WorldWideScience

Sample records for curran diptera tephritidae

  1. Development of Rhagoletis indifferens Curran (Diptera:Tephritidae) in crabapple

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens, Curran, 1932 (Diptera: Tephritidae), was reared from naturally-infested Chinese crabapple, Malus spectabilis (Ait.) Borkh. (Rosaceae), in Washington state, U.S.A. Pupae from Chinese crabapple were smaller than those from sweet cherry, Prunus avium (...

  2. Ammonium carbonate loss rates from lures differentially affect trap captures of Rhagoletis indifferens (Diptera: Tephritidae) and non-target flies

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of cherry (Prunus spp.) in western North America that can be monitored using traps baited with ammonia. However, ammonia-based attractants also attract non-target Diptera that clutter traps. Here, the hypothe...

  3. Temperature-mediated kill and oviposition of Western Cherry Fruit Fly (Diptera: Tephritidae) in the presence of Spinosad

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a quarantine pest of sweet cherry (Prunus avium (L.) L.) that is managed using insecticides, including spinosad, an organic compound that can be applied in low spray volumes. Identifying factors that can increase the...

  4. Impact of prolonged absence of low temperature on adult eclosion patterns of western cherry fruit fly (Diptera: Tephritidae)

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the U.S.A. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in ...

  5. Reduction in Emergence of Rhagoletis indifferens (Diptera: Tephritidae) from Sweet Cherries with Different Egg and Larval Distributions Using Newer Insecticides

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is the major insect pest of sweet cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. To reduce fly populations in unharvested fruit following the completion of commercial harvest, it is important to cont...

  6. Chilling and host plant/site associated eclosion times of western cherry fruit fly (Diptera:Tephritidae) and a host-specific parasitoid

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is native to bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ~100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of ad...

  7. Foraging, Mating, and Thermoregulatory Behavior of Cyrtopogon willistoni Curran (Diptera: Asilidae

    Directory of Open Access Journals (Sweden)

    Kevin M. O'Neill

    1995-01-01

    Full Text Available The robber fly Cyrtopogon willistoni Curran was studied in SW Montana, where it was an opportunistic predator of relatively small insects from 25 families in 7 orders. The most common prey were Diptera (44% and Homoptera (21%, with Cicadellidae, Bibionidae, and Formicidae comprising 44% of the prey. The elaborate courtship behavior of males included audible airborne visual displays that made use of silvery-white combs of hairs on the males' foretarsi. While perching, the flies exhibited both lateral and dorsal basking postures, and were apparently capable of strong flight only when direct sunlight was available. I compare the foraging and courtship behaviors of C. willistoni to those of other Cyrtopogon, and their thermal responses to those of other robber flies in the same habitat.

  8. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  9. Ceratitis cosyra, een Afrikaanse boorvlieg gevonden in Drenthe (Diptera: Tephritidae)

    NARCIS (Netherlands)

    Smit, J.T.; Aartsen, van B.

    2002-01-01

    Ceratitis cosyra, an African fruitfly found in the Dutch province of Drenthe (Diptera: Tephritidae) A single specimen of Ceratitis (Ceratalaspis) cosyra (Walker, 1849) was collected near Papenvoort (utm ld4768) with a malaisetrap in the period 4-6 september 1993 (leg. L. Witmond). Up till now it was

  10. Aphaereta ceratitivora sp. n. (Hymenoptera, Braconidae, a new parasitoid of Ceratitis capitata (Wiedemann (Diptera, Tephritidae from the Azores

    Directory of Open Access Journals (Sweden)

    Kees van Achterberg

    2012-09-01

    Full Text Available A new gregarious larval-pupal endoparasitoid of Ceratitis capitata (Wiedemann (Diptera: Tephritidae is described and illustrated: Aphaereta ceratitivora sp. n. (Braconidae: Alysiinae: Alysiini.

  11. Pheromone Analyses of the Anastrepha fraterculus (Diptera: Tephritidae) Cryptic Species Complex

    National Research Council Canada - National Science Library

    Radka Břízová; Adriana L. Mendonça; Lucie Vanícková; Alana L. Mendonça; Carlos Eduardo Da Silva; Aleš Tomčala; Beatriz Aguiar Jordão Paranhos; Vanessa Simões Dias; Iara Sordi Joachim-Bravo; Michal Hoskovec; Blanka Kalinová; Ruth R. Do Nascimento

    2013-01-01

    ABSTRACT The South American fruit fly Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) cryptic species complex is presently one of the most studied pest models in terms of speciation and population mating compatibility...

  12. Seasonal distributions of the western cherry fruit fly (Diptera: Tephritidae) among host and nonhost fruit trees.

    Science.gov (United States)

    Yee, Wee L

    2014-01-01

    Seasonal distributions of the western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), in sweet cherry (Prunus avium (L.) L.) (major host), black hawthorn (occasional developmental host) (Crataegus douglasii Lindley), and other trees were determined in a ponderosa pine ecosystem in Washington state, USA. The hypothesis that most fly dispersal from cherry trees occurs after fruit senesce or drop was tested, with emphasis on movement to black hawthorn trees. Sweet cherry fruit developed earlier than black hawthorn, bitter cherry (common host), choke cherry, and apple fruit. Flies were usually captured first in sweet cherry trees but were caught in bitter cherry and other trees throughout the season. Peak fly capture periods in sweet cherry began around the same time or slightly earlier than in other trees. However, peak fly capture periods in black hawthorn and other nonsweet cherry trees continued after peak periods in sweet cherry ended, or relative fly numbers within sweet cherry declined more quickly than those within other trees. Larvae were reared from sweet and bitter cherry but not black hawthorn fruit. Results provide partial support for the hypothesis in that although R. indifferens commonly disperses from sweet cherry trees with fruit, it could disperse more, or more flies are retained in nonsweet cherry trees after than before sweet cherries drop. This could allow opportunities for the flies to use other fruit for larval development. Although R. indifferens infestation in black hawthorn was not detected, early season fly dispersal to this and other trees and fly presence in bitter cherry could make fly management in sweet cherry difficult.

  13. Annotated world bibliography of host plants of the melon fly, Bactrocera cucurbitae(Cocquillett)(Diptera:Tephritidae)

    Science.gov (United States)

    The melon fly, Bactrocera cucurbitae(Coquillett), is a widespread, economically important tephritid fruit fly (Diptera: Tephritidae) species. Bactrocera cucurbitae infests fruits and vegetables of a number of different plant species, with many host plants in the plant family Cucurbitaceae, but with ...

  14. A new species of Anastrepha (Diptera: Tephritidae) from Euphorbia tehuacana (Euphorbiaceae) in Mexico.

    Science.gov (United States)

    Norrbom, Allen L; Castillo-Meza, Ana Lucía; García-Chávez, Juan Héctor; Aluja, Martín; Rull, Juan

    2014-03-24

    Anastrepha tehuacana, a new species of Tephritidae (Diptera) from Tehuacán, Puebla, Mexico reared from seeds of Euphorbia tehuacana (Brandegee) V.W. Steinm. (Euphorbiaceae), is described and illustrated. Its probable relationship to A. relicta Hernández-Ortiz is discussed.

  15. Biology of Anastrepha grandis (Diptera: Tephritidae) in Different Cucurbits.

    Science.gov (United States)

    Bolzan, Anderson; Nava, Dori E; Garcia, Flávio R M; Valgas, Ricardo A; Smaniotto, Giovani

    2015-06-01

    Anastrepha grandis (Macquart) (Diptera: Tephritidae) is one of the main pests of cucurbits in Brazil. Losses occur due to the damage caused to the fruits and the embargo on exports, as A. grandis is considered a quarantine pest in countries that import Brazilian cucurbits. This study aimed to evaluate the development of A. grandis in hosts of the Cucurbitaceae family. The hosts used were stem squash (Cucurbita pepo L.), squash (Cucurbita moschata Duchesne), chayote [Sechium edule (Jacq.) Swartz], mini watermelon [Citrullus lanatus (Thunb.) Matsum & Nakai], Spanish melon (Cucumis melo L.), hybrid squash "Tetsukabuto" (C. moschata×Cucurbita maxima Duchesne), and salad cucumber (Cucumis sativus L.). We evaluated the viability and duration of egg-to-pupa period, pupal weight, sex ratio, and average number of pupae per fruit under controlled conditions of temperature, relative humidity, and photophase. The preoviposition and oviposition periods, fecundity, fertility, and longevity of females were determined for adults. Hosts of the genus Cucurbita provided a better development of A. grandis in comparison with other hosts, and presented a greater number of insects on fruit as well as higher infestation rate. Fecundity and longevity were also higher for females that developed in hosts of the genus Cucurbita, although values of these biological parameters varied between stem squash, squash, hybrid squash "Tetsukabuto."

  16. Impact of Prolonged Absence of Low Temperature on Adult Eclosion Patterns of Western Cherry Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Neven, Lisa G; Yee, Wee L

    2017-03-25

    Western cherry fruit fly, Rhagoletis indifferens (Curran) (Diptera: Tephritidae), is a serious pest of cherries (Prunus spp.) in the Pacific Northwest of the United States. Previous research suggests that R. indifferens is unlikely to establish in commercial cherry production areas in California and in tropical export markets because cold temperatures, below 5 °C, in those regions appear insufficient to complete diapause. However, it is unclear how prolonged absence of cold exposure affects diapause termination in R. indifferens. Here, we examined this question by exposing R. indifferens pupae for 40 wk to simulated temperate and tropical conditions of 23 or 26 °C, 40 or 80% RH, and a photoperiod of 16:8 or 12:12 (L:D) h. Eclosion patterns among fly groups in the four conditions did not differ. For all groups, fly eclosion from pupae not exposed to cold exhibited a bimodal distribution. The first major peak, comprising 3.2% of the total fly emergence, occurred at 1-10 wk. The second major peak, comprising the remaining 96.8%, occurred at a mode of ∼30 wk. Based on responses to no cold and cold (3 ± 1.5 °C) exposures, there were three distinct pupal diapause groups: the first eclosion group was likely nondiapausing pupae; the second eclosion group was likely diapausing pupae; a third group that remained viable but did not produce adults after 40 wk may represent prolonged dormancy pupae. We suggest that eclosion of adults after prolonged absence of cold exposure needs to be incorporated into models for potential fly establishment in warm climates.

  17. Influence of media type and moisture on adult development and pupal mortality in Rhagoletis indifferens (Diptera: Tephritidae).

    Science.gov (United States)

    Yee, Wee L

    2013-06-01

    The influence of media type and moisture on adult development and pupal mortality in western cherry fruit fly, Rhagoletis indifferens Curran (Diptera:Tephritidae), was assessed using the pupal-adult and the larval-pupal stage. Inside containers, a higher percent of flies that emerged from dry loam was deformed (44.2%, 1-cm-depth loam; 84.4%, 5-cm-depth loam) than flies from 16% moist loam and dry and 16% moist lab soil (peat moss-sand mix) (0-14.9%). Percent of flies deformed from dry sand (22.1%, 1-cm depth; 49.5%, 5-cm depth) was greater than from 16% moist sand and dry and 16% moist peat moss (0-10.5%). Percents of flies deformed from 8% moist loam, lab soil, sand, and peat moss (0-5.8%) did not differ. Pupae suffered higher mortality at 7 and 14 d after larvae were dropped onto dry loam and dry sand (68.2-94.0%) than dry lab soil and dry peat moss (3.0-53.0%); respective mortalities at 21 and 28 d were similar (81.3-96.0 versus 64.7-97.9%). Pupal mortality in moist media was lower (0.5-40.3%) than in dry media. In outdoor tests, pupal mortality was also higher in dry loam than other dry media. In nature, 60.9% of pupae in dry sandy loams in late summer were dead. Results suggest R. indifferens has not yet evolved to fully cope with dry soils and that pupation in media with traits similar to those of peat moss or a peat moss-sand mix could reduce negative effects of dry environments on fly survival.

  18. Effect ofalpha-difluormethylornithine on Anastrepha fraterculus (Diptera, Tephritidae) ovary size.

    Science.gov (United States)

    Cardoso, V V; Moreira, J C F; Oliveira, A K

    2009-02-01

    Ovarian sizes (length and width) were measured in young females of Anastrepha fraterculus (Wiedemann) (Diptera, Tephritidae) subjected or not to the inhibitor alpha-difluormethylornithine (alpha-DFMO). The most effective concentration of alpha-DMFO used was 50 mM and the ovarian measurements (length and width) of the treated females were smaller than those of females not treated with alpha-DMFO. These data may suggest some relationship between ornithine decarboxylase (ODC) and sexual maturation in A. fraterculus.

  19. Implications of Rhagoletis zephyria, 1894 (Diptera: Tephritidae), captures for apple maggot surveys and fly ecology in Washington state, U.S.A

    Science.gov (United States)

    The apple maggot, Rhagoletis pomonella (Walsh), 1867 (Diptera: Tephritidae), is an introduced quarantine pest of apple (Malus domestica Borkhausen) (Rosaceae) in Washington state, U.S.A. A morphologically similar native fly, Rhagoletis zephyria Snow, 1894, infests snowberries (Symphoricarpos spp.) ...

  20. Pos-harvest control of Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in guava fruits (Psidium guajava L.).; Controle pos-colheita de Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) em frutos de goiaba (Psidium guajava L.)

    Energy Technology Data Exchange (ETDEWEB)

    Doria, Hayda Oliveira Souza

    2006-07-01

    The objective of this work is to evaluate the effect of the treatment with steam heating, hot water and gamma radiation of Co-60 on eggs and fruit flies larvae (Ceratitis capitata Wiedemann, 1824) (Diptera: Tephritidae), and analyze the effect of these treatments in the fruit quality (chemical composition)

  1. The geographic distribution of Rhagoletis pomonella (Diptera:Tephritidae) in the western United States: Introduced species or native population?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella Walsh (Diptera: Tephritidae), is a major pest of commercially grown domesticated apple (Malus domestica) in North America. The shift of the fly from its native host hawthorn (Crataegus mollis) to apple in the eastern U.S. is often cited as an example of inc...

  2. Attraction and Mortality of Oriental Fruit Flies (Diptera: Tephritidae) to SPLAT-MAT- Methyl Eugenol with Spinosad

    Science.gov (United States)

    Studies were conducted in Hawaii to quantify attraction and feeding responses resulting in mortality of male oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to SPLAT-MAT-methyl eugenol (ME) with spinosad in comparison with Min-U-Gel-ME with naled (Dibrom). Our approach invol...

  3. Host Plant Record for the Fruit Flies, Anastrepha fumipennis and A. nascimentoi (Diptera, Tephritidae)

    Science.gov (United States)

    Uramoto, Keiko; Martins, David S.; Lima, Rita C. A.; Zucchi, Roberto A.

    2008-01-01

    The first host plant record for Anastrepha fumipennis Lima (Diptera: Tephritidae) in Geissospermum laeve (Vell.) Baill (Apocynaceae) and for A. nascimentoi Zucchi found in Cathedra bahiensis Sleumer (Olacaceae) was determined in a host plant survey of fruit flies undertaken at the “Reserva Natural da Companhia Vale do Rio Doce”. This reserve is located in an Atlantic Rain Forest remnant area, in Linhares county, state of Espírito Santo, Brazil. The phylogenetic relationships of Anastrepha species and their hosts are discussed. The occurrence of these fruit fly species in relation to the distribution range of their host plants is also discussed. PMID:20302458

  4. Chilling and Host Plant/Site-Associated Eclosion Times of Western Cherry Fruit Fly (Diptera: Tephritidae) and a Host-Specific Parasitoid.

    Science.gov (United States)

    Yee, Wee L; Goughnour, Robert B; Hood, Glen R; Forbes, Andrew A; Feder, Jeffrey L

    2015-08-01

    The western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is an endemic herbivore of bitter cherry, Prunus emarginata (Douglas ex Hooker) Eaton, but ∼100 years ago established on earlier-fruiting domesticated sweet cherry, Prunus avium (L.) L. Here, we determined if eclosion times of adult R. indifferens from sweet and bitter cherry differ according to the phenology of their respective host plants and if eclosion times of the host-specific parasitoid Diachasma muliebre (Muesebeck) (Hymenoptera: Braconidae) attacking bitter and sweet cherry flies differ according to the eclosion phenology of their fly hosts. Fly pupae from sweet and bitter cherry fruit were collected from sympatric and allopatric sites in Washington state, and chilled at 5°C. Because timing of eclosion in R. indifferens depends on chill duration, eclosion time in wasps could also vary with chill duration. To account for this, fly pupae were chilled for 1, 2, 2.5, 3, 4, 6, or 8 mo. Both flies and wasps eclosed earlier with longer chill durations. Eclosion times of sweet and bitter cherry flies from a sympatric site in central Washington did not differ. However, at allopatric sites in northwestern and central Washington, bitter cherry flies eclosed later than sweet and bitter cherry flies at the sympatric site. Correspondingly, D. muliebre parasitizing a more isolated bitter cherry fly population eclosed later than D. muliebre parasitizing earlier-emerging sweet and bitter cherry fly populations. These results provide evidence for D. muliebre rapidly responding to changes in host plant shifts by R. indifferens.

  5. Mortality and oviposition of western cherry fruit fly (Diptera: Tephritidae) exposed to different insecticide baits for varying periods in the presence and absence of food.

    Science.gov (United States)

    Yee, Wee L

    2011-02-01

    Spinosad bait is used to control western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), by killing flies before they oviposit. However, effects of different insecticide baits on management of reproductively mature flies are largely unknown. Objectives here were to determine mortality and oviposition of reproductively mature R. indifferens exposed to different insecticide baits for varying periods in the presence and absence of dried yeast extract and sucrose food. Spinosad bait (spinosad in a mix of protein, sugar, and other ingredients) was compared with acetamiprid, thiamethoxam, and imidacloprid in sucrose or Nu-Lure + sucrose bait. When flies were exposed to treatments and then offered cherries, Prunus avium (L.) L., for oviposition or when they were exposed to treatments and cherries simultaneously, both thiamethoxam bait and imidacloprid bait resulted in higher mortality and lower oviposition than spinosad bait and acetamiprid bait. Exposures to thiamethoxam bait and imidacloprid bait for six and 24 h were similarly effective, but 6-h exposures to spinosad bait and acetamiprid bait were less effective than 24-h exposures. There was little difference between sucrose and Nu-Lure + sucrose baits. When food was present, thiamethoxam bait and imidacloprid bait caused greater mortality and lower oviposition than spinosad bait and acetamiprid bait, but when food was absent, patterns were less consistent. Because of its ability to kill flies sooner after it is exposed to flies when food is present or absent, thiamethoxam or imidacloprid in sucrose or Nu-Lure bait may reduce infestations in cherries more than spinosad bait when mature R. indifferens are present in orchards.

  6. Fruit flies of the genus Anastrepha (Diptera: Tephritidae) from some localities of Paraguay: new records, checklist, and illustrated key.

    Science.gov (United States)

    Arias, Osmar René; Fariña, Nelson Librado; Lopes, Gleidyane Novaes; Uramoto, Keiko; Zucchi, Roberto Antonio

    2014-01-01

    This study deals with fruit flies of the genus Anastrepha Schiner (Diptera: Tephritidae) collected in McPhail traps in the municipalities of Concepción, Belén, Horqueta, Loreto (state of Concepción) and Santa Rosa (state of Misiones), Paraguay. In total, 17 species were captured, 9 of which are new records for Paraguay. All morphological characters used for species identification are illustrated.

  7. Interaction between Tephritidae (Insecta, Diptera and plants of the family Asteraceae: new host and distribution records for the state of Rio Grande do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Marcoandre Savaris

    2015-03-01

    Full Text Available Twenty species of Tephritidae (Diptera are recorded in association with capitula of plants in the family Asteraceae. The Tephritidae genus Tetreuaresta is registered for Rio Grande do Sul for the first time. Five species of Tephritidae are newly recorded for Rio Grande do Sul, and new hosts are recorded for the following fly species: Dioxyna chilensis (Macquart, Plaumannimyia dolores (Hering, Plaumannimyia imitatrix (Hering, Plaumannimyia miseta (Hering, Plaumannimyia pallens Hering, Tomoplagia incompleta (Williston, Tomoplagia matzenbacheri Prado, Norrbom & Lewinsohn, Tomoplagia reimoseri Hendel, Xanthaciura biocellata (Thomson and Xanthaciura chrysura (Thomson.

  8. Sex chromosomes in mitotic and polytene tissues of Anastrepha fraterculus (Diptera, Tephritidae) from Argentina: a review.

    Science.gov (United States)

    Giardini, María Cecilia; Milla, Fabián H; Lanzavecchia, Silvia; Nieves, Mariela; Cladera, Jorge L

    2015-01-01

    Cytogenetics, which is considered a fundamental tool to understand basic genetic and genomic issues of species, has greatly contributed to the description of polymorphisms both at inter- and intra-specific level. In fact, cytogenetics was one of the first approaches used to propose Anastrepha fraterculus (Diptera: Tephritidae) as a complex of cryptic species. Different morphological variants of sex chromosomes have been reported among Argentinean populations of Anastrepha fraterculus. However, since this high structural variability in sex chromosomes does not pose a reproductive barrier, their role in speciation is yet to be unveiled. This review provides an update on general aspects of cytogenetics in Argentinean Anastrepha fraterculus populations, focused on the prevalence of X-Y arrangements.

  9. An Additional Phytosanitary Cold Treatment Against Ceratitis capitata (Diptera: Tephritidae) in 'Oroblanco' Citrus Fruit.

    Science.gov (United States)

    Gazit, Yoav; Kaspi, Roy

    2017-04-01

    For 'Oroblanco' ('Sweetie'), the sweet seedless pummelo-grapefruit hybrid, when exported from Israel to Japan, the standard cold treatment against Ceratitis capitata (Wied.) (Diptera: Tephritidae) is conducted at ≤ 1.5 °C, for 16 d. In recent years, the transportation means of exported citrus was changed from reefer vessels to individual refrigerated containers, where the fruit bulk is relatively small and may be exposed to temperature fluctuations and to the risk of chilling injuries. To reduce this risk, Israel proposed to Japan to increase the treatment temperature and extend its duration to 2.2 °C and 18 d, respectively. This study shows that the proposed treatment effectively kills the third instar larva of C. capitata, in Oroblanco. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Selection of Ceratitis capitata (Diptera: Tephritidae) specific recombinant monoclonal phage display antibodies for prey detection analysis.

    Science.gov (United States)

    Monzó, César; Urbaneja, Alberto; Ximénez-Embún, Miguel; García-Fernández, Julia; García, José Luis; Castañera, Pedro

    2012-01-01

    Several recombinant antibodies against the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), one of the most important pests in agriculture worldwide, were selected for the first time from a commercial phage display library of human scFv antibodies. The specificity and sensitivity of the selected recombinant antibodies were compared with that of a rabbit polyclonal serum raised in parallel using a wide range of arthropod species as controls. The selected recombinant monoclonal antibodies had a similar or greater specificity when compared with classical monoclonal antibodies. The selected recombinant antibodies were successfully used to detect the target antigen in the gut of predators and the scFv antibodies were sequenced and compared. These results demonstrate the potential for recombinant scFv antibodies to be used as an alternative to the classical monoclonal antibodies or even molecular probes in the post-mortem analysis studies of generalist predators.

  11. Grapefruit as a host for the West Indian fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena Tarshis; Robacker, David

    2011-02-01

    The most common hosts for the West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae) are fruit in the family Anacardiaceae (mango [Mangifera L.] and mombin [Spondias L.] species). However, similar to many of the tropical fruit flies of major economic importance, this species attacks several other families of crop fruit, including Annonaceae (cherimoya, Annona cherimola Mill.), Myrtaceae (guava, Psidium L.), Oxalidaceae (carambola, Averrhoa carambola L.), Passifloraceae (granadilla, Passiflora quadrangularis Mill.), and Sapotaceae [mamey sapote, Pouteria sapota (Jacq.) H. E. Moore & Steam]. In the family Rutaceae the economically important genus Citrus has been reported and until recently considered a host for this fruit fly. In this study, we reviewed the taxonomy of A. obliqua, tested specific chemicals that may inhibit oviposition, compared egg-to-adult survival of A. obliqua on preferred hosts and on grapefruit (Citrus X paradisi Macfad.), and measured fruit tissue-specific developmental rates of A. obliqua and the known citrus breeding Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), from egg to pupae. Our literature review shows much confusion concerning the taxonomy of this and related Anastrepha species, including synonymies and confusion with other species. The deterrent effect of the highest concentration of flavonoids for oviposition, although significant, was not absolute. Experiments carried out under laboratory conditions showed 15-40 times greater survival of A. ludens (whose preferred hosts include Rutaceae) on grapefruit compared with A. obliqua for both tree attached and harvested fruit. Experiments of survival of developing stages over time showed that the two species oviposit into different tissues in the fruit, and mortality is much higher for the West Indian fruit fly in the flavedo and albedo of the fruit compared with the Mexican fruit fly.

  12. Nonhost status of commercial Persea americana 'Hass' to Anastrepha ludens, Anastrepha obliqua, Anastrepha serpentina, and Anastrepha striata (Diptera: Tephritidae) in Mexico.

    Science.gov (United States)

    Aluja, Martín; Díaz-Fleischer, Francisco; Arredondo, José

    2004-04-01

    The objective of this study was to determine the host status in Mexico of commercially cultivated and marketed avocado, Persea americana (Mill.), 'Hass' to Anastrepha ludens (Loew), Anastrepha obliqua (Macquart), Anastrepha serpentina (Wiedemann), and Anastrepha striata (Schiner) (Diptera: Tephritidae). Experiments in Michoacán, Mexico, were carried out in six orchards located at three altitudes above sea level during two times (August-October 2001 and April-June 2002). They included choice ('Hass' avocado plus natural host) and no-choice foraging behavior tests on trees under field cages; no-choice, forced infestation trials on caged, fruit-bearing branches in the field, and with individual fruit under laboratory conditions; infestation trials using 'Hass' avocados left unprotected over 1 and 7 d on the ground of orchards; studies to ascertain depth of oviposition and determine egg hatchability; and experiments to determine susceptibility by using time elapsed since removal of fruit from tree as the experimental variable. We trapped adult Anastrepha (n = 7,936) in all orchards and dissected fruit (n = 7,695) from orchards and packing houses (n = 1,620) in search of eggs or larvae. Most (96.7%) A. ludens, A. obliqua, A. striata, and A. serpentina adults were captured in low-elevation orchards. No eggs or larvae were detected in any of the fruit from foraging behavior studies or dissected fruit from orchards or packing houses. Of 5,200 mature, intact fruit on trees in the field forcibly exposed to no-choice female oviposition activity (five females/fruit), we only found four fruit infested by A. ludens but no adults emerged. 'Hass' avocados only became marginally susceptible to attack by A. ludens (but not A. obliqua, A. serpentina, and A. striata) 24 h after being removed from the tree. Fruit placed on the ground in orchards (n = 3,600) were occasionally infested by Neosilba batesi (Curran) (Diptera: Lonchaeidae), a decomposer, but not Anastrepha spp. Based on our

  13. Development of Rhagoletis pomonella and Rhagoletis indifferens (Diptera: Tephritidae)in mango and other tropical and temperate fruit in the laboratory

    Science.gov (United States)

    Temperate fruit flies in the genus Rhagoletis (Diptera: Tephritidae) have narrow host ranges relative to those of tropical fruit flies, suggesting they will not attack or are incapable of developing in most novel fruit. Here we tested the hypothesis that apple maggot fly, Rhagoletis pomonella (Wals...

  14. Ammonium acetate enhances the attractiveness of a variety of protein-based baits to female Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Ammonia and its derivatives are used largely by female fruit 32 flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally-based control strategies such a food-based lures a...

  15. Impact of planting dates on a seed maggot, Neotephritis finalis (Diptera: Tephritidae), and sunflower bud moth (Lepidoptera: Tortricidae) damage in cultivated sunflower

    Science.gov (United States)

    Neotephritis finalis (Loew) (Diptera: Tephritidae), and sunflower bud moth, Suleima helianthana (Riley) (Lepidoptera: Tortricidae) are major head-infesting insect pests of cultivated sunflower (Helianthus annuus L.). Planting date was evaluated as a cultural pest management strategy for control of N...

  16. Population fluctuations of Anastrepha striata (Diptera: Tephritidae in commercial guava orchards = Flutuação populacional de Anastrepha striata (Diptera: Tephritidae em pomares comerciais de goiabeira

    Directory of Open Access Journals (Sweden)

    Luciana Baú Trassato

    2015-10-01

    Full Text Available The aim of this research was to evaluate population fluctuations in Anastrepha striata (Diptera: Tephritidae for two commercial guava orchards, cultivars Paluma and Japanesa, in an area of savanna, in Boa Vista, in the State of Roraima, Brazil, and relate these to plant phenology, relative humidity (%, temperature (°C and rainfall in the region, from December 2011 to November 2012. The fruit flies were captured using McPhail traps, with 300 ml of 30% passion fruit juice as food bait, which was renewed every week at the time the flies were collected and taken to the Entomology Laboratory of the Federal University of Roraima to be sorted, counted, separated by sex and placed into a 70% alcohol solution for later identification of the species A. striata. The population fluctuations of the pest were calculated using the MAD index (Fly / Trap / Day and the values for temperature (°C, relative humidity (% and cumulative rainfall (mm. The correlation between the number of females and the climatic variables was calculated by the Pearson correlation coefficient. Using the Student t-test, the contribution of climatic factors to the population of A. striata was verified by multiple regression analysis. The greatest MAD indices for the Paluma cultivar are in April, August and September, and for the Japonesa cultivator, in April, May and July, coinciding with the fruiting period of the guava. Relative humidity has a positive influence on population fluctuations in A. striata. = Objetivou-se com esta pesquisa avaliar a flutuação populacional de Anastrepha striata (Diptera: Tephritidae em dois pomares comerciais de goiabeira das cultivares Paluma e Japonesa, em área de savana, em Boa Vista, Roraima, além de relacioná-la com a fenologia das plantas, umidade relativa do ar (%, temperatura (°C e pluviosidade da região, no período de dezembro de 2011 a novembro de 2012. A captura das moscas-das-frutas foi realizada por meio de armadilhas McPhail, cujo

  17. Cold tolerance and disinfestation of Bactrocera invadens (Diptera: Tephritidae) in 'Hass' avocado.

    Science.gov (United States)

    Ware, A B; Du Toit, C L N; Mohamed, S A; Nderitu, P W; Ekasi, S

    2012-12-01

    Bactrocera invadens (Diptera: Tephritidae) has spread rapidly across Africa and currently poses a phytosanitary threat to the fruit industry of South Africa. In reaction a cold mitigating treatment to provide phytosanitary security to importing countries was developed in Nairobi, Kenya. Using laboratory reared fruit flies, the rate of development in 'Hass' avocado (Persea americana Miller) was determined at 28 degrees C. Fruit ripeness or softness was found to be a factor improving larval fruit fly survival. Using this information the egg and larval developmental stages were subjected to 2 degrees C cold treatment and it was found that the third instars were the most cold tolerant life stage and that it was expected that between 16 and 17 d treatment would provide phytosanitary security. There were no survivors in the treatment of an estimated 153,001 individuals in four replicates at an average fruit pulp temperature of 2 degrees C satisfying the Probit 9 level of efficiency at a confidence of >95%. These data provide evidence that a continuous cold treatment of 1.5 degrees C or lower for 18 d would provide phytosanitary security in that any consignment entering an importing country poses no risk of accidental importation of B. invadens.

  18. Methyl eugenol aromatherapy enhances the mating competitiveness of male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2014-09-01

    Males of Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) are strongly attracted to methyl eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural compound occurring in variety of plant species. ME-feeding is known to enhance male B. carambolae mating competitiveness 3 days after feeding. Enhanced male mating competitiveness due to ME-feeding can increase the effectiveness of sterile insect technique (SIT) manifolds. However, the common methods for emergence and holding fruit flies prior to field releases do not allow the inclusion of any ME feeding treatment after fly emergence. Therefore this study was planned to assess the effects of ME-aromatherapy in comparison with ME feeding on male B. carambolae mating competitiveness as aromatherapy is pragmatic for fruit flies emergence and holding facilities. Effects of ME application by feeding or by aromatherapy for enhanced mating competitiveness were evaluated 3d after treatments in field cages. ME feeding and ME aromatherapy enhanced male mating competitiveness as compared to untreated males. Males treated with ME either by feeding or by aromatherapy showed similar mating success but mating success was significantly higher than that of untreated males. The results are discussed in the context of application of ME by aromatherapy as a pragmatic approach in a mass-rearing facility and its implications for effectiveness of SIT. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. MORPHOMETRIC STUDY FOR IDENTIFICATION OF THE BACTROCERA DORSALIS COMPLEX (DIPTERA : TEPHRITIDAE USING WING IMAGE ANALYSIS

    Directory of Open Access Journals (Sweden)

    A. ADSAVAKULCHAI

    1999-01-01

    Full Text Available The Bactrocera dorsalis complex (Diptera: Tephritidae used in this study included B. dorsalis, B. arecae, B. propinqua, B. pyrifoliae, B. verbascifoliae, and three new species complexes are species E, species K and species P. Bactrocera tau was used as an out-group. A total of 424 adults, which emerged from pupae collected from natural populations in Thai land, were prepared for wing measurements. Morphometric analysis was performed on measurements of wing vein characters. Wing images were captured in digital format and taken through digital image processing to calculate the Euclidean distance between wing vein junctions. Discriminant and cluster analyses were used for dichotomy of classification processes. All 424 wing specimens were classified to species in terms of the percentage of "grouped" cases which yielded about 89.6% accurate identificati on compared with the formal description of these species. After clustering, the percentage of "grouped"cases yielded 100.0%, 98.9%, 98.1%, 95.2% and 84.6% accurate identification between the B. dorsalis complex and B. tau; B. arecae and Species E; B. dorsalis and B. verbascifoliae; B. propinqua and B. pyrifoliae; and species K and species P, respectively. This method of numerical taxonomy may be useful for practical identification of other groups of agricultural pests.

  20. Large scale artificial rearing of Anastrepha sp.1 aff. fraterculus (Diptera: Tephritidae in Brazil

    Directory of Open Access Journals (Sweden)

    Julio Marcos Melges Walder

    2014-08-01

    Full Text Available Some species of the genus Anastrepha (Diptera: Tephritidae are successfully managed by matching the sterile insect technique with parasitoid releases. Such strategies used in integrated pest management can be implemented only where insect mass-rearing programs are feasible. In this study, we show the process of domestication, rearing technology and quality control data obtained from 54 generations of Anastrepha sp.1 aff. fraterculus (Wiedemann, 1830 kept under fully artificial conditions. Eggs were collected by an artificial oviposition panel consisting of one side of the cage made of blue voile fabric externally covered with a thin layer of silicon rubber. They were then air-bubbled in water at 25 ºC for 48 h before seeding. Larvae were reared on the regular laboratory artificial diet with 66 % of agar reduction turning over a semi-liquid diet, which reduced costs and improved insect quality. The adult and larval diets were composed of local ingredients including hydrolyzed yeast. When large-scale production of this fly is contemplated, the critical stage is larval development. This system of artificial rearing for A. fraterculus sp.1 developed in Brazil, allows for the production of a large number of insects of excellent quality using local ingredients and less agar in diet composition than the original medium used for this species. By reducing the interval of egg collection, the system might be optimized in terms of insect yield and, therefore, meet the demands of A. fraterculus sp.1 with regard to integrated pest management purposes.

  1. Puncture resistance in 'Sharwil' avocado to oriental fruit fly and Mediterranean fruit fly (Diptera: Tephritidae) oviposition.

    Science.gov (United States)

    Follett, Peter A

    2009-06-01

    The physiological basis for host antibiosis or nonpreference to a quarantine pest is often not understood. Studies are needed on the mechanisms that impart resistance to better understand how resistance might fail. Experiments were conducted to examine the infestability of 'Sharwil' avocados by oriental fruit fly, Bactrocera dorsalis (Hendel), and Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), after harvest and to quantify the effect of avocado skin hardness on resistance to infestation by oriental fruit fly. Infestation rate increased with decreasing fruit firmness, but fruit were generally poor hosts. Fruit with a patch of skin removed produced more flies than intact fruit, suggesting that skin puncture resistance was an important deterrent to oviposition. This study showed that fruit can be infested within 1 d after harvest, suggesting that fruit should be transferred to fruit fly-proof containers as they are harvested to minimize the risk of attack. Although risk of infestation is negatively correlated with fruit firmness, even some hard fruit may become infested. Therefore, fruit firmness cannot be used alone as an indicator to ensure fruit fly-free 'Sharwil' avocados. Measuring fruit firmness may be a useful component of a multiple component systems approach as an additional safeguard to reduce risk of infestation.

  2. Genetic relationship of the melon fly, Bactrocera cucurbitae (Diptera: Tephritidae) inferred from mitochondrial DNA

    Institute of Scientific and Technical Information of China (English)

    Yi Wu; Bruce A. McPheron; Jia-Jiao Wu; Zhi-Hong Li

    2012-01-01

    The melon fruit fly,Bactrocera cucurbitae (Coquillett) (Diptera:Tephritidae),has been the subject of worldwide quarantine and management efforts due to its widespread agricultural impact and potential for rapid range expansion.From its presumed native distribution in India,this species has spread throughout the hot-humid regions of the world.We provide information that reveals population structure,invasion history and population connectivity from 23 locations covering nine countries based on DNA sequences of the mitochondrial cytochrome oxidase I (COI) gene.Forty-two polymorphic sites were described among 38 haplotypes.The most common haplotype,H1,was observed in 73% of the samples distributed among all populations.Highest genetic diversity was seen within populations,and no isolation-by-distance was detected.The western regions (Nepal,Bangladesh,Thailand,Burma and China-west) showed higher haplotype diversity than eastern regions (Chins-east).China-Yunnan showed highest levels of genetic diversity in China.Haplotype diversity decreased with longitude from west to east.Together,these analyses suggest that B.cucurbitae has expanded from west to east within a limited geographic scale and recently invaded China through Yunnan Province.

  3. Phylogeographic Structure in Anastrepha ludens (Diptera: Tephritidae) Populations Inferred With mtDNA Sequencing.

    Science.gov (United States)

    Ruiz-Arce, Raul; Owen, Christopher L; Thomas, Donald B; Barr, Norman B; McPheron, Bruce A

    2015-06-01

    Anastrepha ludens (Loew) (Diptera: Tephritidae), the Mexican fruit fly, is a major pest of citrus and mango. It has a wide distribution in Mexico and Central America, with infestations occurring in Texas, California, and Florida with origins believed to have been centered in northeastern Mexico. This research evaluates the utility of a sequence-based approach for two mitochondrial (COI and ND6) gene regions. We use these markers to examine genetic diversity, estimate population structure, and identify diagnostic information for A. ludens populations. We analyzed 543 individuals from 67 geographic collections and found one predominant haplotype occurring in the majority of specimens. We observed 68 haplotypes in all and see differences among haplotypes belonging to northern and southern collections. Mexico haplotypes differ by few bases possibly as a result of a recent bottleneck event. In contrast to the hypothesis suggesting northeastern Mexico as the origin of this species, we see that specimens from two southern collections show high genetic variability delineating three mitochondrial groups. These data suggest that Central America is the origin for A. ludens. We show that COI and ND6 are useful for phylogeographic studies of A. ludens. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  4. Genetic variation of Anastrepha suspensa (Diptera: Tephritidae) in Florida and the Caribbean using microsatellite DNA markers.

    Science.gov (United States)

    Boykin, Laura M; Shatters, Robert G; Hall, David G; Dean, David; Beerli, Peter

    2010-12-01

    Anastrepha suspensa (Loew) (Diptera: Tephritidae), the Caribbean fruit fly, is indigenous to Florida and the Greater Antilles where it causes economic losses in fruit crops, including citrus. Because of the geographic separation of many of its native locations and anecdotal descriptions of regional differences in host preferences, there have been questions about the population structure of A. suspensa. Seven DNA microsatellite markers were used to characterize the population genetic structure of A. suspensa, in Florida and the Caribbean from a variety of hosts, including citrus. We genotyped 729 A. suspensa individuals from Florida, Puerto Rico, Cayman Island, Dominican Republic, and Jamaica. The investigated seven loci displayed from 5 to 19 alleles, with expected heterozygosities ranging from 0.05 to 0.83. There were five unique alleles in Florida and three unique alleles in the Caribbean samples; however, no microsatellite alleles were specific to a single host plant. Genetic diversity was analyzed using F(ST) and analysis of molecular variance and revealed low genetic diversity between Florida and Caribbean samples and also between citrus and noncitrus samples. Analyses using migrate revealed there is continuous gene flow between sampling sites in Florida and the Caribbean and among different hosts. These results support previous comparisons based on the mitochondrial cytochrome oxidase I locus indicating there is no genetic differentiation among locations in Florida and the Caribbean and that there is no separation into host races.

  5. A novel attractant for Anastrepha ludens (Diptera: Tephritidae) from a Concord grape product.

    Science.gov (United States)

    Robacker, David C; Massa, Michelle J; Sacchetti, Patrizia; Bartelt, Robert J

    2011-08-01

    An attractant for Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), was developed from a commercial product called Sabor Uva containing processed Concord grape juice. The principal volatile components of Sabor Uva aroma were identified and an aqueous mixture of 15 components that was gas chromatographically similar to Sabor Uva was prepared. This mixture was equivalent to Sabor Uva in attractiveness by using wind-tunnel bioassays. After deleting chemicals that did not contribute to attractiveness, and increasing the concentrations of the remaining chemicals, the final attractant contained propylene glycol (90,000 ppm, vol/vol), acetic acid (4500), methyl anthranilate (1800), ethyl 2-methylpropionate (670), and one or both of the esters ethyl 3-methylbutyrate (44) and 2-methylbutyl propionate (44), in aqueous solution. This mixture was approximately 1.8X as attractive as Sabor Uva by indirect comparison. Deletion of propylene glycol, acetic acid, methyl anthranilate, or ethyl 2-methylpropionate from the mixture significantly decreased attractiveness. Deletion of either of the other two esters seemed to diminish attractiveness although effects were not statistically significant. Deletion of water from the mixture significantly decreased attractiveness. We conclude that propylene glycol, acetic acid, methyl anthranilate, water, and at least one or as many as all three of the methyl-branched esters are essential for complete attractiveness.

  6. Evaluation of lufenuron as a chemosterilant against fruit flies of the genus Anastrepha (Diptera: Tephritidae).

    Science.gov (United States)

    Moya, Pilar; Flores, Salvador; Ayala, Ildefonso; Sanchis, Juan; Montoya, Pablo; Primo, Jaime

    2010-06-01

    Chemosterilisation with lufenuron bait stations is a recently developed technique that is being implemented for Ceratitis capitata Wiedemann control. The aim of this work was to evaluate the chemosterilising effect of lufenuron against four economically important Latin American fruit flies species: Anastrepha ludens (Loew.), A. obliqua Macquart, A. serpentina Wiedemann and A. striata Schiner (Diptera: Tephritidae) in order to design a similar strategy for their control. Sexually mature adults were treated by ingestion with concentrations ranging from 0.1 to 30.0 mg g(-1) of lufenuron in the diet. In addition, conspecific crosses with only one of the sexes being treated (30.0 mg g(-1)) were performed in order to appraise the contribution of each sex to the sterilising effect. In all cases, fecundity was not affected by the treatments, as opposed to fertility where all Anastrepha species studied were significantly affected, although to different extents. The conspecific crosses showed that treated males of A. ludens, A. obliqua and A. serpentina were not able to transmit the sterility to their respective untreated females. Only in the case of A. striata did crossing treated males with untreated females significantly reduced egg hatch. Although further investigations are required, the present results demonstrate that the use of lufenuron for controlling A. striata could be potentially viable.

  7. Olfactory response of Anastrepha striata (Diptera: Tephritidae) to guava and sweet orange volatiles.

    Science.gov (United States)

    Diaz-Santiz, Edvin; Rojas, Julio C; Cruz-López, Leopoldo; Hernández, Emilio; Malo, Edi A

    2016-10-01

    The behavioral responses of virgin and mated female Anastrepha striata Schiner (Diptera: Tephritidae) to guava (Psidium guajava L.) or sweet orange (Citrus sinensis L.) were evaluated separately using multilure traps in two-choice tests in field cages. The results showed that flies were more attracted to guava and sweet orange volatiles than to control (unbaited trap). The physiological state (virgin or mated) of females did not affect their attraction to the fruit volatiles. Combined analysis of gas chromatography coupled with electroantennography (GC-EAD) of volatile extracts of both fruits showed that 1 and 6 compounds from orange and guava, respectively elicited repeatable antennal responses from mated females. The EAD active compounds in guava volatile extracts were identified by gas chromatography-mass spectrometry (GC-MS) as ethyl butyrate, (Z)-3-hexenol, hexanol, ethyl hexanoate, hexyl acetate, and ethyl octanoate. Linalool was identified as the only antennal active compound in sweet orange extracts. In field cage tests, there were no significant differences between the number of mated flies captured by the traps baited with guava extracts and the number caught by traps baited with the 6-component blend that was formulated according to the relative proportions in the guava extracts. Similar results occurred when synthetic linalool was evaluated against orange extracts. From a practical point of view, the compounds identified in this study could be used for monitoring A. striata populations. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  8. Small-Scale Spatio-Temporal Distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) Using Probability Kriging.

    Science.gov (United States)

    Wang, S Q; Zhang, H Y; Li, Z L

    2016-10-01

    Understanding spatio-temporal distribution of pest in orchards can provide important information that could be used to design monitoring schemes and establish better means for pest control. In this study, the spatial and temporal distribution of Bactrocera minax (Enderlein) (Diptera: Tephritidae) was assessed, and activity trends were evaluated by using probability kriging. Adults of B. minax were captured in two successive occurrences in a small-scale citrus orchard by using food bait traps, which were placed both inside and outside the orchard. The weekly spatial distribution of B. minax within the orchard and adjacent woods was examined using semivariogram parameters. The edge concentration was discovered during the most weeks in adult occurrence, and the population of the adults aggregated with high probability within a less-than-100-m-wide band on both of the sides of the orchard and the woods. The sequential probability kriged maps showed that the adults were estimated in the marginal zone with higher probability, especially in the early and peak stages. The feeding, ovipositing, and mating behaviors of B. minax are possible explanations for these spatio-temporal patterns. Therefore, spatial arrangement and distance to the forest edge of traps or spraying spot should be considered to enhance pest control on B. minax in small-scale orchards.

  9. Conditional embryonic lethality to improve the sterile insect technique in Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Franz Gerald

    2009-01-01

    Full Text Available Abstract Background The sterile insect technique (SIT is an environment-friendly method used in area-wide pest management of the Mediterranean fruit fly Ceratitis capitata (Wiedemann; Diptera: Tephritidae. Ionizing radiation used to generate reproductive sterility in the mass-reared populations before release leads to reduction of competitiveness. Results Here, we present a first alternative reproductive sterility system for medfly based on transgenic embryonic lethality. This system is dependent on newly isolated medfly promoter/enhancer elements of cellularization-specifically-expressed genes. These elements act differently in expression strength and their ability to drive lethal effector gene activation. Moreover, position effects strongly influence the efficiency of the system. Out of 60 combinations of driver and effector construct integrations, several lines resulted in larval and pupal lethality with one line showing complete embryonic lethality. This line was highly competitive to wildtype medfly in laboratory and field cage tests. Conclusion The high competitiveness of the transgenic lines and the achieved 100% embryonic lethality causing reproductive sterility without the need of irradiation can improve the efficacy of operational medfly SIT programs.

  10. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  11. Sperm-less males modulate female behaviour in Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Gabrieli, Paolo; Scolari, Francesca; Di Cosimo, Alessandro; Savini, Grazia; Fumagalli, Marco; Gomulski, Ludvik M; Malacrida, Anna R; Gasperi, Giuliano

    2016-12-01

    In the Mediterranean fruit fly, Ceratitis capitata (Wiedemann)(Diptera: Tephritidae), mating has a strong impact on female biology, leading to a decrease in sexual receptivity and increased oviposition and fecundity. Previous studies suggest that sperm transfer may play a role in inducing these behavioural changes. Here we report the identification of a medfly innexin gene, Cc-inx5, whose expression is limited to the germ-line of both sexes. Through RNA interference of this gene, we generated males without testes and, consequently, sperm, but apparently retaining all the other reproductive organs intact. These sperm-less males were able to mate and, like their wild-type counterparts, to induce in their partners increased oviposition rates and refractoriness to remating. Interestingly, matings to sperm-less males results in oviposition rates higher than those induced by copulation with control males. In addition, the observed female post-mating behavioural changes were congruent with changes in transcript abundance of genes known to be regulated by mating in this species. Our results suggest that sperm transfer is not necessary to reduce female sexual receptivity and to increase oviposition and fecundity. These data pave the way to a better understanding of the role/s of seminal components in modulating female post-mating responses. In the long term, this knowledge will be the basis for the development of novel approaches for the manipulation of female fertility, and, consequently, innovative tools to be applied to medfly control strategies in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Hymenopterous parasitoids attacking Acanthiophilus helianthi Rossi (Diptera: Tephritidae pupae in Kohgiluyeh Safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi

    2016-12-01

    Full Text Available The Safflower capsule fly (SCF, Acanthiophilus helianthi Rossi (Diptera: Tephritidae is the most destructive insect pest attacking the Safflower Carthamus tinctorius L. plant which are cultivated as an oil crop. It is mainly controlled through application of broad-spectrum insecticides, which can adversely affect safflower farms ecosystem and consequently human health. Since a first step in setting up an integrated pest management program is to assess the biological control agents within the ecosystem. Therefore, in this research work the pupal parasitoids of Safflower capsule fly a main insect pest attacking Safflower plants were identified. The impact of these parasitoids against this pest was evaluated on the varying pest generations and within different locations in Kohgiluyeh province during 2008-2009 seasons. Pupal parasitoid adults of SCF were recorded from fieldreared pupae, which had been collected from heavily infested small flower heads of the first generation as well from large flower heads of the second and third generations. Rate of parasitism on A. helianthi pupae was estimated as the number of parasitoids over the total count of parasitoids and flies. Ten hymenopterous species belonging to different families parasitizing insect pupae were screened as follows: Bracon hebetor (Spinola, 1808 and Bracon luteator (Spinola, 1808 (Braconidae; Isocolus tinctorious (Melika and Gharaei, 2006 (Cynipidae; Pronotalia carlinarum (Szelenyi and Erdos, 1951 (Eulophidae; Eurytoma acroptilae (Zerova, 1986 (Eurytomidae; Ormyrus orientalis (Walker, 1871 (Ormyridae; Colotrechnus viridis (Masi, 1921 and Pteromalus sp. (Walker, 1976 (Pteromalidae; and Antistrophoplex conthurnatus (Zerova, 2000 and Microdontomenus annulatus (Masi, 1899 (Torymidae. The average parasitization rate was 23±1 as revealed through the present study. The highest parasitization rate occurred during the first generation in all localities tested, as well as in years. Statistical

  13. Half of the European fruit fly species barcoded (Diptera, Tephritidae; a feasibility test for molecular identification

    Directory of Open Access Journals (Sweden)

    John Smit

    2013-12-01

    Full Text Available A feasibility test of molecular identification of European fruit flies (Diptera: Tephritidae based on COI barcode sequences has been executed. A dataset containing 555 sequences of 135 ingroup species from three subfamilies and 42 genera and one single outgroup species has been analysed. 73.3% of all included species could be identified based on their COI barcode gene, based on similarity and distances. The low success rate is caused by singletons as well as some problematic groups: several species groups within the genus Terellia and especially the genus Urophora. With slightly more than 100 sequences - almost 20% of the total - this genus alone constitutes the larger part of the failure for molecular identification for this dataset. Deleting the singletons and Urophora results in a success-rate of 87.1% of all queries and 93.23% of the not discarded queries as correctly identified. Urophora is of special interest due to its economic importance as beneficial species for weed control, therefore it is desirable to have alternative markers for molecular identification.We demonstrate that the success of DNA barcoding for identification purposes strongly depends on the contents of the database used to blast against. Especially the necessity of including multiple specimens per species of geographically distinct populations and different ecologies for the understanding of the intra- versus interspecific variation is demonstrated. Furthermore thresholds and the distinction between true and false positives and negatives should not only be used to increase the reliability of the success of molecular identification but also to point out problematic groups, which should then be flagged in the reference database suggesting alternative methods for identification.

  14. Field evaluation of potential fruit-derived lures for Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Toledo, Jorge; Malo, Edi A; Cruz-López, Leopoldo; Rojas, Julio C

    2009-12-01

    Previous studies have shown that a nine-component blend (ethyl butyrate, isopropyl butyrate, hexan-1-ol, propyl butyrate, isobutyl butyrate, ethyl hexanoate, isopentyl butyrate, ethyl benzoate, and ethyl octanoate) isolated from Spondias mombin L. (Anacardiaceae) fruit are attractive to both sexes of West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), in laboratory and field cage tests. In this study, we evaluated the effectiveness of traps baited with the nine-component blend in capturing wild A. obliqua in a mango, Mangifera indica L. variety Ataulfo) orchard. In addition, we tested other S. mombin-derived lures to determine whether any of these effectively mimic the nine-component blend in attracting A. obliqua. In all trials, we compared the attractiveness of the S. mombin-derived lures against hydrolyzed protein, the standard bait for monitoring A. obliqua. We found that, in some trials, there was no difference in the number of females caught by traps baited with the nine-component blend or with hydrolyzed protein. In other trials, traps baited with hydrolyzed protein captured more females than traps baited with the nine-component blend. For males, in general there were no differences in the number of flies caught by traps baited either with the nine-component blend or with hydrolyzed protein. Traps baited with other S. mombin-derived lures captured fewer A. obliqua than traps baited with hydrolyzed protein. Traps baited with S. mombin-derived lures caught fewer species of nontarget tephritid flies and nontarget insects than traps baited with hydrolyzed protein.

