WorldWideScience

Sample records for d1 overexpression p53

  1. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  2. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

    2009-01-01

    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  3. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae

    1999-01-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  4. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)

    1999-03-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  5. Overexpression of p53 in Nigerian breast cancers and its ...

    African Journals Online (AJOL)

    This study sought to determine the expression of p53 protein as well as the relationship with oestrogen receptor (ER) and progesterone receptor (PR) proteins. Methodology: Formalin-fixed, paraffin-embedded tissue samples of diagnosed invasive breast cancer were obtained from the Department of Anatomic and ...

  6. Overexpression of p53 activated by small activating RNA suppresses the growth of human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Ge Q

    2016-01-01

    Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate

  7. Overexpression of p53, MDM2 proteins in some atr radiation-induced skin ulcers

    International Nuclear Information System (INIS)

    Gu Qingyang; Gao Yabing; Wang Dewen; Cui Yufang; Zhao Po; Yang Zhixiang; Zhou Jie

    2000-01-01

    An animal model of radiation-induced skin ulcer was set up with 140 rats, which were locally irradiated with 35-55 Gy γ-rays. The pathological changes were observed for 1 year. Immunohistochemical studies were performed in 72 rat radiation skin ulcer specimens using anti-p53 and anti-MDM2 proteins polyclonal antibodies. The results showed that the positive rate for overexpression of p53 protein was 9.7%, and for that of MDM2 was 19.4%. The overexpression of p53 was mainly seen in the nuclei of activated squamous epithelial cells, and in fibroblasts, endotheliocytes in deeper part of the skin ulcers. The overexpression of MDM2 had the same localizations. It is suggested that the changes of p53 and MDM2, genes and proteins, may be related to the cancer transformation and poor healing of radiation-induced skin ulcers

  8. p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors

    NARCIS (Netherlands)

    Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't

    1999-01-01

    Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this

  9. P53 overexpression in head and neck carcinoma and radiotherapy results

    International Nuclear Information System (INIS)

    Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John

    1996-01-01

    Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a

  10. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    Directory of Open Access Journals (Sweden)

    Liu Jun

    2004-07-01

    Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.

  11. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    International Nuclear Information System (INIS)

    Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei

    2004-01-01

    BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies

  12. Pure versus combined Merkel cell carcinomas: immunohistochemical evaluation of cellular proteins (p53, Bcl-2, and c-kit) reveals significant overexpression of p53 in combined tumors.

    Science.gov (United States)

    Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M

    2015-09-01

    Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Apoptosis, proliferation and p53, cyclin D1, and retinoblastoma gene expression in relation to radiation response in transitional cell carcinoma of the bladder

    International Nuclear Information System (INIS)

    Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry

    2001-01-01

    Purpose: To determine whether the apoptotic index, the Ki67 index, and the expression of the p53, cyclin D1, and retinoblastoma genes correlate with local control, overall survival, and time to distant metastases in invasive bladder cancer treated with external beam radiation. Methods and Materials: Paraffin-embedded pretreatment biopsies from 83 patients with invasive transitional cell carcinoma of the bladder were scored morphologically for apoptosis and immunohistochemically for Ki67, p53, cyclin D1, and retinoblastoma gene expression. Survival analysis methods were used to assess overall survival, local control, and freedom from distant metastases. A multiple proportional hazard (PH) regression analysis was performed to study the prognostic value of the above mentioned biologic parameters (all divided into two categories, except Ki67) in addition to classical prognostic factors such as T stage, histologic grade, multifocality of the tumor, and completeness of transurethral resection. All patients were treated with external beam radiation as sole treatment. Median follow-up for the 19 patients still living was 7.5 years. Results: Apoptotic index varied from 0% to 3.4% with a mean of 0.8% and a median of 0.6%. Ki67 index varied from 0% to 60% with a mean of 14% and a median of 12%. P53 protein was detectable in 61% of the tumors. Overexpression of cyclin D1 was observed in 39% of the tumors and loss of retinoblastoma protein in 23% of the tumors. High Ki67 index was found to be significantly associated with p53 expression (p=0.04) and cyclin D1 overexpression (p=0.023). Cyclin D1 overexpression was found more often in Rb-positive tumors than in Rb-negative tumors (p=0.006). Other associations between the markers are less clear. Biologic markers were not correlated with T stage or grade. In the PH analysis local control was found to be significantly better for tumors with wild-type p53 (p=0.028). Also, tumors with an apoptotic index above the median value (0

  14. Overexpression of 15-lipoxygenase-1 induces growth arrest through phosphorylation of p53 in human colorectal cancer cells.

    Science.gov (United States)

    Kim, Jong-Sik; Baek, Seung Joon; Bottone, Frank G; Sali, Tina; Eling, Thomas E

    2005-09-01

    To investigate the function of 15-lipoxygenase-1 (15-LOX-1) in human colorectal cancer, we overexpressed 15-LOX-1 in HCT-116 human colorectal cancer cells. Clones expressing the highest levels of 15-LOX-1 displayed reduced viability compared with the HCT-116-Vector control cells. Further, by cell cycle gene array analyses, the cyclin-dependent kinase inhibitor p21WAF1/CIP1 and MDM2 genes were up-regulated in 15-LOX-1-overexpressing cells. The induction of p21(WAF1/CIP1) and MDM2 were linked to activation of p53 by 15-LOX-1, as there was a dramatic induction of phosphorylated p53 (Ser15) in 15-LOX-1-overesxpressing cells. However, the 15-LOX-1 metabolites 13(S)-hydroxyoctadecadienoic acid and 15(S)-hydroxyeicosatetraenoic acid failed to induce phosphorylation of p53 at Ser15, and the 15-LOX-1 inhibitor PD146176 did not inhibit the phosphorylation of p53 at Ser15 in 15-LOX-1-overexpressing cells. Nonetheless, the growth-inhibitory effects of 15-LOX-1 were p53 dependent, as 15-LOX-1 overexpression had no effect on cell growth in p53 (-/-) HCT-116 cells. Finally, treatment of HCT-116-15-LOX-1 cells with different kinase inhibitors suggested that the effects of 15-LOX-1 on p53 phosphorylation and activation were due to effects on DNA-dependent protein kinase. Collectively, these findings suggest a new mechanism to explain the biological activity of 15-LOX-1, where 15-LOX plays a stoichiometric role in activating a DNA-dependent protein kinase-dependent pathway that leads to p53-dependent growth arrest.

  15. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  16. Immunohistochemical study of p53 overexpression in radiation-induced colon cancers

    International Nuclear Information System (INIS)

    Minami, Kazunori; Hayashi, Nobuyuki; Mokarim, A.; Matsuzaki, Sumihiro; Ito, Masahiro; Sekine, Ichiro.

    1998-01-01

    The expressions of p53 and proliferating cell nuclear antigen (PCNA) were studied immunohistochemically from paraffin sections of 7 cases (9 lesions) of radiation-induced colon cancer and 42 cases of spontaneous colon cancer. Age distribution of radiation-induced and spontaneous colon cancer were 68.1 years (range, 56 to 77 years) and 67.4 years (range, 31 to 85 years), respectively. Among the radiation-induced colon cancers, there were 3 lesions of mucinous carcinoma (33%), a much higher than found for spontaneous mucinous cancer. Immunohistochemically, p53 protein expression was detected in 7/9 (78%) of radiation-induced cancers and in 23/42 (55%) of spontaneous colon cancers. χ 2 analysis found no significant differences between radiation-induced and spontaneous colon cancers in age distribution or p53-positive staining for frequency, histopathology, or Dukes'' classification. In radiation colitis around the cancers including aberrant crypts, spotted p53 staining and abnormal and scattered PCNA-positive staining were observed. In histologically normal cells, p53 staining was almost absent and PCNA-positive staining was regularly observed in the lower half of the crypt. In radiation colitis including aberrant glands, cellular proliferation increased and spotted p53 expression was observed. This study suggests that radiation colitis and aberrant glands might possess malignant potential and deeply associate with carcinogenesis of radiation-induced colon cancer. (author)

  17. Cdk5 phosphorylates non-genotoxically overexpressed p53 following inhibition of PP2A to induce cell cycle arrest/apoptosis and inhibits tumor progression

    Directory of Open Access Journals (Sweden)

    Kumari Ratna

    2010-07-01

    Full Text Available Abstract Background p53 is the most studied tumor suppressor and its overexpression may or may not cause cell death depending upon the genetic background of the cells. p53 is degraded by human papillomavirus (HPV E6 protein in cervical carcinoma. Several stress activated kinases are known to phosphorylate p53 and, among them cyclin dependent kinase 5 (Cdk5 is one of the kinase studied in neuronal cell system. Recently, the involvement of Cdk5 in phosphorylating p53 has been shown in certain cancer types. Phosphorylation at specific serine residues in p53 is essential for it to cause cell growth inhibition. Activation of p53 under non stress conditions is poorly understood. Therefore, the activation of p53 and detection of upstream kinases that phosphorylate non-genotoxically overexpressed p53 will be of therapeutic importance for cancer treatment. Results To determine the non-genotoxic effect of p53; Tet-On system was utilized and p53 inducible HPV-positive HeLa cells were developed. p53 overexpression in HPV-positive cells did not induce cell cycle arrest or apoptosis. However, we demonstrate that overexpressed p53 can be activated to upregulate p21 and Bax which causes G2 arrest and apoptosis, by inhibiting protein phosphatase 2A. Additionally, we report that the upstream kinase cyclin dependent kinase 5 interacts with p53 to phosphorylate it at Serine20 and Serine46 residues thereby promoting its recruitment on p21 and bax promoters. Upregulation and translocation of Bax causes apoptosis through intrinsic mitochondrial pathway. Interestingly, overexpressed activated p53 specifically inhibits cell-growth and causes regression in vivo tumor growth as well. Conclusion Present study details the mechanism of activation of p53 and puts forth the possibility of p53 gene therapy to work in HPV positive cervical carcinoma.

  18. Concurrent overexpression of serum p53 mutation related with Helicobacter pylori infection

    Directory of Open Access Journals (Sweden)

    Lorenzo-Peñuelas Antonio

    2010-06-01

    Full Text Available Abstract Background & Aims In the province of Cadiz (Spain, the adjusted mortality rate for gastric cancer in the coastal town of Barbate is 10/100.000 inhabitants, whereas in the inland town of Ubrique, the rate is twice as high. The rate of Helicobacter pylori (H. pylori infection (H. pylori antibodies in the normal population was 54% in Ubrique, but only 32% in Barbate. In the two decades since its original discovery, p53 has found a singularly prominent place in our understanding of human gastric cancer and H. pylori cause accumulation of reactive oxygen species in the mucosa compartment. This study was designed to compare serum levels of p53 in a population characterized by high mortality due to stomach cancer and a high prevalence of H. pylori infection and another population in which mortality from this cause and the prevalence of H. pylori infection are low. Materials and methods 319 subjects from the low mortality population and 308 from the high mortality population were studied, as were 71 patients with stomach cancer. We measured serum immunoglobulin G antibody to H. pylori and serum mutant p53 protein and ceruloplasmin. Results The difference between the two populations in the prevalence of H. pylori infection was significant (p Conclusions There is a significant association between infection with H. pylori, elevated titers of H. pylori antibodies, and positivity for serum mutant p53 protein. Such information can significantly increase our basic knowledge in molecular pathology of gastric cancer and protection against H. pylori infection.

  19. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    Science.gov (United States)

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  20. Overexpressed ubiquitin ligase Cullin7 in breast cancer promotes cell proliferation and invasion via down-regulating p53

    International Nuclear Information System (INIS)

    Guo, Hongsheng; Wu, Fenping; Wang, Yan; Yan, Chong; Su, Wenmei

    2014-01-01

    Highlights: • Cullin7 is overexpressed in human breast cancer samples. • Cullin7 stimulated proliferation and invasion of breast cancer cells. • Inhibition of p53 contributes to Cullin7-induced proliferation and invasion. - Abstract: Ubiquitin ligase Cullin7 has been identified as an oncogene in some malignant diseases such as choriocarcinoma and neuroblastoma. However, the role of Cullin7 in breast cancer carcinogenesis remains unclear. In this study, we compared Cullin7 protein levels in breast cancer tissues with normal breast tissues and identified significantly higher expression of Cullin7 protein in breast cancer specimens. By overexpressing Cullin7 in breast cancer cells HCC1937, we found that Cullin7 could promote cell growth and invasion in vitro. In contrast, the cell growth and invasion was inhibited by silencing Cullin7 in breast cancer cell BT474. Moreover, we demonstrated that Cullin7 promoted breast cancer cell proliferation and invasion via down-regulating p53 expression. Thus, our study provided evidence that Cullin7 functions as a novel oncogene in breast cancer and may be a potential therapeutic target for breast cancer management

  1. Overexpressed ubiquitin ligase Cullin7 in breast cancer promotes cell proliferation and invasion via down-regulating p53

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Hongsheng [Department of Histology and Embryology, Guangdong Medical College, Dongguan 523808, Guangdong (China); Wu, Fenping [The 7th People’s Hospital of Chengdu, Chengdu 610041, Sichuan (China); Wang, Yan [The Second School of Clinical Medicine, Guangdong Medical College, Dongguan 523808, Guangdong (China); Yan, Chong [School of Pharmacy, Guangdong Medical College, Dongguan 523808, Guangdong (China); Su, Wenmei, E-mail: wenmeisutg@126.com [Oncology of Affiliated Hospital Guangdong Medical College, Zhanjiang 524000, Guangdong (China)

    2014-08-08

    Highlights: • Cullin7 is overexpressed in human breast cancer samples. • Cullin7 stimulated proliferation and invasion of breast cancer cells. • Inhibition of p53 contributes to Cullin7-induced proliferation and invasion. - Abstract: Ubiquitin ligase Cullin7 has been identified as an oncogene in some malignant diseases such as choriocarcinoma and neuroblastoma. However, the role of Cullin7 in breast cancer carcinogenesis remains unclear. In this study, we compared Cullin7 protein levels in breast cancer tissues with normal breast tissues and identified significantly higher expression of Cullin7 protein in breast cancer specimens. By overexpressing Cullin7 in breast cancer cells HCC1937, we found that Cullin7 could promote cell growth and invasion in vitro. In contrast, the cell growth and invasion was inhibited by silencing Cullin7 in breast cancer cell BT474. Moreover, we demonstrated that Cullin7 promoted breast cancer cell proliferation and invasion via down-regulating p53 expression. Thus, our study provided evidence that Cullin7 functions as a novel oncogene in breast cancer and may be a potential therapeutic target for breast cancer management.

  2. No evidence for functional inactivation of wild-type p53 protein by MDM2 overexpression in gastric carcinogenesis

    NARCIS (Netherlands)

    Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1998-01-01

    Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result

  3. Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

    Science.gov (United States)

    Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

    2018-03-09

    The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

    NARCIS (Netherlands)

    Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

    1993-01-01

    Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

  5. Estrogen receptor positive breast tumors resist chemotherapy by the overexpression of P53 in Cancer Stem Cells

    Directory of Open Access Journals (Sweden)

    Fatma Ashour

    2018-06-01

    Full Text Available Background and Objectives: Breast cancer (BC is classified according to estrogen receptor (ER status into ER+ and ER− tumors. ER+ tumors have a worse response to chemotherapy compared to ER− tumors. BCL-2, TP53, BAX and NF-ΚB are involved in drug resistance in the ER+ tumors. Recently it was shown that Cancer Stem Cells (CSCs play an important role in drug resistance. In this study we tested the hypothesis that CSCs of the ER+ tumors resist drug through the overexpression of BCL-2, TP53, BAX and NF-ΚB. Methods: CSCs were isolated by anoikis resistance assay from MCF7 (ER+ and MDA-MB-231 (ER− cell lines. Isolated CSCs were treated with doxorubicin (DOX and the mRNA expression levels of BCL-2, TP53, BAX and NFKB were investigated by quantitative real time PCR (qPCR with and without treatment. Results: BCL-2, BAX and NF-ΚB showed decreased expression in MCF7 bulk cancer cells after DOX treatment whereas only BCL-2 and BAX showed decreased expression in MDA-MB-231 bulk cancer cells. Interestingly TP53 was the only gene showed a considerable increase in its expression in CSCs of the ER+ MCF7 cell line compared to bulk cancer cells. Moreover, TP53 was the only gene showing exceptionally higher level of expression in MCF7-CSCs compared to MDA-MB-231-CSCs. Conclusion: Our results suggest that CSCs in the ER+ cells escape the effect of DOX treatment by the elevation of p53 expression. Keywords: Breast cancer, Cancer Stem Cells, Drug resistance, Estrogen receptors

  6. Deregulation of p53 and RB Transcriptional Control Leads to Overexpression of DNA Methyltransferases in Lung Cancer

    Directory of Open Access Journals (Sweden)

    Yen-An Tang

    2014-06-01

    Conclusions: This study provides cell and clinical evidence that p53 and RB pathways transcriptionally repress DNMT expression. Normal expression of DNMT3A, RB and MDM2 proteins can be a biomarker for good prognosis in lung cancer.

  7. Adenocarcinoma of the esophagogastric junction: relationship between clinicopathological data and p53, cyclin D1 and Bcl-2 immunoexpressions Adenocarcinoma da junção esôfago-gástrica: relação entre os dados cllnipatológicos e a imunoexpressão de p53, ciclina D1 e Bcl-2

    Directory of Open Access Journals (Sweden)

    Dárcio Matenhauer Lehrbach

    2009-12-01

    Full Text Available CONTEXT: Esophagogastric junction adenocarcinoma has an aggressive behavior, and TNM (UICC staging is not always accurate enough to categorize patient's outcome. OBJECTIVES: To evaluated p53, cyclin D1 and Bcl-2 immunoexpressions in esophagogastric junction adenocarcinoma patients, without Barrett's esophagus, and to compared to clinicopathological characteristics and survival rate. METHODS: Tissue sections from 75 esophagogastric junction adenocarcinomas resected from 1991 to 2003 were analyzed by immunohistochemistry for p53, cyclin D1 and Bcl-2 using streptavidin-biotin-peroxidase method. The mean follow-up time was 60 months SD = 61.5 (varying from 4 to 273 months. RESULTS: Fifty (66.7% of the tumors were intestinal type and 25 (33.3% were diffuse. Vascular, lymph node and perineural infiltration were verified in 16%, 80% and 68% of the patients, respectively. The patients were distributed according to the TNM staging in IA in 4 (5.3%, IB in 10 (13.3%, II in 15 (20%, IIA in 15 (20%, IIIB in 15 (20% and IV in 16 (21.3%. Immunohistochemical analysis was positive for p53, cyclin D1 and bcl-2 in 68%, 18.7% and 100%, respectively. There was no association between immunoexpression and vascular and/or perineural invasions, clinicopathological characteristics and patients' survival rate. CONCLUSION: In this selected population, there was no association between the immunomarkers, p53, cyclin D1 and bcl-2 and clinicopathological data and/or overall survival.CONTEXTO: O adenocarcinoma da junção esôfago-gástrica tem um comportamento agressivo e o estádio TNM não é sempre suficiente para categorizar o paciente de acordo com a evolução do mesmo. OBJETIVO: Avaliar a imunoexpressão do p53, ciclina D1 e Bcl-2 em pacientes com adenocarcinoma da junção esôfago-gástrica sem esôfago de Barrett e comparar com as características clínicas e sobrevida. MÉTODOS: Cortes histológicos de 75 adenocarcinomas da esôfago-gástrica ressecados de 1991 a

  8. Nanotized PPARα Overexpression Targeted to Hypertrophied Myocardium Improves Cardiac Function by Attenuating the p53-GSK3β-Mediated Mitochondrial Death Pathway.

