Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N
2007-12-01
Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.
Guidelines for the diagnosis and management of cystathionine beta-synthase deficiency
Morris, A.A.; Kozich, V.; Santra, S.; Andria, G.; Ben-Omran, T.I.; Chakrapani, A.B.; Crushell, E.; Henderson, M.J.; Hochuli, M.; Huemer, M.; Janssen, M.C.H.; Maillot, F.; Mayne, P.D.; McNulty, J.; Morrison, T.M.; Ogier, H.; O'Sullivan, S.; Pavlikova, M.; Almeida, I.T. de; Terry, A.; Yap, S.; Blom, H.J.; Chapman, K.A.
2017-01-01
Cystathionine beta-synthase (CBS) deficiency is a rare inherited disorder in the methionine catabolic pathway, in which the impaired synthesis of cystathionine leads to accumulation of homocysteine. Patients can present to many different specialists and diagnosis is often delayed. Severely affected
Energy Technology Data Exchange (ETDEWEB)
Koutmos, Markos; Kabil, Omer; Smith, Janet L.; Banerjee, Ruma (Michigan-Med)
2011-08-17
The catalytic potential for H{sub 2}S biogenesis and homocysteine clearance converge at the active site of cystathionine {beta}-synthase (CBS), a pyridoxal phosphate-dependent enzyme. CBS catalyzes {beta}-replacement reactions of either serine or cysteine by homocysteine to give cystathionine and water or H{sub 2}S, respectively. In this study, high-resolution structures of the full-length enzyme from Drosophila in which a carbanion (1.70 {angstrom}) and an aminoacrylate intermediate (1.55 {angstrom}) have been captured are reported. Electrostatic stabilization of the zwitterionic carbanion intermediate is afforded by the close positioning of an active site lysine residue that is initially used for Schiff base formation in the internal aldimine and later as a general base. Additional stabilizing interactions between active site residues and the catalytic intermediates are observed. Furthermore, the structure of the regulatory 'energy-sensing' CBS domains, named after this protein, suggests a mechanism for allosteric activation by S-adenosylmethionine.
Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major
Homocystinuria due to cystathionine beta synthase deficiency
Directory of Open Access Journals (Sweden)
Rao T
2008-01-01
Full Text Available A two year-old male child presented with cutis marmorata congenita universalis, brittle hair, mild mental retardation, and finger spasms. Biochemical findings include increased levels of homocysteine in the blood-106.62 µmol/L (normal levels: 5.90-16µmol/L. Biochemical tests such as the silver nitroprusside and nitroprusside tests were positive suggesting homocystinuria. The patient was treated with oral pyridoxine therapy for three months. The child responded well to this therapy and the muscle spasms as well as skin manifestations such as cutis marmorata subsided. The treatment is being continued; the case is reported here because of its rarity. Homocysteinuria arising due to cystathionine beta-synthase (CBS deficiency is an autosomal recessive disorder of methionine metabolism that produces increased levels of urinary homocysteine and methionine It manifests itself in vascular, central nervous system, cutaneous, and connective tissue disturbances and phenotypically resembles Marfan′s syndrome. Skin manifestations include malar flush, thin hair, and cutis reticulata / marmorata.
Engineering of Ion Sensing by the Cystathionine beta-Synthase Module of the ABC Transporter OpuA
Mahmood, Nik A. B. N.; Biemans-Oldehinkel, Esther; Poolman, Bert
2009-01-01
We have previously shown that the C-terminal cystathionine beta-synthase (CBS) domains of the nucleotide-binding domains of the ABC transporter OpuA, in conjunction with an anionic membrane surface function, act as sensor of internal ionic strength (I(in)). Here, we show that a surface-exposed
Mice lacking cystathionine beta synthase have lung fibrosis and air space enlargement.
Hamelet, Julien; Maurin, Nicole; Fulchiron, Romain; Delabar, Jean-Maurice; Janel, Nathalie
2007-10-01
Cystathionine beta synthase (CBS) is a crucial regulator of plasma concentrations of homocysteine. Severe hyperhomocysteinemia due to CBS deficiency confers diverse clinical manifestations, notably pulmonary thrombotic disease. However, the association between hyperhomocysteinemia and chronic obstructive pulmonary disease is not well understood. To investigate the role of hyperhomocysteinemia in lung injury and pulmonary fibrosis, we analyzed the lung of CBS-deficient mice, a murine model of severe hyperhomocysteinemia. The degree of lung injury was assessed by histologic examination. Analysis of profibrogenic factors was performed by real-time quantitative reverse transcription-polymerase chain reaction. CBS-deficient mice develop fibrosis and air space enlargement in the lung, concomitant with an enhanced expression of heme oxygenase-1, pro(alpha)1 collagen type I, transforming growth factor-beta1 and alpha-smooth muscle actin. However, lung fibrosis was found in the absence of increased inflammatory cell infiltrates as determined by histology, without changes in gene expression of proinflammatory cytokines TNFalpha and interleukin 6. The increased expression of alpha-smooth muscle actin and transforming growth factor-beta1 emphasizes the role of myofibroblasts differentiation in case of lung fibrosis due to CBS deficiency in mice.
Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
van der Crabben, S. N.; Wijburg, F. A.; Ackermans, M. T.; Sauerwein, H. P.
2008-01-01
Cystathionine β-synthase (CBS)-deficient patients develop premature arteriosclerosis and thrombosis leading to a high risk of a vascular event before the age of 30 years. In CBS deficiency the transsulfuration pathway is impaired, leading to markedly elevated levels of homocysteine and methionine,
Matoba, Yasuyuki; Yoshida, Tomoki; Izuhara-Kihara, Hisae; Noda, Masafumi; Sugiyama, Masanori
2017-04-01
Cystathionine β-synthase (CBS) catalyzes the formation of l-cystathionine from l-serine and l-homocysteine. The resulting l-cystathionine is decomposed into l-cysteine, ammonia, and α-ketobutylic acid by cystathionine γ-lyase (CGL). This reverse transsulfuration pathway, which is catalyzed by both enzymes, mainly occurs in eukaryotic cells. The eukaryotic CBS and CGL have recently been recognized as major physiological enzymes for the generation of hydrogen sulfide (H 2 S). In some bacteria, including the plant-derived lactic acid bacterium Lactobacillus plantarum, the CBS- and CGL-encoding genes form a cluster in their genomes. Inactivation of these enzymes has been reported to suppress H 2 S production in bacteria; interestingly, it has been shown that H 2 S suppression increases their susceptibility to various antibiotics. In the present study, we characterized the enzymatic properties of the L. plantarum CBS, whose amino acid sequence displays a similarity with those of O-acetyl-l-serine sulfhydrylase (OASS) that catalyzes the generation of l-cysteine from O-acetyl-l-serine (l-OAS) and H 2 S. The L. plantarum CBS shows l-OAS- and l-cysteine-dependent CBS activities together with OASS activity. Especially, it catalyzes the formation of H 2 S in the presence of l-cysteine and l-homocysteine, together with the formation of l-cystathionine. The high affinity toward l-cysteine as a first substrate and tendency to use l-homocysteine as a second substrate might be associated with its enzymatic ability to generate H 2 S. Crystallographic and mutational analyses of CBS indicate that the Ala70 and Glu223 residues at the substrate binding pocket are important for the H 2 S-generating activity. © 2017 The Protein Society.
Yin, Wei-Lan; Yin, Wei-Guo; Huang, Bai-Sheng; Wu, Li-Xiang
2017-09-14
Parkinson's disease (PD) is age-related neurodegenerative disorder by a progressive loss of dopaminergic(DA) neurons in the substantia nigra (SN) and striatum, which is at least partly associated with α-synuclein protein accumulation in these neurons. Hydrogen sulfide (H 2 S) plays an important role in the nervous system. Studies have shown that H 2 S has a protective effect on PD. However, as a kind of gas molecules, H 2 S is lively, volatile, and not conducive to scientific research and clinical application. Cystathionine-beta-synthase(CBS) is the main enzymes of synthesis of H 2 S in the brain. In order to examine the neuroprotective effects of CBS on PD, we detected the effects of CBS overexpression on 6-Hydroxydopamine (6-OHDA)-lesioned PD rats using lentivirus-mediated gene transfection techniques. In the injured SN of 6-OHDA-induced PD rats, the CBS expression and the endogenous H 2 S level markedly decreased, while administration of lentivirus-mediated CBS overexpression increased the CBS expression and the endogenous H 2 S production.CBS overexpression dramatically reversed apomorphine-induced rotation of the 6-OHDA model rats, decreased the number of TUNEL-positive neurons and the loss of the nigral DA neurons,specifically inhibited 6-OHDA-induced oxidase stress injury, and down-regulated the expression of α-synuclein(α-SYN) in the injured SN. NaHS (an H 2 S donor) had similar effects to CBS overexpression, while Amino-oxyacetate(AOAA, a CBS inhibitor) had opposite effects on PD rats. In summary, we demonstrated that CBS overexpression was able to provide neuroprotective on PD rats and improving the expression of CBS may be a potential therapeutic method for PD. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Oyenarte, Iker; Majtan, Tomas; Ereño, June; Corral-Rodríguez, María Angeles; Kraus, Jan P.; Martínez-Cruz, Luis Alfonso
2012-01-01
This article describes the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length cystathionine β-synthase from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525. Human cystathionine β-synthase (CBS) is a pyridoxal-5′-phosphate-dependent hemeprotein, whose catalytic activity is regulated by S-adenosylmethionine. CBS catalyzes the β-replacement reaction of homocysteine (Hcy) with serine to yield cystathionine. CBS is a key regulator of plasma levels of the thrombogenic Hcy and deficiency in CBS is the single most common cause of homocystinuria, an inherited metabolic disorder of sulfur amino acids. The properties of CBS enzymes, such as domain organization, oligomerization degree or regulatory mechanisms, are not conserved across the eukaryotes. The current body of knowledge is insufficient to understand these differences and their impact on CBS function and physiology. To overcome this deficiency, we have addressed the crystallization and preliminary crystallographic analysis of a protein construct (hCBS 516–525 ) that contains the full-length CBS from Homo sapiens (hCBS) and just lacks amino-acid residues 516–525, which are located in a disordered loop. The human enzyme yielded crystals belonging to space group I222, with unit-cell parameters a = 124.98, b = 136.33, c = 169.83 Å and diffracting X-rays to a resolution of 3.0 Å. The crystal structure appears to contain two molecules in the asymmetric unit which presumably correspond to a dimeric form of the enzyme
Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.
Directory of Open Access Journals (Sweden)
Vinciane Régnier
Full Text Available The cystathionine β-synthase (CBS gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA metabolism, a pathway important for several brain physiological processes.Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1 expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line.We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.
Brain phenotype of transgenic mice overexpressing cystathionine β-synthase.
Régnier, Vinciane; Billard, Jean-Marie; Gupta, Sapna; Potier, Brigitte; Woerner, Stéphanie; Paly, Evelyne; Ledru, Aurélie; David, Sabrina; Luilier, Sabrina; Bizot, Jean-Charles; Vacano, Guido; Kraus, Jan P; Patterson, David; Kruger, Warren D; Delabar, Jean M; London, Jaqueline
2012-01-01
The cystathionine β-synthase (CBS) gene, located on human chromosome 21q22.3, is a good candidate for playing a role in the Down Syndrome (DS) cognitive profile: it is overexpressed in the brain of individuals with DS, and it encodes a key enzyme of sulfur-containing amino acid (SAA) metabolism, a pathway important for several brain physiological processes. Here, we have studied the neural consequences of CBS overexpression in a transgenic mouse line (60.4P102D1) expressing the human CBS gene under the control of its endogenous regulatory regions. These mice displayed a ∼2-fold increase in total CBS proteins in different brain areas and a ∼1.3-fold increase in CBS activity in the cerebellum and the hippocampus. No major disturbance of SAA metabolism was observed, and the transgenic mice showed normal behavior in the rotarod and passive avoidance tests. However, we found that hippocampal synaptic plasticity is facilitated in the 60.4P102D1 line. We demonstrate that CBS overexpression has functional consequences on hippocampal neuronal networks. These results shed new light on the function of the CBS gene, and raise the interesting possibility that CBS overexpression might have an advantageous effect on some cognitive functions in DS.
Sheibani, Lili; Lechuga, Thomas J; Zhang, Honghai; Hameed, Afshan; Wing, Deborah A; Kumar, Sathish; Rosenfeld, Charles R; Chen, Dong-Bao
2017-03-01
Endogenous hydrogen sulfide (H2S) synthesized via metabolizing L-cysteine by cystathionine-beta-synthase (CBS) and cystathionine-gamma-lyase (CSE) is a potent vasodilator and angiogenic factor. The objectives of this study were to determine if human uterine artery (UA) H2S production increases with augmented expression and/or activity of CBS and/or CSE during the menstrual cycle and pregnancy and whether exogenous H2S dilates UA. Uterine arteries from nonpregnant (NP) premenopausal proliferative (pPRM) and secretory (sPRM) phases of the menstrual cycle and pregnant (P) women were studied. H2S production was measured by the methylene blue assay. CBS and CSE mRNAs were assessed by quantitative real-time PCR, and proteins were assessed by immunoblotting and semiquantitative immunofluorescence microscopy. Effects of H2S on rat UA relaxation were determined by wire myography ex vivo. H2S production was greater in NP pPRM and P than NP sPRM UAs and inhibited by the specific CBS but not CSE inhibitor. CBS but not CSE mRNA and protein were greater in NP pPRM and P than NP sPRM UAs. CBS protein was localized to endothelium and smooth muscle and its levels were in a quantitative order of P >NP UAs of pPRM>sPRM. CSE protein was localized in UA endothelium and smooth muscle with no difference among groups. A H2S donor relaxed P > NP UAs but not mesentery artery. Thus, human UA H2S production is augmented with endothelium and smooth muscle CBS upregulation, contributing to UA vasodilation in the estrogen-dominant physiological states in the proliferative phase of the menstrual cycle and pregnancy. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
LENUS (Irish Health Repository)
Krijt, Jakub
2011-02-01
Cystathionine β-synthase (CBS) deficiency is usually confirmed by assaying the enzyme activity in cultured skin fibroblasts. We investigated whether CBS is present in human plasma and whether determination of its activity in plasma could be used for diagnostic purposes. We developed an assay to measure CBS activity in 20 μL of plasma using a stable isotope substrate - 2,3,3-(2)H serine. The activity was determined by measurement of the product of enzyme reaction, 3,3-(2)H-cystathionine, using LC-MS\\/MS. The median enzyme activity in control plasma samples was 404 nmol\\/h\\/L (range 66-1,066; n = 57). In pyridoxine nonresponsive CBS deficient patients, the median plasma activity was 0 nmol\\/ho\\/L (range 0-9; n = 26), while in pyridoxine responsive patients the median activity was 16 nmol\\/hour\\/L (range 0-358; n = 28); this overlapped with the enzyme activity from control subject. The presence of CBS in human plasma was confirmed by an in silico search of the proteome database, and was further evidenced by the activation of CBS by S-adenosyl-L-methionine and pyridoxal 5\\'-phosphate, and by configuration of the detected reaction product, 3,3-(2)H-cystathionine, which was in agreement with the previously observed CBS reaction mechanism. We hypothesize that the CBS enzyme in plasma originates from liver cells, as the plasma CBS activities in patients with elevated liver aminotransferase activities were more than 30-fold increased. In this study, we have demonstrated that CBS is present in human plasma and that its catalytic activity is detectable by LC-MS\\/MS. CBS assay in human plasma brings new possibilities in the diagnosis of pyridoxine nonresponsive CBS deficiency.
Novel cystathionine β-synthase gene mutations in a Filipino patient with classic homocystinuria.
Silao, Catherine Lynn T; Fabella, Terence Diane F; Rama, Kahlil Izza D; Estrada, Sylvia C
2015-10-01
Classic homocystinuria due to cystathionine β-synthase (CBS) deficiency is an autosomal recessive disorder of sulfur metabolism. Clinical manifestations include mental retardation, dislocation of the optic lens (ectopia lentis), skeletal abnormalities and a tendency to thromboembolic episodes. We present the first mutational analysis of CBS in a Filipino patient with classic homocystinuria. Genomic DNA was extracted from peripheral blood collected from a diagnosed Filipino patient with classic homocystinuria. The entire coding region of CBS (17 exons) was amplified using polymerase chain reaction and bidirectionally sequenced using standard protocols. The patient was found to be compound heterozygous for two novel mutations, g.13995G>A [c.982G>A; p.D328K] and g.15860-15868dupGCAGGAGCT [c.1083-1091dupGCAGGAGCT; p. Q362-L364dupQEL]. Four known single-nucleotide polymorphisms (rs234706, rs1801181, rs706208 and rs706209) were also detected in the present patient's CBS. The patient was heterozygous for all the identified alleles. This is the first mutational analysis of CBS done in a Filipino patient with classic homocystinuria who presented with a novel duplication mutation and a novel missense mutation. Homocystinuria due to CBS deficiency is a heterogeneous disorder at the molecular level. © 2015 Japan Pediatric Society.
Lievers, K.J.; Kluijtmans, L.A.J.; Blom, H.J.; Wilson, P.W.; Selhub, J.; Ordovas, J.M.
2006-01-01
Elevated total plasma homocysteine concentrations (tHcy), both fasting and post-methionine load, have been established as risk factors for vascular disease. Recently, we described the association of a 31 bp variable number of tandem repeats (VNTR) in the cystathionine beta-synthase (CBS) gene with
Energy Technology Data Exchange (ETDEWEB)
Lee, Eunyoung [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of); Kim, Hyoung-June [Basic Research and Innovation Division, AmorePacific Corporation R& D Center, Yongin, Gyeounggi-do 17074 (Korea, Republic of); Lee, Moonyoung [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Jin, Sun Hee; Hong, Soo Hyun; Ahn, Seyeon; Kim, Sae On [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of); Shin, Dong Wook [Basic Research and Innovation Division, AmorePacific Corporation R& D Center, Yongin, Gyeounggi-do 17074 (Korea, Republic of); Lee, Seung-Taek [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 03722 (Korea, Republic of); Noh, Minsoo, E-mail: minsoonoh@snu.ac.kr [College of Pharmacy, Seoul National University, Seoul 08826 (Korea, Republic of); Natural Products Research Institute, Seoul National University, Seoul 08826 (Korea, Republic of)
2016-11-01
Low-level formaldehyde exposure is inevitable in industrialized countries. Although daily-life formaldehyde exposure level is practically impossible to induce cell death, most of mechanistic studies related to formaldehyde toxicity have been performed in cytotoxic concentrations enough to trigger cell death mechanism. Currently, toxicological mechanisms underlying the sub-cytotoxic exposure to formaldehyde are not clearly elucidated in skin cells. In this study, the genome-scale transcriptional analysis in normal human keratinocytes (NHKs) was performed to investigate cutaneous biological pathways associated with daily life formaldehyde exposure. We selected the 175 upregulated differentially expressed genes (DEGs) and 116 downregulated DEGs in NHKs treated with 200 μM formaldehyde. In the Gene Ontology (GO) enrichment analysis of the 175 upregulated DEGs, the endoplasmic reticulum (ER) unfolded protein response (UPR) was identified as the most significant GO biological process in the formaldeyde-treated NHKs. Interestingly, the sub-cytotoxic formaldehyde affected NHKs to upregulate two enzymes important in the cellular transsulfuration pathway, cystathionine γ-lyase (CTH) and cystathionine-β-synthase (CBS). In the temporal expression analysis, the upregulation of the pro-inflammatory DEGs such as MMP1 and PTGS2 was detected earlier than that of CTH, CBS and other ER UPR genes. The metabolites of CTH and CBS, L-cystathionine and L-cysteine, attenuated the formaldehyde-induced upregulation of pro-inflammatory DEGs, MMP1, PTGS2, and CXCL8, suggesting that CTH and CBS play a role in the negative feedback regulation of formaldehyde-induced pro-inflammatory responses in NHKs. In this regard, the sub-cytotoxic formaldehyde-induced CBS and CTH may regulate inflammation fate decision to resolution by suppressing the early pro-inflammatory response. - Highlights: • Sub-cytotoxic formaldehyde upregulates ER UPR-associated genes in NHKs. • Formaldehyde-induced ER UPR
Reish, O; Townsend, D; Berry, S A; Tsai, M Y; King, R A
1995-01-01
Deficiency of cystathionine beta-synthase (CBS) is a genetic disorder of transsulfuration resulting in elevated plasma homocyst(e)ine and methionine and decreased cysteine. Affected patients have multisystem involvement, which may include light skin and hair. Reversible hypopigmentation in treated homocystinuric patients has been infrequently reported, and the mechanism is undefined. Two CBS-deficient homocystinuric patients manifested darkening of their hypopigmented hair following treatment that decreased plasma homocyst(e)ine. We hypothesized that homocyst(e)ine inhibits tyrosinase, the major pigment enzyme. The activity of tyrosinase extracted from pigmented human melanoma cells (MNT-1) that were grown in the presence of homocysteine was reduced in comparison to that extracted from cells grown without homocysteine. Copper sulfate restored homocyst(e)ine-inhibited tyrosinase activity when added to the culture cell media at a proportion of 1.25 mol of copper sulfate per 1 mol of DL-homocysteine. Holo-tyrosinase activity was inhibited by adding DL-homocysteine to the assay reaction mixture, and the addition of copper sulfate to the reaction mixture prevented this inhibition. Other tested compounds, L-cystine and betaine did not affect tyrosinase activity. Our data suggest that reversible hypopigmentation in homocystinuria is the result of tyrosinase inhibition by homocyst(e)ine and that the probable mechanism of this inhibition is the interaction of homocyst(e)ine with copper at the active site of tyrosinase. Images Figure 1 PMID:7611281
Nitrite reductase activity and inhibition of H₂S biogenesis by human cystathionine ß-synthase.
Directory of Open Access Journals (Sweden)
Carmen Gherasim
Full Text Available Nitrite was recognized as a potent vasodilator >130 years and has more recently emerged as an endogenous signaling molecule and modulator of gene expression. Understanding the molecular mechanisms that regulate nitrite metabolism is essential for its use as a potential diagnostic marker as well as therapeutic agent for cardiovascular diseases. In this study, we have identified human cystathionine ß-synthase (CBS as a new player in nitrite reduction with implications for the nitrite-dependent control of H₂S production. This novel activity of CBS exploits the catalytic property of its unusual heme cofactor to reduce nitrite and generate NO. Evidence for the possible physiological relevance of this reaction is provided by the formation of ferrous-nitrosyl (Fe(II-NO CBS in the presence of NADPH, the human diflavin methionine synthase reductase (MSR and nitrite. Formation of Fe(II-NO CBS via its nitrite reductase activity inhibits CBS, providing an avenue for regulating biogenesis of H₂S and cysteine, the limiting reagent for synthesis of glutathione, a major antioxidant. Our results also suggest a possible role for CBS in intracellular NO biogenesis particularly under hypoxic conditions. The participation of a regulatory heme cofactor in CBS in nitrite reduction is unexpected and expands the repertoire of proteins that can liberate NO from the intracellular nitrite pool. Our results reveal a potential molecular mechanism for cross-talk between nitrite, NO and H₂S biology.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
Directory of Open Access Journals (Sweden)
Mukhopadhyay Jotideb
2005-12-01
Full Text Available Abstract Background Cystathionine β-synthase (CBS mediates conversion of homocysteine to cystathionine and deficiency in enzyme activity may lead to hyperhomocysteinemia/homocystinuria, which are often associated with mental retardation (MR. A large number of polymorphisms have been reported in the CBS gene, some of which impair its activity and among these, a T833C polymorphism in cis with a 68 bp insertion at 844 in the exon 8 is found to be associated with mild hyperhomocysteinemia in different ethnic groups. Methods The present study is aimed at investigating the association between T833C/844ins68 polymorphism and MR. One hundred and ninety MR cases were recruited after psychometric evaluation. Hundred and thirty-eight control subjects, two hundred and sixty-seven parents of MR probands and thirty cardiovascular disorder (CVD patients were included for comparison. Peripheral blood was collected after obtaining informed written consent. The T833C/844ins68 polymorphism was investigated by PCR amplification of genomic DNA and restriction fragment length polymorphism analysis, followed by statistical analysis. Results The genotypic distribution of the polymorphism was within the Hardy-Weinberg equilibrium. A slightly increased genotypic frequency was observed in the Indian control population as compared to other Asian populations. Both haplotype-based haplotype relative risk analysis and transmission disequilibrium test reveled lack of association of the T833C/844ins68 polymorphism with MR; nevertheless, the relative risk calculated was higher (>1 and in a limited number of informative MR families, preferential transmission of the double mutant from heterozygous mothers to the MR probands was noticed (χ2 = 4.00, P Conclusion This is the first molecular genetic study of CBS gene dealing with T833C/844ins68 double mutation in MR subjects. Our preliminary data indicate lack of association between T833C/844ins68 polymorphism with MR. However
Yamane, Satoshi; Kanno, Toshio; Nakamura, Hiroyuki; Fujino, Hiromichi; Murayama, Toshihiko
2014-10-05
Hydrogen sulfide (H2S) is considered to be a signaling molecule. The precise mechanisms underlying H2S-related events, including the producing enzymes and target molecules in gastrointestinal tissues, have not been elucidated in detail. We herein examined the involvement of H2S in contractions induced by repeated electrical stimulations (ES). ES-induced contractions were neurotoxin-sensitive and increased by aminooxyacetic acid, an inhibitor of cystathionine β-synthase (CBS) and cystathionine γ-lyase, but not by D,L-propargylglycine, a selective inhibitor of cystathionine γ-lyase, in an ES trial-dependent manner. ES-induced contractions were markedly decreased in the presence of L-cysteine. This response was inhibited by aminooxyacetic acid and an antioxidant, and accelerated by L-methionine, an activator of CBS. The existence of CBS was confirmed. NaHS transiently inhibited ES- and acetylcholine-induced contractions, and sustainably decreased basal tone for at least 20 min after its addition. The treatment with glibenclamide, an ATP-sensitive K+ channel blocker, reduced both the L-cysteine response and NaHS-induced inhibition of contractions. The NaHS-induced decrease in basal tone was inhibited by apamin, a small conductance Ca2+-activated K+ channel blocker. These results suggest that H2S may be endogenously produced via CBS in ES-activated enteric neurons, and regulates contractility via multiple K+ channels in the ileum. Copyright © 2014 Elsevier B.V. All rights reserved.
Song, Shikui; Hou, Wensheng; Godo, Itamar; Wu, Cunxiang; Yu, Yang; Matityahu, Ifat; Hacham, Yael; Sun, Shi; Han, Tianfu; Amir, Rachel
2013-04-01
Soybean seeds provide an excellent source of protein for human and livestock nutrition. However, their nutritional quality is hampered by a low concentration of the essential sulfur amino acid, methionine (Met). In order to study factors that regulate Met synthesis in soybean seeds, this study used the Met-insensitive form of Arabidopsis cystathionine γ-synthase (AtD-CGS), which is the first committed enzyme of Met biosynthesis. This gene was expressed under the control of a seed-specific promoter, legumin B4, and used to transform the soybean cultivar Zigongdongdou (ZD). In three transgenic lines that exhibited the highest expression level of AtD-CGS, the level of soluble Met increased significantly in developing green seeds (3.8-7-fold). These seeds also showed high levels of other amino acids. This phenomenon was more prominent in two transgenic lines, ZD24 and ZD91. The total Met content, which including Met incorporated into proteins, significantly increased in the mature dry seeds of these two transgenic lines by 1.8- and 2.3-fold, respectively. This elevation was accompanied by a higher content of other protein-incorporated amino acids, which led to significantly higher total protein content in the seeds of these two lines. However, in a third transgenic line, ZD01, the level of total Met and the level of other amino acids did not increase significantly in the mature dry seeds. This line also showed no significant change in protein levels. This suggests a positive connection between high Met content and the synthesis of other amino acids that enable the synthesis of more seed proteins.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Energy Technology Data Exchange (ETDEWEB)
Omura, Hironori; Yoshida, Toyokazu; Nagasawa, Toru [Gifu Univ. (Japan). Dept. of Biomolecular Science; Kuroda, Masako [Ikeda Food Research Co., Ltd., Fukuyama, Hiroshima (Japan); Kobayashi, Michihiko; Shimizu, Sakayu [Kyoto Univ. (Japan). Agricultural Sciences
2003-10-01
A thermophilic and cyanide ion-tolerant bacterium, Bacillus stearothermophilus CN3 isolated from a hot spring in Japan, was found to produce thermostable {beta}-cyano-L-alanine synthase. The enzyme catalyzes the synthesis of {beta}-cyano-L-alanine from O-acetyl-L-serine and cyanide ions. The purified enzyme has a molecular mass of approximately 70 kDa and consists of two identical sub-units. It was stable in the pH range of 6.0 to 10.0 and up to 70degC. The enzyme also catalyzes the synthesis of various {beta}-substituted-L-alanine derivatives from O-acetyl-L-serine and nucleophilic reagents. The gene encoding the {beta}-cyano-L-alanine synthase was isolated from B. stearothermophilus CN3. Sequence homology analysis revealed that the {beta}-cyano-L-alanine synthase of the bacterium is O-acetyl-L-serine sulfhydrylase. A recombinant plasmid, constructed by ligation of the cloned gene and an expression vector, pKK223-3, was introduced into E. coli JM109. The transformed E. coli cells overexpressed {beta}-cyano-L-alanine synthase. Heat stable {beta}-cyano-L-alanine synthase can be applied to the synthesis of [4-{sup 11}C]L-2,4-diaminobutyric acid as a tracer for positron emission tomography. (author)
Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin
2010-02-23
PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3beta (GSK-3beta) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3beta(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3beta after transfection with GSK-3beta by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3beta (s9). Furthermore, we demonstrated GSK-3beta transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3beta was important to improve chemosensitization, indicating the significance of GSK-3beta-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.
Xiao, Ailin; Li, Jing; Liu, Tianjian; Liu, Zhuxi; Wei, Chuanfei; Xu, Xiaomeng; Li, Qin; Li, Jingxin
2016-05-01
Hydrogen sulphide (H2 S) is generated endogenously from L-cysteine (L-Cys) by the enzymes cystathionine-β-synthase (CBS) and cystathionine-γ-lyase (CSE). In addition, L-Cys is commonly used as a precursor in the food and pharmaceutical industries. The aim of the present study is to determine whether L-Cys regulates intestinal nutrient transport. To that end, the presence of CBS and CSE in the jejunum epithelium was assessed by immunohistochemistry, Western blotting and the methylene blue assay. In addition, in vivo L-Cys (100 mg/kg, administered immediately after the glucose load) significantly increased blood glucose levels 30 min after the oral administration of glucose to mice. This effect of L-Cys was completely blocked by amino-oxyacetic acid (AOA; 50 mg/kg; administered at the same time as L-Cys) an inhibitor of CBS. Measurements of the short-circuit current (Isc) in the rat jejunum epithelium revealed that L-Cys (1 mmol/L; 6 min before the administration of L-alanine) enhances Na(+)-coupled L-alanine or glucose transport, and that this effect is inhibited by AOA (1 mmol/L;10 min before the administration of L-Cys), but not D,L-propargylglycine (PAG;1 mmol/L; 10 min before the administration of L-Cys), a CSE inhibitor. Notably, L-Cys-evoked enhancement of nutrient transport was alleviated by glibenclamide (Gli;0.1 mmol/L; 10 min before the administration of L-Cys), a K(+) channel blocker. Together, the data indicate that L-Cys enhances jejunal nutrient transport, suggesting a new approach to future treatment of nutrition-related maladies, including a range of serious health consequences linked to undernutrition. © 2016 John Wiley & Sons Australia, Ltd.
Lechuga, Thomas J; Zhang, Hong-hai; Sheibani, Lili; Karim, Muntarin; Jia, Jason; Magness, Ronald R; Rosenfeld, Charles R; Chen, Dong-bao
2015-06-01
Estrogens dramatically dilate numerous vascular beds with the greatest response in the uterus. Endogenous hydrogen sulfide (H2S) is a potent vasodilator and proangiogenic second messenger, which is synthesized from L-cysteine by cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE). We hypothesized that estrogen replacement therapy (ERT) selectively stimulates H2S biosynthesis in uterine artery (UA) and other systemic arteries. Intact and endothelium-denuded UA, mesenteric artery (MA), and carotid artery (CA) were obtained from ovariectomized nonpregnant ewes (n = 5/group) receiving vehicle or estradiol-17β replacement therapy (ERT). Total RNA and protein were extracted for measuring CBS and CSE, and H2S production was determined by the methylene blue assay. Paraffin-embedded UA rings were used to localize CBS and CSE proteins by immunofluorescence microscopy. ERT significantly stimulated CBS mRNA and protein without altering CSE mRNA or protein in intact and denuded UA. Quantitative immunofluorescence microscopic analyses showed CBS and CSE protein localization in endothelium and smooth muscle and confirmed that ERT stimulated CBS but not CSE protein expression in UA endothelium and smooth muscle. ERT also stimulated CBS, but not CSE, mRNA and protein expression in intact and denuded MA but not CA in ovariectomized ewes. Concomitantly, ERT stimulated UA and MA but not CA H2S production. ERT-stimulated UA H2S production was completely blocked by a specific CBS but not CSE inhibitor. Thus, ERT selectively stimulates UA and MA but not CA H2S biosynthesis by specifically up-regulating CBS expression, implicating a role of H2S in estrogen-induced vasodilation and postmenopausal women's health.
Kumar, Anil; Hou, Xu; Lee, Chunsik; Li, Yang; Maminishkis, Arvydas; Tang, Zhongshu; Zhang, Fan; Langer, Harald F; Arjunan, Pachiappan; Dong, Lijin; Wu, Zhijian; Zhu, Linda Y; Wang, Lianchun; Min, Wang; Colosi, Peter; Chavakis, Triantafyllos; Li, Xuri
2010-05-14
Platelet-derived growth factor-DD (PDGF-DD) is a recently discovered member of the PDGF family. The role of PDGF-DD in pathological angiogenesis and the underlying cellular and molecular mechanisms remain largely unexplored. In this study, using different animal models, we showed that PDGF-DD expression was up-regulated during pathological angiogenesis, and inhibition of PDGF-DD suppressed both choroidal and retinal neovascularization. We also demonstrated a novel mechanism mediating the function of PDGF-DD. PDGF-DD induced glycogen synthase kinase-3beta (GSK3beta) Ser(9) phosphorylation and Tyr(216) dephosphorylation in vitro and in vivo, leading to increased cell survival. Consistently, GSK3beta activity was required for the antiangiogenic effect of PDGF-DD targeting. Moreover, PDGF-DD regulated the expression of GSK3beta and many other genes important for angiogenesis and apoptosis. Thus, we identified PDGF-DD as an important target gene for antiangiogenic therapy due to its pleiotropic effects on vascular and non-vascular cells. PDGF-DD inhibition may offer new therapeutic options to treat neovascular diseases.