  15. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Kendra, Paul E; Epsky, Nancy D; Heath, Robert R

    2010-04-01

    Release-recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew) (Diptera: Tephritidae), to determine sampling range for a liquid protein bait (torula yeast/borax) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were done in a guava, Psidium guajava L., grove and involved releasing flies at a central point and recording the numbers captured after 7 h and 1, 2, 3, and 6 d in an array of 25 Multilure traps located 9-46 m from the release point. In all tests, highest rate of recapture occurred within the first day of release, so estimations of sampling range were based on a 24-h period. Trap distances were grouped into four categories (30 m from release point) and relative trapping efficiency (percentage of capture) was determined for each distance group. Effective sampling range was defined as the maximum distance at which relative trapping efficiency was > or = 25%. This corresponded to the area in which 90% of the recaptures occured. Contour analysis was also performed to document spatial distribution of fly dispersal. In tests with sterile flies, immature females dispersed farther and were recovered in higher numbers than mature females, regardless of attractant, and recapture of both cohorts was higher with torula yeast. For mature feral flies, range of the synthetic lure was determined to be 30 m. With sterile females, effective range of both attractants was 20 m. Contour maps indicated that wind direction had a strong influence on the active space of attractants, as reflected by distribution of captured flies.

  16. Male irradiation affects female remating behavior in Anastrepha serpentina (Diptera: Tephritidae).

    Science.gov (United States)

    Landeta-Escamilla, Anais; Hernández, Emilio; Arredondo, José; Díaz-Fleischer, Francisco; Pérez-Staples, Diana

    2016-02-01

    Female remating in target pest species can affect the efficacy of control methods such as the Sterile Insect Technique (SIT) but very little is known about the postcopulatory mating behavior of these pests. In this study, we investigated the remating behavior of female Anastrepha serpentina (Diptera: Tephritidae), an oligophagous pest of Sapotaceae. First, we tested how long the sexual refractory period of females lasted after an initial mating. Second, we tested the effect of male and female sterility, female ovipositing opportunities and male density on female propensity to remate. Lastly, we tested if the amount of sperm stored by females was correlated to the likelihood of females to remate. We found that receptivity of mass-reared A. serpentina females had a bimodal response, with up to 16% of mass-reared A. serpentina females remating five days after the initial copulation, decreasing to 2% at 10 and 15 days and increasing to 13% after 20 days. Compared to fertile males, sterile males were less likely to mate and less likely to inhibit females from remating. Copula duration of sterile males was shorter compared to fertile males. Remating females were less likely to mate with a sterile male as a second mate. Sterile females were less likely to mate or remate compared to fertile females. Opportunity to oviposit and male density had no effect on female remating probability. Sperm numbers were not correlated with female likelihood to remate. Information on the post-copulatory behavior of mass-reared A. serpentina will aid fruit fly managers in improving the quality of sterile males. We discuss our results in terms of the differences this species presents in female remating behavior compared to other tephritids. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Host status of grapefruit and Valencia oranges for Anastrepha serpentina and Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Mangan, Robert L; Thomas, Donald B; Moreno, Aleena M Tarshis

    2011-04-01

    Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) is sporadically captured in the Rio Grande Valley of Texas. Although its preferred hosts are in the Sapotaceae family, several varieties of Citrus, including grapefruit and oranges are listed as alternate hosts. Although Mexican fruit fly, Anastrepha ludens (Loew), is known to be a major pest of Citrus, doubt exists as to the status of Citrus as a breeding host for A. serpentina. To evaluate the host status of commercial Citrus for A. serpentina we compared oviposition and development with that of A. ludens under laboratory conditions with 'Rio Red' grapefruit (Citrus paradisi MacFayden) and 'Valencia' oranges [Citrus sinensis (L.) Osbeck] in different stages of maturity. Both fly species oviposited in early season fruit in which the eggs and larvae died in the fruit albedo. Survival of either species to the adult stage occurred in later season grapefruit. In oranges, no A. serpentina larvae survived compared with 150 A. ludens surviving to adults. Survival on both Citrus species was much lower for A. serpentina, only approximately 5% of eggs eclosed into larvae in grapefruit compared with approximatley 50% for A. ludens. In oranges approximately 16% of A. serpentina eggs eclosed compared with approximately 76% for A. ludens. In grapefruit, only one fourth as many A. serpentina larvae survived to the adult stage compared with A. ludens. Additional experiments were performed in a greenhouse on small, caged trees of la coma (Sideroxylon celastrinum H.B.K.), a Texas species of Sapotaceae. The A. serpentina females readily oviposited into these berries and normal adults emerged. The present low incidence of the adults, coupled with the high mortality during development of the larvae, suggests that Texas citrus is unlikely to support a breeding population of A. serpentina.

  18. Efficacy of commercial traps and food odor attractants for mass trapping of Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Lasa, Rodrigo; Velázquez, Olinda E; Ortega, Rafael; Acosta, Emilio

    2014-02-01

    One of the most important factors for the success of a mass trapping strategy to control a fruit fly involves the selection of an effective trap-lure combination. Because different species of fruit flies respond differently to the physical characteristics of a trap and to bait volatiles, the evaluation of commercial traps and lures that have proved useful against other tephtrids is necessary to determine their efficacy for mass trapping of Anastrepha ludens (Loew) (Diptera: Tephritidae). Under caged conditions, a commercial hemispherical trap with lateral holes (Maxitrap Plus) proved more attractive to A. ludens (both sexes) than five other commercial traps that were all baited with hydrolyzed protein. Among these traps, bottom invaginated traps and traps with invaginated lateral holes constructed with transparent cylinders had the best physical retention properties. When evaluated under field conditions, the lure was critical for the efficacy of the trap, and one of the traps that performed poorly in attraction and retention cage tests (MS2) resulted as one of the most effective traps when baited with CeraTrap lure. Considering the use of different trap models under field conditions, CeraTrap liquid bait was more effective in A. ludens capture than Biolure dry synthetic bait, but both lures were not replaced during the entire course of the experiment. The percentage of captured females was also slightly higher using CeraTrap lure (67.2%) than using Biolure baits (54.5-58.8%). In field tests, 75-81% of females were mated and no significant differences were observed among trap-lure combinations. Trap selectivity against nontarget adult lacewings also differed among trap-lure combinations.

  19. Insecticide toxicity to oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae) is influenced by environmental factors.

    Science.gov (United States)

    Lin, Yuying; Jin, Tao; Zeng, Ling; Lu, Yongyue

    2013-02-01

    In this study, we investigated the effects of environmental factors (temperature, dose, dietary source, and feeding density) on the insecticide tolerance of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). The results indicated that the toxicities of trichlorphon and abamectin to B. dorsalis increased with an increase in temperature. At 15-35 degrees C, the toxicity of beta-cypermethrin decreased with an increase in temperature at low doses (0.82 and 1.86 mg/L), but was similar at a high dose (4.18 mg/L). These results demonstrated that the temperature coefficient of beta-cypermethrin was related to both temperature and dosage. The insecticide sensitivity of B. dorsalis reared on different dietary sources was significantly different. Trichlorphon sensitivity of B. dorsalis fed on banana was the highest with an LC50 of 1.61 mg/L, followed by on apple, carambola, semiartificial diet, pear, mango, guava, orange, and papaya. With an increasing feeding density, the sensitivity of B. dorsalis adults to trichlorphon increased, while the sensitivities of B. dorsalis adults to abamectin and beta-cypermethrin decreased. The differences between LC50 values of insects reared at densities of 10 and 13 eggs/g of semiartificial diet to trichlorphon, abamectin and beta-cypermethrin were not significant. This result suggested that representative toxicity could be obtained by using adults developed at a feeding density between 10-13 eggs/g of semiartificial diet. Adult body weight was positively correlated with the LC50 value of trichlorphon, but was negatively correlated with the toxicities of abamectin and beta-cypermethrin. These results suggested that the effects of adult body weight on the toxicity of insecticides were different among different chemicals.

  20. Effect of sweeteners on the survival and behaviour of Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Zheng, Chunyan; Zeng, Ling; Xu, Yijuan

    2016-05-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) causes serious damage that affects fruit production. Chemical insecticides have been widely used for the prevention and control of this destructive pest. However, the resistance of B. dorsalis to these compounds has become a serious problem. This study tested six sweeteners for their toxicity to B. dorsalis. B. dorsalis fed on erythritol, aspartame and saccharin exhibited significantly higher mortality than those fed on sucrose. Flies fed on erythritol died faster than did the control flies (water). However, no dose-dependent effects were observed at the concentrations tested. These three sweeteners decreased the climbing ability of B. dorsalis. Notably, adults fed on saccharin exhibited significantly decreased climbing ability after 12 h compared with those fed on sucrose. Additionally, these three sweeteners had a negative effect on the frequency and duration of the flies' behaviour patterns (flying, walking, grooming and inactivity). Saccharin not only induced a marked reduction in the frequency of flights and walks but also induced decreases in the time spent flying and walking and increases in inactivity compared with sucrose. Erythritol induced a reduction in movement and increased the time spent inactive compared with the control and other treatments. Three sweeteners had significant negative effects on the survival of B. dorsalis. Erythritol was toxic to B. dorsalis. Aspartame and saccharin also decreased the survival and behaviour of adult flies and may be toxic to (or contribute to poor nutrition in) B. dorsalis. These sweeteners could therefore be developed as additive ingredients in baits. © 2015 Society of Chemical Industry.

  1. Export of commercial Hass avocados from Argentina poses negligible risk of Ceratitis capitata (Diptera: Tephritidae) infestation.

    Science.gov (United States)

    Villagrán, M Elvira; Willink, Eduardo; Vera, M Teresa; Follett, Peter

    2012-08-01

    Argentina has to meet quarantine restrictions because of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), to export 'Hass' avocados, Persea americana Miller, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata and could open export markets without the need for a quarantine treatment. Trapping data from 1998 to 2006 showed that C. capitata was present in avocado orchards, particularly early in the harvest season. The host status of hard, mature green Hass avocado to C. capitata was evaluated using laboratory and field cage tests under no-choice conditions and by assessing natural levels of infestation in commercially harvested fruit from the main avocado production area. In total, 2,250 hard, mature green avocado fruit were exposed to 11,250 gravid females for 24 or 48 h after harvest in laboratory or field cages, and no infestations were found. During 11 seasons, 5,949 fruit in total were sampled from the trees and 992 fruit were collected from the ground, and in none of them were any live or dead fruit fly larvae found. Inspection of >198,000 commercial fruit at the packinghouse from 1998 to 2011 showed no symptoms of fruit fly infestation. These data exceed the published standards for determination of nonhost status, as well as the Probit 9 standard for development of quarantine treatments. Hass avocado harvested at the hard, mature green stage was not infested by C. capitata and seems to pose a negligible quarantine risk. As a consequence, no postharvest treatment or other quarantine actions should be required by importing countries.

  2. One Metarhizium brunneum Strain, Two Uses to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Yousef, M; Garrido-Jurado, I; Quesada-Moraga, E

    2014-10-01

    We determined the virulence and insecticidal activity of the hypocrealean fungus Metarhizium brunneum (Petch) strain EAMb 09/01-Su and its crude extract against Mediterranean fruit fly Ceratitis capitata Wiedemann (Diptera: Tephritidae) and we evaluated the combined use of the fungus with its crude extract. We also determined the effect of fermentation time, temperature, and initial pH of the M. brunneum culture medium on the insecticidal activity of the crude extract. When C. capitata adults were sprayed with a conidial suspension, the strain EAMb 09/01-Su caused 100% mortality with a mean lethal time (LT50) of 5.6 d and mean lethal concentration (LC50) of 2.84 f#x2013; 10(7) conidia per milliliter. Fermentation time significantly affected the lethality of the crude extract when it was provided to C. capitata per os. The highest level of mortality (73.3%) and the shortest median survival time (25.5 h) was obtained from 15-d-old cultures. The crude extract was demonstrated to be thermostable, given that the mortality was >50% at 48 h when the extract had been heated to 100°C for 3 h. Lastly, the optimum initial pH for maximum crude extract activity in terms of mortality ranged between 7 and 9. Additivity was observed for all M. brunneum EAMb 09/01-Su strain crude extract combinations tested, indicating compatibility between products. We concluded that the M. brunneum EAMb 09/01-Su strain is a promising tool for medfly control alone or in combination with its crude extract. © 2014 Entomological Society of America.

  3. Rhagoletis cerasi Loew (Diptera: Tephritidae – Biological Characteristics, Harmfulness, and Control

    Directory of Open Access Journals (Sweden)

    Svetomir Stamenković

    2012-01-01

    Full Text Available The European cherry fruit fly, Rhagoletis cerasi Loew (Diptera: Tephritidae, is a highlydestructive pest in sweet and sour cherry orchards with a distribution area throughoutEurope and the temperate regions of Asia. It occurs regularly in all production regions ofthese fruit species in Serbia, damaging up to 10% of cherries in commercial production,while damage can go up to 100% in orchards and on solitary threes unprotected by controlmeasures.In Serbia, European cherry fruit fly most often attacks and damages fruits of the lateripeningcultivars of sweet cherry (Van, Stela, Hedelfinger, Bing, Lambert, Drogan’s Yellow.After a sweet cherry harvest, adults migrate to sour cherry where they continue feedingand ovipositing in half-mature sour cherries (prevailingly the domestic ecotype Oblačinska.During their activity period, larvae damage the fruits, so that they can no longer be consumedeither fresh or processed. The high percentage of sour cherries damaged by R. cerasihas become a factor limiting exports because the intensity of infestation of this fruitexceeds permissible limits. Pesticide use for controlling this pest, especially in integratedproduction, is based on a very poor selection of insecticides which cause problems withresidual ecotoxicity. Consequently, alternative measures for controlling European cherryfruit fly have been intensively studied over the past few years.This work surveys up-to-date results of various studies on the European cherry fruit flyas a very important pest in Serbia and other South and Mid-European countries. The workcontains detailed descriptions of its biological characteristics, flight phenology, infestationintensity and possibilities of fly control in sweet and sour cherry production areas.

  4. Natural Field Infestation of Mangifera casturi and Mangifera lalijiwa by Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    McQuate, Grant T; Sylva, Charmaine D; Liquido, Nicanor J

    2017-01-01

    Mango, Mangifera indica (Anacardiaceae), is a crop cultivated pantropically. There are, however, many other Mangifera spp ("mango relatives") which have much more restricted distributions and are poorly known but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapped in mango breeding programs. Because of the restricted distribution of many of the Mangifera spp, there has also been limited data collected on susceptibility of their fruits to infestation by tephritid fruit flies which is important to know for concerns both for quality of production and for quarantine security of fruit exports. Here, we report on natural field infestation by the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae), of two mango relatives native to Indonesia: Mangifera casturi and Mangifera lalijiwa. Rates of infestation of fruits of these two Mangifera spp by tephritid fruit flies have not previously been reported.

  5. Sterilization of fruit flies (Diptera: Tephritidae) with X-rays for sterile insect technique programs; Esterilizacao de moscas-das-frutas (Diptera: Tephritidae) com raios-X para programas de tecnica do inseto esteril

    Energy Technology Data Exchange (ETDEWEB)

    Mastrangelo, Thiago de Araujo

    2009-07-01

    Recent fear of acts of terrorism provoked an increase of delays and denials in the shipment of radioisotopes. This truly represented a menace to sterile insect production projects around the world. In order to validate the use of a new kind of low-energy Xray irradiator, a series of radiobiological studies on Ceratitis capitata (tsl-VIENNA 8 strain) (Wied., 1824) (Diptera: Tephritidae) and an Argentinean strain of Anastrepha fraterculus (Wied., 1830) (Diptera: Tephritidae) were carried out, also comparing biological effectiveness between X-rays and traditional {gamma} radiation from {sup 60}Co. Pupae 48- 24 h before adult emergence of C. capitata males and both sexes of A. fraterculus were irradiated with doses ranging from 15 to 120 Gy and 10 to 70 Gy respectively. Doses that induce 50, 90 and 99% of sterility were estimated and the hypothesis of Parallelism for the Probit equations was tested. Doses of 82.7 Gy of X-rays and 128.2 Gy of {gamma} rays (thus, a RBE{approx}1.5) induced 99% sterility on medfly males. The fertility of A. fraterculus fertile females crossed with 41 Gy of X-rays and 62.7 Gy of {gamma} rays decreased in 99% comparing with the control group (RBE{approx}1.5). 99% sterility of A. fraterculus irradiated females was achieved with 60-80 Gy (RBE{approx}0.7). The standard quality control parameters of fecundity, adult emergence, fliers and survival were not significantly affected by the two types of radiation (RBE{approx}1) either for medfly or A. fraterculus (p>0.01), being averages in conformity with the values required by FAO/IAEA/USDA. Only fecundity of irradiated A. fraterculus females was severely reduced with increasing doses and no egg was laid at 70 Gy of both radiations. There were no significant differences between X-rays and {gamma} rays regarding mating indices (RSI for medfly, RII, ISI, MRPI and FRPI for A. fraterculus) (p>0.05), what indicated more random matings for fertile and sterile insects. The results demonstrated that no

  6. Rationale for a generic phytosanitary irradiation dose of 70 Gy for the genus Anastrepha (Diptera: Tephritidae)

    Science.gov (United States)

    The phytosanitary irradiation (PI) literature of the genus Anastrepha was analyzed to determine if it was sufficient to support a generic dose <150 Gy (the accepted generic dose for all of Tephritidae) that could be used on fruit in areas of the tropical and subtropical Americas where only species o...

  7. Determination of Opiinae parasitoids (Hymenoptera: Braconidae) associated with crop infesting Bactrocera spp. (Diptera: Tephritidae) using COI and Cyt b sequences

    Science.gov (United States)

    Shariff, Safiah; Yaakop, Salmah; Zain, Badrul Munir Md.

    2013-11-01

    Members of the Opiinae subfamily (Hymenoptera: Braconidae) are well known as important parasitoids of fruit fly larvae (Diptera: Tephritidae). They are widely used as biological control agents of fruit flies, especially the Bactrocera Macquart species that infest fruits. In this study, the larvae of fruit flies were collected from infested crops including star fruit, guava, wax apple and ridge gourd. The parasitized larvae were then reared under laboratory conditions until emergence of the adult parasitoids. Additionally, Malaise trap also was used to collect parasitoid species. The general concept of the multiplex PCR has been performed is to amplify two mitochondrial DNA markers, namely cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) simultaneously. Therefore, the lengthy process of reaction will be reduced. The status of the fruit fly species has also been confirmed by using COI marker on the early stage of the larvae. Maximum parsimony (MP) and Bayesian Inference (BI) were implemented to help and support the identification of Opiinae species. The result obtained from this study showed three parasitoid genera of the Opiinae viz. Fopius Wharton, Psyttalia Walker and Diachasmimorpha Viereck. Each genus has been determined by clustering together in a similar clade according to their infested crops. Therefore, accurate determination of parasitoids and the fruit fries species was highly useful and necessary for successful biological control of Bactrocera species.

  8. Chemosterilant bait stations coupled with sterile insect technique: an integrated strategy to control the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Vacas, S; Sanchis, J; Primo, J; Alfaro, C

    2011-10-01

    During 2008 and 2009, the efficacy of the combination of two Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), control techniques, sterile insect technique (SIT) and a chemosterilant bait station system (Adress), was tested in three crops: citrus (Citrus spp.), stone fruit (Prunus spp.), and persimmon (Diospyros spp.). Two thousand sterile males were released per ha each week in the whole trial area (50,000 ha, SIT area). For 3,600 ha, within the whole trial area, 24 Adress traps per ha were hung (SIT + Adress area). Ten SIT + Adress plots and 10 SIT plots in each of three different fruit crops were arranged to assess Mediterranean fruit fly population densities and fruit damage throughout the trial period. To evaluate the efficacy of each treatment, the male and female populations were each monitored from August 2008 to November 2009, and injured fruit was assessed before harvest. Results showed a significant reduction in the C. capitata population in plots treated with both techniques versus plots treated only with the SIT. Likewise, a corresponding reduction in the percentage of injured fruit was observed. These data indicate the compatibility of these techniques and suggest the possibility of using Adress coupled with SIT to reduce C. capitata populations in locations with high population densities, where SIT alone is not sufficiently effective to suppress fruit fly populations to below damaging levels.

  9. Thermal death kinetics of Mediterranean, Malaysian, melon, and oriental fruit fly (Diptera: Tephritidae) eggs and third instars.

    Science.gov (United States)

    Armstrong, John W; Tang, Juming; Wang, Shaojin

    2009-04-01

    The late-aged egg and third-instar life stages of laboratory-reared Malaysian fruit fly, Bactrocera latifrons (Hendel); Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, B. cucurbitae Coquillett; and oriental fruit fly, B. dorsalis (Hendel), (Diptera: Tephritidae); and the third instars of wild Mediterranean fruit fly were exposed to thermal treatments. A heating block system was used to determine the thermal death kinetics of the four fruit fly species. Treatments consisted of heating the fruit fly life stages to 44, 46, 48, and 50 degrees C and holding for different times ranging from 0 to 120 min depending on the thermal mortality response and time required to obtain 100% mortality for each species and life stage. The 0.5-order kinetic model had the best fit to the survival ratio for all the treatment temperatures and was used to predict lethal times. The thermal death time (TDT) curves showed a tolerance order of Mediterranean fruit fly eggs fruit fly third instar thermotolerance from Hawaii and Israel showed that Israel Mediterranean fruit fly was more thermotolerant. A comparison of minimum treatment times at a given temperature required to obtain 100% mortality of laboratory-reared Malaysian, Mediterranean (Hawaii and Israel strains), melon, Mexican, and oriental fruit fly eggs or third instars and wild Mediterranean fruit fly (Hawaii strain) eggs or third instars showed that oriental fruit fly was the most thermotolerant among the third instars, and the difference in heat tolerance between third instars and eggs was negligible at 50 degrees C.

  10. Moscas-das-frutas (Diptera: Tephritidae em um pomar de goiabeira, no semiárido brasileiro

    Directory of Open Access Journals (Sweden)

    Elton Lucio Araujo

    2013-06-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae são pragas-chave na cultura da goiabeira Psidium guajava L., com predominância de diferentes espécies de acordo com a região produtora no Brasil. Os objetivos do presente trabalho foram conhecer a diversidade e analisar parâmetros faunísticos das moscas-das-frutas obtidas em um pomar de goiabeira, no município de Cruzeta, Rio Grande do Norte, situado no semiárido brasileiro. As moscas-das-frutas foram coletadas semanalmente, com auxílio de armadilhas McPhail, tendo como atrativo proteína hidrolisada a 5% v/v. Foram registradas cinco espécies no pomar estudado: Ceratitis capitata (Wied., Anastrepha zenildae Zucchi, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart e Anastrepha dissimilis Stone. Ceratitis capitata foi a espécie mais frequente, constante e dominante, considerada como uma praga invasiva, potencial em pomares de goiabeira no semiárido brasileiro.

  11. Carambola Cultivar, Fruit Ripeness, and Damage by Conspecific Larvae Influence the Host-Related Behaviors of Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    López-Ley, Jorge Ulises; Toledo, Jorge; Malo, Edi A; Gomez, Jaime; Santiesteban, Antonio; Rojas, Julio C

    2016-02-01

    In this study, we investigated the influence of cultivar type, fruit ripeness, and damage by conspecific larvae on the attraction of Anastrepha obliqua (Macquart) (Diptera: Tephritidae) to and oviposition on carambola fruit (Averroha carambola L.). The attraction of both sexes of A. obliqua to fruit of different quality was evaluated through cage experiments in the field, and the oviposition preferences of mated females were examined in laboratory tests. Both sexes, mated or virgin, were more attracted to the "Maha" fruit than to the "Golden Star" fruit, and the females oviposited more frequently on the Maha cultivar than the Golden Star cultivar. Both sexes were more attracted to ripe and half-ripe Maha fruits than to mature green fruit, and although females did not show a preference for ovipositing on half-ripe or ripe fruits, they did not oviposit on mature green fruits. Males did not show a preference for the volatiles from uninfested, artificially damaged, or infested Maha fruits, but females were more attracted to uninfested fruits than to artificially damaged and infested Maha fruits. Furthermore, females preferred to oviposit on uninfested fruits compared with artificially damaged fruit, and they did not oviposit on infested fruits. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Flight capacity of Bactrocera dorsalis (Diptera: Tephritidae) adult females based on flight mill studies and flight muscle ultrastructure.

    Science.gov (United States)

    Chen, Min; Chen, Peng; Ye, Hui; Yuan, Ruiling; Wang, Xiaowei; Xu, Jin

    2015-01-01

    The oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), is considered a major economic threat in many regions worldwide. To better comprehend flight capacity of B. dorsalis and its physiological basis, a computer-monitored flight mill was used to study flight capacity of B. dorsalis adult females of various ages, and the changes of its flight muscle ultrastructures were studied by transmission electron microscopy. The flight capacity (both speed and distance) changed significantly with age of B. dorsalis female adults, peaking at about 15 d; the myofibril diameter of the flight muscle of test insects at 15-d old was the longest, up to 1.56 µm, the sarcomere length at 15-d old was the shortest, averaging at 1.37 µm, volume content of mitochondria of flight muscle at 15-d old reached the peak, it was 32.64%. This study provides the important scientific data for better revealing long-distance movement mechanism of B. dorsalis. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  13. The distribution, relative abundance, and seasonal phenology of Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    De Villiers, Marelize; Manrakhan, Aruna; Addison, Pia; Hattingh, Vaughan

    2013-10-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) are fruit fly species (Diptera: Tephritidae) of economic importance in South Africa. These pests cause direct damage to a number of commercially produced fruit and are of phytosanitary concern. A study was conducted to determine the distribution, relative abundance, and seasonal occurrence of the three species in different climatic regions of South Africa. The relative abundance and seasonal phenology of C. capitata and C. rosa were also compared between production areas and home gardens in Stellenbosch, Western Cape. Yellow bucket traps baited with Biolure were used to trap the flies over a 2-yr period in the different sampling areas. Different fruit types were sampled in Stellenbosch to determine fruit fly infestation. C. capitata was found to have a widespread distribution in South Africa, whereas C. rosa were absent from or only present in low numbers in the drier regions. C. cosyra was restricted to the North East and East coast, following a similar pattern to the distribution of marula, Sclerocarrya birrea, an important wild host. Fruit in home gardens provided a breeding ground for C. capitata and C. rosa and a source for infestation of orchards when fruit started to mature, highlighting the need for an area-wide strategy for the control of fruit flies.

  14. Host status of avocado ('Hass') to Ceratitis capitata, Ceratitis rosa, and Ceratitis cosyra (Diptera: Tephritidae) in South Africa.

    Science.gov (United States)

    de Graaf, J

    2009-08-01

    Ceratitis capitata (Wiedemann), Ceratitis rosa Karsch, and Ceratitis cosyra (Walker) (Diptera: Tephritidae) are pests potentially associated with avocado (Persea americana Mill.) in South Africa. The aim of the study was to determine the host status of 'Hass' avocado to these tephritid pests over 4 yr. Unpunctured harvested avocado was exposed to fruit flies in the laboratory under no-choice conditions for 24 h. In field studies, each species was exposed for 48 h under no-choice conditions to avocado attached to the tree. Fruit was harvested immediately, 4, 8 and 18 d after exposure. In all the experiments, the fruit was incubated at 25 degrees C for 49 d after harvest. Hass avocado fruit was sourced from pack-houses throughout the avocado production areas and inspected for any internal pests. Similar inspections were done from 2005 to 2008 at arrival in Europe following standard export procedures. Analysis indicated that Hass avocado is a conditional nonhost for C. capitata and a poor but potential host for C. rosa and C. cosyra. No requirement for a risk mitigation treatment for C. capitata on South African Hass avocado was found. Fruit sampling data did not produce any infested fruit, suggesting that natural conditions and/or existing procedures functioning in a systems approach are likely to mitigate the quarantine risks of C. rosa and C. cosyra on Hass avocado in South Africa.

  15. Field Efficacy of a Metarhizium anisopliae-Based Attractant-Contaminant Device to Control Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Navarro-Llopis, V; Ayala, I; Sanchis, J; Primo, J; Moya, P

    2015-08-01

    Biological control of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) using entomopathogenic fungi is being studied as a viable control strategy. The efficacy of a Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae)-based attractant-contaminant device (ACD) to control C. capitata was evaluated in a medium-scale (40 ha) 2-yr field trial using a density of 24 ACD per ha. Results showed that this density was adequate to efficiently reduce fruitfly populations and that the inoculation dishes (IDs) needed replacing mid-season to provide protection for the entire season. In this study, fungal treatment was even more effective than conventional chemical treatment. Population dynamics in fungus-treated fields along with the infectivity study of field-aged IDs in the laboratory found that the ACD remained effective for at least 3 mo. The results suggest M. anisopliae-based ACD can be used to control C. capitata in the field. The implications of its use, especially as a tool in an integrated pest management program, are discussed. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Manipulation of the microbiota of mass-reared Mediterranean fruit flies Ceratitis capitata (Diptera: Tephritidae) improves sterile male sexual performance.

    Science.gov (United States)

    Ben Ami, Eyal; Yuval, Boaz; Jurkevitch, Edouard

    2010-01-01

    The sterile insect technique (SIT) is a method of biological control whereby millions of factory reared sterile male insects are released into the field. This technique is commonly used to combat the Mediterranean fruit fly (Ceratitis capitata, Diptera: Tephritidae). Sterile medfly males are less competent in attracting and mating with wild females, a property commonly linked to the irradiation process responsible for the sterilization. As bacteria are important partners in the fly's life cycle, we used molecular analytical methods to study the community structure of the gut microbiota in irradiated male medflies. We find that the sterilizing irradiation procedure affects the gut bacterial community structure of the Mediterranean fruit fly. Although the Enterobacteriaceae family remains the dominant bacterial group present in the gut, the levels of Klebsiella species decreases significantly in the days after sterilization. In addition, we detected substantial differences in some bacterial species between the mass rearing strain Vienna 8 and the wild strain. Most notable among these are the increased levels of the potentially pathogenic species Pseudomonas in the industrial strain. Testing the hypothesis that regenerating the original microbiota community could result in enhanced competitiveness of the sterile flies, we found that the addition of the bacterial species Klebsiella oxytoca to the postirradiation diet enables colonization of these bacteria in the gut while resulting in decreased levels of the Pseudomonas sp. Feeding on diets containing bacteria significantly improved sterile male performance in copulatory tests. Further studies will determine the feasibility of bacterial amelioration in SIT operations.

  17. Ammonium Acetate Enhances the Attractiveness of a Variety of Protein-Based Baits to Female Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Smith, Trevor R; Fox, Abbie J; Vargas, Roger I

    2015-04-01

    Ammonia and its derivatives are used by female fruit flies (Diptera: Tephritidae) as volatile cues to locate protein-rich food needed to produce their eggs. This need for external protein sources has led to the development of behaviorally based control strategies such as food-based lures and insecticidal baits targeting pestiferous fruit fly species. In field cage studies conducted in Hawaii, we examined the behavioral response of laboratory-reared male and female Mediterranean fruit fly, Ceratitis capitata (Wiedemann), to seven commercially available protein baits and to beer waste, a relatively inexpensive and readily available substance. Each material was tested alone or in combination with either ammonium acetate or ammonium carbonate. For the majority of baits evaluated, the presence of ammonium acetate, but not ammonium carbonate, elicited a significantly greater level of response of female C. capitata compared with the protein baits alone. The addition of ammonium acetate to selected baits increased bait attractiveness to a level comparable with that elicited by the most widely used spinosad-based protein bait, GF-120. Our findings indicate that the addition of ammonium acetate to commercially available proteinaceous baits and to beer waste can greatly improve their attractiveness to C. capitata, potentially increasing the bait's effectiveness for fruit fly monitoring and suppression. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Optimizing methyl-eugenol aromatherapy to maximize posttreatment effects to enhance mating competitiveness of male Bactrocera carambolae (Diptera: Tephritidae).

    Science.gov (United States)

    Haq, Ihsan ul; Vreysen, Marc J B; Cacéres, Carlos; Shelly, Todd E; Hendrichs, Jorge

    2015-10-01

    Methyl-eugenol (ME) (1,2-dimethoxy-4-(2-propenyl)benzene), a natural phytochemical, did enhance male Bactrocera carambolae Drew & Hancock (Diptera: Tephritidae) mating competitiveness 3 d after ingestion. Enhanced male mating competitiveness can significantly increase the effectiveness of the sterile insect technique (SIT). ME application to mass reared sterile flies by feeding is infeasible. ME application by aromatherapy however, would be a very practical way of ME application in fly emergence and release facilities. This approach was shown to enhance mating competitiveness of B. carambolae 3 d posttreatment (DPT). Despite this added benefit, every additional day of delaying release will reduce sterile fly quality and will add cost to SIT application. The present study was planned to assess the effects of ME-aromatherapy on male B. carambolae mating competitiveness 1DPT and 2DPT. ME aromatherapy 1DPT or 2DPT did enhance mating competitiveness of B. carambolae males whereas ME feeding 1DPT and 2DPT did not. Male mating competitiveness was enhanced by the ME aromatherapy irrespective if they received 1DPT, 2DPT or 3DPT. ME aromatherapy, being a viable approach for its application, did enhance mating competitiveness of male B. carambolae 1 d posttreatment as ME feeding did 3 d after ingestion.

  19. Cold storage enhances the efficacy and margin of security in postharvest irradiation treatments against fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Snook, Kirsten

    2013-10-01

    Cold storage is used to preserve fruit quality after harvest during transportation in marketing channels. Low temperature can be a stressor for insects that reduces survivorship, and cold storage may contribute to the efficacy of postharvest quarantine treatments such as irradiation against quarantine insect pests. The combined effect of irradiation and cold storage was examined in a radiation-tolerant fruit fly, Bactrocera cucurbitae Coquillet (melon fly), and a radiation-intolerant fruit fly, Ceratitis capitata (Wiedemann) (Mediterranean fruit fly) (Diptera: Tephritidae). Third instars on diet or in papaya were treated with a sublethal radiation dose of 30 Gy and stored at 4 or 11 degrees C for 3-13 d and held for adult emergence. For both fruit fly species, survival of third instars to the adult stage generally decreased with increasing cold storage duration at 4 or 11 degrees C in diet or papaya. Survivorship differences were highly significant for the effects of substrate (diet > papaya), temperature (11 > 4 degrees C),and irradiation (0 > 30 Gy). Few Mediterranean fruit flies survived in any cold storage treatment after receiving a radiation dose of 30 Gy. No melon fly larvae survived to the adult stage after irradiation and 11 d cold storage at 4 or 11 degrees C in papayas. Cold storage enhances the efficacy and widens the margin of security in postharvest irradiation treatments. Potentially irradiation and cold storage can be used in combination to reduce the irradiation exposure requirements of quarantine treatments.

  20. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.Influência de diferentes frutos tropicais em aspectos biológicos e comportamentais da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Estudos em Ceratitis capitata, uma praga agrícola, pode auxiliar

  1. Attraction and consumption of methyl eugenol by male Bactrocera umbrosa Fabricius (Diptera: Tephritidae) promotes conspecific sexual communication and mating performance.

    Science.gov (United States)

    Wee, S L; Abdul Munir, M Z; Hee, A K W

    2017-06-19

    The Artocarpus fruit fly, Bactrocera umbrosa (Fabricius) (Diptera: Tephritidae), is an oligophagous fruit pest infesting Moraceae fruits, including jackfruit (Artocarpus heterophyllus Lamarck), a fruit commodity of high value in Malaysia. The scarcity of fundamental biological, physiological and ecological information on this pest, particularly in relation to behavioural response to phytochemical lures, which are instrumental to the success of many area-wide fruit fly control and management programmes, underpins the need for studies on this much-underrated pest. The positive response of B. umbrosa males to methyl eugenol (ME), a highly potent phytochemical lure, which attracts mainly males of many Bactrocera species, was shown to increase with increasing age. As early as 7 days after emergence (DAE), ca. 22% of males had responded to ME and over 50% by 10 DAE, despite no occurrence of matings (i.e. the males were still sexually immature). Male attraction to ME peaked from 10 to 27 DAE, which corresponded with the flies' attainment of sexual maturity. In wind-tunnel assays during the dusk courtship period, ME-fed males exhibited earlier calling activity and attracted a significantly higher percentage of virgin females compared with ME-deprived males. ME-fed males enjoyed a higher mating success than ME-deprived males at 1-day post ME feeding in semi-field assays. ME consumption also promotes aggregation behaviour in B. umbrosa males, as demonstrated in wind-tunnel and semi-field assays. We suggest that ME plays a prominent role in promoting sexual communication and enhancing mating performance of the Artocarpus fruit fly, a finding that is congruent with previous reports on the consequences of ME acquisition by other economically important Bactrocera species.

  2. Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Anne M. Costa

    2011-09-01

    Full Text Available Influence of different tropical fruits on biological and behavioral aspects of the Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera, Tephritidae. Studies on Ceratitis capitata, a world fruit pest, can aid the implementation of control programs by determining the plants with higher vulnerability to attacks and plants able to sustain their population in areas of fly distribution. The objective of the present study was to evaluate the influence of eight tropical fruits on the following biological and behavioral parameters of C. capitata: emergence percentage, life cycle duration, adult size, egg production, longevity, fecundity, egg viability, and oviposition acceptance. The fruits tested were: acerola (Malpighia glabra L., cashew (Anacardium occidentale L., star fruit (Averrhoa carambola L., guava (Psidium guajava L., soursop (Annona muricata L., yellow mombin (Spondias mombin L., Malay apple (Syzygium malaccense L., and umbu (Spondias tuberosa L.. The biological parameters were obtained by rearing the recently hatched larvae on each of the fruit kinds. Acceptance of fruits for oviposition experiment was assessed using no-choice tests, as couples were exposed to two pieces of the same fruit. The best performances were obtained with guava, soursop, and star fruit. Larvae reared on cashew and acerola fruits had regular performances. No adults emerged from yellow mombin, Malay apple, or umbu. Fruit species did not affect adult longevity, female fecundity, or egg viability. Guava, soursop, and acerola were preferred for oviposition, followed by star fruit, Malay apple, cashew, and yellow mombin. Oviposition did not occur on umbu. In general, fruits with better larval development were also more accepted for oviposition.

  3. Evaluation of the efficacy of the methyl bromide fumigation schedule against Mexican fruit fly (Diptera: Tephritidae) in citrus fruit.

    Science.gov (United States)

    Hallman, Guy J; Thomas, Donald B

    2011-02-01

    Methyl bromide fumigation is widely used as a phytosanitary treatment. Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), is a quarantine pest of several fruit, including citrus (Citrus spp.), exported from Texas, Mexico, and Central America. Recently, live larvae have been found with supposedly correctly fumigated citrus fruit. This research investigates the efficacy of the previously approved U.S. Department of Agriculture-Animal and Plant Health Inspection Service treatment schedule: 40 g/m3 methyl bromide at 21-29.4 degrees C for 2 h. Tolerance ofA. ludens to methyl bromide in descending order when fumigated in grapefruit (Citrus X paradisi Macfad.) is third instar > second instar > first instar > egg. Two infestation techniques were compared: insertion into fruit of third instars reared in diet and oviposition by adult A. ludens into fruit and development to the third instar. Inserted larvae were statistically more likely to survive fumigation than oviposited larvae. When fruit were held at ambient temperature, 0.23 +/- 0.12% of larvae were still observed to be moving 4 d postfumigation. Temperatures between 21.9 and 27.2 degrees C were positively related to efficacy measured as larvae moving 24 h after fumigation, pupariation, and adult emergence. Coating grapefruit with Pearl Lustr 2-3 h before fumigation did not significantly affect the proportion of third instars moving 24 h after fumigation, pupariating, or emerging as adults. In conclusion, fumigation with 40 g/m3 methyl bromide for 2 h at fruit temperatures >26.7 degrees C is not found to be inefficacious for A. ludens. Although a few larvae may be found moving >24 h postfumigation, they do not pupariate.

  4. Determination of the Host Status of the 'Persian' Lime (Citrus latifolia Tanaka) for Anastrepha ludens (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; López, Gladis; Díaz-Fleischer, Francisco

    2015-02-01

    Field and laboratory no-choice oviposition tests were performed to determine whether the 'Persian' lime (Citrus latifolia Tanaka) is a host of Anastrepha ludens Loew (Diptera: Tephritidae). Trapping and fruit sampling were performed to determine adult population densities and the level of infestation in the two lime orchards. Additionally, unharvested and harvested limes were exposed to sexually mature flies and the number of eggs laid and the immature developmental rates were determined. As a control, parthenocarpic 'Ataulfo' mangoes (Mangifera indica L.), a suitable host for A. ludens, were exposed to similar experimental procedures. The fecundity and fertility of adults obtained from limes and mangoes were compared. Our results demonstrate that A. ludens, under forced infestation conditions, oviposit on limes and also on control fruit. However, differences were detected in unharvested and harvested fruit, as unharvested limes were not infested. In the case of harvested fruit, the numbers of eggs laid and survival rates of immatures were significantly lower for 'Persian' limes compared with mangoes. Egg clutches were larger in limes than in mangoes, and most were deposited in the albedo rather than in the pulp. Moreover, oviposition rates were much higher in limes than in mangoes. Despite the fact that few of the immatures reached adulthood, the females obtained from limes were as fecund and fertile as those obtained from mangoes. Although adult A. ludens flies were captured in the two orchards, fruit sampling showed a complete absence of natural infestation among 'Persian' limes. We discuss the importance of our findings for determining the host status for 'Persian' limes. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Comparison of Hydrolyzed Protein Baits and Various Grape Juice Products as Attractants for Anastrepha Fruit Flies (Diptera: Tephritidae).

    Science.gov (United States)

    Herrera, F; Miranda, E; Gómez, E; Presa-Parra, E; Lasa, R

    2016-02-01

    Mexican fruit flies, Anastrepha ludens (Loew; Diptera: Tephritidae), have traditionally been trapped in citrus orchards in Mexico using protein hydrolysates as bait. Recently, CeraTrap(®), an enzymatic hydrolyzed protein, has emerged as an effective lure for monitoring A. ludens at the orchard level and is currently being used by growers in the region of Veracruz. Several studies have revealed that grape juice is highly attractive to A. ludens, and recent work supports its potential use for regulation purposes. In our study, the attraction of A. ludens to different grape products was evaluated in citrus orchards and in comparison to other Anastrepha species in an area composed of mango and chicozapote orchards. Attraction to grape lures was compared with CeraTrap and the standard protein Captor +borax trap. In general, CeraTrap was more attractive than different commercial grape products in several experiments. Only Jumex, a commercial grape juice, did not differ significantly from CeraTrap in the capture of A. ludens males and females in a citrus crop. However, several drawbacks were detected when using Jumex grape juice: 1) higher tendency to capture males, 2) less selectivity against non-targeted insects, 3) higher capture of beneficial lacewings, and iv) the need to re-bait weekly owing to lower stability. In the area containing mango and chicozapote, CeraTrap was more attractive than Captor + borax for Anastrepha obliqua and Anastrepha serpentina, followed by grape juice products, which were the least attractive for these fruit fly species. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Histopathological changes in third-instar and adult Anastrepha ludens (Diptera: Tephritidae) after in vitro heat treatment.

    Science.gov (United States)

    Caro-Corrales, Lorena; Caro-Corrales, Jose; Valdez-Ortiz, Angel; Lopez-Valenzuela, Jose; Lopez-Moreno, Hector; Coronado-Velazquez, Daniel; Hernandez-Ortiz, Emilio; Rendon-Maldonado, Jose

    2015-01-01

    The Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae), is one of the most harmful pests of mango causing direct damage by oviposition on the fruit pulp. Mango for export is subjected to hydrothermal treatment as a quarantine method for the control of this pest, but exposure to heat for long periods of time reduces considerably the quality and shelf-life of treated fruit. The aim of this work was to study morphological changes of third-instar larvae and adults of A. ludens after in vitro exposure to high temperature at sublethal times. A heating block system was used to expose larvae at 46.1°C for 19.6 and 12.9 min, producing 94.6 and 70% mortality, respectively. Treated larvae were processed for optical microscopy. A fraction of surviving treated larvae was separated into containers with artificial diet to allow development into adults. Adult sexual organs were dissected and processed for transmission electron microscopy analysis. Results showed that 94.6% of the treated larvae died at 46.1°C for 19.6 min and none of the surviving larvae eclosed to adulthood, as they developed as malformed puparia. For the in vitro treatment at 46.1°C during 12.9 min, 70% of the treated larvae died and only 3.75% reached the adult stage, but ultrastructural damage in the male testes and in the female ovaries was observed. Additionally, 11.1% of the adult flies from the in vitro treatment also showed wing malformation and were incapable of flying. The analysis showed that surviving flies were unable to reproduce. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  7. Evaluation of Food Lures for Capture and Monitoring of Anastrepha fraterculus (Diptera: Tephritidae) on Temperate Fruit Trees.

    Science.gov (United States)

    Rosa, J M da; Arioli, C J; Santos, J P Dos; Menezes-Netto, A C; Botton, M

    2017-06-01

    The Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is the main pest of fruit trees grown in temperate climates in the southern region of Brazil. The objective of this work was to evaluate the efficiency of the major commercial food lures used in Brazil for trapping and monitoring of A. fraterculus in plum, pear, and feijoa orchards. The assessed lures were hydrolyzed proteins of animal origin (CeraTrap) and plant origin (BioAnastrepha), torula yeast + borax (Torula), and grape juice. Response variables included the rate of adult capture (flies per trap per day, FTD) and the percentage of females captured. We also evaluated the number of times the weekly capture rate exceeded the traditional threshold of 0.5 FTD for each lure. Traps baited with grape juice, currently used for monitoring A. fraterculus in Southern Brazil, captured fewer adults and a lower percentage of females compared with the other lures. CeraTrap trapped a greater number of A. fraterculus adults and, in some cases, a lower percentage of females compared with the other lures in pears. Traps baited with CeraTrap had greater capture rates (FTD), particularly during the stages of fruit maturation and harvest, and even in years with low population density of A. fraterculus, thus demonstrating greater sensitivity in the detection of this pest. These results show that, in order to detect and monitor the presence of A. fraterculus in plum, feijoa, and pear crops, protein-based lures are superior to grape juice, especially the animal protein CeraTrap. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Pathogenicity of Beauveria bassiana isolated from Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in laboratory conditions.

    Science.gov (United States)

    Imoulan, Abdessamad; Elmeziane, Abdellatif

    2014-03-01

    The Mediterranean fruit fly, Ceratitis capitata Wiedemann (Diptera: Tephritidae), is the major tephritid pest in Morocco. This pest survives in Moroccan forests Argania spinosa and continually invades the nearest agricultural areas. Entomopathogenic fungi are an interesting tool for fruit fly control and hold a useful alternative to conventional insecticides. However, primary selection of effective pathogens should be taken in laboratory condition prior to applying them in the field. Here, we used third late instar larvae of C. capitata to investigate the effectiveness of 15 local Beauveria bassiana isolates. Results showed that all isolates were able to infect the larval stage, producing a large mortality rate in puparia ranging from 65 to 95 % and caused significant reduction in adult emergence. The fungal treatments revealed that the mycosis occurred also in adults escaping infection as pupariating larvae. The percentage of mycosed puparia was highest in strain TAM6.2 (95 %) followed by ERS4.16 (90 %), therefore they were the most virulent. Median lethal concentration (LC₅₀) was studied for five isolates at four concentrations ranging from 10⁵ to 10⁸ conidia ml⁻¹. The results showed that the slopes of regression lines for B. bassiana ERS4.16 (slope = 0.386) and TAM6.2 (slope = 0.41) were the most important and had the lowest LC₅₀ values (2.85 × 10³ and 3.16 × 10³ conidia ml⁻¹ respectively). This investigation suggests that the soil of Argan forests contains pathogenic B. bassiana isolates and highlights for the first time their potential as biological control toward C. capitata larval stage in Morocco.

  9. Mapping Global Potential Risk of Establishment of Rhagoletis pomonella (Diptera: Tephritidae) Using MaxEnt and CLIMEX Niche Models.

    Science.gov (United States)

    Kumar, Sunil; Yee, Wee L; Neven, Lisa G

    2016-10-01

    The apple maggot, Rhagoletis pomonella (Walsh) (Diptera: Tephritidae), is a major quarantine pest of apples (Malus domestica Borkhausen) in the United States. Apple maggot is found only in North America and negatively impacts the apple industry in the western United States by reducing grower access to export markets. To reduce the threat of apple maggot to export countries and to facilitate the movement of commercial apples, an assessment of potential risk of establishment of apple maggot is needed to predict which regions are suitable or unsuitable for the fly. We used a correlative niche model MaxEnt and a mechanistic model CLIMEX to model global potential risk of establishment of apple maggot. The MaxEnt model was developed by integrating apple maggot occurrences with global climatic variables. Apple (a major host of apple maggot) climatic suitability was used as an additional variable to include species interactions in the MaxEnt model. The CLIMEX model was developed using published apple maggot physiological tolerance thresholds. Both the MaxEnt and CLIMEX models correctly predicted the known distribution of apple maggot in North America, met biological expectations when projected to the world, and mostly agreed on climatic suitability worldwide for the fly. Degree-days at 6.7 °C, elevation, precipitation seasonality, and apple climatic suitability were the most important predictors associated with apple maggot distribution in North America. Our results can be used to make science-based international trade decisions by policy makers, and for monitoring apple maggot potential introductions in countries where it currently does not occur. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Effectiveness of spinosad bait sprays (GF-120) in controlling mango-infesting fruit flies (Diptera: Tephritidae) in Benin.

    Science.gov (United States)

    Vayssieres, Jean-François; Sinzogan, Antonio; Korie, Sam; Ouagoussounon, Issa; Thomas-Odjo, Agnès

    2009-04-01

    Effectiveness of GF-120 (Dow Chemical) Fruit Fly Bait containing the insecticide spinosad in controlling mango-infesting fruit flies (Diptera: Tephritidae) was assessed by comparing treated orchards with untreated orchards. Twelve mango, Mangifera indica L., plantations located in six villages (two similar orchards per village: one orchard treated and orchard untreated) scattered in the Borgou department (northern Benin) were monitored weekly with fly traps, and the fruit was sampled twice for larval infestation at the beginning and in the middle of May in both 2006 and 2007. The two main mango fruit fly pests are Ceratitis cosyra (Walker) and Bactrocera invadens Drew, Tsuruta & White, an invasive species that recently spread throughout West Africa. In both the 2006 and 2007 seasons, C. cosyra had the earliest peak of abundance, and the difference between treated and untreated orchards, in terms of mean number of flies trapped per week and per trap, was significant only in 2007. B. invadens populations quickly increased with the onset of the rains, from mid-May onward, with no significant difference between treated and untreated orchards. In 2006 and 2007, the larval infestation by B. invadens was significantly lower in plots treated with GF-120 than in untreated control plots. GF-120 provided an 81% reduction in the number of pupae per kilogram of fruit after weekly applications for 7 wk in 2006 and an 89% reduction after 10 wk of weekly applications in 2007. The possibility of integrating GF120 bait sprays in an integrated pest management package is discussed in relation to market requirements.

  11. Population dynamics of oriental fruit fly Bactrocera dorsalis(Diptera:Tephritidae)in Xishuangbanna,Yunnan Province,China

    Institute of Scientific and Technical Information of China (English)

    YE Hui; LIU Jianhong

    2007-01-01

    Annual monitoring of the population dynamics of the oriental fruit fly Bactrocera dorsalis(Hendel)(Diptera:Tephritidae)in Xishuangbanna,southern Yunnan,was conducted by using methyl eugenol-baited traps in 1997,2000,and 2003,and factors including temperature,rainfall,and host species with respect to the population fluctuation were analyzed systematically.The results showed that the fruit fly was present all year round in Xishuangbanna.Its population remained at a lower level from November to February,and increased from March until it reached a peak in June or July,depending on the rainfall that year.Afterward,the fly population declined remarkably until October.Temperature,rainfall,and host fruits were major factors comprehensively influencing the population fluctuation.The monthly mean temperature was in a range of temperatures suitable for development and reproduction of the fly.But the monthly mean minimum temperature from December to February was lower than the suitable temperature range,which was suggested a possible reason for the lower populations in winter months.Rainfall was another essential factor influencing the population fluctuations.The population was depressed when the monthly rainfall amount was lower than 50 mm,but increased when rainfall ranged from 100 mm to 200 mm.When the monthly rainfall amount was higher than 250 mm,the fruit fly population was reduced remarkably.The heavy rain in July and August explained the decreasing population.Mango,orange,pear,longan,and peach were found to be the main host species of the fly in Xishuangbanna.Among them,mango and longan were most preferred by the fly.Therefore,the planted areas,fruiting period,and production exerted essential effects on the fly population fluctuations,which were regarded as another major factor influencing the fly population in that area.Briefly,temperature,monthly rainfall,and the host species,through the way of their functions,the influence strength,as well as the period that they

  12. Do thermal tolerances and rapid thermal responses contribute to the invasion potential of Bactrocera dorsalis (Diptera: Tephritidae)?

