchang; Long, Feng
2016-01-01
A universal sandwich-like immunoassay strategy based on quantum-dots immunoprobe (QD-labeled anti-mouse IgG antibody) was developed for rapid and ultrasensitive detection of small molecules. A portable and reusable optofluidic nano-biosensing platform was applied to investigate the sandwich-like immunoassay mechanism and format of small molecules, as well as the binding kinetics between QD immunoprobe and anti-small molecule antibody. A two-step immunoassay method that involves pre-incubation mixture of different concentration of small molecule and anti-small molecule antibody, and subsequent introduction of QD immunoprobe into the optofluidic cell was conducted for small molecule determination. Compared with the one-step immunoassay method, the two-step immunoassay method can obtain higher fluorescence signal and higher sensitivity index, thus improving the nano-biosensing performance. Based on the proposed strategy, two mode targets, namely, microcystin-LR (MC-LR) and Bisphenol A (BPA) were tested with high sensitivity, rapidity, and ease of use. A higher concentration of small molecules in the sample led to less anti-small molecule antibody bound with antigen-carrier protein conjugate immobilized onto the sensor surface, and less QD immunoprobes bound with anti-small molecule antibody. This phenomenon lowered the fluorescence signal detected by nano-biosensing platform. Under optimal operating conditions, MC-LR and BPA exhibited a limit of detection of 0.003 and 0.04 μg/L, respectively. The LODs were better than those of the indirect competitive immunoassay method for small molecules via Cy5.5-labeled anti-small molecule antibody. The proposed QD-based sandwich-like immunoassay strategy was evaluated in spiked water samples, and showed good recovery, precision and accuracy without complicated sample pretreatments. All these results demonstrate that the new detection strategy could be readily applied to the other trace small molecules in real water samples
Energy Technology Data Exchange (ETDEWEB)
Zhou, Liping; Zhu, Anna; Lou, Xuening; Song, Dan; Yang, Rong [School of Environment and Natural Resources, Renmin University of China, Beijing (China); Shi, Hanchang [School of Environment, Tsinghua University, Beijing (China); Long, Feng, E-mail: longf04@ruc.edu.cn [School of Environment and Natural Resources, Renmin University of China, Beijing (China)
2016-01-28
A universal sandwich-like immunoassay strategy based on quantum-dots immunoprobe (QD-labeled anti-mouse IgG antibody) was developed for rapid and ultrasensitive detection of small molecules. A portable and reusable optofluidic nano-biosensing platform was applied to investigate the sandwich-like immunoassay mechanism and format of small molecules, as well as the binding kinetics between QD immunoprobe and anti-small molecule antibody. A two-step immunoassay method that involves pre-incubation mixture of different concentration of small molecule and anti-small molecule antibody, and subsequent introduction of QD immunoprobe into the optofluidic cell was conducted for small molecule determination. Compared with the one-step immunoassay method, the two-step immunoassay method can obtain higher fluorescence signal and higher sensitivity index, thus improving the nano-biosensing performance. Based on the proposed strategy, two mode targets, namely, microcystin-LR (MC-LR) and Bisphenol A (BPA) were tested with high sensitivity, rapidity, and ease of use. A higher concentration of small molecules in the sample led to less anti-small molecule antibody bound with antigen-carrier protein conjugate immobilized onto the sensor surface, and less QD immunoprobes bound with anti-small molecule antibody. This phenomenon lowered the fluorescence signal detected by nano-biosensing platform. Under optimal operating conditions, MC-LR and BPA exhibited a limit of detection of 0.003 and 0.04 μg/L, respectively. The LODs were better than those of the indirect competitive immunoassay method for small molecules via Cy5.5-labeled anti-small molecule antibody. The proposed QD-based sandwich-like immunoassay strategy was evaluated in spiked water samples, and showed good recovery, precision and accuracy without complicated sample pretreatments. All these results demonstrate that the new detection strategy could be readily applied to the other trace small molecules in real water samples
Greenfeld, Max; van de Meent, Jan-Willem; Pavlichin, Dmitri S; Mabuchi, Hideo; Wiggins, Chris H; Gonzalez, Ruben L; Herschlag, Daniel
2015-01-16
Single-molecule techniques have emerged as incisive approaches for addressing a wide range of questions arising in contemporary biological research [Trends Biochem Sci 38:30-37, 2013; Nat Rev Genet 14:9-22, 2013; Curr Opin Struct Biol 2014, 28C:112-121; Annu Rev Biophys 43:19-39, 2014]. The analysis and interpretation of raw single-molecule data benefits greatly from the ongoing development of sophisticated statistical analysis tools that enable accurate inference at the low signal-to-noise ratios frequently associated with these measurements. While a number of groups have released analysis toolkits as open source software [J Phys Chem B 114:5386-5403, 2010; Biophys J 79:1915-1927, 2000; Biophys J 91:1941-1951, 2006; Biophys J 79:1928-1944, 2000; Biophys J 86:4015-4029, 2004; Biophys J 97:3196-3205, 2009; PLoS One 7:e30024, 2012; BMC Bioinformatics 288 11(8):S2, 2010; Biophys J 106:1327-1337, 2014; Proc Int Conf Mach Learn 28:361-369, 2013], it remains difficult to compare analysis for experiments performed in different labs due to a lack of standardization. Here we propose a standardized single-molecule dataset (SMD) file format. SMD is designed to accommodate a wide variety of computer programming languages, single-molecule techniques, and analysis strategies. To facilitate adoption of this format we have made two existing data analysis packages that are used for single-molecule analysis compatible with this format. Adoption of a common, standard data file format for sharing raw single-molecule data and analysis outcomes is a critical step for the emerging and powerful single-molecule field, which will benefit both sophisticated users and non-specialists by allowing standardized, transparent, and reproducible analysis practices.