    Science.gov (United States)

    Rana, Santanu; Datta, Ritwik; Chaudhuri, Ratul Datta; Chatterjee, Emeli; Chawla-Sarkar, Mamta; Sarkar, Sagartirtha

    2018-05-09

    Metabolic remodeling of cardiac muscles during pathological hypertrophy is characterized by downregulation of fatty acid oxidation (FAO) regulator, peroxisome proliferator-activated receptor alpha (PPARα). Thereby, we hypothesized that a cardiac-specific induction of PPARα might restore the FAO-related protein expression and resultant energy deficit. In the present study, consequences of PPARα augmentation were evaluated for amelioration of chronic oxidative stress, myocyte apoptosis, and cardiac function during pathological cardiac hypertrophy. Nanotized PPARα overexpression targeted to myocardium was done by a stearic acid-modified carboxymethyl-chitosan (CMC) conjugated to a 20-mer myocyte-targeted peptide (CMCP). Overexpression of PPARα ameliorated pathological hypertrophy and improved cardiac function. Augmented PPARα in hypertrophied myocytes revealed downregulated p53 acetylation (lys 382), leading to reduced apoptosis. Such cells showed increased binding of PPARα with p53 that in turn reduced interaction of p53 with glycogen synthase kinase-3β (GSK3β), which upregulated inactive phospho-GSK3β (serine [Ser]9) expression within mitochondrial protein fraction. Altogether, the altered molecular milieu in PPARα-overexpressed hypertrophy groups restored mitochondrial structure and function both in vitro and in vivo. Cardiomyocyte-targeted overexpression of a protein of interest (PPARα) by nanotized plasmid has been described for the first time in this study. Our data provide a novel insight towards regression of pathological hypertrophy by ameliorating mitochondrial oxidative stress in targeted PPARα-overexpressed myocardium. PPARα-overexpression during pathological hypertrophy showed substantial betterment of mitochondrial structure and function, along with downregulated apoptosis. Myocardium-targeted overexpression of PPARα during pathological cardiac hypertrophy led to an overall improvement of cardiac energy deficit and subsequent cardiac

  9. Automated Quantitative Analysis of p53, Cyclin D1, Ki67 and pERK Expression in Breast Carcinoma Does Not Differ from Expert Pathologist Scoring and Correlates with Clinico-Pathological Characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Cass, Jamaica D. [Division of Cancer Biology and Genetics, Cancer Research Institute, Queen’s University, Kingston K7L 3N6 (Canada); Varma, Sonal [Department of Pathology and Molecular Medicine, Queen’s University, Kingston K7L 3N6 (Canada); Day, Andrew G. [Kingston General Hospital, Kingston K7L 2V7 (Canada); Sangrar, Waheed [Division of Cancer Biology and Genetics, Cancer Research Institute, Queen’s University, Kingston K7L 3N6 (Canada); Rajput, Ashish B. [Department of Pathology and Molecular Medicine, Queen’s University, Kingston K7L 3N6 (Canada); Raptis, Leda H.; Squire, Jeremy [Division of Cancer Biology and Genetics, Cancer Research Institute, Queen’s University, Kingston K7L 3N6 (Canada); Madarnas, Yolanda [Department of Oncology, Queen’s University, Kingston K7L 3N6 (Canada); SenGupta, Sandip K. [Department of Pathology and Molecular Medicine, Queen’s University, Kingston K7L 3N6 (Canada); Elliott, Bruce E., E-mail: elliottb@queensu.ca [Division of Cancer Biology and Genetics, Cancer Research Institute, Queen’s University, Kingston K7L 3N6 (Canada); Department of Pathology and Molecular Medicine, Queen’s University, Kingston K7L 3N6 (Canada)

    2012-07-18

    There is critical need for improved biomarker assessment platforms which integrate traditional pathological parameters (TNM stage, grade and ER/PR/HER2 status) with molecular profiling, to better define prognostic subgroups or systemic treatment response. One roadblock is the lack of semi-quantitative methods which reliably measure biomarker expression. Our study assesses reliability of automated immunohistochemistry (IHC) scoring compared to manual scoring of five selected biomarkers in a tissue microarray (TMA) of 63 human breast cancer cases, and correlates these markers with clinico-pathological data. TMA slides were scanned into an Ariol Imaging System, and histologic (H) scores (% positive tumor area x staining intensity 0–3) were calculated using trained algorithms. H scores for all five biomarkers concurred with pathologists’ scores, based on Pearson correlation coefficients (0.80–0.90) for continuous data and Kappa statistics (0.55–0.92) for positive vs. negative stain. Using continuous data, significant association of pERK expression with absence of LVI (p = 0.005) and lymph node negativity (p = 0.002) was observed. p53 over-expression, characteristic of dysfunctional p53 in cancer, and Ki67 were associated with high grade (p = 0.032 and 0.0007, respectively). Cyclin D1 correlated inversely with ER/PR/HER2-ve (triple negative) tumors (p = 0.0002). Thus automated quantitation of immunostaining concurs with pathologists’ scoring, and provides meaningful associations with clinico-pathological data.

  10. Automated Quantitative Analysis of p53, Cyclin D1, Ki67 and pERK Expression in Breast Carcinoma Does Not Differ from Expert Pathologist Scoring and Correlates with Clinico-Pathological Characteristics

    International Nuclear Information System (INIS)

    Cass, Jamaica D.; Varma, Sonal; Day, Andrew G.; Sangrar, Waheed; Rajput, Ashish B.; Raptis, Leda H.; Squire, Jeremy; Madarnas, Yolanda; SenGupta, Sandip K.; Elliott, Bruce E.

    2012-01-01

    There is critical need for improved biomarker assessment platforms which integrate traditional pathological parameters (TNM stage, grade and ER/PR/HER2 status) with molecular profiling, to better define prognostic subgroups or systemic treatment response. One roadblock is the lack of semi-quantitative methods which reliably measure biomarker expression. Our study assesses reliability of automated immunohistochemistry (IHC) scoring compared to manual scoring of five selected biomarkers in a tissue microarray (TMA) of 63 human breast cancer cases, and correlates these markers with clinico-pathological data. TMA slides were scanned into an Ariol Imaging System, and histologic (H) scores (% positive tumor area x staining intensity 0–3) were calculated using trained algorithms. H scores for all five biomarkers concurred with pathologists’ scores, based on Pearson correlation coefficients (0.80–0.90) for continuous data and Kappa statistics (0.55–0.92) for positive vs. negative stain. Using continuous data, significant association of pERK expression with absence of LVI (p = 0.005) and lymph node negativity (p = 0.002) was observed. p53 over-expression, characteristic of dysfunctional p53 in cancer, and Ki67 were associated with high grade (p = 0.032 and 0.0007, respectively). Cyclin D1 correlated inversely with ER/PR/HER2-ve (triple negative) tumors (p = 0.0002). Thus automated quantitation of immunostaining concurs with pathologists’ scoring, and provides meaningful associations with clinico-pathological data

  11. Over-expression of p53 mutants in LNCaP cells alters tumor growth and angiogenesis in vivo

    International Nuclear Information System (INIS)

    Perryman, L.A.; Blair, J.M.; Kingsley, E.A.; Szymanska, B.; Ow, K.T.; Wen, V.W.; MacKenzie, K.L.; Vermeulen, P.B.; Jackson, P.; Russell, P.J.

    2006-01-01

    This study has investigated the impact of three specific dominant-negative p53 mutants (F134L, M237L, and R273H) on tumorigenesis by LNCaP prostate cancer cells. Mutant p53 proteins were associated with an increased subcutaneous 'take rate' in NOD-SCID mice, and increased production of PSA. Tumors expressing F134L and R273H grew slower than controls, and were associated with decreased necrosis and apoptosis, but not hypoxia. Interestingly, hypoxia levels were increased in tumors expressing M237L. There was less proliferation in F134L-bearing tumors compared to control, but this was not statistically significant. Angiogenesis was decreased in tumors expressing F134L and R273H compared with M237L, or controls. Conditioned medium from F134L tumors inhibited growth of normal human umbilical-vein endothelial cells but not telomerase-immortalized bone marrow endothelial cells. F134L tumor supernatants showed lower levels of VEGF and endostatin compared with supernatants from tumors expressing other mutants. Our results support the possibility that decreased angiogenesis might account for reduced growth rate of tumor cells expressing the F134L p53 mutation

  12. In squamous cell carcinoma of the vulva, overexpression of p53 is a late event and neither p53 nor mdm2 expression is a useful marker to predict lymph node metastases

    NARCIS (Netherlands)

    Emanuels, AG; Koudstaal, J; Burger, MPM; Hollema, H

    To offer more tailored treatment to individual patients with squamous cell carcinoma of the vulval more accurate prediction of lymph node metastases is required. As p53 and mdm2 are genes known to be involved in the development of other tumours, we studied expression of p53 and mdm2 in

  13. Nicotine induces cell proliferation in association with cyclin D1 up-regulation and inhibits cell differentiation in association with p53 regulation in a murine pre-osteoblastic cell line

    International Nuclear Information System (INIS)

    Sato, Tsuyoshi; Abe, Takahiro; Nakamoto, Norimichi; Tomaru, Yasuhisa; Koshikiya, Noboru; Nojima, Junya; Kokabu, Shoichiro; Sakata, Yasuaki; Kobayashi, Akio; Yoda, Tetsuya

    2008-01-01

    Recent studies have suggested that nicotine critically affects bone metabolism. Many studies have examined the effects of nicotine on proliferation and differentiation, but the underlying molecular mechanisms remain unclear. We examined cell cycle regulators involved in the proliferation and differentiation of MC3T3-E1 cells. Nicotine induced cell proliferation in association with p53 down-regulation and cyclin D1 up-regulation. In differentiated cells, nicotine reduced alkaline phosphatase activity and mineralized nodule formation in dose-dependent manners. Furthermore, p53 expression was sustained in nicotine-treated cells during differentiation. These findings indicate that nicotine promotes the cell cycle and inhibits differentiation in association with p53 regulation in pre-osteoblastic cells

  14. Skp2B overexpression alters a prohibitin-p53 axis and the transcription of PAPP-A, the protease of insulin-like growth factor binding protein 4.

    Directory of Open Access Journals (Sweden)

    Harish Chander

    Full Text Available We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established.We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured.These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.

  15. Survival of ovarian cancer patients overexpressing the tumour antigen p53 is diminished in case of MHC class I down-regulation

    NARCIS (Netherlands)

    Leffers, Ninke; Lambeck, Annechien J. A.; de Graeff, Pauline; Bijlsma, Astrid Y.; Daemen, Toos; van der Zee, Ate G. J.; Nijman, Hans W.

    Objectives. The adaptive immune system seems to play an essential role in the natural course of ovarian cancer. Aim of this study was to establish whether disease-specific survival for patients expressing the tumour antigen p53 is influenced by MHC class I expression or the presence of p53

  16. The prognostic implication of the expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in primary locally advanced oral squamous cell carcinoma cases: a tissue microarray study.

    Science.gov (United States)

    Solomon, Monica Charlotte; Vidyasagar, M S; Fernandes, Donald; Guddattu, Vasudev; Mathew, Mary; Shergill, Ankur Kaur; Carnelio, Sunitha; Chandrashekar, Chetana

    2016-12-01

    Oral squamous cell carcinomas comprise a heterogeneous tumor cell population with varied molecular characteristics, which makes prognostication of these tumors a complex and challenging issue. Thus, molecular profiling of these tumors is advantageous for an accurate prognostication and treatment planning. This is a retrospective study on a cohort of primary locally advanced oral squamous cell carcinomas (n = 178) of an Indian rural population. The expression of EGFR, p53, cyclin D1, Bcl-2 and p16 in a cohort of primary locally advanced oral squamous cell carcinomas was evaluated. A potential biomarker that can predict the tumor response to treatment was identified. Formalin-fixed paraffin-embedded tumor blocks of (n = 178) of histopathologically diagnosed cases of locally advanced oral squamous cell carcinomas were selected. Tissue microarray blocks were constructed with 2 cores of 2 mm diameter from each tumor block. Four-micron-thick sections were cut from these tissue microarray blocks. These tissue microarray sections were immunohistochemically stained for EGFR, p53, Bcl-2, cyclin D1 and p16. In this cohort, EGFR was the most frequently expressed 150/178 (84%) biomarker of the cases. Kaplan-Meier analysis showed a significant association (p = 0.038) between expression of p53 and a poor prognosis. A Poisson regression analysis showed that tumors that expressed p53 had a two times greater chance of recurrence (unadjusted IRR-95% CI 2.08 (1.03, 4.5), adjusted IRR-2.29 (1.08, 4.8) compared with the tumors that did not express this biomarker. Molecular profiling of oral squamous cell carcinomas will enable us to categorize our patients into more realistic risk groups. With biologically guided tumor characterization, personalized treatment protocols can be designed for individual patients, which will improve the quality of life of these patients.

  17. Hypermethylation of the 5′ CpG island of the p14ARF flanking exon 1β in human colorectal cancer displaying a restricted pattern of p53 overexpression concomitant with increased MDM2 expression

    Directory of Open Access Journals (Sweden)

    Nyiraneza Christine

    2012-06-01

    Full Text Available Abstract Background It has been suggested that inactivation of p14ARF, a tumor suppressor central to regulating p53 protein stability through interaction with the MDM2 oncoprotein, abrogates p53 activity in human tumors retaining the wild-type TP53 gene. Differences in expression of tumor suppressor genes are frequently associated with cancer. We previously reported on a pattern of restricted p53 immunohistochemical overexpression significantly associated with microsatellite instability (MSI, low TP53 mutation frequency, and MDM2 overexpression in colorectal cancers (CRCs. In this study, we investigated whether p14ARF alterations could be a mechanism for disabling the p53 pathway in this subgroup of CRCs. Results Detailed maps of the alterations in the p14ARF gene were determined in a cohort of 98 CRCs to detect both nucleotide and copy-number changes. Methylation-specific PCR combined with bisulfite sequencing was used to evaluate the prevalence and distribution of p14ARF methylation. p14ARF alterations were then correlated with MSI status, TP53 mutations, and immunohistochemical expression of p53 and MDM2. The frequency of p14ARF mutations was extremely low (1/98; 1%, whereas coexistence of methylated and unmethylated alleles in both tumors and normal colon mucosa was common (91/98; 93%. Only seven of ninety-eight tumors (7% had a distinct pattern of methylation compared with normal colon mucosa. Evaluation of the prevalence and distribution of p14ARF promoter methylation in a region containing 27 CpG sites in 35 patients showed a range of methylated CpG sites in tumors (0 to 25 (95% CI 1 to 13 versus 0 to 17 (95% CI 0 to 2 in adjacent colon mucosa (P = 0.004. Hypermethylation of the p14ARF promoter was significantly correlated with the restricted p53 overexpression pattern (P = 0.03, and MDM2 overexpression (P = 0.02, independently of MSI phenotype. Although no significant correlation between p14ARF methylation and TP53 mutational

  18. Presença da Proteína p53 como Prognóstico de Recidiva/Progressão de Neoplasia Intra-epitelial Vulvar III p53 Protein Overexpression as a Prognostic Marker for Vulvar Intraepithelial Neoplasia III Recurrence/Progression

    Directory of Open Access Journals (Sweden)

    Isabel Cristina Chulvis do Val Guimarães

    2002-01-01

    Full Text Available Objetivo: avaliar o valor da presença da proteína p53 nos casos de recidiva/progressão da neoplasia intra-epitelial vulvar (VIN III. Métodos: foram selecionadas 20 pacientes com VIN III indiferenciada, seguidas semestralmente por período de até quatro anos, divididas em dois grupos: quatorze sem e seis com recidiva/progressão da lesão. Os casos de recidiva/progressão foram distribuídos da seguinte forma: em três pacientes a recidiva ocorreu uma única vez, em duas, houve dupla recorrência e apenas uma evoluiu para carcinoma escamoso. Em ambos os grupos foram avaliados o sítio vulvar acometido e a presença da proteína p53 com análise do padrão de marcação imunohistoquímica. Estudo semelhante foi realizado nos casos de recidiva/progressão além da análise do intervalo de tempo para o surgimento de recidiva/progressão. Resultados: observou-se recidiva da VIN III em 25% dos casos e, em 5%, progressão para carcinoma. O tempo médio de recidiva foi de 24,5 meses. A localização multifocal da lesão primária foi a mais freqüente (50% em ambos os grupos. Na maioria dos casos (87,5%, a recidiva/progressão ocorreu na mesma localização da lesão vulvar primária. A presença da proteína p53 mostrou-se positiva em 50% das lesões primárias de VIN III e em 75% dos casos de recidiva/progressão. Conclusões: a presença da proteína p53 parece desempenhar papel importante na gênese e na predição do curso clínico das VIN III. As recidivas/progressão das VIN III tendem a ocorrer na mesma área da doença inicial, sugerindo a presença de campo molecular alterado.Purpose: to evaluate p53 overexpression value in vulvar intraepithelial neoplasia (VIN III recurrence/progression. Methods: twenty patients with undifferentiated VIN III were selected and followed up every six months for four years and divided into two groups: fourteen without and six with recurrence/progression lesion. The recurrence/progression cases were

  19. Molecular markers for diagnostic cytology of neoplasms in the head region of the pancreas: mutation of K-ras and overexpression of the p53 protein product

    NARCIS (Netherlands)

    van Es, J. M.; Polak, M. M.; van den Berg, F. M.; Ramsoekh, T. B.; Craanen, M. E.; Hruban, R. H.; Offerhaus, G. J.

    1995-01-01

    To determine the potential efficiency of molecular markers specific for neoplastic change--mutations of the K-ras oncogene and the p53 tumour suppressor gene--in diagnosing pancreatic carcinoma. Archival cytology samples obtained from 17 patients with established pancreatic carcinoma were assayed

  20. Prognostic implications of molecular and immunohistochemical profiles of the Rb and p53 cell cycle regulatory pathways in primary non-small cell lung carcinoma.

    LENUS (Irish Health Repository)

    Burke, Louise

    2012-02-03

    PURPOSE: Many studies have highlighted the aberrant expression and prognostic significance of individual proteins in either the Rb (particularly cyclin D1, p16INK4A, and pRb) or the p53 (p53 and p21Waf1) pathways in non-small cell lung cancer. We hypothesize that cumulative abnormalities within each and between these pathways would have significant prognostic potential regarding survival. EXPERIMENTAL DESIGN: Our study population consisted of 106 consecutive surgically resected cases of predominantly early-stage non-small cell lung cancer from the National Cancer Institute-Mayo Clinic series, and assessment of proteins involved both immunohistochemical (cyclin D1, p21Waf1, pRb, p16INK4A, and p53) and mutational analysis (p53) in relationship to staging and survival. RESULTS: Cyclin D1 overexpression was noted in 48% of the tumors, p16INK4A negative in 53%, pRb negative in 17%, p53 immunopositive in 50%, p53 mutation frequency in 48%, and p21(Waf1) overexpression in 47%, none with prognostic significance. Cyclin D1 overexpression in pRb-negative tumors revealed a significantly worse prognosis with a mean survival of 2.3 years (P = 0.004). A simultaneous p53 mutation dramatically reduced the mean survival time to 0.9 years (P = 0.007). Cyclin D1 overexpression with either a p53 mutation or a p53 overexpression was also associated with a significantly poorer prognosis (P = 0.0033 and 0.0063, respectively). CONCLUSIONS: Some cumulative abnormalities in the Rb and p53 pathways (e.g., cyclin D1 overexpression and p53 mutations) significantly cooperate to predict a poor prognosis; however, the complexity of the cell cycle protein interaction in any given tumor warrants caution in interpreting survival results when specific protein abnormalities are taken in isolation.

  1. iASPP is over-expressed in human non-small cell lung cancer and regulates the proliferation of lung cancer cells through a p53 associated pathway

    International Nuclear Information System (INIS)

    Chen, Jinfeng; Xie, Fei; Zhang, Lijian; Jiang, Wen G

    2010-01-01

    iASPP is a key inhibitor of tumour suppressor p53 and is found to be up-regulated in certain malignant conditions. The present study investigated the expression of iASPP in clinical lung cancer, a leading cancer type in the world, and the biological impact of this molecule on lung cancer cells. iASPP protein levels in lung cancer tissues were evaluated using an immunohistochemical method. In vitro, iASPP gene expression was suppressed with a lentvirus-mediated shRNA method and the biological impact after knocking down iASSP on lung cancer cell lines was investigated in connection with the p53 expression status. We showed here that the expression of iASPP was significantly higher in lung cancer tissues compared with the adjacent normal tissues. iASPP shRNA treatment resulted in a down-regulation of iASPP in lung cancer cells. There was a subsequent reduction of cell proliferation of the two lung tumour cell lines A459 and 95D both of which had wild-type p53 expression. In contrast, reduction of iASPP in H1229 cells, a cell with little p53 expression, had no impact on its growth rate. iASPP regulates the proliferation and motility of lung cancer cells. This effect is intimately associated with the p53 pathway. Together with the pattern of the over-expression in clinical lung cancers, it is concluded that iASPP plays an pivotal role in the progression of lung cancer and is a potential target for lung cancer therapy

  2. Mantle cell lymphoma pathogenesis: another turn of the screw to cyclin D1 overexpression

    OpenAIRE

    Albero Gallego, Robert

    2017-01-01

    [eng] Mantle cell lymphoma (MCL) is an aggressive lymphoid neoplasm derived from mature B cells characterized by the presence of the t(11;14)(q13;q32) translocation that leads to the overexpression of Cyclin D1. Cyclin D1 plays a well-established role in G1/S progression, although other functions including transcription or DNA damage response (DDR) can be regulated by this cyclin. Therefore, the main goal of this thesis is the characterization of the cyclin D1 non-canonical function in MCL a...

  3. Mantle cell lymphoma pathogenesis: another turn of the screw to cyclin D1 overexpression

    OpenAIRE

    Albero Gallego, Robert

    2017-01-01

    Mantle cell lymphoma (MCL) is an aggressive lymphoid neoplasm derived from mature B cells characterized by the presence of the t(11;14)(q13;q32) translocation that leads to the overexpression of Cyclin D1. Cyclin D1 plays a well-established role in G1/S progression, although other functions including transcription or DNA damage response (DDR) can be regulated by this cyclin. Therefore, the main goal of this thesis is the characterization of the cyclin D1 non-canonical function in MCL and lymp...

  4. Cyclin D1 overexpression, cell cycle progression and radiosensitivity in MBP cells

    International Nuclear Information System (INIS)

    Wu Lijun; Yu Zengliang

    2000-11-01

    Clones that exhibited a minimum of 7-8 fold cyclin D1 level above the parent cell lines or the vector control were obtained after transfected with the entire coding sequence of human 1.1 kb cyclin D1 cDNA. Studies showed that there was no significant difference in Radiosensitivity between over-expressing cyclin D1 and control cultures from either mouse or human origin. Using flow cytometry to access cell cycle distribution in the exponentially growth cultures of MCF10F-D1-21 and MCF10F-V-3, it was found that there was a 50 percent increase in the proportion of G2/M phase cells and 5.3 percent decrease in the proportion of G0/G1 phase cells in MCF10F-D1-21 comparing with MCF10F-V-3, though they were with the same proportion of cells in S phase

  5. Effect of berberine on cell cycle arrest and cell survival during cerebral ischemia and reperfusion and correlations with p53/cyclin D1 and PI3K/Akt.