    Science.gov (United States)

    Pieterse, Welma; Terblanche, John S; Addison, Pia

    2017-04-01

    Bactrocera dorsalis (Hendel) (Diptera: Tephritidae) has shown remarkable range expansion over the past 10years and invaded several new continents including Africa. Here we report results of a detailed assessment of acute high and low temperature survival ability and the plasticity thereof, to test the hypothesis that traits of the thermal niche have contributed to the species' invasion ability. We also assess life-stage-related variation of thermal tolerances to determine potential stage-related environmental sensitivity. The temperatures at which c. 20% of the population survived of B. dorsalis were determined to be -6.5°C and 42.7°C, respectively, when using 2h exposures. Further, four life stages of B. dorsalis (egg, 3rd instar larvae, pupae and adults) were exposed to high and low discriminating temperatures to compare their thermal survival rates. The egg stage was found to be the most resistant life stage to both high and low temperatures, since 44±2.3% survived the low and 60±4.2% survived the high discriminating temperature treatments respectively. Finally, the potential for adult hardening responses to mediate tolerance of extremes was also considered using a diverse range of acute conditions (using 2h exposures to 15°C, 10°C and 5°C and 30°C, 35°C, 37°C and 39°C as hardening temperatures, and some treatments with and without recovery periods between hardening and discriminating temperature treatment). These showed that although some significant hardening responses could be detected in certain treatments (e.g. after exposure to 37°C and 39°C), the magnitude of this plasticity was generally low compared to two other wide-spread and more geographically-range-restricted con-familial species, Ceratitis capitata and C. rosa. In other words, Bactrocera dorsalis adults were unable to rapidly heat- or cold-harden to the same extent as the other Ceratitis species examined to date. These results suggest a narrower thermal niche in B. dorsalis compared

  13. PARASITOIDES (HYMENOPTERA DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO SEMIÁRIDO DO ESTADO DO CEARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    ELTON LUCIO ARAUJO

    2015-09-01

    Full Text Available RESUMO As moscas-das-frutas (Diptera: Tephritidae, Anastrepha spp. e Ceratitis capitata(Wiedemann, são importantes pragas da fruticultura no Brasil. Para desenvolver um sistema sustentável de manejo integrado para este grupo de pragas, é fundamental conhecer os parasitoides (Hymenoptera que podem regular as populações destes tefritídeos. Portanto, o objetivo deste estudo foi relatar a diversidade, a distribuição geográfica e as relações tritróficas dos himenópteros parasitoides de moscas-das-frutas, na região do Baixo Jaguaribe, no semiárido do Estado do Ceará, Brasil. Foram realizadas coletas de frutos em sete municípios da região, no período de maio de 2010 amaio de 2013. Os frutos foram levados para o laboratório, onde foram contados, pesados, colocados em bandejas plásticas com vermiculita e fechadas com tecido voile. Após sete dias, a vermiculita foi peneirada para a obtenção dos pupários das moscas-das-frutas que, em seguida, foram contados e acondicionados em placas de Petri, onde permaneceram até a emergência dos adultos (moscas e/ou parasitoides. Quatro espécies de parasitoides foram encontradas: Doryctobracon areolatus(Szépligeti, Opius bellus Gahan, Utetes anastrephae(Viereck (Braconidae e Tetrastichus giffardianusSilvestri (Eulophidae,sendo o mais frequente e com maior distribuição geográfica na região, D. areolatus. Doryctobracon areolatusfoi mais comum em associação com espécies de Anastrepha - A. sororcula Zucchi, A. obliqua (Mcquart e A. zenildae Zucchi, em frutos nativos e com C. capitata em frutos exóticos. Tetrastichus giffardianus foi obtido apenas em associação com C. capitata, em frutos nativos e exóticos. Estas informações podem servir de base para inserção de parasitoides em futuros programas de manejo integrado de moscas-das-frutas, nas condições do Semiárido brasileiro.

  14. Including climate change in pest risk assessment: the peach fruit fly, Bactrocera zonata (Diptera: Tephritidae).

    Science.gov (United States)

    Ni, W L; Li, Z H; Chen, H J; Wan, F H; Qu, W W; Zhang, Z; Kriticos, D J

    2012-04-01

    Bactrocera zonata (Saunders) is one of the most harmful species of Tephritidae. It causes extensive damage in Asia and threatens many countries located along or near the Mediterranean Sea. The climate mapping program, CLIMEX 3.0, and the GIS software, ArcGIS 9.3, were used to model the current and future potential geographical distribution of B. zonata. The model predicts that, under current climatic conditions, B. zonata will be able to establish itself throughout much of the tropics and subtropics, including some parts of the USA, southern China, southeastern Australia and northern New Zealand. Climate change scenarios for the 2070s indicate that the potential distribution of B. zonata will expand poleward into areas which are currently too cold. The main factors limiting the pest's range expansion are cold, hot and dry stress. The model's predictions of the numbers of generations produced annually by B. zonata were consistent with values previously recorded for the pest's occurrence in Egypt. The ROC curve and the AUC (an AUC of 0.912) were obtained to evaluate the performance of the CLIMEX model in this study. The analysis of this information indicated a high degree of accuracy for the CLIMEX model. The significant increases in the potential distribution of B. zonata projected under the climate change scenarios considered in this study suggest that biosecurity authorities should consider the effects of climate change when undertaking pest risk assessments. To prevent the introduction and spread of B. zonata, enhanced quarantine and monitoring measures should be implemented in areas that are projected to be suitable for the establishment of the pest under current and future climatic conditions.

  15. Nutritive value of diets with different carbohydrates for adult Anastrepha obliqua (Macquart (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Tânia Mara de Lima Fontellas

    1999-01-01

    Full Text Available Adult Tephritidae, especially of the genus Anastrepha (Schiner, 1868, have been observed to feed on a wide variety of natural diets. The fruit on which they feed, in general, are rich in sugar content, chiefly glucose, frutose and sucrose, which are also the sugars that those insects utilise better. Neither the behavioural mechanisms, nor the physiological ones, that control food selection by insects, are well known. Because some of those aspects are not known for the species Anastrepha obliqua (Macquart, 1835 either, and in order to understand their biology better, three experiments were conducted. In the first experiment, it was checked whether there was a difference in metabolic profit by those insects, when fed the carbohydrates more frequently found in nature, as resulting in a bigger egg production and higher survival rate at the end of the experiment. In the second, it was checked whether A. obliqua can regulate diet ingestion according to carbohydrate content in dry as well as wet diets. In the third experiment, measurements were made to establish the lowest carbohydrate concentration flies are able to recognise in the diet. Analysis of the data showed that ingestion of carbohydrates which are commonly found in nature, in association with a protein source, is very well utilised by females of A. obliqua. It was also shown that .those insects are not probably able to compensate for the difference in carbohydrate content in dry diets, whereas they do so for wet diets. In relation to discrimination threshold, it seems that it is related to the higher occurrence of the carbohydrate in their normal diet, that is, they can recognise carbohydrates that are common in their natural diet better than the less frequent ones.

  16. Soil moisture and relative humidity effects during post-diapause on emergence of western cherry fruit fly (Diptera: Tephritidae)

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a pest of sweet cherry, Prunus avium (L.) L., in western North America that is found in relatively moist and dry habitats. In this study, fly pupae from Kennewick and Roslyn in Washington state, U.S.A., were used to test the hypotheses tha...

  17. Oviposition in Sweet Cherry by Reproductively Mature Western Cherry Fruit Fly (Tephritidae:Diptera) Fed Spinosad and Neonicotinoid Insecticide Baits

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a major pest of cherry, Prunus avium (L.) L., in the Pacific Northwest of the U.S. Spinosad bait is applied weekly to kill flies before they develop eggs, but its effects on oviposition by flies that are reproductively mature are unknown. ...

  18. Pupal Mortality and Adult Emergence of Western Cherry Fruit Fly (Diptera: Tephritidae) Exposed to the Fungus Muscodor albus (Xylariales: Xylariaceae)

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran, is a major pest of sweet cherry, Prunus avium (L.) L., that is conventionally controlled using insecticides. One alternative to the use of insecticides for fly control could be fumigation of the fly’s overwintering habitat using the fungus Mus...

  19. Differences in body size and egg loads of Rhagoletis indifferens (Diptera: Tephritidae) from introduced and native cherries

    Science.gov (United States)

    The western cherry fruit fly, Rhagoletis indifferens Curran, infests introduced, domesticated sweet [Prunus avium (L.) L.] and tart cherries (Prunus cerasus L.) as well as native bitter cherry, Prunus emarginata (Douglas) Eaton. Bitter cherries are smaller than sweet and tart cherries and this coul...

  20. The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects.

    Science.gov (United States)

    Sarno, Francesca; Ruiz, María F; Eirín-López, José M; Perondini, André L P; Selivon, Denise; Sánchez, Lucas

    2010-05-13

    the ancestral state (which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage (in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

  1. ESPÉCIES DE MOSCA-DAS-FRUTAS (DIPTERA: TEPHRITIDAE E SEUS PARASITÓIDES EM ITUMBIARA-GO SPECIES OF FRUIT FLIES (DIPTERA: TEPHRITIDAE AND THEIR PARASITOIDS IN ITUMBIARA-GO

    Directory of Open Access Journals (Sweden)

    Ândersen Terra de Oliveira

    2007-09-01

    Full Text Available

    A mosca-das-frutas apresenta ampla distribuição geográfica, sendo encontrada praticamente no mundo todo, causando prejuízos às espécies frutíferas de importância econômica. O objetivo deste trabalho foi conhecer a Tephritidae na região de Itumbiara e seus inimigos naturais. As pupas foram coletadas em frutas em estado de apodrecimento. Entre Tephritidae, Anastrepha fraterculus foi a espécie mais abundante. Entre os parasitóides, Doryctobracon areolatus foi a espécie mais comum.

    PALAVRAS-CHAVE: Insecta; Hymenoptera; Tephritidae; parasitóides; mosca-das-frutas.

    The fruit flies show a huge geographic distribution, being found practically all over the word, bringing damages to the fruit trees that have an economic importance. The objective of this work was to know the Tephritidae in Itumbiara region and their natural enemies. The pupaes were collected of fruits decaying. Among the Tephritidae, Anastrepha fraterculus was the most abundant specie. Among the parasitoids, Doryctobracon areolatus was the most common specie.

    KEY-WORDS: Insecta; Hymenoptera; Tephritidae; parasitoids; fruit flies.

  2. Response of female Ceratitis capitata (Diptera: Tephritidae) to a spinosad bait and polymer matrix mixture with extended residual effect in Hawaii.

    Science.gov (United States)

    Piñero, Jaime C; Souder, Steven K; Gomez, Luis E; Mau, Ronald F L; Vargas, Roger I

    2011-12-01

    The effectiveness of foliar applications of protein baits against pestiferous fruit flies (Tephritidae) can be adversely affected by a rapid loss of attractive volatile compounds and by rainfall due to the high water solubility of the baits. In a large coffee, Coffea arabica L., plantation in Hawaii with high and low populations of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), the relative attractiveness of GF-120 NF Naturalyte Fruit Fly Bait as either a 40% (vol:vol) spray solution (= GF-120 NF) or as a formulated proprietary amorphous polymer matrix (= GF-120 APM) was compared. The GF-120 APM formulations contained either, 25, 50, or 75% of GF-120 NF (wt:wt). All baits were tested in association with visually attractive yellow bait stations as a way of standardizing the evaluations. With both high and low C. capitata populations, significantly more females were attracted to the fresh sprayed GF-120 NF than to any of the three fresh GF-120 APM formulations. The attractiveness of GF-120 sprayed decreased significantly after 1 wk, whereas 1-wk-old GF-120 APM formulations were as attractive as similar fresh formulations. GF-120 APM 75% aged for 3 wk outperformed similarly-aged sprayed GF-120 NF with comparatively high C. capitata populations. With low populations, both GF-120 APM 75% and GF-120 APM 50% aged for 2 wk outperformed the similarly aged sprayed GF-120 NF. Combined findings indicate that APM mixed with either 50 or 75% GF-120 applied to bait stations can be attractive to female C. capitata for up to 3 wk longer than the standard sprayed GF-120 NF.

  3. Detection of an apple-infesting popoulation of Rhagoletis pomonella (Walsh) 1867 (Diptera: Tephritidae) in the state of Colorado, USA

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella (Walsh) 1867 (Tephritidae), is an economically important pest of apples (Malus domesica Borkh.) (Rosaceae) throughout much of the United States. The fly is endemic to the eastern U.S., where its primary host plants are several species of native hawthorns (C...

  4. An evaluation of the species status of Bactrocera invadens and the Systematics of the Bactrocera dorsalis (Diptera: Tephritidae) complex

    Science.gov (United States)

    The genus Bactrocera (Tephritidae) contains over 500 species, including many severe pests of fruits and vegetables. While native to tropical and sub-tropical areas of Africa, India, Southeast Asia and Australasia, a number of the pest species, largely members of the Bactrocera dorsalis complex, have...

  5. The effect of irradiation and mass rearing on the anti-predator behaviour of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Rao, D; Aguilar-Argüello, S; Montoya, P; Díaz-Fleischer, F

    2014-04-01

    Fruit flies (Diptera: Tephritidae) are major pests worldwide. The sterile insect technique, where millions of flies are reared, sterilized by irradiation and then released, is one of the most successful and ecologically friendly methods of controlling populations of these pests. The mating behaviour of irradiated and non-irradiated flies has been compared in earlier studies, but there has been little attention paid to the anti-predator behaviour of mass-reared flies, especially with respect to wild flies. Tephritid flies perform a supination display to their jumping spider predators in order to deter attacks. In this study, we evaluated the possibility of using this display to determine the anti-predator capabilities of mass-reared irradiated, non-irradiated flies, and wild flies. We used an arena setup and observed bouts between jumping spiders (Phidippus audax Hentz) and male Mexican fruit flies (Anastrepha ludens Loew). We show that although all flies performed a supination display to their predator, wild flies were more likely to perform a display and were significantly more successful in avoiding attack than mass-reared flies. We suggest that this interaction can be used to develop a rapid realistic method of quality control in evaluating anti-predator abilities of mass-reared fruit flies.

  6. Effects of bait age and prior protein feeding on cumulative time-dependent mortality of Anastrepha ludens (Diptera: Tephritidae) exposed to GF-120 spinosad baits.

    Science.gov (United States)

    Mangan, Robert L

    2009-06-01

    A fruit fly bait to attract and kill adult fruit flies, GF-120, was tested in cages to determine effects of pretreatment diet and bait aging before use on cumulative mortality rates of Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae). Protein-starved and protein-fed, 9-d-old flies both experienced varying overall cumulative mortality at 4, 8, 24, and 48 h. Pretreatment diet had no significant effect on mortality. Overall mortality rates were below 10% for 4 h, 39-43% at 8 h, but mortality in all treatments increased to 89-93% by 24 h, and 99% by 48 h. In a second experiment, GF-120 baits were either freshly prepared or aged for 24 h. Subtreatments consisted of protein-fed and protein-starved flies. The 24-h-aged bait killed significantly more flies at 4 and 8 h than the freshly prepared bait. Protein-starved flies had significantly higher mortality at 4 h and marginally higher mortality at 8 h than protein-fed flies. At 24 and 48 h, there were no significant differences among treatments, and overall morality rose to 99-100% by 48 h. These results may explain differences noted in previous publications in which fruit fly mortality to GF-120 was reported as unusually low as well as reports of bait ineffectiveness for protein-fed flies. The overall impact of any initial repellency of GF-120 seems negligible as judged by overall cumulative mortality at later evaluation times.

  7. A receiver operating characteristic analysis approach for the assessment of the separation of female Mediterranean fruit fly (Diptera: Tephritidae) oviposition distributions.

    Science.gov (United States)

    Alonzo, Todd A; Nakas, Christos T; Papadopoulos, Nikos T; Papachristos, Dimitrios P

    2009-10-01

    Average fecundity rates and survival are the main components of fitness estimates in studies comparing performance of insect populations. Reproduction is inherently age related in most insect species, and age-specific offspring production is very important in determining fitness components. However, comparison of age-specific reproduction rates are not straight forward and most studies limit analyses to comparisons of average fecundity rates and survival as the main components of the performance of insect populations. We develop a receiver operating characteristic (ROC) curve approach to compare lifetime oviposition distributions. We use empirical data of a study of Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) populations, where each fly's lifetime oviposition distribution was recorded for samples studied in natural and artificial oviposition substrates. Currently, there exists no routinely used methodology for the comparison of oviposition distributions and assessment of their separation. ROC analysis is regularly used in two-sample problems in medical biostatistics when the main task is depiction and quantification of the separation of the empirical distributions from which the data arise. Adaptation of such an analysis to our data has shown that age-specific egg-laying distributions can differ, whereas average fecundity rates do not. Therefore, ROC analysis provides a method of gaining insight in the biological process of egg-laying patterns in relatively long-lived insects with many practical and theoretical implications in entomological experimentation.

  8. Combining field phenological observations with distribution data to model the potential distribution of the fruit fly Ceratitis rosa Karsch (Diptera: Tephritidae).

    Science.gov (United States)

    de Villiers, M; Hattingh, V; Kriticos, D J

    2013-02-01

    Despite the potential for phenological and abundance data to improve the reliability of species niche models, they are seldom used. The aim of this study was to combine information on the distribution, relative abundance and seasonal phenology of Natal fruit fly, Ceratitis rosa Karsch (Diptera: Tephritidae), in South Africa to model its potential global distribution. Bucket traps, baited with Biolure, were used to trap C. rosa in different climatic regions of South Africa over a two-year period. A CLIMEX niche model of the potential global distribution of C. rosa was fitted using the collected trapping data and other distribution records from South Africa. Independent distribution records for elsewhere in Africa were reserved for model validation. The CLIMEX model results conformed well to the South African trapping data, including information on relative abundance and seasonal phenology, as well as to the pattern of presence records of the species elsewhere in Africa. The model suggests that under recent historical conditions a large part of South America, Central America, Mexico and southern USA may be climatically suitable for establishment of C. rosa. In Europe, climatically suitable habitat is restricted to coastal regions of the Mediterranean, in Asia, mostly to the southern and south eastern countries, and in Australia mostly to the wetter south and east. The independent cross-validation provided by South African relative abundance and seasonal phenology data, central African distribution data and relevant species specific biological information provides greater confidence in the modelled potential distribution of C. rosa.

  9. Physiological mechanisms of dehydration tolerance contribute to the invasion potential of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) relative to its less widely distributed congeners.

    Science.gov (United States)

    Weldon, Christopher W; Boardman, Leigh; Marlin, Danica; Terblanche, John S

    2016-01-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is a highly invasive species now with an almost cosmopolitan distribution. Two other damaging, polyphagous and closely-related species, the marula fruit fly, Ceratitis cosyra (Walker), and the Natal fly, Ceratitis rosa Karsch, are not established outside of sub-Saharan Africa. In this study, adult water balance traits and nutritional body composition were measured in all three species at different temperatures and levels of relative humidity to determine whether tolerance of water stress may partially explain their distribution. Adult C. capitata exhibited higher desiccation resistance than C. rosa but not C. cosyra. Desiccation resistance of C. capitata was associated with lower rates of water loss under hot and dry conditions, higher dehydration tolerance, and higher lipid reserves that were catabolised during water stress. In comparison with C. capitata, C. cosyra and C. rosa lost water at significantly higher rates under hot, dry conditions, and did not catabolise lipids or other sources of metabolic water during water stress. These results suggest that adult physiological traits permitting higher tolerance of water stress play a role in the success of C. capitata, particularly relative to C. rosa. The distribution of C. cosyra is likely determined by the interaction of temperature with water stress, as well as the availability of suitable hosts for larval development.

  10. Is bigger better? Male body size affects wing-borne courtship signals and mating success in the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae).

    Science.gov (United States)

    Benelli, Giovanni; Donati, Elisa; Romano, Donato; Ragni, Giacomo; Bonsignori, Gabriella; Stefanini, Cesare; Canale, Angelo

    2016-12-01

    Variations in male body size are known to affect inter- and intrasexual selection outcomes in a wide range of animals. In mating systems involving sexual signaling before mating, body size often acts as a key factor affecting signal strength and mate choice. We evaluated the effect of male size on courtship displays and mating success of the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae). Wing vibrations performed during successful and unsuccessful courtships by large and small males were recorded by high-speed videos and analyzed through frame-by-frame analysis. Mating success of large and small males was investigated. The effect of male-male competition on mating success was evaluated. Male body size affected both male courtship signals and mating outcomes. Successful males showed wing-borne signals with high frequencies and short interpulse intervals. Wing vibrations displayed by successful large males during copulation attempt had higher frequencies over smaller males and unsuccessful large males. In no-competition conditions, large males achieved higher mating success with respect to smaller ones. Allowing large and small males to compete for a female, large males achieve more mating success over smaller ones. Mate choice by females may be based on selection of the larger males, able to produce high-frequency wing vibrations. Such traits may be indicative of "good genes," which under sexual selection could means good social-interaction genes, or a good competitive manipulator of conspecifics. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  11. Insecticidal activity of the leaf essential oil of Peperomia borbonensis Miq. (Piperaceae) and its major components against the melon fly Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Dorla, Emmanuelle; Bialecki, Anne; Deuscher, Zoé; Allibert, Agathe; Grondin, Isabelle; Deguine, Jean-Philippe; Laurent, Philippe

    2017-03-08

    The essential oil from leaves of Peperomia borbonensis from Réunion Island was obtained by hydrodistillation and characterized using GC-FID, GC-MS and NMR. The main components were myristicin (39.5%) and elemicin (26.6%). The essential oil (EO) of Peperomia borbonensis and its major compounds (myristicin and elemicin), pure or in a mixture, were evaluated for their insecticidal activity against Bactrocera cucurbitae (Diptera: Tephritidae) using a filter paper impregnated bioassay. The concentrations necessary to kill 50% (LC50 ) and 90% (LC90 ) of the flies in three hours were determined. The LC50 was 0.23 ± 0.009 mg/cm² and the LC90 was 0.34 ± 0.015 mg/cm² for the EO. The median lethal time (LT50 ) was determined to compare the toxicity of EO and the major constituents. The EO was the most potent insecticide (LT50 = 98 ± 2 min), followed by the mixture of myristicin and elemicin (1.4:1) (LT50 = 127± 2 min) indicating that the efficiency of the EO is potentiated by minor compounds and emphasizing one of the major assets of EOs against pure molecules. This article is protected by copyright. All rights reserved.

  12. Effect of cold storage on larval and adult Anastrepha ludens (Diptera: Tephritidae) viability in commercially ripe, artificially infested Persea americana 'Hass'.

    Science.gov (United States)

    Aluja, M; Díaz-Fleischer, F; Arredondo, J; Valle-Mora, J; Rull, J

    2010-12-01

    Commercially ripe 'Hass' avocados, Persea americana Mill, artificially exposed to wild Anastrepha ludens (Loew) (Diptera: Tephritidae) females 24 h after harvest were placed in a cold storage facility to determine the effect of low temperature on larval survival and adult viability. Fruit were left for 3, 6, 9, and 12 d in a cold room at 5 degrees C followed by a 20-25-d period at ambient temperature to allow for larval development and pupation. Hass avocados and grapefruit, Citrus paradisi Macfadyen, maintained at ambient temperature served as controls. Overall, only 0.23% of the Hass avocados and 19.30% of the grapefruit were infested. The number of infested fruit increased with decreasing exposure time to cold. Puparia from cold-treated Hass avocados were significantly smaller than those stemming from cold-treated grapefruit. Hass avocados exposed for 12 d to 5 degrees C yielded no puparia, and those exposed for 6 and 9 d yielded 22 and two puparia, respectively, but no adults. Although Hass avocados exposed to cold temperature for 3 d yielded adults that reached sexual maturity (N = 16), females laid inviable eggs. Grapefruit exposed to cold for 12 d yielded normal-sized puparia (but no adults), whereas those exposed over 9 d yielded females able to lay viable eggs. We conclude that exposing fruit to cold storage after packing and during transport represents an effective risk-mitigating procedure in the highly improbable event that a gravid A. ludens female might lay eggs in a commercially ripe Hass avocado that had been left unprotected in a packinghouse.

  13. Evaluation of SPLAT with spinosad and methyl eugenol or cue-lure for "attract-and-kill" of oriental and melon fruit flies (Diptera: Tephritidae) in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Stark, John D; Hertlein, Mark; Neto, Agenor Mafra; Coler, Reginald; Piñero, Jaime C

    2008-06-01

    Specialized Pheromone and Lure Application Technology (SPLAT) methyl eugenol (ME) and cue-lure (C-L) "attract-and-kill" sprayable formulations containing spinosad were compared with other formulations under Hawaiian weather conditions against oriental fruit fly, Bactrocera dorsalis (Hendel), and melon fly, Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae), respectively. Field tests were conducted with three different dispensers (Min-U-Gel, Acti-Gel, and SPLAT) and two different insecticides (naled and spinosad). SPLAT ME with spinosad was equal in performance to the standard Min-U-Gel ME with naled formulation up to 12 wk. SPLAT C-L with spinosad was equal in performance to the standard Min-U-Gel C-L with naled formulation during weeks 7 to12, but not during weeks 1-6. In subsequent comparative trials, SPLAT ME + spinosad compared favorably with the current standard of Min-U-Gel ME + naled for up to 6 wk, and it was superior from weeks 7 to 12 in two separate tests conducted in a papaya (Carica papaya L.) orchard and a guava (Psidium guajava L.) orchard, respectively. In outdoor paired weathering tests (fresh versus weathered), C-L dispensers (SPLAT + spinosad, SPLAT + naled, and Min-U-Gel + naled) were effective up to 70 d. Weathered ME dispensers with SPLAT + spinosad compared favorably with SPLAT + naled and Min-U-Gel + naled, and they were equal to fresh dispensers for 21-28 d, depending on location. Our current studies indicate that SPLAT ME and SPLAT C-L sprayable attract-and-kill dispensers containing spinosad are a promising substitute for current liquid organophosphate insecticide formulations used for areawide suppression of B. dorsalis and B. cucurbitae in Hawaii.

  14. Pattern of association between endemic Hawaiian fruit flies (Diptera, Tephritidae) and their symbiotic bacteria: Evidence of cospeciation events and proposal of "Candidatus Stammerula trupaneae".

    Science.gov (United States)

    Viale, E; Martinez-Sañudo, I; Brown, J M; Simonato, M; Girolami, V; Squartini, A; Bressan, A; Faccoli, M; Mazzon, L

    2015-09-01

    Several insect lineages have evolved mutualistic association with symbiotic bacteria. This is the case of some species of mealybugs, whiteflies, weevils, tsetse flies, cockroaches, termites, carpenter ants, aphids and fruit flies. Some species of Tephritinae, the most specialized subfamily of fruit flies (Diptera: Tephritidae), harbour co-evolved vertically transmitted, bacterial symbionts in their midgut, known as "Candidatus Stammerula spp.". The 25 described endemic species of Hawaiian tephritids, plus at least three undescribed species, are taxonomically distributed among three genera: the cosmopolitan genus Trupanea (21 described spp.), the endemic genus Phaeogramma (2 spp.) and the Nearctic genus Neotephritis (2 spp.). We examined the presence of symbiotic bacteria in the endemic tephritids of the Hawaiian Islands, which represent a spectacular example of adaptive radiation, and tested the concordant evolution between host and symbiont phylogenies. We detected through PCR assays the presence of specific symbiotic bacteria, designated as "Candidatus Stammerula trupaneae", from 35 individuals of 15 species. The phylogeny of the insect host was reconstructed based on two regions of the mitochondrial DNA (16S rDNA and COI-tRNALeu-COII), while the bacterial 16S rRNA was used for the symbiont analysis. Host and symbiont phylogenies were then compared and evaluated for patterns of cophylogeny and strict cospeciation. Topological congruence between Hawaiian Tephritinae and their symbiotic bacteria phylogenies suggests a limited, but significant degree of host-symbiont cospeciation. We also explored the character reconstruction of three host traits, as island location, host lineage, and host tissue attacked, based on the symbiont phylogenies under the hypothesis of cospeciation. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Trap capture of three economically important fruit fly species (Diptera: Tephritidae): evaluation of a solid formulation containing multiple male lures in a Hawaiian coffee field.

    Science.gov (United States)

    Shelly, Todd; Nishimoto, Jon; Kurashima, Rick

    2012-08-01

    Invasive fruit flies (Diptera: Tephritidae) pose a global threat to agriculture through direct damage to food crops and the accompanying trade restrictions that often result. Early detection is vital to controlling fruit flies, because it increases the probability of limiting the growth and spread of the invasive population and thus may greatly reduce the monetary costs required for eradication or suppression. Male-specific lures are an important component of fruit fly detection, and three such lures are used widely: trimedlure (TML), cue lure (CL), and methyl eugenol (ME), attractive to Mediterranean fruit fly, Ceratitis capitata (Wiedemann); melon fly, Bactrocera cucurbitae (Coquillett); and oriental fruit fly, Bactrocera dorsalis (Hendel), respectively. In California, Florida, and Texas, the two Bactrocera lures are applied to separate species-specific traps as liquids (with a small amount of the insecticide naled added), whereas TML is delivered as a solid plug in another set of traps. Thus, the detection protocol involves considerable handling time as well as potential contact with a pesticide. The purpose of this study was to compare trap capture between liquid male lures and "trilure" wafers that contain TML, ME, raspberry ketone (RK, the hydroxy equivalent of CL), and the toxicant DDVP embedded within a solid matrix. Field studies were conducted in a Hawaiian coffee (Coffea arabica L.) field where the three aforementioned species co-occur, showed that the wafer captured at least as many flies as the liquid baits for all three species. This same result was obtained in comparisons using both fresh and aged (6-wk) baits. Moreover, the wafers performed as well as the single-lure traps in an ancillary experiment in which TML plugs were substituted for liquid TML. Additional experiments demonstrated explicitly that the presence of ME and RK had no effect on captures of C. capitata males and similarly that the presence of TML had no effect on the capture of B

  16. A comparative assessment of the response of three fruit fly species (Diptera: Tephritidae) to a spinosad-based bait: effect of ammonium acetate, female age, and protein hunger.

    Science.gov (United States)

    Piñero, J C; Mau, R F L; Vargas, R I

    2011-08-01

    Ammonia-releasing substances are known to play an important role in fruit fly (Diptera: Tephritidae) attraction to food sources, and this information has been exploited for the development of effective synthetic food-based lures and insecticidal baits. In field studies conducted in Hawaii, we examined the behavioural response of wild female oriental fruit fly (Bactrocera dorsalis (Hendel)), melon fly (B. cucurbitae (Coquillett)), and Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) to spinosad-based GF-120 NF Naturalyte Fruit Fly Bait(©) formulated to contain either 0, 1 or 2% ammonium acetate. Use of visually-attractive yellow bait stations for bait application in the field allowed for proper comparisons among bait formulations. Field cage tests were also conducted to investigate, using a comparative behavioural approach, the effects of female age and protein starvation on the subsequent response of F1 generation B. cucurbitae and B. dorsalis to the same three bait formulations that were evaluated in the field. Our field results indicate a significant positive effect of the presence, regardless of amount, of AA in GF-120 for B. dorsalis and B. cucurbitae. For C. capitata, there was a significant positive linear relationship between the relative amounts of AA in bait and female response. GF-120 with no AA was significantly more attractive to female C. capitata, but not to female B. dorsalis or B. cucurbitae, than the control treatment. Our field cage results indicate that the effects of varying amounts of AA present in GF-120 can be modulated by the physiological stage of the female flies and that the response of female B. cucurbitae to GF-120 was consistently greater than that of B. dorsalis over the various ages and levels of protein starvation regimes evaluated. Results are discussed in light of their applications for effective fruit fly suppression.

  17. ANÁLISE FAUNÍSTICA E FLUTUAÇÃO POPULACIONAL DE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM BELMONTE, BAHIA

    Directory of Open Access Journals (Sweden)

    MÍRIAN DA SILVA SANTOS

    2011-01-01

    Full Text Available This study was carried out in a mixed orchard in the municipality of Belmonte, in the southernmost region of Bahia and it aimed at characterizing the fruit fly (Diptera: Tephritidae population using faunistic analysis and studying its population fluctuation. The study was conducted from August 2007 to August 2009. Fruit fly captures were carried out using McPhail traps baited with protein hydrolisate at 5%. Weekly, the captured insects found in traps were transferred to plastic vials, one vial per trap, filled with 70% ethanol and taken to the laboratory for identification. A total of 9,709 fruit flies was captured, out of which 9,477 specimens were Anastrepha (5,908 females and 3,569 males and 232 specimens were Ceratitis capitata (Wiedemann (201 females and 31 males. Nine species of Anastrepha were recorded: Anastrepha bahiensis (Lima (2.59%, Anastrepha distincta (Greene (2.71%, Anastrepha fraterculus (Wiedemann (59.37%, Anastrepha leptozona (Hendel (0.02%, Anastrepha manihoti (Lima (0.02%, Anastrepha obliqua (Macquart (2.98%, Anastrepha serpentina (Wiedemann (0.07%, Anastrepha sororcula Zucchi (29.14%, Anastrepha zenildae Zucchi (0.22%, and C. capitata (2.88%. Anastrepha fraterculus and A. sororcula were the dominant species and only A. fraterculus was constant on the orchard. The values of the Simpson (0.51 and of Shannon (01.35 indices were intermediate and the modified Hill index was 0.49, indicating a medium diversity. The high est capturevalues of Anastrepha spp. occurred from July to December 2008, with a population peak in September.

  18. Effect of constant temperatures on the biology, life table, and thermal requirements of Aganaspis pelleranoi (Hymenoptera: Figitidae), a parasitoid of Anastrepha fraterculus (Diptera: Tephritidae).

    Science.gov (United States)

    Gonçalves, R S; Nava, D E; Andreazza, F; Lisbôa, H; Nunes, A M; Grützmacher, A D; Valgas, R A; Maia, A H N; Pazianotto, R A A

    2014-04-01

    Aganaspis pelleranoi (Brèthes, 1924) (Hymenoptera: Figitidae) is a koinobiont endoparasitoid of larvae of species of the genus Anastrepha and of Ceratitis capitata. It is a candidate for use as a biological control agent, as under field conditions, it may reach a parasitism rate of 62%. The objective of this study was to determine the effect of different constant temperatures on biological parameters of A. pelleranoi when parasitizing the larva of Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae), as well as to determine its thermal requirements. The study was conducted in environmental chambers at 18, 20, 22, 25, 28, and 30 ± 1°C; 70 ± 10% relative humidity; and a 12-h photophase. Females maintained at 18 and 20°C produced more progeny than females at other temperatures tested. The longevity of males and females was inversely proportional to temperature, ranging from 49.1 to 3.73 d for females and from 32.1 to 3.8 d for males at temperatures of 18-30°C, respectively. The duration of the biological cycle (egg-to-adult) was influenced by temperature, and ranged from 69.1 d at 18°C to 30 d at 25°C. No preimaginal development of A. pelleranoi occurred at 28 and 30°C. The relationship between temperature and the demographic parameters of A. pelleranoi showed a linear effect over the temperature range of 18-25°C. The lower temperature threshold and thermal constant were 11.69°C and 391.70 degree days, respectively.

  19. Implementing a spinosad-based local bait station to control Bactrocera cucurbitae (Diptera: Tephritidae) in high rainfall areas of Reunion Island.

    Science.gov (United States)

    Delpoux, Camille; Deguine, Jean-Philippe

    2015-01-01

    Three species of fruit flies cause serious damage to cucurbit crops on Reunion Island: Bactrocera cucurbitae (Diptera: Tephritidae) (Coquillett 1899), Dacus ciliatus (Loew 1901), and Dacus demmerezi (Bezzi 1917). To control them, a program of agroecological management of cucurbit flies has been implemented based on the application of Synéis-appât, especially spot sprays on corn borders. However, the high rainfall on Reunion Island limits the long-term efficiency of the bait; in addition, this method cannot be used for large chayote trellises, because corn borders cannot be planted around them. The aim of this study was to design a bait station adapted to prevailing conditions on Reunion Island. An 'umbrella trap' tested in Taiwan was used as a reference to compare its efficacy with our local bait station. Experiments were conducted in field cages on B. cucurbitae to test different characteristics of bait stations and to construct one using local materials. Results were validated in the field. The attractiveness of the bait station was related mainly to the color of the external surface, yellow being the most attractive color. The efficacy of the bait station with respect to fly mortality was found to be linked to the accessibility of the bait, and direct application of Synéis-appât on the bait station was found to be the most efficient. In the field, B. cucurbitae were more attracted to the local bait station than to the umbrella trap, while the two other fly species displayed equal attraction to both trap types. Our local bait station is a useful alternative to spot sprays of Synéis-appât and is now included in a local pest management program and is well accepted by farmers.

  20. Mitochondrial Single Nucleotide Polymorphisms in Ceratitis capitata (Diptera: Tephritidae) Can Distinguish Sterile, Released Flies from Wild Flies in Various Regions of the World.

    Science.gov (United States)

    Parubrub, Arlene; Reyes, Ruel; Smallridge, Catherine J; Woods, Bill; Haymer, David

    2015-02-01

    In areas infested with pest species such as the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), many programs rely heavily on the sterile insect technique (SIT) as a form of biological control. However, when SIT treatments are used both for control of established infestations and for occasional outbreaks, for several reasons, programs are often unable to adequately quantify the success of this approach. Chief among these are difficulties associated with reliably and rapidly determining the strain of origin of males recaptured during and after the SIT program. In this study, we describe the use of a DNA-based marker that can be used to rapidly and reliably distinguish males originating from the two sterile strains that are most widely used in SIT rearing facilities from males originating from wild strains of various regions of the world. This method uses polymerase chain reaction amplification of material from individual specimens to directly analyze DNA sequence variants found within a portion of the mitochondrial ND4 subunit 4 (ND4) gene to identify single nucleotide polymorphisms (SNPs) that are diagnostic of different strains. Specifically, the SNPs described here reliably distinguish individual flies originating from the Vienna 7 and Vienna 8 strains used for sterile release from wild flies infesting various areas including Western Australia, Guatemala, and Hawaii. The availability of such markers for determination of the strain of origin of specimens, either from whole specimens or body parts (including their sperm), has great potential to improve the ability to monitor and quantify the success of any sterile release program. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Attraction and mortality of Bactrocera dorsalis (Diptera: Tephritidae) to STATIC Spinosad ME weathered under operational conditions in California and Florida: a reduced-risk male annihilation treatment.

    Science.gov (United States)

    Vargas, Roger I; Souder, Steven K; Hoffman, Kevin; Mercogliano, Juan; Smith, Trevor R; Hammond, Jack; Davis, Bobbie J; Brodie, Matt; Dripps, James E

    2014-08-01

    Studies were conducted in 2013-2014 to quantify attraction, feeding, and mortality of male oriental fruit flies, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), to STATIC Spinosad ME a reduced-risk male annihilation treatment (MAT) formulation consisting of an amorphous polymer matrix in combination with methyl eugenol (ME) and spinosad compared with the standard treatment of Min-U-Gel mixed with ME and naled (Dibrom). Our approach used a behavioral methodology for evaluation of slow-acting reduced-risk insecticides. ME treatments were weathered for 1, 7, 14, 21, and 28 d under operational conditions in California and Florida and shipped to Hawaii for bioassays. In field tests using bucket traps to attract and capture wild males, and in toxicity studies conducted in 1-m(3) cages using released males of controlled ages, STATIC Spinosad ME performed equally as well to the standard formulation of Min-U-Gel ME with naled for material aged up to 28 d in both California and Florida. In laboratory feeding tests in which individual males were exposed for 5 min to the different ME treatments, mortality induced by STATIC Spinosad ME recorded at 24 h did not differ from mortality caused by Min-U-Gel ME with naled at 1, 7, 14, and 21 d in California and was equal to or higher for all weathered time periods in Florida during two trials. Spinosad has low contact toxicity, and when mixed with an attractant and slow release matrix, offers a reduced-risk alternative for eradication of B. dorsalis and related ME attracted species, without many of the potential negative effects to humans and nontargets associated with broad-spectrum contact insecticides such as naled.

  2. Seasonal Abundance of Mango Fruit Flies (Diptera: Tephritidae) and Ecological Implications for Their Management in Mango and Cashew Orchards in Benin (Centre & North).

    Science.gov (United States)

    Vayssières, J-F; De Meyer, M; Ouagoussounon, I; Sinzogan, A; Adandonon, A; Korie, S; Wargui, R; Anato, F; Houngbo, H; Didier, C; De Bon, H; Goergen, G

    2015-10-01

    We report the results of a large-scale (six orchards) and long-term (5-yr) study on seasonal population fluctuations of fruit flies (Diptera Tephritidae) in mango (2005-2009) and cashew (2007-2009) orchards in the Borgou Department, Benin.During the five consecutive years of mango fruit fly monitoring, 25 tephritid species were captured including three species of Bactrocera, 11 of Ceratitis, and 11 of Dacus, which is represented by 2,138,150 specimens in mango orchards. We observed significant differences in Bactrocera dorsalis (Hendel) counts between "high" and "low" mango production years from 2005 to 2008 but not in Ceratitis cosyra (Walker) counts. The native species, C. cosyra, the most abundant species during the dry season, peaked beginning of May, while the exotic species, B. dorsalis, the most abundant species during the rainy season, peaked in June. Preliminary results underlined the role of nine species of wild hosts and seven species of cultivated ones around mango orchards that played an important role in maintaining B. dorsalis in this Sudan zone all year round. The presence of C. cosyra stretched over 9 mo.During the first 14 wk of tephritid monitoring on cashew orchards situated near mango orchards, most flies (62%) were captured in traps positioned in cashew orchards, showing the strong interest of an early fly control on cashew before the mango season. According to these results, in the Sudan zone, effective and compatible control methods as proposed by the IPM package validated by the West African Fruit Fly Initiative project against mango fruit flies are proposed for a large regional tephritid control program in same zones of West Africa.

  3. Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil

    Directory of Open Access Journals (Sweden)

    Tiago Ledesma Taira

    2013-09-01

    Full Text Available Fruit flies (Diptera, Tephritidae and their parasitoids on cultivated and wild hosts in the Cerrado-Pantanal ecotone in Mato Grosso do Sul, Brazil. Information on frugivorous flies in cultivated or wild host plants and their parasitoids in the Cerrado-Pantanal ecotone in Aquidauana, Mato Grosso do Sul is presented and discussed. Fruit fly samples were collected weekly in specific fruit trees, and McPhail® traps were installed in the same trees for a period of two years. The fruit flies infested ripe and unripe fruits of Averrhoa carambola L., Schoepfia sp., Psidium guajava L. and Pouteria torta (Mart. Radlk and mature fruits of Anacardium occidentale L. and Inga laurina (Sw. Willd. Nineteen fruit fly species were obtained with the combination of sampling methods (collecting fruits and trapping, nine of them obtained with both methods, five found only in fruits and five only in traps. This is the first record of Anastrepha striata Schiner in a species of Sapotaceae, as well as for A. castanea Norrbom and A. daciformes Bezzi in Schoepfia sp. (Olacaceae, and for A. distincta Greene in fruits of P. guajava in the state of Mato Grosso do Sul. Fruit collections simultaneously associated with capture of fruit flies by McPhail traps in the same host plants are essential to understand the diversity of fruit flies and their relationship with hosts and parasitoids. Species of Braconidae and Pteromalidae were recovered, where Doryctobracon areolatus (Szépligeti was the most abundant parasitoid in larvae of tephritids infesting both cultivated and wild host fruits.

  4. Landing and Oviposition Responses of Rhagoletis indifferens (Dipt., Tephritidae) on Sweet Cherry Treated with Kaolin- and Limestone-Based Products

    Science.gov (United States)

    Kaolin- and limestone-based products were compared for their effects on landing and oviposition on sweet cherry by Rhagoletis indifferens Curran (Dipt., Tephritidae). Surround (95% calcined kaolin), Cocoon (100% hydrous kaolin), Eclipse (>97% limestone), and Purshade (62.5% limestone) were studied....

  5. Differences in body size and egg loads of Rhagoletis indifferens (Diptera: Tephritidae) from introduced and native cherries.

    Science.gov (United States)

    Yee, Wee L; Goughnour, Robert B; Feder, Jeffrey L

    2011-12-01

    The western cherry fruit fly, Rhagoletis indifferens Curran, infests introduced, domesticated sweet [Prunus avium (L.) L.], and tart cherries (Prunus cerasus L.) as well as native bitter cherry, Prunus emarginata (Douglas) Eaton. Bitter cherries are smaller than sweet and tart cherries and this could affect various life history traits of flies. The objectives of the current study were to determine 1) if body size and egg loads of flies infesting sweet, tart, and bitter cherries differ from one another; and 2) if any observed body size differences are genetically based or caused by the host fruit environment. Pupae and adults of both sexes reared from larval-infested sweet and tart cherries collected in Washington and Montana were larger than those reared from bitter cherries. In addition, flies of both sexes caught on traps in sweet and tart cherry trees were larger than those caught in bitter cherry trees and females trapped from sweet and tart cherry trees had 54.0-98.8% more eggs. The progeny of flies from naturally-infested sweet and bitter cherries reared for one generation in the laboratory on sweet cherry did not differ in size. The same also was true for progeny of sweet and bitter cherry flies reared in the field on bitter cherry. The results suggest that the larger body sizes of flies from sweet and tart cherries than bitter cherries in the field are caused by host fruit and not genetic factors.

  6. 中国海南寡鬃实蝇属一新种(双翅目,实蝇科,寡鬃实蝇亚科)%A NEW SPECIES OF THE GENUS DACUS FABRICIUS (DIPTERA,TEPHRITIDAE, DACINAE) FROM HAINAN, CHINA

    Institute of Scientific and Technical Information of China (English)

    林明光; 汪兴鉴; 曾玲

    2011-01-01

    记述采自中国海南省双翅目Diptera实蝇科Tephritidae寡鬃实蝇属Dacus Fabricius l新种,二点棍腹实蝇Dacus(Callantra) bimaculatus sp.nov.,并提供其形态特征图.模式标本保存于海南出入境检验检疫局热带植物隔离检疫中心标本馆.%A new species of the genus Dacus Fabricius (Diptera,Tephritidae,Dacinae),D.(Calantra) bimaculatus sp.nov.,is described from the Hainan Province of China.The holotype is deposited in the Insect Museum,Center for Tropical Plant Quarantine,Hainan Entry-Exit Inspection and Quarantine Bureau,Haikou,China.

  7. Hospedeiros e parasitóides de Anastrepha spp. (Diptera: Tephritidae em Itaubal do Piririm, Estado do Amapá, Brasil Host and parasitoids of Anastrepha spp. (Diptera: Tephritidae in Itaubal do Piririm, Amapá State, Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo Adaime da Silva

    2007-04-01

    Full Text Available Este trabalho foi realizado no município de Itaubal do Piririm, Estado do Amapá, com o objetivo de registrar a ocorrência de moscas-das-frutas, suas plantas hospedeiras e seus parasitóides. Foram coletadas 51 amostras de frutos, de 10 espécies vegetais, totalizando 69,5kg. Foram obtidos 1.169 pupários, dos quais emergiram 568 tefritídeos e 105 parasitóides. Quatro espécies de Anastrepha foram registradas: A. antunesi Lima, A. distincta Greene, A. obliqua Macquart e A. striata Schiner. Os hospedeiros de moscas-das-frutas foram taperebá (Spondias mombin, goiaba (Psidium guajava e ingá-cipó (Inga edulis, com índices de infestação de 1,3; 0,6 e 10,0 pupários/fruto e de 141,1; 20,7 e 26,5 pupários kg-1 de fruto, respectivamente. Duas espécies de parasitóides da família Braconidae foram obtidas: Doryctobracon areolatus (Szépligeti e Asobara anastrephae (Muesebeck.The occurrence of fruit flies on three host plants and their parasitoids was registered in Itaubal do Piririm, Amapá State, Brazil. Exactly 51 samples of fruits of 10 botanical species were collected and it totaled 69.5 kg. It was possible to obtain 1,169 puparia that emerged 568 Tephritidae and 105 parasitoids. Moreover, four species of Anastrepha were registered: A. antunesi Lima, A. distincta Greene, A. obliqua Macquart and A. striata Schiner. Spondias mombin, Psidium guajava and Inga edulis were the hosts of Tephritidae species, they had indexes of natural infestation of 1.3; 0.6 and 10.0 puparia/fruit and 141.1; 20.7 and 26.5 puparia kg-1 of fruit, respectively. Two species of Braconidae were obtained: Doryctobracon areolatus (Szépligeti and Asobara anastrephae (Muesebeck.

  8. Effects of GF-120 fruit fly bait concentrations on attraction, feeding, mortality, and control of Rhagoletis indifferens (Diptera: Tephritidae).

    Science.gov (United States)

    Yee, Wee L; Chapman, Peter S

    2005-10-01

    Effects of different concentrations of GF-120 NF Naturalyte Fruit Fly Bait on attraction and feeding responses, mortality, and control of the western cherry fruit fly, Rhagoletis indifferens Curran, were determined. In the laboratory, flies that had been exposed to sugar and yeast extract and then deprived of all food for 16-20 h were attracted to 40.0% GF-120, but not to 0.6 and 4.8% GF-120 (vol:vol). Nonstarved flies were not attracted to any concentration. Flies in the field were not attracted to 55.6% GF-120 on cherry leaves, and few flies fed on the bait. In the laboratory, males fed for shorter durations on and ingested lower amounts of 0.6% than 4.8 or 40.0% GF-120, but females fed equally on all concentrations. Spinosad in GF-120 was highly toxic to flies. Lethal concentrations50 (LC50 values) of spinosad for starved flies at 1-4 d were 1.5-0.7 ppm. When gravid flies were exposed to cherries treated with 0.6, 4.8, and 40.0% GF-120, mortality was greater at each higher concentration, but none prevented oviposition. Field spray tests comparing 0.6, 4.8, and 40.0% GF-120 in 225 ml of spray per cherry tree resulted in 79-94% lower larval infestations than in controls, but no differences were seen among the concentrations. Evidence from this study indicates that fresh 40.0% GF-120 was attractive in the laboratory but that flies were not attracted to fresh GF-120 from far distances within trees, suggesting that suppression of populations is caused in large part by flies finding the bait through normal movement over large areas.

  9. Biodiversidade de moscas-das-frutas do gênero Anastrepha (Diptera, Tephritidae no campus da ESALQ-USP, Piracicaba, São Paulo

    Directory of Open Access Journals (Sweden)

    Keiko Uramoto

    2004-01-01

    Full Text Available Este trabalho foi conduzido na área abrangida pelo campus da Escola Superior de Agricultura Luiz de Queiroz da Universidade de São Paulo, no município de Piracicaba, Estado de São Paulo. Teve como objetivos, determinar a composição do gênero Anastrepha Schiner e verificar a associação das espécies de plantas hospedeiras, estabelecidas na área, com as espécies de Anastrepha. Foram examinadas 23.277 fêmeas de Anastrepha coletadas por meio de armadilhas McPhail e 18 espécies pertencentes a nove grupos de espécies foram registradas. Um total de 563 amostras de frutos pertencentes a nove famílias e, pelo menos, 23 espécies de plantas foi coletado em 47 estações de capturas. Foram identificadas 10.243 fêmeas e das 18 espécies de Anastrepha capturadas em armadilhas somente seis emergiram das amostras de frutos: A. bistrigata Bezzi, A. fraterculus (Wied., A. obliqua (Macquart, A. pseudoparallela (Loew, A. serpentina (Wied. e A. sororcula Zucchi. A. fraterculus infestou maior diversidade de frutos. Os hospedeiros preferidos de A. obliqua foram as espécies da família Anacardiaceae. A. pseudoparallela e A. serpentina infestaram exclusivamente Passifloraceae e Sapotaceae, respectivamente. A. fraterculus é registrada pela primeira vez em sapoti (Manilkara zapota L. no Brasil.Biodiversity of fruit flies of the genus Anastrepha (Diptera, Tephritidae at the ESALQ-USP campus, Piracicaba, São Paulo. The aim of this study was to determine the number of species of Anastrepha Schiner at the campus and to verify the association between host plant species and Anastrepha species in this area. A total of 23,277 females of Anastrepha collected in McPhail traps was examined, and 18 species belonging to nine species groups were recorded. A total of 563 fruit samples representing at least 23 plant species from nine families was collected in 47 capture sites. A total of 10,243 females was identified. Of the 18 Anastrepha species captured in traps

  10. Anastrepha ludens and Anastrepha serpentina (Diptera: Tephritidae) do not infest Psidium guajava (Myrtaceae), but Anastrepha obliqua occasionally shares this resource with Anastrepha striata in nature.