International Nuclear Information System (INIS)
Oda, Masaru; Hasegawa, Atsushi; Iwami, Noriya; Nishiura, Ken; Ando, Naohisa; Nishiyama, Akira; Horiuchi, Hiromi; Tani, Toshiro
2007-01-01
We report here the distinctive modifications of photoluminescence (PL) behaviors in single CdSe/ZnS/TOPO nanocrystals depending on their environments. Long-time traces of PL intensity from single nanocrystals have been obtained in both vacuum and a wet nitrogen atmosphere. While all of the nanocrystals in both environments exhibit PL blinking behaviors, i.e. on-off intermittency of PL intensity, as usual, some of the nanocrystals in the wet nitrogen atmosphere show significant increase in duration time of on-events. As for the duration time of blinking off-events, it is for the moment associated with the occasional events of carrier capturing at trap sites on or near the nanocrystal surfaces. We propose a model in which adsorbed water molecules at the trap sites on the nanocrystal surfaces transform them under light irradiation, which eventually decreases the occurrence of the trapping events due to their inactivation. It in turn increases the PL on-times. In addition to the drastic modification of the blinking profile, we also found that in the PL time traces some kinds of undulated behaviors, i.e. continuous and rather low frequency fluctuation of PL intensity, appear during each on-event in vacuum while they disappear totally in the wet nitrogen atmosphere. These results are also described on the basis of the inactivation model of the trap sites introduced above
Analysis of D3-,4-,5-phosphorylated phosphoinositides using HPLC.
Munnik, Teun
2013-01-01
Detection of polyphosphoinositides (PPIs) is difficult due to their low chemical abundancy. This problem is further complicated by the fact that PPIs are present as various, distinct isomers, which are difficult, if not impossible, to separate by conventional thin layer chromatography (TLC) systems. PPIs in plants include PtdIns3P, PtdIns4P, PtdIns5P, PtdIns(3,5)P 2, and PtdIns(4,5)P 2. Here, a protocol is described analyzing plant PPIs using (32)P-orthophosphorus pre-labeled material. After extraction, lipids are deacylated and the resulting glycerophosphoinositol polyphosphates (GroPInsPs) separated by HPLC using a strong anion-exchange column and a shallow salt gradient. Alternatively, PPIs are first separated by TLC, the lipids reisolated, deacylated, and the GroPInsPs then separated by HPLC.
Double-valence-fluctuating molecules and superconductivity
International Nuclear Information System (INIS)
Hirsch, J.E.; Scalapino, D.J.
1985-01-01
We discuss the possibility of ''double-valence-fluctuating'' molecules, having two ground-state configurations differing by two electrons. We propose a possible realization of such a molecule, and experimental ways to look for it. We argue that a weakly coupled array of such molecules should give rise to a strong-coupling Shafroth-Blatt-Butler superconductor, with a high transition temperature
Dureckova, Hana; Woo, Tom K; Udachin, Konstantin A; Ripmeester, John A; Alavi, Saman
2017-10-13
Clathrate hydrate phases of Cl 2 and Br 2 guest molecules have been known for about 200 years. The crystal structure of these phases was recently re-determined with high accuracy by single crystal X-ray diffraction. In these structures, the water oxygen-halogen atom distances are determined to be shorter than the sum of the van der Waals radii, which indicates the action of some type of non-covalent interaction between the dihalogens and water molecules. Given that in the hydrate phases both lone pairs of each water oxygen atom are engaged in hydrogen bonding with other water molecules of the lattice, the nature of the oxygen-halogen interactions may not be the standard halogen bonds characterized recently in the solid state materials and enzyme-substrate compounds. The nature of the halogen-water interactions for the Cl 2 and Br 2 molecules in two isolated clathrate hydrate cages has recently been studied with ab initio calculations and Natural Bond Order analysis (Ochoa-Resendiz et al. J. Chem. Phys. 2016, 145, 161104). Here we present the results of ab initio calculations and natural localized molecular orbital analysis for Cl 2 and Br 2 guests in all cage types observed in the cubic structure I and tetragonal structure I clathrate hydrates to characterize the orbital interactions between the dihalogen guests and water. Calculations with isolated cages and cages with one shell of coordinating molecules are considered. The computational analysis is used to understand the nature of the halogen bonding in these materials and to interpret the guest positions in the hydrate cages obtained from the X-ray crystal structures.