    Science.gov (United States)

    Chai, Yu-Shuang; Hu, Jun; Lei, Fan; Wang, Yu-Gang; Yuan, Zhi-Yi; Lu, Xi; Wang, Xin-Pei; Du, Feng; Zhang, Dong; Xing, Dong-Ming; Du, Li-Jun

    2013-05-15

    Berberine acted as a natural medicine with multiple pharmacological activities. In the present study, we examined the effect of berberine against cerebral ischemia damage from cell cycle arrest and cell survival. Oxygen-glucose deprivation of PC12 cells and primary neurons, and carotid artery ligation in mice were used as in vitro and in vivo cerebral ischemia models. We found that the effect of berberine on cell cycle arrest during ischemia was mediated by decreased p53 and cyclin D1, increased phosphorylation of Bad (higher expression of p-Bad and higher ratio of p-Bad to Bad) and decreased cleavage of caspase 3. Meanwhile, berberine activated the PI3K/Akt pathway during the reperfusion, especially the phosphor-activation of Akt, to promote the cell survival. The neural protective effect of berberine was remained in the presence of inhibitor of mitogen-activated protein/extracellular signal-regulated kinase (MEK), but was suppressed by the inhibitors of PI3K and Akt. We demonstrated that berberine induced cell cycle arrest and cell survival to resist cerebral ischemia injury. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  7. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  8. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  9. Overexpression of BLCAP induces S phase arrest and apoptosis independent of p53 and NF-kappa B in human tongue carcinoma - BLCAP overexpression induces S phase arrest and apoptosis

    NARCIS (Netherlands)

    Yao, Jun; Duan, Li; Fan, Mingwen; Yuan, Jianhuan; Wu, Xinxing

    Bladder cancer-associated protein gene (BLCAP) is a novel candidate tumor suppressor gene identified from the human bladder carcinoma. Our previous studies have shown that BLCAP overexpression could inhibit cell growth by inducing apoptosis in HeLa cells [Zuo Z, Zhao M, Liu J, Gao G, Wu X: Tumor

  10. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro

    2016-05-01

    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  11. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

    Science.gov (United States)

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

    2017-10-01

    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  12. CARMA3 is overexpressed in colon cancer and regulates NF-κB activity and cyclin D1 expression

    International Nuclear Information System (INIS)

    Miao, Zhifeng; Zhao, Tingting; Wang, Zhenning; Xu, Yingying; Song, Yongxi; Wu, Jianhua; Xu, Huimian

    2012-01-01

    Highlights: ► CARMA3 expression is elevated in colon cancers. ► CARMA3 promotes proliferation and cell cycle progression in colon cancer cells. ► CARMA3 upregulates cyclinD1 through NF-κB activation. -- Abstract: CARMA3 was recently reported to be overexpressed in cancers and associated with the malignant behavior of cancer cells. However, the expression of CARMA3 and its biological roles in colon cancer have not been reported. In the present study, we analyzed the expression pattern of CARMA3 in colon cancer tissues and found that CARMA3 was overexpressed in 30.8% of colon cancer specimens. There was a significant association between CARMA3 overexpression and TNM stage (p = 0.0383), lymph node metastasis (p = 0.0091) and Ki67 proliferation index (p = 0.0035). Furthermore, knockdown of CARMA3 expression in HT29 and HCT116 cells with high endogenous expression decreased cell proliferation and cell cycle progression while overexpression of CARMA3 in LoVo cell line promoted cell proliferation and facilitated cell cycle transition. Further analysis showed that CARMA3 knockdown downregulated and its overexpression upregulated cyclin D1 expression and phospho-Rb levels. In addition, we found that CARMA3 depletion inhibited p-IκB levels and NF-κB activity and its overexpression increased p-IκB expression and NF-κB activity. NF-κB inhibitor BAY 11-7082 reversed the role of CARMA3 on cyclin D1 upregulation. In conclusion, our study found that CARMA3 is overexpressed in colon cancers and contributes to malignant cell growth by facilitating cell cycle progression through NF-κB mediated upregulation of cyclin D1.

  13. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  14. Acquired radioresistance of cancer and the AKT/GSK3β/cyclin D1 overexpression cycle

    International Nuclear Information System (INIS)

    Shimura, Tsutomu

    2011-01-01

    Fractionated radiotherapy (RT) is widely used in cancer therapy for its advantages in the preservation of normal tissues. However, repopulation of surviving tumor cells during fractionated RT limits the efficacy of RT. In fact, repopulating tumors often acquire radioresistance and this is the major cause of failure of RT. We have recently demonstrated that human tumor cells acquire radioresistance when exposed to fractionated radiation (FR) of X-rays every 12 hours for 1 month. The acquired radioresistance was associated with overexpression of cyclin D1, a result of a series of molecular changes; constitutive activation of DNA-PK and AKT with concomitant down-regulation of glycogen synthase kinase-3β (GSK3β) which results in suppression of cyclin D1 proteolysis. Aberrant cyclin D1 overexpression in S-phase induced DNA double strand breaks which activated DNA-PK and established the vicious cycle of cycling D1 overexpression. This overexpression of cyclin D1 is responsible for the radioresistance phenotype of long-term FR cells, since this phenotype was completely abrogated by treatment of FR cells by the AKT/PKB signaling inhibitor (API-2), an AKT inhibitor or by a Cdk4 inhibitor. Thus, targeting the AKT/GSK3β/cyclin D1/Cdk4 pathway can be an efficient modality to suppress acquired radioresistance of tumor cells. In this article, I overview the newly discovered molecular mechanisms underlying acquired radioresistance of tumor cells induced by FR, and propose a strategy for eradication of tumors using fractionated RT by overcoming tumor radioresistance. (author)

  15. The p53-MDM2 network: from oscillations to apoptosis

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    Apoptosis; cancer; cell cycle; MDM2 overexpression; tumour suppressor .... model of the p53-MDM2 negative feedback loop included an .... MDM2 overexpression, when subjected to nutlin-3 treatment. Some aspects of the model are similar to those ... A family of proteases termed caspases .... Implications for therapy; Proc.

  16. Basaloid Squamous Cell Carcinoma of the Head and Neck: Subclassification into Basal, Ductal, and Mixed Subtypes Based on Comparison of Clinico-pathologic Features and Expression of p53, Cyclin D1, Epidermal Growth Factor Receptor, p16, and Human Papillomavirus

    Directory of Open Access Journals (Sweden)

    Kyung-Ja Cho

    2017-07-01

    Full Text Available Background Basaloid squamous cell carcinoma (BSCC is a rare variant of squamous cell carcinoma with distinct pathologic characteristics. The histogenesis of BSCC is not fully understood, and the cancer has been suggested to originate from a totipotent primitive cell in the basal cell layer of the surface epithelium or in the proximal duct of secretory glands. Methods Twenty-six cases of head and neck BSCC from Asan Medical Center, Seoul, Korea, reported during a 14-year-period were subclassified into basal, ductal, and mixed subtypes according to the expression of basal (cytokeratin [CK] 5/6, p63 or ductal markers (CK7, CK8/18. The cases were also subject to immunohistochemical study for CK19, p53, cyclin D1, epidermal growth factor receptor (EGFR, and p16 and to in situ hybridization for human papillomavirus (HPV, and the results were clinico-pathologically compared. Results Mixed subtype (12 cases was the most common, and these cases showed hypopharyngeal predilection, older age, and higher expression of CK19, p53, and EGFR than other subtypes. The basal subtype (nine cases showed frequent comedo-necrosis and high expression of cyclin D1. The ductal subtype (five cases showed the lowest expression of p53, cyclin D1, and EGFR. A small number of p16- and/or HPV-positive cases were not restricted to one subtype. BSCC was the cause of death in 19 patients, and the average follow-up period for all patients was 79.5 months. Overall survival among the three subtypes was not significantly different. Conclusions The results of this study suggest a heterogeneous pathogenesis of head and neck BSCC. Each subtype showed variable histology and immunoprofiles, although the clinical implication of heterogeneity was not determined in this study.

  17. Correlation of cytoplasmic beta-catenin and cyclin D1 overexpression during thyroid carcinogenesis around Semipalatinsk nuclear test site.

    Science.gov (United States)

    Meirmanov, Serik; Nakashima, Masahiro; Kondo, Hisayoshi; Matsufuji, Reiko; Takamura, Noboru; Ishigaki, Katsu; Ito, Masahiro; Prouglo, Yuri; Yamashita, Shunichi; Sekine, Ichiro

    2003-06-01

    The Semipalatinsk nuclear test site (SNTS), the Republic of Kazakhstan, has been contaminated by radioactive fallout. The alteration of oncogenic molecules in thyroid cancer around the SNTS was considered worthy of analysis because it presented the potential to elucidate the relationship between radiation exposure and thyroid cancer. This study aimed to analyze both beta-catenin and cyclin D1 expressions in thyroid carcinomas around the SNTS. We examined nine cases of chronic thyroiditis, eight cases of follicular adenomas, and 23 cases of papillary carcinomas. Immunohistochemically, all carcinomas displayed a strong cytosolic beta-catenin expression, while both chronic thyroiditis and follicular adenomas showed a significantly lower cytoplasmic beta-catenin (22.2% and 37.5%, respectively). No cyclin D1 immunoreactivity was evident in chronic thyroiditis. In contrast, 62.5% of follicular adenomas and 87.0% of papillary carcinoma showed cyclin D1 overexpression. Additionally, a strong correlation between cytoplasmic beta-catenin and cyclin D1 expression was suggested in thyroid tumors. This study revealed a higher prevalence of both aberrant beta-catenin expression and cyclin D1 overexpression in papillary thyroid cancers around the SNTS than sporadic cases. The analysis of the alteration of the Wnt signaling-related molecules in thyroid cancer around the SNTS may be important to gain an insight into radiation-induced thyroid tumorigenesis.

  18. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  19. Analysis of p53- immunoreactivity in astrocytic brain tumors

    Directory of Open Access Journals (Sweden)

    Shinkarenko T.V.

    2016-12-01

    Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

  20. Overexpression of cyclin D1 correlates with recurrence in a group of forty-seven operable squamous cell carcinomas of the head and neck

    NARCIS (Netherlands)

    Michalides, R.; van Veelen, N.; Hart, A.; Loftus, B.; Wientjens, E.; Balm, A.

    1995-01-01

    We evaluated the prognostic significance of overexpression of cyclin D1 in 47 patients with surgically resected squamous cell carcinomas of the head and neck. Overexpression of cyclin D1 was detected immunohistochemically using an affinity-purified polyclonal antibody directed against the

  1. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  2. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

    2011-01-01

    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  3. FGFR3 and P53 characterize alternative genetic pathways in the pathogenesis of urothelial cell carcinoma

    NARCIS (Netherlands)

    B.W. van Rhijn (Bas); Th.H. van der Kwast (Theo); A.N. Vis (André); W.J. Kirkels (Wim); E.R. Boeve; A.C. Jobsis; E.C. Zwarthoff (Ellen)

    2004-01-01

    textabstractFibroblast growth factor receptor 3 (FGFR3) and P53 mutations are frequently observed in bladder cancer. We here describe the distribution of FGFR3 mutations and P53 overexpression in 260 primary urothelial cell carcinomas. FGFR3 mutations were observed in 59% and P53

  4. Induced overexpression of protein kinase D1 stimulates mitogenic signaling in human pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Kisfalvi, Krisztina; Hurd, Cliff; Guha, Sushovan; Rozengurt, Enrique

    2010-05-01

    Neurotensin (NT) stimulates protein kinase D1 (PKD1), extracellular signal regulated kinase (ERK), c-Jun N-terminal Kinase (JNK), and DNA synthesis in the human pancreatic adenocarcinoma cell line PANC-1. To determine the effect of PKD1 overexpression on these biological responses, we generated inducible stable PANC-1 clones that express wild-type (WT) or kinase-dead (K618N) forms of PKD1 in response to the ecdysone analog ponasterone-A (PonA). NT potently stimulated c-Jun Ser(63) phosphorylation in both wild type and clonal derivatives of PANC-1 cells. PonA-induced expression of WT, but not K618N PKD1, rapidly blocked NT-mediated c-Jun Ser(63) phosphorylation either at the level of or upstream of MKK4, a dual-specificity kinase that leads to JNK activation. This is the first demonstration that PKD1 suppresses NT-induced JNK/cJun activation in PANC-1 cells. In contrast, PKD1 overexpression markedly increased the duration of NT-induced ERK activation in these cells. The reciprocal influence of PKD1 signaling on pro-mitogenicERK and pro-apopotic JNK/c-Jun pathways prompted us to examine whether PKD1 overexpression promotes DNA synthesis and proliferation of PANC-1 cells. Our results show that PKD1 overexpression increased DNA synthesis and cell numbers of PANC-1 cells cultured in regular dishes or in polyhydroxyethylmethacrylate [Poly-(HEMA)]-coated dishes to eliminate cell adhesion (anchorage-independent growth). Furthermore, PKD1 overexpression markedly enhanced DNA synthesis induced by NT (1-10 nM). These results indicate that PKD1 mediates mitogenic signaling in PANC-1 and suggests that this enzyme could be a novel target for the development of therapeutic drugs that restrict the proliferation of these cells.

  5. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  6. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  7. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  8. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  9. A Unique Mdm2-Binding Mode of the 3-Pyrrolin-2-one- and 2-Furanone-Based Antagonists of the p53-Mdm2 Interaction

    NARCIS (Netherlands)

    Surmiak, Ewa; Twarda-Clapa, Aleksandra; Zak, Krzysztof M.; Musielak, Bogdan; Tomala, Marcin D.; Kubica, Katarzyna; Grudnik, Przemyslaw; Madej, Mariusz; Jablonski, Mateusz; Potempa, Jan; Kalinowska-Tluscik, Justyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.

    2016-01-01

    The p53 pathway is inactivated in almost all types of cancer by mutations in the p53 encoding gene or overexpression of the p53 negative regulators, Mdm2 and/or Mdmx. Restoration of the p53 function by inhibition of the p53-Mdm2/Mdmx interaction opens up a prospect for a nongenotoxic anticancer

  10. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  11. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du

    2010-12-01

    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  12. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  13. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  14. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  15. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  16. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  17. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

    1993-01-01

    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  18. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

    1993-01-01

    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  19. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  20. Associations between Polycyclic Aromatic Hydrocarbon-Related Exposures and p53 Mutations in Breast Tumors

    Czech Academy of Sciences Publication Activity Database

    Mordukhovich, I.; Rössner ml., Pavel; Terry, M. B.; Santella, R.; Zhang, Y.J.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Garbowski, G.; Agrawal, M.; Gaudet, M. M.; Steck, S. E.; Sagiv, S. K.; Eng, S. M.; Teitelbaum, S. L.; Neugut, A. I.; Conway-Dorsey, K.; Gammon, M. D.

    2010-01-01

    Roč. 118, č. 4 (2010), s. 511-518 ISSN 0091-6765 Institutional research plan: CEZ:AV0Z50390512 Keywords : breast cancer * p53 mutation * p53 overexpression Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 6.087, year: 2010

  1. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  2. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

    1993-01-01

    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  3. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

    2002-01-01

    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  4. P53 Gene Mutagenesis in Breast Cancer

    National Research Council Canada - National Science Library

    Sommer, Steve S

    2005-01-01

    .... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

  5. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  6. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  8. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.

    2011-01-01

    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  9. Rsf-1 is overexpressed in non-small cell lung cancers and regulates cyclinD1 expression and ERK activity

    International Nuclear Information System (INIS)

    Li, Qingchang; Dong, Qianze; Wang, Enhua

    2012-01-01

    Highlights: ► Rsf-1 expression is elevated in non-small cell lung cancers. ► Rsf-1 depletion inhibits proliferation and increased apoptosis in lung cancer cells. ► Rsf-1 depletion decreases the level of cyclinD1 and phosphor-ERK expression. -- Abstract: Rsf-1 (HBXAP) was recently reported to be overexpressed in various cancers and associated with the malignant behavior of cancer cells. However, the expression of Rsf-1 in primary lung cancer and its biological roles in non-small cell lung cancer (NSCLC) have not been reported. The molecular mechanism of Rsf-1 in cancer aggressiveness remains ambiguous. In the present study, we analyzed the expression pattern of Rsf-1 in NSCLC tissues and found that Rsf-1 was overexpressed at both the mRNA and protein levels. There was a significant association between Rsf-1 overexpression and TNM stage (p = 0.0220) and poor differentiation (p = 0.0013). Furthermore, knockdown of Rsf-1 expression in H1299 and H460 cells with high endogenous Rsf-1 expression resulted in a decrease of colony formation ability and inhibition of cell cycle progression. Rsf-1 knockdown also induced apoptosis in these cell lines. Further analysis showed that Rsf-1 knockdown decreased cyclin D1 expression and phospho-ERK levels. In conclusion, Rsf-1 is overexpressed in NSCLC and contributes to malignant cell growth by cyclin D1 and ERK modulation, which makes Rsf-1 a candidate therapeutic target in lung cancer.

  10. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  11. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  12. Mutant, wild type, or overall p53 expression: freedom from clinical progression in tumours of astrocytic lineage.

    Science.gov (United States)

    Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M

    2004-11-01

    Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.

  13. Regulation of Metabolic Activity by p53

    Directory of Open Access Journals (Sweden)

    Jessica Flöter

    2017-05-01

    Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

  14. E2F-1-Induced p53-independent apoptosis in transgenic mice

    DEFF Research Database (Denmark)

    Holmberg, Christian Henrik; Helin, K.; Sehested, M.

    1998-01-01

    The E2F transcription factors are key targets for the retinoblastoma protein, pRB. By inactivation of E2Fs, pRB prevents progression to the S phase. To test proliferative functions of E2F, we generated transgenic mice expressing human E2F-1 and/or human DP-1. When the hydroxymethyl glutaryl...... involving increased apoptosis in the germinal epithelium. This effect was potentiated by simultaneous overexpression of DP-1. Testicular atrophy as a result of overexpression of E2F-1 and DP-1 is independent of functional p53, since p53-nullizygous transgenic mice overexpressing E2F-1 and DP-1 also suffered...

  15. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  16. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    Science.gov (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  17. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  18. p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.

    Directory of Open Access Journals (Sweden)

    Feng Yu

    Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.

  19. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  20. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    Science.gov (United States)

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

    International Nuclear Information System (INIS)

    Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

    2007-01-01

    We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

  2. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  3. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  4. Cytotoxic T-lymphocyte clones, established by stimulation with the HLA-A2 binding p5365-73 wild type peptide loaded on dendritic cells In vitro, specifically recognize and lyse HLA-A2 tumour cells overexpressing the p53 protein

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Petersen, T R; Kirkin, A F

    2000-01-01

    of recognizing p53 derived wild type (self) peptides. Furthermore, the capacity of R9V specific T cell clones to exert HLA restricted cytotoxicity, argues that the R9V peptide is naturally presented on certain cancer cells. This supports the view that p53 derived wild type peptides might serve as candidate......Mutations in the tumour suppressor gene p53 are among the most frequent genetic alterations in human malignancies, often associated with an accumulation of the p53 protein in the cytoplasm. We have generated a number of cytotoxic T lymphocyte (CTL) clones that specifically recognize the HLA-A*0201...

  5. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  6. Negative effect of cyclin D1 overexpression on recurrence-free survival in stage II-IIIA lung adenocarcinoma and its expression modulation by vorinostat in vitro.

    Science.gov (United States)

    Lee, Eunju; Jin, DongHao; Lee, Bo Bin; Kim, Yujin; Han, Joungho; Shim, Young Mog; Kim, Duk-Hwan

    2015-12-17

    This study was aimed at identifying prognostic biomarkers for stage II-IIIA non-small cell lung cancer (NSCLC) according to histology and at investigating the effect of vorinostat on the expression of these biomarkers. Expression levels of cyclin D1, cyclin A2, cyclin E, and p16 proteins that are involved in the G1-to-S phase progression of cell cycle were analyzed using immunohistochemistry in formalin-fixed paraffin-embedded tissues from 372 samples of stage II-IIIA NSCLC. The effect of vorinostat on the expression of these proteins, impacts on cell cycle, and histone modification was explored in lung cancer cells. Abnormal expression of cyclin A2, cyclin D1, cyclin E, and p16 was found in 66, 47, 34, and 51 % of 372 cases, respectively. Amongst the four proteins, only cyclin D1 overexpression was significantly associated with poor recurrence-free survival (adjusted hazard ratio = 1.87; 95 % confidence interval = 1.12 - 2.69, P = 0.02) in adenocarcinoma but not in squamous cell carcinoma (P = 0.44). Vorinostat inhibited cell cycle progression to the S-phase and induced down-regulation of cyclin D1 in vitro. The down-regulation of cyclin D1 by vorinostat was comparable to a siRNA-mediated knockdown of cyclin D1 in A549 cells, but vorinostat in the presence of benzo[a]pyrene showed a differential effect in different lung cancer cell lines. Cyclin D1 down-regulation by vorinostat was associated with the accumulation of dimethyl-H3K9 at the promoter of the gene. The present study suggests that cyclin D1 may be an independent prognostic factor for recurrence-free survival in stage II-IIIA adenocarcinoma of lung and its expression may be modulated by vorinostat.

  7. Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage

    Directory of Open Access Journals (Sweden)

    Marie-Jo Halaby

    2015-01-01

    Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.

  8. p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.

    Science.gov (United States)

    Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R

    1999-05-01

    The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.