    Science.gov (United States)

    Birke, Andrea; Aluja, Martin

    2011-08-01

    This study examined whether economically important fruit fly species Anastrepha ludens (Loew), Anastrepha serpentina (Wiedemann), and Anastrepha obliqua (Macquart) (Diptera: Tephritidae) may opportunistically exploit guavas, Psidium guajava L. (Myrtaceae), growing near preferred natural hosts. We collected 3,459 kg of guavas and 895 kg of other known host species [sour orange, Citrus aurantium L.; grapefruit, Citrus paradisi Macfadyen; mango, Mangifera indica L.; white sapote, Casimiroa edulis La Llave and Lex.; sapote, Pouteria sapota (Jacq.); sapodilla, Manilkara zapota L.; and wild plum, Spondias purpurea L. and Spondias mombin L.] along an altitudinal gradient over a 4-yr period (2006-2009). Plants were growing in sympatry in 23 localities where the guavas are usually infested in the state of Veracruz, M6xico. The guava samples yielded 20,341 Anastrepha spp. pupae in total (overall mean, 5.88 pupae per kg of fruit). Confirming previous reports, Anastrepha fraterculus (Wiedemann) and Anastrepha striata (Schiner) were found heavily infesting guavas in Veracruz. Importantly, although we did not find evidence that A. ludens and A. serpentina are able to attack this valuable commodity, we document for the first time in the agriculturally important state of Veracruz that P. guajava is an alternative natural host plant of A. obliqua. We recovered two fruit in the mango-growing locality of la Vibora, Tlalixcoyan, that harbored larvae of A. striata and A. obliqua. This finding has important practical implications for management of A. obliqua. Over the entire altitudinal gradient, when individual fruit infestation was examined, a dynamic pattern of species dominance was unveiled with guavas growing below 800 m above sea level mainly attacked by A. striata and a progressive replacement with increasing altitude by A. fraterculus. Interestingly, most individual fruit examined (97%) harbored a single species of fruit fly, a finding that may be taken as evidence of

  11. SUSCETIBILIDADE DE GENÓTIPOS DE MACIEIRA A Anastrepha fraterculus (DIPTERA: TEPHRITIDAE EM DIFERENTES CONDIÇÕES DE INFESTAÇÃO

    Directory of Open Access Journals (Sweden)

    JANAÍNA PEREIRA DOS SANTOS

    2015-03-01

    Full Text Available RESUMO O estudo objetivou registrar as injúrias de Anastrepha fraterculus (Diptera: Tephritidae, em dois estádios de desenvolvimento dos frutos das macieiras M-11/00 e ‘Catarina’, submetidos a três condições de infestação a campo, na safra de 2011/2012. O experimento foi conduzido em pomar mantido sob manejo orgânico, na Estação Experimental da Epagri de Caçador-SC. O número médio de moscas foi avaliado semanalmente, com quatro armadilhas do tipo McPhail. Frutos imaturos e maduros da seleção M-11/00 e da cultivar Catarina foram submetidos às condições de infestação artificial, controlada e natural. No início da frutificação, após o raleio, em cada genótipo, 500 frutos foram aleatoriamente ensacados com embalagens de tecido não texturizado (TNT. Os frutos submetidos à infestação artificial foram envoltos, individualmente, por uma gaiola contendo duas fêmeas acasaladas de A. fraterculus, que permaneceram por três dias para oviposição. Na infestação controlada, no mesmo dia da instalação das gaiolas, frutos protegidos tiveram as embalagens retiradas para que ficassem por três dias expostos. Frutos não ensacados foram utilizados para avaliar a infestação natural. Em cada estádio de desenvolvimento, foram registrados os valores dos atributos físico-químicos dos frutos. O número médio de A. fraterculus durante a safra foi de 3,08 moscas/armadilha/ semana. Na seleção M-11/00, em todas as condições de infestação, o número médio de larvas e pupários foi maior em frutos maduros. Na cv. Catarina, estes números não diferiram entre as condições de infestação nem entre os estádios de desenvolvimento. Pupários de A. fraterculus não foram observados em frutos de ‘Catarina’, e nesta cultivar constatou-se maior acidez e menor relação sólidos solúveis/acidez.

  12. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Rempoulakis, Polychronis; Taret, Gustavo; Haq, Ihsan Ul; Wornayporn, Viwat; Ahmad, Sohel; Sto Tomas, Ulysses; Dammalage, Thilakasiri; Gembinsky, Keke; Franz, Gerald; Cáceres, Carlos; Vreysen, Marc J B

    2016-01-01

    The Mediterranean fruit fly Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT) as a component of area-wide integrated pest management (AW-IPM) approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS) that has a white pupae (wp) and temperature sensitive lethal (tsl) mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C). The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2) strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were equally

  13. DEZ ANOS DE PESQUISAS SOBRE MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE NO ESTADO DO AMAPÁ: AVANÇOS OBTIDOS E DESAFIOS FUTUROS.

    Directory of Open Access Journals (Sweden)

    Ezequiel da Glória de Deus

    2013-12-01

    Full Text Available As moscas-das-frutas (Diptera: Tephritidae estão entre as principais pragas da agricultura mundial, sendo motivo de preocupação especialmente para países tropicais em desenvolvimento, os quais têm na fruticultura um importante componente de sua balança comercial. Esta revisão tem por objetivo compilar informações geradas nos últimos 10 anos sobre moscas-das-frutasno estado do Amapá, com ênfase em distribuição, hospedeiros e parasitoides. Além disso, visa indicar as prioridades de pesquisa para os próximos anos.No estado do Amapá, os estudos com moscas-das-frutas e seus inimigos naturais apresentaram, nos últimos anos, significativo crescimento. Atualmente, além Bactrocera carambolae, estão assinaladas para o Estado 34 espécies de Anastrepha. Anastrepha distincta, Anastrepha coronilli, Anastrepha fraterculus e Anastrepha striata são as espécies mais amplamente distribuídas. Estão assinaladas para o estado 37 espécies vegetais hospedeiras (pertencentes a 19 famílias botânicas de moscas-das-frutas. Anastrepha striata é espécie mais polífaga, estando associada a 25 hospedeiros. Nove espécies de parasitoides específicos de moscas-das-frutas estão registrados, sendo Doryctobracon areolatuso mais abundante. Apesar do significativo avanço, novos estudos sobre biologia, genética, ecologia, distribuição e dispersão populacional, bem como fatores reguladores dos níveis populacionais são necessários, com vista a desenvolver estratégias de controle menos onerosas com efeitos não nocivos ao ambiente. Palavras-chave: Anastrepha, Bactrocera carambolae, parasitoides, Amazônia. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v3n3p157-168

  14. Evaluation of Quality Production Parameters and Mating Behavior of Novel Genetic Sexing Strains of the Mediterranean Fruit Fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Polychronis Rempoulakis

    Full Text Available The Mediterranean fruit fly Ceratitis capitata (Wiedemann (Diptera: Tephritidae is one of the most important pest of fruits and vegetables in tropical and subtropical countries. The sterile insect technique (SIT as a component of area-wide integrated pest management (AW-IPM approaches is being used for the successful management of this pest. VIENNA 8 is a genetic sexing strain (GSS that has a white pupae (wp and temperature sensitive lethal (tsl mutation, the latter killing all female embryos when eggs are exposed to high temperatures (34°C. The use of this GSS permits production and the release of only males which has increased the cost effectiveness of the SIT several fold for this pest. An efficient method of identification of recaptured sterile males can further increase the cost effectiveness of the SIT for this pest. Therefore, VIENNA 8-Sergeant2 (Sr2 strain and the transgenic strain VIENNA 8-1260 having visible markers were constructed. All three strains were evaluated for egg production, egg hatch, and egg sterility parameters under semi mass-rearing conditions and mating competitiveness in field cages. VIENNA 8-1260 females produced significantly fewer eggs as compared with the two other strains, which produced similar numbers of eggs. However, egg hatch of all strains was similar. Egg hatch of eggs produced by untreated females that had mated with adult males that had been irradiated with 100 Gy as pupae 2 days before emergence, was different for the three strains, i.e., egg hatch of 0.63%, 0.77%, 0.89% for VIENNA 8, VIENNA 8-1260, and VIENNA 8-Sr2, respectively. Differences in male mating competitiveness of the three strains against wild-type males were gradually reduced with successive generations under semi mass-rearing conditions. However, VIENNA 8 males adapted faster to laboratory conditions as compared with VIENNA 8-Sr2 and VIENNA 8-1260 males with respect to mating competitiveness. VIENNA 8 males of the F10 generation were

  15. KEANEKARAGAMAN DAN KEKERABATAN LALAT BUAH (DIPTERA: TEPHRITIDAE DI KALIMANTAN SELATAN BERDASARKAN KARAKTER MORFOLOGI DAN MOLEKULAR (RAPD-PCR DAN SEKUENSING DNA

    Directory of Open Access Journals (Sweden)

    M Indar Prambudi

    2014-08-01

    Full Text Available Diversity and phylogeny of fruit fly (Diptera: Tephritidae in South Kalimantan based on morphology and molecular (RAPD-PCR and DNA sequencing. Seven species of fruit fly was known by morphological identification. The fruit flies were found from  trapping with methyl eugenol and fruit collecting at all study sites in South Kalimantan. The results showed that as much as 17  plants were infected by fruit fly. Dendrogram based on morphological identification analyzed by using UPGMA with MEGA 4 program consisted in a group consisting of 5 sub-groups. Bactrocera carambolae and Bactrocera papayae of morphology were still a closely related fruit fly at 0.935. Whereas, based on RAPD result analized by UPGMA using 20 character of DNA based, showed that out of seven species consisted 2 groups, 1st group were B. umbrosa,  B. occipitalis and sub-group of B. latifrons. The second group consists of sub-groups B.carambolae, B. papaya, sub-group B. albistrigata and B. cucurbitae. The results of dendrogram from sequencing DNA fruit fly analysis comprised one of group and three sub-groups. The first sub-groups were B. papayae, B. carambolae, B. occipitalis, B.latifrons. The second subgroup were B. cucurbitae and B. umbrosa. While B. albistrigata separate but still one group with another fruit flies. The results of DNA sequencing showed that there were a homology of the seven species of the fruit fly i.e at 83 base pair / bp (C, 101 bp (T, 265 bp (G, 420 bp (A, 432 bp (T, 600 bp (A . The length of the base pair for B. occipitalis, B. cucurbitae, B. albistrigata, B. carambolae, B. papayae, B. latifrons were respectively 615, 898, 570.969, 898 and 615 bp. The results of morphological analysis and RAPD methods showed difference in the distribution of groups and sub-groups. But based on morphologycal and DNA identification seven species of fruit flies found were all same as the genebank.

  16. Research progress on the bacterial and fungal symbionts in fruit flies( Diptera: Tephritidae)%实蝇共生菌研究进展

    Institute of Scientific and Technical Information of China (English)

    柳丽君; 李志红; 戴阳

    2011-01-01

    实蝇类昆虫(双翅目Diptera:实蝇科Tephritidae)是重要的农业害虫,为害农作物茎秆和水果,严重影响农业生产和果蔬贸易,被许多国家列为重要的检疫性有害生物.实蝇共生菌对宿主实蝇的取食、生殖、发育及环境适应能力具有重要作用.目前,已有21个属的共生细菌(Enterobacter、Klebsiellal、Citrobacter、Pseudomonas、Providencia、Erwinia、Acetobacter、Serratia、Proteus、Hafnia、Cedecea、Arthrobacter、Lactobacillus、Micrococcus、Streptococcus、Staphylococcus、Vibrio、Hafnia、Deinococcacea、Bacillus、Wolbachia)以及1个属的共生真菌(Candida)被鉴定.其中,肺炎杆菌Klebsiella pneumoniae、产酸克雷伯氏菌Klebsiella oxytoca、成团泛菌Papa agglomerans、费氏柠檬酸杆菌Citrobter freundii、阴沟肠杆菌Enterobacter cloacae和沃尔巴克氏体Wolbachia普遍存在于实蝇中且备受大家的关注.Wolbachia作为初级共生菌,主要分布于宿主的卵巢和产卵器中;其他次级共生菌则主要分布于宿主的消化道内.共生菌与宿主种群、宿主的地理分布、寄主植物以及宿主入侵能力之间的关系尚未明确.研究实蝇共生菌,对于发现新的实蝇诱饵,提高不育实蝇的环境适应性,以及提出新的实蝇防治技术具有重要意义.本文概述了实蝇共生菌的分布、种类、生物学特性、功能以及相关的研究方法,提出了研究中有待解决的问题,并探讨了下一步的研究热点.

  17. A phylogenetic assessment of the polyphyletic nature and intraspecific color polymorphism in the Bactrocera dorsalis complex (Diptera, Tephritidae).

    Science.gov (United States)

    Leblanc, Luc; San Jose, Michael; Barr, Norman; Rubinoff, Daniel

    2015-01-01

    The Bactrocera dorsalis complex (Tephritidae) comprises 85 species of fruit flies, including five highly destructive polyphagous fruit pests. Despite significant work on a few key pest species within the complex, little has been published on the majority of non-economic species in the complex, other than basic descriptions and illustrations of single specimens regarded as typical representatives. To elucidate the species relationships within the Bactrocera dorsalis complex, we used 159 sequences from one mitochondrial (COI) and two nuclear (elongation factor-1α and period) genes to construct a phylogeny containing 20 described species from within the complex, four additional species that may be new to science, and 26 other species from Bactrocera and its sister genus Dacus. The resulting concatenated phylogeny revealed that most of the species placed in the complex appear to be unrelated, emerging across numerous clades. This suggests that they were placed in the Bactrocera dorsalis complex based on the similarity of convergent characters, which does not appear to be diagnostic. Variations in scutum and abdomen color patterns within each of the non-economic species are presented and demonstrate that distantly-related, cryptic species overlap greatly in traditional morphological color patterns used to separate them in keys. Some of these species may not be distinguishable with confidence by means other than DNA data.

  18. Phenotypic plasticity, trade-offs and gene expression changes accompanying dietary restriction and switches in Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun

    2017-05-16

    In this study, we investigated the effects of dietary restriction (DR) and variable diets on phenotypes and gene expression in oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae around the world. As expected, we found that DR altered the B. dorsalis phenotypes by significantly increasing stress resistance and lifespan, but reduced egg production when compared with the control diet. The results suggested a trade-off between reproduction versus somatic maintenance (stress resistance) and lifespan in B. dorsalis. Diet also had a significant effect on hatchability, and DR could increase the egg hatching success of B. dorsalis. Furthermore, DR up-regulated metabolic pathways involved in energy homeostasis and down-regulated pathways in egg production, which might mediate trade-offs between somatic maintenance and reproduction under DR regimes. The gene expression profiles in response to the acute dietary switches indicated that the digestive and metabolic pathways maybe involved in the adaptability of flies to variable dietary resources. In summary, the research facilitates a better understanding of the molecular mechanisms responsible for the B. dorsalis' phenotypic adjustments to the different qualities of the available diets.

  19. Phenotypes, antioxidant responses, and gene expression changes accompanying a sugar-only diet in Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun

    2017-08-17

    Diet composition (yeast:carbohydrate ratio) is an important determinant of growth, development, and reproduction. Recent studies have shown that decreased yeast intake elicits numerous transcriptomic changes and enhances somatic maintenance and lifespan, which in turn reduces reproduction in various insects. However, our understanding of the responses leading to a decrease in yeast ratio to 0% is limited. In the present study, we investigated the effects of a sugar-only diet (SD) on the gene expression patterns of the oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae. RNA sequencing analyses showed that flies reared on an SD induced significant changes in the expression levels of genes associated with specific metabolic as well as cell growth and death pathways. Moreover, the observed upregulated genes in energy production and downregulated genes associated with reproduction suggested that SD affects somatic maintenance and reproduction in B. dorsalis. As expected, we observed that SD altered B. dorsalis phenotypes by significantly increasing stress (starvation and desiccation) resistance, decreasing reproduction, but did not extend lifespan compared to those that received a normal diet (ND) regime. In addition, administration of an SD resulted in a reduction in antioxidant enzyme activities and an increase in MDA concentrations, thereby suggesting that antioxidants cannot keep up with the increase in oxidative damage induced by SD regime. The application of an SD diet induces changes in phenotypes, antioxidant responses, and gene expressions in B. dorsalis. Previous studies have associated extended lifespan with reduced fecundity. The current study did not observe a prolongation of lifespan in B. dorsalis, which instead incurred oxidative damage. The findings of the present study improve our understanding of the molecular, biochemical, and phenotypic response of B. dorsalis to an SD diet.

  20. Biology and Thermal Requirements of Fopius arisanus (Sonan, 1932) (Hymenoptera: Braconidae) Reared on Ceratitis capitata Eggs (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Groth, M Z; Loeck, A E; Nornberg, S D; Bernardi, D; Nava, D E

    2017-05-04

    Fopius arisanus (Sonan) is a solitary parasitoid of eggs and the first instar larvae of Tephritidae. Due to the occurrence of Ceratitis capitata (Wiedemann) in various regions and under several climatic conditions, this study aimed to evaluate the effect of different temperatures on the embryonic development (egg-adult) and determine thermal requirements and the number of annual generations F. arisanus on eggs of C. capitata. In the laboratory, eggs of C. capitata (24 h) were submitted to parasitism of F. arisanus during 6 h. Later, the eggs were placed in plastic containers (50 mL) (50 eggs/container) on a layer of artificial diet and packed in chambers at temperatures 15, 18, 20, 22, 25, 28, 30, and 32 ± 1°C, RH 70 ± 10%, and a photophase of 12 h. The largest number of offspring, emergence rate, and weight of adults of F. arisanus were observed at 25°C. The highest sex ratios (sr > 0.75) were recorded at 15 and 18°C, being statistically higher than the temperatures 20°C (0.65), 22°C (0.64), 25°C (0.65), 28°C (0.49), and 30°C (0.47). At 32°C, there was no embryonic development of F. arisanus. The egg-adult period was inversely proportional to temperature. Based on the development of the biological cycle (egg-adult), the temperature threshold (T t) was 10.3°C and thermal constant (K) of 488.34 degree-days, being the number of generations/year directly proportional to the temperature increase. The data show the ability of F. arisanus to adapt to different thermal conditions, which is important for biological control programs of C. capitata.

  1. A high-throughput detection method for invasive fruit fly (Diptera: Tephritidae) species based on microfluidic dynamic array.

    Science.gov (United States)

    Jiang, Fan; Fu, Wei; Clarke, Anthony R; Schutze, Mark Kurt; Susanto, Agus; Zhu, Shuifang; Li, Zhihong

    2016-11-01

    Invasive species can be detrimental to a nation's ecology, economy and human health. Rapid and accurate diagnostics are critical to limit the establishment and spread of exotic organisms. The increasing rate of biological invasions relative to the taxonomic expertise available generates a demand for high-throughput, DNA-based diagnostics methods for identification. We designed species-specific qPCR primer and probe combinations for 27 economically important tephritidae species in six genera (Anastrepha, Bactrocera, Carpomya, Ceratitis, Dacus and Rhagoletis) based on 935 COI DNA barcode haplotypes from 181 fruit fly species publically available in BOLD, and then tested the specificity for each primer pair and probe through qPCR of 35 of those species. We then developed a standardization reaction system for detecting the 27 target species based on a microfluidic dynamic array and also applied the method to identify unknown immature samples from port interceptions and field monitoring. This method led to a specific and simultaneous detection for all 27 species in 7.5 h, using only 0.2 μL of reaction system in each reaction chamber. The approach successfully discriminated among species within complexes that had genetic similarities of up to 98.48%, while it also identified all immature samples consistent with the subsequent results of morphological examination of adults which were reared from larvae of cohorts from the same samples. We present an accurate, rapid and high-throughput innovative approach for detecting fruit flies of quarantine concern. This is a new method which has broad potential to be one of international standards for plant quarantine and invasive species detection. © 2016 John Wiley & Sons Ltd.

  2. 桔小实蝇在中国云南省的分布%DISTRIBUTION OF THE ORIENTAL FRUIT FLY (DIPTERA: TEPHRITIDAE) IN YUNNAN PROVINCE

    Institute of Scientific and Technical Information of China (English)

    叶辉

    2001-01-01

    The Oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae), is a serious pest insect for vegetables and fruits in Yunnan Province. The trap experiments located in 12 counties of Yunnan indicated that, the geographical distribution of Oriental fruit fly there could be plotted as three distribution zones. To the south of Guannan, Yuanjiang and Rulin is the annual distribution zone. In this region, the Oriental fruit fly completed 4 - 5 generations per year, and infested the local vegetables and fruits all the year around. To the north of Luku, Dayiao and Qujing is the zone without the insect, where the Oriental fruit fly was not trapped and no fruits infested by the fly were found during the present study. The region between the above two zones was the seasonal distribution zone for the insect. The fruit fly occurred only during May to December in this area, and completed 2 - 3 generations in this period.The peak abundance of the oriental fruit fly took place from June in Jinghong to October in Yiaoan, along the altitude graduates from the south to the north. In elevation, the Oriental fruit fly was trapped at altitude of 500 - 2300 m above sea level, in which high trap catches appeared between 500 - 1 000 m. It is proposed that the variations of the fruit fly distribution in altitude and latitude are principally correlated with local temperatures and host plants.%在云南12个县的诱捕试验表明,桔小实蝇在云南的分布可以划分为3个区域.广南、元江和瑞丽以南的地区为该虫常年发生区.在该区域内,桔小实蝇年发生4-5代,可对瓜果形成周年危害.位于六库、大姚和曲靖以北的地区为该虫的非分布区.本试验未能在该地区诱捕到桔小实蝇或桔小实蝇受害果.位于上述两区域之间的区域为桔小实蝇季节性分布区.桔小实蝇在该地区年发生2-3代,出现于5-11月.桔小实蝇在分布区内不同地区的发生高峰期,由南向北

  3. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets

    Science.gov (United States)

    Background The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family ...

  4. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  5. Variação na infestação de mosca-das-frutas (Diptera: Tephritidae e parasitismo em diferentes fases de frutificação em mirtaceas nativas no Rio Grande do Sul

    Directory of Open Access Journals (Sweden)

    Diogo Ricardo Pereira Rêgo

    2013-07-01

    Abstract. The fruit fly Anastrepha fraterculus (Wiedemann (Diptera: Tephritidae is an important pest of fruit production in Rio Grande do Sul. A. fraterculus presents native and exotic hosts, according to fruiting time. The objective of this study was compare infestation rate, the intensity of infestation of fruit fly and parasitism in four native Myrtaceae. The fruits were stored under ambient conditions until flies or parasitoids emergence. These evaluation were made in fruits collected from the canopy and soil, and between stages of ripening of the canopy. The largest infestation rate of fruit fly occurred in guava (89.5% and the lowest in feijoa (67%. The intensity of infestation per fruit was highest in guava (17.33 and lowest in red strawberry guava (1.62. The highest rate of puparia per gram of fruit was obtained in the feijoa (0.50 and the lowest in guava (0.22. The highest parasitism rate was in feijoa (21.40% and the lowest in yellow strawberry guava (2.81%. A greater occurrence of this pest in guava and feijoa revealing highest attractiveness in these hosts. Feijoa is a repository for native parasitodes species.

  6. An Overview of Pest Species of Bactrocera Fruit Flies (Diptera: Tephritidae and the Integration of Biopesticides with Other Biological Approaches for Their Management with a Focus on the Pacific Region

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2015-04-01

    Full Text Available Fruit flies (Diptera: Tephritidae are among the most economically important pest species in the world, attacking a wide range of fruits and fleshy vegetables throughout tropical and sub-tropical areas. These species are such devastating crop pests that major control and eradication programs have been developed in various parts of the world to combat them. The array of control methods includes insecticide sprays to foliage and soil, bait-sprays, male annihilation techniques, releases of sterilized flies and parasitoids, and cultural controls. During the twenty first century there has been a trend to move away from control with organophosphate insecticides (e.g., malathion, diazinon, and naled and towards reduced risk insecticide treatments. In this article we present an overview of 73 pest species in the genus Bactrocera, examine recent developments of reduced risk technologies for their control and explore Integrated Pest Management (IPM Programs that integrate multiple components to manage these pests in tropical and sub-tropical areas.

  7. Susceptibility of 15 mango (Sapindales: Anacardiaceae) cultivars to the attack by Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) and the role of underdeveloped fruit as pest reservoirs: management implications.

    Science.gov (United States)

    Aluja, M; Arredondo, J; Díaz-Fleischer, F; Birke, A; Rull, J; Niogret, J; Epsky, N

    2014-02-01

    We evaluated the susceptibility of 15 mango cultivars to the attack of Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) (Diptera: Tephritidae), the main tephritid pests of this crop in Mexico. In a field experiment, bagged fruit-bearing branches were exposed to gravid females of both fly species. Infestation rates, developmental time, adult eclosion, and F1 adult longevity, fecundity, and fertility were recorded, ranking cultivars in terms of susceptibility to fly attack and development. We also compared the volatile profile in selected resistant and susceptible cultivars in search of possible correlations. In a second experiment, clutch size for A. ludens was determined in each cultivar. Infestation rates, developmental time, and F1 demographic parameters varied sharply among cultivars and between fly species for bagged fruit. Cultivars 'Vishi,' '74-82,' and 'Brooks' were most susceptible to A. ludens infestation while "Tommy,' 'Sensation,' and 'Ataulfo "niño"' (parthenocarpic fruit) were most susceptible to A. obliqua infestation. 'Edward,' 'Kent,' 'Brooks late,' 'Palmer, and 'Ataulfo' exhibited tolerance to attack of both fly species. Fruit of susceptible and resistant cultivars exhibited unique volatile profiles. Fly development and F1 adult demographic parameters varied significantly among cultivars. A. ludens females laid larger clutches in larger and harder fruit. We highlight the important role of Ataulfo "niño" as pest reservoir if fruit is left unharvested on trees. We discuss the possible use of highly resistant cultivars as trap crops or egg sinks.

  8. Machos Virgens e Acasalados de Ceratitis capitata Wiedemann (Diptera: Tephritidae Apresentam o mesmo Sucesso de Cópula e a mesma Capacidade de Inibição de Recópula das Fêmeas?

    Directory of Open Access Journals (Sweden)

    Luiza Santana

    2014-08-01

    Virgin and Mated Males of Ceratitis capitata Wiedemann (Diptera: Tephritidae Have the Same Mating Success and the Same Ability to Inhibit Female Remating? Abstract. Ceratitis capitata Wiedemann is a polyphagous species that damages fruits and affects their production and consumption. One of the techniques to manage this pest is the Sterile Insect Technique, which consists in releasing sterile males in nature to compete with wild males for mating. The success of this technique is associated with the ability of sterile male in being selected by the female and in preventing female remating with other males. This paper aims to evaluate the influence of male reproductive status in mating success and in female remating inhibition. Tests for evaluating the latency to mate and copula duration were performed to evaluate latency to mate and copula duration based on different male status. In remating inhibition tests, females mated with virgin and mated males, were exposed to other males one day after the first mating so the rate of remating could be evaluated. The results showed that males of different reproductive status had no differences in mating success and in female remating inhibition. The latency to mate and copula duration were similar for both male status as well. Our results suggest that, assuming that the sterile males have the same basic biology of no sterile males, in SIT, after released in nature, mated males can have the same success in mating and female remating inhibition as virgin males.

  9. Age-stage, two-sex life tables of Bactrocera cucurbitae (Coquillett) (Diptera: Tephritidae) with a discussion on the problem of applying female age-specific life tables to insect populations

    Institute of Scientific and Technical Information of China (English)

    Yu-Bing Huang; Hsin Chi

    2012-01-01

    Age-stage,two-sex life tables of the melon fly,Bactrocera cucurbitae ( Coquillett) (Diptera:Tephritidae),reared on cucumber (Cucumis sativus L.),sponge gourd (Luffa cylindrica Roem) and a carrot medium (mashed Daucus carota L.mixed with sucrose and yeast hydrolysate) were constructed under laboratory conditions at 25 ± 1 ℃,65% ± 0.5%relative humidity,and a photoperiod 12 ∶ 12h (L ∶ D).The intrinsic rates of increase of B.cucurbitae were 0.144 6,0.141 2 and 0.068 8 days on cucumber,sponge gourd,and carrot medium,respectively.The highest net reproduction rate was 172 offspring per fly reared on sponge gourd.The mean generation times of B.cucurbitae ranged from 34 days reared on cucumber to 56 days reared on carrot medium.The life history raw data was analyzed using the traditional female age-specific life table and compared to results obtained using the age-stage,two-sex life table.When the age-specific female life table is applied to an age-stage-structured two-sex population,survival and fecundity curves will be improperly manipulated due to an inability to include variation in preadult development time.We discussed different interpretations of the relationship between the net reproductive rate and the intrinsic rate of increase to clarify possible misunderstanding in the literature.

  10. Bioefficacy of Alpinia galanga (Zingiberaceae) rhizome extracts, (E)-p-acetoxycinnamyl alcohol, and (E)-p-coumaryl alcohol ethyl ether against Bactrocera dorsalis (Diptera: Tephritidae) and the impact on detoxification enzyme activities.

    Science.gov (United States)

    Sukhirun, N; Pluempanupat, W; Bullangpoti, V; Koul, O

    2011-10-01

    The application of insecticides to control oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae), is a principal component of the current management of these fruit flies. However, we evaluated four extracts of Alpinia galanga Wild Linn (Zingiberaceae) rhizomes against adult flies and found hexane and ethanol extracts to be most effective (LC50 = 4,866 and 6,337 ppm, respectively, after 24 h). This suggested that both nonpolar and polar compounds could be active in the candidate plant. Accordingly, the hexane extract was further processed to isolate nonpolar active compounds from this plant source. Two compounds, (E)-p-acetoxycinnamyl alcohol and (E)-p-coumaryl alcohol ethyl ether, were identified as active ingredients and found to be more active than total hexane extract (LC50 = 3,654 and 4,044 ppm, respectively, after 24 h). The data suggested that the compounds were not synergistic but may have some additive effect in a mixture. The activity of the hexane extract against detoxification enzymes, carboxylesterase (CE) and glutathione transferase (GST) also was determined in vitro. CE was inhibited by 70%, whereas GST was not significantly inhibited. Insect CEs mediate insecticide resistance via their induction; therefore, inhibition of these enzymes by plant allelochemicals could be a useful alternative approach for the management of the pest in the field.

  11. Construction, implementation and testing of an image identification system using computer vision methods for fruit flies with economic importance (Diptera: Tephritidae).

    Science.gov (United States)

    Wang, Jiang-Ning; Chen, Xiao-Lin; Hou, Xin-Wen; Zhou, Li-Bing; Zhu, Chao-Dong; Ji, Li-Qiang

    2017-07-01

    Many species of Tephritidae are damaging to fruit, which might negatively impact international fruit trade. Automatic or semi-automatic identification of fruit flies are greatly needed for diagnosing causes of damage and quarantine protocols for economically relevant insects. A fruit fly image identification system named AFIS1.0 has been developed using 74 species belonging to six genera, which include the majority of pests in the Tephritidae. The system combines automated image identification and manual verification, balancing operability and accuracy. AFIS1.0 integrates image analysis and expert system into a content-based image retrieval framework. In the the automatic identification module, AFIS1.0 gives candidate identification results. Afterwards users can do manual selection based on comparing unidentified images with a subset of images corresponding to the automatic identification result. The system uses Gabor surface features in automated identification and yielded an overall classification success rate of 87% to the species level by Independent Multi-part Image Automatic Identification Test. The system is useful for users with or without specific expertise on Tephritidae in the task of rapid and effective identification of fruit flies. It makes the application of computer vision technology to fruit fly recognition much closer to production level. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  12. Effect of multiple endogenous biological factors on the response of the tephritids Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to multilure traps baited with BioLure or NuLure in mango orchards.

    Science.gov (United States)

    Arredondo, José; Flores, Salvador; Montoya, Pablo; Díaz-Fleischer, Francisco

    2014-06-01

    The physiological state of an insect is likely the most important endogenous factor influencing resource-oriented behavior, and it varies considerably among individuals. Trials were conducted in mango orchards to study the effect of multiple endogenous biological factors on the response of two fly species, Anastrepha ludens (Loew) and Anastrepha obliqua Maquart (Diptera: Tephritidae), to BioLure and NuLure baits. The biological factors of the two fly species that were tested were the following: 1) fertility status-sterile (irradiated) and fertile flies; 2) two types of diets (only sugar and a 3:1 mixture of sugar and hydrolyzed yeast protein; 3) sex, and 4) two sexual maturity conditions (2-4- and 15-18-d-old flies, representing immature and sexually mature flies, respectively, and 2-4-d-old flies treated with methoprene as an artificially induced sexually state male condition). The laboratory-treated flies were released into three different mango orchards. The trials were conducted in four blocks per orchard using eight traps in each block (50:50 BioLure: NuLure). The traps were replaced every 2 d during the 12-d period and the flies per trap per day values were calculated. More protein-fed, fertile, female, immature, and A. obliqua flies were caught compared with the other flies tested. In addition, the traps baited with NuLure attracted more flies than those baited with BioLure. Interaction analyses indicated that the type of bait and the sexual maturity status were the most important factors affecting the responses of the flies. Our study demonstrated that lures attract only a small segment of the fly population, those that have a specific hunger for amino acids-immature flies-and those that were protein-starved. The implications for improved trapping system designs are discussed.

  13. Sexual communication in Tephritidae-current knowledge and potential applications for integrated pest management

    Science.gov (United States)

    Diptera Tephritidae are an enormous threat to fruit and vegetable production throughout the world, causing both quantitative and qualitative losses. Investigating mating behavioural sequences could help to unravel mate choice dynamics, adding useful information to build behaviour-based control strat...

  14. Aggression in Tephritidae Flies: Where, When, Why? Future Directions for Research in Integrated Pest Management.

    Science.gov (United States)

    Benelli, Giovanni

    2014-12-30

    True fruit flies (Diptera: Tephritidae) include over 4000 species, many of which constitute enormous threats to fruit and vegetable production worldwide. A number of Tephritidae are lekking species, forming aggregations in which males fight to defend a small territory where they court females and mate. Male-male contests also occur in non-lekking species, characterized by resource defense polygyny. Tephritidae females display agonistic behavior to maintain single oviposition sites and reduce larval competition for food. Here, how, where, when and why aggressive interactions occur in Tephritidae flies is reviewed. A number of neglected issues deserving further research are highlighted, with a special focus on diel periodicity of aggression, cues evoking aggressive behavior, the role of previous experience on fighting success and the evolution of behavioral lateralization of aggressive displays. In the final section, future directions to exploit this knowledge in Integrated Pest Management, with particular emphasis on enhancement of Sterile Insect Technique and interspecific competitive displacement in the field are suggested.

  15. Seasonal amounts of nutrients in Western cherry fruit fly (Diptera: Tephritidae) and their relation to nutrient availability on cherry plant surfaces.

    Science.gov (United States)

    Yee, Wee L; Chapman, Peter S

    2008-10-01

    Relatively little is known about the nutritional ecology of fruit flies in the genus Rhagoletis. In this study, nutrient amounts in male and female western cherry fruit fly, Rhagoletis indifferens Curran, and availability of nitrogen and sugar on surfaces of leaves, fruit, and extrafloral nectaries (EFNs) of sweet cherry trees, were determined from late May to late June 2005 and of sugar from EFNs from mid-May to late June 2007 in Washington state. Protein amounts in male and female flies did not differ over the season. Nitrogen was present on leaves, fruit, and EFNs during the sampling period, but amounts on leaves and fruit were lower in late May than the rest of the season. Sugar amounts in flies did not differ over the season. Sugar was present on leaf, fruit, and EFN surfaces all season, but amounts on all three were lower in late May than later in the season. Fructose and glucose were the predominant sugars on all plant surfaces, but sucrose was also present in nectar from EFNs. In outdoor and field cage experiments in 2004 and 2006, more flies survived when cherry branches with leaves and fruit were present than absent. Results suggest that R. indifferens maintains stable protein and sugar levels throughout the season because sufficient amounts of nutrients are found in cherry trees during this time and that increases in nutrient availability caused by ripening and damaged cherries later in the season do not result in increased amounts of nutrients in flies.

  16. There is no magic fruit fly trap: multiple biological factors influence the response of adult Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) individuals to MultiLure traps baited with BioLure or NuLure.

    Science.gov (United States)

    Díaz-Fleischer, Francisco; Arredondo, José; Flores, Salvador; Montoya, Pablo; Aluja, Martín

    2009-02-01

    Field-cage experiments were performed to determine the effectiveness of MultiLure traps (Better World MFG Inc., Fresno, CA) baited with NuLure (Miller Chemical and Fertilizer Corp., Hanover, PA) or BioLure (Suterra LLC, Inc., Bend, OR) in capturing individually marked Mexican fruit fly, Anastrepha ludens (Loew), and West Indian fruit fly, Anastrepha obliqua (Macquart) (Diptera: Tephritidae), of both sexes. Experimental treatments involved wild and laboratory-reared flies of varying ages (2-4 and 15-18 d) and dietary histories (sugar only, open fruit, open fruit plus chicken feces, and hydrolyzed protein mixed with sugar). Data were divided into two parts: total captures over a 24-h period and trap visits/landings, entrances into interior of trap ,and effective captures (i.e., drowning in liquid bait or water) over a 5-h detailed observation period (0600-1100 hours). The response to the two baits varied by fly species, gender, physiological state, age, and strain. Importantly, there were several highly significant interactions among these factors, underlining the complex nature of the response. The two baits differed in attractiveness for A. obliqua but not A. ludens. The effect of strain (wild versus laboratory flies) was significant for A. ludens but not A. obliqua. For effect of dietary history, adults of both species, irrespective of sex, were significantly less responsive to both baits when fed on a mixture of protein and sugar when compared with adults fed the other diets. Finally, we confirmed previous observations indicating that McPhail-type traps are quite inefficient. Considering the total 24-h fly tenure in the cage, and independent of bait treatment and fly type (i.e., strain, adult diet, gender and age), of a total of 2,880 A. obliqua and 2,880 A. ludens adults released into the field cages over the entire study (15 replicates), only 564 (19.6%) and 174 (6%) individuals, respectively, were effectively caught. When only considering the 5-h detailed

  17. Characterizing the developmental transcriptome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae) through comparative genomic analysis with Drosophila melanogaster utilizing modENCODE datasets.

    Science.gov (United States)

    Geib, Scott M; Calla, Bernarda; Hall, Brian; Hou, Shaobin; Manoukis, Nicholas C

    2014-10-28

    The oriental fruit fly, Bactrocera dorsalis, is an important pest of fruit and vegetable crops throughout Asia, and is considered a high risk pest for establishment in the mainland United States. It is a member of the family Tephritidae, which are the most agriculturally important family of flies, and can be considered an out-group to well-studied members of the family Drosophilidae. Despite their importance as pests and their relatedness to Drosophila, little information is present on B. dorsalis transcripts and proteins. The objective of this paper is to comprehensively characterize the transcripts present throughout the life history of B. dorsalis and functionally annotate and analyse these transcripts relative to the presence, expression, and function of orthologous sequences present in Drosophila melanogaster. We present a detailed transcriptome assembly of B. dorsalis from egg through adult stages containing 20,666 transcripts across 10,799 unigene components. Utilizing data available through Flybase and the modENCODE project, we compared expression patterns of these transcripts to putative orthologs in D. melanogaster in terms of timing, abundance, and function. In addition, temporal expression patterns in B. dorsalis were characterized between stages, to establish the constitutive or stage-specific expression patterns of particular transcripts. A fully annotated transcriptome assembly is made available through NCBI, in addition to corresponding expression data. Through characterizing the transcriptome of B. dorsalis through its life history and comparing the transcriptome of B. dorsalis to the model organism D. melanogaster, a database has been developed that can be used as the foundation to functional genomic research in Bactrocera flies and help identify orthologous genes between B. dorsalis and D. melanogaster. This data provides the foundation for future functional genomic research that will focus on improving our understanding of the physiology and

  18. Cytogenetic and symbiont analysis of five members of the B. dorsalis complex (Diptera, Tephritidae): no evidence of chromosomal or symbiont-based speciation events.

    Science.gov (United States)

    Augustinos, Antonios A; Drosopoulou, Elena; Gariou-Papalexiou, Aggeliki; Asimakis, Elias D; Cáceres, Carlos; Tsiamis, George; Bourtzis, Kostas; Penelope Mavragani-Tsipidou; Zacharopoulou, Antigone

    2015-01-01

    The Bactrocera dorsalis species complex, currently comprising about 90 entities has received much attention. During the last decades, considerable effort has been devoted to delimiting the species of the complex. This information is of great importance for agriculture and world trade, since the complex harbours several pest species of major economic importance and other species that could evolve into global threats. Speciation in Diptera is usually accompanied by chromosomal rearrangements, particularly inversions that are assumed to reduce/eliminate gene flow. Other candidates currently receiving much attention regarding their possible involvement in speciation are reproductive symbionts, such as Wolbachia, Spiroplasma, Arsenophonus, Rickettsia and Cardinium. Such symbionts tend to spread quickly through natural populations and can cause a variety of phenotypes that promote pre-mating and/or post-mating isolation and, in addition, can affect the biology, physiology, ecology and evolution of their insect hosts in various ways. Considering all these aspects, we present: (a) a summary of the recently gained knowledge on the cytogenetics of five members of the Bactrocera dorsalis complex, namely Bactrocera dorsalis s.s., Bactrocera invadens, Bactrocera philippinensis, Bactrocera papayae and Bactrocera carambolae, supplemented by additional data from a Bactrocera dorsalis s.s. colony from China, as well as by a cytogenetic comparison between the dorsalis complex and the genetically close species, Bactrocera tryoni, and, (b) a reproductive symbiont screening of 18 different colonized populations of these five taxa. Our analysis did not reveal any chromosomal rearrangements that could differentiate among them. Moreover, screening for reproductive symbionts was negative for all colonies derived from different geographic origins and/or hosts. There are many different factors that can lead to speciation, and our data do not support chromosomal and/or symbiotic

  19. Wing loading and extra loading capacity of adults of the Chinese citrus fruit fly, Bactrocera (Tetradacus) minax ( Diptera: Tephritidae)%柑橘大实蝇成虫的翅载和额外负载能力

    Institute of Scientific and Technical Information of China (English)

    黄秀琴; 李正跃; 李传仁; Gilles BOITEAU; 桂连友

    2012-01-01

    Effective management of the Chinese citrus fruit fly, Bactrocera ( Tetradacus) minax (Enderlein) ( Diptera: Tephritidae) , is hindered by a lack of knowledge about its movements. By measuring the wing loading and extra loading capacity of adults of the Chinese citrus fruit fly, we determined the effect of weight of extra loading electronic tags on the ratio of upward to downward flights of flies, in order to provide technical parameters for making the feasibility of electronic tag for tracking natural movement of B. minax using harmonic radar technology. The wing loading of the Chinese citrus fruit fly was found not to decrease with increasing size over a wide range of individual sizes and independent of sex. The results indicate that an average wing loading of adults of Chinese citrus fruit fly is about 11 mg after normal food uptake alternated with food deprivation (only water is supplied). It is estimated from our results in a large screened cage that 7. 3 mg ( representing about 23% of adult' s weight) extra loading for the technique has no or minimal impact on the number of upward flights of adults of Chinese citrus fruit fly. The results further suggest that when we determine the feasibility of tags for the tracking of natural movement of B. minax using harmonic radar technology, the weight of electronic tags should be no more than 7. 3 mg.%对柑橘大实蝇Bactrocera(Tetradacus)minax (Enderlein)的有效管理受阻于对其成虫运动行为的较少的认识.通过测定其成虫翅载能力和忍受额外负载重量的能力,从而确定其成虫所携带不同的额外负载的电子标签重量对其正常起飞的影响程度,为制作合适的昆虫谐波雷达的电子标签提供技术参数.其雌雄成虫的翅载能力并没有随着成虫个体重量增加而降低,也没有因为性别不同而存在差异.成虫经过正常取食和饥饿(只喂清水)变化处理,其成虫平均净载重量约为11 mg.来自网室成虫忍受额外负载

  20. Caracterização da fauna de moscas-das-frutas (Diptera: Tephritidae na região de Ponta Grossa, Paraná, Brasil Characterization of the fauna of fruit flies (Diptera: Tephritidae in the region of Ponta Grossa, Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Patricia Elizabeth Husch

    2012-10-01

    , Rhagoletis sp. Loew and Hexachaeta sp. Loew. A. A. fraterculus was the only species common to the four orchards, occurring in a frequency higher than 80%. This is the first record of A. montei in the state of Paraná. A. fraterculus, A. sororcula and C. capitata had the highest frequency, abundance, dominance and constancy, and are therefore considered predominant species. The highest diversity index (H'=0.4360 occurred in the orchard 2, differing significantly from all orchards (t test, P<0.05. The Margalef index values were low (close to or below 0.5 confirming that there are predominant species. Regarding the similarity of species between the orchards, that was determined by the coefficient of Jaccard and the Bray-Curtius index, the orchard 4, where occurred only two species (96% of A. fraterculus and 4% of A. pseudoparallela, forms a distinct group from other orchard sampled, where there were four species of Tephritidae.

  1. Wolbachia in Anastrepha fruit flies (Diptera: Tephritidae).

    Science.gov (United States)

    Coscrato, Virginia E; Braz, Antônio S K; P Perondini, André L; Selivon, Denise; Marino, Celso L

    2009-09-01

    Endosymbiotic bacteria of the genus Wolbachia are widespread among arthropods and cause a variety of reproductive abnormalities, such as cytoplasmic incompatibility, thelytokous parthenogenesis, male-killing, and host feminization. In this study, we used three sets of Wolbachia-specific primers (16S rDNA, ftsZ, and wsp) in conjunction with the polymerase chain reaction (PCR), cloning and sequencing to study the infection of fruit flies (Anastrepha spp. and Ceratitis capitata) by Wolbachia. The flies were collected at several localities in Brazil and at Guayaquil, Ecuador. All of the fruit flies studied were infected with Wolbachia supergroup A, in agreement with the high prevalence of this group in South America. Phylogenetic analysis showed that the wsp gene was the most sensitive gene for studying the relationships among Wolbachia strains. The Wolbachia sequences detected in these fruit flies were similar to those such as wMel reported for other fruit flies. These results show that the infection of Anastrepha fruit flies by Wolbachia is much more widespread than previously thought.

  2. Aggression in Tephritidae Flies: Where, When, Why? Future Directions for Research in Integrated Pest Management

    Directory of Open Access Journals (Sweden)

    Giovanni Benelli

    2014-12-01

    Full Text Available True fruit flies (Diptera: Tephritidae include over 4000 species, many of which constitute enormous threats to fruit and vegetable production worldwide. A number of Tephritidae are lekking species, forming aggregations in which males fight to defend a small territory where they court females and mate. Male-male contests also occur in non-lekking species, characterized by resource defense polygyny. Tephritidae females display agonistic behavior to maintain single oviposition sites and reduce larval competition for food. Here, how, where, when and why aggressive interactions occur in Tephritidae flies is reviewed. A number of neglected issues deserving further research are highlighted, with a special focus on diel periodicity of aggression, cues evoking aggressive behavior, the role of previous experience on fighting success and the evolution of behavioral lateralization of aggressive displays. In the final section, future directions to exploit this knowledge in Integrated Pest Management, with particular emphasis on enhancement of Sterile Insect Technique and interspecific competitive displacement in the field are suggested.

  3. Palpada panorama sp. n. (Diptera: Syrphidae), a big-eyed hoverfly from Peru and Suriname.

    Science.gov (United States)

    Reemer, Menno; Morales, Mirian N

    2016-03-15

    The hoverfly species Palpada panorama sp. n. (Diptera: Syrphidae) is described based on specimens from Peru and Suriname. It belongs to the scutellaris species group and it is most similar to P. erratica (Curran, 1930), from which it differs most notably by the strongly enlarged ommatidia in the upper half of the eye. Additional differences between these two species and an adjustment for the latest identification key for the species of the scutellaris group are given.

  4. Evaluating correlative and mechanistic niche models for assessing the risk of pest establishment

    Science.gov (United States)

    Ecological niche modeling was used to assess the risk of establishment of western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), in sweet cherry, Prunus avium (L.) L., in the commercial cherry-growing areas of California. We integrated species occurrence records and spatial...

  5. Behavioral responses, rate of mortality, and oviposition of western cherry fruit fly exposed to Malathion, Zeta-cypermethrin, and Spinetoram

    Science.gov (United States)

    Western cherry fruit fly, Rhagoletis indifferens Curran (Diptera: Tephritidae), is a pest of sweet and tart cherry, Prunus avium L. (L.) and P. cerasus L., respectively, in western North America. This fly is commonly controlled with spinosad bait sprays, but these sprays are ineffective against sp...

  6. Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae) Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member.

    Science.gov (United States)

    Gariou-Papalexiou, Angeliki; Giardini, María Cecilia; Augustinos, Antonios A; Drosopoulou, Elena; Lanzavecchia, Silvia B; Cladera, Jorge L; Caceres, Carlos; Bourtzis, Kostas; Mavragani-Tsipidou, Penelope; Zacharopoulou, Antigone

    2016-01-01

    Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6) pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT) applications.

  7. Cytogenetic Analysis of the South American Fruit Fly Anastrepha fraterculus (Diptera:Tephritidae Species Complex: Construction of Detailed Photographic Polytene Chromosome Maps of the Argentinian Af. sp.1 Member.

    Directory of Open Access Journals (Sweden)

    Angeliki Gariou-Papalexiou

    Full Text Available Genetic and cytogenetic studies constitute a significant basis for understanding the biology of insect pests and the design and the construction of genetic tools for biological control strategies. Anastrepha fraterculus is an important pest of the Tephritidae family. It is distributed from southern Texas through eastern Mexico, Central America and South America causing significant crop damage and economic losses. Currently it is considered as a species complex; until now seven members have been described based on multidisciplinary approaches. Here we report the cytogenetic analysis of an Argentinian population characterized as Af. sp.1 member of the Anastrepha fraterculus species complex. The mitotic karyotype and the first detailed photographic maps of the salivary gland polytene chromosomes are presented. The mitotic metaphase complement consists of six (6 pairs of chromosomes, including one pair of heteromorphic sex chromosomes, with the male being the heterogametic sex. The analysis of the salivary gland polytene complement shows a total number of five long chromosomes that correspond to the five autosomes of the mitotic karyotype and a heterochromatic network corresponding to the sex chromosomes. Comparison of the polytene chromosome maps between this species and Anastrepha ludens shows significant similarity. The polytene maps presented here are suitable for cytogenetic studies that could shed light on the species limits within this species complex and support the development of genetic tools for sterile insect technique (SIT applications.

  8. SISTEMA DE CROMOSSOMOS SEXUAIS MÚLTIPLOS X1X1X2X2/X1X2Y NA MOSCA-DAS-FRUTAS Anastrepha sororcula (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Inês Regina de Araújo Moura Cunha

    2014-08-01

    Full Text Available Sistemas de cromossomos sexuais simples estão difundidos entre os Tephritidae do gênero Anastrepha. Espécies deste gênero apresentam enorme importância pelo impacto que causam em frutíferas cultivadas, sobretudo no nordeste do Brasil. Análises citogenéticas desenvolvidas em Anastrepha sororcula, através da análise da estrutura cariotípica e bandamento C revelaram a presença de um sistema de cromossomos sexuais múltiplos do tipo X1X1X2X2/X1X2Y nesta espécie. Enquanto as fêmeas apresentam um cariótipo homomórfico com 2n=12, os machos possuem 2n=11, onde se destaca um grande cromossomo Y despareado. O nível de divergência cariotípica da espécie A. sororcula do nordeste, com a presença de um sistema de cromossomos sexuais múltiplos, em relação às regiões central e sudeste do Brasil, podem indicar a ocorrência de impedimentos reprodutivos entre os exemplares das duas áreas e que possivelmente, como outros exemplos que existem neste gênero, A. sororcula constitua um complexo de espécies ainda não inteiramente definido. Palavras-chave: Alossomos, peste agrícola, citogenética de insetos, heterocromatina. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v4n2p1-4

  9. A revision of the Anastrepha robusta species group (Diptera: Tephritidae)

    Science.gov (United States)

    The Anastrepha robusta species group is revised to include the following 29 species: A. amaryllis Tigrero (Ecuador), A. amazonensis, n. sp. (Brazil: Amazonas), A. bella, n. sp. (Panamá), A. binodosa Stone (Colombia, Brazil: Amazonas, Pará), A. concava Greene (Costa Rica to Ecuador and Brazil: Amazon...

  10. Managing the pepper maggot (Diptera: Tephritidae) using perimeter trap cropping.

    Science.gov (United States)

    Boucher, T Jude; Ashley, Richard; Durgy, Robert; Sciabarrasi, Michael; Calderwood, William

    2003-04-01

    A perimeter trap crop barrier of hot cherry peppers, border-row insecticide applications, and a combination of the two management strategies were evaluated to see if they could protect a centrally located main crop of bell peppers from oviposition and infestation by the pepper maggot, Zonosemata electa (Say). In large plots, the main cash crop of bell peppers was protected from the majority of the oviposition and infestation by all three barriers. The combination sprayed/trap crop barrier provided the best protection against both oviposition and infestation and resulted in over 98% pest-free fruit at harvest. Maggots infested only 1.7% of the main crop fruit when protected by a sprayed or unsprayed trap crop barrier, compared with 15.4% in control plots. The perimeter sprayed/trap crop strategy was employed in three commercial fields in 2000 and 2001. The combination barrier resulted in superior insect control and reduced insecticide use at all commercial locations, compared with the same farms' past history or to farms using conventional and integrated pest management (IPM) methods. Economic analysis showed that the technique is more cost effective and profitable than relying on whole-field insecticide applications to control the pepper maggot. Farmer users were surveyed and found the perimeter trap crop technique simple to use, with many hard-to-measure benefits associated with worker protection issues, marketing, personnel/management relations, pest control and the environment. Use of the perimeter trap crop technique as part of an IPM or organic program can help improve crop quality and overall farm profitability, while reducing pesticide use and the possibility of secondary pest outbreaks.

  11. Caribbean Fruit Fly (Diptera: Tephritidae) and Small Fruit in Florida

    Science.gov (United States)

    Tephritid fruit flies are among the most important pests of fruits and vegetables worldwide. The Caribbean fruit fly, Anastrepha suspensa (Loew), is a tephritid pest that became established in Florida following introduction in 1965. Populations of this fruit fly also occur in Puerto Rico and Cuba, ...

  12. A transgenic embryonic sexing system for Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Schetelig, Marc F; Handler, Alfred M

    2012-10-01

    The Sterile Insect Technique (SIT) is a highly successful biologically-based strategy to control pest insect populations that relies on the large-scale release of sterilized males to render females in the field non-reproductive. For medfly, a mutant-based sexing system is available as well as a transgenic system where a tetracycline-suppressible (Tet-off) toxic molecule is female-specifically produced. However, the former classical genetic system took many years to refine, and the latter system results in female death by a poorly understood mechanism, primarily in the pupal stage after rearing costs have been incurred. Here we describe a Tet-off transgenic embryonic sexing system (TESS) for Anastrepha suspensa that uses a driver construct having the promoter from the embryo-specific A. suspensa serendipity α gene, linked to the Tet-transactivator. This was used to drive the expression of a phospho-mutated variant of the pro-apoptotic cell death gene, Alhid, from Anastrepha ludens. The system uses a sex-specific intron splicing cassette linked to a cell death gene lethal effector. Progeny from TESS strains heterozygous for the transgene combination were 80-100% males, whereas four double homozygous TESS strains had 100% male-only progeny, with female death limited primarily to embryogenesis. In a large-scale test, more than 30,000 eggs from two strains resulted in 100% male-only progeny. The transgenic sexing approach described here is highly effective and cost-efficient by eliminating most, if not all, female insects early in embryogenesis using a well-characterized apoptotic mechanism. Published by Elsevier Ltd.