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Directory of Open Access Journals (Sweden)
Maja Dziegelewska
2016-08-01
Full Text Available Hydrogen sulfide (H2S is a gaseous signalling molecule involved in many physiological and pathological processes. There is increasing evidence that H2S is implicated in aging and lifespan control in the diet-induced longevity models. However, blood sulfide concentration of naturally long-lived species is not known. Here we measured blood sulfide in the long-lived naked mole-rat and five other mammalian species considerably differing in lifespan and found a negative correlation between blood sulfide and maximum longevity residual. In addition, we show that the naked mole-rat cystathionine β-synthase (CBS, an enzyme whose activity in the liver significantly contributes to systemic sulfide levels, has lower activity in the liver and is activated to a higher degree by S-adenosylmethionine compared to other species. These results add complexity to the understanding of the role of H2S in aging and call for detailed research on naked mole-rat transsulfuration.
Damage of hippocampal neurons in rats with chronic alcoholism.
Du, Ailin; Jiang, Hongbo; Xu, Lei; An, Na; Liu, Hui; Li, Yinsheng; Zhang, Ruiling
2014-09-01
Chronic alcoholism can damage the cytoskeleton and aggravate neurological deficits. However, the effect of chronic alcoholism on hippocampal neurons remains unclear. In this study, a model of chronic alcoholism was established in rats that were fed with 6% alcohol for 42 days. Endogenous hydrogen sulfide content and cystathionine-beta-synthase activity in the hippocampus of rats with chronic alcoholism were significantly increased, while F-actin expression was decreased. Hippocampal neurons in rats with chronic alcoholism appeared to have a fuzzy nuclear membrane, mitochondrial edema, and ruptured mitochondrial crista. These findings suggest that chronic alcoholism can cause learning and memory decline in rats, which may be associated with the hydrogen sulfide/cystathionine-beta-synthase system, mitochondrial damage and reduced expression of F-actin.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Su, Yang; Majtan, Tomas; Freeman, Katherine M; Linck, Rachel; Ponter, Sarah; Kraus, Jan P; Burstyn, Judith N
2013-01-29
Cystathionine β-synthase (CBS) is the first and rate-limiting enzyme in the transsulfuration pathway, which is critical for the synthesis of cysteine from methionine in eukaryotes. CBS uses coenzyme pyridoxal 5'-phosphate (PLP) for catalysis, and S-adenosylmethionine regulates the activity of human CBS, but not yeast CBS. Human and fruit fly CBS contain heme; however, the role for heme is not clear. This paper reports biochemical and spectroscopic characterization of CBS from fruit fly Drosophila melanogaster (DmCBS) and the CO/NO gas binding reactions of DmCBS and human CBS. Like CBS enzymes from lower organisms (e.g., yeast), DmCBS is intrinsically highly active and is not regulated by AdoMet. The DmCBS heme coordination environment, the reactivity, and the accompanying effects on enzyme activity are similar to those of human CBS. The DmCBS heme bears histidine and cysteine axial ligands, and the enzyme becomes inactive when the cysteine ligand is replaced. The Fe(II) heme in DmCBS is less stable than that in human CBS, undergoing more facile reoxidation and ligand exchange. In both CBS proteins, the overall stability of the protein is correlated with the heme oxidation state. Human and DmCBS Fe(II) hemes react relatively slowly with CO and NO, and the rate of the CO binding reaction is faster at low pH than at high pH. Together, the results suggest that heme incorporation and AdoMet regulation in CBS are not correlated, possibly providing two independent means for regulating the enzyme.
Dziegelewska, Maja; Holtze, Susanne; Vole, Christiane; Wachter, Ulrich; Menzel, Uwe; Morhart, Michaela; Groth, Marco; Szafranski, Karol; Sahm, Arne; Sponholz, Christoph; Dammann, Philip; Huse, Klaus; Hildebrandt, Thomas; Platzer, Matthias
2016-08-01
Hydrogen sulfide (H2S) is a gaseous signalling molecule involved in many physiological and pathological processes. There is increasing evidence that H2S is implicated in aging and lifespan control in the diet-induced longevity models. However, blood sulfide concentration of naturally long-lived species is not known. Here we measured blood sulfide in the long-lived naked mole-rat and five other mammalian species considerably differing in lifespan and found a negative correlation between blood sulfide and maximum longevity residual. In addition, we show that the naked mole-rat cystathionine β-synthase (CBS), an enzyme whose activity in the liver significantly contributes to systemic sulfide levels, has lower activity in the liver and is activated to a higher degree by S-adenosylmethionine compared to other species. These results add complexity to the understanding of the role of H2S in aging and call for detailed research on naked mole-rat transsulfuration. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Boehme, K.A.
2006-12-15
Glycogen Synthase Kinase-3{beta} (GSK-3{beta}) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3{beta} by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3{beta} at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3{beta} serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKB{beta}, is required for phosphorylation of GSK- 3{beta} at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3{beta} at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3{beta} in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer
Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping
2009-02-01
Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.
De Marchi, Umberto; Thevenet, Jonathan; Hermant, Aurelie; Dioum, Elhadji; Wiederkehr, Andreas
2014-01-01
Mitochondrial energy metabolism is essential for glucose-induced calcium signaling and, therefore, insulin granule exocytosis in pancreatic beta cells. Calcium signals are sensed by mitochondria acting in concert with mitochondrial substrates for the full activation of the organelle. Here we have studied glucose-induced calcium signaling and energy metabolism in INS-1E insulinoma cells and human islet beta cells. In insulin secreting cells a surprisingly large fraction of total respiration under resting conditions is ATP synthase-independent. We observe that ATP synthase-dependent respiration is markedly increased after glucose stimulation. Glucose also causes a very rapid elevation of oxidative metabolism as was followed by NAD(P)H autofluorescence. However, neither the rate of the glucose-induced increase nor the new steady-state NAD(P)H levels are significantly affected by calcium. Our findings challenge the current view, which has focused mainly on calcium-sensitive dehydrogenases as the target for the activation of mitochondrial energy metabolism. We propose a model of tight calcium-dependent regulation of oxidative metabolism and ATP synthase-dependent respiration in beta cell mitochondria. Coordinated activation of matrix dehydrogenases and respiratory chain activity by calcium allows the respiratory rate to change severalfold with only small or no alterations of the NAD(P)H/NAD(P)+ ratio. PMID:24554722
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Chen, Hai-Bo; Wu, Wen-Ning; Wang, Wei; Gu, Xun-Hu; Yu, Bin; Wei, Bo; Yang, Yuan-Jian
2017-04-01
Hydrogen sulfide (H 2 S) is an endogenous gaseous molecule that functions as a neuromodulator in the brain. We previously reported that H 2 S regulated amygdalar synaptic plasticity and cued fear memory in rats. However, whether endogenous H 2 S is required for amygdalar long-term potentiation (LTP) induction and cued fear memory formation remains unclear. Here, we show that cystathionine-β-synthase (CBS), the predominant H 2 S-producing enzyme in the brain, was highly expressed in the amygdala of rats. Suppressing CBS activity by inhibitor prevented activity-triggered generation of H 2 S in the lateral amygdala (LA) region. Incubating brain slices with CBS inhibitor significantly prevented the induction of NMDA receptors (NMDARs)-dependent LTP in the thalamo-LA pathway, and intra-LA infusion of CBS inhibitor impaired cued fear memory in rats. Notably, treatment with H 2 S donor, but not CBS activator, significantly reversed the impairments of LTP and fear memory caused by CBS inhibition. Mechanismly, inhibition of CBS activity led to a reduction in NMDAR-mediated synaptic response in the thalamo-LA pathway, and treatment with H 2 S donor restored the function of NMDARs. Collectively, these results indicate that CBS-derived H 2 S is required for amygdalar synaptic plasticity and cued fear memory in rats, and the effects of endogenous H 2 S might involve the regulation of NMDAR function. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Liepman, Aaron H; Nairn, C Joseph; Willats, William G T
2007-01-01
from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...
Directory of Open Access Journals (Sweden)
David Vance
2017-01-01
Full Text Available Background Homozygous or compound heterozygous Cystathionine-beta-synthase deficiency (CBS-- may result in thrombosis. Treatment has included various combinations of: low-methionine diets, cystine (cystine dimer-enriched amino acid supplementation, vitamin B6, folic acid, vitamin B12 and betaine. Treatment compliance and outcomes even in the most-developed countries are mostly sub-optimal and variable, and the differing theoretical metabolic ramifications due to differing treatments have not been well addressed. The aim of this work was to further analyse the thrombosis events data of Yap et al (2001/2003, and to compare these with the rate of thrombosis in the general population, and to examine the theoretical significance of the metabolic pathways affected by CBS-- and its treatments, and so find any potential improvements in treatments, considering also less-developed areas. Methods Yap et al’s (2001/2003 data of the thrombosis outcomes of five major (CBS---treating centers: in Dublin, Sydney, Nijmegen, Manchester and London; were statistically compared with outcomes predicted by Mudd et al’s (1985 untreated natural history outcomes, and then Dublin versus the others; these rates were then compared with those of general populations; and treatments were examined regarding their theoretical metabolic ramifications. Results There were less thrombosis outcomes (P<.05 in the treated and followed CBS-- patient groups of each of the five centers, even when considered singly, than that expected in the absence of treatment by reference to the natural history data of Mudd et al (1985, but the reduction was less than half that claimed by Yap et al, and the remaining level of thrombosis is roughly 10 times that of the general population. The thromboses outcome (nil of the Dublin group is better than that of the other four groups, but only at P ~ 0.16 with the other four groups combined, or P = 0.14 to 0.23 singly. Treatment regimens differ, including
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Ion specificity and ionic strength dependence of the osmoregulatory ABC transporter OpuA
Mahmood, N. A. B. Nik; Biemans-Oldehinkel, Esther; Patzlaff, Jason S.; Schuurman-Wolters, Gea K.; Poolman, Bert
2006-01-01
The ATPase subunit of the osmoregulatory ATP- binding cassette transporterOpuAfrom Lactococcus lactis has a C- terminal extension, the tandem cystathionine beta- synthase ( CBS) domain, which constitutes the sensor that allows the transporter to sense and respond to osmotic stress ( Biemans-
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Mudd, S.H.; Cerone, R.; Schiaffino, M.C.; Fantasia, A.R.; Minniti, G.; Caruso, U.; Lorini, R.; Watkins, D.; Matiaszuk, N.; Rosenblatt, D.S.; Schwahn, B.; Rozen, R.; Gros, L. Le; Kotb, M.; Capdevila, A.; Luka, Z.; Finkelstein, J.; Tangerman, A.; Stabler, S.P.; Allen, R.; Wagner, C.
2001-01-01
This paper reports clinical and metabolic studies of two Italian siblings with a novel form of persistent isolated hypermethioninaemia, i.e. abnormally elevated plasma methionine that lasted beyond the first months of life and is not due to cystathionine beta-synthase deficiency, tyrosinaemia I or
Serotonin and dopamine protect from hypothermia/rewarming damage through the CBS/H2S pathway
Talaei, Fatemeh; Bouma, Hjalmar; Van der Graaf, Adrianus; Strijkstra, Arjen; Schmidt, Martina; Henning, Robert
2011-01-01
Biogenic amines have been demonstrated to protect cells from apoptotic cell death. Herein we show for the first time that serotonin and dopamine increase H2S production by the endogenous enzyme cystathionine-beta-synthase (CBS) and protect cells against hypothermia/rewarming induced reactive oxygen
Pey, Angel L; Majtan, Tomas; Kraus, Jan P
2014-09-01
Human cystathionine β-synthase (hCBS) is a key enzyme of sulfur amino acid metabolism, controlling the commitment of homocysteine to the transsulfuration pathway and antioxidant defense. Mutations in hCBS cause inherited homocystinuria (HCU), a rare inborn error of metabolism characterized by accumulation of toxic homocysteine in blood and urine. hCBS is a complex multidomain and oligomeric protein whose activity and stability are independently regulated by the binding of S-adenosyl-methionine (SAM) to two different types of sites at its C-terminal regulatory domain. Here we study the role of surface electrostatics on the complex regulation and stability of hCBS using biophysical and biochemical procedures. We show that the kinetic stability of the catalytic and regulatory domains is significantly affected by the modulation of surface electrostatics through noticeable structural and energetic changes along their denaturation pathways. We also show that surface electrostatics strongly affect SAM binding properties to those sites responsible for either enzyme activation or kinetic stabilization. Our results provide new insight into the regulation of hCBS activity and stability in vivo with implications for understanding HCU as a conformational disease. We also lend experimental support to the role of electrostatic interactions in the recently proposed binding modes of SAM leading to hCBS activation and kinetic stabilization. Copyright © 2014 Elsevier B.V. All rights reserved.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Energy Technology Data Exchange (ETDEWEB)
Dudas, Jozsef, E-mail: Jozsef.Dudas@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Fullar, Alexandra, E-mail: fullarsz@gmail.com [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); 1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Bitsche, Mario, E-mail: Mario.Bitsche@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Schartinger, Volker, E-mail: Volker.Schartinger@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Kovalszky, Ilona, E-mail: koval@korb1.sote.hu [1st Institute of Pathology and Experimental Cancer Research, Semmelweis University, Ulloei ut 26, H-1085 Budapest (Hungary); Sprinzl, Georg Mathias, E-mail: Georg.Sprinzl@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria); Riechelmann, Herbert, E-mail: Herbert.Riechelmann@i-med.ac.at [Department of Otorhinolaryngology, Medical University Innsbruck, Anichstrasse 35, A-6020 Innsbruck (Austria)
2011-09-10
Recently we described a co-culture model of periodontal ligament (PDL) fibroblasts and SCC-25 lingual squamous carcinoma cells, which resulted in conversion of normal fibroblasts into carcinoma-associated fibroblasts (CAFs), and in epithelial-mesenchymal transition (EMT) of SCC-25 cells. We have found a constitutive high interleukin-1{beta} (IL1-{beta}) expression in SCC-25 cells in normal and in co-cultured conditions. In our hypothesis a constitutive IL1-{beta} expression in SCC-25 regulates gene expression in fibroblasts during co-culture. Co-cultures were performed between PDL fibroblasts and SCC-25 cells with and without dexamethasone (DEX) treatment; IL1-{beta} processing was investigated in SCC-25 cells, tumor cells and PDL fibroblasts were treated with IL1-{beta}. IL1-{beta} signaling was investigated by western blot and immunocytochemistry. IL1-{beta}-regulated genes were analyzed by real-time qPCR. SCC-25 cells produced 16 kD active IL1-{beta}, its receptor was upregulated in PDL fibroblasts during co-culture, which induced phosphorylation of interleukin-1 receptor-associated kinase-1 (IRAK-1), and nuclear translocalization of NF{kappa}B{alpha}. Several genes, including interferon regulatory factor 1 (IRF1) interleukin-6 (IL-6) and prostaglandin-endoperoxide synthase 2 (COX-2) were induced in CAFs during co-culture. The most enhanced induction was found for IL-6 and COX-2. Treatment of PDL fibroblasts with IL1-{beta} reproduced a time- and dose-dependent upregulation of IL1-receptor, IL-6 and COX-2. A further proof was achieved by DEX inhibition for IL1-{beta}-stimulated IL-6 and COX-2 gene expression. Constitutive expression of IL1-{beta} in the tumor cells leads to IL1-{beta}-stimulated gene expression changes in tumor-associated fibroblasts, which are involved in tumor progression. -- Graphical abstract: SCC-25 cells produce active, processed IL1-{beta}. PDL fibroblasts possess receptor for IL1-{beta}, and its expression is increased 4.56-times in the
Saitoh, Morihisa; Kunitomo, Jun; Kimura, Eiji; Yamano, Toru; Itoh, Fumio; Kori, Masakuni
2010-09-01
Glycogen synthase kinase 3beta (GSK-3beta) inhibitors are expected to be attractive therapeutic agents for the treatment of Alzheimer's disease (AD). Recently we discovered sulfoxides (S)-1 as a novel GSK-3beta inhibitor having in vivo efficacy. We investigated practical asymmetric preparation methods for the scale-up synthesis of (S)-1. The highly enantioselective synthesis of (S)-1 (94% ee) was achieved by titanium-mediated oxidation with D-(-)-diethyl tartrate on gram scale.
Energy Technology Data Exchange (ETDEWEB)
Mentzingen, Leticia; Andrade, Josiana G. de; Logullo, Carlos [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacazes, RJ (Brazil). Centro de Biociencias e Biotecnologia. Lab. de Quimica e Funcao de Proteinas e Peptideos (LQFPP); Andrade, Caroline P. de; Vaz Junior, Itabajara [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Centro de Biotecnologia
2008-07-01
Full text: Glycogen synthase kinase-3 (GSK3) is recognized as a key component of a large number of cellular processes and diseases. Several mechanisms play a part in controlling the actions of GSK3, including phosphorylation, protein complex formation, and subcellular distribution. Recent observations point to functions for phosphorylases several transcription factors in the nucleus. Also, GSK3b participate of the canonical W nt signalling pathway, which has been studied intensively in embryonic and cancer cells. Like in many other signaling pathways, most components in W nt signal transduction were highly conserved during the evolution. More than 40 proteins have been reported to be phosphorylated by GSK3, including over a dozen transcription factors. Although the mechanisms regulating GSK3 are not fully understood, precise control appears to be achieved by a combination of phosphorylation, localization, and interactions with GSK3-binding proteins. Although GSK3 is traditionally considered a cytosolic protein, it is also present in nuclei. Nuclear GSK3 is particularly interesting because of the many transcription factors that it regulates enabling GSK3 to influence many signaling pathways that converge on these transcription factors, thereby regulating the expression of many genes. Our group identified that GSK-3 {beta} could be detected in different stage eggs of R. micro plus. In this work we detected the GSK-3 in isolated nuclear fraction from the egg homogenates of R. micro plus by western-blot analysis, using anti-GSK- 3 {beta} antibodies. The enzyme activity was also detected radiochemically throughout embryogenesis in same fraction. The GSK-3 activity was inhibiting by using SB 216763 (selective molecule inhibitors of GSK-3). Taken together our results suggest that GSK-3 {beta} isoform probably is involved in gene transcription factors during R. micro plus embryo development.
Energy Technology Data Exchange (ETDEWEB)
Kozikowski, Alan P.; Gunosewoyo, Hendra; Guo, Songpo; Gaisina, Irina N.; Walter, Richard L.; Ketcherside, Ariel; McClung, Colleen A.; Mesecar, Andrew D.; Caldarone, Barbara (Psychogenics); (Purdue); (UIC); (UTSMC)
2012-05-02
Bipolar disorder is characterized by a cycle of mania and depression, which affects approximately 5 million people in the United States. Current treatment regimes include the so-called 'mood-stabilizing drugs', such as lithium and valproate that are relatively dated drugs with various known side effects. Glycogen synthase kinase-3{beta} (GSK-3{beta}) plays a central role in regulating circadian rhythms, and lithium is known to be a direct inhibitor of GSK-3{beta}. We designed a series of second generation benzofuran-3-yl-(indol-3-yl)maleimides containing a piperidine ring that possess IC{sub 50} values in the range of 4 to 680 nM against human GSK-3{beta}. One of these compounds exhibits reasonable kinase selectivity and promising preliminary absorption, distribution, metabolism, and excretion (ADME) data. The administration of this compound at doses of 10 to 25 mg kg{sup -1} resulted in the attenuation of hyperactivity in amphetamine/chlordiazepoxide-induced manic-like mice together with enhancement of prepulse inhibition, similar to the effects found for valproate (400 mg kg{sup -1}) and the antipsychotic haloperidol (1 mg kg{sup -1}). We also tested this compound in mice carrying a mutation in the central transcriptional activator of molecular rhythms, the CLOCK gene, and found that the same compound attenuates locomotor hyperactivity in response to novelty. This study further demonstrates the use of inhibitors of GSK-3{beta} in the treatment of manic episodes of bipolar/mood disorders, thus further validating GSK-3{beta} as a relevant therapeutic target in the identification of new therapies for bipolar patients.
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Directory of Open Access Journals (Sweden)
Elena Voskoboeva
2018-03-01
Full Text Available We present the results of the 45-year clinical observation of 27 Russian homocystinuria patients. We made a mutation analysis of the CBS gene for thirteen patients from eleven unrelated genealogies. All patients except for the two were compound heterozygotes for the mutations detected. The most frequent mutation in the cohort investigated was splice mutation IVS11-2a->c. We detected one new nonsense mutation, one new missense-mutation and three novel small deletions. We also report the clinical case of the B6-responsive patient genotyped as Ile278Thr/Cys109Arg.
DEFF Research Database (Denmark)
Dobritzsch, D.; Gojkovic, Zoran; Andersen, Birgit
2003-01-01
In eukaryotes and some bacteria, the third step of reductive pyrimidine catabolism is catalyzed by beta-alanine synthase (EC 3.5.1.6). Crystals of the recombinant enzyme from the yeast Saccharomyces kluyveri were obtained using sodium citrate as a precipitant. The crystals belong to space group P2...
Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan
2007-07-01
Flavanone 3beta-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the beta-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction).
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
DEFF Research Database (Denmark)
Højlund, Kurt; Wrzesinski, Krzysztof; Larsen, Peter Mose
2003-01-01
quantitate a large number of proteins and their post-translational modifications simultaneously and is a powerful tool to study polygenic diseases like type 2 diabetes. Using this approach on human skeletal muscle biopsies, we have identified eight potential protein markers for type 2 diabetes in the fasting...... synthase beta-subunit phosphoisoform in diabetic muscle correlated inversely with fasting plasma glucose levels. These data suggest a role for phosphorylation of ATP synthase beta-subunit in the regulation of ATP synthesis and that alterations in the regulation of ATP synthesis and cellular stress proteins...
Institute of Scientific and Technical Information of China (English)
Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi
2011-01-01
In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
Szijártó, István András; Markó, Lajos; Filipovic, Milos R; Miljkovic, Jan Lj; Tabeling, Christoph; Tsvetkov, Dmitry; Wang, Ning; Rabelo, Luiza A; Witzenrath, Martin; Diedrich, André; Tank, Jens; Akahoshi, Noriyuki; Kamata, Shotaro; Ishii, Isao; Gollasch, Maik
2018-06-01
Hydrogen sulfide (H 2 S) and NO are important gasotransmitters, but how endogenous H 2 S affects the circulatory system has remained incompletely understood. Here, we show that CTH or CSE (cystathionine γ-lyase)-produced H 2 S scavenges vascular NO and controls its endogenous levels in peripheral arteries, which contribute to blood pressure regulation. Furthermore, eNOS (endothelial NO synthase) and phospho-eNOS protein levels were unaffected, but levels of nitroxyl were low in CTH-deficient arteries, demonstrating reduced direct chemical interaction between H 2 S and NO. Pretreatment of arterial rings from CTH-deficient mice with exogenous H 2 S donor rescued the endothelial vasorelaxant response and decreased tissue NO levels. Our discovery that CTH-produced H 2 S inhibits endogenous endothelial NO bioavailability and vascular tone is novel and fundamentally important for understanding how regulation of vascular tone is tailored for endogenous H 2 S to contribute to systemic blood pressure function. © 2018 American Heart Association, Inc.
DEFF Research Database (Denmark)
Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.
1993-01-01
The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...
Masud, Rizwan; Qureshi, Irfan Zia
2011-09-01
Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Razeghi, Peter; Bruckner, Brian A; Sharma, Saumya; Youker, Keith A; Frazier, O H; Taegtmeyer, Heinrich
2003-01-01
Left ventricular assist device (LVAD) support of the failing human heart improves myocyte function and increases cell survival. One potential mechanism underlying this phenomenon is activation of the protein kinase B (PKB)/Akt/glycogen synthase kinase-3beta (GSK-3beta) survival pathway. Left ventricular tissue was obtained both at the time of implantation and explantation of the LVAD (n = 11). Six patients were diagnosed with idiopathic dilated cardiomyopathy, 4 patients with ischemic cardiomyopathy and 1 patient with peripartum cardiomyopathy. The mean duration of LVAD support was 205 +/- 35 days. Myocyte diameter and phosphorylation of ERK were used as indices for reverse remodeling. Transcript levels of genes required for the activation of PKB/Akt (insulin-like growth factor-1, insulin receptor substrate-1) were measured by quantitative RT-PCR. In addition, we measured the relative activity of PKB/Akt and GSK-3beta, and assayed for molecular and histological indices of PKB/Akt activation (cyclooxygenase mRNA levels and glycogen levels). Myocyte diameter and phosphorylation of ERK decreased with LVAD support. In contrast, none of the components of the PKB/Akt/GSK-3beta pathway changed significantly with mechanical unloading. The PKB/Akt/GSK-3beta pathway is not activated during LVAD support. Other signaling pathways must be responsible for the improvement of cellular function and cell survival during LVAD support. Copyright 2003 S. Karger AG, Basel
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Gene expression analysis of interferon-beta treatment in multiple sclerosis
DEFF Research Database (Denmark)
Sellebjerg, F.; Datta, P.; Larsen, J.
2008-01-01
by treatment with IFN-beta. We use DNA microarrays to study gene expression in 10 multiple sclerosis (MS) patients who began de novo treatment with IFN-beta. After the first injection of IFN-beta, the expression of 74 out of 3428 genes changed at least two-fold and statistically significantly (after Bonferroni......Treatment with interferon-beta (IFN-beta) induces the expression of hundreds of genes in blood mononuclear cells, and the expression of several genes has been proposed as a marker of the effect of treatment with IFN-beta. However, to date no molecules have been identified that are stably induced...
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Damage of hippocampal neurons in rats with chronic alcoholism
Du, Ailin; Jiang, Hongbo; Xu, Lei; An, Na; Liu, Hui; Li, Yinsheng; Zhang, Ruiling
2014-01-01
Chronic alcoholism can damage the cytoskeleton and aggravate neurological deficits. However, the effect of chronic alcoholism on hippocampal neurons remains unclear. In this study, a model of chronic alcoholism was established in rats that were fed with 6% alcohol for 42 days. Endogenous hydrogen sulfide content and cystathionine-beta-synthase activity in the hippocampus of rats with chronic alcoholism were significantly increased, while F-actin expression was decreased. Hippocampal neurons i...
Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)
2011-09-20
The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Hydrogen sulfide synthesis enzymes reduced in lower esophageal sphincter of patients with achalasia.
Zhang, L; Zhao, W; Zheng, Z; Wang, T; Zhao, C; Zhou, G; Jin, H; Wang, B
2016-10-01
The etiology of achalasia remains largely unknown. Considerable evidence reveals that the lower esophageal sphincter dysfunction is due to the lack of inhibitory neurotransmitter, secondary to esophageal neuronal inflammation or loss. Recent studies suggest hydrogen sulfide may act as an inhibitory transmitter in gastrointestinal tract, but study about hydrogen sulfide in human esophagus still lack. The aim of the study was to investigate if hydrogen sulfide synthesis enzymes could be detected in human esophagus and if the synthesis of the endogenous hydrogen sulfide could be affected in achalasia patients. Tissue samples in cardia, lower esophageal sphincter, 2 cm and 4 cm above lower esophageal sphincter were obtained from achalasia patients undergoing peroral endoscopic myotomy. Control tissues in lower esophageal sphincter were obtained from esophageal carcinoma patients. Expression of cystathionine-β-synthase and cystathionine-γ-lyase in lower esophageal sphincter of achalasia patients and control were detected by immunohistochemical staining. In addition, expression of cystathionine-β-synthase and cystathionine-γ-lyase were compared among different parts of esophagus in achalasia patients. Compared with control, the expression of cystathionine-β-synthase and cystathionine-γ-lyase in lower esophageal sphincter of achalasia patients was significantly reduced (χ 2 = 11.429, P = 0.010). The expression of cystathionine-β-synthase and cystathionine-γ-lyase were lower in lower esophageal sphincter than that in 2 cm and 4 cm above lower esophageal sphincter, respectively (all P achalasia, which implicates the involvement of the two hydrogen sulfide synthesis enzymes in the pathophysiology of achalasia. © 2015 International Society for Diseases of the Esophagus.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Nitric oxide synthase gene G298 allele
International Nuclear Information System (INIS)
Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar
2004-01-01
Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant
Birenbaum, Aurélie; Tesse, Angela; Loyer, Xavier; Michelet, Pierre; Andriantsitohaina, Ramaroson; Heymes, Christophe; Riou, Bruno; Amour, Julien
2008-12-01
In senescent heart, beta-adrenergic response is altered in parallel with beta1- and beta2-adrenoceptor down-regulation. A negative inotropic effect of beta3-adrenoceptor could be involved. In this study, the authors tested the hypothesis that beta3-adrenoceptor plays a role in beta-adrenergic dysfunction in senescent heart. beta-Adrenergic responses were investigated in vivo (echocardiography-dobutamine, electron paramagnetic resonance) and in vitro (isolated left ventricular papillary muscle, electron paramagnetic resonance) in young adult (3-month-old) and senescent (24-month-old) rats. Nitric oxide synthase (NOS) immunolabeling (confocal microscopy), nitric oxide production (electron paramagnetic resonance) and beta-adrenoceptor Western blots were performed in vitro. Data are mean percentages of baseline +/- SD. An impaired positive inotropic effect (isoproterenol) was confirmed in senescent hearts in vivo (117 +/- 23 vs. 162 +/- 16%; P < 0.05) and in vitro (127 +/- 10 vs. 179 +/- 15%; P < 0.05). In the young adult group, the positive inotropic effect was not significantly modified by the nonselective NOS inhibitor N-nitro-L-arginine methylester (L-NAME; 183 +/- 19%), the selective NOS1 inhibitor vinyl-L-N-5(1-imino-3-butenyl)-L-ornithine (L-VNIO; 172 +/- 13%), or the selective NOS2 inhibitor 1400W (183 +/- 19%). In the senescent group, in parallel with beta3-adrenoceptor up-regulation and increased nitric oxide production, the positive inotropic effect was partially restored by L-NAME (151 +/- 8%; P < 0.05) and L-VNIO (149 +/- 7%; P < 0.05) but not by 1400W (132 +/- 11%; not significant). The positive inotropic effect induced by dibutyryl-cyclic adenosine monophosphate was decreased in the senescent group with the specific beta3-adrenoceptor agonist BRL 37344 (167 +/- 10 vs. 142 +/- 10%; P < 0.05). NOS1 and NOS2 were significantly up-regulated in the senescent rat. In senescent cardiomyopathy, beta3-adrenoceptor overexpression plays an important role in the
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
beta. -Amyloid gene dosage in Alzheimer's disease
Energy Technology Data Exchange (ETDEWEB)
Murdoch, G H; Manuelidis, L; Kim, J H; Manuelidis, E E
1988-01-11
The 4-5 kd amyloid ..beta..-peptide is a major constituent of the characteristic amyloid plaque of Alzheimer's disease. It has been reported that some cases of sporatic Alzheimer's disease are associated with at least a partial duplication of chromosome 21 containing the gene corresponding to the 695 residue precursor of this peptide. To contribute to an understanding of the frequency to such a duplication event in the overall Alzheimer's population, the authors have determined the gene dosage of the ..beta..-amyloid gene in this collection of cases. All cases had a clinical diagnosis of Alzheimer's confirmed neuropathologically. Each Alzheimer's case had an apparent normal diploid ..beta..-amyloid gene dosage, while control Down's cases had the expected triploid dosage. Thus partial duplication of chromosome 21 may be a rare finding in Alzheimer's disease. Similar conclusions were just reported in several studies of the Harvard Alzheimer collection.
Cadmium induced radioadaptive response via an ATM-independent H2S/cystathionine γ-lyase modulation
International Nuclear Information System (INIS)
Pan Yan; Yuan Dexiao; Zhang Jianghong; Shao Chunlin
2011-01-01
The combined exposure to environmental toxicants such as heavy metals and radiation is an important research area in health protection. Here we explored cadmium induced radioadaptive response (RAR) and investigated the role of hydrogen sulfide (H 2 S) and ATM kinase in this response. Our data showed that the cadmium ions with a sub-lethal concentration could induce RAR in Chang liver cells towards subsequent γ-irradiation and this response could be abrogated by DL-propargylglycine (PPG), the endogenous H 2 S synthetase inhibitor of cystathionine γ-lyase (CSE), but not by aminooxyacetic acid (AOAA), the inhibitor of cystathionine β-synthase (CBS). Moreover, the pretreatment of cells with NaHS also stimulated cellular adaptive response to radiation. Both cadmium treatment and irradiation up-regulated the expression of CSE protein in a time-dependent manner but had no influence on the expression of CBS protein. In the primed cells, the time course of CBS expression showed no significant difference with the cells treated with 2Gy irradiation alone, however, the CSE expression was easier to reach the maximum level, indicating a more efficient H 2 S production by CSE. Moreover, the cadmium-induced RAR was totally suppressed by KU-55933, a specific ATM inhibitor that did not change the CSE expression after radiation. However, exogenous H 2 S decreased the phosphorylation level of radiation-induced ATM. In conclusion, the present results demonstrate firstly that H 2 S is involved in the cadmium induced cross-adaptive response to challenging radiation. CSE, rather than CBS, may mainly responsible for the H 2 S production during this RAR which may also be mediated by ATM pathway. However, the activation of CSE is independent of ATM but could negatively regulate the phosphorylation of ATM.
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
Cystathionine .gamma.-lyase: Clinical, metabolic, genetic, and structural studies
Czech Academy of Sciences Publication Activity Database
Kraus, J. P.; Hašek, Jindřich; Kožich, V.; Collard, R.; Venezia, S.; Janošíková, B.; Wang, J.; Stabler, S. P.; Allen, R. H.; Jakobs, C.; Finn, C. T.; Chien, Y. H.; Hwu, W. L.; Hegele, R. A.; Mudd, S. H.