  9. Amplification and protein overexpression of cyclin D1: Predictor of occult nodal metastasis in early oral cancer.

    Science.gov (United States)

    Noorlag, Rob; Boeve, Koos; Witjes, Max J H; Koole, Ronald; Peeters, Ton L M; Schuuring, Ed; Willems, Stefan M; van Es, Robert J J

    2017-02-01

    Accurate nodal staging is pivotal for treatment planning in early (stage I-II) oral cancer. Unfortunately, current imaging modalities lack sensitivity to detect occult nodal metastases. Chromosomal region 11q13, including genes CCND1, Fas-associated death domain (FADD), and CTTN, is often amplified in oral cancer with nodal metastases. However, evidence in predicting occult nodal metastases is limited. In 158 patients with early tongue and floor of mouth (FOM) squamous cell carcinomas, both CCND1 amplification and cyclin D1, FADD, and cortactin protein expression were correlated with occult nodal metastases. CCND1 amplification and cyclin D1 expression correlated with occult nodal metastases. Cyclin D1 expression was validated in an independent multicenter cohort, confirming the correlation with occult nodal metastases in early FOM cancers. Cyclin D1 is a predictive biomarker for occult nodal metastases in early FOM cancers. Prospective research on biopsy material should confirm these results before implementing its use in routine clinical practice. © 2016 Wiley Periodicals, Inc. Head Neck 39: 326-333, 2017. © 2016 Wiley Periodicals, Inc.

  10. Survivin inhibits anti-growth effect of p53 activated by aurora B

    International Nuclear Information System (INIS)

    Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee

    2005-01-01

    Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53

  11. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  12. FATS is a transcriptional target of p53 and associated with antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhang Xifeng

    2010-09-01

    Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.

  13. Mutant p53 interactions with supercoiled DNA

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil

    2007-01-01

    Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics

  14. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  15. Imidacloprid is degraded by CYP353D1v2, a cytochrome P450 overexpressed in a resistant strain of Laodelphax striatellus.

    Science.gov (United States)

    Elzaki, Mohammed Esmail Abdalla; Miah, Mohammad Asaduzzaman; Wu, Min; Zhang, Haomiao; Pu, Jian; Jiang, Ling; Han, Zhaojun

    2017-07-01

    Cytochrome P450s are associated with the metabolising of a wide range of compounds, including insecticides. CYP353D1v2 has been found to be overexpressed in an imidacloprid-resistant strain of Laodelphax striatellus. Thus, this study was conducted to express CYP353D1v2 in Sf9 cells as a recombinant protein, to assess its ability to metabolise imidacloprid. Western blot and carbon monoxide difference spectrum analysis indicated that the intact CYP353D1v2 protein had been successfully expressed in Sf9 insect cells. Catalytic activity tests with four traditional P450-activity-probing substrates found that the expressed CYP353D1v2 preferentially metabolised p-nitroanisole, ethoxycoumarin and ethoxyresorufin with specific activities of 32.70, 0.317 and 1.22 pmol min -1 pmol -1 protein respectively, but no activity to luciferin-H EGE. The enzyme activity for degrading imidacloprid was tested by measuring substrate depletion and formation of the metabolite. Kinetic parameters for imidacloprid were K m 5.99 ± 0.95 µm and k cat 0.03 ± 0.0004 min -1 . The chromatogram analysis showed clearly the NADPH-dependent depletion of imidacloprid and the formation of an unknown metabolite. The UPLC-MS mass spectrum demonstrated that the metabolite was an oxidative product of imidacloprid, 5-hydroxy-imidacloprid. These results suggest that CYP353D1v2 in L. striatellus is capable of degrading imidacloprid, and that enzyme activity can be evaluated well only by some traditional probing substrates. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.

    Science.gov (United States)

    Gong, Yi; Ju, Chenyu; Zhang, Xiaobo

    2015-10-01

    The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function

    Directory of Open Access Journals (Sweden)

    Jianzhong Chen

    2012-08-01

    Full Text Available As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level.

  18. ARF and ATM/ATR cooperate in p53-mediated apoptosis upon oncogenic stress

    International Nuclear Information System (INIS)

    Pauklin, Siim; Kristjuhan, Arnold; Maimets, Toivo; Jaks, Viljar

    2005-01-01

    Induction of apoptosis is pivotal for eliminating cells with damaged DNA or deregulated proliferation. We show that tumor suppressor ARF and ATM/ATR kinase pathways cooperate in the induction of apoptosis in response to elevated expression of c-myc, β-catenin or human papilloma virus E7 oncogenes. Overexpression of oncogenes leads to the formation of phosphorylated H2AX foci, induction of Rad51 protein levels and ATM/ATR-dependent phosphorylation of p53. Inhibition of ATM/ATR kinases abolishes both induction of Rad51 and phosphorylation of p53, and remarkably reduces the level of apoptosis induced by co-expression of oncogenes and ARF. However, the induction of apoptosis is downregulated in p53-/- cells and does not depend on activities of ATM/ATR kinases, indicating that efficient induction of apoptosis by oncogene activation depends on coordinated action of ARF and ATM/ATR pathways in the regulation of p53

  19. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  20. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  1. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  2. Expression of p53, Bcl-2, VEGF, Ki67 and PCNA and prognostic significance in hepatocellular carcinoma.

    Science.gov (United States)

    Stroescu, Cezar; Dragnea, Adrian; Ivanov, Bogdan; Pechianu, Catalin; Herlea, Vlad; Sgarbura, Olivia; Popescu, Andra; Popescu, Irinel

    2008-12-01

    Hepatocellular carcinoma is one of the most common malignant tumors that carry a poor prognosis. To improve the long-term outlook for HCC, an accurate prognosis is important. To study the immunohistochemical expressions of p53, Ki67, Bcl-2, VEGF and PCNA and their potential role as prognostic factors in patients with radical resection of hepatocellular carcinoma. Forty-seven formalin-fixed paraffin-embedded tumor samples from patients with HCC receiving liver resection were investigated immunohistochemically for the expression of cellular proliferation markers PCNA, Ki67, p53, Bcl-2 and VEGF and their correlation with tumor characteristics and survival time after resection. p53 was expressed in a higher percentage (85.7 vs. 42.1%) in undifferentiated histological tumor grades (Edmondson Steiner G3/G4 vs. G1/G2). Patients with p53 accumulating tumors showed a worse survival than patients with p53 non-accumulating tumors (median 9.5 vs. 16.5 months). Over-expression of VEGF was found in 38.3% of all HCCs. VEGF expression was significantly correlated with p53 expression and recurrence rates. The results showed that the labeling index of PCNA and expression of p53 are correlated. The high labeling index of PCNA or over-expression of p53 resulted in high risk of tumor recurrence, more aggressive growth and poor survival. High labeling index of PCNA, p53 nuclear accumulation and VEGF high expression are associated with poor survival in patients with HCC.

  3. Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

    Directory of Open Access Journals (Sweden)

    Carlos Farkas

    Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

  4. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    Science.gov (United States)

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  5. Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

    International Nuclear Information System (INIS)

    Deocaris, Custer C.

    2004-01-01

    Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

  6. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522 (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  7. The p53 inhibitor, pifithrin-α, suppresses self-renewal of embryonic stem cells

    International Nuclear Information System (INIS)

    Abdelalim, Essam Mohamed; Tooyama, Ikuo

    2012-01-01

    Highlights: ► We determine the role of p53 in ES cells under unstressful conditions. ► PFT-α suppresses ES cell proliferation. ► PFT-α induces ES cell cycle arrest. ► PFT-α downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-α, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-α resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-α caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  8. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.

    1985-01-01

    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  9. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  10. A novel radiation-induced p53 mutation is not implicated in radiation resistance via a dominant-negative effect.

    Directory of Open Access Journals (Sweden)

    Yunguang Sun

    Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.

  11. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  12. p53 specific (auto)immunity in mice

    NARCIS (Netherlands)

    Lauwen, Marjolein Monique

    2008-01-01

    Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

  13. Restriction of human herpesvirus 6B replication by p53

    DEFF Research Database (Denmark)

    Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina

    2008-01-01

    Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

  14. Mutual interactions between P53 and growth factors in cancer

    NARCIS (Netherlands)

    Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

    1998-01-01

    The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

  15. A Dual Role of P53 in Regulating Colistin-Induced Autophagy in PC-12 Cells

    Directory of Open Access Journals (Sweden)

    Ziyin Lu

    2017-10-01

    Full Text Available This study aimed to investigate the mechanism of p53 in regulating colistin-induced autophagy in PC-12 cells. Importantly, cells were treated with 125 μg/ml colistin for 12 and 24 h after transfection with p53 siRNA or recombinant plasmid. The hallmarks of autophagy and apoptosis were examined by real-time PCR and western blot, fluorescence/immunofluorescence microscopy, and electron microscopy. The results showed that silencing of p53 leads to down-regulation of Atg5 and beclin1 for 12 h while up-regulation at 24 h and up-regulation of p62 noted. The ratio of LC3-II/I and autophagic vacuoles were significantly increased at 24 h, but autophagy flux was blocked. The cleavage of caspase3 and PARP (poly ADP-ribose polymerase were enhanced, while PC-12-sip53 cells exposed to 3-MA showed down-regulation of apoptosis. By contrast, the expression of autophagy-related genes and protein reduced in p53 overexpressing cells following a time dependent manner. Meanwhile, there was an increase in the expression of activated caspase3 and PARP, condensed and fragmented nuclei were evident. Conclusively, the data supported that silencing of p53 promotes impaired autophagy, which acts as a pro-apoptotic induction factor in PC-12 cells treated with colistin for 24 h, and overexpression of p53 inhibits autophagy and accelerates apoptosis. Hence, it has been suggested that p53 could not act as a neuro-protective target in colistin-induced neurotoxicity.

  16. The prognostic significance of accumulation of p53 protein in stage III non-small cell lung cancer treated by radiotherapy

    International Nuclear Information System (INIS)

    Langendijk, J.A.; Thunnissen, F.B.J.M.; Lamers, R.J.S.; Jong, J.M.A. de; Velde, G.P.M. ten; Wouters, E.F.M.

    1995-01-01

    In the present study the prognostic significance of accumulation of nuclear p53 protein on survival and freedom from local progression was investigated. Formalin-fixed, paraffin-embedded sections obtained by bronchoscopy or mediastinoscopy were used to examine the expression of nuclear p53 protein using immunohistochemistry. In 37 cases (57%), overexpression of the p53 protein was detected. No relation was found between p53 expression and other pretreatment variables. Response to radiotherapy was found in 11 p53-negative cases (65%) versus 10 p53-positive cases (42%). Freedom from local progression was significantly better in the p53-negative cases as compared with the p53-positive cases. The p53-negative cases who responded to radiotherapy showed an excellent freedom from local progression rate after 2 years of 100%, whereas all p53-positive cases without response to radiotherapy showed local progression within 24 months. Overall survival between p53-negative and -positive cases did not differ, however the disease-specific survival was found to be worse in the p53-positive cases as compared to the negative cases (median survival 8.4 vs. 14.4 months (P < 0.05)). No correlation was found between p53 expression and the frequency of distant metastases. In conclusion, the results of this study suggest that p53 protein expression may be of prognostic value on freedom from local progression in non-small cell lung carcinoma

  17. Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA

    DEFF Research Database (Denmark)

    Glahder, Jacob-Andreas Harald; Norrild, Bodil

    2011-01-01

    Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...

  18. Cyclophilin B induces chemoresistance by degrading wild type p53 via interaction with MDM2 in colorectal cancer.

    Science.gov (United States)

    Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo

    2018-06-06

    Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  19. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

  20. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  1. The expression of p53 protein in patients with multiple myeloma

    Directory of Open Access Journals (Sweden)

    Marković Olivera

    2007-01-01

    Full Text Available Introduction: Although mutations of p53 are one of the most often acquired genetic changes in malignant tumors, these mutations are rare events in patients with newly diagnosed multiple myeloma (MM. Moreover, there are a few literature data about clinical significance of p53 overexpression in multiple myeloma. Objective The aim of our study was to evaluate the clinical significance of p53 immunoexpression in multiple myeloma. Method A total of 58 patients with newly diagnosed MM (26 females and 32 males, mean age 62 years were enrolled in the study. The diagnosis of MM was made according to criteria of Chronic Leukemia-Myeloma Task Force. Clinical staging was done according to Durie and Salmon classification (4 patients had disease stage I, 15 patients stage II and 39 patients stage III. The histological grade and histological stage were determined according to predominant plasma cell morphology and volume of myeloma infiltration, respectively. Standard immunohistochemical analysis with p53 antibody in B5-fixed and paraffin- embedded bone marrow specimens was used to evaluate the expression of p53 in myeloma cells. The specimens were considered positive when ≥5% of plasma cells exhibited clear nuclear positivity. Results Out of 58 patients, p53 expression was detected in 9 (15.52%. No significant correlation was found between p53 expression and clinical stage (I+II vs. III, Я2-microglobulin level (≤6 mg/L vs. >6mg/L, histological grade (I vs. II+III, histological stage (<20% vs. 21-50% vs. >50% and the extent of osteolytic lesions (≤3 vs. >3 lesions. Median survival of patients with p53 immunoreactivity in =>5% of plasma cells was 10 months, whilst median survival of patients with p53 immunoreactivity in <5% of plasma cells was 36 months. However, such difference was not significant (p=0.2. Conclusion The frequency of p53 immunoexpression in our group of newly diagnosed MM was relatively low. Although p53 immunoexpression was not

  2. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  3. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  4. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  5. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  6. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. P53-miR-191-SOX4 regulatory loop affects apoptosis in breast cancer.

    Science.gov (United States)

    Sharma, Shivani; Nagpal, Neha; Ghosh, Prahlad C; Kulshreshtha, Ritu

    2017-08-01

    miRNAs have emerged as key participants of p53 signaling pathways because they regulate or are regulated by p53. Here, we provide the first study demonstrating direct regulation of an oncogenic miRNA, miR-191-5p, by p53 and existence of a regulatory feedback loop. Using a combination of qRT-PCR, promoter-luciferase, and chromatin-immunoprecipitation assays, we show that p53 brings about down-regulation of miR-191-5p in breast cancer. miR-191-5p overexpression brought about inhibition of apoptosis in breast cancer cell lines (MCF7 and ZR-75) as demonstrated by reduction in annexin-V stained cells and caspase 3/7 activity, whereas miR-191-5p down-regulation showed the opposite. We further unveiled that SOX4 was a direct target of miR-191-5p. SOX4 overexpression was shown to increase p53 protein levels in MCF7 cells. miR-191-5p overexpression brought about down-regulation of SOX4 and thus p53 levels, suggesting the existence of a regulatory feedback loop. Breast cancer treatment by doxorubicin, an anti-cancer drug, involves induction of apoptosis by p53; we thus wanted to check whether miR-191-5p affects doxorubicin sensitivity. Interestingly, Anti-miR-191 treatment significantly decreased the IC50 of the doxorubicin drug and thus sensitized breast cancer cells to doxorubicin treatment by promoting apoptosis. Overall, this work highlights the importance of the p53-miR-191- SOX4 axis in the regulation of apoptosis and drug resistance in breast cancer and offers a preclinical proof-of-concept for use of an Anti-miR-191 and doxorubicin combination as a rational approach to pursue for better breast cancer treatment. © 2017 Sharma et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    International Nuclear Information System (INIS)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee

    2011-01-01

    Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.

  9. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  10. A negative regulation loop of long noncoding RNA HOTAIR and p53 in non-small-cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zhai N

    2016-09-01

    Full Text Available Nailiang Zhai,1 Yongfu Xia,1 Rui Yin,2 Jinping Liu,3 Fuquan Gao1 1Department of Respiratory Medicine, Affiliated Hospital of Binzhou Medical University, 2Department of Respiratory Medicine, People’s Hospital of Binzhou City, 3Department of Pharmacology, Binzhou Medical University, Binzhou, Shandong, People’s Republic of China Abstract: Non-small-cell lung cancer (NSCLC is one of the leading causes of cancer-related death worldwide, and the 5-year survival rate is still low despite advances in diagnosis and therapeutics. A long noncoding RNA (lncRNA HOX antisense intergenic RNA (HOTAIR has been revealed to play important roles in NSCLC carcinogenesis but the detailed mechanisms are still unclear. In the current study, we aimed to investigate the regulation between the lncRNA HOTAIR and p53 in the NSCLC patient samples and cell lines. Our results showed that HOTAIR expression was significantly higher in the cancer tissues than that in the adjacent normal tissue, and was negatively correlated with p53 functionality rather than expression. When p53 was overexpressed in A549 cells, the lncRNA HOTAIR expression was downregulated, and the cell proliferation rate and cell invasion capacity decreased as a consequence. We identified two binding sites of p53 on the promoter region of HOTAIR, where the p53 protein would bind to and suppress the HOTAIR mRNA transcription. Inversely, overexpression of lncRNA HOTAIR inhibited the expression of p53 in A549 cells. Mechanistic studies revealed that HOTAIR modified the promoter of p53 and enhanced histone H3 lysine 27 trimethylation (H3K27me3. These studies identified a specific negative regulation loop of lncRNA HOTAIR and p53 in NSCLC cells, which revealed a new understanding of tumorigenesis in p53 dysfunction NSCLC cells. Keywords: NSCLC, LncRNA HOTAIR, p53, negative loop

  11. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    Science.gov (United States)

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  12. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Family matters: sibling rivalry and bonding between p53 and p63 in cancer.

    Science.gov (United States)

    Romano, Rose-Anne; Sinha, Satrajit

    2014-04-01

    The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  15. Targeting p53 by small molecules in hematological malignancies

    OpenAIRE

    Saha, Manujendra N; Qiu, Lugui; Chang, Hong

    2013-01-01

    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...

  16. The nucleolus directly regulates p53 export and degradation.

    Science.gov (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  17. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  18. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

    International Nuclear Information System (INIS)

    Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi

    2006-01-01

    PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK

  19. Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Zhihong; Zhang, Yuxia [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States); Wang, Li, E-mail: l.wang@hsc.utah.edu [Departments of Medicine and Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT 84132 (United States)

    2012-01-13

    Highlights: Black-Right-Pointing-Pointer Mdm2 enhances HNF4{alpha} activation of the ApoCIII promoter via interaction with HNF4{alpha}. Black-Right-Pointing-Pointer p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. Black-Right-Pointing-Pointer Mdm2 alters the enrichment of HNF4{alpha}, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4{alpha}. A direct association of Mdm2 protein with the HNF4{alpha} protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4{alpha} activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4{alpha} to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

  20. Mdm2 is a novel activator of ApoCIII promoter which is antagonized by p53 and SHP inhibition

    International Nuclear Information System (INIS)

    Yang, Zhihong; Zhang, Yuxia; Wang, Li

    2012-01-01

    Highlights: ► Mdm2 enhances HNF4α activation of the ApoCIII promoter via interaction with HNF4α. ► p53 antagonizes the effect of Mdm2 activation of the ApoCIII promoter. ► SHP strengthens p53 inhibition but abolishes Mdm2 activation of the ApoCIII promoter. ► Mdm2 alters the enrichment of HNF4α, p53 and SHP to the ApoCIII promoter. -- Abstract: We examined the effect of Mdm2 on regulation of the ApoCIII promoter and its cross-talk with p53 and nuclear receptor SHP. Overexpression of Mdm2 markedly enhanced ApoCIII promoter activity by HNF4α. A direct association of Mdm2 protein with the HNF4α protein was observed by co-immunoprecipitation. Ectopic expression of p53 decreased HNF4α activation of the ApoCIII promoter and antagonized the effect of Mdm2. Co-expression of SHP further strengthened p53 inhibition and abolished Mdm2 activation of the ApoCIII promoter. Mdm2 inhibited p53-mediated enrichment of HNF4α to the ApoCIII promoter while simultaneously reducing p53 binding and increasing recruitment of SHP to the ApoCIII promoter. The results from this study implicate a potentially important function of Mdm2 in regulation of lipoprotein metabolism.

  1. Frequent alteration of MDM2 and p53 in the molecular progression of recurring non-Hodgkin's lymphoma

    DEFF Research Database (Denmark)

    Møller, Michael Boe; Nielsen, O; Pedersen, Niels Tinggaard

    2002-01-01

    -Hodgkin's lymphoma. METHODS AND RESULTS: We have analysed sequential biopsies from 42 non-Hodgkin's lymphoma patients immunohistochemically for p53 alterations (based on p53 and p21Waf1 expression), as well as for expression of MDM2, p27Kip1 and cyclin D3. Relapse of follicle centre lymphoma was associated with p53...... alterations as 5/6 (83%) follicle centre lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. Of these cases, three showed transformation to diffuse large B-cell lymphoma. p53 alteration was also associated with relapse of de novo diffuse large B-cell lymphoma and T-cell non......-Hodgkin's lymphoma, as 2/5 (40%) diffuse large B-cell lymphomas and 3/9 (33%) T-cell non-Hodgkin's lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. No indolent non-Hodgkin's lymphoma case showed MDM2 over-expression at diagnosis, whereas 4/5 (80%) transformed diffuse large B-cell lymphomas...