Study of the electronic properties of organic molecules within a metal-molecule-metal junction
International Nuclear Information System (INIS)
Lambert, Mathieu
2003-01-01
This ph-D thesis is about electronic transport through organic molecules inserted in a metal molecule-metal junction. We describe first a simple process to prepare sub-3 nm gaps by controllable breakage (under an electrical stress) of gold wires lithographed on a SiO 2 Si substrate at low temperature (4.2 K). We show that the involved mechanism is thermally assisted electromigration. We observe that current-voltage (I-V) characteristics of resulting electrodes are stable up to ∼5 V. which gives access to the well-known Fowler-Nordheim regime in the I-V, allowing an accurate characterisation of the gap size. The average gap is found lo be between 1.5 nm in width and 2.5 eV in height. Molecules and nanoparticles have then been inserted in the junction in the case of nanoparticles for example. The resulting IV clearly shows the suppression of electrical current at low bias known as Coulomb blockade. Characteristic of single-electron tunnelling through nanometer-sized structures, finally we fabricated a single-electron tunneling device based on Au nanoparticles connected to the electrodes via terthiophene (T3) molecule. We use the silicon substrate, separated from the planar structure by a silicon oxide of 200 nm, as an electrostatic gate and observed clear current modulation with possible signature of the transport properties of the terthiophene molecules. (author) [fr
International Nuclear Information System (INIS)
Yanagisawa, O.; Fukubayashi, T.
2010-01-01
Aim: To evaluate the effect of local cooling on the diffusion of water molecules and perfusion within muscle at different cooling temperatures. Materials and methods: Magnetic resonance diffusion-weighted (DW) images of the leg (seven males) were obtained before and after 30 min cooling (0, 10, and 20 o C), and after a 30 min recovery period. Two types of apparent diffusion coefficient (ADC; ADC1, reflecting both water diffusion and perfusion within muscle, and ADC2, approximating the true water diffusion coefficient) of the ankle dorsiflexors were calculated from DW images. T2-weighted images were also obtained to calculate T2 values of the ankle dorsiflexors. The skin temperature was measured before, during, and after cooling. Results: Both ADC values significantly decreased after cooling under all cooling conditions; the rate of decrease depended on the cooling temperature used (ADC1: -36% at 0 o C, -27.8% at 10 o C, and -22.6% at 20 o C; ADC2: -26% at 0 o C, -21.1% at 10 o C, and -14.6% at 20 o C). These significant decreases were maintained during the recovery period. Conversely, the T2 value showed no significant changes. Under all cooling conditions, skin temperature significantly decreased during cooling; the rate of decrease depended on the cooling temperature used (-74.8% at 0 o C, -51.1% at 10 o C, and -26.8% at 20 o C). Decreased skin temperatures were not restored to pre-cooling values during the recovery period under any cooling conditions. Conclusion: Local cooling decreased the water diffusion and perfusion within muscle with decreased skin temperature; the rates of decrease depended on the cooling temperature used. These decreases were maintained for 30 min after cooling.
Spin tunneling in magnetic molecules
Kececioglu, Ersin
In this thesis, we will focus on spin tunneling in a family of systems called magnetic molecules such as Fe8 and Mn12. This is comparatively new, in relation to other tunneling problems. Many issues are not completely solved and/or understood yet. The magnetic molecule Fe 8 has been observed to have a rich pattern of degeneracies in its magnetic spectrum. We focus on these degeneracies from several points of view. We start with the simplest anisotropy Hamiltonian to describe the Fe 8 molecule and extend our discussion to include higher order anisotropy terms. We give analytical expressions as much as we can, for the degeneracies in the semi-classical limit in both cases. We reintroduce jump instantons to the instanton formalism. Finally, we discuss the effect of the environment on the molecule. Our results, for all different models and techniques, agree well with both experimental and numerical results.
Multi-Excitonic Quantum Dot Molecules
Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.
Analysis of experimental positron-molecule binding energies
International Nuclear Information System (INIS)
Danielson, J R; Surko, C M; Young, J A
2010-01-01
Experiments show that positron annihilation on molecules frequently occurs via capture into vibrational Feshbach resonances. In these cases, the downshifts in the annihilation spectra from the vibrational mode spectra provide measures of the positron-molecule binding energies. An analysis of these binding energy data is presented in terms of the molecular dipole polarizability, the permanent dipole moment, and the number of π bonds in aromatic molecules. The results of this analysis are in reasonably good agreement with other information about positron-molecule bound states. Predictions for other targets and promising candidate molecules for further investigation are discussed.
Weak interactions between water and clathrate-forming gases at low pressures
Energy Technology Data Exchange (ETDEWEB)
Thurmer, Konrad; Yuan, Chunqing; Kimmel, Gregory A.; Kay, Bruce D.; Smith, R. Scott
2015-11-01
Using scanning probe microscopy and temperature programed desorption we examined the interaction between water and two common clathrate-forming gases, methane and isobutane, at low temperature and low pressure. Water co-deposited with up to 10-1 mbar methane or 10-5 mbar isobutane at 140 K onto a Pt(111) substrate yielded pure crystalline ice, i.e., the exposure to up to ~107 gas molecules for each deposited water molecule did not have any detectable effect on the growing films. Exposing metastable, less than 2 molecular layers thick, water films to 10-5 mbar methane does not alter their morphology, suggesting that the presence of the Pt(111) surface is not a strong driver for hydrate formation. This weak water-gas interaction at low pressures is supported by our thermal desorption measurements from amorphous solid water and crystalline ice where 1 ML of methane desorbs near ~43 K and isobutane desorbs near ~100 K. Similar desorption temperatures were observed for desorption from amorphous solid water.