2009-01-01
Roč. 97, č. 4 (2009), s. 250-259 ISSN 1096-7192 R&D Projects: GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : cystathionine gamma-lyase * cystathioninuria * hypercystathioninemia Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.897, year: 2009
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Directory of Open Access Journals (Sweden)
Jand-Venes Rolim MEDEIROS
2013-04-01
Full Text Available Context Hydrogen sulphide (H2S has been proved to be a neuromodulator and contributes to the maintenance of gastric mucosal integrity in damage caused by anti-inflammatory nonsteroidal drugs. Previously, we demonstrated that H2S synthesis is essential to gastric protection against ethanol. Objective To better understanding the role of H2S and the detailed localization of its production in both normal and injured stomach due to ethanol injection, we studied the expression of cystathionine-γ-lyase (CSE and cystathionine-β-synthetase (CBS isoforms in gastric mucosa of mice treated with saline or 50% ethanol. Methods Mice were treated by gavage with saline or 50% ethanol (0.5 mL/25 g. After 1 hour, mice were sacrificed, and gastric tissue was evaluated by histological and immunohistochemical analysis specific for CSE and CBS. Results We have demonstrated a non-specific expression of CBS in the normal gastric mucosa and expression of CSE occurring mainly in the parietal cells of the animals treated with ethanol. Conclusion Thus, we demonstrated that the expression of CBS appears to be constitutive and diffuse across the gastric epithelium, while the expression of CSE appears to be induced in parietal cells by damage agents such as ethanol.
Clusters of conserved beta cell marker genes for assessment of beta cell phenotype
DEFF Research Database (Denmark)
Martens, Geert A; Jiang, Lei; Hellemans, Karine H
2011-01-01
The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...... microdissected beta cells, monitor adaptations of the beta cell phenotype to fasting, and retrieve possible conserved transcriptional regulators....
Dhar, Indu; Svingen, Gard F T; Pedersen, Eva R; DeRatt, Barbara; Ulvik, Arve; Strand, Elin; Ueland, Per M; Bønaa, Kaare H; Gregory, Jesse F; Nygård, Ottar K
2018-04-21
Cystathionine is a thio-ether and a metabolite formed from homocysteine during transsulfuration. Elevated plasma cystathionine levels are reported in patients with cardiovascular disease; however prospective relationships with acute myocardial infarction (AMI) are unknown. We investigated associations between plasma cystathionine and AMI among patients with suspected and/or verified coronary heart disease (CHD). Subjects from two independent cohort studies, the Western Norway Coronary Angiography Cohort (WECAC) (3033 patients with stable angina pectoris; 263 events within 4.8 years of median follow-up) and the Norwegian Vitamin Trial (NORVIT) (3670 patients with AMI; 683 events within 3.2 years of median follow-up) were included. In both cohorts, plasma cystathionine was associated with several traditional CHD risk factors (P coronary heart disease, and is possibly related to altered redox homeostasis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Clusters of conserved beta cell marker genes for assessment of beta cell phenotype
DEFF Research Database (Denmark)
Martens, Geert A; Jiang, Lei; Hellemans, Karine H
2011-01-01
The aim of this study was to establish a gene expression blueprint of pancreatic beta cells conserved from rodents to humans and to evaluate its applicability to assess shifts in the beta cell differentiated state. Genome-wide mRNA expression profiles of isolated beta cells were compared to those...... of a large panel of other tissue and cell types, and transcripts with beta cell-abundant and -selective expression were identified. Iteration of this analysis in mouse, rat and human tissues generated a panel of conserved beta cell biomarkers. This panel was then used to compare isolated versus laser capture...
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Correlation between the cystathionine-r-lyase (CES) and the ...
African Journals Online (AJOL)
Background: The infection of Helicobacter pylori (H. pylori) is one of the most important causes of gastric ulcer disease. The role of hydrogen sulfide (H2S) production in H. pylori-induced gastric ulcer disease. Aim: The expression of cystathionine-γ-lyase (CSE) was determined, and correlated with the severity of gastric ulcer ...
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
An X11alpha/FSBP complex represses transcription of the GSK3beta gene promoter.
LENUS (Irish Health Repository)
Lau, Kwok-Fai
2010-08-04
X11alpha is a neuronal adaptor protein that interacts with the amyloid precursor protein (APP) through a centrally located phosphotyrosine binding domain to inhibit the production of Abeta peptide that is deposited in Alzheimer\\'s disease brains. X11alpha also contains two C-terminal postsynaptic density-95, large discs, zona occludens 1 (PDZ) domains, and we show here that through its PDZ domains, X11alpha interacts with a novel transcription factor, fibrinogen silencer binding protein. Moreover, we show that an X11alpha\\/fibrinogen silencer binding protein complex signals to the nucleus to repress glycogen synthase kinase-3beta promoter activity. Glycogen synthase kinase-3beta is a favoured candidate kinase for phosphorylating tau in Alzheimer\\'s disease. Our findings show a new function for X11alpha that may impact on Alzheimer\\'s disease pathogenesis.
Energy Technology Data Exchange (ETDEWEB)
Choi, Hyuk; Gwak, Jungsug; Cho, Munju; Ryu, Min-Jung [PharmacoGenomics Research Center, Inje University, Busan 614-735 (Korea, Republic of); Lee, Jee-Hyun; Kim, Sang Kyum; Kim, Young Ho [College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Lee, Gye Won [Department of Pharmaceutical Engineering, Konyang University, Nonsan 320-711 (Korea, Republic of); Yun, Mi-Young [Department of Beauty Health Care, Daejeon University, Daejeon 305-764 (Korea, Republic of); Cuong, Nguyen Manh [Institute of Natural Products Chemistry, Vietnam Academy of Science and Technology, Hanoi (Viet Nam); Shin, Jae-Gook [PharmacoGenomics Research Center, Inje University, Busan 614-735 (Korea, Republic of); Song, Gyu-Yong, E-mail: gysong@cnu.ac.kr [College of Pharmacy, Chungnam National University, Daejeon 305-764 (Korea, Republic of); Oh, Sangtaek, E-mail: ohsa@inje.ac.kr [PharmacoGenomics Research Center, Inje University, Busan 614-735 (Korea, Republic of)
2010-01-01
Molecular lesions in Wnt/{beta}-catenin signaling and subsequent up-regulation of {beta}-catenin response transcription (CRT) occur frequently during the development of colon cancer. To identify small molecules that suppress CRT, we screened natural compounds in a cell-based assay for detection of TOPFalsh reporter activity. Murrayafoline A, a carbazole alkaloid isolated from Glycosmis stenocarpa, antagonized CRT that was stimulated by Wnt3a-conditioned medium (Wnt3a-CM) or LiCl, an inhibitor of glycogen synthase kinase-3{beta} (GSK-3{beta}), and promoted the degradation of intracellular {beta}-catenin without altering its N-terminal phosphorylation at the Ser33/37 residues, marking it for proteasomal degradation, or the expression of Siah-1, an E3 ubiquitin ligase. Murrayafoline A repressed the expression of cyclin D1 and c-myc, which is known {beta}-catenin/T cell factor (TCF)-dependent genes and thus inhibited the proliferation of various colon cancer cells. These findings indicate that murrayafoline A may be a potential chemotherapeutic agent for use in the treatment of colon cancer.
SULPHUR-CONTAINING AMINO ACIDS METABOLISM IN EXPERIMENTAL HYPER- AND HYPOTHYROIDISM IN RATS.
Nechiporuk, V; Zaichko, N; Korda, М; Melnyk, A; Koloshko, O
2017-10-01
Hyper- and hypothyroidism are some of the most common endocrinopathies that cause many metabolic disorders including amino acids metabolism. However, a specific molecular mechanism of thyroid hormones influence on sulphur-containing amino acids metabolism has not been established. The aim of our research was to investigate experimentally the influence of thyroid gland functional state on the main enzymatic systems of sulphur-containing amino acids metabolism in liver and kidneys, the content of homocysteine, cysteine and H2S in blood. The rats were administered with L-thyroxine and mercazolil to simulate the states of hyper- and hypothyroidism, which were confirmed by the content of fT3, fT4 and TSH in the blood. In liver and kidneys of the animals with hypothyroidism we observed the decrease in the activity of enzymes of remethylation cycle of S-adenosylmethioninsyntase, S-adenosylhomocysteinhyhdrolase, betaine-homocysteine methyltransferase. Suppression of transsulfuration transformation of homocysteine to cysteine in hypothyroidism was mainly due to the inhibition of cystathionine synthase activity of cystathionine-β-synthase, wherein cystathionase activity of cystathionine-γ-lyase was not changed. In animals with hypothyroidism we also noticed the inhibition of cysteine desulfunation reactions: the activity of enzymes of cystathionine-β-synthase, cystathionine-γ-lyase and cysteine aminotransferase significantly decreased in liver and kidneys. Experimental hyperthyroidism was accompanied by increase in activity of remethylation cycle enzymes, increase in cystationine synthase activity of cystathionine-β-synthase in liver and activity of these enzymes in kidneys. The simulation of hyperthyroidism led to the decrease of homocysteine concentration, and of hypothyroidism - to the increase of homocysteine and cysteine concentrations and reduced H2S content in blood of the animals. Thus, the significant risk factors for the development of atherosclerosis
Effects of ultrasound on Transforming Growth Factor-beta genes in bone cells
Directory of Open Access Journals (Sweden)
J Harle
2005-12-01
Full Text Available Therapeutic ultrasound (US is a widely used form of biophysical stimulation that is increasingly applied to promote fracture healing. Transforming growth factor-beta (TGF-beta, which is encoded by three related but different genes, is known to play a major part in bone growth and repair. However, the effects of US on the expression of the TGF-beta genes and the physical acoustic mechanisms involved in initiating changes in gene expression in vitro, are not yet known. The present study demonstrates that US had a differential effect on these TGF-beta isoforms in a human osteoblast cell line, with the highest dose eliciting the most pronounced up-regulation of both TGF-beta1 and TGF-beta3 at 1 hour after treatment and thereafter declining. In contrast, US had no effect on TGF-beta2 expression. Fluid streaming rather than thermal effects or cavitation was found to be the most likely explanation for the gene responses observed in vitro.
Feyt, Christine; Kienlen-Campard, Pascal; Leroy, Karelle; N'Kuli, Francisca; Courtoy, Pierre J; Brion, Jean-Pierre; Octave, Jean-Noël
2005-09-30
Glycogen synthase kinase 3 (GSK3) is able to phosphorylate tau at many sites that are found to be phosphorylated in paired helical filaments in Alzheimer disease. Lithium chloride (LiCl) efficiently inhibits GSK3 and was recently reported to also decrease the production of amyloid-beta peptide (Abeta) from its precursor, the amyloid precursor protein. Therefore, lithium has been proposed as a combined therapeutic agent, inhibiting both the hyperphosphorylation of tau and the production of Abeta. Here, we demonstrate that the inhibition of GSK3 by LiCl induced the nuclear translocation of beta-catenin in Chinese hamster ovary cells and rat cultured neurons, in which a decrease in tau phosphorylation was observed. In both cellular models, a nontoxic concentration of LiCl increased the production of Abeta by increasing the beta-cleavage of amyloid precursor protein, generating more substrate for an unmodified gamma-secretase activity. SB415286, another GSK3 inhibitor, induced the nuclear translocation of beta-catenin and slightly decreased Abeta production. It is concluded that the LiCl-mediated increase in Abeta production is not related to GSK3 inhibition.
Zwaferink, Heather; Stockinger, Silvia; Reipert, Siegfried; Decker, Thomas
2008-01-01
Murine macrophage death upon infection with Listeria monocytogenes was previously shown to be increased by beta interferon, produced by the infected cells. We saw that interferon-upregulated caspase activation or other interferon-inducible, death-associated proteins, including TRAIL, protein kinase R, and p53, were not necessary for cell death. Macrophage death was reduced when inducible nitric oxide synthase (iNOS) was inhibited during infection, and iNOS-deficient macrophages were less susc...
Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis
2018-01-01
Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
International Nuclear Information System (INIS)
Rothenberg, M.; Hanson, M.R.
1988-01-01
A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts
Activation of Beta-Catenin Signaling in Androgen Receptor–Negative Prostate Cancer Cells
Wan, Xinhai; Liu, Jie; Lu, Jing-Fang; Tzelepi, Vassiliki; Yang, Jun; Starbuck, Michael W.; Diao, Lixia; Wang, Jing; Efstathiou, Eleni; Vazquez, Elba S.; Troncoso, Patricia; Maity, Sankar N.; Navone, Nora M.
2012-01-01
Purpose To study Wnt/beta-catenin in castrate-resistant prostate cancer (CRPC) and understand its function independently of the beta-catenin–androgen receptor (AR) interaction. Experimental Design We performed beta-catenin immunocytochemical analysis, evaluated TOP-flash reporter activity (a reporter of beta-catenin–mediated transcription), and sequenced the beta-catenin gene in MDA PCa 118a, MDA PCa 118b, MDA PCa 2b, and PC-3 prostate cancer (PCa) cells. We knocked down beta-catenin in AR-negative MDA PCa 118b cells and performed comparative gene-array analysis. We also immunohistochemically analyzed beta-catenin and AR in 27 bone metastases of human CRPCs. Results Beta-catenin nuclear accumulation and TOP-flash reporter activity were high in MDA PCa 118b but not in MDA PCa 2b or PC-3 cells. MDA PCa 118a and 118b cells carry a mutated beta-catenin at codon 32 (D32G). Ten genes were expressed differently (false discovery rate, 0.05) in MDA PCa 118b cells with downregulated beta-catenin. One such gene, hyaluronan synthase 2 (HAS2), synthesizes hyaluronan, a core component of the extracellular matrix. We confirmed HAS2 upregulation in PC-3 cells transfected with D32G-mutant beta-catenin. Finally, we found nuclear localization of beta-catenin in 10 of 27 human tissue specimens; this localization was inversely associated with AR expression (P = 0.056, Fisher’s exact test), suggesting that reduced AR expression enables Wnt/beta-catenin signaling. Conclusion We identified a previously unknown downstream target of beta-catenin, HAS2, in PCa, and found that high beta-catenin nuclear localization and low or no AR expression may define a subpopulation of men with bone-metastatic PCa. These findings may guide physicians in managing these patients. PMID:22298898
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Ins1 Cre knock-in mice for beta cell-specific gene recombination
Thorens Bernard; Tarussio David; Maestro Miguel Angel; Maestro Miguel Angel; Rovira Meritxell; Rovira Meritxell; Heikkilä Eija; Ferrer Jorge; Ferrer Jorge; Ferrer Jorge
2013-01-01
Aims/hypothesis Pancreatic beta cells play a central role in the control of glucose homeostasis by secreting insulin to stimulate glucose uptake by peripheral tissues. Understanding the molecular mechanisms that control beta cell function and plasticity has critical implications for the pathophysiology and therapy of major forms of diabetes. Selective gene inactivation in pancreatic beta cells, using the Cre-lox system, is a powerful approach to assess the role of particular genes in beta cel...
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Morel, M; Authelet, M; Dedecker, R; Brion, J P
2010-06-02
The complex bi-directional axoplasmic transport of mitochondria is essential for proper metabolic functioning of neurons and is controlled by phosphorylation. We have investigated by time-lapse imaging the effects of increased expression of glycogen synthase kinase-3beta (GSK-3beta) and of the p25 activator of cyclin dependent kinase 5 on mitochondria movements in mammalian cortical neurons and in PC12 cells. Both GSK-3beta and p25 increased the stationary behaviour of mitochondria in PC12 and in neurons, decreased their anterograde transport but did not affect the intrinsic velocities of mitochondria. The microtubule-associated tau proteins were more phosphorylated in GSK-3beta and p25 transfected neurons, but ultrastructural observation showed that these cells still contained microtubules and nocodazole treatment further reduced residual mitochondria movements in GSK-3beta or p25 transfected neurons, indicating that microtubule disruption was not the primary cause of increased mitochondrial stationary behaviour in GSK-3beta or p25 transfected neurons. Our results suggest that increased expression of GSK-3beta and p25 acted rather by decreasing the frequency of mitochondrial movements driven by molecular motors and that GSK-3beta and p25 might regulate these transports by controlling the time that mitochondria spend pausing, rather than their velocities. Copyright 2010 IBRO. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Takahashi Takashi
2007-04-01
Full Text Available Abstract Background TGF-beta is one of the key cytokines implicated in various disease processes including cancer. TGF-beta inhibits growth and promotes apoptosis in normal epithelial cells and in contrast, acts as a pro-tumour cytokine by promoting tumour angiogenesis, immune-escape and metastasis. It is not clear if various actions of TGF-beta on normal and tumour cells are due to differential gene regulations. Hence we studied the regulation of gene expression by TGF-beta in normal and cancer cells. Results Using human 19 K cDNA microarrays, we show that 1757 genes are exclusively regulated by TGF-beta in A549 cells in contrast to 733 genes exclusively regulated in HPL1D cells. In addition, 267 genes are commonly regulated in both the cell-lines. Semi-quantitative and real-time qRT-PCR analysis of some genes agrees with the microarray data. In order to identify the signalling pathways that influence TGF-beta mediated gene regulation, we used specific inhibitors of p38 MAP kinase, ERK kinase, JNK kinase and integrin signalling pathways. The data suggest that regulation of majority of the selected genes is dependent on at least one of these pathways and this dependence is cell-type specific. Interestingly, an integrin pathway inhibitor, RGD peptide, significantly affected TGF-beta regulation of Thrombospondin 1 in A549 cells. Conclusion These data suggest major differences with respect to TGF-beta mediated gene regulation in normal and transformed cells and significant role of non-canonical TGF-beta pathways in the regulation of many genes by TGF-beta.
Ozone-induced gene expression occurs via ethylene-dependent and -independent signalling.
Grimmig, Bernhard; Gonzalez-Perez, Maria N; Leubner-Metzger, Gerhard; Vögeli-Lange, Regina; Meins, Fred; Hain, Rüdiger; Penuelas, Josep; Heidenreich, Bernd; Langebartels, Christian; Ernst, Dieter; Sandermann, Heinrich
2003-03-01
Recent studies suggest that ethylene is involved in signalling ozone-induced gene expression. We show here that application of ozone increased glucuronidase (GUS) expression of chimeric reporter genes regulated by the promoters of the tobacco class I beta-1,3-glucanases (GLB and Gln2) and the grapevine resveratrol synthase (Vst1) genes in transgenic tobacco leaves. 5'-deletion analysis of the class I beta-1,3-glucanase promoter revealed that ozone-induced gene regulation is mainly mediated by the distal enhancer region containing the positively acting ethylene-responsive element (ERE). In addition, application of 1-methylcyclopropene (1-MCP), an inhibitor of ethylene action, blocked ozone-induced class I beta-1,3-glucanase promoter activity. Enhancer activity and ethylene-responsiveness depended on the integrity of the GCC boxes, cis-acting elements present in the ERE of the class I beta-1,3-glucanase and the basic-type pathogenesis-related PR-1 protein (PRB-1b) gene promoters. The minimal PRB-1b promoter containing only the ERE with intact GCC boxes, was sufficient to confer 10-fold ozone inducibility to a GUS-reporter gene, while a substitution mutation in the GCC box abolished ozone responsiveness. The ERE region of the class I beta-1,3-glucanase promoter containing two intact GCC boxes confered strong ozone inducibility to a minimal cauliflower mosaic virus (CaMV) 35S RNA promoter, whereas two single-base substitution in the GCC boxes resulted in a complete loss of ozone inducibility. Taken together, these datastrongly suggest that ethylene is signalling ozone-induced expression of class I beta-l,3-glucanase and PRB-1b genes. Promoter analysis of the stilbene synthase Vst1 gene unravelled different regions for ozone and ethylene-responsiveness. Application of 1-MCP blocked ethylene-induced Vst1 induction, but ozone induction was not affected. This shows that ozone-induced gene expression occurs via at least two different signalling mechanisms and suggests an
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.
Raftopoulos, H; Ward, M; Leboulch, P; Bank, A
1997-11-01
Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza
2015-02-01
To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Raftopoulos, H; Ward, M; Bank, A
1998-06-30
Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.
Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.
Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen
2005-04-01
The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Directory of Open Access Journals (Sweden)
Li Lin
2012-12-01
Full Text Available Abstract Background Irritable bowel syndrome (IBS is characterized by chronic visceral hyperalgesia (CVH that manifested with persistent or recurrent abdominal pain and altered bowel movement. However, the pathogenesis of the CVH remains unknown. The aim of this study was to investigate roles of endogenous hydrogen sulfide (H2S producing enzyme cystathionine beta-synthetase (CBS and p65 nuclear factor-kappa B subunits in CVH. Results CVH was induced by neonatal maternal deprivation (NMD in male rats on postnatal days 2–15 and behavioral experiments were conducted at the age of 7–15 weeks. NMD significantly increased expression of CBS in colon-innervating DRGs from the 7th to 12th week. This change in CBS express is well correlated with the time course of enhanced visceromoter responses to colorectal distention (CRD, an indicator of visceral pain. Administration of AOAA, an inhibitor of CBS, produced a dose-dependent antinociceptive effect on NMD rats while it had no effect on age-matched healthy control rats. AOAA also reversed the enhanced neuronal excitability seen in colon-innervating DRGs. Application of NaHS, a donor of H2S, increased excitability of colon-innervating DRG neurons acutely dissociated from healthy control rats. Intrathecal injection of NaHS produced an acute visceral hyperalgesia. In addition, the content of p65 in nucleus was remarkably higher in NMD rats than that in age-matched controls. Intrathecal administration of PDTC, an inhibitor of p65, markedly reduced expression of CBS and attenuated nociceptive responses to CRD. Conclusion The present results suggested that upregulation of CBS expression, which is mediated by activation of p65, contributes to NMD-induced CVH. This pathway might be a potential target for relieving CVH in patients with IBS.
Molecular identification of TEM-116 beta-lactamase gene in isolates ...
African Journals Online (AJOL)
Purpose: Purpose: To determine TEM-116 beta-lactamase gene prevalence in drug-resistant Pseudomonas aeruginosa isolates from Pakistan. Methods: Sequence analysis of TEM beta-lactamase isolates and their antibiotic susceptibility patterns were carried out. Quantitative bacteriostatic concentrations for commonly ...
Directory of Open Access Journals (Sweden)
R. Vasudevan
2014-06-01
Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.
CTP limitation increases expression of CTP synthase in Lactococcus lactis
DEFF Research Database (Denmark)
Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan
2003-01-01
CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...
Co-ordinate regulation of genes involved in storage lipid mobilization in Arabidopsis thaliana.
Rylott, E L; Hooks, M A; Graham, I A
2001-05-01
Molecular genetic approaches in the model plant Arabidopsis thaliana (Col0) are shedding new light on the role and control of the pathways associated with the mobilization of lipid reserves during oilseed germination and post-germinative growth. Numerous independent studies have reported on the expression of individual genes encoding enzymes from the three major pathways: beta-oxidation, the glyoxylate cycle and gluconeogenesis. However, a single comprehensive study of representative genes and enzymes from the different pathways in a single plant species has not been done. Here we present results from Arabidopsis that demonstrate the co-ordinate regulation of gene expression and enzyme activities for the acyl-CoA oxidase- and 3-ketoacyl-CoA thiolase-mediated steps of beta-oxidation, the isocitrate lyase and malate synthase steps of the glyoxylate cycle and the phosphoenolpyruvate carboxykinase step of gluconeogenesis. The mRNA abundance and enzyme activities increase to a peak at stage 2, 48 h after the onset of seed germination, and decline thereafter either to undetectable levels (for malate synthase and isocitrate lyase) or low basal levels (for the genes of beta-oxidation and gluconeogenesis). The co-ordinate induction of all these genes at the onset of germination raises the possibility that a global regulatory mechanism operates to induce the expression of genes associated with the mobilization of storage reserves during the heterotrophic growth period.
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT
Directory of Open Access Journals (Sweden)
Mariateresa eVolpicella
2016-03-01
Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
Cystathionine γ-lyase deficiency mediates neurodegeneration in Huntington’s disease
Paul, Bindu D.; Sbodio, Juan I.; Xu, Risheng; Vandiver, M. Scott; Cha, Jiyoung Y.; Snowman, Adele M.; Snyder, Solomon H.
2015-01-01
Huntington’s disease is an autosomal dominant disease associated with a mutation in the gene encoding huntingtin (Htt) leading to expanded polyglutamine repeats of mutant Htt (mHtt) that elicit oxidative stress, neurotoxicity, and motor and behavioural changes1. Huntington’s disease is characterized by highly selective and profound damage to the corpus striatum, which regulates motor function. Striatal selectivity of Huntington’s disease may reflect the striatally selective small G protein Rhes binding to mHtt and enhancing its neurotoxicity2. Specific molecular mechanisms by which mHtt elicits neurodegeneration have been hard to determine. Here we show a major depletion of cystathionine γ-lyase (CSE), the biosynthetic enzyme for cysteine, in Huntington’s disease tissues, which may mediate Huntington’s disease pathophysiology. The defect occurs at the transcriptional level and seems to reflect influences of mHtt on specificity protein 1, a transcriptional activator for CSE. Consistent with the notion of loss of CSE as a pathogenic mechanism, supplementation with cysteine reverses abnormalities in cultures of Huntington’s disease tissues and in intact mouse models of Huntington’s disease, suggesting therapeutic potential. PMID:24670645
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
Regional and temporal differences in gene expression of LH(BETA)T(AG) retinoblastoma tumors.
Houston, Samuel K; Pina, Yolanda; Clarke, Jennifer; Koru-Sengul, Tulay; Scott, William K; Nathanson, Lubov; Schefler, Amy C; Murray, Timothy G
2011-07-23
The purpose of this study was to evaluate by microarray the hypothesis that LH(BETA)T(AG) retinoblastoma tumors exhibit regional and temporal variations in gene expression. LH(BETA)T(AG) mice aged 12, 16, and 20 weeks were euthanatized (n = 9). Specimens were taken from five tumor areas (apex, anterior lateral, center, base, and posterior lateral). Samples were hybridized to gene microarrays. The data were preprocessed and analyzed, and genes with a P 2.5 were considered to be differentially expressed. Differentially expressed genes were analyzed for overlap with known networks by using pathway analysis tools. There were significant temporal (P regional differences in gene expression for LH(BETA)T(AG) retinoblastoma tumors. At P 2.5, there were significant changes in gene expression of 190 genes apically, 84 genes anterolaterally, 126 genes posteriorly, 56 genes centrally, and 134 genes at the base. Differentially expressed genes overlapped with known networks, with significant involvement in regulation of cellular proliferation and growth, response to oxygen levels and hypoxia, regulation of cellular processes, cellular signaling cascades, and angiogenesis. There are significant temporal and regional variations in the LH(BETA)T(AG) retinoblastoma model. Differentially expressed genes overlap with key pathways that may play pivotal roles in murine retinoblastoma development. These findings suggest the mechanisms involved in tumor growth and progression in murine retinoblastoma tumors and identify pathways for analysis at a functional level, to determine significance in human retinoblastoma. Microarray analysis of LH(BETA)T(AG) retinal tumors showed significant regional and temporal variations in gene expression, including dysregulation of genes involved in hypoxic responses and angiogenesis.
DEFF Research Database (Denmark)
Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo
2016-01-01
identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Mariela V Catone
Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.
Amour, Julien; Loyer, Xavier; Le Guen, Morgan; Mabrouk, Nejma; David, Jean-Stéphane; Camors, Emmanuel; Carusio, Nunzia; Vivien, Benoît; Andriantsitohaina, Ramaroson; Heymes, Christophe; Riou, Bruno
2007-09-01
In the diabetic heart, the positive inotropic response to beta-adrenoceptor stimulation is altered and beta1 and beta2 adrenoceptors are down-regulated, whereas beta3 adrenoceptor is up-regulated. In heart failure, beta3-adrenoceptor stimulation induces a negative inotropic effect that results from endothelial nitric oxide synthase (NOS3)-derived nitric oxide production. The objective of our study was to investigate the role of beta3-adrenoceptor in diabetic cardiomyopathy. beta-Adrenergic responses were investigated in vivo (dobutamine echocardiography) and in vitro (left ventricular papillary muscle) in healthy and streptozotocin-induced diabetic rats. The effect of beta3-adrenoceptor inhibition on the inotropic response was studied in vitro. Immunoblots and NOS activities were performed in heart homogenates (electron paramagnetic resonance) and isolated cardiomyocytes. Data are mean percentage of baseline +/- SD. The impaired positive inotropic effect was confirmed in diabetes both in vivo (121 +/- 15% vs. 160 +/- 16%; P < 0.05) and in vitro (112 +/- 5% vs. 179 +/- 15%; P < 0.05). In healthy rat, the positive inotropic effect was not significantly modified in presence of beta3-adrenoceptor antagonist (174 +/- 20%), nonselective NOS inhibitor (N -nitro-l-arginine methylester [l-NAME]; 183 +/- 19%), or selective NOS1 inhibitor (vinyl-l-N-5-(1-imino-3-butenyl)-l-ornithine [l-VNIO]; 172 +/- 13%). In diabetes, in parallel with the increase in beta3-adrenoceptor protein expression, the positive inotropic effect was partially restored by beta3-adrenoceptor antagonist (137 +/- 8%; P < 0.05), l-NAME (133 +/- 11%; P < 0.05), or l-VNIO (130 +/- 13%; P < 0.05). Nitric oxide was exclusively produced by NOS1 within diabetic cardiomyocytes. NOS2 and NOS3 proteins were undetectable. beta3-Adrenoceptor is involved in altered positive inotropic response to beta-adrenoceptor stimulation in diabetic cardiomyopathy. This effect is mediated by NOS1-derived nitric oxide in diabetic
In silico identification of NF-kappaB-regulated genes in pancreatic beta-cells
Directory of Open Access Journals (Sweden)
Eizirik Decio L
2007-02-01
Full Text Available Abstract Background Pancreatic beta-cells are the target of an autoimmune attack in type 1 diabetes mellitus (T1DM. This is mediated in part by cytokines, such as interleukin (IL-1β and interferon (IFN-γ. These cytokines modify the expression of hundreds of genes, leading to beta-cell dysfunction and death by apoptosis. Several of these cytokine-induced genes are potentially regulated by the IL-1β-activated transcription factor (TF nuclear factor (NF-κB, and previous studies by our group have shown that cytokine-induced NF-κB activation is pro-apoptotic in beta-cells. To identify NF-κB-regulated gene networks in beta-cells we presently used a discriminant analysis-based approach to predict NF-κB responding genes on the basis of putative regulatory elements. Results The performance of linear and quadratic discriminant analysis (LDA, QDA in identifying NF-κB-responding genes was examined on a dataset of 240 positive and negative examples of NF-κB regulation, using stratified cross-validation with an internal leave-one-out cross-validation (LOOCV loop for automated feature selection and noise reduction. LDA performed slightly better than QDA, achieving 61% sensitivity, 91% specificity and 87% positive predictive value, and allowing the identification of 231, 251 and 580 NF-κB putative target genes in insulin-producing INS-1E cells, primary rat beta-cells and human pancreatic islets, respectively. Predicted NF-κB targets had a significant enrichment in genes regulated by cytokines (IL-1β or IL-1β + IFN-γ and double stranded RNA (dsRNA, as compared to genes not regulated by these NF-κB-dependent stimuli. We increased the confidence of the predictions by selecting only evolutionary stable genes, i.e. genes with homologs predicted as NF-κB targets in rat, mouse, human and chimpanzee. Conclusion The present in silico analysis allowed us to identify novel regulatory targets of NF-κB using a supervised classification method based on
Crofton, Elizabeth J.; Nenov, Miroslav N.; Zhang, Yafang; Scala, Federico; Page, Sean A.; McCue, David L.; Li, Dingge; Hommel, Jonathan D.; Laezza, Fernanda; Green, Thomas A.
2017-01-01
Psychiatric disorders such as anxiety, depression and addiction are often comorbid brain pathologies thought to share common mechanistic biology. As part of the cortico-limbic circuit, the nucleus accumbens shell (NAcSh) plays a fundamental role in integrating information in the circuit, such that modulation of NAcSh circuitry alters anxiety, depression, and addiction-related behaviors. Intracellular kinase cascades in the NAcSh have proven important mediators of behavior. To investigate glycogen-synthase kinase 3 (GSK3) beta signaling in the NAcSh in vivo we knocked down GSK3beta expression with a novel adeno-associated viral vector (AAV2) and assessed changes in anxiety- and depression-like behavior and cocaine self-administration in GSK3beta knockdown rats. GSK3beta knockdown reduced anxiety-like behavior while increasing depression-like behavior and cocaine self-administration. Correlative electrophysiological recordings in acute brain slices were used to assess the effect of AAV-shGSK3beta on spontaneous firing and intrinsic excitability of tonically active interneurons (TANs), cells required for input and output signal integration in the NAcSh and for processing reward-related behaviors. Loose-patch recordings showed that TANs transduced by AAV-shGSK3beta exhibited reduction in tonic firing and increased spike half width. When assessed by whole-cell patch clamp recordings these changes were mirrored by reduction in action potential firing and accompanied by decreased hyperpolarization-induced depolarizing sag potentials, increased action potential current threshold, and decreased maximum rise time. These results suggest that silencing of GSK3beta in the NAcSh increases depression- and addiction-related behavior, possibly by decreasing intrinsic excitability of TANs. However, this study does not rule out contributions from other neuronal sub-types. PMID:28126496
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Sun, Xin; Huang, Luqi; Zhang, Min; Sun, Shenggang; Wu, Yan
2010-01-01
Dopaminergic neurons are lost mainly through apoptosis in Parkinson's disease. Insulin like growth factor-1 (IGF-1) inhibits apoptosis in a wide variety of tissues. Here we have shown that IGF-1 protects PC12 cells from toxic effects of 1-methyl-4-phenylpyridiniumion (MPP + ). Treatment of PC12 cells with recombinant human IGF-1 significantly decreased apoptosis caused by MPP + as measured by acridine orange/ethidium bromide staining. IGF-1 treatment induced sustained phosphorylation of glycogen synthase kinase-3beta (GSK-3beta) as shown by western blot analysis. The anti-apoptotic effect of IGF-1 was abrogated by LY294002, which indirectly inhibits phosphorylation of GSK-3beta. Lithium chloride (LiCl), a known inhibitor of GSK-3beta, also blocked MPP + -induced apoptosis. Finally, although IGF-1 enhanced phosphorylation of extracellular signal-regulated kinases ERK1 and 2 (ERK1/2), PD98059, a specific inhibitor of ERK1/2, did not alter the survival effect of IGF-1. Thus, our findings indicate that IGF-1 protects PC12 cells exposed to MPP + from apoptosis via the GSK-3beta signaling pathway.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Creelman, R A; Mullet, J E
1991-10-01
Transfer of soybean seedlings to low-water-potential vermiculite (psi w = -0.3 MPa) results in a reversible decrease in hypocotyl growth and modulation of several polysomal mRNAs (Plant Physiol 92: 205-214). We report here the isolation of two cDNA clones (pGE16 and pGE95) which correspond to genes whose mRNA levels are increased, and one cDNA clone (pGE23) which corresponds to a gene whose mRNA level is decreased in the hypocotyl zone of cell elongation by water deficit. In well-watered seedlings mRNAs hybridizing to pGE16 and pGE95 are most abundant in mature regions of the seedling, but in water-deficient seedlings mRNA levels are reduced in mature regions and enhanced in elongating regions. RNA corresponding to soybean proline-rich protein 1 (sbPRP1) shows a similar tissue distribution and response to water deficit. In contrast, in well-watered seedlings, the gene corresponding to pGE23 was highly expressed in the hypocotyl and root growing zones. Transfer of seedlings to low-water-potential vermiculite caused a rapid decrease in mRNA hybridizing to pGE23. Sequence analysis revealed that pGE23 has high homology with beta-tubulin. Water deficit also reduced the level of mRNA hybridizing to JCW1, an auxin-modulated gene, although with different kinetics. Furthermore, mRNA encoding actin, glycine-rich proteins (GRPs), and hydroxyproline-rich glycoproteins (HRGPs) were down-regulated in the hypocotyl zone of elongation of seedlings exposed to water deficit. No effect of water deficit was observed on the expression of chalcone synthase. Decreased expression of beta-tubulin, actin, JCW1, HRGP and GRP and increased expression of sbPRP1, pGE95 and pGE16 in the hypocotyl zone of cell elongation could participate in the reversible growth inhibition observed in water-deficient soybean seedlings.