  2. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  3. Narrowband image and the p53 protein immunoexpression in patients with ulcerative colitis and dysplasia

    International Nuclear Information System (INIS)

    Chao González, Lissette

    2012-01-01

    Patients with pancolitis and long-standing ulcerative colitis are at increased risk of developing colorectal cancer, so it is advisable to colonoscopic surveillance. The objective of this study was to identify the endoscopic visualization system of imaging with narrowband and overexpression of the p53 protein as procedures useful for the research of Dysplasia in patients with ulcerative colitis and pancolitis, of eight or more years of evolution. A prospective, descriptive study was performed on 50 patients. The Fisher exact probability test was used for the statistical study and of square Chi, with a level of significance α = 0.05. Shown with narrow-band image increases the likelihood of finding suggestive areas of Dysplasia, reduces the amount of biopsy and gets a higher proportion of diagnoses of Dysplasia in fewer samples (70.4%). The overexpression of the p53 protein was associated with the presence of dysplasia (80.0%) p < 0.001 and is immunoexpress in samples with a high degree of severity of dysplasia and the low grade. Concluded that imaging with narrowband system and overexpression of the p53 protein are procedures useful for the research of Dysplasia in these patients. (author)

  4. P53 autoantibodies in 1006 patients followed up for breast cancer

    International Nuclear Information System (INIS)

    Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A

    2000-01-01

    to p53 would reflect tumour behaviour. However, we found that the presence or absence of p53 autoantibodies was not predictive of presence or absence of recurrent disease. There was an equivalent incidence of active disease at the time of sampling in both the autoantibody-negative and autoantibody-positive groups, these being 25.2 and 28.7%, respectively. Thus, humoral immune activity against p53 appeared to be relatively restricted to a subgroup of patients in whom, once an autoantibody response had been generated, antibody was likely to persist regardless of tumour behaviour. Conversely, where no detectable p53 autoantibody was present at the time of primary diagnosis, these patients remained similarly negative for antibody, irrespective of subsequent disease activity (Table 3). In contrast to shed markers that correlate with tumour mass, such as CA15.3 for cancer of the breast, any tumour-related immune response will be subject to complex regulation. Autoantibody responses to p53 will require appropriate primary immunization; initial low-dose antigen exposure may induce immune tolerance and lack of response. Higher antigen doses may activate either antibody-mediated immunity, or cellular immunity. In breast cancer patients, our results suggest that, once an active humoral response against p53 is established, then this remains active. This persistent humoral reaction may be driven by persistent antigenic stimulation by p53 protein derived from overexpression of p53 at distant metastatic sites; alternatively, irradiated normal tissue may be a source of continued antigenic stimulation, because a long-term side effect of radiation therapy is an increased expression of p53 in normal breast tissue that persists for several years [12]. Since the great majority of our total patient cohort had received radiotherapy, humoral immunity to p53 associated with primary disease might persist, even in those patients who enter remission, due to tumour-independent antigenic

  5. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  6. Exploring a minimal two-component p53 model

    International Nuclear Information System (INIS)

    Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

    2010-01-01

    The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

  7. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  8. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  9. Chronology of p53 protein accumulation in gastric carcinogenesis

    NARCIS (Netherlands)

    Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1995-01-01

    p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

  10. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  11. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  12. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  13. Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.

    Science.gov (United States)

    Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei

    2013-07-01

    Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  14. Fluoxetine protects against IL-1β-induced neuronal apoptosis via downregulation of p53.

    Science.gov (United States)

    Shan, Han; Bian, Yaqi; Shu, Zhaoma; Zhang, Linxia; Zhu, Jialei; Ding, Jianhua; Lu, Ming; Xiao, Ming; Hu, Gang

    2016-08-01

    Fluoxetine, a selective serotonin reuptake inhibitor, exerts neuroprotective effects in a variety of neurological diseases including stroke, but the underlying mechanism remains obscure. In the present study, we addressed the molecular events in fluoxetine against ischemia/reperfusion-induced acute neuronal injury and inflammation-induced neuronal apoptosis. We showed that treatment of fluoxetine (40 mg/kg, i.p.) with twice injections at 1 h and 12 h after transient middle cerebral artery occlusion (tMCAO) respectively alleviated neurological deficits and neuronal apoptosis in a mouse ischemic stroke model, accompanied by inhibiting interleukin-1β (IL-1β), Bax and p53 expression and upregulating anti-apoptotic protein Bcl-2 level. We next mimicked neuroinflammation in ischemic stroke with IL-1β in primary cultured cortical neurons and found that pretreatment with fluoxetine (1 μM) prevented IL-1β-induced neuronal apoptosis and upregulation of p53 expression. Furthermore, we demonstrated that p53 overexpression in N2a cell line abolished the anti-apoptotic effect of fluoxetine, indicating that p53 downregulation is required for the protective role of fluoxetine in IL-1β-induced neuronal apoptosis. Fluoxetine downregulating p53 expression could be mimicked by SB203580, a specific inhibitor of p38, but blocked by anisomycin, a p38 activator. Collectively, our findings have revealed that fluoxetine protects against IL-1β-induced neuronal apoptosis via p38-p53 dependent pathway, which give us an insight into the potential of fluoxetine in terms of opening up novel therapeutic avenues for neurological diseases including stroke. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  16. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-01-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  17. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  18. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  19. HEXIM1, a New Player in the p53 Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

    2013-07-04

    Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

  20. Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

    International Nuclear Information System (INIS)

    Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk; Yoo, Young A.

    2012-01-01

    p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)–Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh–Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3–p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expression of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2–p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.

  1. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  2. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  3. Robustness of the p53 network and biological hackers.

    Science.gov (United States)

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  4. Clinical significance of altered nm23-H1, EGFR, RB and p53 expression in bilharzial bladder cancer

    International Nuclear Information System (INIS)

    Khaled, Hussein M; Bahnassy, Abeer A; Raafat, Amira A; Zekri, Abdel-Rahman N; Madboul, Maha S; Mokhtar, Nadia M

    2009-01-01

    Clinical characterization of bladder carcinomas is still inadequate using the standard clinico-pathological prognostic markers. We assessed the correlation between nm23-H1, Rb, EGFR and p53 in relation to the clinical outcome of patients with muscle invasive bilharzial bladder cancer (MI-BBC). nm23-H1, Rb, EGFR and p53 expression was assessed in 59 MI-BBC patients using immunohistochemistry and reverse transcription (RT-PCR) and was correlated to the standard clinico-pathological prognostic factors, patient's outcome and the overall survival (OS) rate. Overexpression of EGFR and p53 proteins was detected in 66.1% and 35.6%; respectively. Loss of nm23-H1and Rb proteins was detected in 42.4% and 57.6%; respectively. Increased EGFR and loss of nm23-H1 RNA were detected in 61.5% and 36.5%; respectively. There was a statistically significant correlation between p53 and EGFR overexpression (p < 0.0001), nm23 loss (protein and RNA), lymph node status (p < 0.0001); between the incidence of local recurrence and EGFR RNA overexpression (p= 0.003) as well as between the incidence of metastasis and altered Rb expression (p = 0.026), p53 overexpression (p < 0.0001) and mutation (p = 0.04). Advanced disease stage correlated significantly with increased EGFR (protein and RNA) (p = 0.003 & 0.01), reduced nm23-H1 RNA (p = 0.02), altered Rb (p = 0.023), and p53 overexpression (p = 0.004). OS rates correlated significantly, in univariate analysis, with p53 overexpression (p = 0.011), increased EGFR (protein and RNA, p = 0.034&0.031), nm23-H1 RNA loss (p = 0.021) and aberrations of ≥ 2 genes. However, multivariate analysis showed that only high EGFR overexpression, metastatic recurrence, high tumor grade and the combination of ≥ 2 affected markers were independent prognostic factors. nm23-H1, EGFR and p53 could be used as prognostic biomarkers in MI-BBC patients. In addition to the standard pathological prognostic factors, a combination of these markers (≥ 2) has

  5. Apoptosis and cell proliferation in the development of gastric carcinomas: associations with c-myc and p53 protein expression.

    Science.gov (United States)

    Ishii, Hideaki H; Gobé, Glenda C; Pan, Wenshen; Yoneyama, Juichi; Ebihara, Yoshiro

    2002-09-01

    Patients with gastric carcinomas have a poor prognosis and low survival rates. The aim of the present paper was to characterize cellular and molecular properties to provide insight into aspects of tumor progression in early compared with advanced gastric cancers. One hundred and nine graded gastric carcinomas (early or advanced stage, undifferentiated or differentiated type) with paired non-cancer tissue were studied to define the correlation between apoptosis (morphology, terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labeling), cell proliferation (Ki-67 expression, morphology) and expression and localization of two proteins frequently having altered expression in cancers, namely p53 and c-myc. Overall, apoptosis was lower in early stage, differentiated and undifferentiated gastric carcinomas compared with advanced-stage cancers. Cell proliferation was comparatively high in all stages. There was a high level of p53 positivity in all stages. Only the early- and advanced-stage undifferentiated cancers that were p53 positive had a significantly higher level of apoptosis (P cancers that had either c-myc or p53-positivity. The results indicate that low apoptosis and high cell proliferation combine to drive gastric cancer development. The molecular controls for high cell proliferation of the early stage undifferentiated gastric cancers involve overexpression of both p53 and c-myc. Overexpression of p53 may also control cancer development in that its expression is associated with higher levels of apoptosis in early and late-stage undifferentiated, cancers. Copyright 2002 Blackwell Publishing Asia Pty Ltd

  6. Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.

    Directory of Open Access Journals (Sweden)

    Alejo Efeyan

    Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.

  7. Structural effects and competition mechanisms targeting the interactions between p53 and MDM2 for cancer therapy

    Science.gov (United States)

    Liu, Shu-Xia; Geng, Yi-Zhao; Yan, Shi-Wei

    2017-06-01

    Approximately half of all human cancers show normal TP53 gene expression but aberrant overexpression of MDM2 and/or MDMX. This fact suggests a promising cancer therapeutic strategy in targeting the interactions between p53 and MDM2/MDMX. To help realize the goal of developing effective inhibitors to disrupt the p53-MDM2/MDMX interaction, we systematically investigated the structural and interaction characteristics of p53 with inhibitors of its interactions with MDM2 and MDMX from an atomistic perspective using stochastic molecular dynamics simulations. We found that some specific α helices in the structures of MDM2 and MDMX play key roles in their binding to inhibitors, and that the hydrogen bond formed by the Trp23 residue of p53 with its counterpart in MDM2 or MDMX determines the dynamic competition processes of the disruption of the MDM2-p53 interaction and replacement of p53 from the MDM2-p53 complex in vivo. The results reported in this paper are expected to provide basic information for designing functional inhibitors and realizing new strategies of cancer gene therapy.

  8. Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation

    International Nuclear Information System (INIS)

    Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli

    2004-01-01

    Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)

  9. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  10. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

    2006-01-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  11. Role of P53 in Mammary Epithelial Cell Senescence

    National Research Council Canada - National Science Library

    Dimri, Goberdhan P

    2006-01-01

    .... We also chose several other targets of p53 that are induced by DNA damage. The RT PCR analysis aws carried out using mRNA prepared from young growing early passage and senescent late passage HMECs...

  12. Polymorphism at codon 36 of the p53 gene.

    Science.gov (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  13. Post-translational regulation enables robust p53 regulation.

    Science.gov (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-08-30

    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  14. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

    1993-01-01

    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  15. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  16. p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression

    International Nuclear Information System (INIS)

    Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo

    1997-01-01

    , but negative for p21 and Bax. They did not show significant differences between before and after irradiation. These three tumors often showed very weak staining for Bax, and it was much weaker than in the positive control slides. PCR-SSCP analysis showed a mutation in exon 7 of the p53 gene in the glioblastoma and the small cell lung cancer, but, no mutations were demonstrated in exons of the p53 gene in the ependymoblastoma. Conclusion: The radiation-induced apoptosis in the ependymoblastoma was highly correlated with p53 protein expression, but, the changes in Bcl-2 and Bax expression did not always correspond to the frequency of apoptosis. In the other two tumors, radiation induced apoptosis in only a few cells. These tumors showed overexpression of p53 and Bcl-2, and a mutation of p53 gene was also suggested by PCR-SSCP analysis

  17. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  18. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  19. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    Science.gov (United States)

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  20. ATM and p53 combined analysis predicts survival in glioblastoma multiforme patients: A clinicopathologic study.

    Science.gov (United States)

    Romano, Francesco Jacopo; Guadagno, Elia; Solari, Domenico; Borrelli, Giorgio; Pignatiello, Sara; Cappabianca, Paolo; Del Basso De Caro, Marialaura

    2018-06-01

    Glioblastoma is one of the most malignant cancers, with a distinguishing dismal prognosis: surgery followed by chemo- and radiotherapy represents the current standard of care, and chemo- and radioresistance underlie disease recurrence and short overall survival of patients suffering from this malignancy. ATM is a kinase activated by autophosphorylation upon DNA doublestrand breaks arising from errors during replication, byproducts of metabolism, chemotherapy or ionizing radiations; TP53 is one of the most popular tumor suppressor, with a preeminent role in DNA damage response and repair. To study the effects of the immunohistochemical expression of p-ATM and p53 in glioblastoma patients, 21 cases were retrospectively examined. In normal brain tissue, p-ATM was expressed only in neurons; conversely, in tumors cells, the protein showed a variable cytoplasmic expression (score: +,++,+++), with being completely undetectable in three cases. Statistical analysis revealed that high p-ATM score (++/+++) strongly correlated to shorter survival (P = 0.022). No difference in overall survival was registered between p53 normally expressed (NE) and overexpressed (OE) glioblastoma patients (P = 0.669). Survival analysis performed on the results from combined assessment of the two proteins showed that patients with NE p53 /low pATM score had longer overall survival than the NE p53/ high pATM score counterpart. Cox-regression analysis confirmed this finding (HR = 0.025; CI 95% = 0.002-0.284; P = 0.003). Our study outlined the immunohistochemical expression of p-ATM/p53 in glioblastomas and provided data on their possible prognostic/predictive of response role. A "non-oncogene addiction" to ATM for NEp53 glioblastoma could be postulated, strengthening the rationale for development of ATM inhibiting drugs. © 2018 Wiley Periodicals, Inc.

  1. System-based strategies for p53 recovery.

    Science.gov (United States)

    Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

    2018-06-01

    The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

  2. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  3. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    International Nuclear Information System (INIS)

    Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A

    2012-01-01

    A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology

  4. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    Directory of Open Access Journals (Sweden)

    Kousparou Christina A

    2012-08-01

    Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.

  5. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  6. RBP-J-interacting and tubulin-associated protein induces apoptosis and cell cycle arrest in human hepatocellular carcinoma by activating the p53–Fbxw7 pathway

    International Nuclear Information System (INIS)

    Wang, Haihe; Yang, Zhanchun; Liu, Chunbo; Huang, Shishun; Wang, Hongzhi; Chen, Yingli; Chen, Guofu

    2014-01-01

    Highlights: • RITA overexpression increased protein expression of p53 and Fbxw7 and downregulated the expression of cyclin D1, cyclin E, CDK2, Hes-1 and NF-κB p65. • RITA can significantly inhibit the in vitro growth of SMMC7721 and HepG2 cells. • RITA exerts tumor-suppressive effects in hepatocarcinogenesis through induction of G0/G1 cell cycle arrest and apoptosis and suggest a therapeutic application of RITA in HCC. - Abstract: Aberrant Notch signaling is observed in human hepatocellular carcinoma (HCC) and has been associated with the modulation of cell growth. However, the role of Notch signaling in HCC and its underlying mechanism remain elusive. RBP-J-interacting and tubulin-associated (RITA) mediates the nuclear export of RBP-J to tubulin fibers and downregulates Notch-mediated transcription. In this study, we found that RITA overexpression increased protein expression of p53 and Fbxw7 and downregulated the expression of cyclin D1, cyclin E, CDK2, Hes-1 and NF-κB p65. These changes led to growth inhibition and induced G0/G1 cell cycle arrest and apoptosis in SMMC7721 and HepG2 cells. Our findings indicate that RITA exerts tumor-suppressive effects in hepatocarcinogenesis through induction of G0/G1 cell cycle arrest and apoptosis and suggest a therapeutic application of RITA in HCC

  7. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  8. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  9. p53-Mediated Molecular Control of Autophagy in Tumor Cells

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    2018-03-01

    Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

  10. Tumor hypoxia, p53, and prognosis in cervical cancers

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

    2001-01-01

    Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

  11. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14

  12. P53 Protein Expression in Dental Follicle, Dentigerous Cyst, Odontogenic Keratocyst, and Inflammatory Subtypes of Cysts: An Immunohistochemical Study.

    Science.gov (United States)

    Fatemeh, Mashhadiabbas; Sepideh, Arab; Sara, Bagheri Seyedeh; Nazanin, Mahdavi

    2017-05-01

    An odontogenic keratocyst (OKC) is a developmental odontogenic cyst with aggressive clinical behavior. This cyst shows a different growth mechanism from the more common dentigerous cyst and now has been renamed as a keratocystic odontogenic tumor (KCOT). Inflammation can assist tumor growth via different mechanisms including dysregulation of the p53 gene. This study aims to assess and compare the expression of tumor suppressor gene p53 in inflamed and non-inflamed types of OKC and dentigerous cyst. Immunohistochemical expression of p53 was assessed in 14 cases of dental follicle, 34 cases of OKC (including 18 inflamed OKCs), and 31 cases of dentigerous cyst (including 16 inflamed cysts). The mean percentage of p53 positive cells was 0.7% in dental follicles, 5.4% in non-inflamed OKCs, 17.3% in inflamed OKCs, 1.2% in non-inflamed dentigerous cysts, and 2.2% in inflamed dentigerous cysts. The differences between the groups were statistically significant ( p < 0.050) except for the difference between inflamed and non-inflamed dentigerous cysts, and between dental follicle and non-inflamed dentigerous cyst. The difference in p53 expression in OKC and dentigerous cyst can explain their different growth mechanism and clinical behavior. Inflammation is responsible for the change in behavior of neoplastic epithelium of OKC via p53 overexpression.

  13. P53 Protein Expression in Dental Follicle, Dentigerous Cyst, Odontogenic Keratocyst, and Inflammatory Subtypes of Cysts: An Immunohistochemical Study

    Directory of Open Access Journals (Sweden)

    Mashhadiabbas Fatemeh

    2017-05-01

    Full Text Available Objectives: An odontogenic keratocyst (OKC is a developmental odontogenic cyst with aggressive clinical behavior. This cyst shows a different growth mechanism from the more common dentigerous cyst and now has been renamed as a keratocystic odontogenic tumor (KCOT. Inflammation can assist tumor growth via different mechanisms including dysregulation of the p53 gene. This study aims to assess and compare the expression of tumor suppressor gene p53 in inflamed and non-inflamed types of OKC and dentigerous cyst. Methods: Immunohistochemical expression of p53 was assessed in 14 cases of dental follicle, 34 cases of OKC (including 18 inflamed OKCs, and 31 cases of dentigerous cyst (including 16 inflamed cysts. Results: The mean percentage of p53 positive cells was 0.7% in dental follicles, 5.4% in non-inflamed OKCs, 17.3% in inflamed OKCs, 1.2% in non-inflamed dentigerous cysts, and 2.2% in inflamed dentigerous cysts. The differences between the groups were statistically significant (p < 0.050 except for the difference between inflamed and non-inflamed dentigerous cysts, and between dental follicle and non-inflamed dentigerous cyst. Conclusions: The difference in p53 expression in OKC and dentigerous cyst can explain their different growth mechanism and clinical behavior. Inflammation is responsible for the change in behavior of neoplastic epithelium of OKC via p53 overexpression.

  14. Prognostic Role of Serum Antibody Immunity to p53 Oncogenic Protein in Ovarian Cancer: A Systematic Review and a Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Marica Garziera

    Full Text Available Serum p53 autoantibodies (p53-AAbs are the product of an endogenous immune response against p53 overexpression driven by the ovarian tumour. The p53-AAbs are detectable only in a subset of patients. To date, the evidence of an association between the presence of p53-AAbs and ovarian cancer outcomes has been poorly investigated.A systematic literature search was performed to identify eligible studies investigating the association of serum p53-AAbs and overall survival (OS and disease free survival (DFS. Associations between presence of serum p53-AAbs and baseline tumour characteristics were also evaluated. Pooled hazard ratios (HRs and corresponding 95% confidence intervals (CI were computed to estimate the prognostic impact of serum p53-AAbs. Heterogeneity between studies was assessed.A total of 583 patients (7 studies for OS and 356 patients (4 studies for DFS were included in the meta-analysis. Presence of p53-AAbs was not associated to OS (pooled uni- multivariate HR = 1.09; 95% CI: 0.55-2.16, and a large heterogeneity was found. When only multivariate HRs were pooled together (4 studies, presence of p53-AAbs was significantly associated to a better OS (pooled HR = 0.57; 95% CI: 0.40-0.81, and no significant heterogeneity was observed. A reduced DFS was associated to p53-AAbs (pooled uni- multivariate HR = 1.37; 95% CI: 0.83-2.25, though not significantly and with a moderate heterogeneity.The prognostic significance of serum p53-AAbs in ovarian cancer was diverging according to uni or multivariate models used. Since the results of this work were based on only few investigations, large prospective studies are needed to better define the role of antibody immunity against p53.

  15. Flavopiridol induces apoptosis in glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway.

    Science.gov (United States)

    Alonso, Michelle; Tamasdan, Cristina; Miller, Douglas C; Newcomb, Elizabeth W

    2003-02-01

    Flavopiridol is a synthetic flavone, which inhibits growth in vitro and in vivo of several solid malignancies such as renal, prostate, and colon cancers. It is a potent cyclin-dependent kinase inhibitor presently in clinical trials. In this study, we examined the effect of flavopiridol on a panel of glioma cell lines having different genetic profiles: five of six have codeletion of p16(INK4a) and p14(ARF); three of six have p53 mutations; and one of six shows overexpression of mouse double minute-2 (MDM2) protein. Independent of retinoblastoma and p53 tumor suppressor pathway alterations, flavopiridol induced apoptosis in all cell lines but through a caspase-independent mechanism. No cleavage products for caspase 3 or its substrate poly(ADP-ribose) polymerase or caspase 8 were detected. The pan-caspase inhibitor Z-VAD-fmk did not inhibit flavopiridol-induced apoptosis. Mitochondrial damage measured by cytochrome c release and transmission electron microscopy was not observed in drug-treated glioma cells. In contrast, flavopiridol treatment induced translocation of apoptosis-inducing factor from the mitochondria to the nucleus. The proteins cyclin D(1) and MDM2 involved in the regulation of retinoblastoma and p53 activity, respectively, were down-regulated early after flavopiridol treatment. Given that MDM2 protein can confer oncogenic properties under certain circumstances, loss of MDM2 expression in tumor cells could promote increased chemosensitivity. After drug treatment, a low Bcl-2/Bax ratio was observed, a condition that may favor apoptosis. Taken together, the data indicate that flavopiridol has activity against glioma cell lines in vitro and should be considered for clinical development in the treatment of glioblastoma multiforme.