National Research Council Canada - National Science Library
Wang, Guang-Jia
1996-01-01
.... The deacylation rate was also found to exhibit a maximum for the same substrate 2 (n=6). These results are similar to those previously reported with cholesterol esterase as catalyst for the same hydrolysis reaction...
Molecules cooled below the Doppler limit
Truppe, S.; Williams, H. J.; Hambach, M.; Caldwell, L.; Fitch, N. J.; Hinds, E. A.; Sauer, B. E.; Tarbutt, M. R.
2017-12-01
Magneto-optical trapping and sub-Doppler cooling have been essential to most experiments with quantum degenerate gases, optical lattices, atomic fountains and many other applications. A broad set of new applications await ultracold molecules, and the extension of laser cooling to molecules has begun. A magneto-optical trap (MOT) has been demonstrated for a single molecular species, SrF, but the sub-Doppler temperatures required for many applications have not yet been reached. Here we demonstrate a MOT of a second species, CaF, and we show how to cool these molecules to 50 μK, well below the Doppler limit, using a three-dimensional optical molasses. These ultracold molecules could be loaded into optical tweezers to trap arbitrary arrays for quantum simulation, launched into a molecular fountain for testing fundamental physics, and used to study collisions and chemistry between atoms and molecules at ultracold temperatures.
Distinguishing Biologically Relevant Hexoses by Water Adduction to the Lithium-Cationized Molecule.
Campbell, Matthew T; Chen, Dazhe; Wallbillich, Nicholas J; Glish, Gary L
2017-10-03
A method to distinguish the four most common biologically relevant underivatized hexoses, d-glucose, d-galactose, d-mannose, and d-fructose, using only mass spectrometry with no prior separation/derivatization step has been developed. Electrospray of a solution containing hexose and a lithium salt generates [Hexose+Li] + . The lithium-cationized hexoses adduct water in a quadrupole ion trap. The rate of this water adduction reaction can be used to distinguish the four hexoses. Additionally, for each hexose, multiple lithiation sites are possible, allowing for multiple structures of [Hexose+Li] + . Electrospray produces at least one structure that reacts with water and at least one that does not. The ratio of unreactive lithium-cationized hexose to total lithium-cationized hexose is unique for the four hexoses studied, providing a second method for distinguishing the isomers. Use of the water adduction reaction rate or the unreactive ratio provides two separate methods for confidently (p ≤ 0.02) distinguishing the most common biologically relevant hexoses using only femtomoles of hexose. Additionally, binary mixtures of glucose and fructose were studied. A calibration curve was created by measuring the reaction rate of various samples with different ratios of fructose and glucose. The calibration curve was used to accurately measure the percentage of fructose in three samples of high fructose corn syrup (<4% error).
Institute of Scientific and Technical Information of China (English)
无
2010-01-01
Two three-dimensional supramolecular water architectures,[Zn(phen)3]2 ·[Zn(C10H16O4)·(H2O)3]·(C10H16O4)2·20H2O(1) and [Co(phen)3]2 ·[Co(H2O)6]·(C10H16O4)3·30H2O(2)[phen=1,10-Phenanthroline,C10H16O4=sebacic dianion],have been synthesized and characterized by IR,elemental analysis,thermogravimetric analysis,and single-crystal X-ray diffractions.The two structures both contain extensive hydrogen bonding between water molecules as well as between water molecules and sebacic anions.The water molecules and sebacic acid O atoms assembled 2D supramolecular corrugated sheets with different morphology in the two complexes.
Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas
2012-09-17
Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.
Directory of Open Access Journals (Sweden)
Peironcely Julio E
2012-09-01
Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.
Physics of Complex Polymeric Molecules
Kelly, Joshua Walter
The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.
Energy Technology Data Exchange (ETDEWEB)
Yao, Yi; Berkowitz, Max L., E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu; Kanai, Yosuke, E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu [Department of Chemistry, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599 (United States)
2015-12-28
The translational diffusivity of water in solutions of alkali halide salts depends on the identity of ions, exhibiting dramatically different behavior even in solutions of similar salts of NaCl and KCl. The water diffusion coefficient decreases as the salt concentration increases in NaCl. Yet, in KCl solution, it slightly increases and remains above bulk value as salt concentration increases. Previous classical molecular dynamics simulations have failed to describe this important behavior even when polarizable models were used. Here, we show that inclusion of dynamical charge transfer among water molecules produces results in a quantitative agreement with experiments. Our results indicate that the concentration-dependent diffusivity reflects the importance of many-body effects among the water molecules in aqueous ionic solutions. Comparison with quantum mechanical calculations shows that a heterogeneous and extended distribution of charges on water molecules around the ions due to ion-water and also water-water charge transfer plays a very important role in controlling water diffusivity. Explicit inclusion of the charge transfer allows us to model accurately the difference in the concentration-dependent water diffusivity between Na{sup +} and K{sup +} ions in simulations, and it is likely to impact modeling of a wide range of systems for medical and technological applications.