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2017-08-09
Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.
Transcriptional regulation of Saccharomyces cerevisiaeCYS3 encoding cystathionine γ-lyase
Hiraishi, Hiroyuki; Miyake, Tsuyoshi
2008-01-01
In studying the regulation of GSH11, the structural gene of the high-affinity glutathione transporter (GSH-P1) in Saccharomyces cerevisiae, a cis-acting cysteine responsive element, CCGCCACAC (CCG motif), was detected. Like GSH-P1, the cystathionine γ-lyase encoded by CYS3 is induced by sulfur starvation and repressed by addition of cysteine to the growth medium. We detected a CCG motif (−311 to −303) and a CGC motif (CGCCACAC; −193 to −186), which is one base shorter than the CCG motif, in the 5′-upstream region of CYS3. One copy of the centromere determining element 1, CDE1 (TCACGTGA; −217 to −210), being responsible for regulation of the sulfate assimilation pathway genes, was also detected. We tested the roles of these three elements in the regulation of CYS3. Using a lacZ-reporter assay system, we found that the CCG/CGC motif is required for activation of CYS3, as well as for its repression by cysteine. In contrast, the CDE1 motif was responsible for only activation of CYS3. We also found that two transcription factors, Met4 and VDE, are responsible for activation of CYS3 through the CCG/CGC and CDE1 motifs. These observations suggest a dual regulation of CYS3 by factors that interact with the CDE1 motif and the CCG/CGC motifs. PMID:18317767
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Crystal structure of riboflavin synthase
Energy Technology Data Exchange (ETDEWEB)
Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)
2010-03-05
Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.
Urreizti, Roser; Asteggiano, Carla; Bermudez, Marta; Córdoba, Alfonso; Szlago, Marina; Szlago, Mariana; Grosso, Carola; de Kremer, Raquel Dodelson; Vilarinho, Laura; D'Almeida, Vania; Martínez-Pardo, Mercedes; Peña-Quintana, Luís; Dalmau, Jaime; Bernal, Jaime; Briceño, Ignacio; Couce, María Luz; Rodés, Marga; Vilaseca, Maria Antonia; Balcells, Susana; Grinberg, Daniel
2006-01-01
Classical homocystinuria is due to cystathionine beta-synthase (CBS) deficiency. More than 130 mutations, which differ in prevalence and severity, have been described at the CBS gene. Mutation p.I278T is very prevalent, has been found in all European countries where it has been looked for with the exception of the Iberian peninsula, and is known to respond to vitamin B6. On the other hand, mutation p.T191M is prevalent in Spain and Portugal and does not respond to B6. We analysed 30 pedigrees from Spain, Portugal, Colombia and Argentina, segregating for homocystinuria. The p.T191M mutation was detected in patients from all four countries and was particularly prevalent in Colombia. The number of p.T191M alleles described in this study, together with those previously published, is 71. The prevalence of p.T191M among CBS mutant alleles in the different countries was: 0.75 in Colombia, 0.52 in Spain, 0.33 in Portugal, 0.25 in Venezuela, 0.20 in Argentina and 0.14 in Brazil. Haplotype analyses suggested a double origin for this mutation. No genotype-phenotype correlation other than the B6-nonresponsiveness could be established for the p.T191M mutation. Additionally, three new mutations, p.M173V, p.I429del and c.69_70+8del10, were found. The p.M173V was associated with a mild, B6-responsive, phenotype.
Directory of Open Access Journals (Sweden)
Gnanasambandan Ramanathan
2017-01-01
Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.
Ma, Xueyan; Panjikar, Santosh; Koepke, Juergen; Loris, Elke; Stöckigt, Joachim
2006-04-01
The enzyme strictosidine synthase (STR1) from the Indian medicinal plant Rauvolfia serpentina is of primary importance for the biosynthetic pathway of the indole alkaloid ajmaline. Moreover, STR1 initiates all biosynthetic pathways leading to the entire monoterpenoid indole alkaloid family representing an enormous structural variety of approximately 2000 compounds in higher plants. The crystal structures of STR1 in complex with its natural substrates tryptamine and secologanin provide structural understanding of the observed substrate preference and identify residues lining the active site surface that contact the substrates. STR1 catalyzes a Pictet-Spengler-type reaction and represents a novel six-bladed beta-propeller fold in plant proteins. Structure-based sequence alignment revealed a common repetitive sequence motif (three hydrophobic residues are followed by a small residue and a hydrophilic residue), indicating a possible evolutionary relationship between STR1 and several sequence-unrelated six-bladed beta-propeller structures. Structural analysis and site-directed mutagenesis experiments demonstrate the essential role of Glu-309 in catalysis. The data will aid in deciphering the details of the reaction mechanism of STR1 as well as other members of this enzyme family.
Chen, Yong; Boettger, Michael K; Reif, Andreas; Schmitt, Angelika; Uçeyler, Nurcan; Sommer, Claudia
2010-03-02
Although it has been largely demonstrated that nitric oxide synthase (NOS), a key enzyme for nitric oxide (NO) production, modulates inflammatory pain, the molecular mechanisms underlying these effects remain to be clarified. Here we asked whether cytokines, which have well-described roles in inflammatory pain, are downstream targets of NO in inflammatory pain and which of the isoforms of NOS are involved in this process. Intraperitoneal (i.p.) pretreatment with 7-nitroindazole sodium salt (7-NINA, a selective neuronal NOS inhibitor), aminoguanidine hydrochloride (AG, a selective inducible NOS inhibitor), L-N(G)-nitroarginine methyl ester (L-NAME, a non-selective NOS inhibitor), but not L-N(5)-(1-iminoethyl)-ornithine (L-NIO, a selective endothelial NOS inhibitor), significantly attenuated thermal hyperalgesia induced by intraplantar (i.pl.) injection of complete Freund's adjuvant (CFA). Real-time reverse transcription-polymerase chain reaction (RT-PCR) revealed a significant increase of nNOS, iNOS, and eNOS gene expression, as well as tumor necrosis factor-alpha (TNF), interleukin-1 beta (IL-1beta), and interleukin-10 (IL-10) gene expression in plantar skin, following CFA. Pretreatment with the NOS inhibitors prevented the CFA-induced increase of the pro-inflammatory cytokines TNF and IL-1beta. The increase of the anti-inflammatory cytokine IL-10 was augmented in mice pretreated with 7-NINA or L-NAME, but reduced in mice receiving AG or L-NIO. NNOS-, iNOS- or eNOS-knockout (KO) mice had lower gene expression of TNF, IL-1beta, and IL-10 following CFA, overall corroborating the inhibitor data. These findings lead us to propose that inhibition of NOS modulates inflammatory thermal hyperalgesia by regulating cytokine expression.
Beta-cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene
DEFF Research Database (Denmark)
Efrat, S; Linde, S; Kofod, Hans
1988-01-01
Three pancreatic beta-cell lines have been established from insulinomas derived from transgenic mice carrying a hybrid insulin-promoted simian virus 40 tumor antigen gene. The beta tumor cell (beta TC) lines maintain the features of differentiated beta cells for about 50 passages in culture. The ...... both to immortalize a rare cell type and to provide a selection for the maintenance of its differentiated phenotype....
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Energy Technology Data Exchange (ETDEWEB)
Pejcha, Robert; Ludwig, Martha L. (Michigan)
2010-03-08
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...
Regulation of laminin beta2 chain gene expression in human cancer cell lines
DEFF Research Database (Denmark)
Durkin, M E; Nielsen, F C; Loechel, F
2001-01-01
of the human laminin beta2 chain gene generates two isoforms of the 5' untranslated region of the beta2 chain mRNA. The translational efficiencies of the two laminin beta2 chain leaders did not differ significantly, when assayed by polysome profile analysis of endogenous clone A cell beta2 chain m......RNA, transient transfection of chimeric beta2 chain leader/luciferase expression plasmids in clone A cells, and translation of in vitro synthesized RNAs in rabbit reticulocyte lysates....
Li, Yang I; Kong, Lesheng; Ponting, Chris P; Haerty, Wilfried
2013-01-01
Sequencing of vertebrate genomes permits changes in distinct protein families, including gene gains and losses, to be ascribed to lineage-specific phenotypes. A prominent example of this is the large-scale duplication of beta-keratin genes in the ancestors of birds, which was crucial to the subsequent evolution of their beaks, claws, and feathers. Evidence suggests that the shell of Pseudomys nelsoni contains at least 16 beta-keratins proteins, but it is unknown whether this is a complete set and whether their corresponding genes are orthologous to avian beak, claw, or feather beta-keratin genes. To address these issues and to better understand the evolution of the turtle shell at a molecular level, we surveyed the diversity of beta-keratin genes from the genome assemblies of three turtles, Chrysemys picta, Pelodiscus sinensis, and Chelonia mydas, which together represent over 160 Myr of chelonian evolution. For these three turtles, we found 200 beta-keratins, which indicate that, as for birds, a large expansion of beta-keratin genes in turtles occurred concomitantly with the evolution of a unique phenotype, namely, their plastron and carapace. Phylogenetic reconstruction of beta-keratin gene evolution suggests that separate waves of gene duplication within a single genomic location gave rise to scales, claws, and feathers in birds, and independently the scutes of the shell in turtles.
DEFF Research Database (Denmark)
Costa, M C; Helweg-Larsen, J; Lundgren, Bettina
2003-01-01
The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)
Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru
2018-04-01
Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.
Oxidative Metabolism Genes Are Not Responsive to Oxidative Stress in Rodent Beta Cell Lines
Directory of Open Access Journals (Sweden)
Faer Morrison
2012-01-01
Full Text Available Altered expression of oxidative metabolism genes has been described in the skeletal muscle of individuals with type 2 diabetes. Pancreatic beta cells contain low levels of antioxidant enzymes and are particularly susceptible to oxidative stress. In this study, we explored the effect of hyperglycemia-induced oxidative stress on a panel of oxidative metabolism genes in a rodent beta cell line. We exposed INS-1 rodent beta cells to low (5.6 mmol/L, ambient (11 mmol/L, and high (28 mmol/L glucose conditions for 48 hours. Increases in oxidative stress were measured using the fluorescent probe dihydrorhodamine 123. We then measured the expression levels of a panel of 90 oxidative metabolism genes by real-time PCR. Elevated reactive oxygen species (ROS production was evident in INS-1 cells after 48 hours (P<0.05. TLDA analysis revealed a significant (P<0.05 upregulation of 16 of the 90 genes under hyperglycemic conditions, although these expression differences did not reflect differences in ROS. We conclude that although altered glycemia may influence the expression of some oxidative metabolism genes, this effect is probably not mediated by increased ROS production. The alterations to the expression of oxidative metabolism genes previously observed in human diabetic skeletal muscle do not appear to be mirrored in rodent pancreatic beta cells.
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Directory of Open Access Journals (Sweden)
Zhong Tao P
2007-07-01
Full Text Available Abstract Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish. Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3 and duplicate genes for beta4 (zbeta4.1, zbeta4.2. Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Noar, Roslyn D; Daub, Margaret E
2016-01-01
Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Directory of Open Access Journals (Sweden)
Roslyn D Noar
Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Energy Technology Data Exchange (ETDEWEB)
Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others
1994-09-01
A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.
DEFF Research Database (Denmark)
Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S
2008-01-01
Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
RFLP for the human retinoic acid receptor gene RAR-. beta
Energy Technology Data Exchange (ETDEWEB)
Datson, N A; Oostra, B A [Erasmus Univ., Rotterdam (Netherlands); van der Saag, P T [Netherlands Institute for Developmental Biology, Utrecht (Netherlands)
1989-11-11
1.4 kb Mae I fragment containing the entire RAR-{beta} ORF was cloned into the Sma I site of pTZ18U, yielding the plasmid pCOD20. Msp I digestion of genomic DNA and hybridization with the pCOD20 probe detects a two allele polymorphism with allelic fragments of 8.1 and 7.7 kb. The human RAR-{beta} gene has been localized to the p24 band of chromosome 3. Co-dominant segregation of the alleles was observed in 4 Caucasian families.
Energy Technology Data Exchange (ETDEWEB)
Pestov, Nikolay B. [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry, Moscow 117997 (Russian Federation); Zhao, Hao [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States); Basrur, Venkatesha [Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109 (United States); Modyanov, Nikolai N., E-mail: nikolai.modyanov@utoledo.edu [Department of Physiology and Pharmacology, University of Toledo College of Medicine, 3000 Arlington Ave., Toledo, OH 43614 (United States)
2011-09-09
Highlights: {yields} Structural properties of BetaM and Na,K-ATPase {beta}-subunits are sharply different. {yields} BetaM protein is concentrated in nuclear membrane of skeletal myocytes. {yields} BetaM does not associate with a Na,K-ATPase {alpha}-subunit in skeletal muscle. {yields} Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. {yields} BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a {beta}-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase {beta}-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du
2015-11-01
The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
An Arabidopsis callose synthase
DEFF Research Database (Denmark)
Ostergaard, Lars; Petersen, Morten; Mattsson, Ole
2002-01-01
in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....
Directory of Open Access Journals (Sweden)
Ashley T Martino
2009-08-01
Full Text Available Hepatic gene transfer, in particular using adeno-associated viral (AAV vectors, has been shown to induce immune tolerance to several protein antigens. This approach has been exploited in animal models of inherited protein deficiency for systemic delivery of therapeutic proteins. Adequate levels of transgene expression in hepatocytes induce a suppressive T cell response, thereby promoting immune tolerance. This study addresses the question of whether AAV gene transfer can induce tolerance to a cytoplasmic protein.AAV-2 vector-mediated hepatic gene transfer for expression of cytoplasmic beta-galactosidase (beta-gal was performed in immune competent mice, followed by a secondary beta-gal gene transfer with E1/E3-deleted adenoviral Ad-LacZ vector to provoke a severe immunotoxic response. Transgene expression from the AAV-2 vector in approximately 2% of hepatocytes almost completely protected from inflammatory T cell responses against beta-gal, eliminated antibody formation, and significantly reduced adenovirus-induced hepatotoxicity. Consequently, approximately 10% of hepatocytes continued to express beta-gal 45 days after secondary Ad-LacZ gene transfer, a time point when control mice had lost all Ad-LacZ derived expression. Suppression of inflammatory T cell infiltration in the liver and liver damage was linked to specific transgene expression and was not seen for secondary gene transfer with Ad-GFP. A combination of adoptive transfer studies and flow cytometric analyses demonstrated induction of Treg that actively suppressed CD8(+ T cell responses to beta-gal and that was amplified in liver and spleen upon secondary Ad-LacZ gene transfer.These data demonstrate that tolerance induction by hepatic AAV gene transfer does not require systemic delivery of the transgene product and that expression of a cytoplasmic neo-antigen in few hepatocytes can induce Treg and provide long-term suppression of inflammatory responses and immunotoxicity.
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Regulation of homocysteine metabolism and methylation in human and mouse tissues
Chen, Natalie C.; Yang, Fan; Capecci, Louis M.; Gu, Ziyu; Schafer, Andrew I.; Durante, William; Yang, Xiao-Feng; Wang, Hong
2010-01-01
Hyperhomocysteinemia is an independent risk factor for cardiovascular disease. Homocysteine (Hcy) metabolism involves multiple enzymes; however, tissue Hcy metabolism and its relevance to methylation remain unknown. Here, we established gene expression profiles of 8 Hcy metabolic and 12 methylation enzymes in 20 human and 19 mouse tissues through bioinformatic analysis using expression sequence tag clone counts in tissue cDNA libraries. We analyzed correlations between gene expression, Hcy, S-adenosylhomocysteine (SAH), and S-adenosylmethionine (SAM) levels, and SAM/SAH ratios in mouse tissues. Hcy metabolic and methylation enzymes were classified into two types. The expression of Type 1 enzymes positively correlated with tissue Hcy and SAH levels. These include cystathionine β-synthase, cystathionine-γ-lyase, paraxonase 1, 5,10-methylenetetrahydrofolate reductase, betaine:homocysteine methyltransferase, methionine adenosyltransferase, phosphatidylethanolamine N-methyltransferases and glycine N-methyltransferase. Type 2 enzyme expressions correlate with neither tissue Hcy nor SAH levels. These include SAH hydrolase, methionyl-tRNA synthase, 5-methyltetrahydrofolate:Hcy methyltransferase, S-adenosylmethionine decarboxylase, DNA methyltransferase 1/3a, isoprenylcysteine carboxyl methyltransferases, and histone-lysine N-methyltransferase. SAH is the only Hcy metabolite significantly correlated with Hcy levels and methylation enzyme expression. We established equations expressing combined effects of methylation enzymes on tissue SAH, SAM, and SAM/SAH ratios. Our study is the first to provide panoramic tissue gene expression profiles and mathematical models of tissue methylation regulation.—Chen, N. C., Yang, F., Capecci, L. M., Gu, Z., Schafer, A. I., Durante, W., Yang, X.-F., Wang, H. Regulation of homocysteine metabolism and methylation in human and mouse tissues. PMID:20305127
Chen, Xi; Sun, Weiwen; Pan, Ying; Yang, Quan; Cao, Kaiyi; Zhang, Jin; Zhang, Yizhi; Chen, Mincong; Chen, Feidi; Huang, Yueling; Dai, Lijun; Chen, Shengqiang
2013-10-01
To investigate whether lithium modifies open-field and elevated plus maze behavior, and brain phospho-glycogen synthase kinase 3 (P-GSK3beta) expression in Fmr1 knockout mice. One hundred and eighty FVB mice, including knockout and wild type, with an age of 30 days were used. An open-field and elevated plus maze was utilized to test behavior, while western blot was used to measure the P-GSK3beta expression. Six groups were formed: control (saline), lithium chloride 30, 60, 90, 120, and 200 mg/kg. The experiments were carried out in the Institute of Neuroscience, Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China between January and June 2012. Lithium significantly decreased total distance, crossing, central area time, and center entry in the open-field test (popen-arm tracking, open-arm entry, and open-arm time in the elevated plus maze (popen-field and elevated plus maze behaviors of Fmr1 knockout mice. This effect may be related to its enhancement of P-GSK3beta expression. Our findings suggest that lithium might have a therapeutic effect in fragile X syndrome.
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang
2008-11-18
To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.
Lee, K H; Song, S U; Hwang, T S; Yi, Y; Oh, I S; Lee, J Y; Choi, K B; Choi, M S; Kim, S J
2001-09-20
Transforming growth factor beta (TGF-beta) has been considered as a candidate for gene therapy of orthopedic diseases. The possible application of cell-mediated TGF-beta gene therapy as a new treatment regimen for degenerative arthritis was investigated. In this study, fibroblasts expressing active TGF-beta 1 were injected into the knee joints of rabbits with artificially made cartilage defects to evaluate the feasibility of this therapy for orthopedic diseases. Two to 3 weeks after the injection there was evidence of cartilage regeneration, and at 4 to 6 weeks the cartilage defect was completely filled with newly grown hyaline cartilage. Histological analyses of the regenerated cartilage suggested that it was well integrated with the adjacent normal cartilage at the sides of the defect and that the newly formed tissue was indeed hyaline cartilage. Our findings suggest that cell-mediated TGF-beta 1 gene therapy may be a novel treatment for orthopedic diseases in which hyaline cartilage damage has occurred.
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni
2004-12-01
Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.
Naujok, Ortwin; Lentes, Jana; Diekmann, Ulf; Davenport, Claudia; Lenzen, Sigurd
2014-04-29
Small membrane-permeable molecules are now widely used during maintenance and differentiation of embryonic stem cells of different species. In particular the glycogen synthase kinase 3 (GSK3) is an interesting target, since its chemical inhibition activates the Wnt/beta-catenin pathway. In the present comparative study four GSK3 inhibitors were characterized. Cytotoxicity and potential to activate the Wnt/beta-catenin pathway were tested using the commonly used GSK3 inhibitors BIO, SB-216763, CHIR-99021, and CHIR-98014. Wnt/beta-catenin-dependent target genes were measured by quantitative PCR to confirm the Wnt-reporter assay and finally EC50-values were calculated. CHIR-99021 and SB-216763 had the lowest toxicities in mouse embryonic stem cells and CHIR-98014 and BIO the highest toxicities. Only CHIR-99021 and CHIR-98014 lead to a strong induction of the Wnt/beta-catenin pathway, whereas BIO and SB-216763 showed a minor or no increase in activation of the Wnt/beta-catenin pathway over the natural ligand Wnt3a. The data from the Wnt-reporter assay were confirmed by gene expression analysis of the TCF/LEF regulated gene T. Out of the four tested GSK3 inhibitors, only CHIR-99021 and CHIR-98014 proved to be potent pharmacological activators of the Wnt/beta-catenin signaling pathway. But only in the case of CHIR-99021 high potency was combined with very low toxicity.
International Nuclear Information System (INIS)
Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.
2006-01-01
The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)
Activation of the human beta interferon gene by the adenovirus type 12 E1B gene
International Nuclear Information System (INIS)
Shiroki, K.; Toth, M.
1988-01-01
The transcription of endogenous beta interferon mRNA was activated in human embryo kidney (HEK) cells infected with adenovirus 12 (Ad12) but was activated only inefficiently or not at all in HEK cells infected with Ad5 and rc-1 (Ad5 dl312 containing the Ad12 E1A region). The analysis with Ad12 mutants showed that Ad12 E1B products, especially the 19K protein, were important for the expression of the endogenous beta interferon gene and Ad12 E1A products were not involved in the expression. The expression of exogeneously transfected pIFN-CAT (a hybrid plasmid having the human beta interferon promoter fused with the CAT gene) was activated in HEK and chicken embryo fibroblast (CEF) cells infected with either Ad12 or Ad5. The analysis of cotransfection of CEF cells with pIFN-CAT and plasmids containing fragments of Ad12 or Ad5 DNA showed that Ad12 or Ad5 E1B (possibly the 19K protein) was and E1A was not involved in the expression of the exogenous pIFN-CAT
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M
1990-01-01
The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei
2013-01-01
Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mazzarelli, Joan M; Brestelli, John; Gorski, Regina K; Liu, Junmin; Manduchi, Elisabetta; Pinney, Deborah F; Schug, Jonathan; White, Peter; Kaestner, Klaus H; Stoeckert, Christian J
2007-01-01
EPConDB (http://www.cbil.upenn.edu/EPConDB) is a public web site that supports research in diabetes, pancreatic development and beta-cell function by providing information about genes expressed in cells of the pancreas. EPConDB displays expression profiles for individual genes and information about transcripts, promoter elements and transcription factor binding sites. Gene expression results are obtained from studies examining tissue expression, pancreatic development and growth, differentiation of insulin-producing cells, islet or beta-cell injury, and genetic models of impaired beta-cell function. The expression datasets are derived using different microarray platforms, including the BCBC PancChips and Affymetrix gene expression arrays. Other datasets include semi-quantitative RT-PCR and MPSS expression studies. For selected microarray studies, lists of differentially expressed genes, derived from PaGE analysis, are displayed on the site. EPConDB provides database queries and tools to examine the relationship between a gene, its transcriptional regulation, protein function and expression in pancreatic tissues.
Chong, Zhao Zhong; Li, Faqi; Maiese, Kenneth
2007-06-01
Initially described as a modulator of embryogenesis for a number of organ systems, Wnt1 has recently been linked to the development of several neurodegenerative disorders, none being of greater significance than Alzheimer's disease. We therefore examined the ability of Wnt1 to oversee vital pathways responsible for cell survival during beta-amyloid (Abeta1-42) exposure. Here we show that Wnt1 is critical for protection in the SH-SY5Y neuronal cell line against genomic DNA degradation, membrane phosphatidylserine (PS) exposure, and microglial activation, since these neuroprotective attributes of Wnt1 are lost during gene silencing of Wnt1 protein expression. Intimately tied to Wnt1 protection is the presence and activation of Akt1. Pharmacological inhibition of the PI 3-K pathway or gene silencing of Akt1 expression can abrogate the protective capacity of Wnt1. Closely aligned with Wnt1 and Akt1 are the integrated canonical pathways of synthase kinase-3beta (GSK-3beta) and beta-catenin. Through Akt1 dependent pathways, Wnt1 phosphorylates GSK-3beta and maintains beta-catenin integrity to insure its translocation from the cytoplasm to the nucleus to block apoptosis. Our work outlines a highly novel role for Wnt1 and its integration with Akt1, GSK-3beta, and beta-catenin to foster neuronal cell survival and repress inflammatory microglial activation that can identify new avenues of therapy against neurodegenerative disorders.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
DEFF Research Database (Denmark)
Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri
2014-01-01
BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...
DEFF Research Database (Denmark)
Takahashi, N; Rieneck, K; van der Kraan, P M
2005-01-01
To elucidate the antagonism between interleukin-1 (IL-1) and transforming growth factor-beta (TGF-beta) at the gene expression level, as IL-1 and TGF-beta are postulated to be critical mediators of cartilage degeneration/protection in rheumatic diseases....
Uterine leiomyoma is associated with a polymorphism in the interleukin 1-beta gene.
Pietrowski, Detlef; Thewes, Roberta; Sator, Michael; Denschlag, Dominik; Keck, Christoph; Tempfer, Clemens
2009-08-01
To investigate whether polymorphisms in the interleukin-1beta (IL-1beta) gene are associated with uterine leiomyoma. Case-control study in a collective of 131 patients and 280 controls. Genotyping of the IL-1beta-511 and IL-1beta-3954 polymorphism was performed by PCR amplification and subsequent RFLP analysis. A significant difference in the allele frequencies of the IL-1beta-511 C
Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H
1995-01-01
Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Energy Technology Data Exchange (ETDEWEB)
Lahbib-Mansais, Y.; Yerle, M.; Dalens, M.; Chevalet, C.; Gellin, J. (Centre de Recherches de Toulouse (France))
1993-01-01
Two genes coding for Na[sup +],K[sup +] -ATPase [alpha] and [beta] subunits are localized on pig chromosome 4, to the q1.6[yields]q2.3 and 1.3[yields]q2.1 regions, respectively, by radioactive in situ hybridization. According to nucleotide and amino acid sequence comparisons with different human isoforms of Na[sup +] ,K[sup +]-ATPase, these pig [alpha] and [beta] ATPase genes show strong homologies with human [alpha]1 and [beta] subunit ATPase genes, respectively. These results are discussed with respect to comparative mapping data of conserved genes in mammalian species. We showed that the pig cDNA probes encoding ATPase [alpha] and, [beta] genes reveal DNA polymorphism in Meishan an Large White pigs. 35 refs., 4 figs., 2 tabs.
Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny
2016-03-09
Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Energy Technology Data Exchange (ETDEWEB)
Choi, Cheol-Hee [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Department of Pharmacology, College of Medicine, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of); Lee, Byung-Hoon [College of Pharmacy and Multiscreening Center for Drug Development, Seoul National University, Seoul 151-742 (Korea, Republic of); Ahn, Sang-Gun [Department of Pathology, College of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of); Oh, Seon-Hee, E-mail: oshccw@hanmail.net [Research Center for Resistant Cells, Chosun University, Seosuk-dong, Dong-gu, Gwangju 501-759 (Korea, Republic of)
2012-02-24
Highlights: Black-Right-Pointing-Pointer MG132 induces the phosphorylation of GSK3{beta}{sup Ser9} and, to a lesser extent, of GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer MG132 induces dephosphorylation of p70S6K{sup Thr389} and phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 dephosphorylates GSK3{beta}{sup Ser9} and phosphorylates GSK3{beta}{sup Thr390}. Black-Right-Pointing-Pointer Inactivation of p38 phosphorylates p70S6K{sup Thr389} and increases the phosphorylation of p70S6K{sup Thr421/Ser424}. Black-Right-Pointing-Pointer Inactivation of p38 decreases autophagy and increases apoptosis induced by MG132. -- Abstract: Proteasome inhibition is a promising approach for cancer treatment; however, the underlying mechanisms involved have not been fully elucidated. Here, we show that proteasome inhibition-induced p38 mitogen-activated protein kinase regulates autophagy and apoptosis by modulating the phosphorylation status of glycogen synthase kinase 3{beta} (GSK3{beta}) and 70 kDa ribosomal S6 kinase (p70S6K). The treatment of MDA-MB-231 cells with MG132 induced endoplasmic reticulum stress through the induction of ATF6a, PERK phosphorylation, and CHOP, and apoptosis through the cleavage of Bax and procaspase-3. MG132 caused the phosphorylation of GSK3{beta} at Ser{sup 9} and, to a lesser extent, Thr{sup 390}, the dephosphorylation of p70S6K at Thr{sup 389}, and the phosphorylation of p70S6K at Thr{sup 421} and Ser{sup 424}. The specific p38 inhibitor SB203080 reduced the p-GSK3{beta}{sup Ser9} and autophagy through the phosphorylation of p70S6K{sup Thr389}; however, it augmented the levels of p-ERK, p-GSK3{beta}{sup Thr390}, and p-70S6K{sup Thr421/Ser424} induced by MG132, and increased apoptotic cell death. The GSK inhibitor SB216763, but not lithium, inhibited the MG132-induced phosphorylation of p38, and the downstream signaling pathway was consistent with that in SB203580-treated cells. Taken together, our
Arterbery, Adam S; Deitcher, David L; Bass, Andrew H
2010-05-15
The vocalizing midshipman fish, Porichthys notatus, has two male morphs that exhibit alternative mating tactics. Only territorial males acoustically court females with long duration (minutes to >1h) calls, whereas sneaker males attempt to steal fertilizations. During the breeding season, morph-specific tactics are paralleled by a divergence in relative testis and vocal muscle size, plasma levels of the androgen 11-ketotestosterone (11KT) and the glucocorticoid cortisol, and mRNA expression levels in the central nervous system (CNS) of the steroid-synthesizing enzyme aromatase (estrogen synthase). Here, we tested the hypothesis that the midshipman's two male morphs would further differ in the CNS, as well as in the testis and vocal muscle, in mRNA abundance for the enzymes 11beta-hydroxylase (11betaH) and 11beta-hydroxysteroid dehydrogenase (11betaHSD) that directly regulate both 11KT and cortisol synthesis. Quantitative real-time PCR demonstrated male morph-specific profiles for both enzymes. Territorial males had higher 11betaH and 11betaHSD mRNA levels in testis and vocal muscle. By contrast, sneaker males had the higher CNS expression, especially for 11betaHSD, in the region containing an expansive vocal pacemaker circuit that directly determines the temporal attributes of natural calls. We propose for territorial males that higher enzyme expression in testis underlies its greater plasma 11KT levels, which in vocal muscle provides both gluconeogenic and androgenic support for its long duration calling. We further propose for sneaker males that higher enzyme expression in the vocal CNS contributes to known cortisol-specific effects on its vocal physiology. Copyright 2010 Elsevier Inc. All rights reserved.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Human amyloid beta protein gene locus: HaeIII RFLP
Energy Technology Data Exchange (ETDEWEB)
Taylor, J E; Gonzalez-DeWhitt, P A; Fuller, F; Cordell, B; Frossard, P M [California Biotechnology Inc., Mountain View (USA); Tinklenberg, J R; Davies, H D; Eng, L F; Yesavage, J A [Stanford Univ. School of Medicine, Palo Alto, CA (USA)
1988-07-25
A 2.2 kb EcoRI-EcoRI fragment from the 5{prime} end of the human amyloid beta protein cDNA was isolated from a human fibroblast cDNA library and subcloned into pGEM3. HaeIII (GGCC) detects 6 invariant bands at 0.5 kb, 1.0 kb, 1.1 kb, 1.3 kb, 1.4 kb and 1.6 kb and a two-allele polymorphism with bands at either 1.9 kb or 2.1 kb. Its frequency was studied in 50 North Americans. Human amyloid beta protein gene mapped to the long arm of chromosome 21 (21q11.2-21q21) by Southern blot analysis of human-rodent somatic cell hybrids. Co-dominant segregation was observed in two families (15 individuals).
Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K
1993-01-01
The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene d...