  13. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  14. Patterns of inner chorion structure in Anastrepha (Diptera: Tephritidae) eggs.

    Science.gov (United States)

    Figueiredo, Julia V A; Perondini, André L P; Selivon, Denise

    2017-03-01

    The inner chorion structure of Anastrepha eggs from 16 species of various infrageneric taxonomic groups is described by scanning and transmission electron microscopy. The layers of the chorion, the outer egg membrane, are structurally similar. Furthermore, an additional trabecular layer (ATL) that exists in some species, together with other characteristics, facilitates the recognition of four patterns of chorion structuring: Pattern I, in which the ATL layer is absent, is found in Anastrepha amita, the Anastrepha fraterculus complex, Anastrepha obliqua, Anastrepha sororcula, Anastrepha suspensa and Anastrepha zenildae (fraterculus group), and Anastrepha bistrigata and Anastrepha striata (striata group); Pattern II in Anastrepha serpentina (serpentina group), Anastrepha grandis (grandis group) and Anastrepha pseudoparallela (pseudoparallela group), in which the ATL presents large open spaces with pillars; Pattern III, found in Anastrepha consobrina (pseudoparallela group), in which the ATL is composed of round cavities; and Pattern IV, found in Anastrepha alveata and Anastrepha pickeli (spatulata group), where the large ATL cavities are reticulated. Comparatively, the chorion structure in Anastrepha eggs is more complex than in eggs of other fruit flies, e.g., Bactrocera, Rhagoletis and Ceratitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Mating compatibility between Bactrocera invadens and Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Bo, W; Ahmad, S; Dammalage, T; Tomas, U Sto; Wornoayporn, V; Ul Haq, I; Cáceres, C; Vreysen, M J B; Schutze, M K

    2014-04-01

    The invasive fruit fly, Bactrocera invadens Drew, Tsuruta & White, is a highly polyphagous fruit pest that occurs predominantly in Africa yet has its origins in the Indian subcontinent. It is extremely morphologically and genetically similar to the Oriental fruit fly, Bactrocera dorsalis (Hendel); as such the specific relationship between these two species is unresolved. We assessed prezygotic compatibility between B. dorsalis and B. invadens using standardized field cage mating tests, which have proven effectiveness in tephritid cryptic species studies. These tests were followed by an assessment of postzygotic compatibility by examining egg viability, larval and pupal survival, and sex ratios of offspring produced from parental and subsequent F1 crosses to examine for hybrid breakdown as predicted under a two-species hypothesis. B. dorsalis was sourced from two countries (Pakistan and China), and each population was compared with B. invadens from its type locality of Kenya. B. invadens mated randomly with B. dorsalis from both localities, and there were generally high levels of hybrid viability and survival resulting from parental and F1 crosses. Furthermore, all but one hybrid cross resulted in equal sex ratios, with the single deviation in favor of males and contrary to expectations under Haldane's rule. These data support the hypothesis that B. dorsalis and B. invadens represent the same biological species, an outcome that poses significant implications for pest management and international trade for sub-Saharan Africa.

  16. Biodiversity and Bionomics for Fruit Flies ( Diptera: Tephritidae ) in ...

    African Journals Online (AJOL)

    ... for formulating an ecologically based Integrated Pest Management (IPM). ... sites and neighboring areas representing the three agro-ecological zones of Morogoro ... Two key fruit fly pests were determined based on abundance, host range and ... An IPM program based on the ecology of the key pests B. invadens and C.

  17. The fruit flies (Tephritidae) of Ontario

    Science.gov (United States)

    Thirteen species of Tephritidae are newly recorded from Ontario, and alternative format keys are provided to the 31 genera and 72 species of fruit fly now known from, or likely to occur, in the province. Standard dichotomous keys to genera, and simplified field keys to genera and species are provide...

  18. Neotropical Copestylum Macquart (Diptera: Syrphidae) Breeding in Fruits and Flowers, Including 7 New Species

    Science.gov (United States)

    Ricarte, Antonio; Marcos-García, M. Ángeles; Hancock, E. Geoffrey; Rotheray, Graham E.

    2015-01-01

    Ten species of Copestylum (Diptera: Syrphidae) were reared from fruits and flowers in Costa Rica, Ecuador and Trinidad. Seven were new and in this paper, we describe them, their development sites and the third stage larva and/or the puparium of all ten species. One new synonym is proposed, Copestylum pinkusi (Curran) [= Copestylum cinctiventre (Curran)]. Similarities and differences between these new and other Copestylum species, suggest they separate into two groups, referred to as the Vagum and Cinctiventre species groups. Features characterising these groups for both adult and early stages are assessed. Each species was also distinguished using adult and early stage characters. Within the Vagum group, adults were more disparate morphologically than the larval stage; this was reversed in the Cinctiventre group. Adult colour patterns are probably cryptic in function and for disguise. Vagum species have disruptive marks, while the Cinctiventre species have reflective colours. Biologically, the groups are almost distinguished by larval development sites. Vagum species use predominantly fruits and have a larval stage that is relatively generalised in form and habit. Cinctiventre species are confined to developing in flowers and the larva is more specialised. A key to both adult and early stages of all ten species is provided. PMID:26580811

  19. Neotropical Copestylum Macquart (Diptera: Syrphidae Breeding in Fruits and Flowers, Including 7 New Species.

    Directory of Open Access Journals (Sweden)

    Antonio Ricarte

    Full Text Available Ten species of Copestylum (Diptera: Syrphidae were reared from fruits and flowers in Costa Rica, Ecuador and Trinidad. Seven were new and in this paper, we describe them, their development sites and the third stage larva and/or the puparium of all ten species. One new synonym is proposed, Copestylum pinkusi (Curran [= Copestylum cinctiventre (Curran]. Similarities and differences between these new and other Copestylum species, suggest they separate into two groups, referred to as the Vagum and Cinctiventre species groups. Features characterising these groups for both adult and early stages are assessed. Each species was also distinguished using adult and early stage characters. Within the Vagum group, adults were more disparate morphologically than the larval stage; this was reversed in the Cinctiventre group. Adult colour patterns are probably cryptic in function and for disguise. Vagum species have disruptive marks, while the Cinctiventre species have reflective colours. Biologically, the groups are almost distinguished by larval development sites. Vagum species use predominantly fruits and have a larval stage that is relatively generalised in form and habit. Cinctiventre species are confined to developing in flowers and the larva is more specialised. A key to both adult and early stages of all ten species is provided.

  20. Aqueous Grape Juice Bait for Anastrepha suspensa (Loew), (Diptera: Tephritidae) and Zaprionus indianus Gupta (Diptera: Drosophilidae)

    Science.gov (United States)

    Field tests were conducted in Miami, Florida to evaluate attraction of Anastrepha suspensa (Loew), and Zaprionus indianus Gupta, to traps baited with aqueous grape juice solution (10%) with and without preservative. Microbial activity, which occurred in baits without preservative that were aged in t...

  1. Grape Juice as a Bait for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae).

    Science.gov (United States)

    Epsky, Nancy D; Gill, Micah A; Mangan, Robert L

    2015-08-01

    In field tests conducted in south Florida to test grape juice as a bait for the Caribbean fruit fly, Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps with aqueous grape juice. These experiments included comparisons of grape juice bait with established A. suspensa protein-based baits (ammonium acetate + putrescine lures, or torula yeast) or wine, a bait found previously to be attractive to Z. indianus. Effects of different preservatives (polypropylene glycol, polyethylene glycol, proxel, or sodium tetraborate) and bait age were also tested. Traps with grape juice baits captured more A. suspensa than unbaited traps, but more were captured in traps with grape juice plus preservative baits and the highest numbers were captured in traps containing the established protein-based baits. In contrast, grape juice baits without preservative that were prepared on the day of deployment (0 d) or that were aged for 3-4 d in the laboratory captured the highest numbers of Z. indianus, while solutions that were aged in the laboratory for 6 or 9 d captured fewer. Although these studies found that aqueous grape juice is a poor bait for A. suspensa, we found that actively fermenting aqueous grape juice may be an effective bait for Z. indianus. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  2. Grape Juice as an Attractant for Anastrepha suspensa (Diptera: Tephritidae) and Zaprionus indianus (Diptera: Drosophilidae)

    Science.gov (United States)

    In field tests conducted in south Florida to test grape juice as an alternative inexpensive bait for Anastrepha suspensa Loew, high numbers of Zaprionus indianus Gupta were captured in traps baited with aqueous grape juice. These experiments included comparisons of grape juice with standard A. susp...

  3. Cuticular hydrocarbons corroborate the distinction between lowland and highland Natal fruit fly (Tephritidae, Ceratitis rosa) populations

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ekesi, Sunday; Meyer, Marc De

    2015-01-01

    Abstract The cuticular hydrocarbons (CHs) and morphology of two Ceratitis rosa Karsch (Diptera: Tephritidae) populations, putatively belonging to two cryptic taxa, were analysed. The chemical profiles were characterised by two-dimensional gas chromatography with mass spectrometric detection. CHs of Ceratitis rosa that originated from the lowlands and highlands of Kenya comprised of n-alkanes, monomethylalkanes, dimethylalkanes and unsaturated hydrocarbons in the range of the carbon backbone from C14 to C37. Hydrocarbons containing C29, C31, C33 and C35 carbon atoms predominated in these two populations. 2-Methyltriacontane was the predominant compound in both populations. Quantitative differences in the distribution of hydrocarbons of different chain lengths, mainly the C22, C32, C33 and C34 compounds of these two populations, were observed despite indistinct qualitative differences in these hydrocarbons. Morphological analyses of male legs confirmed that the flies belong to different morphotypes of Ceratitis rosa previously labelled as R1 and R2 for lowland and highland populations, respectively. A statistical analysis of the CH compositions of the putative R1 and R2 species showed distinct interspecific identities, with several CHs specific for each of the lowland and highland populations. This study supports a hypothesis that the taxon Ceratitis rosa consists of at least two biological species. PMID:26798275

  4. СКЛЕРИТЫ И МУСКУЛАТУРА ГЕНИТАЛИЙ САМЦОВ ВЫСШИХ TEPHRITOIDEA (DIPTERA: TEPHRITIDAE, OTITIDAE, ULIDIIDAE И PLATYSTOMATIDAE)

    OpenAIRE

    ГАЛИНСКАЯ ТАТЬЯНА ВЛАДИМИРОВНА; ОВЧИННИКОВА ОЛЬГА ГЕОРГИЕВНА

    2015-01-01

    В статье рассматривается мускулатура гениталий мух надсемейства Tephritoidea, мускулатура генителай самцов была ранее изучена только у двух видов Tephritidae, у одного вида Platystomatidae, у одного вида Pallopteridae, и у трех видов Ulidiidae. Рассматриваются различные точки зрения на гомологию некоторых склеритов гениталий самцов Tephritoidea; изучение мускулатуры генитального аппарата....

  5. Registro de Peckia (Squamatodes trivittata (Curran (Diptera, Sarcophagidae parasitada por Gnathopleura semirufa (Brullé (Hymenoptera, Braconidae, Alysiinae no cerrado de Brasília, DF Record of Peckia (Squamatodes trivittata (Curran (Diptera, Sarcophagidae parasited by Gnathopleura semirufa (Brullé (Hymenoptera, Braconidae, Alysiinae in the cerrado of Brasília, DF

    Directory of Open Access Journals (Sweden)

    Rodrigo Meneses de Barros

    2006-09-01

    Full Text Available Em Julho de 2004, foram observados adultos de G. semirufa atacando larvas de Peckia Robineau-Desvoidy, 1830 enquanto estas se alimentavam de carcaça de porco Sus scrofa em área de cerrado. Em Dezembro do mesmo ano, no mesmo local, larvas de terceiro instar de P. trivittata foram coletadas em outra carcaça de porco e levadas ao laboratório. As larvas foram criadas em condições naturais. Das 31 pupas obtidas, emergiram 19 adultos de G. semirufa e seis adultos de P. trivittata, correspondendo a uma prevalência de 61% de parasitismo.In July 2004, adults of G. semirufa were observed attacking maggots of Peckia Robineau-Desvoidy, 1830 while feeding on a Sus scrofa carcass in a cerrado area. In December of the same year, in the same location, third instar maggots of P. trivittata were collected from another pig carcass and taken to laboratory. They were reared in natural conditions. 19 adults of G. semirufa and six adults of P. trivittata emerged from the 31 pupae we had obtained previously, corresponding to 61% of parasitic prevalence.

  6. Ectoparasites of bats (Chiroptera, Furipteridae, with a description of a new species of Synthesiostrebla Townsend (Diptera, Streblidae from Brazil

    Directory of Open Access Journals (Sweden)

    Gustavo Graciolli

    2011-12-01

    Full Text Available Ectoparasites of bats (Chiroptera, Furipteridae, with a description of a new species of Synthesiostrebla Townsend (Diptera, Streblidae from Brazil. Records of ectoparasites from furipterid bats are restricted to bat flies (Streblidae. Only three streblid species were known before this work: Trichobius pallidus (Curran, 1934, Strebla wiedemanni Kolenati, 1856, and Synthesiostrebla amorphochili Townsend, 1913. A second species of Synthesiostrebla is described here, increasing the geographical distribution of the genus to east of the Andes. Synthesiostrebla cisandina sp. nov. was found on Furipterus horrens (Cuvier, 1828 in southeastern Brazil. Anterior parts of the body, wing, tergite 7, epiproct and male genitalia are illustrated, and a key to females for species of Synthesiostrebla is provided.

  7. Effects of acoustic waves on pupas of Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae); Efeitos das ondas acusticas em pupas de Ceratitis capitata. (Wied., 1824) (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Barros, Adilson Camilo de

    2007-07-01

    The aim of this research has been to investigate the hypothesis that acoustic waves would provoke a measurable effect on a population of fruit flies, a treatment denominated sonication. Ionizing radiation, the causative agent for the treatment designated by irradiation has been used as a reference, as long as its effects on living beings and particularly on insects are widely known. This research also enquiries into the possible effects of acoustic waves and gamma rays. The experiments of sonication were carried out in the Laboratory of Entomology of the Instituto Biologico de Sao Paulo. The experiments of radiation were carried out in the Centro de Tecnologia das Radiacoes - IPEN, located within the campus of the University of Sao Paulo. It has been employed a Gamma cell source model 220 with average activity of 757.069 {+-} 293.484 curies (Ci) and an average doses rate of 3.106 {+-} 0.245 kilo grays per hour (kGy/h). Levels applied to the sonication treatment, in hertz and kilo Hertz were: 0 Hz (control) ; 5.0 Hz; 10.0 Hz; 20.0 Hz; 40.0 Hz; 60.0 Hz; 80.0 Hz; 1.0 k Hz; 2.0 k Hz; 10.0 k Hz; 15.0 k Hz e 20.0 k Hz. Irradiation doses applied in Grays were: 5.0 Gy; 7.5 Gy; 10.0 Gy; 12.5 Gy; 15 Gy; 50 Gy; 100 Gy; 150 Gy and 200 Gy. It has been used an acoustic tube made of glass - 40.6 cm in length and 9.1 cm in diameter - and sinusoidal waves originated from three acoustic sources, with response in decibels, which sound intensity varied from 93.60 {+-} 1.51 dB to 123.96 {+-} 0.23 dB. Final results have pointed to evidences that would justify the rejection of null hypothesis H{sub 0}, to which the average of the treatments due to acoustic waves do not differ significantly from each other.(author)

  8. Performance of Anastrepha obliqua (Diptera, Tephritidae larvae fed on artificial diets Desempenho das larvas de Anastrepha obliqua (Diptera, Tephritidae alimentadas com dietas artificiais

    Directory of Open Access Journals (Sweden)

    Tânia M. L. Fontellas-Brandalha

    2010-06-01

    Full Text Available Moscas das frutas do gênero Anastrepha Schiner, 1868 são conhecidas por sua importância econômica devido aos danos que elas causam nos frutos comerciais. As exigências nutricionais dos estágios imaturo e adulto são diferentes e as larvas não se desenvolvem bem utilizando a mesma dieta do adulto. Embora as necessidades nutricionais básicas dos insetos sejam bem conhecidas, existe ainda o problema de elaborar dietas de criação adequadas para espécies com necessidades específicas. O objetivo deste trabalho foi verificar o efeito de diferentes tipos e quantidades de carboidratos na dieta sobre a performance larval de Anastrepha obliqua (Macquart, 1835. Larvas foram criadas individualmente em tubos de ensaio contendo uma das dietas artificiais a serem testadas onde elas foram mantidas até a pupação. A composição básica das dietas testadas incluia 2,5 g de agar, 3,25 g de levedo de cerveja e quantidades variadas de sacarose e farinha de trigo. A adequação do meio artificial para A. obliqua foi testada pela avaliação da sobrevivência larval e pupal (% e o tempo de desenvolvimento larval, pupal e de larva-adulto. A dieta contendo farinha de trigo (2 g e sacarose (2 g e a dieta somente com sacarose (5,5 g foram as que apresentaram melhor performance larval. Todas as dietas testadas apresentaram resultados similares ou superiores às dietas utilizadas em outros trabalhos. A importância da presença da farinha de trigo e seu valor nutricional para as larvas são discutidos.Fruit flies of the genus Anastrepha Schiner, 1868 are well-known for having economical importance since they damage commercially cultivated fruits. Nutritional demands during the immature and adult stages are different, so the larvae do not develop well using the same diet as the adults. Although the insect basic nutritional needs are well-known, there is also the challenge to elaborate rearing diets adequate to species with specific needs. The aim of this study was to determine the effect on the Anastrepha obliqua (Macquart, 1835 larvae performance of different kinds and amounts of carbohydrates in the diet. Larvae were individually reared until pupation in test tubes containing one of the artificial diets to be tested. The basic composition of the diets to be tested included 2.5 g agar, 3.25 g brewer's yeast and several different amounts of flour and sucrose. The suitability of the artificial diet for A. obliqua was tested evaluating the larvae and pupae survival (% and the larvae, pupae and larvae-adults periods of development. The diet containing flour (2 g and sucrose (2 g and the diet containing only sucrose (5.5 g have shown the best results regarding larval performance. All tested diets presented similar or superior results as compared to diets used in other studies. The importance of flour and its nutritional value for the larvae was discussed.

  9. Comportamento sexual de Anastrepha sororcula Zucchi (Diptera, Tephritidae em laboratório Sexual behavior of Anastrepha sororcula Zucchi (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Michelli C. N. Facholi-Bendassolli

    2006-09-01

    Full Text Available Anastrepha sororcula Zucchi, 1979, é uma das espécies de mosca-das-frutas mais disseminadas no País, sendo considerada a praga-chave que causa os maiores danos à produção de goiaba (Psidium guajava L., 1758 no Brasil. Em vista da importância desta espécie no complexo de pragas naturais da fruticultura brasileira e, em face à escassez de dados sobre sua biologia e comportamento, este trabalho teve por objetivo obter informações sobre a idade de maturação sexual de A. sororcula em laboratório e descrever seu comportamento reprodutivo. Os machos atingiram a maturidade sexual entre 7 e 18 dias após a emergência, com a maioria dos indivíduos tornando-se sexualmente maduros entre 10 e 13 dias de idade. Exibiram comportamento de sinalização às fêmeas, caracterizado pela distensão da região pleural do abdome, formando uma pequena bolsa de cada lado e, eversão de uma diminuta bolsa membranosa de cutícula retal que circunda a área anal. Durante este processo, os machos realizaram rápidos movimentos de vibração das asas, produzindo sinais audíveis. Uma gotícula foi liberada da região anal durante os movimentos de vibração alar. Após a atração das fêmeas, os machos realizaram uma série de movimentos elaborados de cortejo. As fêmeas alcançaram a maturação sexual entre 14 e 24 dias da emergência, com a maioria tornando-se sexualmente madura aos 19 dias de idade. A exibição diária das atividades sexuais foi confinada quase que exclusivamente ao período das 16:00-17:30h. A. sororcula apresentou um acentuado padrão de protandria.Anastrepha sororcula Zucchi, 1979, is a fruit fly species that can be considered a key pest to the production of guava (Psidium guajava L., 1758, fruit tree which has a wide distribution in Brazil. In view of the importance of this species as a natural pest of Brazilian horticulture and, considering the lack of data about its biology and behavior, the aim of this paper is to obtain information about the age of sexual maturation of A. sororcula in the laboratory and to describe its reproductive behavior. The males reached sexual maturity between 7 and 18 days after emergence, with most of the individuals becoming sexually mature between 10 and 13 days of age. They exhibited signalling behavior to the females, characterized by the distension of the pleural area of the abdomen, forming a small pouch on each side, and by the protrusion of a tiny membranous pouch of rectal cuticle that surrounds the anal area. During this display, the males produced rapid movements of vibration of the wings, producing audible sounds. A droplet was liberated from the anal area during the vibration movements of the wings. After attracting the females, the males accomplished a series of elaborated movements of courtship behavior. The females reached sexual maturation between 14 and 24 days after emergence, with the majority becoming sexually mature at 19 days. The daily exhibition of sexual activities was confined almost exclusively to the period of 16:00-17:30h. A. sororcula presented a sharp protandry pattern.

  10. Controle químico de Anastrepha fraterculus (Wied. (Diptera: Tephritidae em laboratório Chemical control of Anastrepha fraterculus (Wied. (Diptera: Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Priscila Lang Scoz

    2004-12-01

    Full Text Available O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina, éter piretróide (etofemprox, neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan e naturalyte (spinosad foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas, visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.The South American Fruit Fly, Anastrepha fraterculus is one of the most important pest of temperate fruit crops. The effect of four new inseticide groups to replace organophosphate compounds for A. fraterculus control was evaluated under laboratory conditions (25 ± 3ºC, relative humity of 70 ± 10% and 12:12 L:D. Emamectin benzoate, etofenprox, imidacloprid, spinosad, thiacloprid and thiamethoxan were evaluated to control adults by contact and ingestion and against eggs/larvae inside apple fruits compared with fenthion and thrichlorphon. Emamectin benzoate was not efficient to control adults of A. fraterculus by contact and ingestion. Etofenprox, imidacloprid, spinosad and thiamethoxan were efficient to control adults by contact and ingestion being more toxic by ingestion. No new insecticide controlled eggs/larvae inside apple fruit while organophosphate compounds caused 100% of mortality of immature stages and adults. The new insecticides showed more potential to substitute organophosphate compounds in bait sprays for adult control.

  11. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and B. zonata (Diptera: Tephritidae) by comparison...existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Phytosanitary cold treatments are attempted for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) by comparison with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were...

  12. Development of phytosanitary cold treatments for oranges infested with Bactrocera invadens and Bactrocera zonata (Diptera: Tephritidae) by comparison with existing cold treatment schedules for Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Hallman, Guy J; Myers, Scott W; El-Wakkad, Mokhtar F; Tadrous, Meshil D; Jessup, Andrew J

    2013-08-01

    Phytosanitary cold treatments were tested for Bactrocera invadens Drew, Tsuruta, and White and Bactrocera zonata (Saunders) using comparisons with Ceratitis capitata (Wiedemann). Oranges were infested by puncturing holes in the peel and allowing tephritids to oviposit in the holes. The treatments were initiated when the larvae reached late third instar because previous research had shown that stage to be the most cold tolerant for all three species. Results show that B. invadens is not more cold tolerant than C. capitata and B. zonata at 1.0 +/- 0.1 degrees C and lend support to the use of C. capitata cold treatment schedules for B. invadens. It cannot be concluded that B. zonata is not more cold tolerant than C. capitata.

  13. Streblidae (Diptera: Hippoboscoidea) from Yucatan and Updated Species List for Mexico.

    Science.gov (United States)

    Cuxim-Koyoc, Alan; Reyes-Novelo, Enrique; Morales-Malacara, Juan B; Bolívar-Cimé, Beatriz; Laborde, Javier

    2015-09-01

    This study describes the diversity of ectoparasitic bat flies (Diptera: Streblidae) in the state of Yucatan, Mexico. Fieldwork was carried out from June 2010 to January 2012 in seven municipalities of Yucatan, where 13 sampling sites were selected to capture bats using mist nets. Over 156 sampling nights a total of 910 bats were captured; these belonged to 19 species in four families: Mormoopidae, Phyllostomidae, Natalidae, and Vespertilionidae. Phyllostomidae was the richest family (13 bat species), followed by Mormoopidae (3 spp.), Vespertilionidae (2 spp.), and Natalidae (1 spp.). After careful inspection of the bats, a total of 2,134 Streblid bat flies were collected, belonging to 17 species in six genera (Nycterophilia coxata Ferris, N. natali Wenzel, Trichobius diphyllae Wenzel, T. dugesii Townsend, T. galei Wenzel, T. hirsutulus Bequaert, T. intermedius Peterson and Hurka, T. parasiticus Gervais, T. uniformis Curran, T. yunkeri Wenzel, Megistopoda aranea Coquillett, M. proxima Séguy, Aspidoptera delatorrei Wenzel, Strebla alvarezi Wenzel, S. diphyllae Wenzel, S. wiedemanni Kolenati, and Metelasmus pseudopterus Coquillett). The richest and most diverse genus was Trichobius. Five species--N. natali, T. diphyllae, M. proxima, A. delatorrei, and M. pseudopterus, are new records for Yucatan, and T. galei is a new record for the country, increasing the total number of Streblidae species for Mexico to 49.

  14. 实蝇科昆虫交配行为的研究进展%Review of reproductive behavior in the family Tephritidae

    Institute of Scientific and Technical Information of China (English)

    周鹏; 杨洪; 金道超

    2015-01-01

    实蝇科隶属双翅目,寄主范围广,其中250 余种实蝇具有经济意义,很多种类具有入侵性,是一类危害严重的农业害虫.本文综述了实蝇科昆虫的求偶场(lek)行为、交配行为、性选择、多重交配、精子竞争,交配行为对引诱剂和SIT应用的影响等,并对研究中存在的问题和进一步研究的方向进行了讨论.%The insect family Tephritidae, belonging to the order Diptera, has a wide host plant range. More than 250 species are economically important. Many species are invasive. This paper reviews the advances in the research on the insects' lek behavior, mating behavior, sexual selection, multiple mating and sperm com-petition. It also investigates the impact of cure lure on the mating behavior and the influence of the mating be-havior on the effectiveness of Sterile Insect Technique (SIT) . The paper also discusses the existing problems and the directions for future research.

  15. Nonhost status of mangosteen to Bactrocera dorsalis and Bactrocera carambolae (Diptera:Tephritidae) in Thailand

    Science.gov (United States)

    Postharvest quarantine treatments (irradiation or vapor heat) are used to control fruit flies and other pests in mangosteen (Garcinia mangostana L) exported to the United States and Japan from Thailand. No-choice tests were conducted in the laboratory to determine whether Thai mangosteen is a host f...

  16. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia

    Science.gov (United States)

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), ...

  17. Population Dynamics of Anastrepha ludens (Loew) (Diptera: Tephritidae) on Citrus Areas in Southern Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, V; Barrientos-Lozano, L; Pérez-Castañeda, R; Gaona-García, G; Lara-Villalon, M

    2015-12-01

    An analysis of adult population fluctuation of Anastrepha ludens (Loew) was performed in southern Tamaulipas, Mexico from 2008 to 2011. The aim was to analyze population dynamics of A. ludens and its relationships with climatic factors in the citrus region of Llera, Tamaulipas, Mexico. Population densities were weekly examined to identify variation through the year and study period. Four periods were identified according to population size, amplitude, host availability and season of the year. The correlation between population density vs. rainfall and temperature (average, minimum and maximum) was determined by linear and multiple regression analyses. Simple linear regression analysis showed that population density with minimum temperature and rainfall was the most consistent correlation, whereas in multiple regression analysis, rainfall and maximum temperature showed more consistency. A seasonal association between the availability of commercial host, climatic variation, and population peaks of A. ludens was determined. This study may have practical implications for the design of specific control strategies, monitoring, and infestation prevention based on different phases of the pest through the year. This strategy, along with the area-wide approach implemented by the Plant Protection Service may lead to an optimization of material, financial and human resources.

  18. Host susceptibility of citrus cultivars to Queensland fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Lloyd, A C; Hamacek, E L; Smith, D; Kopittke, R A; Gu, H

    2013-04-01

    Citrus crops are considered to be relatively poor hosts for Queensland fruit fly, Bactrocera tryoni (Froggatt), as for other tephritid species. Australian citrus growers and crop consultants have reported observable differences in susceptibility of different citrus cultivars under commercial growing conditions. In this study we conducted laboratory tests and field surveys to determine susceptibility to B. tryoni of six citrus cultivars [(Eureka lemon (Citrus limon (L.) Osbeck); Navel and Valencia oranges (C. sinensis (L.) Osbeck); and Imperial, Ellendale, and Murcott mandarins (C. reticulata Blanco). The host susceptibility of these citrus cultivars was quantified by a Host Susceptibility Index, which is defined as the number of adult flies produced per gram of fruit infested at a calculated rate of one egg per gram of fruit. The HSI was ranked as Murcott (0.083) > Imperial (0.052) > Navel (0.026) - Ellendale (0.020) > Valencia (0.008) > Eureka (yellow) (0.002) > Eureka (green) (0). Results of the laboratory study were in agreement with the level of field infestation in the four citrus cultivars (Eureka lemon, Imperial, Ellendale, and Murcott mandarins) that were surveyed from commercial orchards under baiting treatments against fruit flies in the Central Burnett district of Queensland. Field surveys of citrus hosts from the habitats not subject to fruit fly management showed that the numbers of fruit flies produced per gram of fruit were much lower, compared with the more susceptible noncitrus hosts, such as guava (Psidium guajava L.), cherry guava (P. littorale Raddi), mulberry (Morus nigra L.), loquat (Eriobotrya japonica (Thunb.) Lindl.), and pear (Pyrus communis L.). Therefore, the major citrus crops commercially cultivated in Australia have a relatively low susceptibility to B. tryoni, with Eureka lemons being a particularly poor host for this tephritid fruit fly.

  19. A new species and new records of Cryptodacus (Diptera: Tephritidae) from Colombia, Bolivia and Peru.

    Science.gov (United States)

    Rodriguez, Pedro Alexander; Rodriguez, Erick J; Norrbom, Allen L; Arévalo, Emilio

    2016-05-16

    Cryptodacus bernardoi Rodriguez & Rodriguez, new species, is described from Colombia. It was reared from fruits of Phoradendron sp. near piperoides (Kunth) Trel. New distribution records are reported for Cryptodacus ornatus Norrbom from Colombia and Peru, for Cryptodacus trinotatus Norrbom & Korytkowski from Colombia, and for Cryptodacus obliquus Hendel from Bolivia and Peru. The female abdomen and terminalia of C. obliquus is described for the first time. The Norrbom & Korytkowski (2008)`s key to species was modified to include C. bernardoi n. sp.

  20. Chilled packing systems for fruit flies (Diptera: Tephritidae) in the sterile insect technique

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, Emilio; Escobar, Arseny; Bravo, Bigail; Montoya, Pablo [Instituto Interamericano de Cooperacion para la Agricultura (IICA), Chiapas (Mexico); Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacion (SAGARPA), Mexico, D.F. (Mexico). Programa Moscafrut

    2010-07-15

    We evaluated three packing systems (PARC boxes, 'GT' screen towers and 'MX' screen towers) for the emergence and sexual maturation of sterile fruit flies, at three adult fl y densities (1, 1.2 and 1.3 fly/cm 2) and three food types. At the lowest density, results showed no significant differences in the longevity and flight ability of adult Anastrepha ludens (Loew) and Anastrepha obliqua Macquart among the three packing systems. Higher densities resulted in a decrease in these parameters. In the evaluation of the three food types, no significant differences were found either on longevity or flight ability of A. ludens. However, the greatest longevity for both sexes A. obliqua was obtained with commercial powdered Mb and the mix of sugar, protein and corn starch on paper (SPCP) food types. The highest value for flight ability in A. obliqua males was obtained with powdered Mb and SPCP food types, and for females with Mb powdered food. Our data indicated that GT and MX screen tower packing systems are an alternative to the PARC boxes, since they were suitable for adult fl y sexual maturation without any harm to their longevity or flight ability. The tested foods were equivalent in both fruit fl y species, with the exception of the agar type for A. obliqua, which yielded the lowest biological parameters evaluated. Our results contribute to the application of new methods for the packing and release of sterile flies in large-scale programs. (author)

  1. Effect of Low-Temperature Phosphine Fumigation on the Survival of Bactrocera correcta (Diptera: Tephritidae).

    Science.gov (United States)

    Liu, Tao; Li, Li; Zhang, Fanhua; Gong, Shaorun; Li, Tianxiu; Zhan, Guoping; Wang, Yuejin

    2015-08-01

    This laboratory-based study examined the effects of low-temperature phosphine fumigation on the survival of the eggs and larvae of the guava fruit fly, Bactrocera correcta (Bezzi). Individual flies at different developmental stages, from 6-h-old eggs to third instars, were exposed to 0.92 mg/liter phosphine for 1-7 d at 5°C. We found that 12-h-old eggs and third instars were the most tolerant to phosphine. Increasing phosphine concentrations from 0.46 to 4.56 mg/liter increased mortality in these two stages. However, increased exposure times were required to achieve equal mortality rates in 12-h-old eggs and third instars when phosphine concentrations were ≥4.56 and ≥3.65 mg/liter, respectively. C(n)t = k expression was obtained at 50, 90, and 99% mortality levels, and the toxicity index (n) ranged from 0.43 to 0.77 for the two stages. The synergistic effects of a controlled atmosphere (CA) with elevated CO(2) levels were also investigated, and we found that a CO(2) concentration between 10% and 15% under CA conditions was optimal for low-temperature phosphine fumigation.

  2. Bacterial communities associated with invasive populations of Bactrocera dorsalis (Diptera: Tephritidae) in China.

    Science.gov (United States)

    Liu, L J; Martinez-Sañudo, I; Mazzon, L; Prabhakar, C S; Girolami, V; Deng, Y L; Dai, Y; Li, Z H

    2016-12-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) is a destructive insect pest of a wide range of fruits and vegetables. This pest is an invasive species and is currently distributed in some provinces of China. To recover the symbiotic bacteria of B. dorsalis from different invasion regions in China, we researched the bacterial diversity of this fruit fly among one laboratory colony (Guangdong, China) and 15 wild populations (14 sites in China and one site in Thailand) using DNA-based approaches. The construction of 16S rRNA gene libraries allowed the identification of 24 operational taxonomic units of associated bacteria at the 3% distance level, and these were affiliated with 3 phyla, 5 families, and 13 genera. The higher bacterial diversity was recovered in wild populations compared with the laboratory colony and in samples from early term invasion regions compared with samples from late term invasion regions. Moreover, Klebsiella pneumoniae and Providencia sp. were two of the most frequently recovered bacteria, present in flies collected from three different regions in China where B. dorsalis is invasive. This study for the first time provides a systemic investigation of the symbiotic bacteria of B. dorsalis from different invasion regions in China.

  3. Status of Bactrocera invadens (Diptera: Tephritidae) in Mango-Producing Areas of Arba Minch, Southwestern Ethiopia

    Science.gov (United States)

    Massebo, Fekadu; Tefera, Zenebe

    2015-01-01

    Bactrocera invadens, the Asian fruit fly, was first reported in Kenya in 2003, and it spread fast to most tropical countries in Africa. To our knowledge, there is no detailed data on the fruit damage and status of fruit flies in Arba Minch and elsewhere in Ethiopia. Hence, information on the species composition and pest status of the fruit fly species is urgent to plan management strategies in the area. Fruit flies were captured using male parapheromone-baited traps. Matured mango (Mangifera indica) fruits were collected from randomly selected mango trees and incubated individually in cages (15 by 15 by 15 cm) with sandy soil. B. invadens was the predominant (96%; 952 of 992) captured species and the only fruit fly species emerging from mango fruits incubated in the laboratory. The mean number of adult B. invadens emerging per mango fruit was 35.25, indicating that the species is the most devastating mango fruit fly in the area. The loss due to this species would be serious if no management strategies are implemented. PMID:25612742

  4. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  5. Laboratory longevity and competitiveness of Dacus ciliatus Loew (Diptera: Tephritidae) following sub-sterilizing gamma irradiation.

    Science.gov (United States)

    Nemny-Lavy, E; Nestel, D; Rempoulakis, P

    2016-06-01

    The effect of a sub-sterilizing gamma radiation dose on Dacus ciliatus adults was investigated to assess the suitability of the sterile insect technique (SIT) as an alternative method to control this pest. Late pupae (48 h prior to adult emergence) from a laboratory strain were irradiated with 120 Gy of gamma rays emitted by a 60Co source. Following adult emergence, the mortality of irradiated and non-irradiated cohorts was recorded. Over a period of 50 days after emergence, no significant negative effects of irradiation upon the longevity of male or female laboratory flies were observed. A laboratory competitiveness study (Fried test), using irradiated laboratory and wild males at a ratio of 3:1 was conducted to assess the ability of irradiated males to reduce the egg hatch rates of a wild population. The overall competitiveness was found to be ca. 0.32, suggesting a reduced, but satisfactory, quality of irradiated laboratory as compared with wild males. Based on the above findings, we calculated and proposed effective male release ratios for field application of SIT against D. ciliatus.

  6. Volatile substances from male Anastrepha fraterculus wied. (Diptera: Tephritidae: identification and behavioural activity

    Directory of Open Access Journals (Sweden)

    Lima Ivanildo S.

    2001-01-01

    Full Text Available Volatile compounds produced by calling males of Anastrepha species have previously been reported from A. ludens and A. suspensa. Both species mate in the afternoon, release a similar range of compounds in different proportions, and only differ in the production of monoterpenes. When calling, male A. fraterculus releases two isomers of the sesquiterpene alpha-farnesene, three lactones (anastrephin, epianastrephin and (E,E-suspensolide, and two monoterpenes (limonene and (Z-beta-ocimene. The dimorphic male salivary glands produce and/or store the same isomers of alpha-farnesene and suspensolide, and four pyrazines. Two of these compounds have been previously reported from male A. ludens and A. suspensa. Salivary glands from virgin calling male A. fraterculus showed behavioural activity when bioassayed with virgin mature female flies, but immature females were not attracted.

  7. A new species and new records of Cryptodacus (Diptera: Tephritidae) from Colombia, Bolivia and Peru

    Science.gov (United States)

    Cryptodacus bernardoi Rodriguez & Rodriguez, new species, is described from Colombia. It was reared from fruits of Phoradendron sp. near piperoides (Kunth) Trel. New distribution records are reported for Cryptodacus ornatus Norrbom from Colombia and Peru, for Cryptodacus trinotatus Norrbom & Korytko...

  8. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae)

    Science.gov (United States)

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated....

  9. Populations of Bactrocera oleae (Diptera: Tephritidae) and Its Parasitoids in Himalayan Asia

    Science.gov (United States)

    For a biological control program against olive fruit fly, Bactrocera oleae Rossi, olives were collected in the Himalayan foothills (China, Nepal, India, and Pakistan) to discover new natural enemies. Wild olives, Olea europaea ssp. cuspidata (Wall ex. G. Don), were sparsely distributed and fly-infes...

  10. IMPROVING MASS REARING TECHNOLOGY FOR SOUTH AMERICAN FRUIT FLY (DIPTERA:TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    Raimundo Braga Sobrinho

    2006-01-01

    Full Text Available Studies on availability of suitable and economic diets for adults and larvae of the South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 were carried out at the Entomology Unit of the FAO/IAEA Agriculture and Biotechnology Laboratories in Seibersdorf, Austria with the aim to find the best diets to fit in a large scale mass rearing production. The best diet for adult was the combination of Hydrolysate Corn Protein + Yeast Hydrolysate Enzymatic + Sugar (3:1:3. This diet resulted in the highest numbers of egg/female/day, spermatozoid in the spermathecae, percentages of egg hatch, the lowest mortality rate of adults and the highest average mating duration compared with the standard adult diet based on Yeast Hydrolysate Enzymatic + Sugar (1:3. Among eleven larval diets tested, diets based on sugarcane and sugarbeet bagases plus 7% brewer yeast, 8% sugar, 0.2% sodium benzoate, 0.8% of hydrochloric acid and 60% water (adjusted, yielded the highest percentages of egg hatching, pupal recovery, pupal weight and adult emergence. There was no statistical difference with the standard larval diet based on wheat germ 3%, corncob 15%, corn flower 8%, brewer yeast 6%, sugar 8%, sodium benzoate 0.23%, hydrochloric acid 0.63%, nipagin 0.14% and water 59% (adjusted. The significant performance of these adult and larval diets open discussion for future researches on improvement of rearing techniques required for the establishment of sterile insect technique (SIT program focused on the South American fruit fly.

  11. Analyses of volatiles produced by the African fruit fly species complex ( Diptera , Tephritidae )

    OpenAIRE

    Břízová, Radka; Vaníčková, Lucie; Faťarová, Mária; Ekesi, Sunday; Hoskovec,Michal; Kalinová, Blanka

    2015-01-01

    Abstract Ceratitis fasciventris , Ceratitis anonae and Ceratitis rosa are polyphagous agricultural pests originating from the African continent. The taxonomy of this group (the so-called Ceratitis FAR complex) is unclear. To clarify the taxonomic relationships, male and female-produced volatiles presumably involved in pre-mating communication were studied using comprehensive two-dimensional gas chromatography with time-of-flight mass spectrometry (GC×GC-TOFMS) followed by multivariate analysi...

  12. Host-plant finding by the asparagus fly, Plioreocepta poeciloptera (Diptera: Tephritidae), a monophagous, monovoltine tephritid.

    Science.gov (United States)

    Thibout, E; Pierre, D; Mondy, N; Lecomte, C; Biémont, J C; Auger, J

    2005-10-01

    The role of various olfactory and visual stimuli was studied in host-plant finding by the asparagus fly Plioreocepta poeciloptera (Schrank), a monophagous monovoltine tephritid causing serious damage to asparagus spears. Volatiles released by asparagus plants were extracted by diethyl ether after cryotrapping concentration, and identified by gas chromatography-mass spectrometry. Twelve of the 13 compounds identified were tested using electroantennography to measure the response of the fly. Behavioural response was analysed using two different flight tunnels according to circadian rhythm, age and sex of adults, presence of the plant and of different coloured lures, presence of a male congener, or exposure to four pure asparagus odour compounds that elicited responses in electroantennography, i.e. hexanal, (E)-2-hexenal, (Z)-2-hexen-1-ol and decanal. Data showed that males locate the host plant more quickly than females. Females are attracted mainly by the blend of plant odour and male pheromone. Both sexes respond to a complex of stimuli only during the afternoon. These findings will be helpful in developing new and effective approaches to control this pest insect.

  13. New species of Rhagoletotrypeta (Diptera: Tephritidae) from the Dominican Republic and southern Brazil and Paraguay

    Science.gov (United States)

    Rhagoletotrypeta chapecensis Norrbom & Savaris, new species, and R. gelabertae Norrbom & Savaris, new species, are described and illustrated from specimens from southern Brazil (Paraná, Santa Catarina) and Paraguay, and from the Dominican Republic, respectively. The larvae of R. chapecensis develop ...

  14. Male Fruit Fly, Bactrocera tau (Diptera; Tephritidae) attractants from Elsholtzia pubescens Bth

    NARCIS (Netherlands)

    Hasyim, A.; Muryati,; Mizu Istianto,; Kogel, de W.J.

    2007-01-01

    Studies on the ability of different plant extracts to attract male fruit flies indicated that an extract of Elsholtzia pubescens attracted male Bactrocera tau fruit flies in Passion fruit orchards in West Sumatra, Indonesia. Analyses of the plant extract showed that the major compound present was Ca

  15. Psyttalia cf. concolor (Hymenoptera: Braconidae) for biological control of olive fruit fly (Diptera: Tephritidae) in California.

    Science.gov (United States)

    Yokoyama, Victoria Y; Rendón, Pedro A; Sivinski, John

    2008-06-01

    The larval parasitoid, Psyttalia cf. concolor (Szépligeti), reared on Mediterranean fruit fly, Ceratitis capitata (Weidemann), by the USDA-APHIS-PPQ, Guatemala City, Guatemala, was imported into California for biological control of olive fruit fly, Bactrocera oleae (Gmelin), in olives, Olea europaea L. Mean percentage parasitism of olive fruit fly third instars infesting fruit in field cages ranged from 7.0 in Grapevine to 59.7 in Santa Barbara and in free releases ranged from 0 in Grapevine to 10.6 in Santa Barbara after 4- to 6-d exposures. In the laboratory, more parasitoids developed to adults in olive fruit fly larvae that were 11-13 d old than in larvae 8-10 d old. Adult parasitoids lived significantly longer when provided with water than adults without water in environmental chambers at 5 degrees C, 85% RH; 15 degrees C, 65% RH; 25 degrees C, 25% RH; and 35 degrees C, 25% RH. Adult parasitoids lived for 48 d with honey for food and water and 32 d with food and sugar solution at 15 degrees C and 65% RH. Survival of adult parasitoids without food and water in greenhouse tests was approximately 4 d in a simulated coastal climate and 1 d in a simulated inland valley climate and was significantly increased by providing food and water. The parasitoid did not develop in the beneficial seedhead fly, Chaetorellia succinea (Costa), in yellow star thistle. The rate of parasitism of walnut husk fly, Rhagoletis completa Cresson, larvae in green walnut husks was 28.4% in laboratory no-choice tests. In choice tests, the rate of parasitism of walnut husk fly versus olive fruit fly larvae in olives was 11.5 and 24.2%, respectively.

  16. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Cresoni-Pereira Carla

    2001-01-01

    Full Text Available Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835 wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed.

  17. Reproductive maturity of cherry fruit fly (Diptera: Tephritidae) in managed and natural habitats.

    Science.gov (United States)

    Teixeira, Luís A F; Gut, Larry J; Isaacs, Rufus; Alston, Diane G

    2009-08-01

    We studied the timing of reproductive maturity of cherry fruit fly, Rhagoletis cingulata (Loew), a key pest of sweet and tart cherries in the eastern United States. To determine when cherry fruit fly females become reproductively mature in managed and natural habitats, we deployed traps in sweet and tart cherry orchards and nearby stands of the ancestral host tree, black cherry. Flies were removed from the traps and females were dissected to determine the presence of fully developed eggs. We found that capture of reproductively mature female flies occurred earlier in orchards that are not sprayed with insecticides than in sprayed orchards or in black cherry tree sites. In addition, the gap between the flights of immature and mature females in unmanaged sweet or tart cherry orchards was shorter than in managed orchards or black cherry tree sites. We also determined fruit color, size, and skin hardness to characterize the progression of fruit maturity. We found that fruit became mature earlier in sweet and tart cherry orchards than in black cherry tree sites. This study indicates that the timing of female reproductive maturity is plastic and varies among cherry fruit fly populations present in distinct habitats. Variation in the timing of reproductive maturity is related to the fruit maturity period of distinct host plant species and to orchard management.

  18. Gut bacterial community structure of two Australian tropical fruit fly species (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Narit Thaochan

    2015-12-01

    Full Text Available The community structure of the alimentary tract bacteria of two Australian fruit fly species, Bactrocera cacuminata (Hering and Bactrocera tryoni (Froggatt, was studied using a molecular cloning method based on the 16S rRNA gene. Differences in the bacterial community structure were shown between the crops and midguts of the two species and sexes of each species. Proteobacteria was the dominant bacterial phylum in the flies, especially bacteria in the order Gammaproteobacteria which was prominent in all clones. The total bacterial community consisted of Proteobacteria (more than 75% of clones, except in the crop of B. cacuminata where more than 50% of clones belonged to Firmicutes. Firmicutes gave the number of the secondary community structure in the fly’s gut. Four orders, Alpha-, Beta-, Delta- and Gammaproteobacteria and the phyla Firmicutes and Actinobacteria were found in both fruit fly species, while the order Epsilonproteobacteria and the phylum Bacteroidetes were found only in B. tryoni. Two phyla, Actinobacteria and Bacteroidetes, were rare and less frequent in the flies. There was a greater diversity of bacteria in the crop of the two fruit fly species than in the midgut. The midgut of B. tryoni females and the midgut of B. cacuminata males had the lowest bacterial diversity.

  19. Threshold Concentration of Limonoids (Azamax) for Preventing Infestation by Mediterranean Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Silva, M A; Bezerra-Silva, G C D; Vendramim, J D; Forim, M R; Sá, I C G

    2015-04-01

    This study identified the threshold concentration of limonoids for the complete inhibition of oviposition of Ceratitis capitata (Wiedemann) in grapes 'Itália.' Choice and no-choice experiments with the insect were performed. The three no-choice bioassays were conducted following a completely randomized design with 18 treatments (three densities of insects [one, two, or three females]×five concentrations of limonoids and control) and 20 replicates. In a free choice bioassay, two fruits per cage (a treatment grape and a control) were provided for ovipositing. Three densities of insects (one, two, or three females) were used, with 15 replicates. Bioassays were conducted at 25±2°C, 60±10% relative humidity, and a photoperiod of 14:10 (L:D) h. The inhibition of oviposition of C. capitata was concentration dependent, with infestation occurring at lower concentrations of azadirachtin (+3-tigloylazadirachtol) and complete inhibition occurring at concentrations at or exceeding 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol), maintaining protective effects even at the most densely populated treatment (three females per fruit). When the pest had a free choice of host grapes (treatment vs. control), severe inhibition was observed at concentrations≥50 ppm azadirachtin (+14.3 ppm of 3-tigloylazadirachtol). We conclude that a threshold concentration of 100 ppm azadirachtin (+28.5 ppm of 3-tigloylazadirachtol) is capable of preventing grape infestation. This concentration is likely to provide a reliable level of protection, as the experimental population density of three females per fruit usually does not occur in the field and wild flies usually have more host options.

  20. Fruit fly (Diptera: Tephritidae) host status determination: critical conceptual, methodological, and regulatory considerations.

    Science.gov (United States)

    Aluja, Martín; Mangan, Robert L

    2008-01-01

    Although fruit fly host status determination/designation lies at the heart of strategic decisions on national and international trade of fruit and vegetables, all attempts thus far to define host plant status have been contentious and as a result long-standing disputes between commercial partners throughout the world have lingered over decades. Part of the problem is that too little effort has been devoted to understanding the underlying mechanisms involved in host plant use by fruit flies and that instead economic and political interests usually prevail. Here we review the most important evolutionary, biological, ecological, physiological, and behavioral aspects that drive host use by fruit flies, and then construct a flow diagram rooted in these fundamentals that outlines a series of steps and definitions to determine if a particular fruit or vegetable (and cultivars thereof) is a natural host, or a conditional (potential, artificial) host, or a nonhost. Along the way, we incorporate risk analysis considerations and propose that the underlying complexity determining host plant utilization by fruit flies requires a flexible systems approach capable of realistically dealing with fly/host/environment/geographic variability on a case-by-case basis.

  1. Potential geographical distribution of Rhagoletis pomonella (Diptera: Tephritidae)in China

    Institute of Scientific and Technical Information of China (English)

    Jian Geng; Zhi-Hong Li; Edwin G. Rajotte; Fang-Hao Wan; Xiao-Yu Lu; Zhi-Ling Wang

    2011-01-01

    Apple maggot fly, Rhagoletis pomonella (Walsh) is a major pest causing considerable economic losses of fruits in North America. During the development of international trade, apple maggot fly has become a threat to Chinese agriculture. In this study, CLIMEX and ArcGIS were used to predict the potential geographical distribution of apple maggot fly in China. The parameters used in CLIMEX for apple maggot fly were derived from ecological data and the present geographical distribution of apple maggot fly in North America. Then the potential distribution map in China was presented based on the adjusted values of these parameters. The results showed that apple maggot fly has a wide potential distribution area in China; 47.5% of 748 meteorological stations presented high or medium suitability of pest establishment. These high suitable stations are mainly located in northeast, southwest and northwest of China, such as Liaoning, Shandong,Gansu and Shaanxi Provinces. These areas are also the central regions of apple, pear and peach production in China. Two hundred and twenty-five stations (30.1%) in western and southern China, such as Tibet, Qinghai, Guangdong, Guangxi, Hainan and Taiwan,were unsuitable for establishment of apple maggot fly populations. In order to prevent the introduction of apple maggot fly in China, the present plant quarantine measures should be enhanced, especially in the areas with high suitability for the presence of apple maggot fly.

  2. Overwintering survival of olive fruit fly (Diptera: Tephritidae) and two introduced parasitoids in California.

    Science.gov (United States)

    Wang, Xin-Geng; Levy, Karmit; Nadel, Hannah; Johnson, Marshall W; Blanchet, Arnaud; Argov, Yael; Pickett, Charles H; Daane, Kent M

    2013-06-01

    The overwintering survival and development of olive fruit fly, Bactrocera oleae (Rossi), and the endoparasitoids, Psyttalia humilis Silvestri and P. lounsburyi (Silvestri), were investigated at sites in California's interior valley and coastal region. In the interior valley, adult flies survived up to 4-6 mo during the winter when food was provided. Adult female flies could oviposit in late fall and early winter on nonharvested fruit and, although egg survival was low (0.23-8.50%), a portion of the overwintered cohort developed into adults the following spring; percentage of survival was negatively correlated to daily minimum temperature. P. humilis and P. lounsburyi successfully oviposited into host larvae in late fall, and their progeny developed into adults the following spring, although with a low percentage (0-11.9%) survivorship. Overwintering survival of puparia of the olive fruit fly and immature larvae of P. humilis and P. lounsburyi (inside host puparia), buried in the soil, were tested at an interior valley and coastal site. Survival of olive fruit fly ranged from 0 to 60% and was affected by the trial date and soil moisture. Overwintering survival of both the fruit fly and tested parasitoids was lower at the colder interior valley than the coastal site; P. humilis immature stages had the highest mortality levels while B. oleae pupae had the lowest mortality levels. The spring emergence pattern of the tested insects was well predicted by a degree-day model. We discuss factors potentially impeding establishment of introduced olive fruit fly parasitoids in California and elsewhere.