Cooperative effects in (ethanol)3-water heterotetramers
International Nuclear Information System (INIS)
Mejia, Sol; Espinal, Juan F; Mondragon, Fanor
2009-01-01
Density Functional Theory (DFT: B3LYP/6-31 + G(d)) was used for the optimization of clusters on the potential energy surface of (ethanol)3-water heterotetramers. The tetramerization energies can reach values up to -21.00 kcal/ mol. This energy can not be obtained by just considering the contributions from interactions between two cluster molecules, which suggests of the presence of global cooperative effects (positive). These effects are reflected in smaller hydrogen bond distances and smaller oxygen-oxygen distances, as well as in greater elongations of the O-H proton donor bond with a stronger red-shift in the heterotetramers compared to the ethanol-water heterodimers and the ethanol dimer. The largest cooperativity effect was observed in the four hydrogen bonds arranged in the largest possible cyclic geometric pattern, where all the molecules act as proton acceptor and donor simultaneously. A similar analysis to the characterization of (ethanol)3-water heterotetramers was carried out on (methanol)3-water heterotetramers, and ethanol and methanol tetramers, whose comparison showed a great similarity between all evaluated parameters for the clusters with equal geometric pattern.
Unal, Mustafa; Akkus, Ozan
2018-01-01
Water loss is an early onset indicator of osteoarthritis. Although Raman spectroscopy (RS) holds the potential for measurement of cartilage hydration, the knowledge of Raman OH-stretch bands of biological tissue is very limited. We assesed here the sensitivity of RS to identify and classify water types in the cartilage. Raman spectrum measurements over the high wavenumber range were employed to identify different water fractions in articular cartilage. Raman spectra were collected from wet and sequentially dehydrated cartilage along with pure collagen type II and chondroitin sulfate standards. OH-stretch band of cartilage is dominated by mobile water, up to 95% of total intensities. We identified six peaks in cartilage spectrum using second-derivative analysis: peaks at 3200 and 3650 cm-1 are associated with organic matrix (both collagen and proteglycan) and matrix-bound water molecules. Peaks at 3250, 3453, and 3630 cm-1 are associated with collagen and collagen-related water molecules, whereas the peak at 3520 cm-1 is associated with proteoglycan (PG) and PG-related water molecules. The current work is the first thorough analysis of the Raman OH-stretch band of the cartilage and with the knowledge generated by this study, it may now be possible to study on cartilage hydration by RS.
Single Molecule Spectroscopy of Electron Transfer
International Nuclear Information System (INIS)
Holman, Michael; Zang, Ling; Liu, Ruchuan; Adams, David M.
2009-01-01
The objectives of this research are threefold: (1) to develop methods for the study electron transfer processes at the single molecule level, (2) to develop a series of modifiable and structurally well defined molecular and nanoparticle systems suitable for detailed single molecule/particle and bulk spectroscopic investigation, (3) to relate experiment to theory in order to elucidate the dependence of electron transfer processes on molecular and electronic structure, coupling and reorganization energies. We have begun the systematic development of single molecule spectroscopy (SMS) of electron transfer and summaries of recent studies are shown. There is a tremendous need for experiments designed to probe the discrete electronic and molecular dynamic fluctuations of single molecules near electrodes and at nanoparticle surfaces. Single molecule spectroscopy (SMS) has emerged as a powerful method to measure properties of individual molecules which would normally be obscured in ensemble-averaged measurement. Fluctuations in the fluorescence time trajectories contain detailed molecular level statistical and dynamical information of the system. The full distribution of a molecular property is revealed in the stochastic fluctuations, giving information about the range of possible behaviors that lead to the ensemble average. In the case of electron transfer, this level of understanding is particularly important to the field of molecular and nanoscale electronics: from a device-design standpoint, understanding and controlling this picture of the overall range of possible behaviors will likely prove to be as important as designing ia the ideal behavior of any given molecule.
Alternative types of molecule-decorated atomic chains in Au–CO–Au single-molecule junctions
Directory of Open Access Journals (Sweden)
Zoltán Balogh
2015-06-01
Full Text Available We investigate the formation and evolution of Au–CO single-molecule break junctions. The conductance histogram exhibits two distinct molecular configurations, which are further investigated by a combined statistical analysis. According to conditional histogram and correlation analysis these molecular configurations show strong anticorrelations with each other and with pure Au monoatomic junctions and atomic chains. We identify molecular precursor configurations with somewhat higher conductance, which are formed prior to single-molecule junctions. According to detailed length analysis two distinct types of molecule-affected chain-formation processes are observed, and we compare these results to former theoretical calculations considering bridge- and atop-type molecular configurations where the latter has reduced conductance due to destructive Fano interference.
Frozen Dynamics and Insulation of Water at the Lipid Interface
Bakulin, A.A.; Cringus, D.; Pshenichnikov, M.S.; Wiersma, D.A.; Corkum, P; DeSilvestri, S; Nelson, KA; Riedle, E
2009-01-01
2D IR correlation spectroscopy reveals extremely slow dynamics and splitting of the OH-stretching mode of water in anionic micelles. Water at the lipid interface behaves as if the molecules were isolated in a "frozen" environment.
Individual Magnetic Molecules on Ultrathin Insulating Surfaces
El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus
2012-02-01
Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.
Experimental decoherence in molecule interferometry
International Nuclear Information System (INIS)
Hackermueller, L.; Hornberger, K.; Stibor, A.; Zeilinger, A.; Arndt, M.; Kiesewetter, G.