DEFF Research Database (Denmark)
Mortensen, Ole Hartvig; Frandsen, Lis; Schjerling, Peter
2006-01-01
Peroxisome proliferator-activated receptor-gamma coactivator-1alpha and -1beta (PGC-1alpha and PGC-1beta) were overexpressed by adenovirus-mediated gene transfer in cultures of primary rat skeletal muscle cells derived from neonatal myoblasts. Effects on muscle fiber type transition and metabolism...... an increase in the mRNA expression of TRB3, a negative regulator of insulin signaling. These results show that both PGC-1alpha and PGC-1beta are involved in the regulation of skeletal muscle fiber transition and metabolism and that they have both overlapping and differing effects....... were studied from days 5 to 22 of culture. PGC-1alpha and PGC-1beta overexpression caused a three- to fourfold increase in mRNA level, a doubling of enzymatic activity of citrate synthase, a slight increase in short-chain acyl-CoA dehydrogenase mRNA, a doubling of the mRNA level, and a 30-50% increase...
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
Hou, Yu; Mao, ZeBin; Wei, XueLei; Lin, Lin; Chen, LianXu; Wang, HaiJun; Fu, Xin; Zhang, JiYing; Yu, Changlong
2009-07-01
Repaired Achilles tendons typically take weeks before they are strong enough to handle physiological loads. Gene therapy is a promising treatment for Achilles tendon defects. The aim of the present study was to evaluate the histological/biomechanical effects of Transforming growth factor-beta1 (TGF-beta1) and vascular endothelial growth factor 165 (VEGF(165)) gene transfer on Achilles tendon healing in rabbits. Bone Marrow-Derived Mesenchymal Stem Cells (BMSCs) were transduced with adenovirus carrying human TGF-beta1 cDNA (Ad-TGF-beta1), human VEGF(165) cDNA (Ad-VEGF(165)), or both (PIRES-TGF-beta1/VEGF(165)) Viruses, no cDNA (Ad-GFP), and the BMSCs without gene transfer and the intact tendon were used as control. BMSCs were surgically implanted into the experimentally injured Achilles tendons. TGF-beta1 distribution, cellularity, nuclear aspect ratio, nuclear orientation angle, vascular number, collagen synthesis, and biomechanical features were measured at 1, 2, 4, and 8 weeks after surgery. The TGF-beta1 and TGF beta 1/VEGF(165) co-expression groups exhibited improved parameters compared with other groups, while the VEGF(165) expression group had a negative impact. In the co-expression group, the angiogenesis effects of VEGF(165) were diminished by TGF-beta1, while the collagen synthesis effects of TGF-beta1 were unaltered by VEGF(165). Thus treatment with TGF-beta1 cDNA-transduced BMSCs grafts is a promising therapy for acceleration and improvement of tendon healing, leading to quicker recovery and improved biomechanical properties of Achilles tendons.
The structure of the human interferon alpha/beta receptor gene.
Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G
1992-02-05
Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....
Directory of Open Access Journals (Sweden)
Vinita Khot
2014-01-01
Full Text Available We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR and methionine synthase , but higher cystathionine b-synthase (CBS and Phosphatidylethanolamine-N-methyltransferase (PEMT as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE, phosphatidylcholine (PC, in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.
White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M
2014-08-01
The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J
1999-01-01
Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....
International Nuclear Information System (INIS)
Somaya, E.T.; Soliman, M.D
2010-01-01
The present study investigated whether the single-strand conformational polymorphism (SSCP) method could be employed to identify (rather than simply detect) four of the most common beta-globin gene mutations in the Egyptian population: IVS-I-110, IVS-I-6, the IVS-I-1, and Codon 39. Using DNA from 90 beta-thalassemia patients and carriers, by PCR the appropriate 238-bp region of the human beta-globin gene was amplified, the reaction products (Single-stranded DNA) were analyzed by none denaturing polyacrylamide gel electrophoresis, and the bands visualized by silver staining. Single-stranded DNA (ssDNA) fragments showed reproducible pattern of bands that were characteristic of the mutations present. With the use of control samples containing six of the 10 possible combinations of the four beta-globin gene mutations under study, we were able to predict the mutations present in 23 out of 90 (26.4%) of the patients studied. These predictions were confirmed independently by the amplification refractory mutation system (ARMS) method. It is concluded that this non-radioactive PCR-SSCP method can be used to reliably identify mutations in beta-thalassemia patients, provided that suitable controls are available. However, usefulness of this method for determining the genotype of beta-thalassaemic individuals is obviously limited by the great number of controls required. Moreover, the ability to detect mutations by SSCP is in general lower compared to other methods, ARMS, DGGE or DHPLC, which are reported to detect 49.5% to 73% of the mutations present. The SSCP method is nevertheless much easier to employ than other methods and is especially successful for beta-thalassemia carriers. This method would thus be particularly useful for an initial screening of target groups (prenatal diagnosis)
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
Furie, Karen L; Kelly, Peter J
2006-02-01
Homocyst(e)ine elevation is associated with a two- to threefold fold increased risk of ischemic stroke. Although most commonly associated with large-artery atherosclerosis and venous thrombosis, hyperhomocysteinemia may contribute to stroke by other mechanisms as well. Levels of homocysteine are determined by genetic regulation of the enzymes involved in homocyst(e)ine metabolism and by levels of the vitamin cofactors (folate, B (6), and B (12)) associated with those reactions. Emerging evidence suggests that genetic variation within this pathway, such as the methyleneterahydrofolate reductase and cystathionine beta-synthase and nicotinamide N-methyltransferase genes, increases the risk of ischemic stroke. The introduction of grain folate fortification in 1998 has reduced homocyst(e)ine concentrations in the U.S. population. However, it is important to screen for vitamin B (12) deficiency and be cognizant that vitamin B (6) levels may be low in the elderly and in individuals with inflammatory disorders. The Vitamin Intervention in Stroke Prevention study failed to prove that high-dose supplementation with folate, B (6), and B (12) reduced the risk of recurrent stroke or myocardial infarction at 2 years; however, there is an ongoing clinical trial evaluating the potential benefit of vitamin supplementation.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.
Burgers, P M; Kornberg, A; Sakakibara, Y
1981-09-01
An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.
Genomic organization of the mouse peroxisome proliferator-activated receptor beta/delta gene
DEFF Research Database (Denmark)
Larsen, Leif K; Amri, Ez-Zoubir; Mandrup, Susanne
2002-01-01
Peroxisome proliferator-activated receptor (PPAR) beta/delta is ubiquitously expressed, but the level of expression differs markedly between different cell types. In order to determine the molecular mechanisms governing PPARbeta/delta gene expression, we have isolated and characterized the mouse...
Directory of Open Access Journals (Sweden)
Chen Jiande DZ
2009-08-01
Full Text Available Abstract Background The pathogenesis of visceral hypersensitivity, a characteristic pathophysiological feature of irritable bowel syndrome (IBS, remains elusive. Recent studies suggest a role for hydrogen sulfide (H2S in pain signaling but this has not been well studied in visceral models of hyperalgesia. We therefore determined the role for the endogenous H2S producing enzyme cystathionine-β-synthetase (CBS in a validated rat model of IBS-like chronic visceral hyperalgesia (CVH. CVH was induced by colonic injection of 0.5% acetic acid (AA in 10-day-old rats and experiments were performed at 8–10 weeks of age. Dorsal root ganglion (DRG neurons innervating the colon were labeled by injection of DiI (1,1'-dioleyl-3,3,3',3-tetramethylindocarbocyanine methanesulfonate into the colon wall. Results In rat DRG, CBS-immunoreactivity was observed in approximately 85% of predominantly small- and medium-sized neurons. Colon specific DRG neurons revealed by retrograde labeling DiI were all CBS-positive. CBS-positive colon neurons co-expressed TRPV1 or P2X3 receptors. Western blotting analysis showed that CBS expression was significantly increased in colon DRGs 8 weeks after neonatal AA-treatment. Furthermore, the CBS inhibitor hydroxylamine markedly attenuated the abdominal withdrawal reflex scores in response to colorectal distention in rats with CVH. By contrast, the H2S donor NaHS significantly enhanced the frequency of action potentials of colon specific DRG neurons evoked by 2 times rheobase electrical stimulation. Conclusion Our results suggest that upregulation of CBS expression in colonic DRG neurons and H2S signaling may play an important role in developing CVH, thus identifying a specific neurobiological target for the treatment of CVH in functional bowel syndromes.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.
2013-01-01
The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Riegert, P; Andersen, R; Bumstead, N
1996-01-01
a similar genomic organization but smaller introns and higher G+C content than mammalian beta 2-microglobulin genes. The promoter region is particularly G+C-rich and contains, in addition to interferon regulatory elements, potential S/W, X, and Y boxes that were originally described for mammalian class II...... but not class I alpha or beta 2-microglobulin genes. There is a single chicken beta 2-microglobulin gene that has little polymorphism in the coding region. Restriction fragment length polymorphisms from Mhc homozygous lines, Mhc congenic lines, and backcross families, as well as in situ hybridization, show...
Segars, J H; Marks, M S; Hirschfeld, S; Driggers, P H; Martinez, E; Grippo, J F; Brown, M; Wahli, W; Ozato, K
1993-04-01
The retinoid X receptor beta (RXR beta; H-2RIIBP) forms heterodimers with various nuclear hormone receptors and binds multiple hormone response elements, including the estrogen response element (ERE). In this report, we show that endogenous RXR beta contributes to ERE binding activity in nuclear extracts of the human breast cancer cell line MCF-7. To define a possible regulatory role of RXR beta regarding estrogen-responsive transcription in breast cancer cells, RXR beta and a reporter gene driven by the vitellogenin A2 ERE were transfected into estrogen-treated MCF-7 cells. RXR beta inhibited ERE-driven reporter activity in a dose-dependent and element-specific fashion. This inhibition occurred in the absence of the RXR ligand 9-cis retinoic acid. The RXR beta-induced inhibition was specific for estrogen receptor (ER)-mediated ERE activation because inhibition was observed in ER-negative MDA-MB-231 cells only following transfection of the estrogen-activated ER. No inhibition of the basal reporter activity was observed. The inhibition was not caused by simple competition of RXR beta with the ER for ERE binding, since deletion mutants retaining DNA binding activity but lacking the N-terminal or C-terminal domain failed to inhibit reporter activity. In addition, cross-linking studies indicated the presence of an auxiliary nuclear factor present in MCF-7 cells that contributed to RXR beta binding of the ERE. Studies using known heterodimerization partners of RXR beta confirmed that RXR beta/triiodothyronine receptor alpha heterodimers avidly bind the ERE but revealed the existence of another triiodothyronine-independent pathway of ERE inhibition. These results indicate that estrogen-responsive genes may be negatively regulated by RXR beta through two distinct pathways.
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried
2007-09-15
The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.
Directory of Open Access Journals (Sweden)
Lin-Hui Gao
2018-01-01
Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling
2016-01-01
Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
DEFF Research Database (Denmark)
Ek, J; Grarup, N; Urhammer, S A
2001-01-01
Mutations in the homeodomain-containing transcription factor hepatocyte nuclear factor-1beta (HNF-1beta) are known to cause a rare subtype of maturity-onset diabetes of the young (MODY5), which is associated with early-onset progressive non-diabetic renal dysfunction. To investigate whether...... mutations in HNF-1 are implicated in the pathogenesis of MODY or late-onset diabetes with and without nephropathy in Danish Caucasians we examined the HNF-1beta (TCF2) and the dimerization cofactor of HNF-1 (DCoH, PCBD) genes for mutations in 11 MODY probands, 28 type 2 diabetic patients with nephropathy...... comprising the DCoH gene revealed a previously described A-->G polymorphism located in the 3' untranslated region, which was not investigated further. In conclusion, mutations in HNF-1beta and DCoH are not a major cause of MODY or late onset type 2 diabetes in Danish Caucasian subjects....
Directory of Open Access Journals (Sweden)
Nayereh Younessi
2017-09-01
Full Text Available Introduction: Growing evidence exists that agriculture affects antibiotic resistance in human pathogens. Beta-lactam antibiotics are the most commonly used antimicrobial agents in many countries. The abundance of beta-lactamase encoding genes can be used as an indicator of antibiotic resistance in the environment. So, to determine the beta-lactamase resistance genes, the abundance of culturable bacteria having bla-TEM genesin the soils under different land uses wasexamined. Materials and methods: 44 Gram-positive and 34 Gram-negative bacteria plated on nutrient agar were isolated from agricultural, pasture and mining soils and selected to study the presence of TEM-class gene using PCR amplification. Antibiotic sensitivity test of bla-TEM+isolateswas done adopting the Kirby-Bauer disk diffusion method and antibiotic discs used were: ampicillin, amoxicillin, vancomicin, streptomycin, tetracycline and gentamicin. Finally, five multi-drug resistant and bla-TEM+ isolates were identified using universal primers. Results: The highest level of beta-lactamase genes was observed in the Gram-positive and Gram-negative isolates from the pasture soils. In the agricultural and mining soils, a high abundance of bla-TEM+ isolateswasfound which also showed resistance to beta-lactam antibiotics. The identified multi-drug resistant and bla-TEM+ isolates were from these genera: Achromobacter, Bacillus, Brevibacillus, Aminobacter and Brevundimonas. Discussion and conclusion: The high number of bla-TEM+ bacteria in all the soils may be attributed to the other important feature of bla genes which is their capability to extrude toxic compounds like heavy metals in contaminated environments. Sensitivity of some bla-TEM+ bacteria to beta-lactam antibiotics was interesting. This result shows that bla-TEM genes confer resistance to beta-lactamase inhibitors in a different degree. Some of the identified isolates were pathogen. These pathogens in soils can transfer to plants
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Energy Technology Data Exchange (ETDEWEB)
Rudolf, Jeffrey D.; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N.; Shen, Ben
2016-08-31
Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three alpha-helical domains (alpha beta gamma), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (alpha) and type II TSs (beta gamma). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtnaT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 angstrom, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg2+-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.
Molecular evolution of flavonoid dioxygenases in the family Apiaceae.
Gebhardt, Yvonne; Witte, Simone; Forkmann, Gert; Lukacin, Richard; Matern, Ulrich; Martens, Stefan
2005-06-01
Plant species of the family Apiaceae are known to accumulate flavonoids mainly in the form of flavones and flavonols. Three 2-oxoglutarate-dependent dioxygenases, flavone synthase or flavanone 3 beta-hydroxylase and flavonol synthase are involved in the biosynthesis of these secondary metabolites. The corresponding genes were cloned recently from parsley (Petroselinum crispum) leaves. Flavone synthase I appears to be confined to the Apiaceae, and the unique occurrence as well as its high sequence similarity to flavanone 3beta-hydroxylase laid the basis for evolutionary studies. In order to examine the relationship of these two enzymes throughout the Apiaceae, RT-PCR based cloning and functional identification of flavone synthases I or flavanone 3beta-hydroxylases were accomplished from Ammi majus, Anethum graveolens, Apium graveolens, Pimpinella anisum, Conium maculatum and Daucus carota, yielding three additional synthase and three additional hydroxylase cDNAs. Molecular and phylogenetic analyses of these sequences were compatible with the phylogeny based on morphological characteristics and suggested that flavone synthase I most likely resulted from gene duplication of flavanone 3beta-hydroxylase, and functional diversification at some point during the development of the apiaceae subfamilies. Furthermore, the genomic sequences from Petroselinum crispum and Daucus carota revealed two introns in each of the synthases and a lack of introns in the hydroxylases. These results might be explained by intron losses from the hydroxylases occurring at a later stage of evolution.
Gente, Stéphanie; La Carbona, Stéphanie; Guéguen, Micheline
2007-03-10
Geotrichum candidum is a cheese-ripening agent with the potential to produce sulphur flavour compounds in soft cheeses. We aimed to develop an alternative test for predicting the aromatic (sulphur flavours) potential of G. candidum strains in soft cheese. Twelve strains of G. candidum with different levels of demethiolase activity (determined by a chemical method) in YEL-met (yeast extract, lactate methionine) medium were studied. We investigated cgl (cystathionine gamma lyase) gene expression after culture in three media - YEL-met, casamino acid and curd media - and then carried out sensory analysis on a Camembert cheese matrix. We found no correlation between demethiolase activity in vitro and cgl gene expression. Sensory analysis (detection of sulphur flavours) identified different aromatic profiles linked to cgl expression, but not to demethiolase activity. The RT-PCR technique described here is potentially useful for predicting the tendency of a given strain of G. candidum to develop sulphur flavours in cheese matrix. This is the first demonstration that an in vitro molecular approach could be used as a predictive test for evaluating the potential of G. candidum strains to generate sulphur compounds in situ (Camembert cheese matrix).
Directory of Open Access Journals (Sweden)
Mahnaz Kheirkhah
2017-06-01
Full Text Available Background: Aspergillus species are opportunistic pathogens among immunocompromised patients. In terms of pathogenesis and mycotoxin production, they are in great value. The aim of the this study was to evaluate of beta-tubulin gene for identification of clinical Aspergillus species by PCR-sequencing method compared to morphological features of clinical isolates (such as conidial shape in direct microscopic examination, colony shape in culture, and physiological tests. Materials and Methods: In this study, 465 patients referred to the Shefa laboratory of Isfahan were evaluated. Morphological and molecular identification of clinical samples were performed using culture on sabouraud agar, malt extract agar, czapekdox agar, direct microscopy, and PCR-sequencing of beta tubulin gene, respectively. Sequences were analyzed in comparison with gene bank data. Results: Thirty nine out of 465 suspected cases (8.4% had aspergillosis. The most prevalent species were Aspergillus flavus (56.4%, A. oryzae (20.5%, and A. fumigatus (10.2%, respectively. Fifty nine percent of patients were females and 49% were males. Conclusion: In comparison with phenotypic tests, sequencing of beta-tubulin gene for identification of Aspergillus species is at great value. Replacement of molecular techniques with conventional tests is recommended for precise identification of microorganism for better management of infection.
Saudi experience with classic homocystinuria
International Nuclear Information System (INIS)
Al-Essa, M.; Ozand, P.T.; Rashed, M.
1998-01-01
Classic homocystinuria is an autosomal recessive disorder due to cystathionine beta-synthase deficiency. The clinical, radiological and neurophysiological findings of classic homcystinuria diagnosed at King Faisal Specialist Hospital and Research Centre (KFSH and RC) are presented in this report. Twenty-four patients (15 females and 9 males) were referred to KFSH and RC for work-up of mental retardation, seizures, thrombo-embolic episodes and dislocation of the ocular lenses. The common clinical findings included ectopia lentis (20 patients), skeletal system involvement (18 patients), vascular system involvement (9patients), and mental retardation (all patients to varying degrees). Unusual findings consisted of a patient who developed severe lower gastrointestinal bleeding, a patient with insulin-dependent diabetes mellitus, probably due to vasculopathy, and other having severe bronchiectasis, which may have been due to fibrillin disruption, and required the resection of a lobe of lung. The parents of 21 patients were first-degree relatives, and 19 patients had one or more family members affected by the same disease. All patients had markedly elevated plasma levels of methionine. Cystathionine synthase activity in the fibroblast was measured in 25% of the patients and was deficient. Only four patients responded to pyridoxine and their methionine level decreased to almost normal range. The aim of this study was to increase the awareness of this disease in the scientific and medical community, in particular in the general pediatrician working in Saudi Arabia who first encounters the clinical manifestations of disease. Early detection through tandem mass spectrometry of blood spot screening and treatment are important and may prevent the major complications of this disease. (author)
Positive selection within the Schizophrenia-associated GABA(A receptor beta(2 gene.
Directory of Open Access Journals (Sweden)
Wing-Sze Lo
Full Text Available The gamma-aminobutyric acid type-A (GABA(A receptor plays a major role in inhibitory neurotransmissions. Intronic SNPs and haplotypes in GABRB2, the gene for GABA(A receptor beta(2 subunit, are associated with schizophrenia and correlated with the expression of two alternatively spliced beta(2 isoforms. In the present study, using chimpanzee as an ancestral reference, high frequencies were observed for the derived (D alleles of the four SNPs rs6556547, rs187269, rs1816071 and rs1816072 in GABRB2, suggesting the occurrence of positive selection for these derived alleles. Coalescence-based simulation showed that the population frequency spectra and the frequencies of H56, the haplotype having all four D alleles, significantly deviated from neutral-evolution expectation in various demographic models. Haplotypes containing the derived allele of rs1816072 displayed significantly less diversity compared to haplotypes containing its ancestral allele, further supporting positive selection. The variations in DD-genotype frequencies in five human populations provided a snapshot of the evolutionary history, which suggested that the positive selections of the D alleles are recent and likely ongoing. The divergence between the DD-genotype profiles of schizophrenic and control samples pointed to the schizophrenia-relevance of positive selections, with the schizophrenic samples showing weakened selections compared to the controls. These DD-genotypes were previously found to increase the expression of beta(2, especially its long isoform. Electrophysiological analysis showed that this long beta(2 isoform favored by the positive selections is more sensitive than the short isoform to the inhibition of GABA(A receptor function by energy depletion. These findings represent the first demonstration of positive selection in a schizophrenia-associated gene.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Órpez-Zafra, Teresa; Pinto-Medel, María Jesús; Oliver-Martos, Begoña; Ortega-Pinazo, Jesús; Arnáiz, Carlos; Guijarro-Castro, Cristina; Varadé, Jezabel; Álvarez-Lafuente, Roberto; Urcelay, Elena; Sánchez-Jiménez, Francisca
2013-01-01
TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO) and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10−4, pc = 0.048, OR = 0.30). This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A), a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells) were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS. PMID:23658636
Directory of Open Access Journals (Sweden)
Carlos López-Gómez
Full Text Available TRAIL and TRAIL Receptor genes have been implicated in Multiple Sclerosis pathology as well as in the response to IFN beta therapy. The objective of our study was to evaluate the association of these genes in relation to the age at disease onset (AAO and to the clinical response upon IFN beta treatment in Spanish MS patients. We carried out a candidate gene study of TRAIL, TRAILR-1, TRAILR-2, TRAILR-3 and TRAILR-4 genes. A total of 54 SNPs were analysed in 509 MS patients under IFN beta treatment, and an additional cohort of 226 MS patients was used to validate the results. Associations of rs1047275 in TRAILR-2 and rs7011559 in TRAILR-4 genes with AAO under an additive model did not withstand Bonferroni correction. In contrast, patients with the TRAILR-1 rs20576-CC genotype showed a better clinical response to IFN beta therapy compared with patients carrying the A-allele (recessive model: p = 8.88×10(-4, pc = 0.048, OR = 0.30. This SNP resulted in a non synonymous substitution of Glutamic acid to Alanine in position 228 (E228A, a change previously associated with susceptibility to different cancer types and risk of metastases, suggesting a lack of functionality of TRAILR-1. In order to unravel how this amino acid change in TRAILR-1 would affect to death signal, we performed a molecular modelling with both alleles. Neither TRAIL binding sites in the receptor nor the expression levels of TRAILR-1 in peripheral blood mononuclear cell subsets (monocytes, CD4+ and CD8+ T cells were modified, suggesting that this SNP may be altering the death signal by some other mechanism. These findings show a role for TRAILR-1 gene variations in the clinical outcome of IFN beta therapy that might have relevance as a biomarker to predict the response to IFN beta in MS.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu
2008-11-15
Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Directory of Open Access Journals (Sweden)
Vassiliki Lila Koumandou
2014-09-01
Full Text Available Bacteria and archaea are characterized by an amazing metabolic diversity, which allows them to persist in diverse and often extreme habitats. Apart from oxygenic photosynthesis and oxidative phosphorylation, well-studied processes from chloroplasts and mitochondria of plants and animals, prokaryotes utilize various chemo- or lithotrophic modes, such as anoxygenic photosynthesis, iron oxidation and reduction, sulfate reduction, and methanogenesis. Most bioenergetic pathways have a similar general structure, with an electron transport chain composed of protein complexes acting as electron donors and acceptors, as well as a central cytochrome complex, mobile electron carriers, and an ATP synthase. While each pathway has been studied in considerable detail in isolation, not much is known about their relative evolutionary relationships. Wanting to address how this metabolic diversity evolved, we mapped the distribution of nine bioenergetic modes on a phylogenetic tree based on 16S rRNA sequences from 272 species representing the full diversity of prokaryotic lineages. This highlights the patchy distribution of many pathways across different lineages, and suggests either up to 26 independent origins or 17 horizontal gene transfer events. Next, we used comparative genomics and phylogenetic analysis of all subunits of the F0F1 ATP synthase, common to most bacterial lineages regardless of their bioenergetic mode. Our results indicate an ancient origin of this protein complex, and no clustering based on bioenergetic mode, which suggests that no special modifications are needed for the ATP synthase to work with different electron transport chains. Moreover, examination of the ATP synthase genetic locus indicates various gene rearrangements in the different bacterial lineages, ancient duplications of atpI and of the beta subunit of the F0 subcomplex, as well as more recent stochastic lineage-specific and species-specific duplications of all subunits. We
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei
Directory of Open Access Journals (Sweden)
Yue Ming
2009-06-01
Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.
Energy Technology Data Exchange (ETDEWEB)
Knapp, Charles W., E-mail: charles.knapp@strath.ac.u [David Livingstone Centre for Sustainability, Department of Civil Engineering, University of Strathclyde, 50 Richmond Street, Glasgow, G1 1XN (United Kingdom); School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Zhang, Wen; Sturm, Belinda S.M. [Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States); Graham, David W. [School of Civil Engineering and Geosciences, Newcastle University, Newcastle upon Tyne, NE1 7RU (United Kingdom); Department of Civil, Environmental and Architectural Engineering, University of Kansas, Lawrence, KS 66045 (United States)
2010-05-15
The attenuation and fate of erythromycin-resistance-methylase (erm) and extended-spectrum beta-lactamse (bla) genes were quantified over time in aquatic systems by adding 20-L swine waste to 11,300-L outdoor mesocosms that simulated receiving water conditions below intensive agricultural operations. The units were prepared with two different light-exposure scenarios and included artificial substrates to assess gene movement into biofilms. Of eleven genes tested, only erm(B), erm(F), bla{sub SHV} and bla{sub TEM} were found in sufficient quantity for monitoring. The genes disappeared rapidly from the water column and first-order water-column disappearance coefficients were calculated. However, detected gene levels became elevated in the biofilms within 2 days, but then disappeared over time. Differences were observed between sunlight and dark treatments and among individual genes, suggesting that ecological and gene-specific factors play roles in the fate of these genes after release into the environment. Ultimately, this information will aid in generating better predictive models for gene fate. - The disappearance and fate of erythromycin-resistance-methylase and beta-lactamase genes were monitored in outdoor mesocosms under different light conditions.
Masha, Roland T; Houreld, Nicolette N; Abrahamse, Heidi
2013-02-01
Low-intensity laser irradiation (LILI) has been shown to stimulate cellular functions leading to increased adenosine triphosphate (ATP) synthesis. This study was undertaken to evaluate the effect of LILI on genes involved in the mitochondrial electron transport chain (ETC, complexes I-IV) and oxidative phosphorylation (ATP synthase). Four human skin fibroblast cell models were used in this study: normal non-irradiated cells were used as controls while wounded, diabetic wounded, and ischemic cells were irradiated. Cells were irradiated with a 660 nm diode laser with a fluence of 5 J/cm(2) and gene expression determined by quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR). LILI upregulated cytochrome c oxidase subunit VIb polypeptide 2 (COX6B2), cytochrome c oxidase subunit VIc (COX6C), and pyrophosphatase (inorganic) 1 (PPA1) in diabetic wounded cells; COX6C, ATP synthase, H+transporting, mitochondrial Fo complex, subunit B1 (ATP5F1), nicotinamide adenine dinucleotide (NADH) dehydrogenase (ubiquinone) 1 alpha subcomplex, 11 (NDUFA11), and NADH dehydrogenase (ubiquinone) Fe-S protein 7 (NDUFS7) in wounded cells; and ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2) in ischemic cells. LILI at 660 nm stimulates the upregulation of genes coding for subunits of enzymes involved in complexes I and IV and ATP synthase.
Clonal expansion of T-cell receptor beta gene segment in the retrocochlear lesions of EAE mice.
Cheng, K C; Lee, K M; Yoo, T J
1998-01-01
It has been reported that the T cell receptor V beta 8.2 (TcrbV8.2) gene segment is predominantly expressed in encephalomyelitic T cells responding to myelin basic protein (MBP) in experimental allergic encephalomyelitis (EAE) mice. We have demonstrated retrocochlear hearing loss in EAE mice in previous studies. Administration of a monoclonal antibody specific to the T cell receptor V beta 8 (TcrbV8) subfamily prevented both this type of hearing loss and the central nerve disease. In this study, we examined the role of the TcrbV8.2 gene segment in the retrocochlear lesions of EAE mice. A clonal expression of T cell receptor beta chain gene segment (TcrbV8.2-TcrbD2-TcrbJ2.7) was identified in the retrocochlear lesions. The TcrbV8.2 gene segment appears to recombine only with TcrbJ2.1 (32.1%) and TcrbJ2.7 (67.9%) gene segments. The TcrbJ2.7 gene segment has also been previously identified as the dominant TcrbJ gene in the lymph nodes of EAE mice. Only TcrbD2, with a length of 4 amino acids, was observed recombining with these TcrbV8.2 sequences. G and C nucleotides are predominantly expressed at the N regions between the V-D and D-J junctions. This dominant TcrbV gene segment (TcrbV8.2-TcrbD2-TcrbJ2.7) observed in the retrocochlear lesions has been identified in the MBP-specific T cells from the lymph nodes of EAE mice. These results suggest that a small subset of antigen-specific T cells migrate to, and expand at, the retrocochlear lesions, which leads to hearing loss.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Wong, Yick Ching; Teh, Huey Fang; Mebus, Katharina; Ooi, Tony Eng Keong; Kwong, Qi Bin; Koo, Ka Loo; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R; Kulaveerasingam, Harikrishna
2017-06-21
The oil yield trait of oil palm is expected to involve multiple genes, environmental influences and interactions. Many of the underlying mechanisms that contribute to oil yield are still poorly understood. In this study, we used a microarray approach to study the gene expression profiles of mesocarp tissue at different developmental stages, comparing genetically related high- and low- oil yielding palms to identify genes that contributed to the higher oil-yielding palm and might contribute to the wider genetic improvement of oil palm breeding populations. A total of 3412 (2001 annotated) gene candidates were found to be significantly differentially expressed between high- and low-yielding palms at at least one of the different stages of mesocarp development evaluated. Gene Ontologies (GO) enrichment analysis identified 28 significantly enriched GO terms, including regulation of transcription, fatty acid biosynthesis and metabolic processes. These differentially expressed genes comprise several transcription factors, such as, bHLH, Dof zinc finger proteins and MADS box proteins. Several genes involved in glycolysis, TCA, and fatty acid biosynthesis pathways were also found up-regulated in high-yielding oil palm, among them; pyruvate dehydrogenase E1 component Subunit Beta (PDH), ATP-citrate lyase, β- ketoacyl-ACP synthases I (KAS I), β- ketoacyl-ACP synthases III (KAS III) and ketoacyl-ACP reductase (KAR). Sucrose metabolism-related genes such as Invertase, Sucrose Synthase 2 and Sucrose Phosphatase 2 were found to be down-regulated in high-yielding oil palms, compared to the lower yield palms. Our findings indicate that a higher carbon flux (channeled through down-regulation of the Sucrose Synthase 2 pathway) was being utilized by up-regulated genes involved in glycolysis, TCA and fatty acid biosynthesis leading to enhanced oil production in the high-yielding oil palm. These findings are an important stepping stone to understand the processes that lead to
Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.
2013-01-01
Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150
Ayala, Claudia; García, Reggie; Cruz, Edith; Prieto, Karol; Bermúdez, Marta
2010-01-01
Thrombosis develops when the hemostatic system is incorrectly activated due to the unbalance between procoagulant, anticoagulant and fibrinolytic mechanisms allowing the formation of a clot within a blood vessel. The risk factors of this pathology can be acquired or can be genetic. To analyze in a Colombian population with diagnosis of venous thrombosis, lipid profile, glucose and homocystein levels, to calculate the alleles and genotypic frequencies of polymorphisms c.699 C>T, c.1080 C>T, c.844ins68 of the cystathionine ß synthase and the c.677 C>T of the methylenetetrahydrofolate reductase (MTHFR) genes. Thirty three patients and their controls were studied. The biochemical test was carried out by colorimetric methods and immunoassay. In this survey we used the restriction fragments longitude polymorphism (RLFP) technique to identify the polymorphisms mentioned. The association study was performed through the chi square test. We confirmed that gene alterations increase risk for pathology; we found statistically significant differences in the group with hypercholesterolemia in presence of the polymorphism c.699 C>T in the CBS gene, showing a protective effect in the individuals carrying this genetic variation. Likewise, we found a statistical trend for an eventual protective effect of the CBS c.844ins68 polymorphism to venous thrombotic disease. There were not any statistically significant differences in homocystein levels between cases and controls; nevertheless, the variability in the plasma concentrations was greater in the group of cases.
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Energy Technology Data Exchange (ETDEWEB)
Zeadin, Melec G.; Butcher, Martin K.; Shaughnessy, Stephen G. [Department of Medicine, McMaster University, Hamilton, ON (Canada); Thrombosis and Atherosclerosis Research Institute, Hamilton, ON (Canada); Werstuck, Geoff H., E-mail: Geoff.Werstuck@taari.ca [Department of Medicine, McMaster University, Hamilton, ON (Canada); Thrombosis and Atherosclerosis Research Institute, Hamilton, ON (Canada)
2012-09-07
Highlights: Black-Right-Pointing-Pointer Leptin promotes osteoblast differentiation of primary smooth muscle cells. Black-Right-Pointing-Pointer Leptin regulates the expression of genes involved in osteoblast differentiation. Black-Right-Pointing-Pointer Constitutively active GSK-3{beta} attenuates leptin-induced osteoblast differentiation. Black-Right-Pointing-Pointer This suggests that leptin signals through GSK-3{beta} to promote osteoblast differentiation. -- Abstract: In this study, we begin to investigate the underlying mechanism of leptin-induced vascular calcification. We found that treatment of cultured bovine aortic smooth muscle cells (BASMCs) with leptin (0.5-4 {mu}g/ml) induced osteoblast differentiation in a dose-dependent manner. Furthermore, we found that leptin significantly increased the mRNA expression of osteopontin and bone sialoprotein, while down-regulating matrix gla protein (MGP) expression in BASMCs. Key factors implicated in osteoblast differentiation, including members of the Wnt signaling pathway, were examined. Exposure to leptin enhanced phosphorylation of GSK-3{beta} on serine-9 thereby inhibiting activity and promoting the nuclear accumulation of {beta}-catenin. Transfection of BASMCs with an adenovirus that expressed constitutively active GSK-3{beta} (Ad-GSK-3{beta} S9A) resulted in a >2-fold increase in GSK-3{beta} activity and a significant decrease in leptin-induced alkaline phosphatase (ALP) activity. In addition, qRT-PCR analysis showed that GSK-3{beta} activation resulted in a significant decrease in the expression of osteopontin and bone sialoprotein, but a marked increase in MGP mRNA expression. When taken together, our results suggest a mechanism by which leptin promotes osteoblast differentiation and vascular calcification in vivo.