  3. New species and host plants of Anastrepha (Diptera: Tephritidae) primarily from Peru and Bolivia.

    Science.gov (United States)

    Norrbom, Allen L; Rodriguez, Erick J; Steck, Gary J; Sutton, Bruce A; Nolazco, Norma

    2015-11-16

    Twenty-eight new species of Anastrepha are described and illustrated: A. acca (Bolivia, Peru), A. adami (Peru), A. amplidentata (Bolivia, Peru), A. annonae (Peru), A. breviapex (Peru), A. caballeroi (Peru), A. camba (Bolivia, Peru), A. cicra (Bolivia, Peru), A. disjuncta (Peru), A. durantae (Peru), A. echaratiensis (Peru), A. eminens (Peru), A. ericki (Peru), A. gonzalezi (Bolivia, Peru), A. guevarai (Peru), A. gusi (Peru), A. kimi (Colombia, Peru), A. korytkowskii (Bolivia, Peru), A. latilanceola (Bolivia, Peru), A. melanoptera (Peru), A. mollyae (Bolivia, Peru), A. perezi (Peru), A. psidivora (Peru), A. robynae (Peru), A. rondoniensis (Brazil, Peru), A. tunariensis (Bolivia, Peru), A. villosa (Bolivia), and A. zacharyi (Peru). The following host plant records are reported: A. amplidentata from Spondias mombin L. (Anacardiaceae); A. caballeroi from Quararibea malacocalyx A. Robyns & S. Nilsson (Malvaceae); A. annonae from Annona mucosa Jacq. and Annona sp. (Annonaceae); A. durantae from Duranta peruviana Moldenke (Verbenaceae); and A. psidivora from Psidium guajava L. (Myrtaceae).

  4. Current knowledge of the species complex Anastrepha fraterculus (Diptera, Tephritidae) in Brazil

    Science.gov (United States)

    Vaníčková, Lucie; Hernández-Ortiz, Vicente; Bravo, Iara Sordi Joachim; Dias, Vanessa; Roriz, Alzira Kelly Passos; Laumann, Raul Alberto; Mendonça, Adriana de Lima; Paranhos, Beatriz Aguiar Jordão; do Nascimento, Ruth Rufino

    2015-01-01

    Abstract The study of the species complex Anastrepha fraterculus (Af complex) in Brazil is especially important in a taxonomical, evolutionary and pest management context, because there are evidences that some of them may occur in sympatry. In this review, we analyzed the main results supporting evidences that three cryptic species occur in Brazil. The taxonomical and phylogenetic relationships based on eggshell morphology, adult morphometrics, as well as cytotaxonomy and genetic differentiations are discussed. We also review available information on sexual behavior including acoustic communication of males during courtship and sexual incompatibility; and chemical signals involved in the communication between sexes, with a special focus on sex pheromones. We examined the role of long- and short-range pheromones (male-produced volatiles and cuticular hydrocarbons, respectively), their implications in sexual isolation, and their possible use for chemotaxonomic differentiation of the putative species of the Af complex. PMID:26798261

  5. Effective sampling range of a synthetic protein-based attractant for Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Studies were conducted in Honduras to determine sampling range for female-targeted food-based synthetic attractants for pest tephritid fruit flies. Field studies were conducted in shaded coffee and adults of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), were captured. Traps (38 traps ...

  6. Toward an Automated Identification of Anastrepha Fruit Flies in the fraterculus group (Diptera, Tephritidae).

    Science.gov (United States)

    Perre, P; Faria, F A; Jorge, L R; Rocha, A; Torres, R S; Souza-Filho, M F; Lewinsohn, T M; Zucchi, R A

    2016-10-01

    In this study, we assess image analysis techniques as automatic identifiers of three Anastrepha species of quarantine importance, Anastrepha fraterculus (Wiedemann), Anastrepha obliqua (Macquart), and Anastrepha sororcula Zucchi, based on wing and aculeus images. The right wing and aculeus of 100 individuals of each species were mounted on microscope slides, and images were captured with a stereomicroscope and light microscope. For wing image analysis, we used the color descriptor Local Color Histogram; for aculei, we used the contour descriptor Edge Orientation Autocorrelogram. A Support Vector Machine classifier was used in the final stage of wing and aculeus classification. Very accurate species identifications were obtained based on wing and aculeus images, with average accuracies of 94 and 95%, respectively. These results are comparable to previous identification results based on morphometric techniques and to the results achieved by experienced entomologists. Wing and aculeus images produced equally accurate classifications, greatly facilitating the identification of these species. The proposed technique is therefore a promising option for separating these three closely related species in the fraterculus group.

  7. Morphometric Differentiation Among Anastrepha fraterculus (Diptera: Tephritidae) Exploiting Sympatric Alternate Hosts.

    Science.gov (United States)

    Gómez-Cendra, P V; Paulin, L E; Oroño, L; Ovruski, S M; Vilardi, J C

    2016-04-01

    Anastrepha fraterculus (Wiedemann) is currently considered a complex of cryptic species infesting fruits from Mexico to Argentina and represents an interesting biological model for evolutionary studies. Moreover, detecting and quantifying behavioral, morphological, and genetic differentiation among populations is also relevant to the application of environment-friendly control programs. Here, phenotypic differentiation among individuals coexisting in the wild in a Northern region of Argentina was unveiled and associated with host choice. Six morphometric traits were measured in sympatric flies exploiting three different host species. Phenotypic variation was shown to be host-dependent regardless of geographical or temporal overlap. Flies collected from synchronous alternate hosts (peach and walnut) differed from each other despite the lack of geographical isolation. By contrast, flies emerging from guavas that ripen about two months later than peach and walnut showed no significant differentiation in comparison to flies collected from walnuts, but they differ significantly from flies originating from peaches. This result is consistent with the hypothesis that the same population of flies shifts from walnuts to guavas throughout the year, whereas the population of flies that uses peaches as a host is probably exploiting other alternate hosts when peach availability decreases. Further research is needed to study the underlying mechanism. Results are consistent with previous molecular markers (inter-simple sequence repeat-ISSR) research on flies stemming from the same hosts and the same area, suggesting that differentiation among flies emerging from alternative hosts occurs at both genetic and phenotypic levels. The contribution of host preference in long-term genetic differentiation is discussed. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. The Gene Transformer of Anastrepha Fruit Flies (Diptera, Tephritidae) and Its Evolution in Insects

    Science.gov (United States)

    Salvemini, Marco; Eirín-López, José María; Perondini, André L. P.; Selivon, Denise; Polito, Catello; Saccone, Giuseppe; Sánchez, Lucas

    2007-01-01

    In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA), and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA). Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality. PMID:18043746

  9. Two new species of Anastrepha Schiner (Diptera, Tephritidae) closely related to Anastrepha pickeli Lima.

    Science.gov (United States)

    Canal, N A; Uramoto, K; Zucchi, R A

    2013-02-01

    Anastrepha entodonta n. sp. and Anastrepha hadropickeli n. sp. are described and illustrated. The new species belong to the spatulata group. Both species occur sympatrically with Anastrepha pickeli Lima in the semiarid region of the state of Minas Gerais, Brazil. Anastrepha hadropickeli occurs also in the semiarid of the state of Rio Grande do Norte, Brazil, where it was misidentified as A. pickeli.

  10. Residual control and lethal concentrations of GF-120 (spinosad) for Anastrepha spp. (Diptera: Tephritidae).

    Science.gov (United States)

    Flores, Salvador; Gomez, Luis E; Montoya, Pablo

    2011-12-01

    The objective of this study was to determine the relationship between residual time of GF-120 (spinosad) treatment and mortality in three species of Anastrepha Schiner. Concentrations of 96, 72, 48, and 24 ppm were aged on mango leaves under field conditions for 0, 3, 7, 10, 14, 17, and 21 d after application. We found that Anastrepha ludens, A. obliqua, and A. serpentina were highly sensitive to spinosad. The effects of spinosad were not reduced over the 4 d after the initial application, even at a concentration of 24 ppm. Mortality at 14 d after the application of 72 and 96 ppm of spinosad was similar in each of the three fruit fly species. In addition, we found that 24 ppm of spinosad was consumed the most by each species even though no direct relationship between the rate of consumption per female and the dose of the product was observed, in this test, higher consumption of active ingredient was observed at a concentration of 72 ppm, for A. ludens, 48 ppm for A. obliqua, and 96 ppm for A. serpentina. Our results suggest that a spinosad concentration of 72 ppm may effectively control these pests for at least 10 d under field conditions.

  11. Phylogenetic relationships of the tribe Toxotrypanini (Diptera: Tephritidae) based on molecular characters

    Science.gov (United States)

    Current hypotheses of relationship among the species of the fruit fly genera Anastrepha and Toxotrypana are tested using sequence data from six DNA regions: the mitochondrial 16S rRNA gene; the 5’-region of the carbomoylphosphate synthase (CPS) domain of the rudimentary gene (CAD); the mitochondrial...

  12. Influence of quantities of brewer yeast on the performance of Anastrepha obliqua wild females (Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2001-11-15

    Using artificial solid diets, experiments were performed with Anastrepha obliqua (Macquart, 1835) wild females in order to verify the influence of different quantities of brewer yeast on the performance and compensation behavior to unbalanced diets ingestion. The observed parameters were egg production, ingestion, diet efficiency and survival in the reproductive phase. Results indicated that there was no compensatory ingestion to different quantities of yeast and that the diet with 12.5g of yeast provided the best performance. The absence of compensatory ingestion is discussed based on the yeast phagostimulation and on the costs involved in solid diets ingestion. The relation between the analyzed parameters and the protein quantities in the diet were discussed. (author)

  13. Egg length of Anastrepha obliqua Macquart (Diptera, Tephritidae according to oviposition rate and maternal age

    Directory of Open Access Journals (Sweden)

    Isabel C. Boleli

    1992-01-01

    Full Text Available The length of the entire egg, micropile and vitellus regions of Anastrepha obliqua Macquart, 1835 were measured during all opposition period. Obtained values were compared among them and with oviposition rate. The smallest eggs were produced during the first 35 oviposition days, period where the highest oviposition rate occured. The decrease in egg length was found to be due to a descrease in the vitellus region. Micropile length was found to be pratically constant throughout oviposition. Furthermore, no relationship between maternal age and length was detectable.

  14. Insect thermotolerance comparing host infestation methods: Anastrepha ludens (Diptera: Tephritidae) reared in grapefruit or diet.

    Science.gov (United States)

    Hallman, Guy J

    2014-08-01

    Research on insect control should be conducted in a manner that mimics as closely as is feasible its commercial application in all of its practicably conceivable forms. When significant deviations from commercial application are used in research, the effect of the deviations on efficacy should be evaluated. Pest control techniques are sometimes based on research that used untested assumptions about variables that might affect efficacy. For example, some phytosanitary treatments are based on research done with diet-reared larvae inserted into holes bored in fruits, although the effect of this manipulation has not been evaluated. This research compares this type of infestation of grapefruit with Mexican fruit fly, Anastrepha ludens (Loew), third instars with a more natural infestation technique whereby females were allowed to oviposit on picked grapefruit in laboratory cages and third instars were reared inside the fruit. Although the results did not show statistically significant differences between infestation techniques, tendencies in the data caution against researchers making assumptions about efficacy without testing them when experimental techniques stray from more natural situations for which the research is designed.

  15. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    Kendra, Paul E; Epsky, Nancy D; Montgomery, Wayne S; Heath, Robert R

    2008-10-01

    A current trapping system for Anastrepha fruit flies uses a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane). Development of more effective monitoring programs may be realized through identification of additional attractant chemicals. This study examined response of the Caribbean fruit fly, Anastrepha suspensa (Loew), to putrescine and four homologous terminal diamines, differing only in carbon chain length. Using a fixed dose of each diamine substrate, electroantennogram (EAG) responses from mature females to putrescine and cadaverine (1,5-diaminopentane) were not significantly different from each other but were significantly greater than responses to longer chain diamines. Over a range of doses tested, mean female EAG response was greater than male response to both putrescine and cadaverine. In an initial field test, capture of female flies in traps baited with ammonium acetate and either putrescine or cadaverine was higher than in traps baited with ammonium acetate and any of the other diamines. In a subsequent field test, traps baited with putrescine, cadaverine, or 1,6-diaminohexane in combination with ammonium acetate captured more female flies than traps baited with ammonium acetate alone. A significantly greater synergistic effect on female captures was observed with either putrescine or cadaverine than with 1,6-diaminohexane. Thus, of the diamines evaluated, cadaverine elicited both antennal and behavioral responses comparable to that of putrescine and will be studied further as a potential attractant for pest Anastrepha species.

  16. Morphometry and distribution of sensilla on the antennae of Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae).

    Science.gov (United States)

    Bisotto-de-Oliveira, R; Redaelli, L R; Sant'ana, J

    2011-01-01

    Antennal sensilla of Anastrepha fraterculus (Wied.) were examined using scanning electron microscopy. In the flagellum, there are trichoid, basiconic, clavate type I and II, and styloconic sensilla and microtrichia. Only microtrichiae and chaetica sensilla were observed in the scape and pedicel. The number of sensilla in the flagellum was similar between sexes. At the apex there was a higher density of trichoid and an absence of clavate sensilla, while basiconic sensilla were more abundant in the proximal region.

  17. Description of the third-instar of Anastrepha leptozona Hendel (Diptera: Tephritidae).

    Science.gov (United States)

    Lasserre, Daniel Frías; Ortiz, Vicente Hernández; Muñoz, Liliana López

    2009-01-01

    The morphology of the third-instar larva of Anastrepha leptozona Hendel is characterized using optical and scanning electron microscopy. The antennomaxillary complex, oral ridges, labium, stomal sensory organ, cephalopharyngeal skeleton, anterior and posterior spiracles and caudal segment are described and illustrated. Mature larvae of A. leptozona present a 'ventral sclerite' below the pharyngeal sclerite which is characterized for the first time in Anastrepha species.

  18. Description of third instar larvae of Anastrepha curitis, Anastrepha pickeli and Anastrepha pulchra (Diptera: Tephritidae)

    Science.gov (United States)

    We describe and illustrate for the first time the third instar larvae of three Anastrepha species, Anastrepha pickeli Lima, Anastrepha pulchra Stone, and Anastrepha curitis Stone, and also the second instar of A. curitis. Internal structures, such as the cephalopharyngeal skeleton and spiracles, and...

  19. Effect of sucrose ingestion on the performance of wild Anastrepha obliqua (Macquart) females (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Fontellas, Tania M.L.; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2003-04-15

    Carbohydrates are the main source of energy for insects and the lack of these nutrients in the diet can cause serious damage to the biology of these arthropods. In order to better understand the effect of sucrose on the performance and dietary selection of adult Anastrepha obliqua (Macquart), the following experiments were carried out: 1) effect of different amount of sucrose on diet ingestion, longevity and egg production; 2) dietary selection that contains different amounts of sucrose, and 3) discrimination threshold for sucrose in adult individuals deprived or not of carbohydrates. The control diet showed the best results in relation to ingestion, longevity and egg production for these species, probably due to the fact that it presents an optimal nutritional balance between sucrose and yeast. The control diet was also the preferred diet of females, indicating a positive correlation between the nutritional value of a diet and chemical perception by A. obliqua. Sucrose-deprived females were able to perceive lower carbohydrate quantity than non-deprived females. This characteristic might represent a biological advantage since it reduces the food foraging time for these insects. (author)

  20. Hemocyte types and total and differential counts in unparasitized and parasitized Anastrepha obliqua (Diptera, Tephritidae larvae

    Directory of Open Access Journals (Sweden)

    J. E. B. SILVA

    Full Text Available The hemocyte types, in addition to total and differential hemocyte counts were studied in parasitized and unparasitized Anastrepha obliqua larvae at the beginning and at the end of the third instar. In both developmental phases, in parasitized and unparasitized larvae, prohemocytes, plasmatocytes, granulocytes, adipohemocytes, spherulocytes and oenocytoids cells were observed. Mitotic figures indicate prohemocytes as stem cells. Prohemocytes, plasmatocytes and granulocytes are the most numerous cells in the hemolymph of A. obliqua. Difference in the total number of hemocytes was observed between unparasitized and parasitized larvae at the end of the third instar, but not at the beginning.

  1. Selection of oviposition sites by wild Anastrepha obliqua (Macquart) (Diptera: Tephritidae) based on the nutritional composition

    Energy Technology Data Exchange (ETDEWEB)

    Fontellas-Brandalha, Tania M.L.; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia]. E-mail: zucoloto@ffclrp.usp.br

    2004-09-15

    Few works have studied in detail the types of nutrients associated to hosts which are attractive to females of Anastrepha obliqua (Macquart) and influence the choice of the oviposition site. The relationship of the males in the physiology and in the behavior of those females has also been scarcely studied and some ecological relationships seem to be quite important for the knowledge of this species' biology. Our objective in this study was to evaluate the discriminatory behavior of A. obliqua between oviposition sites containing different nutrients. The presence of the male and the nutritional status of the female were also considered in this work. Two experiments were developed: in the first, the preference of A. obliqua females between artificial oviposition substrates was evaluated; in the second, females were submitted to two types of artificial oviposition substrates in the presence and in the absence of males and were fed either on a poor diet or on an adequate diet concerning sucrose concentration. In the first experiment, A. obliqua showed higher preference for substrates containing brewer's yeast and sucrose. Substrate containing only yeast was the second most accepted. Offspring development and adult feeding may have determined the choice for the substrate containing brewer's yeast and sucrose. In addition, the presence of protein in the brewer's yeast may indicate nutritional quality to the females in a more accurate way than the sucrose. In the second experiment, the brewer's yeast was the most accepted by the females. The male absence was also an important factor in the selection of hosts and in the egg production of A. obliqua. (author)

  2. Morphometric divergence in populations of Anastrepha obliqua (Diptera, Tephritidae) from Colombia and some Neotropical locations.

    Science.gov (United States)

    Castañeda, Maria R; Selivon, Denise; Hernández-Ortiz, Vicente; Soto, Alberto; Canal, Nelson A

    2015-01-01

    The West Indian fruit fly, Anastrepha obliqua, is one of seven species of quarantine importance of its genus and is one of the most economically important fruit fly pests in Colombia. The taxonomic status of this species is a key issue for further implementation of any pest management program. Several molecular studies have shown enough variability within Anastrepha obliqua to suggest its taxonomic status could be revised; however, there are no morphological studies supporting this hypothesis. The aim of this work was to describe the morphological variability of Colombian populations of Anastrepha obliqua, comparing this variability with that of other samples from the Neotropics. Measurements were performed on individuals from 11 populations collected from different geographic Colombian localities and were compared with populations from Mexico (2), Dominica Island (1), Peru (1) and Brazil (2). Linear morphometric analyses were performed using 23 female morphological traits, including seven variables of the aculeus, three of the thorax, and six of the wing; seven ratios among them were also considered. Discriminant function analyses showed significant morphological differentiation among the Colombian populations, separating them into two groups. Furthermore, in the comparisons between Colombian samples with those from other countries, three clusters were observed. The possibility of finding more than one species within the nominal Anastrepha obliqua population is discussed.

  3. The gene transformer of anastrepha fruit flies (Diptera, tephritidae and its evolution in insects.

    Directory of Open Access Journals (Sweden)

    María Fernanda Ruiz

    Full Text Available In the tephritids Ceratitis capitata and Bactrocera oleae, the gene transformer acts as the memory device for sex determination, via an auto-regulatory function; and functional Tra protein is produced only in females. This paper investigates the evolution of the gene tra, which was characterised in twelve tephritid species belonging to the less extensively analysed genus Anastrepha. Our study provided the following major conclusions. Firstly, the memory device mechanism used by this gene in sex determination in tephritids likely existed in the common ancestor of the Ceratitis, Bactrocera and Anastrepha phylogenetic lineages. This mechanism would represent the ancestral state with respect to the extant cascade seen in the more evolved Drosophila lineage. Secondly, Transformer2-specific binding intronic splicing silencer sites were found in the splicing regulatory region of transformer but not in doublesex pre-mRNAs in these tephritids. Thus, these sites probably provide the discriminating feature for the putative dual splicing activity of the Tra-Tra2 complex in tephritids. It acts as a splicing activator in dsx pre-mRNA splicing (its binding to the female-specific exon promotes the inclusion of this exon into the mature mRNA, and as a splicing inhibitor in tra pre-mRNA splicing (its binding to the male-specific exons prevents the inclusion of these exons into the mature mRNA. Further, a highly conserved region was found in the specific amino-terminal region of the tephritid Tra protein that might be involved in Tra auto-regulatory function and hence in its repressive splicing behaviour. Finally, the Tra proteins conserved the SR dipeptides, which are essential for Tra functionality.

  4. Relevant genetic differentiation among Brazilian populations of Anastrepha fraterculus (Diptera, Tephritidae)

    Science.gov (United States)

    Manni, Mosè; Lima, Kátia Manuela; Guglielmino, Carmela Rosalba; Lanzavecchia, Silvia Beatriz; Juri, Marianela; Vera, Teresa; Cladera, Jorge; Scolari, Francesca; Gomulski, Ludvik; Bonizzoni, Mariangela; Gasperi, Giuliano; Silva, Janisete Gomes; Malacrida, Anna Rodolfa

    2015-01-01

    Abstract We used a population genetic approach to detect the presence of genetic diversity among six populations of Anastrepha fraterculus across Brazil. To this aim, we used Simple Sequence Repeat (SSR) markers, which may capture the presence of differentiative processes across the genome in distinct populations. Spatial analyses of molecular variance were used to identify groups of populations that are both genetically and geographically homogeneous while also being maximally differentiated from each other. The spatial analysis of genetic diversity indicates that the levels of diversity among the six populations vary significantly on an eco-geographical basis. Particularly, altitude seems to represent a differentiating adaptation, as the main genetic differentiation is detected between the two populations present at higher altitudes and the other four populations at sea level. The data, together with the outcomes from different cluster analyses, identify a genetic diversity pattern that overlaps with the distribution of the known morphotypes in the Brazilian area. PMID:26798258

  5. Electroantennogram and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to putrescine and ammonium bicarbonate lures.

    Science.gov (United States)

    Kendra, Paul E; Montgomery, Wayne S; Epsky, Nancy D; Heath, Robert R

    2009-08-01

    At present, the most effective synthetic lures for pest Anastrepha fruit flies are multicomponent blends that include ammonia and the diamine synergist putrescine (1,4-diaminobutane). Both chemicals generally have been regarded as protein cues that result in female-biased attraction. Using electroantennography (EAG) and flight tunnel bioassays, this study evaluated response of the Caribbean fruit fly, Anastrepha suspensa (Loew) to vapors released from commercial lure formulations of ammonium bicarbonate and putrescine. Over a range of doses tested, EAG response to ammonium bicarbonate was equivalent for both sexes, but female response was significantly greater than male response to putrescine and to a 1:1 mixture of ammonium bicarbonate and putrescine. Amplitude of EAG response to the mixture was approximately equal to the summation of responses to the individual substrates. Using a fixed dose of substrate, EAG measurements from females 1-14 d old indicated that antennal sensitivity to both lures varied according to physiological state of the fly. Peak response to ammonium bicarbonate was recorded from immature females, peak response to putrescine from sexually mature females. In bioassays, more females were captured with ammonium bicarbonate plus putrescine than with ammonium bicarbonate alone. This difference was not observed in males, resulting in a higher female to male ratio in captures with ammonium bicarbonate plus putreseine (3:1) versus ammonium bicarbonate alone (1:1). Results suggest that separate olfactory receptors are involved in detection of the two semiochemicals, and that the putrescine component is primarily responsible for the female-biased attraction.

  6. Redescription, lectotype designation and new records of Anastrepha luederwaldti Lima (Diptera, Tephritidae).

    Science.gov (United States)

    Uramoto, Keiko; Norrbom, Allen L; Zucchi, Roberto A

    2016-09-15

    The previously poorly known species Anastrepha luederwaldti Lima, 1934 is redescribed based on a reexamination of the syntypes from São Paulo and additional specimens from Santa Catarina and Rio Grande do Sul, Brazil. A lectotype is designated.

  7. Random mating and reproductive compatibility among Argentinean and southern Brazilian populations of Anastrepha fraterculus (Diptera: Tephritidae).

    Science.gov (United States)

    Rull, J; Abraham, S; Kovaleski, A; Segura, D F; Islam, A; Wornoayporn, V; Dammalage, T; Tomas, U Santo; Vera, M T

    2012-08-01

    As a prerequisite for area-wide application of the sterile insect technique in an area encompassing northern Argentina and southern Brazil, prezygotic and postzygotic reproductive compatibility among three geographically distant populations in the area was tested. In field cages, sexually mature adults of each population were found to be sexually compatible, mating duration was not affected by fly origin and there was no clear evidence of spatial partition of mating location. In the laboratory, homotypic and heterotypic crosses for all possible combinations displayed similar levels of fertility and yielded F1 adults without distortion of the sex ratio. Finally, F1 hybrid and parental adults produced equally viable F2 eggs. Put together, our results and those from earlier studies suggest that a large area, ranging from Buenos Aires to the surroundings of São Paulo, could be managed using a single A. fraterculus mass-reared strain. At the northern margin of this area, two A. fraterculus morphotypes appear to coexist in sympatry. We delineate future research to further delimit the distribution of the aff1 morphotype (Argentina-southern Brazil) and to gain insight into evolutionary patterns producing divergence and radiation of tropical fruit fly species.

  8. New protein sources in adults diet for mass-rearing of Anastrepha fraterculus (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Renata Morelli

    2012-12-01

    Full Text Available The aim of this study was to find alternatives to reduce the cost of mass production of the South American fruit fly (A. fraterculus by looking for locally available products as protein source in the diet of adults to replace the imported product without changing the quality parameters. Two yeast from a Brazilian company were evaluated. The quality parameters showed that the imported hydrolyzed yeast used in the adult diet could be perfectly replaced by the local products tested, with a reduction of over 80% of the cost of the diet. The quality of the produced insects remained the same and there were improvements in some quality parameters such as the volume of eggs produced, number of adults flying and longevity under the stress.

  9. The current and future potential geographic range of West Indian fruit fly, Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Fu, Liao; Li, Zhi-Hong; Huang, Guan-Sheng; Wu, Xing-Xia; Ni, Wen-Long; Qü, Wei-Wei

    2014-04-01

    The West Indian fruit fly, Anastrepha obliqua (Macquart), is one of the most important pests throughout the Americas. CLIMEX 3.0 and ArcGIS 9.3 were used to model the current and future potential geographical distribution of this pest. Under current climatic conditions, A. obliqua is predicted to be able to establish throughout much of the tropics and subtropics, including not only North and South America, where it has been reported, but also southern Asia, northeastern Australia and Sub-Saharan Africa. The main factors limiting the pest's range expansion may be cold stress. Climate change expands the potential distribution of A. obliqua poleward as cold stress boundaries recede, but the predicted distribution in northwestern Australia and northern parts of Sub-Saharan Africa will decrease because of heat stress. Considering the widely suitable range for A. obliqua globally and in China, enhanced quarantine and monitoring measures should be implemented in areas that are projected to be suitable for the establishment of the pest under current and future climatic conditions. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  10. Influence of irradiation on development of Caribbean fruit fly (diptera: tephritidae) larvae

    Energy Technology Data Exchange (ETDEWEB)

    Nation, J.L.; Milne, K.; Dykstra, T.M. [Univ. of Florida, Gainesville, FL (United States)] [and others

    1995-05-01

    Larvae of the Caribbean fruit fly, Anastrepha suspensa (Loew), were irradiated at hatching with 0, 5, 10, 20, 50, 75, 100 and 150 Gy doses from a Cesium-137 source and dissected for measurements of the supraesophageal ganglion (brain) and proventriculus (B/Prv) as mature third instars. Cross-sectional area of a plane through the brain and proventriculus, and simple dorsal width measurements of the two organs were evaluated as indicators of radiation exposure. Brain area, brain width, and brain/proventriculus (B/Prv) ratios were significantly different from controls in insects treated with a dose {ge}20 Gy. Detailed dissections of hatching larvae exposed to 50 Gy revealed reductions in brain growth, small and misshapen compound eye and leg imaginal disks, and a ventral nerve cord that was elongated and sinuous. Larvae irradiated on the 1st d of each of the three instars had smaller brains, with the percentage of reduction in brain size being greater the younger the larvae were at the time of exposure. Brain and proventriculus measurements and calculated B/Prv values are indicative of irradiation in Caribbean fruit fly larvae, but the procedure may not be adaptable for routine use by quarantine inspectors. 14 refs., 4 figs., 2 tabs.

  11. Influence of Methoprene on Pheromone Emission and Sexual Maturation of Anastrepha obliqua (Diptera: Tephritidae) males.

    Science.gov (United States)

    Muñoz-Barrios, Rodolfo; Cruz-López, Leopoldo; Rojas, Julio C; Hernández, Emilio; Liedo, Pablo; Gómez-Simuta, Yeudiel; Malo, Edi A

    2016-04-01

    It has been demonstrated that the application of juvenile hormone analog, methoprene, reduces the time required for sexual maturation and enhances mating success in several species of tephritid fruit flies. This study examined the effect of different concentrations of methoprene incorporated into the diet of adult flies and distinct sugar:protein (S:P) ratios on sexual maturity and pheromone emission of Anastrepha obliqua males. Diets with 0.2 and 0.5% of methoprene accelerated sexual maturation of males compared with untreated males. In subsequent assays, the enhancement of male pheromone emission and sexual maturation by the incorporation of 0.02% methoprene into a 24:1 (S: P) diet was confirmed. Among the volatiles released by males, (Z)-3-nonenol and (Z,Z)-3,6-nonadienol were emitted at higher quantities by flies treated with methoprene than untreated ones. The results show that methoprene accelerates sexual maturation of mass-reared A. obliqua males and increases their mating propensity. This would reduce the time required to attain sexual maturation by sterile males, thus decreasing fly handling costs and improving the efficacy of the sterile insect technique.

  12. Phylogeographic structure in Anastrepha ludens (Diptera: Tephritidae) populations inferred with mtDNA

    Science.gov (United States)

    Anastrepha ludens (Loew), the Mexican fruit fly, is a major pest of citrus and mango. It has a wide distribution in Mexico and Central America with infestations occurring in Texas, California and Florida with origins believed to be centered in northeastern Mexico. This research evaluates the utilit...

  13. Predation of Anastrepha ludens (Diptera: Tephritidae) by Norops serranoi (Reptilia: Polychrotidae): functional response and evasion ability.

    Science.gov (United States)

    Dor, Ariane; Valle-Mora, Javier; Rodríguez-Rodríguez, Susana Eva; Liedo, Pablo

    2014-06-01

    The Mexican fruit fly, Anastrepha ludens (Loew), is one of the 10 worldwide more important fruit crop pests. Orchards of southeastern Chiapas also shelter the tree-dwelling lizard Norops serranoi (Köhler), which likely prey upon these flies. In standard laboratory conditions, we determined the functional response of four male and four female lizards on mass-reared fruit flies. We used a general logistic analysis of proportion of killed prey versus available prey to determine the shape of the functional response. Male lizards showed a type II functional response, while females showed a type III functional response. For the highest fruit fly densities, female lizards caught significantly more fruit flies than males did. The predator evasion ability and the survival of mass-reared and wild fruit flies were compared. Wild fruit flies evaded more male lizard attacks than mass-reared flies. However, when female lizards attacked, there was no significant difference between strains. Fruit flies survival was higher with male than with female lizards, but it did not depend on fruit fly strains. This is the first report of a vertebrate preying on the Mexican fruit fly, demonstrating that female lizards impose a higher predation pressure and are more efficient at capturing wild fruit flies than males. We discuss the implications of our results on mass-rearing and quality control of sterile flies.

  14. Wolbachia strains in cryptic species of the Anastrepha fraterculus complex (Diptera, Tephritidae) along the Neotropical Region.

    Science.gov (United States)

    Prezotto, Leandro F; Perondini, André L P; Hernández-Ortiz, Vicente; Marino, Celso L; Selivon, Denise

    2017-01-01

    Infection by Wolbachia was described previously in eleven species of Anastrepha fruit flies some of which are important pests of fruticulture. One such species is the nominal Anastrepha fraterculus, the South American fruit fly, which actually comprises a complex of cryptic species. The suggestions of using Wolbachia for the control of these pest species, make imperative a more precise characterization of the existing strains of the bacteria. In this study, population samples of the A. fraterculus complex from Brazil, Argentina, Peru, Ecuador, Colombia, Guatemala and Mexico were analyzed for Wolbachia infection. The bacteria were genotyped by the MLST and WSP Typing methodologies. All samples were infected with Wolbachia of supergroup "A". For each of the five MLST genes, unique as well as already known alleles were detected. Nineteen sequence types for the concatenated sequences of the five MLST genes, and twenty wsp alleles were found in the samples. Host-specific haplotypes, shared strains among distinct hosts, and more than one strain of Wolbachia were found in some population samples. Recombination among the MLST genes and intragenic recombination between wsp haplotypes was rare. Phylogenetic analysis showed a great similarity among the Wolbachia strains in the A. fraterculus complex. However, some strains of Wolbachia are found throughout the Neotropical Region and there are specific strains in determined geographical areas. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. First record of Anastrepha flavipennis Greene (Diptera: Tephritidae) and of its host in the Brazilian Amazon.

    Science.gov (United States)

    Corrêa, E C; Silva, N M; Silva, F C C; Pena, M R

    2011-01-01

    Anastrepha flavipennis Greene was obtained from Pouteria glomerata (Sapotaceae) fruits, known as "abiurana-da-várzea" in the Brazilian Amazon. This is the first record of A. flavipennis for the state of Amazonas and of P. glomerata as a host for this fruit fly in the Amazon Basin.

  16. INSETICIDAS VEGETAIS NO CONTROLE DE Anastrepha spp. (DIPTERA: TEPHRITIDAE EM POMAR DE GOIABA

    Directory of Open Access Journals (Sweden)

    Francisco Roberto Azevedo

    2013-09-01

    Full Text Available Objetivando avaliar os efeitos de inseticidas vegetais sobre Anastrepha spp. em pomar de goiaba, realizaram-se pesquisas em Barbalha, de 6 de maio a 24 de junho de 2011, testando Pironat®, Rotenat® e Natuneem®. Para avaliar o efeito sobre adultos, instalaram-se 20 armadilhas McPhail iscadas com proteína hidrolisada de milho a 5%, quantificando-se o número de insetos capturados. Na avaliação do efeito sobre larvas, colheram-se ao acaso 100 frutos maduros, verificando-se a presença de larvas vivas e mortas. Foram feitas três aplicações em ambos os experimentos com o auxílio de um atomizador costal motorizado, sendo as avaliações realizadas semanalmente. O extrato pirolenhoso do Pironat® repele satisfatoriamente adultos de Anastrepha spp., enquanto que a azadiractina presente no Natuneem® promove efeito inseticida sobre as larvas nas condições de campo, sendo estes produtos mais eficazes para o controle da praga a partir da segunda aplicação. Embora estes produtos vegetais não cheguem a causar 100% de controle, eles podem ser utilizados em programas de Manejo Agroecológico de Anastrepha spp. em pomares de goiaba, pois além de baratos, são de fácil aplicação e não provocam impacto ambiental em termos de risco de resíduos tóxicos nos frutos. Use este espaço para escrever o resumo.

  17. Mitotic and polytene chromosome analysis in the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Garcia-Martinez, V; Hernandez-Ortiz, E; Zepeta-Cisneros, C S; Robinson, A S; Zacharopoulou, A; Franz, G

    2009-01-01

    The present study constitutes the first attempt to construct a polytene chromosome map of an Anastrepha species, Anastrepha ludens (Loew), a major agricultural pest. The mitotic karyotype has a diploid complement of 12 acrocentric chromosomes, including five pairs of autosomes and an XX/XY sex chromosome pair. The analysis of salivary gland polytene chromosomes has shown a total number of five polytene elements that correspond to the five autosomes. The characteristic features and the most prominent landmarks of each chromosome are described. By comparing chromosome banding patterns, the possible chromosomal homology between A. ludens and Ceratitis capitata (Wiedemann) is presented. This work shows that polytene maps of A. ludens are suitable for cytogenetic studies in this species and may be used as reference for other Anastrepha species, most of which are also serious agricultural pests.

  18. An EST database of the Caribbean fruit fly, Anastrepha suspensa (Diptera: Tephritidae).

    Science.gov (United States)

    Nirmala, Xavier; Schetelig, Marc F; Yu, Fahong; Handler, Alfred M

    2013-04-01

    Invasive tephritid fruit flies are a great threat to agriculture worldwide and warrant serious pest control measures. Molecular strategies that promote embryonic lethality in these agricultural pests are limited by the small amount of nucleotide sequence data available for tephritids. To increase the dataset for sequence mining, we generated an EST database by 454 sequencing of the caribfly, Anastrepha suspensa, a model tephritid pest. This database yielded 95,803 assembled sequences with 24% identified as independent transcripts. The percentage of caribfly sequences with hits to the closely related tephritid, Rhagoletis pomonella, transcriptome was higher (28%) than to Drosophila proteins/genes (18%) in NCBI. The database contained genes specifically expressed in embryos, genes involved in the cell death, sex-determination, and RNAi pathways, and transposable elements and microsatellites. This study significantly expands the nucleotide data available for caribflies and will be a valuable resource for gene isolation and genomic studies in tephritid insects. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. A morphometric and molecular study of Anastrepha pickeli Lima (Diptera: Tephritidae).

    Science.gov (United States)

    Bomfim, Z V; Lima, K M; Silva, J G; Costa, M A; Zucchi, Robert A

    2011-10-01

    This study investigated the level of morphometric and genetic variability among populations of Anastrepha pickeli Lima from several localities in Brazil, one locality in Bolivia and one in Paraguay. Traditional and geometric morphometric analyses were used, as well as sequencing of a fragment of the cytochrome oxidase gene (COI). Six variables were measured from the aculeus for traditional morphometric analysis and 14 landmarks from the right wing were used for geometric analysis, using 10 specimes/population. The aculeus tip length, aculeus width at the end of the cloaca opening, and the serrate part length contributed with 62.7% for grouping. According to the results from traditional morphometry, there was no significant difference, but the multivariate tests showed that the canonical variables were statistically significant, indicating a difference in the wing conformation among populations. Molecular phylogenetic analysis indicated that the populations clustered into three clades and revealed a high level of genetic variation within A. pickeli populations from various geographic regions. Anastrepha pickeli populations differed among them according to the methods used in this study, showing incongruence among the methods used.

  20. A New Adult Diet Formulation for Sterile Males of Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Orozco-Dávila, Dina; Quintero-Fong, Luis

    2015-08-01

    A new adult diet formulation was evaluated for sterile Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart) males at the emergence and release facility of fruit flies in Mexico. The formulation consists of hydrolyzed protein, sugar, juvenile hormone analogue methoprene, and water. The proportion of the ingredients between the solute (4% hydrolyzed protein and 96% sugar) and solvent (10% methoprene and 90% water) was 5:1. This new formulation was called the 1:24 formulation. The main objectives of this study were to develop a simple way to supply the 1:24 formulation to adults and to compare the sexual performance of these flies with the performance of flies fed a standard diet (called the Mubarqui formulation) used at the emergence and release facility of fruit flies in Mexico. The preparation, time, and cost also were evaluated. The results showed no significant differences in the sexual behaviors of the males (number of males mating, number of males calling, mating latency, and mating duration) between the 1:24 formulation and the Mubarqui formulation. However, the cost and the required preparation time are much lower for the 1:24 formulation process than for the Mubarqui formulation process. Based on these results, we recommend the 1:24 formulation as an additional adult diet option in the handling of sterile flies. Its application is practical and does not require changes in packaging systems. The contribution of our findings and their potential application to the improvement of the sterile insect technique are discussed. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Dynamics of genetic variability in Anastrepha fraterculus (Diptera: Tephritidae) during adaptation to laboratory rearing conditions.

    Science.gov (United States)

    Parreño, María A; Scannapieco, Alejandra C; Remis, María I; Juri, Marianela; Vera, María T; Segura, Diego F; Cladera, Jorge L; Lanzavecchia, Silvia B

    2014-01-01

    Anastrepha fraterculus is one of the most important fruit fly plagues in the American continent and only chemical control is applied in the field to diminish its population densities. A better understanding of the genetic variability during the introduction and adaptation of wild A. fraterculus populations to laboratory conditions is required for the development of stable and vigorous experimental colonies and mass-reared strains in support of successful Sterile Insect Technique (SIT) efforts. The present study aims to analyze the dynamics of changes in genetic variability during the first six generations under artificial rearing conditions in two populations: a) a wild population recently introduced to laboratory culture, named TW and, b) a long-established control line, named CL. Results showed a declining tendency of genetic variability in TW. In CL, the relatively high values of genetic variability appear to be maintained across generations and could denote an intrinsic capacity to avoid the loss of genetic diversity in time. The impact of evolutionary forces on this species during the adaptation process as well as the best approach to choose strategies to introduce experimental and mass-reared A. fraterculus strains for SIT programs are discussed.

  2. Copulatory behaviour and the process of intromission in Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Briceño, R D; Orozco, Dina; Luis Quintero, J; Hanson, Paul; del Refugio Hernández, Ma

    2011-03-01

    Complex genitalia occur in many arthropods and in some species extreme female morphologies lead to serious mechanical difficulties for males. Tephritid flies offer examples of such complex genitalia. Because of their economic importance and the extensive use of sterile male releases for tephritid control in Texas and Mexico, studies have been done on various aspects of their basic reproductive biology, but the process of intromission has received little attention. The distiphallus of the male of Anastrepha ludens is complex. One membranous sac on the distiphallus is capable of rhythmic cycles of inflation and deflation. Inflations of the sac near the base of the distiphallus probably help propel the aedeagus deeper into the female along with stiffening of the basiphallus and may drive the genital rod (which does not transfer sperm) into the ventral receptacle. We were unable to establish an association between some of the behaviours displayed by males during mating and intromission process.

  3. Development of a larval diet for the South American fruit fly Anastrepha fraterculus (Diptera:Tephritidae)

    Science.gov (United States)

    Mass-rearing protocols must be developed. In particular, a cost-effective larval diet, to implement the sterile insect technique against Anastrepha fratercculus (Wiedemann). The key elements of this diet are the optimal nutrients and their concentrations, diet supports or bulking agents, and the pH ...

  4. First record of Anastrepha serpentina (Wiedemann) (Diptera: Tephritidae) in citrus in Brazil.

    Science.gov (United States)

    Lemos, W P; da Silva, R A; Araújo, S C A; Oliveira, E L A; da Silva, W R

    2011-01-01

    Anastrepha serpentina (Wiedemann) is recorded for the first time in citrus (Rutaceae) in Brazil. Specimens were obtained from sweet orange (Citrus sinensis) sampled in the municipalities of Belém and Capitão Poço, and from mandarin orange (Citrus reticulata) from Tomé-Açu, state of Pará, Brazil.

  5. Estimation of populations and sterility induction in Anastrepha luden (Diptera: Tephritidae) fruit flies.

    Science.gov (United States)

    Flores, Salvador; Montoya, Pablo; Toledo, Jorge; Enkerlin, Walther; Liedo, Pablo

    2014-08-01

    The relationship between different release densities of sterile flies and fly trap captures, expressed as flies per trap per day, in the monitoring of Anastrepha ludens (Loew) populations was evaluated in mango orchards. The induction of sterility in fertile females was evaluated using different ratios of sterile: fertile males under field cage conditions. A direct relationship between recaptured flies and densities of release sterile flies was found. However, trap efficiency, expressed as percentage of recaptured flies, decreased as the density of released flies increased. Sterility induction was positively correlated to the ratio of sterile: fertile flies. A significant difference in egg fertility among treatments was observed. The trajectory of sterility induction slowed down after a sterile: wild ratio of 30:1, which suggests that this ratio could be appropriate in an sterile insect technique program with A. ludens. Sterility induction was greater when only sterile males were released than when releasing both sterile males and females, but the differences were not significant. Our findings contribute to a better interpretation of fly captures obtained from the field trapping networks, and to an improvement in the efficiency of sterile insect technique against A. ludens fruit flies, through the implementation of more rational sterile fly release densities.

  6. Copula duration, insemination and sperm allocation in Anastrepha ludens (Diptera: Tephritidae)

    Science.gov (United States)

    The juxtaposition and functional relationship of the sperm storage organs in Anastrepha ludens is described. The spermatheca squash technique has been used to determine mated status in tephritid fruit flies and thus as a measure of compatability and coverage for SIT programs. Female Anastrepha luden...

  7. Haldane's rule and other aspects of reproductive isolation observed in the Anastrepha fraterculus complex (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Selivon Denise

    1999-01-01

    Full Text Available Some aspects of reproductive isolation between allopatric populations of two closely related species of the Anastrepha fraterculus complex (A. fraterculus sp. 1 and sp. 2 were evaluated in laboratory conditions. Most of the crosses were fertile in each species as well as between sp. 2 females and sp. 1 males. In the reciprocal cross only 41.7% of the matings yielded viable progeny. Egg hatching occurred at similar rates within the two species, but was significantly lower in the crosses between the species. Adult emergence did not differ significantly among crosses. The sex ratio of adult progeny within each species, as well as in the hybrid progeny derived from sp. 1 females crossed to sp. 2 males, did not differ from the expected 1:1 ratio. However, in the crosses between sp. 2 females to sp. 1 males, a significant deviation in the sex ratio in favor of females was observed, according to the Haldane's rule. The results reinforce previous data which indicated that A. fraterculus sp. 1 and A. fraterculus sp. 2 are distinct biological entities.

  8. Female receptivity in Anastrepha ludens (Diptera: Tephritidae) is not modulated by male accessory gland products.

    Science.gov (United States)

    Abraham, Solana; Nuñez-Beverido, Nicolás; Contreras-Navarro, Yair; Pérez-Staples, Diana

    2014-11-01

    In numerous insects, accessory gland products (AGPs) transferred from males to females during mating are responsible for female sexual inhibition, but these products can be affected by male condition. Here, we investigated the effect of AGPs on female receptivity of the Mexican fruit fly Anastrepha ludens (Loew), and the effect of male and female strain, male irradiation, AGP dose and sexual activity period on the effectiveness of these AGPs in inhibiting female remating. Injections of aqueous extracts of male accessory glands into the abdomen of females did not reduce their receptivity either at 0.2 or 0.8 male equivalent. Females injected with AGPs behaved like virgin females and not as mated females. Neither male origin, female origin (wild versus mass-reared), nor male irradiation (sterile versus fertile males) had an effect in inhibiting female remating. Also, injections of glands obtained during the sexual calling period of males, or obtained during the morning when males are not sexually active had no effect on female remating behavior. Mated mass-reared females were more likely to remate than wild females. We conclude that inhibition of female sexual receptivity of A. ludens is mediated by factors other than AGPs, such as the number of sperm stored by females, the stimulus of copulation per se or more probably, mediated by a combination of factors. More research is needed to elucidate the role of AGPs in this species. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Inheritance, Realized Heritability, and Biochemical Mechanisms of Malathion Resistance in Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Wang, Luo-Luo; Feng, Zi-Jiao; Li, Ting; Lu, Xue-Ping; Zhao, Jia-Jia; Niu, Jin-Zhi; Smagghe, Guy; Wang, Jin-Jun

    2016-02-01

    To better characterize the resistance development and therefore establish effective pest management strategies, this study was undertaken to investigate the inheritance mode and biochemical mechanisms of malathion resistance in the oriental fruit fly, Bactrocera dorsalis (Hendel), which is one of the most notorious pests in the world. After 22 generations of selection with malathion, the malathion-resistant (MR) strain of B. dorsalis developed a 34-fold resistance compared with a laboratory susceptible strain [malathion-susceptible (MS)]. Bioassay results showed that there was no significant difference between the LD50 values of malathion against the progenies from both reciprocal crosses (F(1)-SR and F(1)-RS). The degree of dominance values (D) was calculated as 0.39 and 0.32 for F(1)-RS and F(1)-SR, respectively. The logarithm dosage-probit mortality lines of the F(2) generation and progeny from the backcross showed no clear plateaus of mortality across a range of doses. In addition, Chi-square analysis revealed significant differences between the mortality data and the theoretical expectations. The realized heritability (h(2)) value was 0.16 in the laboratory-selected resistant strain of B. dorsalis. Enzymatic activities identified significant changes of carboxylesterases, cytochrome P450 (general oxidases), and glutathione S-transferases in MR compared with the MS strain of B. dorsalis. Taken together, this study revealed for the first time that malathion resistance in B. dorsalis follows an autosomal, incompletely dominant, and polygenic mode of inheritance and is closely associated with significantly elevated activities of three major detoxification enzymes. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Monitoring of Bactrocera dorsalis (Diptera: Tephritidae) resistance to cyantraniliprole in the south of China.

    Science.gov (United States)

    Zhang, Ruimin; He, Shiyu; Chen, Jiahua

    2014-06-01

    The oriental fruit fly, Bactrocera dorsalis (Hendel), is a globally important economic insect pest that has evolved resistance to various types of insecticides. Cyantraniliprole (DuPont Cyazypyr) is a new anthranilic diamide insecticide registered to control lepidopteran and sucking insects. The susceptibility of field-collected populations of B. dorsalis to cyantraniliprole was assessed via a diet incorporation bioassay in adults. Based on the obtained LC50 values (ranging from 3.29 to 15.83 microg/g), all the testing populations, including ZZ (Fujian province), HH (Yunnan province), JM (Guangdong province), SY (Hainan province), HZ (Zhejiang province), YL (Guangxi province), SH (Shanghai), WH (Hubei province), and CS (Hunan province), were susceptible to cyantraniliprole, with the samples of WH (Hubei province) being the most tolerant (by 4.80-fold). Two (SY, Hainan province; CS, Hunan province) of the nine field-collected populations of B. dorsalis showed a similar susceptibility to cyantraniliprole, while the remaining populations displayed narrow variations in tolerance compared with the laboratory strain. Synergist assays were performed to determine the potential detoxification mechanisms. Piperonyl butoxide showed significant synergism effects in lab, CS, and resistant strain. S,S,S-tributylphorotrithioate and diethyl maleate also showed obvious synergism effects in resistant strain. A 19.44-fold increase in resistance to cyantraniliprole was observed after 14 generations of selection in the laboratory. The present work clarifies the baseline susceptibility and primary mechanisms of B. dorsalis to cyantraniliprole in the south China and established a cyantraniliprole-resistant strain as well. A sound resistance management strategy is also discussed in relation to the risk of susceptibility.

  11. Nonhost status of mangosteen to Bactrocera dorsalis and Bactrocera carambolae (Diptera: Tephritidae) in Thailand.

    Science.gov (United States)

    Unahawutti, Udorn; Intarakumheng, Rachada; Oonthonglang, Pitawat; Phankum, Salukjit; Follett, Peter A

    2014-08-01

    Postharvest quarantine treatments (irradiation or vapor heat) are used to control fruit flies and other pests in mangosteen (Garcinia mangostana L) exported to the United States and Japan from Thailand. No-choice tests were conducted in the laboratory to determine whether Thai mangosteen is a host for Bactrocera dorsalis (Hendel) (oriental fruit fly) and Bactrocera carambolae Drew & Hancock (carambola fruit fly). Ripe commercial quality fruit (1 wk after harvest) that were either undamaged or damaged by puncturing or peeling the pericarp were exposed to a high density of gravid flies in screen cages and then held for 10 d and dissected to inspect for immature life stages. Undamaged mangosteen fruit were not infested by B. dorsalis and B. carambolae. Partially damaged fruit with shallow punctures in the pericarp that did not extend to the aril also were not infested. Both fruit flies could infest damaged fruit if the pericarp damage allowed oviposition in the aril. Results suggest that natural infestation of mangosteen by B. dorsalis and B. carambolae can only occur if fruit exhibit physical cracks or mechanical injury. Resistance appears to be due to the pericarp hardness and thickness as well as latex secretion. Nonhost status could be used without additional quarantine measures to achieve quarantine security against B. dorsalis and B. carambolae in mangosteen exported from Thailand.

  12. Lethal and sublethal effects of cyantraniliprole on Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Zhang, Ruimin; Jang, Eric B; He, Shiyu; Chen, Jiahua

    2015-02-01

    The oriental fruit fly, Bactrocera dorsalis (Hendel), is one of the most globally important insect pests. Studies were conducted with the novel anthranilic diamide insecticide cyantraniliprole to determine its lethal and sublethal effects on B. dorsalis. An ingestion toxicity bioassay showed that cyantraniliprole was active against B. dorsalis, and the 72 h feeding LC50 was 3.22 µg g(-1) in adult diet for a susceptible strain. Sublethal doses of cyantraniliprole (1.30 µg g(-1) adult diet) induced a hormesis effect on B. dorsalis. The mating competitiveness of B. dorsalis treated with cyantraniliprole at 3.27 µg g(-1) adult diet was significantly lower when compared with the controls. The lower dose (1.30 µg g(-1) adult diet) of cyantraniliprole improved the total mating times of both mating pairs in treated groups and also the mating competitiveness of the treated males when compared with the higher dose and controls. Cyantraniliprole-treated females of the mated pairs with the lower dose laid more eggs. On the fifth day, female receptivity in the treated group was significantly reduced when compared with the controls. These results indicate that cyantraniliprole is effective against B. dorsalis. The inhibition and stimulation effect of cyantraniliprole on the adult's mating performance at different concentrations was proved. © 2014 Society of Chemical Industry.

  13. Epicuticular chemistry reinforces the new taxonomic classification of the Bactrocera dorsalis species complex (Diptera: Tephritidae, Dacinae).