2005-01-01
Full text: We present three mechanisms of decoherence that occur quite naturally in matter wave interferometer with large molecules. One way molecules can lose coherence is through collision with background gas particles. We observe a loss of contrast with increasing background pressure for various types of gases. We can understand this phenomenon quantitatively with a new model for collisional decoherence which corrects older models by a factor of 2 π;. The second experiment studies the thermal emission of photons related to the high internal energy of the interfering molecules. When sufficiently many or sufficiently short photons are emitted inside the interferometer, the fringe contrast is lost. We can continuously vary the temperature of the molecules and compare the loss of contrast with a model based on decoherence theory. Again we find good quantitative agreement. A third mechanism that influences our interference pattern is dephasing due to vibrations of the interference gratings. By adding additional vibrations we study this effect in more detail. (author)
Extracting Models in Single Molecule Experiments
Presse, Steve
2013-03-01
Single molecule experiments can now monitor the journey of a protein from its assembly near a ribosome to its proteolytic demise. Ideally all single molecule data should be self-explanatory. However data originating from single molecule experiments is particularly challenging to interpret on account of fluctuations and noise at such small scales. Realistically, basic understanding comes from models carefully extracted from the noisy data. Statistical mechanics, and maximum entropy in particular, provide a powerful framework for accomplishing this task in a principled fashion. Here I will discuss our work in extracting conformational memory from single molecule force spectroscopy experiments on large biomolecules. One clear advantage of this method is that we let the data tend towards the correct model, we do not fit the data. I will show that the dynamical model of the single molecule dynamics which emerges from this analysis is often more textured and complex than could otherwise come from fitting the data to a pre-conceived model.
Microassay for measurement of binding of radiolabelled ligands to cell surface molecules
International Nuclear Information System (INIS)
Woof, J.M.; Burton, D.R.
1988-01-01
An improved technique for measuring the binding of radiolabelled ligands to cell surface molecules has been developed by modification of a procedure using centrifugation through a water-immiscible oil to separate free and cell-bound ligand. It maximises the percentage of ligand bound since cell-bound and free ligand can be separated easily and reproducibly even when very small reaction volumes are used. This permits low levels of ligand radiolabelling and relatively low numbers of cells to be used
International Nuclear Information System (INIS)
Bellili, A.; Hochlaf, M.; Schwell, M.; Bénilan, Y.; Fray, N.; Gazeau, M.-C.; Mogren Al-Mogren, M.; Guillemin, J.-C.; Poisson, L.
2014-01-01
The present combined theoretical and experimental investigation concerns the single photoionization of gas-phase acetyl cyanide and the fragmentation pathways of the resulting cation. Acetyl cyanide (AC) is inspired from both the chemistry of cyanoacetylene and the Strecker reaction which are thought to be at the origin of medium sized prebiotic molecules in the interstellar medium. AC can be formed by reaction from cyanoacetylene and water but also from acetaldehyde and HCN or the corresponding radicals. In view of the interpretation of vacuum ultraviolet (VUV) experimental data obtained using synchrotron radiation, we explored the ground potential energy surface (PES) of acetyl cyanide and of its cation using standard and recently implemented explicitly correlated methodologies. Our PES covers the regions of tautomerism (between keto and enol forms) and of the lowest fragmentation channels. This allowed us to deduce accurate thermochemical data for this astrobiologically relevant molecule. Unimolecular decomposition of the AC cation turns out to be very complex. The implications for the evolution of prebiotic molecules under VUV irradiation are discussed
Energy Technology Data Exchange (ETDEWEB)
Bellili, A.; Hochlaf, M., E-mail: hochlaf@univ-mlv.fr, E-mail: martin.schwell@lisa.u-pec.fr [Laboratoire Modélisation et Simulation Multi Echelle, MSME UMR 8208 CNRS, Université Paris-Est, 5 bd Descartes, 77454 Marne-la-Vallée (France); Schwell, M., E-mail: hochlaf@univ-mlv.fr, E-mail: martin.schwell@lisa.u-pec.fr; Bénilan, Y.; Fray, N.; Gazeau, M.-C. [Laboratoire Interuniversitaire des Systèmes Atmosphériques (LISA), UMR 7583 CNRS, Institut Pierre et Simon Laplace, Universités Paris-Est Créteil et Paris Diderot, 61 Avenue du Général de Gaulle, 94010 Créteil (France); Mogren Al-Mogren, M. [Chemistry Department, Faculty of Science, King Saud University, P.O. Box 2455, Riyadh 11451 (Saudi Arabia); Guillemin, J.-C. [Institut des Sciences Chimiques de Rennes, Ecole Nationale Supérieure de Chimie de Rennes, CNRS, UMR 6226, Allée de Beaulieu, CS 50837, 35708 Rennes Cedex 7 (France); Poisson, L. [Laboratoire Francis Perrin, CNRS URA 2453, CEA, IRAMIS, Laboratoire Interactions Dynamique et Lasers, Bât 522, F-91191 Gif/Yvette (France)
2014-10-07
The present combined theoretical and experimental investigation concerns the single photoionization of gas-phase acetyl cyanide and the fragmentation pathways of the resulting cation. Acetyl cyanide (AC) is inspired from both the chemistry of cyanoacetylene and the Strecker reaction which are thought to be at the origin of medium sized prebiotic molecules in the interstellar medium. AC can be formed by reaction from cyanoacetylene and water but also from acetaldehyde and HCN or the corresponding radicals. In view of the interpretation of vacuum ultraviolet (VUV) experimental data obtained using synchrotron radiation, we explored the ground potential energy surface (PES) of acetyl cyanide and of its cation using standard and recently implemented explicitly correlated methodologies. Our PES covers the regions of tautomerism (between keto and enol forms) and of the lowest fragmentation channels. This allowed us to deduce accurate thermochemical data for this astrobiologically relevant molecule. Unimolecular decomposition of the AC cation turns out to be very complex. The implications for the evolution of prebiotic molecules under VUV irradiation are discussed.