  16. Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

    Science.gov (United States)

    Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

    2012-06-01

    Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

  17. A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

    Science.gov (United States)

    Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

    2018-05-23

    PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

  18. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  19. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Renee

    2001-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p21, bax, and mdm2...

  20. Functional Significance of Mutant p53 in Breast Cancer

    National Research Council Canada - National Science Library

    O'Lear, Rene

    2002-01-01

    ... in those cells with irreparable damage. In human tumors, many hot-spot mutations are found within the DNA-binding domain of p53, rendering it incapable of sequence-specific transactivation of target genes such as p2l, bax, and mdm2...

  1. The Hunger Games: p53 regulates metabolism upon serine starvation.

    Science.gov (United States)

    Tavana, Omid; Gu, Wei

    2013-02-05

    Cancer cells reprogram their metabolism to support a high proliferative rate. A new study shows that, upon serine starvation, the tumor suppressor p53 activates p21 to shift metabolic flux from purine biosynthesis to glutathione production, which enhances cellular proliferation and viability by combating ROS (Maddocks et al., 2013). Copyright © 2013 Elsevier Inc. All rights reserved.

  2. p53 expression in colorectal carcinoma in relation to ...

    African Journals Online (AJOL)

    Haematoxylin and eosin stain was used for evaluation of histological types and degree of differentiation of the tumors. Topography of the tumors and demographic data were obtained from accompanying histological request forms. Results: Out of 109 patient\\'s tissue blocks that were studied, 61 cases (56%) expressed p53 ...

  3. Cellular inactivation of nitric oxide induces p53-dependent ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.

  4. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    Science.gov (United States)

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  5. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    Science.gov (United States)

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  6. Morphological Heterogeneity of p53 Positive and p53 Negative Nuclei in Breast Cancers Stratified by Clinicopathological Variables

    Directory of Open Access Journals (Sweden)

    Katrin Friedrich

    1997-01-01

    Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.

  7. Apoptosis in spermatogonia irradiated P53 null mice

    International Nuclear Information System (INIS)

    Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.

    2007-01-01

    Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after

  8. The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Čechová, Jana; Battistin, M.; Coufal, Jan; Jagelská, Eva; Raimondi, I.; Inga, A.

    2017-01-01

    Roč. 483, č. 1 (2017), s. 516-521 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor p53 * cruciform structures * dna-conformation Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.466, year: 2016

  9. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

  10. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

    Science.gov (United States)

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

    2011-01-01

    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

  11. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

    Science.gov (United States)

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

    2011-11-01

    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

  12. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    Energy Technology Data Exchange (ETDEWEB)

    Nishida, Tamotsu, E-mail: nishida@gene.mie-u.ac.jp [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan); Yamada, Yoshiji [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan)

    2011-03-11

    Research highlights: {yields} SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. {yields} SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. {yields} SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. {yields} We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  13. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    International Nuclear Information System (INIS)

    Nishida, Tamotsu; Yamada, Yoshiji

    2011-01-01

    Research highlights: → SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. → SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. → SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. → We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  14. Vaccination with p53-peptide-pulsed dendritic cells, of patients with advanced breast cancer: report from a phase I study

    DEFF Research Database (Denmark)

    Svane, Inge Marie; Pedersen, Anders E; Johnsen, Hans E

    2004-01-01

    the treatment. In conclusion, the strategy for p53-DC vaccination seems safe and without toxicity. Furthermore, indications of both immunologic and clinical effect were found in heavily pretreated patients with advanced breast cancer. An independent clinical effect of repeated administration of DCs and IL-2 can......Peptides derived from over-expressed p53 protein are presented by class I MHC molecules and may act as tumour-associated epitopes. Due to the diversity of p53 mutations, immunogenic peptides representing wild-type sequences are preferable as a basis for a broad-spectrum p53-targeting cancer vaccine......) loaded with a cocktail of three wild-type and three modified p53 peptides are being analysed in six HLA-A2+ patients with progressive advanced breast cancer. Vaccinations were well tolerated and no toxicity was observed. Disease stabilisation was seen in two of six patients, one patient had a transient...

  15. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  16. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Ganapathy, Suthakar, E-mail: s.ganapathy@neu.edu [Center for Drug Development, Northeastern University, Boston (United States); Li, Ping [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Fagman, Johan [The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Yu, Tianqi; Lafontant, Jean [Center for Drug Development, Northeastern University, Boston (United States); Zhang, Guojun [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); Chen, Changyan [Center for Drug Development, Northeastern University, Boston (United States); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden)

    2016-09-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  17. Distinct pattern of p53 mutations in bladder cancer

    DEFF Research Database (Denmark)

    Spruck, C H; Rideout, W M; Olumi, A F

    1993-01-01

    A distinct mutational spectrum for the p53 tumor suppressor gene in bladder carcinomas was established in patients with known exposures to cigarette smoke. Single-strand conformational polymorphism analysis of exons 5 through 8 of the p53 gene showed inactivating mutations in 16 of 40 (40%) bladder...... tumors from smokers and 13 of 40 (33%) tumors from lifetime nonsmokers. Overall, 13 of the 50 (26%) total point mutations discovered in this and previous work were G:C-->C:G transversions, a relatively rare mutational type in human tumors. In six tumors, identical AGA (Arg)-->ACA (Thr) point mutations...... double mutations, four of which were tandem mutations on the same allele. No double mutations were found in tumors from nonsmoking patients. None of the mutations in smokers were G:C-->T:A transversions, which would be anticipated for exposure to the suspected cigarette smoke carcinogen 4-aminobiphenyl...

  18. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    International Nuclear Information System (INIS)

    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan

    2016-01-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  19. COX-2 and p53 in human sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Cyr, Diane; Luce, Danièle

    2008-01-01

    The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...

  20. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public...a lead construct. Technical skills gained in the proposal include cell culture , transfections, microscopy, apoptosis assays, transcriptional assays...experiments complete 100% (DOD) Specific Aim 2: Deliver super p53 DNA with advanced polymeric systems alone and in combination with CPTX first in vitro

  1. p53 and ARF: Unexpected players in autophagy

    OpenAIRE

    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

    2010-01-01

    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

  2. Non-Canonical Cell Death Induced by p53

    Directory of Open Access Journals (Sweden)

    Atul Ranjan

    2016-12-01

    Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.

  3. Electrophoretic detection of protein p53 in human leukocytes

    International Nuclear Information System (INIS)

    Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.

    1986-01-01

    The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients

  4. P53-dependent antiproliferative and pro-apoptotic effects of trichostatin A (TSA) in glioblastoma cells.

    Science.gov (United States)

    Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R

    2012-05-01

    Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.

  5. p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

    Science.gov (United States)

    Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

    2009-04-01

    Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

  6. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  7. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2004-01-01

    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  8. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov

    2014-01-01

    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  9. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G

    2013-01-01

    Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

  10. Expression of p53 protein in Barrett’s adenocarcinoma and adenocarcinoma of the gastric cardia and antrum

    Directory of Open Access Journals (Sweden)

    Jovanović Ivan

    2005-01-01

    Full Text Available Background/Aim. Most studies of esophageal and gastric adenocarcinomas have shown a very high rate of p53 gene mutation and/or protein overexpression, but the influence of the tumor site upon the frequency of p53 protein expression has not been evaluated (gastroesophageal junction, Barret's esophagus, and antrum. The aim of our study was to analyze the correlation between the selected clinico-pthological parameters, and p53 protein overexpression in regards to the particular tumor location. Methods. The material comprised 66 surgical specimens; 10 were Barrett’s carcinomas, 25 adenocarcinomas of the gastric cardia (type II adenocarcinoma of the esophagogastric junction - EGJ, and 31 adenocarcinomas of the antrum. Immunostaining for p53 protein was performed on formalin-fixed, paraffin-embedded tissue sections, using the alkaline phosphatase - antialkaline phosphatase (APAAP method. The cases were considered positive for p53 if at least 5% of the tumor cells expressed this protein by immunostaining. Results. There was no significant difference observed between the studied groups in regards to age, sex, Lauren’s classification and tumor differentiation. There was, however, a significant difference observed in the depth of tumor invasion between Barrrett’s adenocarcinoma and adenocarcinoma of the cardia compared with the adenocarcinoma of the antrum. Namely, at the time of surgery, both Barrett’s adenocarcinomas and adenocarcinomas of the cardia, were significantly more advanced comparing with the adenocarcinomas of the antrum. Overexpression of p53 was found in 40% (4/10 of Barrett’s adenocarcinomas, 72% (18/25 of adenocarcinoma of the cardia and 65% (20/31 of adenocarcinoma of the antrum. No significant differences in p53 expression in relation to sex, type (Lauren of tumor, depth of invasion, lymph node involvement, or tumor differentiation were observed in any of the analyzed groups of tumors. Patients with more advanced Barrett

  11. Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Lin [West Biostatistics and Cost-effectiveness Research Center, Medical Insurance Office, West China Hospital of Sichuan University, 610041, Sichuan (China); Li, Yu [Department of Anesthesiology, West China Hospital, Sichuan University, 610041, Sichuan (China); Yang, Bangxiang, E-mail: b19933009@qq.coom [Department of Pain Management, West China Hospital of Sichuan University, 610041, Sichuan (China)

    2016-09-09

    Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition of proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.

  12. Assessment of the potential diagnostic value of serum p53 antibody for cancer: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    Full Text Available BACKGROUND: Mutant p53 protein over-expression has been reported to induce serum antibodies against p53. We assessed the diagnostic precision of serum p53 (s-p53 antibodies for diagnosis of cancer patients and compared the positive rates of the s-p53 antibody in different types of cancers. METHODS: We systematically searched PubMed and Embase, through May 31, 2012. Studies were assessed for quality using QUADAS (quality assessment of studies of diagnostic accuracy. The positive likelihood ratio (PLR and negative likelihood ratio (NLR were pooled separately and compared with overall accuracy measures using diagnostic odds ratios (DORs and Area under the curve(AUC. Meta regression and subgroup analyses were done, and heterogeneity and publication bias were assessed. RESULTS: Of 1089 studies initially identified, 100 eligible studies with 23 different types of tumor met the inclusion criteria for the meta-analysis (cases = 15953, controls = 8694. However, we could conduct independent meta analysis on only 13 of 36 types of tumors. Approximately 56% (56/100 of the included studies were of high quality (QUADAS score≥8. The summary estimates for quantitative analysis of serum p53 antibody in the diagnosis of cancers were: PLR 5.75 (95% CI: 4.60-7.19, NLR 0.81 (95%CI: 0.79-0.83 and DOR 7.56 (95% CI: 6.02-9.50. However, for the 13 types of cancers on which meta-analysis was conducted, the ranges for PLR (2.33-11.05, NLR (0.74-0.97, DOR (2.86-13.80, AUC(0.29-0.81, and positive rate (4.47%-28.36% indicated significant heterogeneity. We found that breast, colorectal, esophageal, gastric, hepatic, lymphoma, lung and ovarian cancer had relatively reasonable diagnostic accuracy. The remaining results of the five types of cancers suggested that s-p53 antibody had limited value. CONCLUSIONS: The current evidence suggests that s-p53 antibody has potential diagnostic value for cancer, especially for breast, colorectal, esophageal, gastric, hepatic

  13. The Inherited p53 Mutation in the Brazilian Population.

    Science.gov (United States)

    Achatz, Maria Isabel; Zambetti, Gerard P

    2016-12-01

    A common criticism of studying rare diseases is the often-limited relevance of the findings to human health. Here, we review ∼15 years of research into an unusual germline TP53 mutation (p.R337H) that began with its detection in children with adrenocortical carcinoma (ACC), a remarkably rare childhood cancer that is associated with poor prognosis. We have come to learn that the p.R337H mutation exists at a very high frequency in Southern and Southeastern Brazil, occurring in one of 375 individuals within a total population of ∼100 million. Moreover, it has been determined that carriers of this founder mutation display variable tumor susceptibility, ranging from isolated cases of pediatric ACC to Li-Fraumeni or Li-Fraumeni-like (LFL) syndromes, thus representing a significant medical issue for this country. Studying the biochemical and molecular consequences of this mutation on p53 tumor-suppressor activity, as well as the putative additional genetic alterations that cooperate with this mutation, is advancing our understanding of how p53 functions in tumor suppression in general. These studies, which originated with a rare childhood tumor, are providing important information for guiding genetic counselors and physicians in treating their patients and are already providing clinical benefit. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.

  14. Evaluation of HER2 and p53 expression in predicting response to docetaxel-based first-line chemotherapy in advanced breast cancer

    Directory of Open Access Journals (Sweden)

    Martini Leonardo

    2011-04-01

    Full Text Available Abstract Background The human epidermal growth factor receptor 2 (HER2 and p53 pathways may be involved in chemotherapy sensitivity and/or resistance. We explore the value of HER2 and p53 status to foretell docetaxel sensitivity in advanced breast cancer. Methods HER2 and p53 expression was analysed in 36 (median age 55 yrs; range 37-87 metastatic breast cancer patients receiving docetaxel-based first-line chemotherapy. HER2 was determined by immunohistochemistry (IHC and fluorescence in situ hybridization (FISH, p53 was tested by IHC. We correlate the expression of study parameters with pathologic parameters, RECIST response and survival. The standard cut-off value of 2 was used to determine HER2 overexpression while p53 mean expression level was used to divide low/high expressors tumors. Results Median time to progression and overall survival were 9 (range 2 - 54 and 20 (range 3 - 101 months. Overall response rate was 41.6%. Nine cases showed HER2 overexpression. HER2 was more frequently overexpressed in less differentiated (p = 0.05 and higher stage (p = 0.003 disease. Mean FISH-HER2 values were significantly higher in responder than in non-responder pts (8.53 ± 10.21 vs 2.50 ± 4.12, p = 0.027. Moreover, HER2 overexpression correlates with treatment response at cross-tabulation analysis (p = 0.046. p53 expression was only associated with higher stage disease (p = 0.02 but lack of any significant association with HER status or docetaxel response. No significant relation with survival was observed for any parameter. Conclusion Our data seem to indicate that FISH-determined HER2 status but not p53 is associated with docetaxel sensitivity in metastatic breast cancer.

  15. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  16. Distinction between asymptomatic monoclonal B-cell lymphocytosis with cyclin D1 overexpression and mantle cell lymphoma: from molecular profiling to flow cytometry.

    Science.gov (United States)

    Espinet, Blanca; Ferrer, Ana; Bellosillo, Beatriz; Nonell, Lara; Salar, Antonio; Fernández-Rodríguez, Concepción; Puigdecanet, Eulàlia; Gimeno, Javier; Garcia-Garcia, Mar; Vela, Maria Carmen; Luño, Elisa; Collado, Rosa; Navarro, José Tomás; de la Banda, Esmeralda; Abrisqueta, Pau; Arenillas, Leonor; Serrano, Cristina; Lloreta, Josep; Miñana, Belén; Cerutti, Andrea; Florensa, Lourdes; Orfao, Alberto; Sanz, Ferran; Solé, Francesc; Dominguez-Sola, David; Serrano, Sergio

    2014-02-15

    According to current diagnostic criteria, mantle cell lymphoma (MCL) encompasses the usual, aggressive variants and rare, nonnodal cases with monoclonal asymptomatic lymphocytosis, cyclin D1-positive (MALD1). We aimed to understand the biology behind this clinical heterogeneity and to identify markers for adequate identification of MALD1 cases. We compared 17 typical MCL cases with a homogeneous group of 13 untreated MALD1 cases (median follow-up, 71 months). We conducted gene expression profiling with functional analysis in five MCL and five MALD1. Results were validated in 12 MCL and 8 MALD1 additional cases by quantitative reverse transcription polymerase chain reaction (qRT-PCR) and in 24 MCL and 13 MALD1 cases by flow cytometry. Classification and regression trees strategy was used to generate an algorithm based on CD38 and CD200 expression by flow cytometry. We found 171 differentially expressed genes with enrichment of neoplastic behavior and cell proliferation signatures in MCL. Conversely, MALD1 was enriched in gene sets related to immune activation and inflammatory responses. CD38 and CD200 were differentially expressed between MCL and MALD1 and confirmed by flow cytometry (median CD38, 89% vs. 14%; median CD200, 0% vs. 24%, respectively). Assessment of both proteins allowed classifying 85% (11 of 13) of MALD1 cases whereas 15% remained unclassified. SOX11 expression by qRT-PCR was significantly different between MCL and MALD1 groups but did not improve the classification. We show for the first time that MALD1, in contrast to MCL, is characterized by immune activation and driven by inflammatory cues. Assessment of CD38/CD200 by flow cytometry is useful to distinguish most cases of MALD1 from MCL in the clinical setting. MALD1 should be identified and segregated from the current MCL category to avoid overdiagnosis and unnecessary treatment. ©2013 AACR

  17. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  18. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik

    2006-01-01

    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  19. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    NARCIS (Netherlands)

    Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.

    2013-01-01

    Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

  20. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

    NARCIS (Netherlands)

    Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.

    2015-01-01

    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

  2. p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer

    DEFF Research Database (Denmark)

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F

    2014-01-01

    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....

  3. P53- and mevalonate pathway–driven malignancies require Arf6 for metastasis and drug resistance

    Science.gov (United States)

    Hashimoto, Ari; Oikawa, Tsukasa; Hashimoto, Shigeru; Sugino, Hirokazu; Yoshikawa, Ayumu; Otsuka, Yutaro; Handa, Haruka; Onodera, Yasuhito; Nam, Jin-Min; Oneyama, Chitose; Okada, Masato; Fukuda, Mitsunori

    2016-01-01

    Drug resistance, metastasis, and a mesenchymal transcriptional program are central features of aggressive breast tumors. The GTPase Arf6, often overexpressed in tumors, is critical to promote epithelial–mesenchymal transition and invasiveness. The metabolic mevalonate pathway (MVP) is associated with tumor invasiveness and known to prenylate proteins, but which prenylated proteins are critical for MVP-driven cancers is unknown. We show here that MVP requires the Arf6-dependent mesenchymal program. The MVP enzyme geranylgeranyl transferase II (GGT-II) and its substrate Rab11b are critical for Arf6 trafficking to the plasma membrane, where it is activated by receptor tyrosine kinases. Consistently, mutant p53, which is known to support tumorigenesis via MVP, promotes Arf6 activation via GGT-II and Rab11b. Inhibition of MVP and GGT-II blocked invasion and metastasis and reduced cancer cell resistance against chemotherapy agents, but only in cells overexpressing Arf6 and components of the mesenchymal program. Overexpression of Arf6 and mesenchymal proteins as well as enhanced MVP activity correlated with poor patient survival. These results provide insights into the molecular basis of MVP-driven malignancy. PMID:27044891

  4. p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.

    Science.gov (United States)

    Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina

    2009-11-01

    Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.

  5. Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.

    Science.gov (United States)

    Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi

    2018-04-19

    Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.

  6. Combined Analysis of COX-2 and p53 Expressions Reveals Synergistic Inverse Correlations with Microsatellite Instability and CpG Island Methylator Phenotype in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Shuji Ogino

    2006-06-01

    Full Text Available Cyclooxygenase-2 (COX-2 overexpression and mutations of p53 (a known COX-2 regulator are inversely associated with microsatellite instability—high (MSI-H and CpG island methylator phenotype (CIMP, characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A, CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15% tumors were CIMP-high (≥ 4 of 5 methylated promoters, 251 (33% were CIMP-low (1 to 3 methylated promoters, and the remaining 385 (51% were CIMP-0 (no methylated promoters. CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6% than in COX-2+/p53- tumors (19%; P < .0001, COX-2-/p53+ tumors (17%; P = .04, and COX-2-/p53- tumors (28%; P < .0001. In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7% than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P < .0001. In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone.

  7. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    International Nuclear Information System (INIS)

    Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang

    2006-01-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties

  8. Prognostic significance of cyclin D1 protein expression and gene amplification in invasive breast carcinoma.

    Directory of Open Access Journals (Sweden)

    Angela B Ortiz

    Full Text Available The oncogenic capacity of cyclin D1 has long been established in breast cancer. CCND1 amplification has been identified in a subset of patients with poor prognosis, but there are conflicting data regarding the predictive value of cyclin D1 protein overexpression. This study was designed to analyze the expression of cyclin D1 and its correlation with CCND1 amplification and their prognostic implications in invasive breast cancer. By using the tissue microarray technique, we performed an immunohistochemical study of ER, PR, HER2, p53, cyclin D1, Ki67 and p16 in 179 invasive breast carcinoma cases. The FISH method was performed to detect HER2/Neu and CCND1 amplification. High cyclin D1 expression was identified in 94/179 (52% of invasive breast cancers. Cyclin D1 overexpression and CCND1 amplification were significantly associated (p = 0.010. Overexpression of cyclin D1 correlated with ER expression, PR expression and Luminal subtypes (p<0.001, with a favorable impact on overall survival in the whole series. However, in the Luminal A group, high expression of cyclin D1 correlated with shorter disease-free survival, suggesting that the prognostic role of cyclin D1 depends on the molecular subtype. CCND1 gene amplification was detected in 17 cases (9% and correlated significantly with high tumor grade (p = 0.038, high Ki-67 protein expression (p = 0.002, and the Luminal B subtype (p = 0.002. Patients with tumors with high amplification of CCND1 had an increased risk of recurrence (HR = 2.5; 95% CI, 1.2-4.9, p = 0.01. These findings suggest that CCND1 amplification could be useful for predicting recurrence in invasive breast cancer.