    Science.gov (United States)

    Vaníčková, Lucie; Nagy, Radka; Pompeiano, Antonio; Kalinová, Blanka

    2017-01-01

    Bactrocera invadens Drew, Tsuruta & White, Bactrocera papayae Drew & Hancock, and Bactrocera philippinensis Drew & Hancock, key pest species within the Bactrocera dorsalis species complex, have been recently synonymized under the name Bactrocera dorsalis (Hendel). The closely related Bactrocera carambolae Drew & Hancock remains as a discrete taxonomic entity. Although the synonymizations have been accepted by most researchers, debate about the species limits remains. Because of the economic importance of this group of taxa, any new information available to support or deny the synonymizations is valuable. We investigated the chemical epicuticle composition of males and females of B. dorsalis, B. invadens, B. papayae, B. philippinensis, and B. carambolae by means of one- and two-dimensional gas chromatography-mass spectrometry, followed by multiple factor analyses and principal component analysis. Clear segregation of complex cuticule profiles of both B. carambolae sexes from B. dorsalis (Hendel) was observed. In addition to cuticular hydrocarbons, abundant complex mixtures of sex-specific oxygenated lipids (three fatty acids and 22 fatty acid esters) with so far unknown function were identified in epicuticle extracts from females of all species. The data obtained supports both taxonomic synonymization of B. invadens, B. papayae, and B. philippinensis with B. dorsalis, as well as the exclusion of B. carambolae from B. dorsalis.

  14. Inter-regional mating compatibility among Bactrocera dorsalis populations in Thailand (Diptera,Tephritidae).

    Science.gov (United States)

    Chinvinijkul, Suksom; Srikachar, Sunyanee; Kumjing, Phatchara; Weera Kimjong; Sukamnouyporn, Weerawan; Polchaimat, Nongon

    2015-01-01

    Mating compatibility among recently colonized (wildish) populations of Bactrocera dorsalis (Hendel) from different geographic origins in Thailand was assessed through inter-regional mating tests. Outdoor octagonal nylon screen field cages containing single potted mango trees (Mangifera indica L.) were used. Sexual compatibility was determined using the index of sexual isolation (ISI), the male relative performance index (MRPI), and the female relative performance index (FRPI). The ISI values indicated that the northern population of Bactrocera dorsalis from Chiang Mai province was sexually compatible with the southern population of Bactrocera dorsalis (previously Bactrocera papayae) from Nakhon Si Thammarat province. The MRPI values showed that the northern males had a slightly higher tendency to mate than southern males, while the FRPI data reflected that females of both origins participated equally in matings. In all combinations there were no differences between homotypic and heterotypic couples in mating latency. Southern males tended to mate first with southern females, followed by northern males mating with northern females, while the latest matings involved heterotypic couples, in particular northern males mating with southern females. Overall, more couples were collected from higher parts of the field cage and the upper tree canopy, while there were no differences between the origins of flies in terms of elevation of couples within the cage. Laboratory assessments of fecundity showed no differences in the average number of eggs resulting from inter-regional crosses. Development of immature stages was also equal in the two hybrid crosses, with no differences found in the number of pupae produced, percentage pupal recovery, and percent adult emergence. The practical implication of this study is that colony of Bactrocera dorsalis derived from any northern or southern region of Thailand can potentially be used in sterile insect technique programs against this pest.

  15. Isolation and Molecular Characterization of the Transformer Gene From Bactrocera cucurbitae (Diptera: Tephritidae)

    Science.gov (United States)

    Luo, Ya; Zhao, Santao; Li, Jiahui; Li, Peizheng

    2017-01-01

    transformer (tra) is a switch gene of sex determination in many insects, particularly in Dipterans. However, the sex determination pathway in Bactrocera cucurbitae (Coquillett), a very destructive pest on earth, remains largely uncharacterized. In this study, we have isolated and characterized one female-specific and two male-specific transcripts of the tra gene (Bcutra) of B. cucurbitae. The genomic structure of Bcutra has been determined and the presence of multiple conserved Transformer (TRA)/TRA-2 binding sites in Bcutra has been found. BcuTRA is highly conservative with its homologues in other tephritid fruit flies. Gene expression analysis of Bcutra at different developmental stages demonstrates that the female transcript of Bcutra appears earlier than the male counterparts, indicating that the maternal TRA is inherited in eggs and might play a role in the regulation of TRA expression. The conservation of protein sequence and sex-specific splicing of Bcutra and its expression patterns during development suggest that Bcutra is probably the master gene of sex determination of B. cucurbitae. Isolation of Bcutra will facilitate the development of a genetic sexing strain for its biological control.

  16. Oral and Topical Toxicity of Fipronil to Melon Fly and Oriental Fruit Fly (Diptera: Tephritidae)

    Science.gov (United States)

    BACKGROUND: The objective of this study was to develop basic oral and topical toxicity data for Fipronil in Solulys protein bait to wild melon fly, Bactrocera cucurbitae (Coquillett) and the oriental fruit fly, Bactrocera dorsalis (Hendel). RESULTS: For the oral study, both females and males were ...

  17. Population dynamics of safflower capsule flies (Diptera: Tephritidae in Kohgiluyeh safflower farms of Iran

    Directory of Open Access Journals (Sweden)

    K. Saeidi

    2015-08-01

    Full Text Available Oilseeds such as flax, canola, safflower, soybean and sunflower, which are annual plants, provide the world’s major source of vegetable oils, although the highest oil yield comes from oil-bearing tree fruits. One of the most popular oil seeds is safflower (Carthamus tinctorius L., which belongs to the Asteraceae family. Due to the ability of this plant to grow in dry and semi-dry conditions, safflower oil has the potential to be a commercially profitable product in Iran. Seasonal populations of safflower capsule flies were studied in Kohgiluyeh safflower farms, Iran, from March to May in 2008 and 2009. Four yellow sticky traps were used to monitor populations of fruit flies in the safflower farms. Traps were checked once a week during the sampling period. The traps were emptied weekly into insect collection vials containing 70% ethanol. Data were analysed with a two-way ANOVA. The relation between abiotic factors and species abundance was analysed with multiple linear regression. The results emphasized that Acanthiophilus helianthi was the most serious pest of safflower under the ecological conditions found in Gachsaran, being present in the field throughout three months of the year (March to May. Chaetorellia carthami was present in safflower fields from March to May, but in significant numbers only during April and May. Terellia luteola was present in safflower fields from March to May and in significant numbers only in late April, it does not seem to be a serious pest in safflower farms under Gachsaran’s ecological conditions.

  18. Determination of lipase activity in the larval midgut of Bacterocera oleae Gmelin (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    S Delkash-Roudsari

    2014-02-01

    Full Text Available In the current study, digestive lipase activity was determined and characterized in the third larval instars of olive fly, Bactericera oleae as the first time in dipteran order. By using two sample fractions, it was found that the enzyme had higher activity in membrane-bound fraction than that of soluble fraction. Optimal pH of soluble lipase was found to be 4 and 6 but membrane-bound lipase showed pH 4 as optimal value. Optimal temperatures for soluble and membrane-bound lipase were obtained to be 35 and 50 °C, respectively. Activities of digestive soluble and membrane-bound lipases decreased by using various mono- and di-valent ions. Since, fruits of olive are full of various oils, digestive lipases of B. oleae larvae have critical role in their digestion. So, these enzymes might be a good target for developing inhibitors and resistant varieties.

  19. Effect of dietary components on larval life history characteristics in the medfly (Ceratitis capitata: Diptera, Tephritidae).

    Science.gov (United States)

    Nash, William J; Chapman, Tracey

    2014-01-01

    The ability to respond to heterogenous nutritional resources is an important factor in the adaptive radiation of insects such as the highly polyphagous Medfly. Here we examined the breadth of the Medfly's capacity to respond to different developmental conditions, by experimentally altering diet components as a proxy for host quality and novelty. We tested responses of larval life history to diets containing protein and carbohydrate components found in and outside the natural host range of this species. A 40% reduction in the quantity of protein caused a significant increase in egg to adult mortality by 26.5%±6% in comparison to the standard baseline diet. Proteins and carbohydrates had differential effects on larval versus pupal development and survival. Addition of a novel protein source, casein (i.e. milk protein), to the diet increased larval mortality by 19.4%±3% and also lengthened the duration of larval development by 1.93±0.5 days in comparison to the standard diet. Alteration of dietary carbohydrate, by replacing the baseline starch with simple sugars, increased mortality specifically within the pupal stage (by 28.2%±8% and 26.2%±9% for glucose and maltose diets, respectively). Development in the presence of the novel carbohydrate lactose (milk sugar) was successful, though on this diet there was a decrease of 29.8±1.6 µg in mean pupal weight in comparison to pupae reared on the baseline diet. The results confirm that laboratory reared Medfly retain the ability to survive development through a wide range of fluctuations in the nutritional environment. We highlight new facets of the responses of different stages of holometabolous life histories to key dietary components. The results are relevant to colonisation scenarios and key to the biology of this highly invasive species.

  20. Oviposition preference hierarchy in Ceratitis capitata (Diptera, Tephritidae: influence of female age and experience

    Directory of Open Access Journals (Sweden)

    Joachim-Bravo Iara S.

    2001-01-01

    Full Text Available The influence of two factors, age and previous experience, on the oviposition hierarchy preference of Ceratitis capitata (Wiedemann, 1824 females was studied. Two populations were analyzed: one reared in laboratory during 17 years and the other captured in nature. In the first experiment the oviposition preference for four fruits, papaya, orange, banana and apple was tested at the beginning of oviposition period and 20 days past. The results showed that the wild females as much the laboratory ones had an oviposition preference hierarchy at the beginning of peak period of oviposition. However this hierarchic preference disappeared in a later phase of life. In the second experiment the females were previously exposed to fruits of different hierarchic positions and afterwards their choice was tested in respect to the oviposition preference for those fruits. The results showed that there was an influence of the previous experience on the posterior choice of fruits to oviposition when the females were exposed to fruits of lower hierarchic position.

  1. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae in southern Syria

    Directory of Open Access Journals (Sweden)

    Mansour Mohammed

    2016-09-01

    Full Text Available Population fluctuations of the Mediterranean fruit fly (medfly, Ceratitis capitata, were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria (Damascus Ghota, Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab. Medfly adults were monitored weekly all year around using Jackson traps baited with trimedlure dispensers. Larvae were also sampled in Damascus Ghota by collecting fruits from ripe or ripening fruit trees and recording the number of larvae emerged from these fruits. In addition, suspected overwintering refuges were sampled at weekly intervals during the three coldest months of the year (December – February and the number of collected larvae was recorded. The results of trap catches and fruit sampling studies showed a similar pattern of occurrence of medfly populations in the study areas, particularly in Damascus Ghota, during the three years of the study. In Damascus Ghota, flies were caught continuously from early June to late December with some variability between years. Two distinct periods of high fly activity were observed: the first one occurred in August and the second in November with a much higher amplitude. In general, seasonal fluctuations in the pattern of occurrence were influenced by differences in temperature and abundance of preferred host fruits. Traps on fig Ficus carica and oriental persimmon Diospyros kaki trees caught the highest numbers of flies, and fruits collected from these trees showed the highest level of infestation, reaching 100% for fig fruit late in the season. Sampling fruits (in Damascus Ghota from trees during the three coldest months of the year showed that a small population of medfly larvae was able to survive winter conditions in prickly pear Opuntia vulgaris fruit left on the trees. In the other areas of the study (Zabadani, Sargaiah, Rankus, Orneh and Ain Al-Arab, only a few flies were caught.

  2. Hot-water phytosanitary treatment against Ceratitis capitata (Diptera: Tephritidae) in 'Ataulfo' mangoes.

    Science.gov (United States)

    Hernández, Emilio; Rivera, Pedro; Bravo, Bigail; Toledo, Jorge; Caro-Corrales, José; Montoya, Pablo

    2012-12-01

    We determined the thermal death rate constants and mortality curves for the eggs and different instars of Ceratitis capitata (Mediterranean fruit fly) (Wiedemann) submerged in isolation in water at 44, 46, and 48 degrees C and submerged within fruits of Mangifera indica (mango) (L.) in water at 43.1, 44.1, 45.1, and 46.1 degrees C. The first instar was the most tolerant to this treatment, with estimated times for achieving 99.9968% mortality of 103.28, 92.73, and 92.49 min at temperatures of 43.1, 44.1, and 45.1 degrees C, respectively. The results of the study indicate that 'Ataulfo' mangoes weighing capitata while maintaining market quality at least for 15 d.

  3. Transgenic sexing system for Ceratitis capitata (Diptera: Tephritidae) based on female-specific embryonic lethality.

    Science.gov (United States)

    Ogaugwu, Christian E; Schetelig, Marc F; Wimmer, Ernst A

    2013-01-01

    Fruit fly pest species have been successfully controlled and managed via the Sterile Insect Technique (SIT), a control strategy that uses infertile matings of sterile males to wild females to reduce pest populations. Biological efficiency in the field is higher if only sterile males are released in SIT programs and production costs are also reduced. Sexing strains developed in the Mediterranean fruit fly Ceratitis capitata (medfly) through classical genetics are immensely beneficial to medfly SIT programs but exhibit reduced fertility and fitness. Moreover, transfer of such classical genetic systems to other tephritid species is difficult. Transgenic approaches can overcome this limitation of classical genetic sexing strains (GSSs), but had resulted so far in transgenic sexing strains (TSSs) with dominant lethality at late larval and pupal stages. Here we present a transgene-based female-specific lethality system for early embryonic sexing in medfly. The system utilizes the sex-specifically spliced transformer intron to restrict ectopic mRNA translation of the pro-apoptotic gene hid(Ala5) to females only. The expression of this lethal effector gene is driven by a tetracycline-repressible transactivator gene tTA that is under the control of promoters/enhancers of early-acting cellularization genes. Despite observed position effects on the sex-specific splicing, we could effectively establish this early-acting transgenic sexing system in the medfly C. capitata. After satisfactory performance in large scale tests, TSSs based on this system will offer cost-effective sexing once introduced into SIT programs. Moreover, this approach is straight forward to be developed also for other insect pest and vector species. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Molecular cloning and expression of nanos in the Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Ogaugwu, Christian E; Wimmer, Ernst A

    2013-01-01

    The gene nanos (nos) is a maternal-effect gene that plays an important role in posterior patterning and germ cell development in early stage embryos. nos is known from several diverse insect species, but has so far not been described for any Tephritid fruit fly. Here, we report the molecular cloning and expression pattern of the nos orthologous gene, Ccnos, in the Mediterranean fruit fly Ceratitis capitata, which is a destructive pest of high agricultural importance. CcNOS contains 398 amino acids and has a C-terminal region with two conserved CCHC zinc-binding motifs known to be essential for NOS function. Transcripts of Ccnos were confirmed by in situ hybridization to be maternally-derived and localized to the posterior pole of early stage embryos. Regulatory regions of nos have been employed in genetic engineering in some dipterans such as Drosophila and mosquitoes. Given the similarity in spatial and temporal expression between Ccnos and nos orthologs from other dipterans, its regulatory regions will be valuable to generate additional genetic tools that can be applied for engineering purposes to improve the fight against this devastating pest. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Seasonality of the Mediterranean Fruit Fly (Diptera: Tephritidae) on Terceira and Sao Jorge Islands, Azores, Portugal

    Science.gov (United States)

    Lopes, D.J.H.; Mexia, A.M.M.; Mumford, J.D.

    2017-01-01

    Population dynamics studies are very important for any area-wide control program as they provide detailed knowledge about the relationship of Medfly [Ceratitis capitata (Wiedemann)] life cycle with host availability and abundance. The main goal of this study is to analyse seasonality of C. capitata in Terceira and Sao Jorge Islands (Azores archipelago) using field and laboratory data collected during (2010–2014) CABMEDMAC (MAC/3/A163) project. The results from Sao Jorge Island indicate significantly lower male/female ratio than on Terceira Island. This is an important finding specially regarding when stablishing the scenario parameters for a sterile insect technique application in each island. The population dynamics of C. capitata are generally linked with host fruit availability and abundance. However, on Terceira Island fruit infestation levels are not synchronized with the trap counts. For example, there was Medfly infestations in some fruits [e.g., Solanum mauritianum (Scop.)] while in the nearby traps there were no captures at the same time. From this perspective, it is important to denote the importance of wild invasive plants, on the population dynamics of C. capitata, as well important to consider the possibility of having different densities of traps according to the characteristics of each area in order to improve the network of traps surveillance’s sensitivity on Terceira Island. PMID:28082349

  6. Global Assessment of Seasonal Potential Distribution of Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    Szyniszewska, Anna M.; Tatem, Andrew J.

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species. PMID:25375649

  7. Sexual behavior of mutant strains of the medfly Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    R.D Briceño

    2003-09-01

    Full Text Available Males of the mutant strains (blind, vestigal-winged of the Mediterranean fruit fly (medfly, Ceratits capitata (Wiedmann showed differences in behavior compared with control (mass-reared males. Mutant males made fewer mating attempts and achieved fewer matings than control males. Vestigal-winged females copulated less frequently with both mutants. Blind males climbed rather than jumped onto females and copulated in very low numbers compared with control and vestigal males. Blind females copulated normally with control, males and in very low numbers with both types of mutant malesMachos mutantes (ciegos, alas vestigiales de la mosca del mediterráneo Ceratitis capitata (Wiedmann mostraron diferencias en conducta comparados con los machos testigo (cría masiva. Los machos mutantes, realizaron menos intentos por aparearse y lograron menos apareamientos que los machos testigo. Las hembras con alas vestigiales, copularon menos con ambas clases de mutantes. Los machos ciegos, subieron en lugar de saltar sobre las hembras y copularon en números muy bajos comparados con los machos testigo y con los de alas vestigiales. Las hembras ciegas, copularon de forma normal con los machos testigo y en números muy bajos con ambos tipos de machos mutantes

  8. Population Fluctuation of Ceratitis capitata (Diptera: Tephritidae) as a Function of Altitude in Eastern Guatemala.

    Science.gov (United States)

    Flores, S; Montoya, P; Ruiz-Montoya, L; Villaseñor, A; Valle, A; Enkerlin, W; Liedo, P

    2016-08-01

    Population fluctuations of Ceratitis capitata (Wiedemann) were evaluated over a period of 12 mo in four altitudinal strata (400-750, 750-1,100, 1,100-1,450, and 1,450-1,800 meters above sea level, masl) in Eastern Guatemala. Within each altitudinal range, sampling plots were established in coffee plantations and adjacent areas, in which Jackson traps were set and baited with Trimedlure. Coffee berries and other host fruits were collected. Population density was lowest at the 400-750 masl stratum and highest at 1,450-1,800 masl. At every altitudinal range, the fluctuations of the pest were associated mainly with the availability of ripe coffee berries as a primary host. From 750-1,450 masl, the pest was also associated with the availability of sweet orange and mandarins in commercial and backyard orchards. The highest densities of the pest were recorded in the dry season. Citrus were the main alternate host where ripe coffee berries were not available. This knowledge on population dynamics of C. capitata will contribute to develop more effective area-wide pest management strategies including the use of sterile insects, natural enemies, and bait sprays. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Photosensitizing effect of hematoporphyrin IX on immature stages of Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Pujol-Lereis, Luciana Mercedes; Massaldi, Ana; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2010-01-01

    Immature stages of Ceratitis capitata were tested as a model for hematoporphyrin IX (HP IX) phototoxicity. The lethal concentration 50 (LC(50)) of HP IX in the food was determined during postembryonic development until adult emergence as 0.173 mm (95% CI: 0.138-0.209). The corresponding HP IX LC(50) during the dispersal period alone was 0.536 mm (95% CI: 0.450-0.633). HP IX toxicity was compared against Phloxine B (PhB) (0.5 mm). HP IX elicited a mortality of 90.87%, which was mainly concentrated during prepupal and early pupal stages. PhB mortality was much lower (56.88%) and occurred mainly during the adult pharate stage. A direct correlation between light-dependent HP IX mortality, evidence of reactive oxygen species (ROS) and lipid peroxidation (conjugated dienes and thiobarbituric acid reactive substances) was established in C. capitata larvae. ROS were found to be very significant in both the brain and in the gut.

  10. Effect of dietary components on larval life history characteristics in the medfly (Ceratitis capitata: Diptera, Tephritidae.

    Directory of Open Access Journals (Sweden)

    William J Nash

    Full Text Available BACKGROUND: The ability to respond to heterogenous nutritional resources is an important factor in the adaptive radiation of insects such as the highly polyphagous Medfly. Here we examined the breadth of the Medfly's capacity to respond to different developmental conditions, by experimentally altering diet components as a proxy for host quality and novelty. METHODOLOGY/PRINCIPAL FINDINGS: We tested responses of larval life history to diets containing protein and carbohydrate components found in and outside the natural host range of this species. A 40% reduction in the quantity of protein caused a significant increase in egg to adult mortality by 26.5%±6% in comparison to the standard baseline diet. Proteins and carbohydrates had differential effects on larval versus pupal development and survival. Addition of a novel protein source, casein (i.e. milk protein, to the diet increased larval mortality by 19.4%±3% and also lengthened the duration of larval development by 1.93±0.5 days in comparison to the standard diet. Alteration of dietary carbohydrate, by replacing the baseline starch with simple sugars, increased mortality specifically within the pupal stage (by 28.2%±8% and 26.2%±9% for glucose and maltose diets, respectively. Development in the presence of the novel carbohydrate lactose (milk sugar was successful, though on this diet there was a decrease of 29.8±1.6 µg in mean pupal weight in comparison to pupae reared on the baseline diet. CONCLUSIONS: The results confirm that laboratory reared Medfly retain the ability to survive development through a wide range of fluctuations in the nutritional environment. We highlight new facets of the responses of different stages of holometabolous life histories to key dietary components. The results are relevant to colonisation scenarios and key to the biology of this highly invasive species.

  11. Export of commercial 'Hass' avocados from Argentina poses negligible risk of ceratitis capitata (Diptera: Tephritidae) infestation

    Science.gov (United States)

    Quarantine restrictions due to the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), prevent Argentina from exporting avocados, Persea americana Miller, cv. Hass, to certain countries. Hass avocado at the hard, mature green stage is potentially a conditional nonhost for C. capitata, which cou...

  12. Seasonal occurrence of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann, 1824) (Diptera: Tephritidae) in southern Syria

    National Research Council Canada - National Science Library

    Mohammed Mansour; Fater Mohamad

    2016-01-01

      Population fluctuations of the Mediterranean fruit fly (medfly), [Ceratitis capitata], were investigated between 1999 and 2001 at several locations representing fruit production areas in the southern part of Syria...

  13. Antennal and behavioral responses to putrescine and ammonium bicarbonate in the Caribbean fruit fly (Diptera: tephritidae)

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies uses a 2-component lure that emits ammonia and putrescine, both regarded as protein cues. This study used electroantennography and flight tunnel bioassays to quantify olfactory and behavioral responses of A. suspensa to vapors from ammonium bicar...

  14. Effective sampling range of food-based attractants for female Anastrepha suspensa (Diptera: Tephritidae)

    Science.gov (United States)

    Release/recapture studies were conducted with both feral and sterile females of the Caribbean fruit fly, Anastrepha suspensa (Loew), to determine sampling range for a liquid protein bait (hydrolyzed torula yeast) and for a two-component synthetic lure (ammonium acetate and putrescine). Tests were d...

  15. Antennal and behavioral responses of Anastrepha suspensa (Diptera: Tephritidae) to a series of homologous terminal diamines

    Science.gov (United States)

    Current monitoring programs for Anastrepha fruit flies use a two-component synthetic attractant consisting of ammonium acetate (AA) and putrescine (1,4-diaminobutane). Identification of additional attractant chemicals may improve trapping efficacy. We examined response of the Caribbean fruit fly, ...

  16. Response of Anastrepha suspensa (Diptera: Tephritidae) to terminal diamines in a food-based synthetic attractant.

    Science.gov (United States)

    A current trapping system for Anastrepha fruit flies utilizes a two-component food-based synthetic attractant consisting of ammonium acetate and putrescine (1,4-diaminobutane) lures. Development of more effective monitoring programs may be realized through identification of additional attractant ch...

  17. Controlled-release panel traps for the Mediterranean fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Leonhardt, B A; Cunningham, R T; Chambers, D L; Avery, J W; Harte, E M

    1994-10-01

    Solid, controlled-release dispensers containing 2 g of the synthetic attractant trimedlure now are used in Jackson traps to detect the Mediterranean fruit fly, Ceratitis capitata (Wiedemann). Panel traps consisting of trimedlure mixed in a sticky substance and spread on the surfaces of a plastic panel are used to delineate the limits of discovered insect infestations in California. We describe the development of controlled-release, polymeric panels that prolong release of trimedlure and a highly attractive analog, ceralure. Attractants were incorporated in a polyethylene matrix to form panels and in a polymer coating on cardboard panels that then were evaluated by biological and chemical assay. In addition, commercial polymer matrix panels were evaluated. Field bioassay tests conducted in Hilo, HI, using released flies and in Guatemala in a natural population showed that the polyethylene matrix panel became brittle and cracked during field exposure and that release rates of the attractants were relatively low. The coated cardboard panels were stable under field conditions and yielded high fly captures for up to 6 wk. Farma Tech commercial panels containing 12.3 and 23.4 g of trimedlure remained highly attractive throughout a 134-d test in Hawaii and appear to be a long-lasting alternative to panels coated with trimedlure in Stikem. The cost of the relatively high dose of trimedlure is offset by the prolonged active life of the panel. Commercial panels from AgriSense (10 g trimedlure and 10 g ceralure) released the attractants at a slower rate and were less attractive.

  18. Higher phylogeny of frugivorous flies (Diptera, Tephritidae, Dacini): localised partition conflicts and a novel generic classification.

    Science.gov (United States)

    Virgilio, Massimiliano; Jordaens, Kurt; Verwimp, Christophe; White, Ian M; De Meyer, Marc

    2015-04-01

    The phylogenetic relationships within and among subtribes of the fruit fly tribe Dacini (Ceratitidina, Dacina, Gastrozonina) were investigated by sequencing four mitochondrial and one nuclear gene fragment. Bayesian, maximum likelihood and maximum parsimony analyses were implemented on two datasets. The first, aiming at obtaining the strongest phylogenetic signal (yet, having lower taxon coverage), consisted of 98 vouchers and 2338 concatenated base pairs (bp). The second, aiming at obtaining the largest taxonomic coverage (yet, providing lower resolution), included 159 vouchers and 1200 concatenated bp. Phylogenetic relationships inferred by different tree reconstruction methods were largely congruent and showed a general agreement between concatenated tree topologies. Yet, local conflicts in phylogenetic signals evidenced a number of critical sectors in the phylogeny of Dacini fruit flies. All three Dacini subtribes were recovered as monophyletic. Yet, within the subtribe Ceratitidina only Perilampsis and Capparimyia formed well-resolved monophyletic groups while Ceratitis and Trirhithrum did not. Carpophthoromyia was paraphyletic because it included Trirhithrum demeyeri and Ceratitis connexa. Complex phylogenetic relationships and localised conflict in phylogenetic signals were observed within subtribe Dacina with (a) Dacus, (b) Bactrocera (Zeugodacus) and (c) all other Bactrocera species forming separate clades. The subgenus Bactrocera (Zeugodacus) is therefore raised to generic rank (Zeugodacus Hendel stat. nov.). Additionally, Bactrocera subgenera grouped under the Zeugodacus group should be considered under new generic combinations. Although there are indications that Zeugodacus and Dacus are sister groups, the exact relationship between Zeugodacus stat. nov., Dacus and Bactrocera still needs to be properly resolved.

  19. Paraffin wax emulsion for increased rainfastness of insecticidal bait to control Rhagoletis pomonella (Diptera: Tephritidae).

    Science.gov (United States)

    Teixeira, Luís A F; Wise, John C; Gut, Larry J; Isaacs, Rufus

    2009-06-01

    In regions with a humid summer climate, the use of water-soluble bait to control apple maggot is often limited by rainfall. We studied increasing the rainfastness of GF-120 fruit fly bait by adding paraffin wax emulsion. First, we verified that adding 10% wax to a mixture containing 16.7% GF-120 did not reduce the mortality of female apple maggot compared with GF-120 without wax. In addition, we determined that fly mortality caused by GF-120 plus wax subjected to simulated rain was similar to that caused by GF-120 without wax not subjected to rain. Other assays showed that higher fly mortality resulted from increasing the proportion of wax from 10 to 15%, and lower mortality resulted from decreasing GF-120 from 16.7 to 10 or 5%. The availability of spinosad on or near droplets of a mixture consisting of 5, 10, or 15% GF-120 and 15% wax was determined before and after the droplets were subjected to three 15-min periods of simulated rain. We found an initial steep decline in dislodgeable spinosad and smaller decreases after subsequent periods of rain. In a small-plot field trial, fruit infestation by apple maggot in plots treated with a mixture consisting of 16.7% GF-120 and 19.2% wax was less than in plots treated with 16.7% GF-120 without wax but not less than in control plots. Overall, we found that adding paraffin wax emulsion to GF-120 increased rainfastness in laboratory bioassays, and specifically that it retained the active ingredient spinosad. However, our field data suggest that optimal rainfastness requires the development of mixtures with > 19.2% wax, which may preclude application using standard spray equipment.

  20. Habitat-specific flight period in the cherry fruit fly Rhagoletis cingulata (Loew) (Diptera: Tephritidae).

    Science.gov (United States)

    Teixeira, Luís A F; Isaacs, Rufus; Gut, Larry J

    2007-12-01

    Flight periods of the cherry fruit fly, Rhagoletis cingulata (Loew), were compared in the major sweet and tart cherry-growing regions of Michigan, among neglected orchards, managed orchards, and natural areas containing the ancestral host, black cherry. Traps were deployed from early June to late September 2005 and 2006. Captures indicated that cherry fruit fly has an early flight (June-July) in neglected orchards, a mid-season flight peaking immediately after harvest (June-August) in managed orchards, and an extended flight covering most of the season (June-September) in natural areas. We found that the period of fruit infestation mirrored the flight period in neglected and managed orchards. In natural areas, we found infestation late in the season only. The relative emergence periods for adults reared from pupae collected from the three habitats and maintained under the same conditions coincided with adult flight periods for each habitat. We also studied factors related to fruit availability that may have a role in shaping the flight periods. Fruit abundance decreased rapidly early in the season in neglected orchards, whereas in managed orchards, fruit left after harvest remained on the trees until late August. Measurements of fruit size and skin firmness revealed that fly activity in neglected and managed orchards began immediately after fruit increased in size and skin firmness decreased, whereas in natural areas, the flight began before fruit matured. In managed orchards, fruit harvest and insecticide sprays likely maintain the late flight period of resident fly populations by preventing the use of fruit earlier in the season. However, a significant proportion of these resident flies may still emerge before harvest and increase the risk of costly fruit infestation.

  1. A review of hymenopterous parasitoid guilds attacking Anastrepha spp. and Ceratitis capitata (Diptera: Tephritidae) in Argentina

    Energy Technology Data Exchange (ETDEWEB)

    Ovruski, Sergio M.; Orono, Luis E.; Nunez-Campero, Segundo; Schliserman, Pablo; Albornoz-Medina, Patricia; Bezdjian, Laura P.; Nieuwenhove, Guido A. Van; Martin, Cristina B. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Tucuman (Argentina). Planta Piloto de Procesos Industriales Microbiologicos y Biotecnologia. Div. Control Biologico de Plagas

    2006-07-01

    This study provides detailed information on the diversity, abundance, guilds, host plant and host fly ranges, distribution, and taxonomic status of hymenopterous parasitoid species associated with Ceratitis capitata (Wiedemann) and Anastrepha spp. (A. fraterculus (Wiedemann) and A. schultzi Blanchard) in Argentina. Moreover, the article also argues future needs regarding the use of some parasitoid species as an alternative tool in fruit fly management programs of the National Fruit Fly Control and Eradication Program (PROCEM-Argentina). Data used for this work were obtained from numerous old and recent published articles on fruit fly parasitoids in Argentina. (author)

  2. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Anna M Szyniszewska

    Full Text Available The Mediterranean fruit fly (Medfly is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  3. Novel toxicity of Bacillus thuringiensis strains against the melon fruit fly, Bactrocera cucurbitae (Diptera: Tephritidae).

    Science.gov (United States)

    Shishir, Md Asaduzzaman; Akter, Asma; Bodiuzzaman, Md; Hossain, M Aftab; Alam, Md Musfiqul; Khan, Shakil Ahmed; Khan, Shakila Nargis; Hoq, M Mozammel

    2015-01-01

    Bactrocera cucurbitae (melon fruit fly) is one of the most detrimental vegetable-damaging pests in Bangladesh. The toxicity of Bacillus thuringiensis (Bt) has been reported against a few genera of Bactrocera in addition to numerous other insect species. Bt strains, harbouring cry1A-type genes were, therefore, assayed in vivo against the 3(rd) instar larvae of B. cucurbitae in this study. The biotype-based prevalence of cry1 and cry1A genes was calculated to be 30.8% and 11.16%, respectively, of the test strains (n=224) while their prevalence was greatest in biotype kurstaki. Though three indigenous Bt strains from biotype kurstaki with close genetic relationship exhibited higher toxicity, maximum mortalities were recorded for Btk HD-73 (96%) and the indigenous Bt JSc1 (93%). LC50 and LC99 values were determined to be 6.81 and 8.32 for Bt JSc1, 7.30 and 7.92 for Bt SSc2, and 6.99 and 7.67 for Btk HD-73, respectively. The cause of toxicity and its variation among the strains was found to be correlated with the synergistic toxic effects of cry1, cry2, cry3 and cry9 gene products, i.e. relevant Cry proteins. The novel toxicity of the B. thuringiensis strains against B. cucurbitae revealed in the present study thus will help in developing efficient and eco-friendly control measures such as Bt biopesticides and transgenic Bt cucurbits.

  4. Global assessment of seasonal potential distribution of Mediterranean fruit fly, Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Szyniszewska, Anna M; Tatem, Andrew J

    2014-01-01

    The Mediterranean fruit fly (Medfly) is one of the world's most economically damaging pests. It displays highly seasonal population dynamics, and the environmental conditions suitable for its abundance are not constant throughout the year in most places. An extensive literature search was performed to obtain the most comprehensive data on the historical and contemporary spatio-temporal occurrence of the pest globally. The database constructed contained 2328 unique geo-located entries on Medfly detection sites from 43 countries and nearly 500 unique localities, as well as information on hosts, life stages and capture method. Of these, 125 localities had information on the month when Medfly was recorded and these data were complemented by additional material found in comprehensive databases available online. Records from 1980 until present were used for medfly environmental niche modeling. Maximum Entropy Algorithm (MaxEnt) and a set of seasonally varying environmental covariates were used to predict the fundamental niche of the Medfly on a global scale. Three seasonal maps were also produced: January-April, May-August and September-December. Models performed significantly better than random achieving high accuracy scores, indicating a good discrimination of suitable versus unsuitable areas for the presence of the species.

  5. Efficacy of wax matrix bait stations for Mediterranean Fruit Flies (Diptera: Tephritidae)

    Science.gov (United States)

    Tests were conducted that evaluated efficacy of wax matrix bait stations for Ceratitis capitata (Wiedemann) adults in Guatemala. Bait stations were exposed to outdoor conditions to determine effect of weathering on longevity as indicated by bait station age. Results of laboratory tests found that ba...

  6. Exposure to tea tree oil enhances the mating success of male Mediterranean fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    The aroma of various plant essential oils has been shown to enhance the mating competitiveness of males of the Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann). Laboratory observations revealed that male medflies show strong short-range attraction to tea tree oil (TTO hereafter) deri...

  7. Volatile host fruit odors as attractants for the oriental fruit fly (Diptera: Tephritidae).

    Science.gov (United States)

    Cornelius, M L; Duan, J J; Messing, R H

    2000-02-01

    We examined the responses of oriental fruit flies, Bactrocera dorsalis Hendel, to the odors of different stages and types of fruit presented on potted trees in a field cage. Females were most attracted to odors of soft, ripe fruit. Odors of common guava were more attractive to females than papaya and starfruit, and equally as attractive as strawberry guava, orange, and mango. In field tests, McPhail traps baited with mango, common guava, and orange captured equal numbers of females. Traps baited with mango were compared with 2 commercially available fruit fly traps. McPhail traps baited with mango captured more females than visual fruit-mimicking sticky traps (Ladd traps) and equal numbers of females as McPhail traps baited with protein odors. Results from this study indicate that host fruit volatiles could be used as lures for capturing oriental fruit flies in orchards.

  8. Livestock manure as an alternative attractant for fruit flies (Diptera: Tephritidae in guava tree

    Directory of Open Access Journals (Sweden)

    Rosenya Michely Cintra Filgueiras

    2016-03-01

    Full Text Available Fruit flies are typically managed using hydrolyzed protein, which is difficult for family farmers to obtain. This study aimed at assessing the efficiency of livestock manure for monitoring and/or controlling this pest in guava tree orchards. The first experiment tested the efficiency of guava juice and manure from cattle, sheep, pig, horse and chicken as attractants for fruit flies. Once the best bait had been established, a second experiment was conducted using guava juice and chicken manure extract at concentrations of 10 %, 30 %, 50 %, 70 % and 100 %. A third assay analyzed guava juice and chicken manure extract (10 % at three attractant aging periods (3, 7 and 14 days after trap installation. The cost-effectiveness ratio between guava juice and extract was also analyzed. It was concluded that fruit flies prefer the chicken manure extract (10 %, with greater capture observed three days after trap installation, which can replace the guava juice in the agroecological management of fruit flies in guava trees in family farms, since it is low cost and efficient.

  9. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    Science.gov (United States)

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (Ptebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  10. Phylogenetic relationships between flies of the Tephritinae subfamily (Diptera, Tephritidae) and their symbiotic bacteria.

    Science.gov (United States)

    Mazzon, Luca; Martinez-Sañudo, Isabel; Simonato, Mauro; Squartini, Andrea; Savio, Claudia; Girolami, Vincenzo

    2010-07-01

    The Tephritinae is considered the most specialized subfamily of fruit flies, predominantly infesting flowerheads of Asteraceae. Some species are known to host specific non-culturable symbiont bacteria ("Candidatus Stammerula spp.") in the midgut. In this work we (i) examined the phylogenetic relationships among the insect hosts, (ii) investigated the presence of bacteria in other hitherto unexamined species, and (iii) evaluated the phylogenetic congruence between insects and symbionts. A total of 33 Tephritinae species in 17 different genera were analyzed. Two regions of the mitochondrial DNA (16S rDNA and COI-tRNALeu-COII) were examined in the insect host, while the 16S was analyzed in the bacteria. From the phylogenetic trees, four of the five tribes considered were statistically supported by each of the clustering methods used. Species belonging to the tribe Noeetini never clustered at significant levels. The phylogenetic COI-tRNALeu-COII tree showed internal nodes more highly supported than the 16S phylogeny. The analysis of the distribution of symbiosis across the subfamily has highlighted the presence of bacteria only in the tribe Tephritini and in the genus Noeeta from the tribe Noeetini. A cophylogenetic analysis revealed a substantial congruence between hosts and symbionts. The interesting exceptions can be justified by events like losses, duplications and hosts switching opportunities, which are likely to arise during the biological cycle of the fly in consideration of the extracellular status of these symbionts.

  11. Insecticidal Activity of a Destruxin-Containing Extract of Metarhizium brunneum Against Ceratitis capitata (Diptera: Tephritidae).

    Science.gov (United States)

    Lozano-Tovar, M D; Garrido-Jurado, I; Lafont, F; Quesada-Moraga, E

    2015-04-01

    Tephritid fruit flies are major pests that limit fruit production around the world; they cause important damages, increasing directly and indirectly annual costs, and their management is predominately based on the use of chemical insecticides. This research investigated the insecticidal activity of the crude extract obtained of Metarhizium brunneum Petch EAMb 09/01-Su strain and its capacity to secrete secondary metabolites including destruxins (dtx). Dtx A and A2 had insecticidal activity against Ceratitis capitata (Wiedemann) when administered per os. The crude extract of seven Metarhizium and one Beauveria isolates were evaluated per os against medfly adults. The crude extracts of the isolate EAMb 09/01-Su resulted in mortality ranging between 95 and 100% at 48 h. The high-pressure liquid chromatography profile showed two active peaks (F5B and F6 subfractions) related with dtx A2 and dtx A, which caused 70 and 100% mortality on C. capitata at 48 h postfeeding, respectively. The LC50 was 104.92 ppm of dtx A, contained in the F6 subfraction, and the LT50 was 4.16 h at a concentration of 400 ppm of dtx A contained in the F6 subfraction. Moreover, the average survival time of adults exposed to this subfraction was 12.6 h with only 1 h of exposure. The insecticide metabolites of the F6 subfraction of the EAMb 09/01-Su isolate retained >90% of its insecticidal activity after exposure to 60°C for 2 h and 120°C for 20 min. These results highlight the potential of this strain as a source of new insecticidal compounds of natural origin for fruit fly control.

  12. A new species of Molynocoelia Giglio-Tos (Diptera: Tephritidae) from Ecuador

    Science.gov (United States)

    Molynocoelia erwini, a new species of fruit fly from Ecuador is described and illustrated. It differs from its previously known congeners in wing pattern (not banded, distal half brown), scutal and scutellar markings, and male femoral setation....

  13. Ketertarikan Bactrocera carambolae (Diptera: Tephritidae pada Senyawa Volatil Olahan Limbah Kakao

    Directory of Open Access Journals (Sweden)

    Dyah Rini Indriyanti

    2013-03-01

    Full Text Available Tanaman kakao (Theobroma cacao menghasilkan biji. Biji ditutupi oleh pulp pada saat dipanen, kemudian difermentasi selama tiga hari untuk diambil biji kakao dan dihasilkan limbah cair. Penelitian ini bertujuan untuk menguji ketertarikan lalat buah pada olahan limbah kakao dan mengidentifikasi senyawa kimia volatil yang menarik lalat buah. Penelitian dilakukan di laboratorium, dimulai dari pengolahan limbah kakao, pengujian ketertarikan B. carambolae pada limbah dan mengidentifikasi senyawa volatil olahan limbah kakao. Hasil penelitian menunjukkan bahwa jantan dan betina B. carambolae tertarik pada limbah. Olahan limbah kakao berisi berbagai senyawa volatil yakni: amonia; etil-2-hidroksi propanoat ; 7-dodesenil asetat; senyawa asetamida; 3,5-dihidroksi-2-metil-5,6-dihidropiran; hidroksi metilfurfurol; dan derivat-1-undekuna.The cocoa plants (Theobroma cacao produce seeds. The seeds are covered by pulp when it is harvested. Then these seeds were fermented for three days to transform them becoming cocoa seeds and the fermentation would produce liquid wastes. The study aims to test the attractiveness of fruit flies to the processed liquid cocoa wastes and to identify the chemical compounds which attract fruit flies. The study was conducted in the laboratory, beginning from the processing of cocoa wastes, the testing of the attractiveness of B. carambolae to wastes and to identify the chemical compounds of the processed cocoa wastes. The result showed that males and females B. carambolae were attracted to the wastes.The processed cocoa wastes contain various chemical compounds, i.e. ammonia; ethyl-2-hydroxy propanoate; 7-dodecenyl acetate; acetamide compounds; 3,5 dihydroxy-2-methyl-5,6-dihydropyrane; hydroxyl methylfurfurol; and 1-undecyne derivates.

  14. Efficacy of brown sugar flotation and hot water methods for detecting Rhagoletis indifferens (Dipt., Tephritidae) larvae

    Science.gov (United States)

    The brown sugar flotation and hot water methods are accepted procedures for detecting larval western cherry fruit fly, Rhagoletis indifferens Curran, in sweet cherry [Prunus avium (L.) L.] and could be included in a systems approach for showing the absence of larvae in fruit. The methods require cr...

  15. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić

    2015-01-01

    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  16. Sarchophagid flies (Insecta, Diptera from pig carcasses in Minas Gerais, Brazil, with nine new records from the Cerrado, a threatened Neotropical biome

    Directory of Open Access Journals (Sweden)

    Cátia A. Mello-Patiu

    2014-06-01

    Full Text Available Sarchophagid flies (Insecta, Diptera from pig carcasses in Minas Gerais, Brazil, with nine new records from the Cerrado, a threatened Neotropical biome. The diversity of the Sarcophagidae fauna of the Cerrado biome, also know as the Brazilian Savanna, is still underestimated. In this research we collected flies in the state of Minas Gerais, Brazil, during a Forensic Entomology experiment. Samples were collected throughout the decomposition process of domestic pig (Sus scrofa Linnaeus carcasses, and the experiments were conducted in areas of pasture and semideciduous forest. A total of 85,694 adult flesh flies belonging to 57 species were collected from all carcasses. New records for nine species of Sarcophaginae are provided, including the first record of Blaesoxipha (Acridiophaga caridei (Brèthes, 1906 to Brazil, and new occurrences of the following species for the Cerrado and/or for the state of Minas Gerais: Blaesoxipha (Acanthodotheca acridiophagoides (Lopes & Downs, 1951, Malacophagomyia filamenta (Dodge, 1964, Nephochaetopteryx orbitalis (Curran & Walley, 1934, Nephochaetopteryx cyaneiventris Lopes, 1936, Nephochaetopteryx pallidiventris Townsend, 1934, Oxysarcodexia occulta Lopes, 1946, Ravinia effrenata (Walker, 1861 and Sarcophaga (Neobellieria polistensis (Hall, 1933.

  17. Global establishment risk of economically important fruit fly species (Tephritidae).

    Science.gov (United States)

    Qin, Yujia; Paini, Dean R; Wang, Cong; Fang, Yan; Li, Zhihong

    2015-01-01

    The global invasion of Tephritidae (fruit flies) attracts a great deal of attention in the field of plant quarantine and invasion biology because of their economic importance. Predicting which one in hundreds of potential invasive fruit fly species is most likely to establish in a region presents a significant challenge, but can be facilitated using a self organising map (SOM), which is able to analyse species associations to rank large numbers of species simultaneously with an index of establishment. A global presence/absence dataset including 180 economically significant fruit fly species in 118 countries was analysed using a SOM. We compare and contrast ranked lists from six countries selected from each continent, and also show that those countries geographically close were clustered together by the SOM analysis because they have similar fruit fly assemblages. These closely clustered countries therefore represent greater threats to each other as sources of invasive fruit fly species. Finally, we indicate how this SOM method could be utilized as an initial screen to support prioritizing fruit fly species for further research into their potential to invade a region.

  18. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini

    2009-03-01

    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  19. Ocorrência de moscas-das-frutas (Diptera: Tephritidae em mangueiras (Mangifera indica L. em Boa Vista, Roraima = The occurrence of fruit fly (Diptera: Tephritidae in mango (Mangifera indica L. in Boa Vista, Roraima

    Directory of Open Access Journals (Sweden)

    Adriana Bezerra Lima

    2012-08-01

    Full Text Available Um estudo foi conduzido no período de junho de 2007 a janeiro de 2008, em pomares comerciais de manga das variedades: Tommy Atkins, Haden e Palmer sendo 3 ha de cada cultivar, localizado na região do Bom Intento no Município de Boa Vista. Os espécimes de moscas-das-frutas foram coletados, por meio de armadilhas, confeccionadas com garrafas pet, que foram penduradas na copa das árvores a 1,60 m de altura. Como atrativo alimentar foi utilizado 200 mL de suco de maracujá a 30%. Foram utilizadas nove armadilhas, sendo uma armadilha por hectare. Semanalmente as armadilhas eram examinadas, ocasião em que se substituía o atrativo e os insetos capturados retirados e colocados em frascos de vidro devidamente etiquetados e transportados ao Laboratório de Entomologia do Centro de Ciências Agrárias da Universidade Federal de Roraima. As identificações dos espécimes foram feitas no Instituto Nacional de Pesquisa da Amazônia - INPA. No período de oito meses foram coletados 24 espécimes adultos do gênero Anastrepha (nove fêmeas e 15 machos. Quatro espécies foram identificadas: A. serpentina, A. striata, A. obliqua e A. turpinae. A maior frequência foi A. serpentina (44,44%, seguida de A. striata e A. obliqua ambas com 22,22% e A. turpinae com 11,11%. Os meses de maior ocorrência de Anastrepha spp. foram junho, julho e agosto. Este é o primeiro registro da espécie Anastrepha turpinae Stone, 1942, em Roraima. The study was done during th period of June 2007 to January of 2008, in commercial mango orchards having: 3 ha of cv. Tommy Atkins, 3 ha of cv. Haden. and 3 ha of cv. Palmer, located at Bom Intento in the municipal district of Boa Vista - RR. The specimens of fruit flies were collected, by trapping, made with transparent bottles pet, which were hung in the cup of the trees at 1.60 m of height. 200 mL of passion fruit juice (30% was used as an attractant feed; 9 traps were used, being one trap for hectare. Weekly The traps were examined weekly, during which the bait was substituted and the capture insects removed, placed in labeled glass flasks properly and transported to the Laboratory of Entomology, Centro de Ciências Agrárias, Universidade Federal de Roraima - UFRR. The identification of the specimens was done at the Instituto Nacional de Pesquisa da Amazônia - INPA. a - INPA. During the period of eight months 24 adult specimens of Anastrepha were collected (9 females and 15 males. Four species were identified: A. serpentina, A. striata, A. obliqua and A. turpinae. The highest frequency of trapped insects was A. serpentina (44.44%, followed by A. striata and A. obliqua with 22.22%, and A. turpinae with 11.11%. The months of highest occurrence of Anastrepha spp., were June, July, and August. This is the first documentation of the specie Anastrepha turpinae Stone, 1942, in Roraima.

  20. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae) related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae) em relação a uma fonte protéica

    OpenAIRE

    2006-01-01

    The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835) females are able to associate a compound (quinine sulphate - QS) not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a die...

  1. Associative learning in wild Anastrepha obliqua females (Diptera, Tephritidae related to a protein source Aprendizagem associativa em fêmeas selvagens de Anastrepha obliqua (Diptera, Tephritidae em relação a uma fonte protéica

    Directory of Open Access Journals (Sweden)

    Carla Cresoni-Pereira

    2006-03-01

    Full Text Available The aim of the present study was to determine whether wild adult Anastrepha obliqua (Macquart, 1835 females are able to associate a compound (quinine sulphate - QS not related to their habitual diet with a protein-enriched food. Females were first fed on diets based on brewer yeast and sucrose containing or not QS. The groups were then allowed to choose between their original diets and a diet with or without QS, depending on the previous treatment, and between a diet based on agar and a diet containing agar and QS. When the nutritional value of the diets was adequate, the females did not show any preference for the diet with or without QS. With respect to the agar diet and the agar + QS diet, females previously fed on a nutritive diet containing QS preferred the diet containing QS, indicating an association between the compound and the nutritional value of the diet. The importance of this behavioral strategy is discussed.O objetivo do presente estudo foi determinar se fêmeas adultas selvagens de Anastrepha obliqua (Macquart, 1835 são capazes de associar um composto (sulfato de quinino-SQ não-relacionado à sua dieta habitual com um alimento rico em proteínas. Primeiro, as fêmeas foram alimentadas com dietas à base de lêvedo de cerveja e sacarose contendo ou não SQ. Os grupos foram então colocados para escolher entre sua dieta original e dietas com ou sem SQ, dependendo do tratamento prévio, e entre uma dieta à base de agar somente e outra à base de agar e SQ. Quando o valor nutricional das dietas era adequado, as fêmeas não mostraram nenhuma preferência para a dieta com ou sem SQ. Em relação às dietas de agar e agar+SQ, fêmeas previamente alimentadas com uma dieta nutritiva contendo SQ preferiram a dieta contendo SQ, indicando uma associação entre o composto e o valor nutricional da dieta. A importância desta estratégia comportamental é discutida.

  2. Importance of adult protein ingestion on the mating success of Ceratitis capitata Wiedemann males (Diptera: Tephritidae); Importancia da ingestao de proteina na fase adulta para o sucesso de acasalamento dos machos de Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S., E-mail: bio.alberto@gmail.co, E-mail: vanessasidias@hotmail.co, E-mail: ibravo@ufba.b [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral

    2010-04-15

    The importance of the protein ingestion during the adult stage on the mating success of males of Ceratitis capitata Wiedemann was evaluated in experiments of laboratory and fi eld cage. In laboratory, the effects of protein ingestion during the fi rst four or 12 days of the male adult life was assessed by the following parameters: mating success (capacity of being chosen by the female) and the number of males that give out pheromonal signals. Some experiments of mating success had been carried through with males in different ratios. In these tests, the number of males which had ingested protein (an unique male) was remained constant and the number of males fed without protein was gradually increased from 1:1 to 1:5. In the fi eld cages, the mating success experiments were done using a 1:1 ratio. The results showed that the protein ingestion in the fi rst four days of life did not influence any of the analyzed parameters. When the period of ingestion of protein was extended to 12 days, protein-fed males fed produced more pheromonal signals and had a higher mating success when at a 1:1 ratio in laboratory and fi eld cage assays. In laboratory, females randomly chose males in any other tested ratio (1:2, 1:3, 1:4 and 1:5), indicating that the female may lose the perception to identify the male who ingested protein in the fi rst 12 days. (author)

  3. Mating choice of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of male ageing on mating success; Escolha de parceiro para acasalamento em Ceratitis capitata (Wiedemann)(Diptera: Tephritidae): influencia do envelhecimento dos machos no sucesso de copula

    Energy Technology Data Exchange (ETDEWEB)

    Silva Neto, Alberto M. da; Dias, Vanessa S.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral], e-mail: bio.alberto@gmail.com, e-mail: vanessasidias@hotmail.com, e-mail: ibravo@ufba.br

    2009-09-15

    The objective of this study was to evaluate the effect of male ageing on male pheromone release and mating success of Ceratitis capitata (Wiedemann). The effects of male ageing on mating were evaluated on fi ve and 21 d-old males by assessing their mating success (males chosen by a female for copulation) and the amount of males releasing the sex pheromone. The mating success was evaluated by using several ratios of young to older males by increasing the number of older males:young males from 1:1 to 5:1. The mating success of the 1:1 ratio was also evaluated in fi eld cages. The evaluation of the mating success (in the 1:1 ratio) showed a clear preference of the females for young males. Sex pheromone emission was much more common on young than older males. Even in cases were older males were more abundant (ratios 2:1 and 3:1), females still chose the young males. However, females could not distinguish young from older males in ratios of 4:1 or 5:1. Our data indicate that the ageing of C. capitata males has a considerable negative effect on their reproductive success, especially if they are found in a proportion any lower than 3:1. (author)

  4. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae Relationship between time of larval development and fecundity in the female of Ceratitis capitata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. Manso

    2006-07-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw , la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw (- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw (- como en las sw(+ , los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.We studied the relationship between the development time in the larva stage and the resulting female fecundity, in Ceratitis capitata Wiedemann wild-type individuals compared to mutant individuals showing slow development (sw. We observed the morphology of the ovaries in the progenies of the crossing between mutant and wild-type strains, comparing females segregating by «development time». This study showed that sw(- females developing later have got less ovarioles, and a more heterogeneous distribution of ovules, than females developing earlier. It was also found that the wild type females developing late also produce lower numbers both of ovarioles and fully developed ova, than those developing earlier. In sw females as well as in wildtype females, delays in development reduce the fecundity of the females, which is expressed as lower number of ovarioles and slower maturation of the ovary. When the rearing conditions are appropriate, the sw females are as fertile as wild-type ones.