International Nuclear Information System (INIS)
Bankura, Arindam; Chandra, Amalendu
2015-01-01
The dynamics of proton transfer (PT) through hydrogen bonds in a two-dimensional water layer confined between two graphene sheets at room temperature are investigated through ab initio and quantum-classical simulations. The excess proton is found to be mostly solvated as an Eigen cation where the hydronium ion donates three hydrogen bonds to the neighboring water molecules. In the solvation shell of the hydronium ion, the three coordinated water molecules with two donor hydrogen bonds are found to be properly presolvated to accept a proton. Although no hydrogen bond needs to be broken for transfer of a proton to such presolvated water molecules from the hydronium ion, the PT rate is still found to be not as fast as it is for one-dimensional chains. Here, the PT is slowed down as the probability of finding a water with two donor hydrogen bonds in the solvation shell of the hydronium ion is found to be only 25%-30%. The hydroxide ion is found to be solvated mainly as a complex anion where it accepts four H-bonds through its oxygen atom and the hydrogen atom of the hydroxide ion remains free all the time. Here, the presolvation of the hydroxide ion to accept a proton requires that one of its hydrogen bonds is broken and the proton comes from a neighboring water molecule with two acceptor and one donor hydrogen bonds. The coordination number reduction by breaking of a hydrogen bond is a slow process, and also the population of water molecules with two acceptor and one donor hydrogen bonds is only 20%-25% of the total number of water molecules. All these factors together tend to slow down the hydroxide ion migration rate in two-dimensional water layers compared to that in three-dimensional bulk water
Multi-small molecule conjugations as new targeted delivery carriers for tumor therapy
Directory of Open Access Journals (Sweden)
Shan L
2015-09-01
Full Text Available Lingling Shan,1 Ming Liu,2 Chao Wu,1 Liang Zhao,1 Siwen Li,3 Lisheng Xu,1 Wengen Cao,1 Guizhen Gao,1 Yueqing Gu3 1Institute of Pharmaceutical Biotechnology, School of Biology and Food Engineering, Suzhou University, Suzhou, People’s Republic of China; 2Department of Biology, University of South Dakota, Vermillion, SD, USA; 3Department of Biomedical Engineering, School of Life Science and Technology, China Pharmaceutical University, Nanjing, People’s Republic of China Abstract: In response to the challenges of cancer chemotherapeutics, including poor physicochemical properties, low tumor targeting ability, and harmful side effects, we developed a new tumor-targeted multi-small molecule drug delivery platform. Using paclitaxel (PTX as a model therapeutic, we prepared two prodrugs, ie, folic acid-fluorescein-5(6-isothiocyanate-arginine-paclitaxel (FA-FITC-Arg-PTX and folic acid-5-aminofluorescein-glutamic-paclitaxel (FA-5AF-Glu-PTX, composed of folic acid (FA, target, amino acids (Arg or Glu, linker, and fluorescent dye (fluorescein in vitro or near-infrared fluorescent dye in vivo in order to better understand the mechanism of PTX prodrug targeting. In vitro and acute toxicity studies demonstrated the low toxicity of the prodrug formulations compared with the free drug. In vitro and in vivo studies indicated that folate receptor-mediated uptake of PTX-conjugated multi-small molecule carriers induced high antitumor activity. Notably, compared with free PTX and with PTX-loaded macromolecular carriers from our previous study, this multi-small molecule-conjugated strategy improved the water solubility, loading rate, targeting ability, antitumor activity, and toxicity profile of PTX. These results support the use of multi-small molecules as tumor-targeting drug delivery systems. Keywords: multi-small molecules, paclitaxel, prodrugs, targeting, tumor therapy
Nonempirical calculations of the LiBO molecule
International Nuclear Information System (INIS)
Nemukhin, A.V.; Stepanov, N.F.
1987-01-01
Problems of nonempirical calculations of molecule energies, related to the use of limited basis AO set and configurations were considered taking the LiBO molecule as an example. The version of optimizing parameters of basis functions of the base of the concept of ''atoms in molecules'' was suggested. It is shown that correct description of the potential surface of LiBO molecule is impossible without consideration of electron correlation; main contributions to correlation corrections were distinguished
Lenselink, Eelke B; Beuming, Thijs; Sherman, Woody; van Vlijmen, Herman W T; IJzerman, Adriaan P
2014-06-23
A major challenge in structure-based virtual screening (VS) involves the treatment of explicit water molecules during docking in order to improve the enrichment of active compounds over decoys. Here we have investigated this in the context of the adenosine A2A receptor, where water molecules have previously been shown to be important for achieving high enrichment rates with docking, and where the positions of some binding site waters are known from a high-resolution crystal structure. The effect of these waters (both their presence and orientations) on VS enrichment was assessed using a carefully curated set of 299 high affinity A2A antagonists and 17,337 decoys. We show that including certain crystal waters greatly improves VS enrichment and that optimization of water hydrogen positions is needed in order to achieve the best results. We also show that waters derived from a molecular dynamics simulation - without any knowledge of crystallographic waters - can improve enrichments to a similar degree as the crystallographic waters, which makes this strategy applicable to structures without experimental knowledge of water positions. Finally, we used decision trees to select an ensemble of structures with different water molecule positions and orientations that outperforms any single structure with water molecules. The approach presented here is validated against independent test sets of A2A receptor antagonists and decoys from the literature. In general, this water optimization strategy could be applied to any target with waters-mediated protein-ligand interactions.