  9. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    Science.gov (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  10. Sublethal dose of irradiation enhances invasion of malignant glioma cells through p53-MMP 2 pathway in U87MG mouse brain tumor model

    International Nuclear Information System (INIS)

    Pei, Jian; Park, In-Ho; Ryu, Hyang-Hwa; Li, Song-Yuan; Li, Chun-Hao; Lim, Sa-Hoe; Wen, Min; Jang, Woo-Youl; Jung, Shin

    2015-01-01

    Glioblastoma is a highly lethal neoplasm that frequently recurs locally after radiotherapy, and most of these recurrences originate from near the irradiated target field. In the present study, we identified the effects of radiation on glioma invasion and p53, TIMP-2, and MMP-2 expression through in vitro and in vivo experiments. The U87MG (wt p53) and U251 (mt p53) human malignant glioma cell lines were prepared, and the U2OS (wt 53) and Saos2 (del p53) osteosarcoma cell lines were used as p53 positive and negative controls. The four cell lines and p53 knock-downed U87MG cells received radiation (2–6 Gy) and were analyzed for expression of p53 and TIMP-2 by Western blot, and MMP-2 activity was detected by zymography. In addition, the effects of irradiation on directional invasion of malignant glioma were evaluated by implanting nude mice with bioluminescent u87-Fluc in vivo followed by MMP-2, p53, and TIMP-2 immunohisto-chemistry and in situ zymography. MMP-2 activity and p53 expression increased in proportional to the radiation dose in cell lines with wt p53, but not in the cell lines with del or mt p53. TIMP-2 expression did not increase in U87MG cells. MMP-2 activity decreased in p53 knock-downed U87MG cells but increased in the control group. Furthermore, radiation enhanced MMP-2 activity and increased tumor margin invasiveness in vivo. Tumor cells invaded by radiation overexpressed MMP-2 and p53 and revealed high gelatinolytic activity compared with those of non-radiated tumor cells. Radiation-induced upregulation of p53 modulated MMP-2 activity, and the imbalance between MMP-2 and TIMP-2 may have an important role in glioblastoma invasion by degrading the extracellular matrix. Bioluminescent “U87-Fluc”was useful for observing tumor formation without sacrifice after implanting tumor cells in the mouse brain. These findings suggest that the radiotherapy involved field for malignant glioma needs to be reconsidered, and that future trials should investigate

  11. Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

    International Nuclear Information System (INIS)

    Hu, Duanmin; Su, Cunjin; Jiang, Min; Shen, Yating; Shi, Aiming; Zhao, Fenglun; Chen, Ruidong; Shen, Zhu; Bao, Junjie; Tang, Wen

    2016-01-01

    There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.

  12. Fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of LncRNA MEG3

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Duanmin [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Su, Cunjin [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Jiang, Min [Department of Breast Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Yating [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shi, Aiming; Zhao, Fenglun [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Chen, Ruidong [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Shen, Zhu [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Bao, Junjie, E-mail: baojjsdfey@sina.com [Department of Pharmacy, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China); Tang, Wen, E-mail: sztangwen@163.com [Department of Gastroenterology, The Second Affiliated Hospital of Soochow University, Suzhou 215004 (China)

    2016-03-04

    There is still no suitable drug for pancreatic cancer treatment, which is one of the most aggressive human tumors. Maternally expressed gene 3 (MEG3), a LncRNA, has been suggested as a tumor suppressor in a range of human tumors. Studies found fenofibrate exerted anti-tumor roles in various human cancer cell lines. However, its role in pancreatic cancer remains unknown. The present study aimed to explore the impacts of fenofibrate on pancreatic cancer cell lines, and to investigate MEG3 role in its anti-tumor mechanisms. We used MTT assay to determine cells proliferation, genome-wide LncRNA microarray analysis to identify differently expressed LncRNAs, siRNA or pCDNA-MEG3 transfection to interfere or upregulate MEG3 expression, western blot to detect protein levels, real-time PCR to determine MEG3 level. Fenofibrate significantly inhibited proliferation of pancreatic cancer cells, increased MEG3 expression and p53 levels. Moreover, knockdown of MEG3 attenuated cytotoxicity induced by fenofibrate. Furthermore, overexpression of MEG3 induced cells death and increased p53 expression. Our results indicated fenofibrate inhibited pancreatic cancer cells proliferation via activation of p53 mediated by upregulation of MEG3. - Highlights: • We found that fenofibrate suppressed proliferation of pancreatic cancer cells. • We found fenofibrate increased LncRNA-MEG3 expression and p53 level in PANC-1 cells. • Inhibition of MEG3 expression attenuated anti-tumor effects of fenofibrate.

  13. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  14. Regulatory module involving FGF13, miR-504, and p53 regulates ribosomal biogenesis and supports cancer cell survival

    Science.gov (United States)

    Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe

    2017-01-01

    The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142

  15. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Energy Technology Data Exchange (ETDEWEB)

    Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  16. FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

    Science.gov (United States)

    Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

    2017-01-01

    Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

  17. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  18. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  19. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  20. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    OpenAIRE

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...

  1. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

    Science.gov (United States)

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

    2018-05-31

    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  3. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  4. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    Science.gov (United States)

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  5. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  6. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  7. An adaptive molecular timer in p53-meidated cell fate decision

    Science.gov (United States)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  8. The critical role of catalase in prooxidant and antioxidant function of p53

    Science.gov (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  9. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  10. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  11. The dependence receptor Ret induces apoptosis in somatotrophs through a Pit-1/p53 pathway, preventing tumor growth.

    Science.gov (United States)

    Cañibano, Carmen; Rodriguez, Noela L; Saez, Carmen; Tovar, Sulay; Garcia-Lavandeira, Montse; Borrello, Maria Grazia; Vidal, Anxo; Costantini, Frank; Japon, Miguel; Dieguez, Carlos; Alvarez, Clara V

    2007-04-18

    Somatotrophs are the only pituitary cells that express Ret, GFRalpha1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCdelta, JNK, c/EBPalpha and CREB induced by a complex of Ret, caspase 3 and PKCdelta. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas.

  12. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  13. Prognostic value of p53 in patients with muscle-invasive bladder cancer treated with preoperative radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Catherine S; Pollack, Alan; Czerniak, Bogdan A; Chyle, Valerian; Zagars, Gunar K; Dinney, Colin P; Benedict, William F

    1995-07-01

    Purpose/Objective: The overexpression of mutated and/or wild type p53 has been associated with poorer prognosis in patients with bladder cancer. However, most studies have involved a mixed patient population, including those with superficial and muscle-invasive disease, and some patients treated with adjuvant chemotherapy. In this study we examine the prognostic significance of p53 detected immunohistochemically in a cohort of patients with muscle-invasive transitional cell carcinoma of the bladder treated relatively uniformly with preoperative radiotherapy 4-6 weeks prior to radical cystectomy. Materials and Methods: Of 301 patients treated with preoperative radiotherapy (50 Gy in 25 fractions over 5 weeks) for muscle-invasive bladder cancer between 1960-1983, adequate material for immunohistochemical analysis of p53 was obtained in 107. Formalin-fixed paraffin-embedded archival tissue was stained using monoclonal anti-p53 antibody D01 (Oncogene Science, Manhasset, NY). The immunostaining of p53 was considered positive if greater than 20% of the tumor nuclei were stained. There were 82 men and 25 women with a mean age of 61 yr and no patient received neoadjuvant or adjuvant chemotherapy. All patients were without distant metastasis prior to treatment initiation. The median follow-up for those living (n=32) was 88 mo. The number of patients by clinical stage was 48 for T2, 30 for T3a, and 29 for T3b. Results: Overall, 46% of the patients were p53 positive, with 42% in Stage T2, 57% in Stage T3a, and 41% in Stage T3b. The distributions of potential patient prognostic factors by p53 positivity were investigated and the only association was with lymphatic-vascular invasion (p=0.04, chi-square). No correlation was seen between p53 staining and pathologic complete response (seen in 47%), clinical-to-pathologic downstaging (seen in 69%), clinical stage, tumor grade, tumor morphology, tumor number, tumor size, gender, patient age, pretreatment hemoglobin levels, BUN

  14. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    Science.gov (United States)

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  15. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    Science.gov (United States)

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  16. Neem oil limonoids induces p53-independent apoptosis and autophagy

    Science.gov (United States)

    Chandra, Dhyan

    2012-01-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  17. Avoiding restorative proctocolectomy for colorectal cancer in patients with ulcerative colitis based on preoperative diagnosis involving p53 immunostaining: report of a case.

    Science.gov (United States)

    Sada, Haruki; Shimomura, Manabu; Hinoi, Takao; Egi, Hiroyuki; Kawaguchi, Koji; Yano, Takuya; Niitsu, Hiroaki; Saitou, Yasufumi; Sawada, Hiroyuki; Miguchi, Masashi; Adachi, Tomohiro; Ohdan, Hideki

    2015-03-26

    The standard operation for colitic cancer in ulcerative colitis (UC) is restorative proctocolectomy; however, sporadic colorectal cancer (CRC) can coincidentally arise in patients with UC and the optimal procedure remains controversial. Therefore, it is crucial to preoperatively determine whether the CRC in UC is a sporadic or colitic cancer. We report a case of avoiding proctocolectomy for sporadic CRC in a patient with UC based on preoperative diagnosis involving p53 immunostaining. A 73-year-old man with CRC in UC had undergone sigmoid colectomy with lymphadenectomy because of the submucosal deep invasion pathologically after endoscopic mucosal resection. The cancer was diagnosed sporadic cancer preoperatively not only based on the endoscopic, clinical, and histological patterns but also that the colon epithelium was unlikely to develop dysplasia as the circumference and unaffected UC mucosa did not detect p53 protein overexpression. Recent reports have shown that the immunohistochemical detection of p53 protein overexpression can be useful for a differential diagnosis and as a predictor of dysplasia and colitic cancer. The analysis of p53 mutation status based on immunostaining of p53 protein expression in the unaffected UC mucosa can be useful for the decision regarding a surgical procedure for CRC in patients with UC.

  18. Ectopic AP4 expression induces cellular senescence via activation of p53 in long-term confluent retinal pigment epithelial cells.

    Science.gov (United States)

    Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay

    2015-11-15

    When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Structural Basis of Competitive Recognition of p53 and MDM2 by HAUSP/USP7: Implications for the Regulation of the p53-MDM2 Pathway.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.

  20. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  1. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  2. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  3. Isolation and characterization of DUSP11, a novel p53 target gene

    DEFF Research Database (Denmark)

    Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

    2009-01-01

    target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

  4. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  5. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    NARCIS (Netherlands)

    Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent

  6. A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

    Directory of Open Access Journals (Sweden)

    Alfredo Ribeiro-Silva

    2003-06-01

    Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

  7. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  8. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    Science.gov (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  9. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  10. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

    Science.gov (United States)

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

    2013-04-16

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  11. p53 expression in biopsies from children with Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik

    2002-01-01

    based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

  12. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  13. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  14. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    Science.gov (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  15. Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation

    International Nuclear Information System (INIS)

    Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki

    2001-01-01

    We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)

  16. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  17. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  18. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  19. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  20. Friend or Foe: MicroRNAs in the p53 network.

    Science.gov (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  1. Essentials in clinical application of p53 for tumors intervention-example of liver cancer

    International Nuclear Information System (INIS)

    Guan Yongsong; He Qing

    2008-01-01

    Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)

  2. Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline

    Directory of Open Access Journals (Sweden)

    Noriko Mori

    2004-10-01

    Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.

  3. Association of p53 protein expression with clinical outcome in advanced supraglottic cancer

    International Nuclear Information System (INIS)

    Kang, Jin Oh; Hong, Seong Eon

    1998-01-01

    To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression

  4. Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity

    Directory of Open Access Journals (Sweden)

    Masataka Yokoyama

    2014-06-01

    Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.

  5. Deregulated expression of p16INK4a and p53 pathway members in benign and malignant myoepithelial tumours of the salivary glands

    NARCIS (Netherlands)

    Vékony, H.; Röser, K.; Löning, T.; Raaphorst, F.M.; Leemans, C.R.; van der Waal, I.; Bloemena, E.

    2008-01-01

    Aims: Myoepithelial salivary gland tumours are uncommon and follow an unpredictable biological course. The aim was to examine their molecular background to acquire a better understanding of their clinical behaviour. Methods and results: Expression of protein (E2F1, p16INK4a, p53, cyclin D1, Ki67 and

  6. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  7. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  8. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  9. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. The PRR11-SKA2 Bidirectional Transcription Unit Is Negatively Regulated by p53 through NF-Y in Lung Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yitao Wang

    2017-03-01

    Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.

  11. OSU-2S/sorafenib synergistic antitumor combination against hepatocellular carcinoma: The role of PKCδ/p53

    Directory of Open Access Journals (Sweden)

    Hany A Omar

    2016-11-01

    Full Text Available Background: Sorafenib (Nexavar® is an FDA-approved systemic therapy for advanced hepatocellular carcinoma (HCC. However, the low efficacy and adverse effects at high doses limit the clinical application of sorafenib and strongly recommend its combination with other agents aiming at ameliorating its drawbacks. OSU-2S, a PKCδ activator, was selected as a potential candidate anticancer agent to be combined with sorafenib to promote the anti-cancer activity through synergistic interaction. Methods: The antitumor effects of sorafenib, OSU-2S and their combination were assessed by MTT assay, caspase activation, Western blotting, migration/invasion assays in four different HCC cell lines. The synergistic interactions were determined by Calcusyn analysis. PKCδ knockdown was used to elucidate the role of PKCδ activation as a mechanism for the synergy. The knockdown/over-expression of p53 was used to explain the differential sensitivity of HCC cell lines to sorafenib and/or OSU-2S. Results: OSU-2S synergistically enhanced the anti-proliferative effects of sorafenib in the four used HCC cell lines with combination indices < 1. This effect was accompanied by parallel increases in caspase 3/7 activity, PARP cleavage, PKCδ activation and HCC cell migration/invasion. In addition, PKCδ knockdown abolished the synergy between sorafenib and OSU-2S. Furthermore, p53 restoration in Hep3B cells through the over-expression rendered them more sensitive to both agents while p53 knockdown from HepG2 cells increased their resistance to both agents. Conclusions: OSU-2S augments the anti-proliferative effect of sorafenib in HCC cell lines, in part, through the activation of PKCδ. The p53 status in HCC cells predicts their sensitivity towards both sorafenib and OSU-2S. The proposed combination represents a therapeutically relevant approach that can lead to a new HCC therapeutic protocol.

  12. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies.

    Science.gov (United States)

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael

    2016-02-16

    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.

  13. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    Science.gov (United States)

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  15. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  16. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  17. Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

    International Nuclear Information System (INIS)

    Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

    2015-01-01

    Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

  18. NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

    Directory of Open Access Journals (Sweden)

    Labhart Paul

    2007-05-01

    Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

  19. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    Science.gov (United States)

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  20. Changes in p53 expression in mouse fibroblasts can modify motility and extracellular matrix organization.

    Science.gov (United States)

    Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J

    2000-11-23

    Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.

  1. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    Directory of Open Access Journals (Sweden)

    Iva Simeonova

    2013-06-01

    Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

  2. Targeting Oct2 and P53: Formononetin prevents cisplatin-induced acute kidney injury

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Di [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Wang, Chuangyuan [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China); Duan, Yingjie [General hospital of Fuxin mining (Group) Co., Ltd (China); Meng, Qiang; Liu, Zhihao; Huo, Xiaokui; Sun, Huijun; Ma, Xiaodong [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China); Liu, Kexin, E-mail: kexinliu@dlmedu.edu.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China)

    2017-07-01

    Nephrotoxicity is one of major side effects of cisplatin in chemotherapy. Therefore, there is an urgent medical need to develop drugs that may protect kidney from toxicity. In previous study, we found that it showed the protective effects of formononetin against apoptosis by upregulating Nrf2. In this study, we investigated the renoprotective effect of formononetin against cisplatin-induced AKI and tried to elucidate the possible mechanisms. The amelioration of renal function, histopathological changes, and apoptosis in tubular cells was observed after formononetin treatment. Formononetin decreased expression of organic cation transporter 2 (Oct2) and increased the expressions of multidrug resistance-associated proteins (Mrps), which might result in a decrease accumulation of cisplatin in tubular cells after AKI. 5-Bromo-2-deoxyuridine (BrdU) and Ki-67 staining assay indicated that formononetin could promote the renal tubular cells proliferation after cisplatin nephrotoxicity. Moreover, formononetin regulated cyclins and pro-apoptotic proteins to involve the regulation of cell cycle. Furthermore, formononetin decreased p53 expression via promoting the overexpression of murine double minute 2 (MDM2) and MDMX. Taken together, formononetin provided protective effects by promoting proliferation of surviving renal tubular cells and inhibiting apoptosis after cisplatin-induced AKI. - Highlights: • Formononetin ameliorated the cisplatin-induced AKI. • Oct2 were reduced by formononetin. • Protective effect of formononetin was closely related to the reduction of cisplatin.

  3. Targeting Oct2 and P53: Formononetin prevents cisplatin-induced acute kidney injury

    International Nuclear Information System (INIS)

    Huang, Di; Wang, Chuangyuan; Duan, Yingjie; Meng, Qiang; Liu, Zhihao; Huo, Xiaokui; Sun, Huijun; Ma, Xiaodong; Liu, Kexin

    2017-01-01

    Nephrotoxicity is one of major side effects of cisplatin in chemotherapy. Therefore, there is an urgent medical need to develop drugs that may protect kidney from toxicity. In previous study, we found that it showed the protective effects of formononetin against apoptosis by upregulating Nrf2. In this study, we investigated the renoprotective effect of formononetin against cisplatin-induced AKI and tried to elucidate the possible mechanisms. The amelioration of renal function, histopathological changes, and apoptosis in tubular cells was observed after formononetin treatment. Formononetin decreased expression of organic cation transporter 2 (Oct2) and increased the expressions of multidrug resistance-associated proteins (Mrps), which might result in a decrease accumulation of cisplatin in tubular cells after AKI. 5-Bromo-2-deoxyuridine (BrdU) and Ki-67 staining assay indicated that formononetin could promote the renal tubular cells proliferation after cisplatin nephrotoxicity. Moreover, formononetin regulated cyclins and pro-apoptotic proteins to involve the regulation of cell cycle. Furthermore, formononetin decreased p53 expression via promoting the overexpression of murine double minute 2 (MDM2) and MDMX. Taken together, formononetin provided protective effects by promoting proliferation of surviving renal tubular cells and inhibiting apoptosis after cisplatin-induced AKI. - Highlights: • Formononetin ameliorated the cisplatin-induced AKI. • Oct2 were reduced by formononetin. • Protective effect of formononetin was closely related to the reduction of cisplatin.

  4. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  5. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  6. Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Fu Jia

    2009-12-01

    Full Text Available Abstract Background Tumor Protein p53 (p53, cyclin-dependent kinase inhibitor 1A (p21/WAF1, and murine double minute 2 (MDM2 participate in the regulation of cell growth. Altered expression of these gene products has been found in malignant tumors and has been associated with poor prognosis. Our aim was to investigate the expression of the 3 proteins in hepatocellular carcinoma (HCC and their prognostic significance. Methods We examined p53, p21/WAF1, and MDM2 expression in 181 pairs of HCC tissues and the adjacent hepatic tissues by performing immunohistochemistry and examined the expression of the 3 proteins in 7 pairs of HCC tissues and the adjacent hepatic tissues by using western blot analysis. Results The expression of p53, p21/WAF1, and MDM2 in the HCC tissues was significantly higher than those in the adjacent hepatic tissues (P P = 0.008. A statistical correlation was observed between expression of p53 and p21/WAF1 (R = 0.380, P = 0.000, p53 and MDM2 (R = 0.299, P = 0.000, p21/WAF1 and MDM2 (R = 0.285, P = 0.000 in 181 liver tissues adjacent to the tumor. Patients with a low pathologic grade HCC (I+II had a higher tendency to express p53 on tumor cells than the patients with high pathologic grade HCC (III+IV (P = 0.007. Survival analysis showed that positive p21/WAF1 expression or/and negative MDM2 expression in HCC was a predictor of better survival of patients after tumor resection (P Conclusions The proteins p53, p21/WAF1, and MDM2 were overexpressed in all the HCC cases in this study, and p53 and p21/WAF1 overexpression were positively correlated. The expression of p21/WAF1 and MDM2 can be considered as 2 useful indicators for predicting the prognosis of HCC.

  7. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    Science.gov (United States)

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  8. Increased Arf/p53 activity in stem cells, aging and cancer.

    Science.gov (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  9. Functions of MDMX in the Modulation of the p53-Response

    Directory of Open Access Journals (Sweden)

    Kristiaan Lenos

    2011-01-01

    Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.