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Cytoskeletal actin genes function downstream of HNF-3beta in ascidian notochord development.
Jeffery, W R; Ewing, N; Machula, J; Olsen, C L; Swalla, B J
1998-11-01
We have examined the expression and regulation of cytoskeletal actin genes in ascidians with tailed (Molgula oculata) and tailless larvae (Molgula occulta). Four cDNA clones were isolated representing two pairs of orthologous cytoskeletal actin genes (CA1 and CA2), which encode proteins differing by five amino acids in the tailed and tailless species. The CA1 and CA2 genes are present in one or two copies, although several related genes may also be present in both species. Maternal CA1 and CA2 mRNA is present in small oocytes but transcript levels later decline, suggesting a role in early oogenesis. In the tailed species, embryonic CA1 and CA2 mRNAs first appear in the presumptive mesenchyme and muscle cells during gastrulation, subsequently accumulate in the presumptive notochord cells, and can be detected in these tissues through the tadpole stage. CA1 mRNAs accumulate initially in the same tissues in the tailless species but subsequently disappear, in concert with the arrest of notochord and tail development. In contrast, CA2 mRNAs were not detected in embryos of the tailless species. Fertilization of eggs of the tailless species with sperm of the tailed species, which restores the notochord and the tail, also results in the upregulation of CA1 and CA2 gene expression in hybrid embryos. Antisense oligodeoxynucleotide experiments suggest that CA1 and CA2 expression in the notochord, but not in the muscle cells, is dependent on prior expression of Mocc FHI, an ascidian HNF-3beta-like gene. The expression of the CA1 and CA2 genes in the notochord in the tailed species, downregulation in the tailless species, upregulation in interspecific hybrids, and dependence on HNF-3beta activity is consistent with a role of these genes in development of the ascidian notochord.
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Institute of Scientific and Technical Information of China (English)
YU Yang; HOU Wen-sheng; YaeI Hacham; SUN Shi; WU Cun-xiang; Ifat Matityahu; SONG Shikui; RacheI Amir; HAN Tian-fu
2018-01-01
Soybean (Glycine max (L.) Merr.) is a major crop that provides plant-origin protein and oil for humans and livestock. Although the soybean vegetative tissues and seeds provide a major source of high-quality protein, they suffer from low concentration of an essential sulfur-containing amino acid, methionine, which significantly limits their nutritional quality. The level of methionine is mainly controlled by the first unique enzyme of methionine synthesis, cystathione γ-synthase (CGS). Aiming to elevate methionine level in vegetative tissues and seeds, we constitutively over-expressed a feedback-insensitive Arabidopsis CGS (AtD-CGS) in soybean cultivars, Zigongdongdou (ZD) and Jilinxiaoli 1 (JX). The levels of soluble methionine increased remarkably in leaves of transgenic soybeans compared to wild-type plants (6.6- and 7.3-fold in two transgenic ZD lines, and 3.7-fold in one transgenic JX line). Furthermore, the total methionine contents were significantly increased in seeds of the transgenic ZD lines (1.5- to 4.8-fold increase) and the transgenic JX lines (1.3- to 2.3-fold increase) than in the wild type. The protein contents of the transgenic soybean seeds were significantly elevated compared to the wild type, suggesting that the scarcity of methionine in soybeans may limit protein accumulation in soybean seeds. The increased protein content did not alter the profile of major storage proteins in the seeds. Generally, this study provides a promising strategy to increase the levels of methionine and protein in soybean through the breeding programs.
Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2
Directory of Open Access Journals (Sweden)
Bhubalan, K.
2010-01-01
Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.
Energy Technology Data Exchange (ETDEWEB)
Guo Xiaodong [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Zheng Qixin [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yang Shuhua [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shao Zengwu [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Yuan Quan [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Pan Zhengqi [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Tang Shuo [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Liu Kai [Department of Orthopaedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Quan Daping [Institute of Polymer Science, School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou 510275 (China)
2006-12-15
Articular cartilage repair remains a clinical and scientific challenge with increasing interest focused on the combined techniques of gene transfer and tissue engineering. Transforming growth factor beta 1 (TGF-{beta}{sub 1}) is a multifunctional molecule that plays a central role in promotion of cartilage repair, and inhibition of inflammatory and alloreactive immune response. Cell mediated gene therapy can allow a sustained expression of TGF-{beta}{sub 1} that may circumvent difficulties associated with growth factor delivery. The objective of this study was to investigate whether TGF-{beta}{sub 1} gene modified mesenchymal stem cells (MSCs) could enhance the repair of full-thickness articular cartilage defects in allogeneic rabbits. The pcDNA{sub 3}-TGF-{beta}{sub 1} gene transfected MSCs were seeded onto biodegradable poly-L-lysine coated polylactide (PLA) biomimetic scaffolds in vitro and allografted into full-thickness articular cartilage defects in 18 New Zealand rabbits. The pcDNA{sub 3} gene transfected MSCs/biomimetic scaffold composites and the cell-free scaffolds were taken as control groups I and II, respectively. The follow-up times were 2, 4, 12 and 24 weeks. Macroscopical, histological and ultrastructural studies were performed. In vitro SEM studies found that abundant cartilaginous matrices were generated and completely covered the interconnected pores of the scaffolds two weeks post-seeding in the experimental groups. In vivo, the quality of regenerated tissue improved over time with hyaline cartilage filling the chondral region and a mixture of trabecular and compact bone filling the subchondral region at 24 weeks post-implantation. Joint repair in the experimental groups was better than that of either control group I or II, with respect to: (1) synthesis of hyaline cartilage specific extracellular matrix at the upper portion of the defect; (2) reconstitution of the subchondral bone at the lower portion of the defect and (3) inhibition of
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Structure of a Eukaryotic CLC Transporter Defines an Intermediate State in the Transport Cycle
International Nuclear Information System (INIS)
Feng, Liang; Campbell, Ernest B.; Hsiung, Yichun; MacKinnon, Roderick
2010-01-01
CLC proteins transport chloride (Cl - ) ions across cell membranes to control the electrical potential of muscle cells, transfer electrolytes across epithelia, and control the pH and electrolyte composition of intracellular organelles. Some members of this protein family are Cl - ion channels, whereas others are secondary active transporters that exchange Cl - ions and protons (H + ) with a 2:1 stoichiometry. We have determined the structure of a eukaryotic CLC transporter at 3.5 angstrom resolution. Cytoplasmic cystathionine beta-synthase (CBS) domains are strategically positioned to regulate the ion-transport pathway, and many disease-causing mutations in human CLCs reside on the CBS-transmembrane interface. Comparison with prokaryotic CLC shows that a gating glutamate residue changes conformation and suggests a basis for 2:1 Cl - /H + exchange and a simple mechanistic connection between CLC channels and transporters.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
The roles of TGF-beta1 gene transfer on collagen formation during Achilles tendon healing.
Hou, Yu; Mao, ZeBing; Wei, XueLei; Lin, Lin; Chen, LianXu; Wang, HaiJun; Fu, Xin; Zhang, JiYing; Yu, ChangLong
2009-05-29
Collagen content and cross-linking are believed to be major determinants of tendon structural integrity and function. The current study aimed to investigate the effects of transforming growth factor (TGF)-beta1 on the collagen content and cross-linking of Achilles tendons, and on the histological and biomechanical changes occurring during Achilles tendon healing in rabbits. Bone marrow-derived mesenchymal stem cells (BMSCs) transfected with the TGF-beta1 gene were surgically implanted into experimentally injured Achilles tendons. Collagen proteins were identified by immunohistochemical staining and fiber bundle accumulation was revealed by Sirius red staining. Achilles tendons treated with TGF-beta1-transfected BMSCs showed higher concentrations of collagen I protein, more rapid matrix remodeling, and larger fiber bundles. Thus TGF-beta1 can promote mechanical strength in healing Achilles tendons by regulating collagen synthesis, cross-link formation, and matrix remodeling.
Sakao, Kei; Takahashi, Kenji A; Arai, Yuji; Saito, Masazumi; Honjyo, Kuniaki; Hiraoka, Nobuyuki; Kishida, Tsunao; Mazda, Osam; Imanishi, Jiro; Kubo, Toshikazu
2009-11-01
To clarify the significance of subchondral bone and osteophytes in the pathology of osteoarthritis (OA), we investigated the expression of asporin (ASPN), transforming growth factor-beta1 (TGF-beta1), TGF-beta2, TGF-beta3, and runt-related transcription factor-2 (Runx2) genes involved in bone metabolism. Osteoblasts were isolated from 19 patients diagnosed with knee OA and from 4 patients diagnosed with femoral neck fracture. Osteoblast expression of mRNA encoding ASPN, TGF-beta1, TGF-beta2, TGF-beta3, and Runx2 was analyzed using real-time RT-PCR. Expression of ASPN, TGF-beta1, and TGF-beta3 mRNA in the subchondral bone and osteophytes of OA patients increased compared with that of non-OA patients. The ratio of ASPN to TGF-beta1 mRNA in patients with severe cartilage damage was higher than that in patients with mild cartilage damage. The increased ratio of ASPN mRNA to TGF-beta1 mRNA in patients with severe relative to mild cartilage damage indicates that increased ASPN mRNA expression was significantly associated with the severity of cartilage degeneration. This finding suggests that ASPN may regulate TGF-beta1-mediated factors in the development of OA, which may provide clues as to the underlying pathology of OA.
Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.
Directory of Open Access Journals (Sweden)
Mohamed I Husseiny
Full Text Available The onset of metabolic dysregulation in type 1 diabetes (T1D occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy.
Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells.
Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng
Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Bin Tang
2018-01-01
Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Yang, Jian-feng; Shi, Xiao-peng; Zhao, Dan; Deng, Feng-mei; Zhong, Hua; Wang, Gang; Wang, Zhen-huan; Chen, Xiong-ying; He, Fang
2010-06-01
Essential hypertension (EH) was a complex disease resulted from the interaction of cumulative effect of multiple genetic and environment factors. The relationship between the genetic polymorphisms in the transforming growth factor-beta1 (TGF-beta1), the blood levels and EH have been investigated, but the conclusions were different. Therefore, we investigate the relationship between the tagging single nucleotide polymorphisms (tSNPs) (rs1800469, rs2241716, rs11466345, rs2241715, rs4803455) in TGF-beta1 gene, blood levels and EH in the Han nationality population in Xinjiang, to clarity the pattern of linkage disequilibrium (LD) and the feature of the structure of haplotype. Based on the case-control study,we selected 732 (365 EH patients,367 controls) Han Chinese population from the Boertonggu countryside of Shawan region in the Xinjiang Uygur Autonomous Region of China by random cluster sampling. After questionnaire and physical examination, we collected blood samples, and the blood levels of TGF-beta1 were quantified using sandwich ELISA. The polymorphisms of TGF-beta1 gene in the study groups were detected with SNaPshot system. The case-control study in a large group was carried out separately for each of the tSNP and followed up by haplotypes analyses to determine the relation between tSNPs of TGF-beta1 gene and EH in the Han population. (1) The frequencies of alleles A, G of rs11466345 of TGF-beta1 gene in EH group and control group were as follows: 69.7%, 30.3%, 74.4%, 25.6%, respectively. It was demonstrated that the G allele of the rs11466345 polymorphism occurred at a significantly higher frequency in EH patients than in healthy controls (30.3% vs. 25.6%, P 0.05). (2)Except the site of rs11466345, the other tSNPs were in strong LD, and no statistical differences were observed in haplotypes distribution in the followup study between case-control groups (P > 0.05). (3) There were no difference of TGF-beta1 levels between the different genotypes and alleles in
Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele
2015-08-01
Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Lutter, R; Saraste, M; van Walraven, H S; Runswick, M J; Finel, M; Deatherage, J F; Walker, J E
1993-01-01
A new procedure for the isolation of ATP synthase from bovine mitochondria has been developed, with the primary objective of producing enzyme suitable for crystallization trials. Proteins were extracted from mitochondrial membranes with dodecyl-beta-D-maltoside, and the ATP synthase was purified from the extract in the presence of the same detergent by a combination of ion-exchange and gel-filtration chromatography and ammonium sulphate precipitation. This simple and rapid procedure yields 20...
Yang, Ji; Gu, Hongya; Yang, Ziheng
2004-01-01
Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
DEFF Research Database (Denmark)
Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O
2002-01-01
An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
Analysis of bone marrow stromal cell transferred bacterial {beta}-galactosidase gene by PIXE
Energy Technology Data Exchange (ETDEWEB)
Kumakawa, Toshiro [Tokyo Metropolitan Geriatric Hospital, Tokyo (Japan). Dept. of Blood Transfusion and Hematology; Hibino, Hitoshi; Tani, Kenzaburo; Asano, Shigetaka; Futatugawa, Shouji; Sera, Kouichiro
1997-12-31
PIXE, Particle Induced X-ray Emission, is a powerful, multi-elemental analysis method which has many distinguishing features and has been used in varies research fields. Recently the method of applying baby cyclotrons for nuclear medicine to PIXE has been developed. This enables us to study biomedical phenomena from the physical point of view. Mouse bone marrow stromal cells were transferred bacterial {beta}-galactosidase gene (LacZ gene) by murine retroviral vectors. Analysis of the bone marrow stromal cells with the LacZ gene by PIXE revealed remarkable changes of intracellular trace elements compared with the normal control cells. These results indicate that gene transfer by retroviral vectors may bring about a dynamic change of intracellular circumstances of the target cell. (author)
International Nuclear Information System (INIS)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-01-01
The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis
Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H
2002-08-01
Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Rao, A.M.; Drake, M.R.; Stipanuk, M.H.
1990-01-01
To assess the extent to which low hepatic gamma-cystathionase levels affect methionine flux to cysteine in hepatocytes, the effect of inhibition of gamma-cystathionase activity with propargylglycine on the metabolism of L-[ 35 S]methionine was determined in studies with freshly isolated rat hepatocytes. gamma-Cystathionase activity was inhibited 25%, 42%, 63% and 76% (maximal inhibition) by treatment with 2.5 mumol/L, 0.01 mmol/L, 0.02 mmol/L and 2 mmol/l propargylglycine, respectively. Inhibition of gamma-cystathionase activity with up to 0.02 mmol/L propargylglycine had no statistically significant effect on [ 35 S]glutathione, [ 35 S]sulfate or [ 35 S]cysteine formation from [ 35 S]methionine. However, treatment of cells with 2 mmol/L propargylglycine markedly inhibited the metabolism of [ 35 S]methionine to [ 35 S]glutathione by 93%, to [ 35 S]sulfate by 88% and to [ 35 S]cysteine by 89%; [ 35 S]cystathionine accumulation in these incubation systems was 60 times control. Hepatic gamma-cystathionase activity in premature infants has been reported to be about 23% of mature levels; this level of gamma-cystathionase activity may limit cysteine synthesis by the methionine transsulfuration pathway. No evidence for cysteine synthesis from serine and sulfide, which can be catalyzed by cystathionine beta-synthase, or for methionine metabolism by an S-adenosylmethionine-independent pathway was obtained
Quaglino, D; Nanney, L B; Kennedy, R; Davidson, J M
1990-09-01
The effect of transforming growth factor-beta 1 (TGF-beta 1) on matrix gene expression has been investigated during the process of wound repair, where the formation of new connective tissue represents a critical step in restoring tissue integrity. Split-thickness excisional wounds in the pig were studied by in situ hybridization in order to obtain subjective findings on the activity and location of cells involved in matrix gene expression after the administration of recombinant TGF-beta 1. Data focus on the stimulatory role of this growth factor in granulation tissue formation, on the enhanced mRNA content of collagen types I and III, fibronectin, TGF-beta 1 itself, and on the reduction in stromelysin mRNA, suggesting that increased matrix formation measured after treatment with TGF-beta 1 is due to fibroplasia regulated by the abundance of mRNAs for several different structural, matrix proteins as well as inhibition of proteolytic phenomena elicited by metalloproteinases. These studies reveal elastin mRNA early in the repair process, and elastin mRNA expression is enhanced by administration of TGF-beta 1. Moreover, we show that TGF-beta 1 was auto-stimulating in wounds, accounting, at least in part, for the persistent effects of single doses of this multipotential cytokine.
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells
International Nuclear Information System (INIS)
Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng
2015-01-01
Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. - Highlights: • TLX overexpression in MIN6 cell causes significant expression changes of 225 genes. • TLX overexpression promotes MIN6 cell proliferation and decreases cell apoptosis. • TLX overexpression does not cause impairment of insulin secretion.
Nuclear orphan receptor TLX affects gene expression, proliferation and cell apoptosis in beta cells
Energy Technology Data Exchange (ETDEWEB)
Shi, Xiaoli; Xiong, Xiaokan; Dai, Zhe; Deng, Haohua; Sun, Li; Hu, Xuemei; Zhou, Feng; Xu, Yancheng, E-mail: oxyccc@163.com
2015-12-04
Nuclear orphan receptor TLX is an essential regulator of the growth of neural stem cells. However, its exact function in pancreatic islet cells is still unknown. In the present study, gene expression profiling analysis revealed that overexpression of TLX in beta cell line MIN6 causes suppression of 176 genes and upregulation of 49 genes, including a cadre of cell cycle, cell proliferation and cell death control genes, such as Btg2, Ddit3 and Gadd45a. We next examined the effects of TLX overexpression on proliferation, apoptosis and insulin secretion in MIN6 cells. Proliferation analysis using EdU assay showed that overexpression of TLX increased percentage of EdU-positive cells. Cell cycle and apoptosis analysis revealed that overexpression of TLX in MIN6 cells resulted in higher percentage of cells exiting G1 into S-phase, and a 58.8% decrease of cell apoptosis induced by 0.5 mM palmitate. Moreover, TLX overexpression did not cause impairment of insulin secretion. Together, we conclude that TLX is among factors capable of controlling beta cell proliferation and survival, which may serve as a target for the development of novel therapies for diabetes. - Highlights: • TLX overexpression in MIN6 cell causes significant expression changes of 225 genes. • TLX overexpression promotes MIN6 cell proliferation and decreases cell apoptosis. • TLX overexpression does not cause impairment of insulin secretion.
Directory of Open Access Journals (Sweden)
Hiroaki Iwasaka
2018-04-01
Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.
Description of a Riboflavin Biosynthetic Gene Variant Prevalent in the Phylum Proteobacteria
Brutinel, Evan D.; Dean, Antony M.
2013-01-01
Riboflavin (vitamin B2) is the precursor of flavin mononucleotide and flavin adenine dinucleotide, which are cofactors essential for a host of intracellular redox reactions. Microorganisms synthesize flavins de novo to fulfill nutritional requirements, but it is becoming increasingly clear that flavins play a wider role in cellular physiology than was previously appreciated. Flavins mediate diverse processes beyond the cytoplasmic membrane, including iron acquisition, extracellular respiration, and interspecies interactions. While investigating the regulation of flavin electron shuttle biosynthesis in the Gram-negative gammaproteobacterium Shewanella oneidensis, we discovered that a riboflavin biosynthetic gene (ribBA) annotated as encoding a bifunctional 3,4-dihydroxy-2-butanone 4-phosphate (DHBP) synthase/GTP cyclohydrolase II does not possess both functions. The novel gene, renamed ribBX here, encodes an amino-terminal DHBP synthase domain. The carboxy-terminal end of RibBX not only lacks GTP cyclohydrolase II activity but also has evolved a different function altogether in S. oneidensis, regulating the activity of the DHBP synthase domain. Phylogenetic analysis revealed that the misannotation of ribBX as ribBA is rampant throughout the phylum Proteobacteria (40% of 2,173 annotated ribBA genes) and that ribBX emerged early in the evolution of this group of microorganisms. We examined the functionality of representative ribBX genes from Beta-, Gamma-, and Epsilonproteobacteria and found that, consistent with sequence-based predictions, the encoded GTP cyclohydrolase II domains lack catalytic activity. The persistence of ribBX in the genomes of so many phylogenetically divergent bacterial species lends weight to the argument that ribBX has evolved a function which lends a selective advantage to the host. PMID:24097946
Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji
2014-11-01
We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
DEFF Research Database (Denmark)
Ortis, Fernanda; Naamane, Najib; Flamez, Daisy
2010-01-01
by the cytokines interleukin (IL)-1beta + interferon (IFN)-gamma and tumor necrosis factor (TNF)-alpha + IFN-gamma in primary rat beta-cells. RESEARCH DESIGN AND METHODS: Fluorescence-activated cell sorter-purified rat beta-cells were exposed to IL-1beta + IFN-gamma or TNF-alpha + IFN-gamma for 6 or 24 h......-cells, with temporal differences in the number of genes modulated by IL-1beta + IFNgamma or TNF-alpha + IFN-gamma. These cytokine combinations induced differential expression of inflammatory response genes, which is related to differential induction of IFN regulatory factor-7. Both treatments decreased the expression...... of genes involved in the maintenance of beta-cell phenotype and growth/regeneration. Cytokines induced hypoxia-inducible factor-alpha, which in this context has a proapoptotic role. Cytokines also modified the expression of >20 genes involved in RNA splicing, and exon array analysis showed cytokine...
Muddana, Venkata; Park, James; Lamb, Janette; Yadav, Dhiraj; Papachristou, Georgios I; Hawes, Robert H; Brand, Randall; Slivka, Adam; Whitcomb, David C
2010-11-01
Platelet-derived growth factor [beta] (PDGF-[beta]) is a major signal in proliferation and matrix synthesis through activated pancreatic stellate cells, leading to fibrosis of the pancreas. Recurrent acute pancreatitis (RAP) seems to predispose to chronic pancreatitis (CP) in some patients but not others. We tested the hypothesis that 2 known PDGF-[beta] polymorphisms are associated with progression from RAP to CP. We also tested the hypothesis that PDGF-[beta] polymorphisms in combination with environmental risk factors such as alcohol and smoking are associated with CP. Three hundred eighty-two patients with CP (n = 176) and RAP (n = 206) and 251 controls were evaluated. Platelet-derived growth factor [beta] polymorphisms +286 A/G (rs#1800818) seen in 5'-UTR and +1135 A/C (rs#1800817) in first intron were genotyped using single-nucleotide polymorphism polymerase chain reaction approach and confirmed by DNA sequencing. The genotypic frequencies for PDGF-[beta] polymorphisms in positions +286 and +1135 were found to be similar in controls and patients with RAP and CP. There was no difference in genotypic frequencies among RAP, CP, and controls in subjects in the alcohol and smoking subgroups. Known variations in the PDGF-[beta] gene do not have a significant effect on promoting or preventing fibrogenesis in pancreatitis. Further evaluation of this important pathway is warranted.
DEFF Research Database (Denmark)
Krath, B N; Hove-Jensen, B
2001-01-01
Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...... is consistent with a homotrimer. Secondary structure prediction shows that spinach PRPP synthase isozyme 4 has a general folding similar to that of Bacillus subtilis class I PRPP synthase, for which the three-dimensional structure has been solved, as the position and extent of helices and beta-sheets of the two...... in the spinach enzyme. In contrast, residues of the active site of B. subtilis PRPP synthase show extensive conservation in spinach PRPP synthase isozyme 4....
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yonghai Fan
2017-12-01
Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.
Directory of Open Access Journals (Sweden)
Jianrong Wang
2014-12-01
Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.
DEFF Research Database (Denmark)
Durkin, M E; Gautam, M; Loechel, F
1996-01-01
We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon-intron organ......We have determined the structural organization of the human and mouse genes that encode the laminin beta2 chain (s-laminin), an essential component of the basement membranes of the neuromuscular synapse and the kidney glomerulus. The human and mouse genes have a nearly identical exon...
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk
2011-07-01
Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells
Directory of Open Access Journals (Sweden)
Kuchipudi Suresh V
2012-10-01
Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Kabil, Omer; Yadav, Vinita; Banerjee, Ruma
2016-08-05
Substrate ambiguity and relaxed reaction specificity underlie the diversity of reactions catalyzed by the transsulfuration pathway enzymes, cystathionine β-synthase (CBS) and γ-cystathionase (CSE). These enzymes either commit sulfur metabolism to cysteine synthesis from homocysteine or utilize cysteine and/or homocysteine for synthesis of H2S, a signaling molecule. We demonstrate that a kinetically controlled heme-dependent metabolite switch in CBS regulates these competing reactions where by cystathionine, the product of CBS, inhibits H2S synthesis by the second enzyme, CSE. Under endoplasmic reticulum stress conditions, induction of CSE and up-regulation of the CBS inhibitor, CO, a product of heme oxygenase-1, flip the operating preference of CSE from cystathionine to cysteine, transiently stimulating H2S production. In contrast, genetic deficiency of CBS leads to chronic stimulation of H2S production. This metabolite switch from cystathionine to cysteine and/or homocysteine renders H2S synthesis by CSE responsive to the known modulators of CBS: S-adenosylmethionine, NO, and CO. Used acutely, it regulates H2S synthesis; used chronically, it might contribute to disease pathology. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Alpha and beta adrenergic effects on metabolism in contracting, perfused muscle
DEFF Research Database (Denmark)
Richter, Erik; Ruderman, N B; Galbo, H
1982-01-01
The role of alpha- and beta-adrenergic receptor stimulation for the effect of epinephrine on muscle glycogenolysis, glucose- and oxygen uptake and muscle performance was studied in the perfused rat hindquarter at rest and during electrical stimulation (60 contractions/min). Adrenergic stimulation...... was obtained by epinephrine in a physiological concentration (2.4 X 10(-8) M) and alpha- and beta-adrenergic blockade by 10(-5) M phentolamine and propranolol, respectively. Epinephrine enhanced net glycogenolysis during contractions most markedly in slow-twitch red fibers. In these fibers the effect...... was mediated by alpha- as well as by beta-adrenergic stimulation, the latter involving production of cAMP, phosphorylase activation and synthase inactivation. In contrast, in fast-twitch fibers only beta-adrenergic mechanisms were involved in the glycogenolytic effect of epinephrine. Moreover, inactivation...
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram
2003-12-01
Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.
Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek
2014-01-01
Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...
GenBank blastx search result: AK058464 [KOME
Lifescience Database Archive (English)
Full Text Available AK058464 001-016-A10 U27202.1 Actinobacillus pleuropneumoniae riboflavin biosynthesis operon, riboflavin...-specific deaminase (ribG), riboflavin synthase alpha subunit (ribB), bifunctional GTP ...cyclohydrase II/3,4-dihydroxy-2-butanone-4-phosphate synthase (ribA), and riboflavin synthase beta subunit (ribH) genes, complete cds.|BCT BCT 1e-105 +2 ...
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.
Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae
2017-11-15
Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd
Directory of Open Access Journals (Sweden)
Mei Lan Jin
2017-11-01
Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Vassilopoulos, Athanassios; Pennington, J Daniel; Andresson, Thorkell; Rees, David M; Bosley, Allen D; Fearnley, Ian M; Ham, Amy; Flynn, Charles Robb; Hill, Salisha; Rose, Kristie Lindsey; Kim, Hyun-Seok; Deng, Chu-Xia; Walker, John E; Gius, David
2014-08-01
Adenosine triphosphate (ATP) synthase uses chemiosmotic energy across the inner mitochondrial membrane to convert adenosine diphosphate and orthophosphate into ATP, whereas genetic deletion of Sirt3 decreases mitochondrial ATP levels. Here, we investigate the mechanistic connection between SIRT3 and energy homeostasis. By using both in vitro and in vivo experiments, we demonstrate that ATP synthase F1 proteins alpha, beta, gamma, and Oligomycin sensitivity-conferring protein (OSCP) contain SIRT3-specific reversible acetyl-lysines that are evolutionarily conserved and bind to SIRT3. OSCP was further investigated and lysine 139 is a nutrient-sensitive SIRT3-dependent deacetylation target. Site directed mutants demonstrate that OSCP(K139) directs, at least in part, mitochondrial ATP production and mice lacking Sirt3 exhibit decreased ATP muscle levels, increased ATP synthase protein acetylation, and an exercise-induced stress-deficient phenotype. This work connects the aging and nutrient response, via SIRT3 direction of the mitochondrial acetylome, to the regulation of mitochondrial energy homeostasis under nutrient-stress conditions by deacetylating ATP synthase proteins. Our data suggest that acetylome signaling contributes to mitochondrial energy homeostasis by SIRT3-mediated deacetylation of ATP synthase proteins.
Energy Technology Data Exchange (ETDEWEB)
Andujar-Sanchez, Montserrat; Martinez-Gomez, Ana Isabel; Martinez-Rodriguez, Sergio; Clemente-Jimenez, Josefa Maria; Heras-Vazquez, Francisco Javier Las; Rodriguez-Vico, Felipe [Departamento de Quimica Fisica, Bioquimica y Quimica Inorganica, Facultad de Ciencias Experimentales, Universidad de Almeria, Carretera de Sacramento s/n, La Canada de San Urbano, Almeria 04120 (Spain); Jara-Perez, Vicente [Departamento de Quimica Fisica, Bioquimica y Quimica Inorganica, Facultad de Ciencias Experimentales, Universidad de Almeria, Carretera de Sacramento s/n, La Canada de San Urbano, Almeria 04120 (Spain)], E-mail: vjara@ual.es
2009-02-15
The enzyme N-carbamoyl-{beta}-alanine amidohydrolase catalyse the hydrolysis of N-carbamoyl-{beta}-alanine or N-carbamoyl-{beta}-aminoisobutyric acid to {beta}-alanine or 3-aminoisobutyric acid, under the release of carbon-dioxide and ammonia. This work studies the inhibition of N-carbamoyl-{beta}-alanine amidohydrolase from Agrobacterium tumefaciens C58 (At{beta}car) by different carboxylic acid compounds that differ in number of carbons, and position and size of ramification, while the binding thermodynamics of the inhibitors are studied by isothermal titration calorimetry (ITC) and fluorescence. From the binding constants and inhibition studies, we conclude that propionate is the most efficient inhibitor among those tested. Substitution of the linear alkyl acids in positions 2 and 3 resulted in a drastic decrease of the affinity. The thermodynamic parameters show that a conformational change is triggered upon ligand binding. Binding enthalpy {delta}H{sub b} is negative in all cases for all ligands, and thus, Van der Waals interactions and hydrogen bonding are most probably the major sources for this term. The process is entropically favoured at all temperatures and pH studied, most probably due to the liberation of water molecules accompanying the conformational change of the enzyme.
Localisation of Neuregulin 1-{beta}3 to different sub-nuclear structures alters gene expression
Energy Technology Data Exchange (ETDEWEB)
Wang, Ming; Trim, Carol M.; Gullick, William J., E-mail: w.j.gullick@kent.ac.uk
2011-02-15
Neuregulins are growth factors that signal via the ErbB3 and ErbB4 receptors. Here we show using immunohistochemistry that they are often expressed in the nucleus of a range of tumour types including soft tissue and breast. The Neuregulin 1 type I-{beta}3 (NRG1-{beta}3) isoform localises to two sub-nuclear compartments in animal cells, nucleoli and spliceosomes. We used NRG1-{beta}3 tagged with photoactivatable GFP and demonstrated that this re-localised from nucleoli to spliceosomes over 90 min. Tyrosine kinase activity was not required for retaining the NRG1-{beta}3 within the nucleus. Mutation of the lysines 14 and 16 or 15 and 16 together prevented nucleolar uptake while four positively charged residues were identified which were required for spliceosome uptake. Molecular modelling suggests that three of these may form a binding site. We showed using a kinome array that NRG1-{beta}3 and a mutant exclusively localising to spliceosomes increased phosphorylation and/or expression of the HER4 and HER2 receptors. Using a transcriptomic analysis the same two constructs induced expression of several messenger RNAs and we confirmed the increased expression at the protein level of the most highly induced, Heat Shock Protein 70B'. These results suggest that Neuregulin activates receptor signalling in spliceosomes leading to altered gene expression.
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.
Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul
2016-01-01
Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Using the NCBI Genome Databases to Compare the Genes for Human & Chimpanzee Beta Hemoglobin
Offner, Susan
2010-01-01
The beta hemoglobin protein is identical in humans and chimpanzees. In this tutorial, students see that even though the proteins are identical, the genes that code for them are not. There are many more differences in the introns than in the exons, which indicates that coding regions of DNA are more highly conserved than non-coding regions.