The 'wet mind': water and functional neuroimaging
International Nuclear Information System (INIS)
Le Bihan, Denis
2007-01-01
Functional neuroimaging has emerged as an important approach to study the brain and the mind. Surprisingly, although they are based on radically different physical approaches both positron emission tomography (PET) and magnetic resonance imaging (MRI) make brain activation imaging possible through measurements involving water molecules. So far, PET and MRI functional imaging have relied on the principle that neuronal activation and blood flow are coupled through metabolism. However, a new paradigm has emerged to look at brain activity through the observation with MRI of the molecular diffusion of water. In contrast with the former approaches diffusion MRI has the potential to reveal changes in the intrinsic water physical properties during brain activation, which could be more intimately linked to the neuronal activation mechanisms and lead to an improved spatial and temporal resolution. However, this link has yet to be fully confirmed and understood. To shed light on the possible relationship between water and brain activation, this introductory paper reviews the most recent data on the physical properties of water and on the status of water in biological tissues, and evaluates their relevance to brain diffusion MRI. The biophysical mechanisms of brain activation are then reassessed to reveal their intimacy with the physical properties of water, which may come to be regarded as the 'molecule of the mind'. (invited topical review)
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:
Water transport and desalination through double-layer graphyne membranes.
Akhavan, Mojdeh; Schofield, Jeremy; Jalili, Seifollah
2018-05-16
Non-equilibrium molecular dynamics simulations of water-salt solutions driven through single and double-layer graphyne membranes by a pressure difference created by rigid pistons are carried out to determine the relative performance of the membranes as filters in a reverse osmosis desalination process. It is found that the flow rate of water through a graphyne-4 membrane is twice that of a graphyne-3 membrane for both single and double-layer membranes. Although the addition of a second layer to a single-layer membrane reduces the membrane permeability, the double-layer graphyne membranes are still two or three orders of magnitude more permeable than commercial reverse osmosis membranes. The minimum reduction in flow rate for double-layer membranes occurs at a layer spacing of 0.35 nm with an AA stacking configuration, while at a spacing of 0.6 nm the flow rate is close to zero due to a high free energy barrier for permeation. This is caused by the difference in the environments on either side of the membrane sheets and the formation of a compact two-dimensional layer of water molecules in the interlayer space which slows down water permeation. The distribution of residence times of water molecules in the interlayer region suggests that at the critical layer spacing of 0.6 nm, a cross-over occurs in the mechanism of water flow from the collective movement of hydrogen-bonded water sheets to the permeation of individual water molecules. All membranes are demonstrated to have a high salt rejection fraction and the double-layered graphyne-4 membranes can further increase the salt rejection by trapping ions that have passed through the first membrane from the feed solution in the interlayer space.
Carbon chain molecules in interstellar clouds
International Nuclear Information System (INIS)
Winnewisser, G.; Walmsley, C.M.
1979-01-01
A survey of the distribution of long carbon chain molecules in interstellar clouds shows that their abundance is correlated. The various formation schemes for these molecules are discussed. It is concluded that the ion-molecule type formation mechanisms are more promising than their competitors. They have also the advantage of allowing predictions which can be tested by observations. Acetylene C 2 H 2 and diacetylene HCCCCH, may be very abundant in interstellar clouds. (Auth.)
Molecular dynamics simulations of ultrathin water film confined between flat diamond plates
Directory of Open Access Journals (Sweden)
A.V. Khomenko
2008-12-01
Full Text Available Molecular dynamics simulations of ultrathin water film confined between atomically flat rigid diamond plates are described. Films with thickness of one and two molecular diameters are concerned and TIP4P model is used for water molecules. Dynamical and equilibrium characteristics of the system for different values of the external load and shear force are investigated. An increase of the external load causes the transition of the film to a solidlike state. This is manifested in a decrease of the diffusion constant and in the ordering of the liquid molecules into quasidiscrete layers. For two-layer film under high loads, the molecules also become ordered parallel to the surfaces. Time dependencies of the friction force and the changes of its average value with the load are obtained. In general, the behaviour of the studied model is consistent with the experimental results obtained for simple liquids with spherical molecules.
Calorimetric and relaxation properties of xylitol-water mixtures
Elamin, Khalid; Sjöström, Johan; Jansson, Helén; Swenson, Jan
2012-03-01
considerably stronger water (w) relaxation at about the same frequency. However, the similarities in time scale and activation energy between the w-relaxation and the β-relaxation of xylitol at water contents below 13 wt. % suggest that the w-relaxation is governed, in some way, by the β-relaxation of xylitol, since clusters of water molecules are rare at these water concentrations. At higher water concentrations the intensity and relaxation rate of the w-relaxation increase rapidly with increasing water content (up to the concentration where ice starts to form), most likely due to a rapid increase of small water clusters where an increasing number of water molecules interacting with other water molecules.