  10. The role of p53 in lung macrophages following exposure to a panel of manufactured nanomaterials

    DEFF Research Database (Denmark)

    Belade, Esther; Chrusciel, Sandra; Armand, Lucie

    2015-01-01

    is a key transcription factor implicated in cellular defence and reparative responses to various stress factors. Additionally, p53 has been implicated in cellular responses following exposure to some MNMs. Here, the role of the MNM mediated p53 induction and activation and its downstream effects following...... exposure to five well-characterised materials [namely two types of TiO2, two carbon black (CB), and one single-walled carbon nanotube (SWCNT)] were investigated. MNM internalisation, cellular viability, p53 protein induction and activation, oxidative stress, inflammation and apoptosis were measured...... in murine cell line and primary pulmonary macrophage models. It was observed that p53 was implicated in the biological responses to MNMs, with oxidative stress associated with p53 activation (only following exposure to the SWCNT). We demonstrate that p53 acted as an antioxidant and anti...

  11. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  12. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  13. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  14. Distinct HIC1-SIRT1-p53 Loop Deregulation in Lung Squamous Carcinoma and Adenocarcinoma Patients

    Directory of Open Access Journals (Sweden)

    Ruo-Chia Tseng

    2009-08-01

    Full Text Available A HIC1-SIRT1-p53 circular loop in which hypermethylation in cancer 1 (HIC1 represses the transcription of SIRT1 that deacetylates and inactivates p53 thus leading to HIC1 inactivation has been identified in cell and animal models. However, the alteration and prognostic effects of HIC1-SIRT1-p53 circular loop have never been demonstrated in human cancer patients. We examine the HIC1-SIRT1-p53 alterations in 118 lung cancer patients to define their etiological roles in tumorigenesis. We found that patients with lung squamous cell carcinoma with low p53 acetylation and SIRT1 expression mostly showed low HIC1 expression, confirming deregulation of HIC1-SIRT1-p53 circular loop in the clinical model. Interestingly, the expression of deleted in breast cancer 1 (DBC1, which blocks the interaction between SIRT1 deacetylase and p53, led to acetylated p53 in patients with lung adenocarcinoma. However, epigenetic alteration of HIC1 promoter by posttranslational modifications of histones and promoter hypermethylation favoring the compacted chromatin production attenuated the transcriptional induction by acetylated p53. Importantly, lung cancer patients with altered HIC1-SIRT1-p53 circular regulation showed poor prognosis. Our data show the first valid clinical evidence of the deregulation of HIC1-SIRT1-p53 loop in lung tumorigenesis and prognosis. Distinct status of p53 acetylation/deacetylation and HIC1 alteration mechanism result from different SIRT1-DBC1 control and epigenetic alteration in lung squamous cell carcinoma and lung adenocarcinoma.

  15. Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer

    International Nuclear Information System (INIS)

    Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van

    2013-01-01

    p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression

  16. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    OpenAIRE

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...

  17. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    OpenAIRE

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...

  18. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    Science.gov (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  19. Changes in protein expression in p53 deleted spontaneous thymic lymphomas

    DEFF Research Database (Denmark)

    Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm

    2004-01-01

    with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....

  20. The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.

    Science.gov (United States)

    Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang

    2017-05-01

    This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.

  1. Minnelide/Triptolide Impairs Mitochondrial Function by Regulating SIRT3 in P53-Dependent Manner in Non-Small Cell Lung Cancer.

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    Full Text Available Minnelide/Triptolide (TL has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC. However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS. Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2, along with diminished cellular glutathione (GSH content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC. TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y, restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.

  2. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    Science.gov (United States)

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  3. Suppression of p53 by Notch3 is mediated by Cyclin G1 and sustained by MDM2 and miR-221 axis in hepatocellular carcinoma

    Science.gov (United States)

    Baglioni, Michele; Fornari, Francesca; Giannone, Ferdinando; Ravaioli, Matteo; Cescon, Matteo; Chieco, Pasquale; Bolondi, Luigi; Gramantieri, Laura

    2014-01-01

    To successfully target Notch receptors as part of a multidrug anticancer strategy, it will be essential to fully characterize the factors that are modulated by Notch signaling. We recently reported that Notch3 silencing in HCC results in p53 up-regulation in vitro and, therefore, we focused on the mechanisms that associate Notch3 to p53 protein expression. We explored the regulation of p53 by Notch3 signalling in three HCC cell lines HepG2, SNU398 and Hep3B.We found that Notch3 regulates p53 at post-transcriptional level controlling both Cyclin G1 expression and the feed-forward circuit involving p53, miR-221 and MDM2. Moreover, our results were validated in human HCCs and in a rat model of HCC treated with Notch3 siRNAs. Our findings are becoming an exciting area for further in-depth research toward targeted inactivation of Notch3 receptor as a novel therapeutic approach for increasing the drug-sensitivity, and thereby improving the treatment outcome of patients affected by HCC. Indeed, we proved that Notch3 silencing strongly increases the effects of Nutilin-3. With regard to therapeutic implications, Notch3-specific drugs could represent a valuable strategy to limit Notch signaling in the context of hepatocellular carcinoma over-expressing this receptor. PMID:25431954

  4. Peran p53 Sebagai Jalur Kritis pada Mekanisme Kontrol Siklus Sel Sebagai Pencegah Terjadinya Kanker Mulut

    Directory of Open Access Journals (Sweden)

    Herlia Nur Istindiah

    2015-09-01

    Full Text Available In cell cycle control, p53 acts as an emergency brake, where its important checkpoint function is to maintain the genome integrity by preventing the formation and proliferation of mutant cells. P53 activity is increased by DNA damage occurs caused by agents (such as radioation, UV light or drugs or oncogenes. Mdm2 protein can inhibit the p53 activation, but oncogenes can inhibit Mdm2 or activate p53. If DNA damage occurs, then p53 prevents the cells from replicating their DNA by arresting the cell cycle, so that the cells can repair the damage. Alternatively, p53 instructs the cells to undergo apoptosis by inducing bax gene expression, so that irregular cell growth, and cancer can be avoided. Cancer, including oral cancer, oftenthuolved cells with altered p53. Exogenous factors, such as tobacco and alcohol, presumably plays a role in triggering p53 mutations. Several techniques, such as immunohistochemistry and PCR can be used to investigation their etiology and development of oral cancer. The results hopefully be applied clinically in early detection, prevention and prediction of cancer. This paper discusses the role on p53 in preventing the occurrence and proliferation of mutated cells that lead to cancer, including oral cancer.

  5. hSSB1 regulates both the stability and the transcriptional activity of p53

    OpenAIRE

    Xu, Shuangbing; Wu, Yuanzhong; Chen, Qiong; Cao, Jingying; Hu, Kaishun; Tang, Jianjun; Sang, Yi; Lai, Fenju; Wang, Li; Zhang, Ruhua; Li, Sheng-Ping; Zeng, Yi-Xin; Yin, Yuxin; Kang, Tiebang

    2012-01-01

    The tumor suppressor p53 is essential for several cellular processes that are involved in the response to diverse genotoxic stress, including cell cycle arrest, DNA repair, apoptosis and senescence. Studies of the regulation of p53 have mostly focused on its stability and transactivation; however, new regulatory molecules for p53 have also been frequently identified. Here, we report that human ssDNA binding protein SSB1 (hSSB1), a novel DNA damage-associated protein, can interact with p53 and...

  6. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    Science.gov (United States)

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  7. Gene expression patterns associated with p53 status in breast cancer

    International Nuclear Information System (INIS)

    Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

    2006-01-01

    Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

  8. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  9. P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors

    International Nuclear Information System (INIS)

    Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.

    1999-01-01

    Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy

  10. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    Directory of Open Access Journals (Sweden)

    Asita Elengoe

    2015-01-01

    Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  11. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    International Nuclear Information System (INIS)

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein

  12. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    Directory of Open Access Journals (Sweden)

    Shah Keerti V

    2005-02-01

    Full Text Available Abstract Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT, and 8 supratentorial primitive neuroectodermal tumors (sPNET using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3 was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein.

  13. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    Science.gov (United States)

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein. PMID:15717928

  14. Ensemble-based computational approach discriminates functional activity of p53 cancer and rescue mutants.

    Directory of Open Access Journals (Sweden)

    Özlem Demir

    2011-10-01

    Full Text Available The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain ("cancer mutants". Activity can be restored by second-site suppressor mutations ("rescue mutants". This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD, without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC metric was strongly correlated (r(2 = 0.77 with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i p53 cancer mutants were more flexible than wild-type protein, (ii second-site rescue mutations decreased the flexibility of cancer mutants, and (iii negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants.

  15. Correlation between p53 expression and clinical-pathological characteristics of gastric cancer

    Directory of Open Access Journals (Sweden)

    Radovanović Dragče

    2011-01-01

    Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.

  16. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    Science.gov (United States)

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  17. Therapeutic targeting of the p53 pathway in cancer stem cells

    Science.gov (United States)

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  18. Nuclear localization signal of ING4 plays a key role in its binding to p53

    International Nuclear Information System (INIS)

    Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang

    2005-01-01

    ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53

  19. Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

    International Nuclear Information System (INIS)

    Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

    2005-01-01

    The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

  20. Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression

    Directory of Open Access Journals (Sweden)

    Shang-Jui Wang

    2016-10-01

    Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.

  1. Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways

    Directory of Open Access Journals (Sweden)

    Lisa Wiesmüller

    2001-01-01

    Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.

  2. Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

    Science.gov (United States)

    Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

    2003-04-01

    Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

  3. Expression of p53, inducible nitric oxide synthase and vascular endothelial growth factor in gastric precancerous and cancerous lesions: correlation with clinical features

    International Nuclear Information System (INIS)

    Feng, Chang Wei; Wang, Li Dong; Jiao, Lian Hua; Liu, Bin; Zheng, Shu; Xie, Xin Ji

    2002-01-01

    The growth and metastasis of tumors depend on the development of an adequate blood supply via angiogenesis. Recent studies indicate that the inducible nitric oxide synthase (iNOS), vascular endothelial growth factor (VEGF) and the tumor suppressor p53 are fundamental play-markers of the angiogenic process. Overexpression of iNOS and VEGF has been shown to induce angiogenesis in tumors. P53 suppresses angiogenesis by down-regulating VEGF and iNOS. The correlation of expression of p53, VEGF and iNOS and clinical features in gastric carcinogenesis, however, has not been well characterized. The expression of p53, iNOS and VEGF in gastric precancerous and cancerous lesions and its relation with the clinical features was determined with immunohistochemistry (avidin-biotin-peroxidase complex method) on 55 randomly selected GC patients and 60 symptom-free subjects from the mass survey in the high-incidence area for GC in Henan, northern China. The positive immunostainig rates for p53, iNOS and VEGF in gastric carcinomas were 51%, 44% and 51%, respectively, and correlated well with TNM stages, but did not show significant difference among the groups with different degrees of gastric wall invasion depth by GC. A positive immunostaining reaction for the iNOS protein was significantly correlated with lymph node metastasis (p = 0.019; Spearman correlation coefficient). P53 protein accumulation was higher in the poorly-differentiated gastric carcinoma than in well-differentiated one. In gastric biopsies, no positive immunosatining was observed for p53, iNOS and VEGF in the histologically normal tissue and chronic superficial gastritis (CSG). However, p53, iNOS and VEGF positive immunostaining was observed in the tissues with different severities of lesions of chronic atrophic gastritis (CAG), intestinal metaplasia (IM) and dysplasia (DYS), and the positive rates increased with the lesion progression from CAG to IM to DYS. A high coincidental positive and negative immunostaining

  4. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  5. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  6. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  7. Arsenic promotes centrosome abnormalities and cell colony formation in p53 compromised human lung cells

    International Nuclear Information System (INIS)

    Liao Weiting; Lin Pinpin; Cheng, T.-S.; Yu, H.-S.; Chang, Louis W.

    2007-01-01

    Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus, an interaction between arsenic and cigarette smoking in lung carcinogenesis was suspected. p53 dysfunction or mutation in lung epithelial cells was frequently observed in cigarette smokers. Our present study was to explore the differential effects by arsenic on H1355 cells (human lung adenocarcinoma cell line with mutation in p53), BEAS-2B (immortalized lung epithelial cell with functional p53) and pifithrin-α-treated BEAS-2B cells (p53-inhibited cells). These cells were treated with different doses of sodium arsenite (0, 0.1, 1, 5 and 10 μM) for 48 h. A greater reduction in cell viability was observed in the BEAS-2B cells vs. p53 compromised cells (H1355 or p53-inhibited BEAS-2B). Similar observation was also made on 7-day cell survival (growth) study. TUNEL analysis confirmed that there was indeed a significantly reduced arsenite-induced apoptosis found in p53-compromised cells. Centrosomal abnormality has been attributed to eventual chromosomal missegregation, aneuploidy and tumorigenesis. In our present study, reduced p21 and Gadd45a expressions and increased centrosomal abnormality (atopic and multiple centrosomes) were observed in both arsenite-treated H1355 and p53-inhibited BEAS-2B cells as compared with similarly treated BEAS-2B cells. Increased anchorage-independent growth (colony formation) of BEAS-2B cells co-treated with pifithrin-α and 5 μM sodium arsenite was also observed in soft agar. Our present investigation demonstrated that arsenic would act specifically on p53 compromised cells (either with p53 dysfunction or inhibited) to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenic, especially under the condition of p53 dysfunction

  8. Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction

    Directory of Open Access Journals (Sweden)

    Louis Chesler

    2008-11-01

    Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.

  9. Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

    Directory of Open Access Journals (Sweden)

    Lu Xin

    2009-06-01

    Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

  10. Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Clarke Alan R

    2002-11-01

    Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.

  11. Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

    DEFF Research Database (Denmark)

    Savelyeva, I.; Dobbelstein, M.

    2011-01-01

    to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

  12. AS1411-Induced Growth Inhibition of Glioma Cells by Up-Regulation of p53 and Down-Regulation of Bcl-2 and Akt1 via Nucleolin.

    Directory of Open Access Journals (Sweden)

    Ye Cheng

    Full Text Available AS1411 binds nucleolin (NCL and is the first oligodeoxynucleotide aptamer to reach phase I and II clinical trials for the treatment of several cancers. However, the mechanisms by which AS1411 targets and kills glioma cells and tissues remain unclear. Here we report that AS1411 induces cell apoptosis and cycle arrest, and inhibits cell viability by up-regulation of p53 and down-regulation of Bcl-2 and Akt1 in human glioma cells. NCL was overexpressed in both nucleus and cytoplasm in human glioma U87, U251 and SHG44 cells compared to normal human astrocytes (NHA. AS1411 bound NCL and inhibited the proliferation of glioma cells but not NHA, which was accompanied with up-regulation of p53 and down-regulation of Bcl-2 and Akt1. Moreover, AS1411 treatment resulted in the G2/M cell cycle arrest in glioma cells, which was however abolished by overexpression of NCL. Further, AS1411 induced cell apoptosis, which was prevented by silencing of p53 and overexpression of Bcl-2. In addition, AS1411 inhibited the migration and invasion of glioma cells in an Akt1-dependent manner. Importantly, AS1411 inhibited the growth of glioma xenograft and prolonged the survival time of glioma tumor-bearing mice. These results revealed a promising treatment of glioma by oligodeoxynucleotide aptamer.

  13. Isolation and identification of the human homolog of a new p53-binding protein, Mdmx

    NARCIS (Netherlands)

    Shvarts, A.; Bazuine, M.; Dekker, P.; Ramos, Y. F.; Steegenga, W. T.; Merckx, G.; van Ham, R. C.; van der Houven van Oordt, W.; van der Eb, A. J.; Jochemsen, A. G.

    1997-01-01

    We recently reported the identification of a mouse cDNA encoding a new p53-associating protein that we called Mdmx because of its structural similarity to Mdm2, a well-known p53-binding protein. Here we report the isolation of a cDNA encoding the human homolog of Mdmx. The ORF of the cDNA encodes a

  14. Synergistic anti-tumor effects of nitroreductase mutants and p53

    Directory of Open Access Journals (Sweden)

    Mahboobeh Razmkhah

    2014-01-01

    Conclusion: Combination of T41L/F70A NTR with p53 may have more advantages for treatment of different types of cancers compared to the other NTRs and p53 alone. The present study results may open new windows for getting desired outcome in gene therapy of different types of cancer.

  15. Stress-specific response of the p53-Mdm2 feedback loop

    Directory of Open Access Journals (Sweden)

    Jensen Mogens H

    2010-07-01

    Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.

  16. p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication

    Directory of Open Access Journals (Sweden)

    Constance Qiao Xin Yeo

    2016-04-01

    Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.

  17. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    Science.gov (United States)

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  18. Synergistic induction of profibrotic PAI-1 by TGF-β and radiation depends on p53

    International Nuclear Information System (INIS)

    Niemantsverdriet, Maarten; Jong, Edwin de; Langendijk, Johannes A.; Kampinga, Harm H.; Coppes, Robert P.

    2010-01-01

    Radiation-induced fibrosis is a severe side effect of radiotherapy. TGF-β and radiation synergistically induce expression of the profibrotic PAI-1 gene and this cooperation potentially involves p53. Here, we demonstrate that p53 is both indispensable and sufficient for the radiation effect inducing synergistic activation of PAI-1 by radiation and TGF-β.

  19. Differential programming of p53-deficient embryonic cells during rotenone block

    Science.gov (United States)

    Mitochondrial dysfunction has been implicated in chemical toxicities. The present study used an in vitro model to investigate the differential expression of metabolic pathways during cellular stress in p53- efficient embryonic fibroblasts compared to p53-deficient cells. These c...

  20. p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research

    Science.gov (United States)

    When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53.  This protein can activate or shut down gene activity in response to DNA damage.  But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.   

  1. Recent progress of the study of p53 control mechanism by ionizing radiation

    International Nuclear Information System (INIS)

    Kawai, Hidehiko

    2004-01-01

    Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)

  2. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production.

    Directory of Open Access Journals (Sweden)

    Dana Austin

    Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.

  3. The role of p53 and pRB in apoptosis and cancer

    DEFF Research Database (Denmark)

    Hickman, Emma S; Moroni, M Cristina; Helin, Kristian

    2002-01-01

    Loss of function of both the p53 pathway and the retinoblastoma protein (pRB) pathway plays a significant role in the development of most human cancers. Loss of pRB results in deregulated cell proliferation and apoptosis, whereas loss of p53 desensitizes cells to checkpoint signals, including...

  4. Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans.

    NARCIS (Netherlands)

    Bokhoven, J.H.L.M. van; McKeon, F.

    2002-01-01

    p63 is the most recently discovered but most ancient member of the p53 family. In marked contrast to p53, p63 is highly expressed in embryonic ectoderm and in the basal, regenerative layers of many epithelial tissues in the adult. The p63-knockout mouse dies at birth and lacks limbs, epidermis,

  5. The tumor suppressors pRB and p53 as regulators of adipocyte differentiation and function

    DEFF Research Database (Denmark)

    Hallenborg, Philip; Feddersen, Søren; Madsen, Lise

    2009-01-01

    BACKGROUND: The retinoblastoma protein (pRB) and p53 are crucial members of regulatory networks controlling the cell cycle and apoptosis, and a hallmark of virtually all cancers is dysregulation of expression or function of pRB or p53. Although they are best known for their role in cancer...

  6. Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines

    DEFF Research Database (Denmark)

    Liu, Ying; Bodmer, Walter F

    2006-01-01

    A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...

  7. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    Science.gov (United States)

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  8. Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

    Science.gov (United States)

    Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

    2009-06-19

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

  9. Human herpesvirus 6B inhibits cell proliferation by a p53-independent pathway

    DEFF Research Database (Denmark)

    Øster, Bodil; Kaspersen, M.D.; Kofod-Olsen, Emil

    2006-01-01

    BACKGROUND: Various forms of cellular stress can activate the tumour suppressor protein p53, an important regulator of cell cycle arrest, apoptosis, and cellular senescence. Cells infected by human herpesvirus 6B (HHV-6B) accumulate aberrant amounts of p53. OBJECTIVES: The aim of this study...

  10. Antigen-specific immunotherapy in ovarian cancer and p53 as tumor antigen

    NARCIS (Netherlands)

    Vermeij, Renee; Leffers, Ninke; Melief, Cornelis J.; Daemen, Toos; Nijman, Hans W.

    This review discusses the results of different immunization strategies, identifies possible drawbacks in study design and provides potential solutions for augmentation of clinical efficacy. A potential target for cancer immunotherapy is p53, as approximately 50% of ovarian cancer cells carry p53

  11. Rb and p53 Liver Functions Are Essential for Xenobiotic Metabolism and Tumor Suppression

    NARCIS (Netherlands)

    Nantasanti, Sathidpak; Toussaint, Mathilda J. M.; Youssef, Sameh A.; Tooten, Peter C. J.; de Bruin, Alain

    2016-01-01

    The tumor suppressors Retinoblastoma (Rb) and p53 are frequently inactivated in liver diseases, such as hepatocellular carcinomas (HCC) or infections with Hepatitis B or C viruses. Here, we discovered a novel role for Rb and p53 in xenobiotic metabolism, which represent a key function of the liver

  12. Analysis of a p53 Mutation Associated with Cancer Susceptibility for Biochemistry and Genetic Laboratory Courses

    Science.gov (United States)

    Soto-Cruz, Isabel; Legorreta-Herrera, Martha

    2009-01-01

    We have devised and implemented a module for an upper division undergraduate laboratory based on the amplification and analysis of a p53 polymorphism associated with cancer susceptibility. First, students collected a drop of peripheral blood cells using a sterile sting and then used FTA cards to extract the genomic DNA. The p53 region is then PCR…

  13. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    International Nuclear Information System (INIS)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd; Groesch, Sabine

    2008-01-01

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53 wt ) or being p(HCT-116 p53 -/- ), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53 -/- xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53 wt cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53 wt cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75 NTR , p53 and Bax

    <