Metalo-beta-lactamases Metallo-beta-lactamases
Directory of Open Access Journals (Sweden)
Rodrigo Elisandro Mendes
2006-04-01
Full Text Available Nos últimos anos tem sido observada maior incidência de bacilos Gram-negativos resistentes a cefalosporinas de espectro ampliado no ambiente hospitalar, ocasionando, assim, maior uso de betalactâmicos mais potentes, como os carbapenens. A utilização de carbapenens exerce maior pressão seletiva sobre a microbiota hospitalar, o que pode ocasionar aumento da resistência a esses agentes. Entre os mecanismos de resistência a carbapenens mais comumente identificados estão a produção de betalactamases, como, por exemplo, as pertencentes à classe D de Ambler e as que pertencem à classe B de Ambler, ou metalo-beta-lactamases (MbetaL. Essas últimas hidrolisam todos betalactâmicos comercialmente disponíveis, sendo a única exceção o monobactam aztreonam. Desde o início da década de 1990, novos genes que codificam MbetaLs têm sido descritos em microrganismos clinicamente importantes, como Pseudomonas spp., Acinetobacter spp. e membros da família Enterobacteriaceae. O encontro desses microrganismos não-sensíveis a carbapenens pode ser submetido a metodologias fenotípicas para detecção da produção de MbetaL com o intuito de auxiliar a Comissão de Controle de Infecção Hospitalar (CCIH e prevenir a disseminação desses determinantes de resistência, uma vez que genes que codificam MbetaLs estão contidos em estruturas genéticas que propiciam sua mobilidade de forma muito efetiva, sendo então facilmente disseminados.Increase isolation of Gram-negative bacilli resistant to broad-spectrum cephalosporin has been observed during the last few years, thus determining the use of more potent beta-lactams, such as carbapenems. The use of these antimicrobial agents may lead to the emergence of carbapenem resistant Gram-negative bacilli in the nosocomial environment. Carbapenem resistance may be due to the production of Ambler class D beta-lactamase or Ambler class B beta-lactamase, also called metallo-beta-lactamase (MbetaL. Apart from
IMPDH2 Is an Intracellular Target of the Cyclophilin A and Sanglifehrin A Complex
Directory of Open Access Journals (Sweden)
Khian Hong Pua
2017-01-01
Full Text Available Summary: Natural products have demonstrated utility in the clinic and can also act as probes to understand complex cellular pathways. Sanglifehrin A (SFA is a mixed polyketide and non-ribosomal peptide synthase natural product with sub-nano-molar affinity for its receptor cyclophilin A (PPIA. It has been shown to behave in vitro as an immune suppressant. Here, we identify inosine-5′-monophosphate dehydrogenase 2 (IMPDH2 as an intracellular target of the PPIA-SFA binary complex. The formation of this ternary complex does not inhibit the enzymatic activity of IMPDH2. Rather, ternary complex formation modulates cell growth through interaction with the cystathionine-β-synthase (CBS domain of IMPDH2. We further demonstrate that the SFA complex is highly isoform selective for IMPDH2 (versus IMPDH1. This work reveals a role for the CBS domains of IMPDH2 in cellular proliferation, suggesting a more complex role than previously suspected for IMPDH2 in T cell activation and proliferation. : Pua et al. identify IMPDH2 as an intracellular target of the PPIA-SFA complex and show that the CBS domains of IMPDH2 are required for cellular proliferation. Keywords: cyclophilin A, sanglifehrin A, inosine-5′-monophosphate dehydrogenase, cystathionine-β-synthase domains, protein-protein interactions
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Acetaminophen modulates the transcriptional response to recombinant interferon-beta.
Directory of Open Access Journals (Sweden)
Aaron Farnsworth
Full Text Available BACKGROUND: Recombinant interferon treatment can result in several common side effects including fever and injection-site pain. Patients are often advised to use acetaminophen or other over-the-counter pain medications as needed. Little is known regarding the transcriptional changes induced by such co-administration. METHODOLOGY/PRINCIPAL FINDINGS: We tested whether the administration of acetaminophen causes a change in the response normally induced by interferon-beta treatment. CD-1 mice were administered acetaminophen (APAP, interferon-beta (IFN-beta or a combination of IFN-beta+APAP and liver and serum samples were collected for analysis. Differential gene expression was determined using an Agilent 22 k whole mouse genome microarray. Data were analyzed by several methods including Gene Ontology term clustering and Gene Set Enrichment Analysis. We observed a significant change in the transcription profile of hepatic cells when APAP was co-administered with IFN-beta. These transcriptional changes included a marked up-regulation of genes involved in signal transduction and cell differentiation and down-regulation of genes involved in cellular metabolism, trafficking and the IkappaBK/NF-kappaB cascade. Additionally, we observed a large decrease in the expression of several IFN-induced genes including Ifit-3, Isg-15, Oasl1, Zbp1 and predicted gene EG634650 at both early and late time points. CONCLUSIONS/SIGNIFICANCE: A significant change in the transcriptional response was observed following co-administration of IFN-beta+APAP relative to IFN-beta treatment alone. These results suggest that administration of acetaminophen has the potential to modify the efficacy of IFN-beta treatment.
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor
2018-04-01
Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Jackson, Belinda M; Abete-Luzi, Patricia; Krause, Michael W; Eisenmann, David M
2014-04-16
The Wnt signaling pathway plays a fundamental role during metazoan development, where it regulates diverse processes, including cell fate specification, cell migration, and stem cell renewal. Activation of the beta-catenin-dependent/canonical Wnt pathway up-regulates expression of Wnt target genes to mediate a cellular response. In the nematode Caenorhabditis elegans, a canonical Wnt signaling pathway regulates several processes during larval development; however, few target genes of this pathway have been identified. To address this deficit, we used a novel approach of conditionally activated Wnt signaling during a defined stage of larval life by overexpressing an activated beta-catenin protein, then used microarray analysis to identify genes showing altered expression compared with control animals. We identified 166 differentially expressed genes, of which 104 were up-regulated. A subset of the up-regulated genes was shown to have altered expression in mutants with decreased or increased Wnt signaling; we consider these genes to be bona fide C. elegans Wnt pathway targets. Among these was a group of six genes, including the cuticular collagen genes, bli-1 col-38, col-49, and col-71. These genes show a peak of expression in the mid L4 stage during normal development, suggesting a role in adult cuticle formation. Consistent with this finding, reduction of function for several of the genes causes phenotypes suggestive of defects in cuticle function or integrity. Therefore, this work has identified a large number of putative Wnt pathway target genes during larval life, including a small subset of Wnt-regulated collagen genes that may function in synthesis of the adult cuticle.
Tang, Xiaoli; Zheng, Dong; Hu, Ping; Zeng, Zongyue; Li, Ming; Tucker, Lynne; Monahan, Renee; Resnick, Murray B; Liu, Manran; Ramratnam, Bharat
2014-03-01
Glycogen synthase kinase 3 beta (GSK3β) is a critical protein kinase that phosphorylates numerous proteins in cells and thereby impacts multiple pathways including the β-Catenin/TCF/LEF-1 pathway. MicroRNAs (miRs) are a class of noncoding small RNAs of ∼22 nucleotides in length. Both GSK3β and miR play myriad roles in cell functions including stem cell development, apoptosis, embryogenesis and tumorigenesis. Here we show that GSK3β inhibits the expression of miR-96, miR-182 and miR-183 through the β-Catenin/TCF/LEF-1 pathway. Knockout of GSK3β in mouse embryonic fibroblast cells increases expression of miR-96, miR-182 and miR-183, coinciding with increases in the protein level and nuclear translocation of β-Catenin. In addition, overexpression of β-Catenin enhances the expression of miR-96, miR-182 and miR-183 in human gastric cancer AGS cells. GSK3β protein levels are decreased in human gastric cancer tissue compared with surrounding normal gastric tissue, coinciding with increases of β-Catenin protein, miR-96, miR-182, miR-183 and primary miR-183-96-182 cluster (pri-miR-183). Furthermore, suppression of miR-183-96-182 cluster with miRCURY LNA miR inhibitors decreases the proliferation and migration of AGS cells. Knockdown of GSK3β with siRNA increases the proliferation of AGS cells. Mechanistically, we show that β-Catenin/TCF/LEF-1 binds to the promoter of miR-183-96-182 cluster gene and thereby activates the transcription of the cluster. In summary, our findings identify a novel role for GSK3β in the regulation of miR-183-96-182 biogenesis through β-Catenin/TCF/LEF-1 pathway in gastric cancer cells.
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.
Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W
2018-05-01
Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder
2017-11-03
Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.
TGF-Beta Gene Polymorphisms in Food Allergic versus Non-Food Allergic Eosinophilic Esophagitis
2013-10-01
esophageal dysfunction (i.e. dysphagia, anorexia, early satiety, failure to thrive) in whom gastro - esophageal reflux disease has been ruled out by...W81XWH-11-1-0741 TITLE: TGF-Beta Gene Polymorphisms in Food Allergic versus Non-Food Allergic Eosinophilic Esophagitis PRINCIPAL INVESTIGATOR...versus Non-Food Allergic Eosinophilic Esophagitis 5b. GRANT NUMBER W81XWH-11-1-0741 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) David Broide MB
Behague, I; Poirier, O; Nicaud, V; Evans, A; Arveiler, D; Luc, G; Cambou, J P; Scarabin, P Y; Bara, L; Green, F; Cambien, F
1996-02-01
Polymorphisms of the beta fibrinogen gene have been shown to affect plasma fibrinogen levels and the risk of peripheral arterial disease. We now present the results of a detailed analysis of the beta fibrinogen gene in relation to plasma fibrinogen and to the severity of coronary artery disease (CAD) in patients with myocardial infarction (MI) in the ECTIM Study. Ten polymorphisms of the beta fibrinogen gene, including five new polymorphisms identified by single-strand conformation polymorphism analysis, and one polymorphism in the 3' flanking region of the alpha fibrinogen gene were investigated in 565 patients with MI and 668 control subjects. The polymorphisms were in tight linkage disequilibrium and the genotype frequencies were similar in patients with MI and control subjects. In the multivariate analysis, only two polymorphisms, beta Hae III (P 50% stenosis was estimated by angiography and used as a criterion for severity of CAD. Presence of the less frequent allele of the beta Bcl I (P < .0003) and of other polymorphisms was positively associated with the severity of CAD. Genetic variants of the beta fibrinogen gene are associated with an increased plasma level of fibrinogen, especially in smokers. The association with CAD appears to be the consequence of an increased risk of MI in subjects with severe CAD who carry the predisposing beta fibrinogen genotypes.
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
A polymorphism of the interleukin-1 beta gene is associated with sperm pathology in humans.
Bentz, Eva-Katrin; Hefler, Lukas A; Denschlag, Dominik; Pietrowski, Detlef; Buerkle, Bernd; Tempfer, Clemens B
2007-09-01
In a prospective case-control study of 127 normozoospermic and 435 non-normozoospermic Caucasian men, the genotype frequencies of a polymorphism of the interleukin-1 beta gene (IL-1beta Taq C-->T) were statistically significantly different between groups (homozygous wild-type C/C [57%], heterozygous C/T [42%], and homozygous mutant T/T [1%] vs. C/C [57%], C/T [36%], T/T [7%] for normozoospermic and non-normozoospermic men, respectively; odds ratio, 4.8; 95% confidence interval, 1.13 to 20.28). This association was restricted to men with the oligoasthenoteratozoospermia (OAT) syndrome. We conclude that the investigated polymorphism is associated with sperm pathology in Caucasians.
Mukherjee, M; Hadar, R; Mukherjee, P K; Horwitz, B A
2003-01-01
To clone the beta-tubulins and to induce resistance to benzimidazoles in the biocontrol fungus Trichoderma virens through site-directed mutagenesis. Two beta-tubulin genes have been cloned using PCR amplification followed by the screening of a T. virens cDNA library. The full-length cDNA clones, coding for 445 and 446 amino acids, have been designated as T. virens tub1 and T. virens tub2. A sequence alignment of these two tubulins with tubulins from other filamentous fungi has shown the presence of some unique amino acid sequences not found in those positions in other beta-tubulins. Constitutive expression of the tub2 gene with a histidine to tyrosine substitution at position 6 (known to impart benomyl/methyl benzimadazol-2-yl carbamate resistance in other fungi), under the Pgpd promoter of Aspergillus nidulans, did not impart resistance to benomyl. The homologous expression of tub2 gene with a histidine to tyrosine mutation at position +6, which is known to impart benomyl tolerance in other fungi, does not impart resistance in T. virens. Unlike other Trichoderma spp., T. virens, has been difficult to mutate for benomyl tolerance. The present study, through site-directed mutagenesis, shows that a mutation known to impart benomyl tolerance in T. viride and other fungi does not impart resistance in this fungus. Understanding the mechanisms of this phenomenon will have a profound impact in plant-disease management, as many plant pathogenic fungi develop resistance to this group of fungicides forcing its withdrawal after a short period of use.
H2S: a universal defense against antibiotics in bacteria.
Shatalin, Konstantin; Shatalina, Elena; Mironov, Alexander; Nudler, Evgeny
2011-11-18
Many prokaryotic species generate hydrogen sulfide (H(2)S) in their natural environments. However, the biochemistry and physiological role of this gas in nonsulfur bacteria remain largely unknown. Here we demonstrate that inactivation of putative cystathionine β-synthase, cystathionine γ-lyase, or 3-mercaptopyruvate sulfurtransferase in Bacillus anthracis, Pseudomonas aeruginosa, Staphylococcus aureus, and Escherichia coli suppresses H(2)S production, rendering these pathogens highly sensitive to a multitude of antibiotics. Exogenous H(2)S suppresses this effect. Moreover, in bacteria that normally produce H(2)S and nitric oxide, these two gases act synergistically to sustain growth. The mechanism of gas-mediated antibiotic resistance relies on mitigation of oxidative stress imposed by antibiotics.
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Souazé, Frédérique; Viardot-Foucault, Véronique; Roullet, Nicolas; Toy-Miou-Leong, Mireille; Gompel, Anne; Bruyneel, Erik; Comperat, Eva; Faux, Maree C; Mareel, Marc; Rostène, William; Fléjou, Jean-François; Gespach, Christian; Forgez, Patricia
2006-04-01
Alterations in the Wnt/APC (adenomatous polyposis coli) signalling pathway, resulting in beta-catenin/T cell factor (Tcf)-dependent transcriptional gene activation, are frequently detected in familial and sporadic colon cancers. The neuropeptide neurotensin (NT) is widely distributed in the gastrointestinal tract. Its proliferative and survival effects are mediated by a G-protein coupled receptor, the NT1 receptor. NT1 receptor is not expressed in normal colon epithelial cells, but is over expressed in a number of cancer cells and tissues suggesting a link to the outgrowth of human colon cancer. Our results demonstrate that the upregulation of NT1 receptor occurring in colon cancer is the result of Wnt/APC signalling pathway activation. We first established the functionality of the Tcf response element within the NT1 receptor promoter. Consequently, we observed the activation of NT1 receptor gene by agents causing beta-catenin cytosolic accumulation, as well as a strong decline of endogenous receptor when wt-APC was restored. At the cellular level, the re-establishment of wt-APC phenotype resulted in the impaired functionality of NT1 receptor, like the breakdown in NT-induced intracellular calcium mobilization and the loss of NT pro-invasive effect. We corroborated the Wnt/APC signalling pathway on the NT1 receptor promoter activation with human colon carcinogenesis, and showed that NT1 receptor gene activation was perfectly correlated with nuclear or cytoplasmic beta-catenin localization while NT1 receptor was absent when beta-catenin was localized at the cell-cell junction in early adenomas of patients with familial adenomatous polyposis, hereditary non-polyposis colorectal cancer and loss of heterozygosity tumours. In this report we establish a novel link in vitro between the Tcf/beta-catenin pathway and NT1 receptor promoter activation.
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
Directory of Open Access Journals (Sweden)
Priscila Camillo Teixeira
2011-06-01
Full Text Available BACKGROUND: Chronic Chagas disease cardiomyopathy (CCC is an inflammatory dilated cardiomyopathy with a worse prognosis than other cardiomyopathies. CCC occurs in 30 % of individuals infected with Trypanosoma cruzi, endemic in Latin America. Heart failure is associated with impaired energy metabolism, which may be correlated to contractile dysfunction. We thus analyzed the myocardial gene and protein expression, as well as activity, of key mitochondrial enzymes related to ATP production, in myocardial samples of end-stage CCC, idiopathic dilated (IDC and ischemic (IC cardiomyopathies. METHODOLOGY/PRINCIPAL FINDINGS: Myocardium homogenates from CCC (N=5, IC (N=5 and IDC (N=5 patients, as well as from heart donors (N=5 were analyzed for protein and mRNA expression of mitochondrial creatine kinase (CKMit and muscular creatine kinase (CKM and ATP synthase subunits aplha and beta by immunoblotting and by real-time RT-PCR. Total myocardial CK activity was also assessed. Protein levels of CKM and CK activity were reduced in all three cardiomyopathy groups. However, total CK activity, as well as ATP synthase alpha chain protein levels, were significantly lower in CCC samples than IC and IDC samples. CCC myocardium displayed selective reduction of protein levels and activity of enzymes crucial for maintaining cytoplasmic ATP levels. CONCLUSIONS/SIGNIFICANCE: The selective impairment of the CK system may be associated to the loss of inotropic reserve observed in CCC. Reduction of ATP synthase alpha levels is consistent with a decrease in myocardial ATP generation through oxidative phosphorylation. Together, these results suggest that the energetic deficit is more intense in the myocardium of CCC patients than in the other tested dilated cardiomyopathies.
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
Directory of Open Access Journals (Sweden)
Inês Barroso
2003-10-01
Full Text Available Type 2 diabetes is an increasingly common, serious metabolic disorder with a substantial inherited component. It is characterised by defects in both insulin secretion and action. Progress in identification of specific genetic variants predisposing to the disease has been limited. To complement ongoing positional cloning efforts, we have undertaken a large-scale candidate gene association study. We examined 152 SNPs in 71 candidate genes for association with diabetes status and related phenotypes in 2,134 Caucasians in a case-control study and an independent quantitative trait (QT cohort in the United Kingdom. Polymorphisms in five of 15 genes (33% encoding molecules known to primarily influence pancreatic beta-cell function-ABCC8 (sulphonylurea receptor, KCNJ11 (KIR6.2, SLC2A2 (GLUT2, HNF4A (HNF4alpha, and INS (insulin-significantly altered disease risk, and in three genes, the risk allele, haplotype, or both had a biologically consistent effect on a relevant physiological trait in the QT study. We examined 35 genes predicted to have their major influence on insulin action, and three (9%-INSR, PIK3R1, and SOS1-showed significant associations with diabetes. These results confirm the genetic complexity of Type 2 diabetes and provide evidence that common variants in genes influencing pancreatic beta-cell function may make a significant contribution to the inherited component of this disease. This study additionally demonstrates that the systematic examination of panels of biological candidate genes in large, well-characterised populations can be an effective complement to positional cloning approaches. The absence of large single-gene effects and the detection of multiple small effects accentuate the need for the study of larger populations in order to reliably identify the size of effect we now expect for complex diseases.
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Alvarez, Vanessa; Rodríguez-Sáiz, Marta; de la Fuente, Juan Luis; Gudiña, Eduardo J; Godio, Ramiro P; Martín, Juan F; Barredo, José Luis
2006-04-01
The conversion of beta-carotene into xanthophylls is a subject of great scientific and industrial interest. We cloned the crtS gene involved in astaxanthin biosynthesis from two astaxanthin producing strains of Xanthophyllomyces dendrorhous: VKPM Y2410, an astaxanthin overproducing strain, and the wild type ATCC 24203. In both cases, the ORF has a length of 3166 bp, including 17 introns, and codes for a protein of 62.6 kDa with similarity to cytochrome-P450 hydroxylases. crtS gene sequences from strains VKPM Y2410, ATCC 24203, ATCC 96594, and ATCC 96815 show several nucleotide changes, but none of them causes any amino acid substitution, except a G2268 insertion in the 13th exon of ATCC 96815 which causes a change in the reading frame. A G1470 --> A change in the 5' splicing region of intron 8 was also found in ATCC 96815. Both point mutations explain astaxanthin idiotrophy and beta-carotene accumulation in ATCC 96815. Mutants accumulating precursors of the astaxanthin biosynthetic pathway were selected from the parental strain VKPM Y2410 (red) showing different colors depending on the compound accumulated. Two of them were blocked in the biosynthesis of astaxanthin, M6 (orange; 1% astaxanthin, 71 times more beta-carotene) and M7 (orange; 1% astaxanthin, 58 times more beta-carotene, 135% canthaxanthin), whereas the rest produced lower levels of astaxanthin (5-66%) than the parental strain. When the crtS gene was expressed in M7, canthaxanthin accumulation disappeared and astaxanthin production was partially restored. Moreover, astaxanthin biosynthesis was restored when X. dendrorhous ATCC 96815 was transformed with the crtS gene. The crtS gene was heterologously expressed in Mucor circinelloides conferring to this fungus an improved capacity to synthesize beta-cryptoxanthin and zeaxanthin, two hydroxylated compounds from beta-carotene. These results show that the crtS gene is involved in the conversion of beta-carotene into xanthophylls, being potentially useful to
Directory of Open Access Journals (Sweden)
Vivas Yurena
2011-12-01
Full Text Available Abstract Background The progression towards type 2 diabetes depends on the allostatic response of pancreatic beta cells to synthesise and secrete enough insulin to compensate for insulin resistance. The endocrine pancreas is a plastic tissue able to expand or regress in response to the requirements imposed by physiological and pathophysiological states associated to insulin resistance such as pregnancy, obesity or ageing, but the mechanisms mediating beta cell mass expansion in these scenarios are not well defined. We have recently shown that ob/ob mice with genetic ablation of PPARγ2, a mouse model known as the POKO mouse failed to expand its beta cell mass. This phenotype contrasted with the appropriate expansion of the beta cell mass observed in their obese littermate ob/ob mice. Thus, comparison of these models islets particularly at early ages could provide some new insights on early PPARγ dependent transcriptional responses involved in the process of beta cell mass expansion Results Here we have investigated PPARγ dependent transcriptional responses occurring during the early stages of beta cell adaptation to insulin resistance in wild type, ob/ob, PPARγ2 KO and POKO mice. We have identified genes known to regulate both the rate of proliferation and the survival signals of beta cells. Moreover we have also identified new pathways induced in ob/ob islets that remained unchanged in POKO islets, suggesting an important role for PPARγ in maintenance/activation of mechanisms essential for the continued function of the beta cell. Conclusions Our data suggest that the expansion of beta cell mass observed in ob/ob islets is associated with the activation of an immune response that fails to occur in POKO islets. We have also indentified other PPARγ dependent differentially regulated pathways including cholesterol biosynthesis, apoptosis through TGF-β signaling and decreased oxidative phosphorylation.
Beta-lactamases in Enterobacteriaceae in broilers
Dierikx, C.M.
2013-01-01
Resistance to cephalosprins due to the production of extended spectrum beta-lactamases (ESBLs) or plasmid mediated AmpC beta-lactamases is increasingly found in infections in humans outside the hospital. The genes encoding for these beta-lactamases are located on mobile DNA (plasmids), which can be
CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.
Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel
2018-03-29
Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.
Cotta, S.R.; Cavalcante Franco Dias, A.; Seldin, L.; Andreote, F. D.; van Elsas, J. D.
The ecology of microbial communities associated with organic phosphorus (P) mineralization in soils is still understudied. Here, we assessed the abundance and diversity of bacteria harbouring genes encoding beta-propeller phytases (BPP) in the rhizosphere of traditional and transgenic maize
Characterization of a 1,4-. beta. -D-glucan synthase from Dictyostelium discoideum
Energy Technology Data Exchange (ETDEWEB)
Blanton, R.L.
1992-01-15
Various aspects of research concerning Dictyostelium discoideum are presented. The initial focus of this project was upon: the characterization of potential probes for the cellulose synthase (antibody and nucleic acid), the determination of the cultural induction conditions of cellulose synthesis, the solubilization of the enzyme activity, the development of a non-inhibitory disruption buffer, the generation and isolation of mutant strains deficient in cellulose synthesis, and the development of the capability to determine the degree of polymerization of the in vitro product. I have briefly summarized our most significant findings with only selected data sets being shown in this report in the interest of brevity.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
DEFF Research Database (Denmark)
Hu, Yating; Zhou, Yongjin J.; Bao, Jichen
2017-01-01
inefficient and suffers from limited natural resources. Here, we engineered a yeast cell factory for the sustainable production of germacrene A, which can be transformed to beta-elemene by a one-step chemical reaction in vitro. Two heterologous germacrene A synthases (GASs) converting farnesyl pyrophosphate...... (FPP) to germacrene A were evaluated in yeast for their ability to produce germacrene A. Thereafter, several metabolic engineering strategies were used to improve the production level. Overexpression of truncated 3-hydroxyl-3-methylglutaryl-CoA reductase and fusion of FPP synthase with GAS, led...
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D
2001-09-01
The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by
Regulation of galactan synthase expression to modify galactan content in plants
None
2017-08-22
The disclosure provides methods of engineering plants to modulate galactan content. Specifically, the disclosure provides methods for engineering a plant to increase the galactan content in a plant tissue by inducing expression of beta-1,4-galactan synthase (GALS), modulated by a heterologous promoter. Further disclosed are the methods of modulating expression level of GALS under the regulation of a transcription factor, as well as overexpression of UDP-galactose epimerse in the same plant tissue. Tissue specific promoters and transcription factors can be used in the methods are also provided.
Yamamoto, E; Baird, W V
1999-01-01
Dinitroaniline herbicides are antimicrotubule drugs that bind to tubulins and inhibit polymerization. As a result of repeated application of dinitroaniline herbicides, resistant biotypes of goosegrass (Eleusine indica) developed in previously susceptible wild-type populations. We have previously reported that alpha-tubulin missense mutations correlate with dinitroaniline response phenotypes (Drp) (Plant Cell 10: 297-308, 1998). In order to ascertain associations of other tubulins with dinitroaniline resistance, four beta-tubulin cDNA classes (designated TUB1, TUB2, TUB3, and TUB4) were isolated from dinitroaniline-susceptible and -resistant biotypes. Sequence analysis of the four beta-tubulin cDNA classes identified no missense mutations. Identified nucleotide substitutions did not result in amino acid replacements. These results suggest that the molecular basis of dinitroaniline resistance in goosegrass differs from those of colchicine/dinitroaniline cross-resistant Chlamydomonas reinhardtii and benzimidazole-resistant fungi and yeast. Expression of the four beta-tubulins was highest in inflorescences. This is in contrast to alpha-tubulin TUA1 that is expressed predominantly in roots. Collectively, these results imply that beta-tubulin genes are not associated with dinitroaniline resistance in goosegrass. Phylogenetic analysis of the four beta-tubulins, together with three alpha-tubulins, suggests that the resistant biotype developed independently in multiple locations rather than spreading from one location.
Chung, Jin Young; Choi, Jung Hoon; Shin, Il Seob; Choi, Eun Wha; Hwang, Cheol Yong; Lee, Sang Koo; Youn, Hwa Young
2008-12-01
Due to the therapeutic potential of gene therapy for neuronal injury, many studies of neurotrophic factors, vectors, and animal models have been performed. The presumed dog beta-nerve growth factor (pdbeta-NGF) was generated and cloned and its expression was confirmed in CHO cells. The recombinant pdbeta-NGF protein reacted with a human beta-NGF antibody and showed bioactivity in PC12 cells. The pdbeta-NGF was shown to have similar bioactivity to the dog beta-NGF. The recombinant pdbeta-NGF plasmid was administrated into the intrathecal space in the gene therapy group. Twenty-four hours after the vector inoculation, the gene therapy group and the positive control group were intoxicated with excess pyridoxine for seven days. Each morning throughout the test period, the dogs' body weight was taken and postural reaction assessments were made. Electrophysiological recordings were performed twice, once before the experiment and once after the test period. After the experimental period, histological analysis was performed. Dogs in the gene therapy group had no weight change and were normal in postural reaction assessments. Electrophysiological recordings were also normal for the gene therapy group. Histological analysis showed that neither the axons nor the myelin of the dorsal funiculus of L4 were severely damaged in the gene therapy group. In addition, the dorsal root ganglia of L4 and the peripheral nerves (sciatic nerve) did not experience severe degenerative changes in the gene therapy group. This study is the first to show the protective effect of NGF gene therapy in a dog model.
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Elk-3 is a transcriptional repressor of nitric-oxide synthase 2.
Chen, Yen-Hsu; Layne, Matthew D; Chung, Su Wol; Ejima, Kuniaki; Baron, Rebecca M; Yet, Shaw-Fang; Perrella, Mark A
2003-10-10
The inducible isoform of nitric-oxide synthase (NOS2), a key enzyme catalyzing the dramatic increase in nitric oxide by lipopolysaccharide (LPS), plays an important role in the pathophysiology of endotoxemia and sepsis. Recent evidence suggests that Ets transcription factors may contribute to NOS2 induction by inflammatory stimuli. In this study, we investigated the role of Ets transcription factors in the regulation of NOS2 by LPS and transforming growth factor (TGF)-beta 1. Transient transfection assays in macrophages showed that Ets-2 produced an increase in NOS2 promoter activity, whereas the induction by Ets-1 was modest and NERF2 had no effect. Elk-3 (Net/Erp/Sap-2a) markedly repressed NOS2 promoter activity in a dose-dependent fashion, and overexpression of Elk-3 blunted the induction of endogenous NOS2 message. Mutation of the Net inhibitory domain of Elk-3, but not the C-terminal-binding protein interaction domain, partially alleviated this repressive effect. We also found that deletion of the Ets domain of Elk-3 completely abolished its repressive effect on the NOS2 promoter. LPS administration to macrophages led to a dose-dependent decrease in endogenous Elk-3 mRNA levels, and this decrease in Elk-3 preceded the induction of NOS2 mRNA. In a mouse model of endotoxemia, the expression of Elk-3 in kidney, lung, and heart was significantly down-regulated after systemic administration of LPS, and this down-regulation also preceded NOS2 induction. Moreover, TGF-beta 1 significantly increased endogenous Elk-3 mRNA levels that had been down-regulated by LPS in macrophages. This increase in Elk-3 correlated with a TGF-beta 1-induced down-regulation of NOS2. Taken together, our data suggest that Elk-3 is a strong repressor of NOS2 promoter activity and mRNA levels and that endogenous expression of Elk-3 inversely correlates with NOS2. Thus, Elk-3 may serve as an important mediator of NOS2 gene expression.
Directory of Open Access Journals (Sweden)
Gentil Claudino de Galiza Neto
2005-10-01
Full Text Available No presente trabalho abordam-se vários aspectos relacionados à natureza molecular da anemia falciforme (AF, desordem hematológica de caráter hereditário. A descoberta do polimorfismo do DNA no grupamento do gene betaS, originando diferentes haplótipos da doença, permitiu ampliar o conhecimento em torno da heterogeneidade clínica observada nos pacientes falcêmicos nas mais diversas regiões do mundo. Analisaram-se os diferentes haplótipos e seus parâmetros hematológicos, presentes em um grupo de 22 pacientes naturais e procedentes do estado do Ceará. A distribuição das freqüências dos haplótipos encontrados foi de 55,9% para Benin; 41,2% para República Centro-Africana (CAR; e de 2,9% para o haplótipo Senegal. Esses dados, em comparação com os demais estudos realizados no Brasil, mostram associação entre os seus valores para um alfa de 5% (p The present work deals with numerous aspects related to the molecular nature of sickle cell anemia. The discovery of the DNA polymorphism in the betas-globin gene cluster, gave origin to different haplotypes of the disease, making possible to enlarge the knowledge about the clinical heterogenity observed on the patients with sickle cell disease, in the various regions of the world. The different haplotypes and its hematological parameters were analysed in a group of 22 patients born in the State of Ceará, northeast of Brazil. The distribution found in the haplotypes frequency was of 55.9% for the Benin, of 41.2% for the CAR, and of 2.9% for Senegal haplotype. The data, compared to the others works done in Brazil, show relations among their values to alpha of 5% (p < 0,05. The results make possible a full understanding of the pathophisiology of the illness and of its clinical complexity in our State, as well as it allows a better knowledge of the sickle cell disease in our country.
Energy Technology Data Exchange (ETDEWEB)
Choi, Hye Jin [Laboratory of Systems Mucosal Biomodulation, Department of Microbiology and Immunology, Pusan National University School of Medicine, Yangsan (Korea, Republic of); Lee, Dong-Hyung [Department of Obstetrics and Gynecology, Medical Research Institute, Pusan National University, Busan (Korea, Republic of); Park, Seong-Hwan; Kim, Juil; Do, Kee Hun [Laboratory of Systems Mucosal Biomodulation, Department of Microbiology and Immunology, Pusan National University School of Medicine, Yangsan (Korea, Republic of); An, Tae Jin; Ahn, Young Sup; Park, Chung Berm [Department of Herbal Crop Research, NIHHS, RDA, Eumseong (Korea, Republic of); Moon, Yuseok, E-mail: moon@pnu.edu [Laboratory of Systems Mucosal Biomodulation, Department of Microbiology and Immunology, Pusan National University School of Medicine, Yangsan (Korea, Republic of); Medical Research Institute and Research Institute for Basic Sciences, Pusan National University, Busan (Korea, Republic of)
2011-09-30
Highlights: {yields} As a target of oncogene RhoA-linked signal, a prostaglandin metabolism is assessed. {yields} RhoA activation increases PGE{sub 2} levels and its metabolic enzyme mPGES-1. {yields} RhoA-activated NF-{kappa}B and EGR-1 are positively involved in mPGES-1 induction. -- Abstract: Oncogenic RhoA GTPase has been investigated as a mediator of pro-inflammatory responses and aggressive carcinogenesis. Among the various targets of RhoA-linked signals, pro-inflammatory prostaglandin E{sub 2} (PGE{sub 2}), a major prostaglandin metabolite, was assessed in epithelial cancer cells. RhoA activation increased PGE{sub 2} levels and gene expression of the rate-limiting PGE{sub 2} producing enzymes, cyclooxygenase-2 and microsomal prostaglandin E synthase 1 (mPGES-1). In particular, human mPGES-1 was induced by RhoA via transcriptional activation in control and interleukin (IL)-1{beta}-activated cancer cells. To address the involvement of potent signaling pathways in RhoA-activated mPGES-1 induction, various signaling inhibitors were screened for their effects on mPGES-1 promoter activity. RhoA activation enhanced basal and IL-1{beta}-mediated phosphorylated nuclear factor-{kappa}B and extracellular signal-regulated kinase1/2 proteins, all of which were positively involved in RhoA-induced gene expression of mPGES-1. As one potent down-stream transcription factor of ERK1/2 signals, early growth response gene 1 product also mediated RhoA-induced gene expression of mPGES-1 by enhancing transcriptional activity. Since oncogene-triggered PGE{sub 2} production is a critical modulator of epithelial tumor cells, RhoA-associated mPGES-1 represents a promising chemo-preventive or therapeutic target for epithelial inflammation and its associated cancers.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Pizzichini Daniele
2007-03-01
Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.
Directory of Open Access Journals (Sweden)
Vesentini Nicoletta
2012-02-01
Full Text Available Abstract Background Changes in cardiac gene expression due to myocardial injury are usually assessed in whole heart tissue. However, as the heart is a heterogeneous system, spatial and temporal heterogeneity is expected in gene expression. Results In an ischemia/reperfusion (I/R rat model we evaluated gene expression of mitochondrial and cytoplasmatic superoxide dismutase (MnSod, Cu-ZnSod and thioredoxin reductase (trxr1 upon short (4 h and long (72 h reperfusion times in the right ventricle (RV, and in the ischemic/reperfused (IRR and the remote region (RR of the left ventricle. Gene expression was assessed by Real-time reverse-transcription quantitative PCR (RT-qPCR. In order to select most stable reference genes suitable for normalization purposes, in each myocardial region we tested nine putative reference genes by geNorm analysis. The genes investigated were: Actin beta (actb, Glyceraldehyde-3-P-dehydrogenase (gapdh, Ribosomal protein L13A (rpl13a, Tyrosine 3-monooxygenase (ywhaz, Beta-glucuronidase (gusb, Hypoxanthine guanine Phosphoribosyltransferase 1 (hprt, TATA binding box protein (tbp, Hydroxymethylbilane synthase (hmbs, Polyadenylate-binding protein 1 (papbn1. According to our findings, most stable reference genes in the RV and RR were hmbs/hprt and hmbs/tbp/hprt respectively. In the IRR, six reference genes were recommended for normalization purposes; however, in view of experimental feasibility limitations, target gene expression could be normalized against the three most stable reference genes (ywhaz/pabp/hmbs without loss of sensitivity. In all cases MnSod and Cu-ZnSod expression decreased upon long reperfusion, the former in all myocardial regions and the latter in IRR alone. trxr1 expression did not vary. Conclusions This study provides a validation of reference genes in the RV and in the anterior and posterior wall of the LV of cardiac ischemia/reperfusion model and shows that gene expression should be assessed separately in
Energy Technology Data Exchange (ETDEWEB)
Broekelmann, T.J.; Limper, A.H.; McDonald, J.A. (Washington Univ., St. Louis, MO (United States)); Colby, T.V. (Mayo Clinic, Rochester, MN (United States))
1991-08-01
Idiopathic pulmonary fibrosis is an inexorably fatal disorder characterized by connective tissue deposition within the terminal air spaces resulting in loss of lung function and eventual respiratory failure. Previously, the authors demonstrated that foci of activated fibroblasts expressing high levels of fibronectin, procollagen, and smooth muscle actin and thus resembling those found in healing wounds are responsible for the connective tissue deposition and scarring in idiopathic pulmonary fibrosis. Using in situ hybridization and immunohistochemistry, they now demonstrate the presence of transforming growth factor {beta}{sub 1} (TGF-{beta}{sub 1}), a potent profibrotic cytokine, in the foci containing these activated fibroblasts. These results suggest that matrix-associated TGF-{beta}{sub 1} may serve as a stimulus for the persistent expression of connective tissue genes. One potential source of the TGF-{beta}{sub 1} is the alveolar macrophage, and they demonstrate the expression of abundant TGF-{beta}{sub 1} mRNA in alveolar macrophages in lung tissue from patients with idiopathic pulmonary fibrosis.
Energy Technology Data Exchange (ETDEWEB)
Varco-Merth, Benjamin; Fromme, Raimund; Wang, Meitian; Fromme, Petra (AZU)
2008-08-27
The ATP synthase is one of the most important enzymes on earth as it couples the transmembrane electrochemical potential of protons to the synthesis of ATP from ADP and inorganic phosphage, providing the main ATP source of almost all higher life on earth. During ATP synthesis, stepwise protonation of a conserved carboxylate on each protein subunit of an oligomeric ring of 10--15 c-subunits is commonly thought to drive rotation of the rotor moiety (c{sub 10-14}{gamma}{sup {epsilon}}) relative to stator moiety ({alpha}{sub 3}{beta}{sub 3}{delta}ab{sub 2}). Here we report the isolation and crystallization of the c{sub 14}-ring of subunit c from the spinach chloroplast enzyme diffracting as far as 2.8 {angstrom}. Though ATP synthase was not previously know to contain any pigments, the crystals of the c-subunit possessed a strong yellow color. The pigment analysis revaled that they contain 1 chlorophyll and 2 carotenoids, thereby showing for the first time that the chloroplast ATP synthase contains cofactors, leading to the question of the possible roles of the functions of the pigments in the chloroplast ATP synthase.
International Nuclear Information System (INIS)
Pestov, Nikolay B.; Zhao, Hao; Basrur, Venkatesha; Modyanov, Nikolai N.
2011-01-01
Highlights: → Structural properties of BetaM and Na,K-ATPase β-subunits are sharply different. → BetaM protein is concentrated in nuclear membrane of skeletal myocytes. → BetaM does not associate with a Na,K-ATPase α-subunit in skeletal muscle. → Polypeptide chain of the native BetaM is highly sensitive to endogenous proteases. → BetaM in neonatal muscle is a product of alternative splice mRNA variant B. -- Abstract: ATP1B4 genes represent a rare instance of the orthologous gene co-option that radically changed functions of encoded BetaM proteins during vertebrate evolution. In lower vertebrates, this protein is a β-subunit of Na,K-ATPase located in the cell membrane. In placental mammals, BetaM completely lost its ancestral role and through acquisition of two extended Glu-rich clusters into the N-terminal domain gained entirely new properties as a muscle-specific protein of the inner nuclear membrane possessing the ability to regulate gene expression. Strict temporal regulation of BetaM expression, which is the highest in late fetal and early postnatal myocytes, indicates that it plays an essential role in perinatal development. Here we report the first structural characterization of the native eutherian BetaM protein. It should be noted that, in contrast to structurally related Na,K-ATPase β-subunits, the polypeptide chain of BetaM is highly sensitive to endogenous proteases that greatly complicated its isolation. Nevertheless, using a complex of protease inhibitors, a sample of authentic BetaM was isolated from pig neonatal skeletal muscle by a combination of ion-exchange and lectin-affinity chromatography followed by SDS-PAGE. Results of the analysis of the BetaM tryptic digest using MALDI-TOF and ESI-MS/MS mass spectrometry have demonstrated that native BetaM in neonatal skeletal muscle is a product of alternative splice mRNA variant B and comprised of 351 amino acid residues. Isolated BetaM protein was also characterized by SELDI-TOF mass
International Nuclear Information System (INIS)
Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand
2008-01-01
Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses
A plasmodesmata-associated beta-1,3-glucanase in Arabidopsis.
Levy, Amit; Erlanger, Michael; Rosenthal, Michal; Epel, Bernard L
2007-02-01
Plasmodesmal conductivity is regulated in part by callose turnover, which is hypothesized to be determined by beta-1,3-glucan synthase versus glucanase activities. A proteomic analysis of an Arabidopsis thaliana plasmodesmata (Pd)-rich fraction identified a beta-1,3-glucanase as present in this fraction. The protein encoded by the putative plasmodesmal associated protein (ppap) gene, termed AtBG_ppap, had previously been found to be a post-translationally modified glycosylphosphatidylinositol (GPI) lipid-anchored protein. When fused to green fluorescent protein (GFP) and expressed in tobacco (Nicotiana tabacum) or Nicotiana benthamiana epidermal cells, this protein displays fluorescence patterns in the endoplasmic reticulum (ER) membrane system, along the cell periphery and in a punctate pattern that co-localizes with aniline blue-stained callose present around the Pd. Plasma membrane localization was verified by co-localization of AtBG_ppap:GFP together with a plasma membrane marker N-[3-triethylammoniumpropyl]-4-[p-diethylaminophenylhexatrienyl] pyridinium dibromide (FM4-64) in plasmolysed cells. In Arabidopsis T-DNA insertion mutants that do not transcribe AtBG_ppap, functional studies showed that GFP cell-to-cell movement between epidermal cells is reduced, and the conductivity coefficient of Pd is lower. Measurements of callose levels around Pd after wounding revealed that callose accumulation in the mutant plants was higher. Taken together, we suggest that AtBG_ppap is a Pd-associated membrane protein involved in plasmodesmal callose degradation, and functions in the gating of Pd.
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-01-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
DEFF Research Database (Denmark)
Riess, O; Noerremoelle, A; Weber, B
1992-01-01
The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons...
Uozumi, N; Sakurai, K; Sasaki, T; Takekawa, S; Yamagata, H; Tsukagoshi, N; Udaka, S
1989-01-01
The Bacillus polymyxa amylase gene comprises 3,588 nucleotides. The mature amylase comprises 1,161 amino acids with a molecular weight of 127,314. The gene appeared to be divided into two portions by the direct-repeat sequence located at almost the middle of the gene. The 5' region upstream of the direct-repeat sequence was shown to be responsible for the synthesis of beta-amylase. The 3' region downstream of the direct-repeat sequence contained four sequences homologous with those in other a...
Yoshikawa, Noriko; Yamada, Shizuo; Takeuchi, Chihiro; Kagota, Satomi; Shinozuka, Kazumasa; Kunitomo, Masaru; Nakamura, Kazuki
2008-06-01
Cordyceps sinensis, a parasitic fungus on the larvae of Lepidoptera, has been used as a traditional Chinese medicine. We previously reported that the growth of B16-BL6 mouse melanoma (B16-BL6) cells was inhibited by cordycepin (3'-deoxyadenosine), an active ingredient of C. sinensis, and its effect was antagonized by MRS1191, a selective adenosine A3 receptor antagonist. In this study, the radioligand binding assay using [125I]-AB-MECA (a selective adenosine A3 receptor agonist) has shown that B16-BL6 cells express adenosine A3 receptors and that cordycepin binds to these receptors. We also confirmed the involvement of adenosine A3 receptors in the action of cordycepin using MRS1523 and MRS1220, specific adenosine A3 receptor antagonists. Next, indirubin, a glycogen synthase kinase-3beta (GSK-3beta) inhibitor, antagonized the growth suppression induced by cordycepin. Furthermore, the level of cyclin D1 protein in B16-BL6 cells was decreased by cordycepin using Western blot analysis. In conclusion, this study demonstrated that cordycepin inhibits the proliferation of B16-BL6 cells by stimulating adenosine A3 receptors followed by the Wnt signaling pathway, including GSK-3beta activation and cyclin D1 inhibition.
Dziubińska-Parol, Izabella; Gasowska, Urszula; Rzymowska, Jolanta; Kwaśniewska, Anna
2003-09-01
Many recent studies indicate that long term use of contraceptives is a strong risk factor in the development of cervical cancer. Steroid hormones, in persistent papilloma virus infection act on various levels, one of them is enhancing transforming activity of the virus. The aim of the study was to estimate if physiological concentrations of 17 beta-estradiol could influence expression of viral transforming genes. HeLa cell lines were incubated with three different physiological concentrations and and on the third day of incubation the level of E6 gene expression was determined. Results show no differences in expression between the control culter, and cultures incubated with physiological concentrations. It indicates that normal levels of 17 beta-estradiol don't play role in transforming process but it also shows need to analyse higher levels of hormones by quantitative analyses in prospective studies.
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.
2006-01-01
Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870
Directory of Open Access Journals (Sweden)
Selma Ünal
2014-09-01
Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.
Directory of Open Access Journals (Sweden)
Chong Seng Shueh
2012-10-01
Full Text Available The main objective of current study was to explore the function of chromosomal putative beta-lactamase gene (smlt 0115 in clinical Stenotrophomonas maltophilia. Antibiotic susceptibility test (AST screening for current antimicrobial drugs was done and Minimum Inhibitory Concentration (MIC level towards beta-lactams was determined by E-test. Putative beta-lactamase gene of S. maltophilia was amplified via PCR, with specific primers, then cloned into pET-15 expression plasmid and transformed into Escherichia coli BL21. The gene was sequenced and analyzed. The expressed protein was purified by affinity chromatography and the kinetic assay was performed. S. maltophilia ATCC 13637 was included in this experiment. Besides, a hospital strain which exhibited resistant to a series of beta-lactams including cefepime was identified via AST and MIC, hence it was named as S2 strain and was considered in this study. Sequencing result showed that putative beta-lactamase gene obtained from ATCC 13637 and S2 strains were predicted to have cephalosporinase activity by National Center for Biotechnology Information (NCBI blast program. Differences in the sequences of both ATCC 13637 and S2 strains were found via ClustalW alignment software. Kinetic assay proved a cephalosporinase characteristic produced by E. coli BL21 clone that overexpressed the putative beta-lactamase gene cloned under the control of an external promoter. Yet, expressed protein purified from S2 strain had high catalytic activity against beta-lactam antibiotics which was 14-fold higher than expressed protein purified from ATCC 13637 strain. This study represents the characterization analysis of putative beta-lactamase gene (smlt 0115 of S. maltophilia. The presence of the respective gene in the chromosome of S. maltophilia suggested that putative beta-lactamase gene (smlt 0115 of S. maltophilia plays a role in beta-lactamase resistance.
Directory of Open Access Journals (Sweden)
Kwangwoo Kim
Full Text Available The genetic association of HLA-DRB1 with rheumatoid arthritis (RA and systemic lupus erythematosus (SLE is well documented, but association with other HLA-DR beta genes (HLA-DRB3, HLA-DRB4 and HLA-DRB5 has not been thoroughly studied, despite their similar functions and chromosomal positions. We examined variants in all functional HLA-DR beta genes in RA and SLE patients and controls, down to the amino-acid level, to better understand disease association with the HLA-DR locus. To this end, we improved an existing HLA reference panel to impute variants in all protein-coding HLA-DR beta genes. Using the reference panel, HLA variants were inferred from high-density SNP data of 9,271 RA-control subjects and 5,342 SLE-control subjects. Disease association tests were performed by logistic regression and log-likelihood ratio tests. After imputation using the newly constructed HLA reference panel and statistical analysis, we observed that HLA-DRB1 variants better accounted for the association between MHC and susceptibility to RA and SLE than did the other three HLA-DRB variants. Moreover, there were no secondary effects in HLA-DRB3, HLA-DRB4, or HLA-DRB5 in RA or SLE. Of all the HLA-DR beta chain paralogs, those encoded by HLA-DRB1 solely or dominantly influence susceptibility to RA and SLE.
Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi
2008-06-01
Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.
2017-01-01
Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu
2008-08-01
Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.
Onouchi, Hitoshi; Nagami, Yoko; Haraguchi, Yuhi; Nakamoto, Mari; Nishimura, Yoshiko; Sakurai, Ryoko; Nagao, Nobuhiro; Kawasaki, Daisuke; Kadokura, Yoshitomo; Naito, Satoshi
2005-01-01
Expression of the Arabidopsis CGS1 gene that codes for cystathionine γ-synthase is feedback regulated at the step of mRNA stability in response to S-adenosyl-L-methionine (AdoMet). A short stretch of amino acid sequence, called the MTO1 region, encoded by the first exon of CGS1 itself is involved in this regulation. Here, we demonstrate, using a cell-free system, that AdoMet induces temporal translation elongation arrest at the Ser-94 codon located immediately downstream of the MTO1 region, by analyzing a translation intermediate and performing primer extension inhibition (toeprint) analysis. This translation arrest precedes the formation of a degradation intermediate of CGS1 mRNA, which has its 5′ end points near the 5′ edge of the stalled ribosome. The position of ribosome stalling also suggests that the MTO1 region in nascent peptide resides in the ribosomal exit tunnel when translation elongation is temporarily arrested. In addition to the MTO1 region amino acid sequence, downstream Trp-93 is also important for the AdoMet-induced translation arrest. This is the first example of nascent peptide-mediated translation elongation arrest coupled with mRNA degradation in eukaryotes. Furthermore, our data suggest that the ribosome stalls at the step of translocation rather than at the step of peptidyl transfer. PMID:16027170
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Directory of Open Access Journals (Sweden)
Juan J. González-Plaza
2018-01-01
Full Text Available Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs, which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the
González-Plaza, Juan J.; Šimatović, Ana; Milaković, Milena; Bielen, Ana; Wichmann, Fabienne; Udiković-Kolić, Nikolina
2018-01-01
Environments polluted by direct discharges of effluents from antibiotic manufacturing are important reservoirs for antibiotic resistance genes (ARGs), which could potentially be transferred to human pathogens. However, our knowledge about the identity and diversity of ARGs in such polluted environments remains limited. We applied functional metagenomics to explore the resistome of two Croatian antibiotic manufacturing effluents and sediments collected upstream of and at the effluent discharge sites. Metagenomic libraries built from an azithromycin-production site were screened for resistance to macrolide antibiotics, whereas the libraries from a site producing veterinary antibiotics were screened for resistance to sulfonamides, tetracyclines, trimethoprim, and beta-lactams. Functional analysis of eight libraries identified a total of 82 unique, often clinically relevant ARGs, which were frequently found in clusters and flanked by mobile genetic elements. The majority of macrolide resistance genes identified from matrices exposed to high levels of macrolides were similar to known genes encoding ribosomal protection proteins, macrolide phosphotransferases, and transporters. Potentially novel macrolide resistance genes included one most similar to a 23S rRNA methyltransferase from Clostridium and another, derived from upstream unpolluted sediment, to a GTPase HflX from Emergencia. In libraries deriving from sediments exposed to lower levels of veterinary antibiotics, we found 8 potentially novel ARGs, including dihydrofolate reductases and beta-lactamases from classes A, B, and D. In addition, we detected 7 potentially novel ARGs in upstream sediment, including thymidylate synthases, dihydrofolate reductases, and class D beta-lactamase. Taken together, in addition to finding known gene types, we report the discovery of novel and diverse ARGs in antibiotic-polluted industrial effluents and sediments, providing a qualitative basis for monitoring the dispersal of ARGs
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
OXA beta-lactamase-mediated carbapenem resistance in Acinetobacter baumannii
Directory of Open Access Journals (Sweden)
S M Amudhan
2011-01-01
Full Text Available Objectives: Acinetobacter baumannii is a significant pathogen in health care settings. In recent years, an increase in carbapenem resistance among A. baumannii due to Ambler class B metallo-beta-lactamases or class D OXA carbapenamases has been reported. In this study we detected the presence of OXA carbapenamases and coproduction of metallo-beta-lactamases (blaVIM and blaIMP by phenotypic and genotypic methods in carbapenem resistant clinical isolates of Acinetobacter baumannii. Materials and Methods: A total of 116 consecutive, non-duplicate carbapenem resistant A. baumannii isolated from various clinical specimens were included in the study. The modified Hodge test and inhibitor potentiated disk diffusion tests were done for the screening of carbapenamase and metallo-beta-lactamase production, respectively. Polymerase chain reaction (PCR was performed for the detection of OXA (blaOXA 23 like, blaOXA 24 like, blaOXA-51 like and blaOXA-58 like genes and metallo-beta-lactamases (blaVIM and blaIMP genes. Gene sequencing was performed for representative isolates. Results: Among 116 A. baumannii, OXA genes were detected in 106 isolates. BlaOXA 51 like (n = 99 and blaOXA -23 like (n = 95 were the most common and they coexisted in 89 isolates. blaOXA-24 like gene was detected in two isolates of which one also carried blaOXA-51 like and blaOXA-58 like genes. The modified Hodge test was positive in 113 isolates. The metallo-beta-lactamase screening test was positive in 92 isolates. blavim was detected in 54 isolates of which 1 also carried the blaIMP gene. Conclusions: blaOXA-23 like and bla OXA 51 like genes are the most common types of OXA carbapenamases while the blaVIM type is the most common type of metallo-beta-lactamase contributing to carbapenem resistance in clinical isolates of A. baumannii. The coproduction of OXA and metallo-beta-lactamases is not an uncommon phenomenon in A. baumannii.
Directory of Open Access Journals (Sweden)
Linda Koshy
2008-01-01
Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi
2016-12-01
To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.
Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun
2017-09-01
Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.
Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.
Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi
2007-11-01
Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.
Rutherford, R.; Gallois, P.; Masson, P. H.
1998-01-01
Arabidopsis thaliana roots grow in a wavy pattern upon a slanted surface. A novel mutation in the anthranilate synthase alpha 1 (ASA1) gene, named trp5-2wvc1, and mutations in the tryptophan synthase alpha and beta 1 genes (trp3-1 and trp2-1, respectively) confer a compressed root wave phenotype on tilted agar surfaces. When trp5-2wvc1 seedlings are grown on media supplemented with anthranilate metabolites, their roots wave like wild type. Genetic and pharmacological experiments argue that the compressed root wave phenotypes of trp5-2wvc1, trp2-1 and trp3-1 seedlings are not due to reduced IAA biosynthetic potential, but rather to a deficiency in L-tryptophan (L-Trp), or in a L-Trp derivative. Although the roots of 7-day-old seedlings possess higher concentrations of free L-Trp than the shoot as a whole, trp5-2wvc1 mutants show no detectable alteration in L-Trp levels in either tissue type, suggesting that a very localized shortage of L-Trp, or of a L-Trp-derived compound, is responsible for the observed phenotype.
Directory of Open Access Journals (Sweden)
G. V. Matyushin
2017-01-01
Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group. In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men, this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Directory of Open Access Journals (Sweden)
M.M. Sales
2005-05-01
Full Text Available We analyzed the genetic recombination pattern of the T-cell receptor beta-chain gene (TCR-beta in order to identify clonal expansion of T-lymphocytes in 17 human T-lymphotropic virus type I (HTLV-I-positive healthy carriers, 7 of them with abnormal features in the peripheral blood lymphocytes. Monoclonal or oligoclonal expansion of T-cells was detected in 5 of 7 HTLV-I-positive patients with abnormal lymphocytes and unconfirmed diagnosis by using PCR amplification of segments of TCR-beta gene, in a set of reactions that target 102 different variable (V segments, covering all members of the 24 V families available in the gene bank, including the more recently identified segments of the Vbeta-5 and Vbeta-8 family and the two diversity beta segments. Southern blots, the gold standard method to detect T-lymphocyte clonality, were negative for all of these 7 patients, what highlights the low sensitivity of this method that requires a large amount of very high quality DNA. To evaluate the performance of PCR in the detection of clonality we also analyzed 18 leukemia patients, all of whom tested positive. Clonal expansion was not detected in any of the negative controls or healthy carriers without abnormal lymphocytes. In conclusion, PCR amplification of segments of rearranged TCR-beta is reliable and highly suitable for the detection of small populations of clonal T-cells in asymptomatic HTLV-I carriers who present abnormal peripheral blood lymphocytes providing an additional instrument for following up these patients with potentially higher risk of leukemia.
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
Chemical rescue of cleft palate and midline defects in conditional GSK-3beta mice.
Liu, Karen J; Arron, Joseph R; Stankunas, Kryn; Crabtree, Gerald R; Longaker, Michael T
2007-03-01
Glycogen synthase kinase-3beta (GSK-3beta) has integral roles in a variety of biological processes, including development, diabetes, and the progression of Alzheimer's disease. As such, a thorough understanding of GSK-3beta function will have a broad impact on human biology and therapeutics. Because GSK-3beta interacts with many different pathways, its specific developmental roles remain unclear. We have discovered a genetic requirement for GSK-3beta in midline development. Homozygous null mice display cleft palate, incomplete fusion of the ribs at the midline and bifid sternum as well as delayed sternal ossification. Using a chemically regulated allele of GSK-3beta (ref. 6), we have defined requirements for GSK-3beta activity during discrete temporal windows in palatogenesis and skeletogenesis. The rapamycin-dependent allele of GSK-3beta produces GSK-3beta fused to a tag, FRB* (FKBP/rapamycin binding), resulting in a rapidly destabilized chimaeric protein. In the absence of drug, GSK-3beta(FRB)*(/FRB)* mutants appear phenotypically identical to GSK-3beta-/- mutants. In the presence of drug, GSK-3betaFRB* is rapidly stabilized, restoring protein levels and activity. Using this system, mutant phenotypes were rescued by restoring endogenous GSK-3beta activity during two distinct periods in gestation. This technology provides a powerful tool for defining windows of protein function during development.
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Retinal Ganglion Cell Loss in Diabetes Associated with Elevated Homocysteine
Directory of Open Access Journals (Sweden)
Kenneth S. Shindler
2009-11-01
Full Text Available A number of studies have suggested that homocysteine may be a contributing factor to development of retinopathy in diabetic patients based on observed correlations between elevated homocysteine levels and the presence of retinopathy. The significance of such a correlation remains to be determined, and potential mechanisms by which homocysteine might induce retinopathy have not been well characterized. Ganapathy and colleagues1 used mutant mice that have endogenously elevated homocysteine levels due to heterozygous deletion of the cystathionine-β-synthase gene to examine changes in retinal pathology following induction of diabetes. Their finding that elevated homocysteine levels hastens loss of cells in the retinal ganglion cell layer suggests that toxicity to ganglion cells may warrant further investigation as a potential mechanism of homocysteine enhanced susceptibility to diabetic retinopathy.
Cuong, Do Manh; Arasu, Mariadhas Valan; Jeon, Jin; Park, Yun Ji; Kwon, Soon-Jae; Al-Dhabi, Naif Abdullah; Park, Sang Un
2017-12-01
Carotenoids, found in the fruit and different organs of bitter melon ( Momordica charantia ), have attracted great attention for their potential health benefits in treating several major chronic diseases. Therefore, study related to the identification and quantification of the medically important carotenoid metabolites is highly important for the treatment of various disorderes. The present study involved in the identification and quantification of the various carotenoids present in the different organs of M. charantia and the identification of the genes responsible for the accumulation of the carotenoids with respect to the transcriptome levels were investigated. In this study, using the transcriptome database of bitter melon, a partial-length cDNA clone encoding geranylgeranyl pyrophosphate synthase ( McGGPPS2 ), and several full-length cDNA clones encoding geranylgeranyl pyrophosphate synthase ( McGGPPS1 ), zeta-carotene desaturase ( McZDS ), lycopene beta-cyclase ( McLCYB ), lycopene epsilon cyclases ( McLCYE1 and McLCYE2 ), beta-carotene hydroxylase ( McCHXB ), and zeaxanthin epoxidase ( McZEP ) were identified in bitter melon . The expression levels of the mRNAs encoding these eight putative biosynthetic enzymes, as well as the accumulation of lycopene, α-carotene, lutein, 13Z-β-carotene, E-β-carotene, 9Z-β-carotene, β-cryptoxanthin, zeaxanthin, antheraxanthin, and violaxanthin were investigated in different organs from M. charantia as well as in the four different stages of its fruit maturation. Transcripts were found to be constitutively expressed at high levels in the leaves where carotenoids were also found at the highest levels . Collectively, these results indicate that the putative McGGPPS2, McZDS, McLCYB, McLCYE1, McLCYE2, and McCHXB enzymes might be key factors in controlling carotenoid content in bitter melon . In conclusion, the over expression of the carotenoid biosynthetic genes from M. charantia crops to increase the yield of these
Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G
1981-01-01
Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...
Zhou, Wenlong; Yang, Yan; Tang, Liang; Cheng, Kai; Li, Changkun; Wang, Huimin; Liu, Minzhi; Wang, Wei
2018-03-14
Acrolein (Acr) was used as a selection agent to improve the glutathione (GSH) overproduction of the prototrophic strain W303-1b/FGP PT . After two rounds of adaptive laboratory evolution (ALE), an unexpected result was obtained wherein identical GSH production was observed in the selected isolates. Then, a threshold selection mechanism of Acr-stressed adaption was clarified based on the formation of an Acr-GSH adduct, and a diffusion coefficient (0.36 ± 0.02 μmol·min -1 ·OD 600 -1 ) was calculated. Metabolomic analysis was carried out to reveal the molecular bases that triggered GSH overproduction. The results indicated that all three precursors (glutamic acid (Glu), glycine (Gly) and cysteine (Cys)) needed for GSH synthesis were at a relativity higher concentration in the evolved strain and that the accumulation of homocysteine (Hcy) and cystathionine might promote Cys synthesis and then improve GSH production. In addition to GSH and Cys, it was observed that other non-protein thiols and molecules related to ATP generation were at obviously different levels. To divert the accumulated thiols to GSH biosynthesis, combinatorial strategies, including deletion of cystathionine β-lyase (STR3), overexpression of cystathionine γ-lyase (CYS3) and cystathionine β-synthase (CYS4), and reduction of the unfolded protein response (UPR) through up-regulation of protein disulphide isomerase (PDI), were also investigated.
Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.
Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice
2018-01-06
The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.
International Nuclear Information System (INIS)
Silver, A.; Boultwood, J.; Breckon, G.; Masson, W.; Adam, J.; Shaw, A.R.; Cox, R.
1989-01-01
The incidence of acute myeloid leukemia (AML) in CBA/H mice following exposure to single acute doses of ionizing radiation has previously been determined. A high proportion of these AMLs are characterized by rearrangement of murine chromosome 2 in the C2 and/or E5-F regions, and there is evidence that these events are a direct consequence of radiation damage to multipotential hemopoietic cells. Using a combination of in situ chromosome hybridization and mRNA analyses, we show that the cytokine gene interleukin-1 beta (IL-1 beta) is encoded in the chromosome 2 F region and is translocated in a chromosome 2---2 rearrangement in an x-ray-induced AML (N36). Also, IL-1 beta is specifically deregulated in N36 and in two other chromosome 2-rearranged AMLs but not in a fourth, which has two cytogenetically normal chromosome 2 copies. We suggest that radiation-induced specific chromosome 2 rearrangement associated with IL-1 beta deregulation may initiate murine leukemogenesis through the uncoupling of normal proliferative control mechanisms in multipotential hemopoietic cells
Energy Technology Data Exchange (ETDEWEB)
Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))
1990-08-28
The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.
DEFF Research Database (Denmark)
Jørgensen, Sebastian B; Nielsen, Jakob N.; Birk, Jesper Bratz
2004-01-01
The 5'AMP-activated protein kinase (AMPK) is a potential antidiabetic drug target. Here we show that the pharmacological activation of AMPK by 5-aminoimidazole-1-beta-4-carboxamide ribofuranoside (AICAR) leads to inactivation of glycogen synthase (GS) and phosphorylation of GS at Ser 7 (site 2). ...
DEFF Research Database (Denmark)
Munck, L.; Møller, B.; Jacobsen, Susanne
2004-01-01
-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
Neve, Bernadette; Fernandez-Zapico, Martin E.; Ashkenazi-Katalan, Vered; Dina, Christian; Hamid, Yasmin H.; Joly, Erik; Vaillant, Emmanuel; Benmezroua, Yamina; Durand, Emmanuelle; Bakaher, Nicolas; Delannoy, Valerie; Vaxillaire, Martine; Cook, Tiffany; Dallinga-Thie, Geesje M.; Jansen, Hans; Charles, Marie-Aline; Clément, Karine; Galan, Pilar; Hercberg, Serge; Helbecque, Nicole; Charpentier, Guillaume; Prentki, Marc; Hansen, Torben; Pedersen, Oluf; Urrutia, Raul; Melloul, Danielle; Froguel, Philippe
2005-01-01
KLF11 (TIEG2) is a pancreas-enriched transcription factor that has elicited significant attention because of its role as negative regulator of exocrine cell growth in vitro and in vivo. However, its functional role in the endocrine pancreas remains to be established. Here, we report, for the first time, to our knowledge, the characterization of KLF11 as a glucose-inducible regulator of the insulin gene. A combination of random oligonucleotide binding, EMSA, luciferase reporter, and chromatin immunoprecipitation assays shows that KLF11 binds to the insulin promoter and regulates its activity in beta cells. Genetic analysis of the KLF11 gene revealed two rare variants (Ala347Ser and Thr220Met) that segregate with diabetes in families with early-onset type 2 diabetes, and significantly impair its transcriptional activity. In addition, analysis of 1,696 type 2 diabetes mellitus and 1,776 normoglycemic subjects show a frequent polymorphic Gln62Arg variant that significantly associates with type 2 diabetes mellitus in North European populations (OR = 1.29, P = 0.00033). Moreover, this variant alters the corepressor mSin3A-binding activity of KLF11, impairs the activation of the insulin promoter and shows lower levels of insulin expression in pancreatic beta cells. In addition, subjects carrying the Gln62Arg allele show decreased plasma insulin after an oral glucose challenge. Interestingly, all three nonsynonymous KLF11 variants show increased repression of the catalase 1 promoter, suggesting a role in free radical clearance that may render beta cells more sensitive to oxidative stress. Thus, both functional and genetic analyses reveal that KLF11 plays a role in the regulation of pancreatic beta cell physiology, and its variants may contribute to the development of diabetes. PMID:15774581
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
Directory of Open Access Journals (Sweden)
Ansaya Thonpho
Full Text Available Pyruvate carboxylase (PC is an enzyme that plays a crucial role in many biosynthetic pathways in various tissues including glucose-stimulated insulin secretion. In the present study, we identify promoter usage of the human PC gene in pancreatic beta cells. The data show that in the human, two alternative promoters, proximal and distal, are responsible for the production of multiple mRNA isoforms as in the rat and mouse. RT-PCR analysis performed with cDNA prepared from human liver and islets showed that the distal promoter, but not the proximal promoter, of the human PC gene is active in pancreatic beta cells. A 1108 bp fragment of the human PC distal promoter was cloned and analyzed. It contains no TATA box but possesses two CCAAT boxes, and other putative transcription factor binding sites, similar to those of the distal promoter of rat PC gene. To localize the positive regulatory region in the human PC distal promoter, 5'-truncated and the 25-bp and 15-bp internal deletion mutants of the human PC distal promoter were generated and used in transient transfections in INS-1 832/13 insulinoma and HEK293T (kidney cell lines. The results indicated that positions -340 to -315 of the human PC distal promoter serve as (an activator element(s for cell-specific transcription factor, while the CCAAT box at -71/-67, a binding site for nuclear factor Y (NF-Y, as well as a GC box at -54/-39 of the human PC distal promoter act as activator sequences for basal transcription.
2013-01-01
Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205
Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg
2013-05-16
The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.
Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing
2009-05-13
One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.
DEFF Research Database (Denmark)
Matheu, Victor; Treschow, Alexandra; Navikas, Vaidrius
2003-01-01
. OBJECTIVE: We sought to define the differential role of endogenous IFN-beta in controlling the development of allergic inflammation. METHODS: We assessed whether deletion of the gene encoding IFN-beta (IFNB) with knockout mice participated in the development of allergic response in ovalbumin (OVA......BACKGROUND: IFN-beta has been shown to be effective as therapy for multiple sclerosis. Some reports attributed its beneficial effects to the capacity to induce a T(H)2 response. However, other studies have suggested that endogenous type I IFN might downregulate the allergic response in mice...
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840