  5. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae Viability of eggs and screen cage model for mass artificial rearing of Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Juliana García

    2011-12-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de ía con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.The aim of this study was to determine the viability of eggs and cage model suitable for artificial mass rearing of Anastrepha fraterculus (Wiedemann. The results show that the period of maximum oviposition occurs during the first 10 days in Medium cages which allows to obtain the necessary volume of eggs to feed the foot of rearing of A. fraterculus in a mass rearing. Considering that a positive relationship was found between the volume of eggs oviposited and the hatchability percentage in a period of 21 days of collection, this period coincides with the highest values of hatching. Among the evaluated cage models: Medium, Large and Mission, Medium model showed the best results when assessing the number of eggs/female/day with an average of 11.4. The cage that showed lower results was Mission model with an average of 4.6 eggs/female/day. The Large cages showed values lower than the Medium cages but the differences were not significant. Good values recorded in the Medium cages were likely due to their structure, with the inside of the cage divided into several compartments, which improves the distribution of adult flies and prevents early mortality due to the overcrowding of the base or the roof of the cage.

  6. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina Dispersal behavior of Ceratitis capitata (Diptera: Tephritidae among agricultural valleys in San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. Díaz

    2008-06-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata, mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.Ceratitis capitata (Wiedemann is a cosmopolitan Tephritids dipteran native to the north of Africa, which is the main plague of fruit trees in many countries of the American continent. Here we assess the dispersion capacity of the Ceratitis capitata, by releasing sterile flies under field conditions, in order to predict possible invasion to agricultural valleys nearby. 54,000 marked sterile flies of both sexes were released in locations of the Tulum Valley, close to the access to the Ullum and Zonda valleys. Jackson & Mc Phail traps were set up for monitoring the dispersion flights. 1,213 adults were captured during the sampling period, and there was no dispersion of the released adults from the Tulum valley to the Ullum and Zonda valleys. Host presence, geographical position of each ravine and wind orientation could explain the dispersion difference betwen both ravines. The dispersion lasted five weeks and the average dispersion distance reached by the released adults was of 3,764 m (S= 2897 m. No differences between sexes were detected.

  7. Avaliação da qualidade de frutos de café atacados por Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae Evaluation of the quality of coffee fruit attacked by Ceratitis capitata (Wiedemann, 1824 (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    F.J. Cividanes

    1993-09-01

    Full Text Available Foram usadas plantas de Coffea arabica L., variedade Catuaí Vermelho, localizadas no Campus da Escola Superior de Agricultura "Luiz de Queiroz" - USP, Piracicaba,SP, para avaliação dos danos que Ceratitis capitata (Wied., 1824 pode causar aos frutos do cafeeiro. Os resultados mostraram que o ataque de C. capitula não causou queda prematura dos frutos, mas aumentou a queda de cerejas e foram encontradas, fortes evidências, com base na atividade da enzima polifenol oxidase e lixiviação de potássio, que cerejas atacadas podem produzir bebida de café de qualidade inferior.The present work was carried out using trees of Coffea arabica L. variety Red Catuaí grown at Escola Superior de Agricultura "Luiz de Queiroz" - Campus of the University of São Paulo, Piracicaba,SP. The objective was to estimate damages that Ceratitis capitata (Wied., 1824 can cause to coffee fruits. The results showed that C.capitata did not cause premature fruit fall, but it increased berry fall. The activity of the enzyme polyphenol oxidase and potassium lixiviatiou give strong evidences that atacked coffee beans produce coffee beverage of inferior quality.

  8. Disinfestation of Averrhoa carambola infested with Anastrepha obliqua (Macquart, 1835) (Diptera - Tephritidae) using gamma radiation; Desinfestacao de Averrhoa carambola infestada por Anastrepha obliqua (Macquart, 1835) (Diptera - Tephritidae) atraves de radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, V.; Wiendl, F.M. [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil)

    1994-05-01

    The disinfestation dose of gamma radiation in Averrhoa carambola infested with larvae of Anastrepha obliqua was determined. Fruits were collected in the field, each having about 11 larvae in the last instar. Fruits were irradiated with the following ganna radiation doses: 0 (control), 50, 150, 300, 600 and 900 Gy. Each treatment consisted of 9 fruits (3 replications) giving the amount of 99 larvae for each treatment. After irradiation the fruits were kept in a climatic chamber with the temperature adjusted to 25{+-} 5{sup 0} C and relative humidity of 70{+-} 5{sup 0} C, until larvae left the fruit and became transformed into pupae and adults. The lethal dose (LD{sub 100}) of gamma radiation for larvae in the fuits was 600 Gy and the dose of 50 Gy inhibited completely the total emergency of adults. (author). 19 refs, 1 figs, 1 tab.

  9. Disinfestation of apples attacked by the fruit fly Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) using gamma radiation of cobalt-60; Desinfestacao de macas atacadas por Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) atraves das radiacoes gama do cobalto-60

    Energy Technology Data Exchange (ETDEWEB)

    Arthur, Valter; Wiendl, Frederico M. [Centro de Energia Nuclear na Agricultura (CENA), Piracicaba, SP (Brazil)

    1996-04-01

    Apples, cv. Gala, artificially infested during 72 hours with adults of the fruit fly Anastrepha fraterculus (Wied.) were irradiated with the following gamma radiation doses: 0 (control), 25, 50, 75 and 100 Gy, at the dose rate of 1048 Gy per hour. After irradiation fruits were put in plastic bags with 80 ml of sugar cane bagasse. The bags were maintained in a rearing room at temperature 21 - 24 deg C, 65 - 75% R H, and photo period of 12 hours. Pupae obtained were sieved out and kept in small glass tubes. All doses tested did not allow emergence of adults. (author) 4 refs., 1 tab.

  10. Irradiation of Ceratitis capitata, Anastrepha fraterculus and Anastrepha obliqua larvae (Diptera: Tephritidae) on an artificial diet; Irradiacao de larvas de Ceratitis capitata, Anastrepha fraterculus e Anastrepha obliqua (Diptera: Tephritidae) em dieta artificial

    Energy Technology Data Exchange (ETDEWEB)

    Raga, A.; Sato, M.E.; Suplicy Filho, N.; Potenza, M.R. [Instituto Biologico, Sao Paulo, SP (Brazil); Yamazaki, M.C.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1992-01-01

    The aim of the experiment was to establish gamma radiation dose levels sufficient to prevent the emergence of adults, and thus to serve as parameters for disinfestation of hosts of the fruit-flies Ceratitis capitata, Anastrepha fraterculus, and Anastrepha obliqua. Four-, 5,6-, and 7-day-old larvae of the 3 species were tested. Pupation was unaffected by 40 Gy for C. capitata, and by 100 Gy for A. fraterculus and A. obliqua. Gamma radiation doses necessary to prevent development of adults from larvae were 30 Gy, 20 Gy and 20 Gy for C. capitata, A. obliqua respectively. (author). 10 refs, 6 tabs.

  11. Percepção química e visual de Anastrepha fraterculus (Diptera, Tephritidae em laboratório Chemical and visual perception of Anastrepha fraterculus (Diptera, Tephritidae in laboratory

    Directory of Open Access Journals (Sweden)

    Patrícia L. F. Gregorio

    2010-06-01

    Full Text Available A mosca-das-frutas-sul-americana, Anastrepha fraterculus (Wiedemann, 1830, é uma das principais pragas da fruticultura no Brasil. Durante a alimentação, as larvas fazem galerias nos frutos, alterando o sabor e prejudicando a produção e comercialização dos mesmos. O presente trabalho teve como objetivo estudar fatores envolvidos na escolha do hospedeiro por A. fraterculus. Foram avaliadas as respostas eletroantenográficas de machos e fêmeas a extratos etanólicos de frutos verdes e maduros de pessegueiro - Prunus persica, cultivar Chimarrita (Rosaceae, pitangueira - Eugenia uniflora (Myrtaceae, guabirobeira - Campomanesia xanthocarpa (Myrtaceae e araçazeiro - Psidium cattleianum (Myrtaceae. Foram também observadas as influências da cor (amarela, verde e vermelha e da composição do substrato de oviposição (polpas de araçá, guabiroba, pitanga e pêssego na fecundidade da espécie. As respostas eletroantenográficas de fêmeas foram significativamente distintas para os extratos de guabiroba verde e madura, araçá maduro e pitanga verde. Em antenas de machos, as maiores despolarizações médias foram registradas em resposta aos extratos de guabiroba verde e madura, araçá verde e maduro e pitanga verde. As respostas eletrofisiológicas geradas não diferiram estatisticamente entre os sexos, para todos os tratamentos. A cor do substrato não afetou a oviposição. As fêmeas ovipositaram mais nos substratos contendo polpa de pêssego e de guabiroba, quando comparados aos respectivos controles.The South American fruit fly Anastrepha fraterculus (Wiedemann, 1830 is one of the greatest threats to the fruit growing industry in Brazil. During the feeding process, the larvae build galleries within the fruit, altering the flavor and damaging its production and commercialization. The present work had as its objective to study the factors involved in the choice of the host by A. fraterculus. Electroantennographic responses of the males and females to the ethanolic extracts of the fruits of the peach tree - Prunus persica, cultivar Chimarrita (Rosaceae, Surinam cherry tree - Eugenia uniflora (Myrtaceae, Guabirobeira tree - Campomanesia xanthocarpa (Myrtaceae and Brazilian guava tree - Psidium cattleianum (Myrtaceae were considered. Also recorded was the influence of the color (yellow, green and red and the composition of the substratum of oviposition (pulps of Brazilian guava, Guabiroba, Surinam cherry and peaches in the fecundity. Electroantennographic responses of the females were distinct to the extracts of the unripe and ripe Guabiroba, ripe Brazilian guava and unripe Surinam cherry. In antennae of the males, the greatest depolarization average was registered in the responses to the extracts of ripe and unripe Guabiroba, ripe and unripe Brazilian guava and unripe Surinam cherry. Electrophysiologic responses did not differ statistically between the sexes for all the treatments. The colors of the substratum of oviposition did not affect the fecundity. The females ovipositioned more on the substratum containing pulp of peaches and of Guabiroba, when compared to the respective controls.

  12. Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae Eficácia de Metarhizium anisopliae a estágios imaturos de Anastrepha fraterculus a mosca das frutas (Diptera : Tephritidae

    Directory of Open Access Journals (Sweden)

    Ricardo Henry Rodrigues Destéfano

    2005-03-01

    Full Text Available The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae, against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS and non-autoclaved (NAS soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10(10 for AS and 2.52 x 10(10 for NAS. The lethal concentration (LC50, expressed as conidia concentration, was 8.44 x 10(9 conidia/g of soil (S for AS and 12.23 x 10(9 conidia/g of soil for NAS.O estudo avaliou a eficácia de Metarhizium anisopliae var. anisopliae, (Hyphomycetes : Moniliales linhagem E9, isolada da cigarrinha das pastagens Deois flavopicta (Hemiptera : Cercopidae, contra larvas, prepupas, pupas e adultos emergentes de Anastreha fraterculus, a mosca Sul Americana das frutas. Os bioensaios foram conduzidos simulando condições de campo em solo autoclavado (AS e não autoclavado (NAS de pomares típicos de citros no Estado de São Paulo, sudeste do Brasil. Várias concentrações de conídios foram incorporadas no solo. A mortalidade calculada sobre a porcentagem de adultos emergentes, foi de 86% para as concentrações mais altas de conídios: 2,52 x 10(10 para AS e 2,52 x 10(10 para NAS. A concentração letal (LC50 expressa pela concentração de conídios, foi 8,44 x 10(9 conídios/g de solo para AS e 12,2 x 10(9 conídios/g/S para NAS.

  13. Quarantine treatment to Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) in orange fruits (Citrus sinensis).; Tratamento quarentenario para Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) em frutos de laranja (Citrus sinensis)

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno Miguel Mendes Soares de

    2005-07-01

    This work was carried out to evaluate the effect of thermal treatments (vapour heat and hot water) and irradiation on Ceratitis capitata eggs and larvae (first, second and third instars), in 'Valencia' oranges; the relation between temperature and exposition time to vapour heat and hot water on fruit fly immature; the relation among the different doses of radiation on fruit fly immature and evaluate the effect of the treatments (thermal treatments and irradiation) on the chemical composition of the fruits. It was evaluated the heat absorption and loose of heat by the fruit. For thermal treatments it was used temperatures of 44 and 46 deg C for 15,30,60, 90 and 120 minutes and a control. For irradiation were used the doses: 10,20, 30, 40, 50, 100, 150 and 200 Gy. By the results obtained it is possible to conclude that: to the control of eggs and larvae (first, second and third instars) the treatment with vapour heat was less efficient than the hot water treatment; the thermal treatments of C. capitata eggs and larvae (first and second and third instars) can be recommended with vapor heat at 46 deg C at 152.2 minutes or with hot water at 46 deg C at 84.8 minutes, achieving the quarantine request; third instar larvae are more tolerant to the thermal and irradiation treatments; the treatment with irradiation can be recommended for quarantine treatment of ali immature stages evaluated with the dose of 72.88 Gy; the dose of 50 Gy causes sterility to the adults emerged from ali immature stages irradiated; treatments do not cause any change in the chemical proprieties in the orange fruits var. 'Valencia'. (author)

  14. Producción masiva y simultánea de machos de Ceratitis capitata (Diptera: Tephritidae y parasitoides Dichasmimorpha longicaudata (Hymenoptera: Braconidae Massive and simultaneous production of Ceratitis capitata (Diptera: Tephritidae males and Diachasmimorpha longicaudata (Hymenoptera: Braconidae parasitoids

    Directory of Open Access Journals (Sweden)

    Silvia N. López

    2006-12-01

    Full Text Available En la línea de sexado genético «Cast191» las hembras de Ceratitis capitata son homocigotas para el gen slow , lo que reduce su velocidad de desarrollo; los machos son heterocigotas y muestran una velocidad de desarrollo normal. Esta característica permitió producir, con Cast191, machos estériles por un lado, y parasitoides criados sobre las larvas remanentes por el otro. Nuestro objetivo con este trabajo fue producir ambos insumos simultáneamente y a una escala mayor que hasta ahora. Además, bajo estas condiciones, y en un intento por aumentar la separación entre sexos, se aplicó a las larvas del primer estadío un pulso de 15º C, durante 1 ó 2 días, luego del cual se las mantuvo a 20º C ó 25º C, hasta que entraron al estado de pupa, luego se mantuvo todo el material a 25º C. La mejor separación de sexos, lograda con el tratamiento a 20º C sin pulso de frío, se usó para comparar la calidad del parasitoide Diachasmimorpha longicaudata, criado sobre las larvas obtenidas tras la separación de los machos, con aquellos criados sobre la línea salvaje. Para ello, este tratamiento de separación fue aplicado en la cría de la mosca, y el material remanente de dieta con larvas fue expuesto al parasitoide. La tasa de parasitismo obtenida fue semejante a la hallada sobre la línea salvaje, y la tasa sexual de la F 1 del parasitoide presentó un sesgo hacia las hembras aún mayor. Se discute la factibilidad de utilizar la línea Cast191 de C. Capitata, para la producción a mayor escala de machos de mosca y para la cría masiva del parasitoide D. longicaudata.In the genetic sexing strain «Cast191», the females of Ceratitis capitata are homozygous for the mutation slow , slowing down their rate of development, and the males are heterozygous, having a normal rate of development. This feature made Cast191 capable of producing sterile males, on one hand, and parasitoids that are reared on the remaining larvae, on the other. The objective of the present work was to do this two thing simultaneously and at a larger scale than previously. Besides, in an attempt to improve malefemale separation under this conditions, a pulse of 15ºC was applied to first stage larva during 1 or 2 days; these larvae were later held either at 20ºC or, at 25ºC until pupation, both groups of pupae being then kept at 25ºC . The best separation between male and female, achieved rearing larvae at 20ºC without any pulse of 15ºC , was then used to evaluate the quality of the parasitoids Diachasmimorpha longicaudata reared on the larvae remaining after male separation. These larvae were exposed to the parasitoid under standard conditions. The rate of parasitism obtained was similar to the one found when parasitoids are exposed to wild strain, and the F1 sex rate was even more biased toward females. The potential use at larger scale of the Cast191 strain of C. capitata for producing sterile males and D. longicaudata parasitoids is discussed.

  15. Some aspects of the behavior at different ages of Ceratitis capitata (Wiedemann, 1824) (Diptera-Tephritidae) irradiated with gamma rays; Alguns aspectos do comportamento em diferentes idades de Ceratitis capitata (Wiedemann, 1824) (Diptera-tephritidae) irradiadas com radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Ivone Midori

    1988-08-01

    The present work was carried out in the laboratory of the Entomology Section of the Nuclear Energy for Agriculture Center (CENA) in Piracicaba, Sao Paulo state, Brazil, to determine the effects different gamma radiation doses on the reproductive potential of males and the flight behavior of Ceratitis capitata (Wied.). For all the treatments with gamma radiation a Cobalt-60 source type Gamma beam-650 was used, with activity of approximately 13,410 x 10{sup B} Bq. (4,967 Ci.), and the dose rate of 2.000 Gy per hour. The doses used were 80 Gy, 100 Gy and 120 Gy. The three doses employed affected more the longevity of males than the females and the number of spermatozoid found lower in the irradiated insects compared with the control, with no significant differences between doses. The insects irradiated with 80 Gy showed activity similar to the control population until four days after emergence: afterwards they were more active than the unirradiated. The gamma irradiation diminished the take-off ability of the insects. (author). 59 refs., 9 figs., 9 tabs.

  16. Danos de moscas-das-frutas (Diptera, Tephritidae) em citros, manejados no sistema orgânico de produção/Damage caused by fruit flies (Diptera, Tephritidae) on citrus under organic production

    National Research Council Canada - National Science Library

    Fernando Felisberto da Silva; Luíza Rodrigues Redaelli; Rafael Narciso Meirelles; Fábio Kessler Dal Soglio

    2014-01-01

    .... The objective of this experiment was to evaluate the population variation of Anastrepha fraterculus and the relationship of its population with damage in organic orchards of orange Ceu cultivar and tangor (C...

  17. Effects of Curcuma longa extracts on mortality and fecundity of Bactrocera zonata (Diptera: Tephritidae Efeitos dos extratos de Curcuma longa sobre mortalidade e fecundidade de Bactrocera zonata (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Abdul Rauf Siddiqi

    2011-12-01

    Full Text Available The peach fruit fly, Bactrocera zonata, is a significant pest of fruit and vegetable crops in South East Asia and Pacific region. Ccontrol strategies of fruit flies, relying chiefly on insecticides, have serious environmental consequences, disturbing the agro-ecosystem as well as eliminating natural enemies. This study was oriented at exploring the potential of turmeric, Curcuma longa, extracts to control the peach fruit fly. Freshly emerged female adults of Bactrocera zonata were continuously fed for 16 days on diet containing 1000, 500 and 250 ppm of acetone extract of Curcuma longa separately in laboratory cages. The extract caused 85.00, 66.67 and 56.67 percent mortality at 1000, 500 and 250 ppm respectively. The surviving females were mated and allowed to reproduce on clean guava fruits in separate cages. The inhibition in pupal progeny was 67.90, 60.74 and 51.96 percent in the flies fed on 1000, 500 and 250 ppm, the inhibition observed in adult progeny was 84.68, 79.03 and 67.74 percent, respectively.A mosca do pêssego, Bactrocera zonata, é uma importante praga das frutas e produtos hortícolas no Sudeste Asiático e Pacífico. As estratégias de controle de moscas-das-frutas, que se baseia principalmente no uso de inseticidas, têm consequências ambientais graves, perturbando o agroecossistema, bem como eliminando os inimigos naturais. Este estudo foi orientado a explorar as potencialidades dos extratos de açafrão Curcuma longa para controle de B. zonata. Após a emergência, adultos de fêmeas de B. zonata foram continuamente alimentados, durante 16 dias, com dieta contendo 1000, 500 e 250 ppm de extrato acetônico de C. longa separadamente em gaiolas no laboratório. O extrato causou 85,00, 66,67 e 56,67 % de mortalidade em 1000, 500 e 250 ppm, respectivamente. As fêmeas foram acasaladas e postas para ovipositar separadamente em goiabas dentro das gaiolas. A inibição na progênie pupal foi 67,90, 60,74 e 51,96 % nos insetos alimentados em 1000, 500 e 250 ppm, a inibição observada na progênie adulta foi 84,68, 79,03 e 67,74%, respectivamente.

  18. Espessura da polpa como condicionante do parasitismo de mosca-das-frutas (Diptera:Tephritidae por Hymenoptera: braconidae Fruit pulp thickness conditioning fruit fly (Diptera:Tephritidae parasitism by Hymenoptera: braconidae

    Directory of Open Access Journals (Sweden)

    Eduardo Rodrigues Hickel

    2002-12-01

    Full Text Available Dentre as estratégias de manejo integrado de mosca-das-frutas está a manutenção de refúgios, vizinhos aos pomares, para proliferação de inimigos naturais. Objetivando verificar quais hospedeiros de mosca-das-frutas seriam mais adequados para incrementar o controle natural, estabeleceu-se uma correlação entre o nível de parasitismo e a espessura da polpa de frutos. Frutos em maturação de café (Coffea arabica, jabuticaba (Myrciaria cauliflora, cajá-mirim (Spondias lutea e laranja (Citrus aurantium foram coletados e mantidos em bandejas plásticas sobre uma camada de areia. As pupas de mosca-das-frutas retiradas da areia foram mantidas em estufa incubadora para emergência dos adultos. O diâmetro dos frutos e das sementes foi medido para se calcular a espessura da polpa. O café, com 1,8mm de polpa, foi o hospedeiro em que ocorreu maior índice de parasitismo de mosca-das-frutas (13,73%. O nível de parasitismo apresentou uma correlação negativa com a espessura da polpa dos frutos, sendo os frutos de polpa fina mais adequados para proliferação de parasitóides de mosca-das-frutas.One of the strategies for fruit fly integrated pest management is the refugee maintenance, near the orchards, for fruit fly natural enemies proliferation. With the aim to check the most suitable fruit fly hosts to increment natural control, a correlation was established between the parasitism level and the fruit pulp thickness. Ripening fruits of coffee (Coffea arabica, jabuticaba (Myrciaria cauliflora, cajá-mirim (Spondias lutea, and orange (Citrus aurantium were collected and maintained in plastic trays over a sand layer. The fruit fly pupae were taken from the sand and put in B.O.D. for adult emergence. The fruit and seed diameter were measure to estimate the fruit pulp thickness. The coffee bean, with 1.8mm of pulp was the fruit fly host with the greatest parasitism level (13.37%. The level of parasitism showed a negative relation with the fruit pulp thickness, and the thin pulp fruits were the most suitable hosts for fruit fly parasitoids proliferation.

  19. Viabilidad de huevos y modelo de jaula para la cría artificial masiva de Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    JULIANA GARCÍA

    2011-01-01

    Full Text Available El objetivo del presente trabajo fue determinar la viabilidad de huevos y el modelo de jaula apropiada para la cría artificial masiva de Anastrepha fraterculus (Wiedemann. Los resultados muestran que el periodo de máxima oviposición ocurre durante los primeros 10 días en jaulas modelo Mediana, lo cual permite obtener el volumen de huevos necesario para alimentar el pie de cría de A. fraterculus en una cría masiva. Considerando que se encontró relación positiva entre el volumen de huevos ovipositados y el porcentaje de eclosión de huevos, en un periodo de 21 días de colecta, este periodo coincide además con los valores de eclosión más altos. Entre los modelos de jaulas evaluadas: Mediana, Grande y Mission; el modelo Mediana mostró los mejores resultados al evaluar el número de huevos/hembra/día con un valor promedio de 11,4. La jaula que mostró menores resultados fue el modelo Mission, con un valor promedio de 4,6 huevos/hembra/día. Las jaulas grandes mostraron valores menores a las jaulas Medianas, pero las diferencias fueron no significativas. Los buenos valores registrados en las jaulas Medianas posiblemente se deban a la estructura de la jaula, que presentó la cara interna dividida en muchos compartimientos, lo cual mejora la distribución de las moscas adultas y previene la mortalidad temprana por hacinamiento en la base o en el techo de la jaula.

  20. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Wang Jin-Jun

    2010-10-01

    Full Text Available Abstract Background Quantitative real-time reverse transcriptase PCR (RT-qPCR has been widely used for quantification of mRNA as a way to determine key genes involved in different biological processes. For accurate gene quantification analysis, normalization of RT-qPCR data is absolutely essential. To date, normalization is most frequently achieved by the use of internal controls, often referred to as reference genes. However, several studies have shown that the reference genes used for the quantification of mRNA expression can be affected by the experimental set-up or cell type resulting in variation of the expression level of these key genes. Therefore, the evaluation of reference genes is critical for gene expression profiling, which is often neglected in gene expression studies of insects. For this purpose, ten candidate reference genes were investigated in three different tissues (midgut, Malpighian tubules, and fat body of the oriental fruit fly, Bactrocera dorsalis (Hendel. Results Two different programs, geNorm and Normfinder, were used to analyze the data. According to geNorm, α-TUB + ACT5 are the most appropriate reference genes for gene expression profiling across the three different tissues in the female flies, while ACT3 + α-TUB are considered as the best for males. Furthermore, we evaluated the stability of the candidate reference genes to determine the sexual differences in the same tissue. In the midgut and Malpighian tubules, ACT2 + α-TUB are the best choice for both males and females. However, α-TUB + ACT1 are the best pair for fat body. Meanwhile, the results calculated by Normfinder are quite the same as the results with geNorm; α-TUB is always one of the most stable genes in each sample validated by the two programs. Conclusions In this study, we validated the suitable reference genes for gene expression profiling in different tissues of B. dorsalis. Moreover, appropriate reference genes were selected out for gene expression profiling of the same tissues taking the sexual differences into consideration. This work not only formed a solid basis for future gene expression study in B. dorsalis, but also will serve as a resource to screen reference genes for gene expression studies in any other insects.

  1. Capture of Anastrepha sororcula (Diptera: Tephritidae in McPhail and Jackson traps with food attractant and virgin adults

    Directory of Open Access Journals (Sweden)

    Christiane dos Santos Felix

    2009-02-01

    Full Text Available This stady evaluated the capture of A. sororcula in the traps baited with the conspecific virgin adults and food attractant in two orchards. The first was the orchard of the Universidade Federal da Grande Dourados (OUFGD and the second, the orchard of the Sindicato Rural de Dourados (OSRD. The capture of A. sororcula in McPhail and Jackson traps was carried out using the corn hydrolysed protein (CHP, control (no flies, virgin males (5, 10 and 15, five virgin females and five virgin couples. The average number of the flies caught in the traps with the corn hydrolysed protein was signifícantly higher than all the other treatments. There was no significant capture of A. sororcula females in the traps baited with the conspecific virgin males, females or the couples.As moscas-das-frutas constituem um grupo de pragas responsáveis por grandes prejuízos econômicos à fruticultura mundial. Anastrepha sororcula Zucchi, é a principal espécie de tefritídeo que ataca a goiaba em Mato Grosso do Sul. O objetivo desta pesquisa foi avaliar a captura de adultos de A. sororcula em armadilhas com atrativo alimentar e adultos virgens, em dois ambientes. Os bioensaios iniciaram-se com a criação de A. sororcula no Laboratório de Insetos Frugívoros da Universidade Federal da Grande Dourados (UFGD. As pesquisas de campo foram desenvolvidas nos pomares da UFGD e do Sindicato Rural de Dourados (SRD-MS. A captura de adultos de A. sororcula em armadilhas McPhail e Jackson foi avaliada para os tratamentos: proteína hidrolisada de milho, testemunha (sem moscas, machos virgens (5, 10 e 15, 5 fêmeas virgens e 5 casais. O número médio de indivíduos capturados nas armadilhas com proteína foi significativamente maior que nos demais tratamentos. O número médio de adultos de A. sororcula, capturado com o tratamento proteína no SRD foi significativamente superior ao do pomar da UFGD. Não ocorreu captura significativa de fêmeas de A. sororcula nas armadilhas com machos virgens co-específicos como atrativo.

  2. Histologia y morfologia del sistema reproductor en hembras de Rhagoletis conversa (Brethes y de Rhagoletis nova (Schimer (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Verónica Flores Rojas

    1987-01-01

    Full Text Available The histology and morphology of the reproductive system of females of Rhagoletis conversa (Brèthes and Rhagoletis nova (Schiner were studied. These species parasitize wild and cultivated Solanaceae respectively. Adult females of both species were collected in natural populations in the Central Zone of Chile. In order to study the development of ovaries the females collected were sacrificed at different ages. Once obtained, ovaries were preparedfor optical microscopy by using histological and squash standard techniques. Results show that within each one of ovarioles it can be observed follicles arranged in line and showing different stages of maduration. It can be described about 6 follicle stages in the ovarioles studied. Ovaries of both species show a very similar structure. However, females of Rhagoletis nova show an ovipositor wider than R. conversa. The number of ovarioles of R. nova is also higher than in R. conversa.

  3. Sexual Competitiveness of Anastrepha ludens (Diptera: Tephritidae) Males Exposed to Citrus aurantium and Citrus paradisi Essential Oils.

    Science.gov (United States)

    Morató, Santiago; Shelly, Todd; Rull, Juan; Aluja, Martin

    2015-04-01

    Males of the Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) display increased mating competitiveness following exposure to the odor of certain host and nonhost plants, and this phenomenon has been used in the sterile insect technique to boost the mating success of released, sterile males. Here, we aimed to establish whether males of the Mexican fruit fly (Anastrepha ludens (Loew)) gain a mating advantage when exposed to the aroma of two preferred hosts, grapefruit (Citrus paradisi Macfadyen) and bitter orange (Citrus aurantium L.). Under seminatural conditions, we observed that, in trials using wildish males (from a young laboratory colony started with wild flies) exclusively, exposure to the aroma of bitter orange had no effect on male mating success but exposure to the odor grapefruit oil increased male mating success significantly. In a separate test involving both exposed and nonexposed wildish and mass-reared, sterile males, although wildish males were clearly more competitive than sterile males, exposure to grapefruit oil had no detectable effect on either male type. Exposure to oils had no effect on copulation duration in any of the experiments. We discuss the possibility that the positive effect of grapefruit essential oils on wildish male competitiveness may have been linked to exposure of females to grapefruit as a larval food, which may have imprinted them with grapefruit odors during pupal eclosion and biased their response as adults to odors of their maternal host.

  4. Tapachula-7, a new genetic sexing strain of the Mexican fruit fly (Diptera: Tephritidae): sexual compatibility and competitiveness.

    Science.gov (United States)

    Orozco, Dina; Meza, J Salvador; Zepeda, Silvia; Solís, Eduardo; Quintero-Fong, J Luis

    2013-04-01

    A new genetic sexing strain of the Mexican fruit fly, Anastrepha ludens (Loew), was evaluated in tests of sexual behavior to determine its possible application using the sterile insect technique. Tests in field cages measuring time to sexual maturity, compatibility with wild flies, and competitiveness were compared between the genetic sexing strain, Tapachula-7, and the mass-reared standard bisexual strain. The results indicated that the onset of sexual maturity was similar for both laboratory strains. Males from the Tapachula-7 strain do not differ from the standard bisexual strain in compatibility and competitiveness with wild insects. The results indicate that the release of Tapachula-7 males in the field would be viable in programs that use the sterile insect technique for the control of the Mexican fruit fly.

  5. RHAGOLETIS COMPLETA (DIPTERA; TEPHRITIDAE DISTRIBUTION, FLIGHT DYNAMICS AND INFLUENCE ON WALNUT KERNEL QUALITY IN THE CONTINENTAL CROATIA

    Directory of Open Access Journals (Sweden)

    Božena Barić

    2015-06-01

    Full Text Available Walnut husk fly (WHF, Rhagoletis completa Cresson 1929 is an invasive species spreading quickly and damaging walnuts in Croatia and neighbouring countries. We researched distribution of this pest in the continental part of Croatia, flight dynamics in Međimurje County and its influence on quality of walnut kernels. CSALOMON®PALz traps were used for monitoring the spread and flight dynamics of R. completa. Weight and the protein content of kernels and the presence of mycotoxin contamination were measured. Walnut husk fly was found in six counties (Istria County: pest reconfirmation, Zagreb County, The City of Zagreb, Varaždin County, Međimurje County and Koprivnica-Križevci County. The presence of the fly was not confirmed on one site in Koprivnica-Križevci County (locality Ferdinandovac and in the eastern part of Croatia (Vukovar-Srijem County: Vinkovci locality. The flight dynamics showed rapid increase in number of adults only a year after the introduction into new area. The weight of infested kernels was 5.81% lower compared to not infested. Protein content was 14.04% in infested kernels and 17.31% in not infested kernels. There was no difference in mycotoxins levels. Additional researches on mycotoxin levels in stored nuts, ovipositional preferences of walnut husk fly and protection measures against this pest are suggested.

  6. Fungi that cause rot in bunches of grape identified in adult fruit flies (Anastrepha fraterculus (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Ruben Machota Jr

    2013-06-01

    Full Text Available Anastrepha fraterculus (Wiedemann is the main species of frugivorous insect that damages berries of table grape (Vitis vinifera L. in Southern Brazil. This study was conducted to isolate and identify the fungi associated with bunch rot present in the body of adults of A. fraterculus collected in a commercial vineyard. From January to February 2011, adults of A. fraterculus were collected from a commercial vineyard of green grapes using adapted McPhail traps. In laboratory, flies bodies were divided into four parts (head, legs, wings, and ovipositor in Petri dishes with PDA medium to evaluate microorganisms associated. Six adult females of A. fraterculus collected in the field were also analyzed in a scanning electron microscope (SEM to identify spores of fungi. Phytopathogenic microorganisms were found in all sectioned parts. Fungal spores were recorded adhered to the body of adult females of A. fraterculus. The main species of fungi found in the body parts of A. fraterculus were Cladosporium spp. (20.2% of the obtained colonies, Botrytis cinerea Pers. (12.9%, Colletotrichum spp. (10.1%, Penicillium spp. (10.1%, Fusarium spp. (7.7%, followed by Rhizopus spp., Trichoderma spp. and Aspergillus spp., suggesting that the insect can serve as a mechanical vector of spores increasing damage in the vineyards.

  7. Treatment post harvest of Citrus sinensis infested with Ceratitis capitata (Wied., 1824) (Diptera: Tephritidae) using gamma radiation

    Energy Technology Data Exchange (ETDEWEB)

    Albergaria, Nuno M.M. Soares de; Bortoli, Sergio A. de, E-mail: nmendes@terra.com.b, E-mail: bortoli@fcav.unesp.b [UNESP, Jaboticabal, SP (Brazil). Faculdade de Ciencias Agrarias e Veterinarias. Depto. de Fitossanidade; Doria, Hayda O.S., E-mail: hosd75@terra.com.b [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Medicina. Dept. de Biologia; Arthur, Valter, E-mail: varthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil). Lab. de Radiobiologia e Ambiente

    2009-07-01

    This work was carried out to evaluate the effect of irradiation on fruit fly (Ceratitis capitata) eggs and larvae (first, second, third instars), in 'Valencia' oranges; and evaluate the effect of the irradiation on the chemical composition of the fruits. Fruits were artificially infested with the immature stages of the fruit fly and treated with 0, 10, 20, 30, 40, 50, 100, 150 and 200 Gy Cobalt-60 doses. By the results obtained it is possible to conclude that: third instar larvae are more tolerant to irradiation treatments; the dose of 50 Gy causes sterility to the adults emerged from all immature stages irradiated. (author)

  8. Response of the pearly eye melon fly Bactrocera cucurbitae(Coquillett)(Diptera:Tephritidae) mutant to host-associated visual cues

    Science.gov (United States)

    We report on a pearly eye mutant (PEM) line generated from a single male Bactrocera cucurbitae collected in Kapoho, Hawaii. Crossing experiments with colony wild-type flies indicate that the locus controlling this trait is autosomal and the mutant allele is recessive. Experiments with females to ass...

  9. Case 3693 Cryptodacus Hendel, 1914 (Insecta: Diptera: Tephritidae): Proposed suppression of Cryptodacus Gundlach, 1862 (Reptilia, Serpentes, Colubridae)

    Science.gov (United States)

    Norrbom, Allen L.; McDiarmid, Roy W.; Chen, Xiao-Lin; David, King J.; De Meyer, Marc; Freidberg, Amnon; Han, Ho-Yeon; Steck, Gary J.; Thompson, F. Christian; White, Ian M.; Zucchi, Roberto A.

    2015-01-01

    The purpose of this application, under Article 23.9.3, is to conserve current usage of the well-established genus-group name Cryptodacus Hendel, 1914 for a genus of Neotropical fruit flies by suppression of the earlier, unused name Crypto- dacus Gundlach, 1862, currently a junior synonym of Arrhyton Günther, 1858, a genus of snakes, under the plenary power of the Commission, in the interest of nomenclatural stability. Cryptodacus Gundlach has not been used as a valid name since 1883, whereas Cryptodacus Hendel has been used in a significant body of literature relating to fruit fly systematics, morphology and phylogeny and is the currently used name in various name and molecular databases. 

  10. Susceptibility of low-chill blueberry cultivars to oriental fruit fly, mediterranean fruit fly, and melon fly (Diptera: Tephritidae)

    Science.gov (United States)

    Forced infestation studies were conducted to determine if fruits of southern highbush blueberries (Vaccinium corymbosum L. hybrids) are hosts for three invasive tephritid fruit flies. Fruits of 17 blueberry cultivars were exposed to gravid female flies of Bactrocera dorsalis (Hendel) (oriental frui...

  11. Mexican fruit fly (Diptera: tephritidae) and the phenology of its native host plant, Yellow Chapote (Rutaceae) in Mexico

    Science.gov (United States)

    In northeastern Mexico, the Mexican fruit fly, Anastrepha ludens (Loew), breeds on its native host, yellow chapote, Casimiroa greggii (Wats.), which typically produces fruit in the spring. Peak populations of the fly occur in late spring or early summer when adults emerge from the generation of lar...

  12. Cuelure but not zingerone make the sex pheromone of male Bactrocera tryoni (Tephritidae: Diptera) more attractive to females.

    Science.gov (United States)

    Kumaran, Nagalingam; Hayes, R Andrew; Clarke, Anthony R

    2014-09-01

    In tephritid fruit flies of the genus Bactrocera Macquart, a group of plant derived compounds (sensu amplo 'male lures') enhance the mating success of males that have consumed them. For flies responding to the male lure methyl eugenol, this is due to the accumulation of chemicals derived from the male lure in the male rectal gland (site of pheromone synthesis) and the subsequent release of an attractive pheromone. Cuelure, raspberry ketone and zingerone are a second, related group of male lures to which many Bactrocera species respond. Raspberry ketone and cuelure are both known to accumulate in the rectal gland of males as raspberry ketone, but it is not known if the emitted male pheromone is subsequently altered in complexity or is more attractive to females. Using Bactrocera tryoni as our test insect, and cuelure and zingerone as our test chemicals, we assess: (i) lure accumulation in the rectal gland; (ii) if the lures are released exclusively in association with the male pheromone; and (iii) if the pheromone of lure-fed males is more attractive to females than the pheromone of lure-unfed males. As previously documented, we found cuelure was stored in its hydroxyl form of raspberry ketone, while zingerone was stored largely in an unaltered state. Small but consistent amounts of raspberry ketone and β-(4-hydroxy-3-methoxyphenyl)-propionic acid were also detected in zingerone-fed flies. Males released the ingested lures or their analogues, along with endogenous pheromone chemicals, only during the dusk courtship period. More females responded to squashed rectal glands extracted from flies fed on cuelure than to glands from control flies, while more females responded to the pheromone of calling cuelure-fed males than to control males. The response to zingerone treatments in both cases was not different from the control. The results show that male B. tryoni release ingested lures as part of their pheromone blend and, at least for cuelure, this attracts more females.

  13. Genetic structure and colonization history of the fruit fly Bactrocera tau (Diptera: Tephritidae) in China and Southeast Asia.

    Science.gov (United States)

    Shi, W; Kerdelhué, C; Ye, H

    2014-06-01

    Bactrocera tau (Walker), a major invasive pest worldwide, was first described in Fujian (China) in 1849 and has dispersed to tropical and subtropical Asia and the South Pacific region. Few data are available on its colonization history and expansion processes. This pilot study attempted to reconstruct the colonization history and pathways of this pest in China and neighboring Southeast Asian countries based on mitochondrial DNA. Results of the study showed six genetic groups corresponding to geographical characteristics, although the pattern was relatively weak. Homogeneous genetic patterns were observed within southern and central China, and northern Vietnam. Continuous colonization from the coast of southern China to inland regions of China and northern Vietnam was suggested. Strong genetic structure was observed in western China, Thailand, and Laos. The isolation of four of the six groups was most probably attributable to major topographical barriers of western China. Yunnan acted as a contact zone of B. tau in China and neighboring Southeast Asia. The absence of isolation by distance and the overall low phylogeographic structure of B. tau suggested that long distance dispersal events and human activities could play a major role in the colonization and expansion patterns of B. tau. By analyzing the genetic diversity, gene flow, haplotype phylogeny, and demographic history of 23 fly populations, we hypothesized that B. tau could have been introduced long ago in southern China, from which it further expanded or that southern China could correspond to the native range of this species.

  14. Susceptibility of low-chill blueberry cultivars to Mediterranean fruit fly, oriental fruit fly, and melon fly (Diptera: Tephritidae).

    Science.gov (United States)

    Follett, Peter A; Zee, Francis T; Hamasaki, Randall T; Hummer, Kim; Nakamoto, Stuart T

    2011-04-01

    No-choice tests were conducted to determine whether fruit of southern highbush blueberry, Vaccinium corymbosum L., hybrids are hosts for three invasive tephritid fruit flies in Hawaii. Fruit of various blueberry cultivars was exposed to gravid female flies of Bactrocera dorsalis Hendel (oriental fruit fly), Ceratitis capitata (Wiedemann) (Mediterranean fruit fly), or Bactrocera cucurbitae Coquillet (melon fly) in screen cages outdoors for 6 h and then held on sand in the laboratory for 2 wk for pupal development and adult emergence. Each of the 15 blueberry cultivars tested were infested by oriental fruit fly and Mediterranean fruit fly, confirming that these fruit flies will oviposit on blueberry fruit and that blueberry is a suitable host for fly development. However, there was significant cultivar variation in susceptibility to fruit fly infestation. For oriental fruit fly, 'Sapphire' fruit produced an average of 1.42 puparia per g, twice as high as that of the next most susceptible cultivar 'Emerald' (0.70 puparia per g). 'Legacy', 'Biloxi', and 'Spring High' were least susceptible to infestation, producing only 0.20-0.25 oriental fruit fly puparia per g of fruit. For Mediterranean fruit fly, 'Blue Crisp' produced 0.50 puparia per g of fruit, whereas 'Sharpblue' produced only 0.03 puparia per g of fruit. Blueberry was a marginal host for melon fly. This information will aid in development of pest management recommendations for blueberry cultivars as planting of low-chill cultivars expands to areas with subtropical and tropical fruit flies. Planting of fruit fly resistant cultivars may result in lower infestation levels and less crop loss.

  15. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development.

  16. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt) (Diptera: Tephritidae).

    Science.gov (United States)

    Park, Soo J; Morelli, Renata; Hanssen, Benjamin L; Jamie, Joanne F; Jamie, Ian M; Siderhurst, Matthew S; Taylor, Phillip W

    2016-01-01

    The Queensland fruit fly, Bactrocera tryoni (Froggatt) (Q-fly), is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT) and mass trapping (MT) are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl)-2-butanone) and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl) and ethers (methyl ether, trimethylsilyl ether) in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC), and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated.

  17. Bacterial communities in the gut and reproductive organs of Bactrocera minax (Diptera: Tephritidae based on 454 pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Ailin Wang

    Full Text Available The citrus fruit fly Bactrocera minax is associated with diverse bacterial communities. We used a 454 pyrosequencing technology to study in depth the microbial communities associated with gut and reproductive organs of Bactrocera minax. Our dataset consisted of 100,749 reads with an average length of 400 bp. The saturated rarefaction curves and species richness indices indicate that the sampling was comprehensive. We found highly diverse bacterial communities, with individual sample containing approximately 361 microbial operational taxonomic units (OTUs. A total of 17 bacterial phyla were obtained from the flies. A phylogenetic analysis of 16S rDNA revealed that Proteobacteria was dominant in all samples (75%-95%. Actinobacteria and Firmicutes were also commonly found in the total clones. Klebsiella, Citrobacter, Enterobacter, and Serratia were the major genera. However, bacterial diversity (Chao1, Shannon and Simpson indices and community structure (PCA analysis varied across samples. Female ovary has the most diverse bacteria, followed by male testis, and the bacteria diversity of reproductive organs is richer than that of the gut. The observed variation can be caused by sex and tissue, possibly to meet the host's physiological demands.

  18. Olive fruit fly (Diptera: Tephritidae) in California: longevity, oviposition, and development in canning olives in the laboratory and greenhouse.

    Science.gov (United States)

    Yokoyama, Victoria Y

    2012-02-01

    The biology of olive fruit fly, Bactrocera oleae (Rossi), was studied in the laboratory, greenhouse, and in canning olives, Olea europaea L., in relation to California regional climates. Adults survived in laboratory tests at constant temperatures and relative humidities of 5 degrees C and 83%; 15 degrees C and 59%; 25 degrees C and 30%; and 35 degrees C and 29% for 15, 6, 3, and 2 d without provisions of food and water and for 37, 63, 25, and 4 d with provisions, respectively. In a divided greenhouse, adults survived for 8-11 d in the warm side (36 degrees C and 31% RH daytime); and in the cool side (26 degrees C and 63% RH daytime) 10 d without provisions and 203 d with provisions. A significantly greater number of adults survived in the cool side than the warm side, and with provisions than without. First and last eggs were oviposited in olive fruit when females were 6 and 90 d old, respectively. The highest number of eggs was 55 per day in 10 olive fruit oviposited by 10 28 d-old females, with maximum egg production by 13-37 d-old females. A significantly greater number of ovipositional sites occurred in all sizes of immature green fruit when exposed to adults in cages for 5 d than 2 d. Adults emerged from fruit with a height of > or = 1.0 cm or a volume of > or = 0.2 cm3. More than seven adults per 15 fruit emerged from field infested fruit with a height of 1.1 cm and volume of 0.1 cm3. Larval length was significantly different among the first, second, and third instars and ranged from 0.7 to 1.6, 2.4-4.3, and 4.8-5.6 mm at 14 degrees C; 0.8-1.1, 1.9-2.9, and 3.9-4.4 mm at 21 degrees C, and 0.7-1.3, 2.4-2.9, and 4.4-4.8 mm at 26 degrees C, respectively. Survival of pupae to the adult stage was significantly lower at 26 degrees C than 14 degrees C or 21 degrees C. The period of adult emergence began at 38, 14, and 11 d over a period of 8, 5, and 1 d at 14, 21, and 26 degrees C, respectively. Findings were related to the occurrence and control of California olive fruit fly infestations.

  19. Evaluation of the Host Status of Mature Green Papayas 'Maradol' for the Mexican Fruit Fly (Diptera: Tephritidae).

    Science.gov (United States)

    Arredondo, José; Ruiz, Lia; Díaz-Fleischer, Francisco

    2014-10-01

    The suitability of mature green 'Maradol' papaya as a host of Anastrepha ludens (Loew) was studied under field and laboratory conditions. Field tests were conducted on commercial-ripened and spot-ripened fruit in two orchards and during two seasons in the state of Chiapas. Fruits at exportation ripeness are in "commercial ripeness", while fruits that are harvested immediately preceding exportation ripeness are in "spot ripeness." The field tests consisted of forced infestation experiments that evaluated papayas at two ripeness stages: the commercial- or exportation-ripened fruit (green fruits with one or two yellow stripes) and fruit before exportation ripeness called "spot ripeness." These tests were conducted in two orchards and during two seasons in the state of Chiapas, Mexico. Laboratory trials were performed with commercial-ripened fruit only. Fruit from four different postharvest periods (3, 24, 48, and 72 h) were exposed to groups of gravid flies. No larvae emerged from the fruit that was collected in the field experiments. However, some larvae and several fertile flies were obtained from the commercial-ripened fruit 72 h postharvest but not 3, 24, and 48 h postharvest in the laboratory. The results of this study indicate that the commercially ripe fruits of papaya Maradol were resistant to or free from infestation of A. ludens flies under field conditions, though these fruits must be considered nonnatural, conditional host because they became infested in the laboratory.

  20. Analysis of Surstylus and Aculeus Shape and Size Using Geometric Morphometrics to Discriminate Rhagoletis pomonella and Rhagoletis zephyria (Diptera: Tephritidae)

    Science.gov (United States)

    Rhagoletis pomonella (Walsh) and Rhagoletis zephyria Snow both occur in the Pacific Northwest of the U. S. and are frequently confused with one another due to their morphological similarity. The apple maggot, R. pomonella, is a threat to commercial apples in the Pacific Northwest, whereas R. zephyr...

  1. Genetic diversity and population structure of Anastrepha striata (Diptera: Tephritidae) in three natural regions of southwestern Colombia using mitochondrial sequences.

    Science.gov (United States)

    Gallo-Franco, Jenny Johana; Velasco-Cuervo, Sandra Marcela; Aguirre-Ramirez, Elkin; González Obando, Ranulfo; Carrejo, Nancy Soraya; Toro-Perea, Nelson

    2017-02-01

    Anastrepha striata is widely distributed across the Americas and is a pest of economically important crops, especially crops of the Myrtaceae family. Insect population structures can be influenced by the presence of physical barriers or characteristics associated with habitat differences. This study evaluated the effect of the Western Andes on the population structure of A. striata. Individuals were collected from Psidium guajava fruits from three natural regions of southwestern Colombia (Pacific Coast, mountainous region and the inter-Andean valley of the Cauca River). Based on a 1318 bp concatenated of the genes Cytochrome Oxidase subunit I (COI) and NADH dehydrogenase subunit 6 (ND6), 14 haplotypes with few changes among them (between 1 and 3) were found. There was only one dominant haplotype in all three regions. No genetic structure associated with the three eco-geographical regions of the study was found. Moreover, the Western Andes are not an effective barrier for the genetic isolation of the populations from the Pacific Coast compared with the inter-Andean valley populations. This genetic homogeneity could be partially due to anthropogenic intervention, which acts as a dispersal agent of infested fruits. Another hypothesis to explain the lack of structure would be the relatively recent arrival of A. striata to the region, as indicated by an analysis of the demographic history, which reveals a process of population expansion. This study represents the first attempt to understand the population genetics of A. striata in Colombia and could contribute to the integral management of this pest.

  2. Are apple and hawthorn fruit volatiles more attractive than ammonium carbonate to Rhagoletis pomonella (Diptera: Tephritidae) in Washington state?

    Science.gov (United States)

    The apple maggot fly, Rhagoletis pomonella (Walsh), is an introduced, quarantine pest of apple (Malus domestica Borkhausen) in the Pacific Northwest of the U.S. In the eastern U.S. where the fly is native, fruit volatiles have been reported to be more attractive than ammonia compounds to R. pomonel...

  3. Ammonium carbonate is more attractive than apple and hawthorn fruit volatile lures to Rhagoletis pomonella (Diptera: Tephritidae) in Washington State.

    Science.gov (United States)

    Yee, Wee L; Nash, Meralee J; Goughnour, Robert B; Cha, Dong H; Linn, Charles E; Feder, Jeffrey L

    2014-08-01

    The apple maggot fly, Rhagoletis pomonella (Walsh), is an introduced, quarantine pest of apple (Malus domestica Borkhausen) in the Pacific Northwest of the United States. In the eastern United States where the fly is native, fruit volatiles have been reported to be more attractive than ammonia compounds to R. pomonella. However, the opposite may be true in the western United States. Here, we determined whether newly identified western apple and western hawthorn fruit volatiles are more attractive than ammonium carbonate (AC) to R. pomonella in apple, black hawthorn, and ornamental hawthorn trees in western Washington State. In all three host trees, sticky red sphere or yellow panel traps baited with AC generally caught more flies than traps baited with lures containing the four newly developed fruit blends (modified eastern apple, western apple, western ornamental hawthorn, and western black hawthorn) or two older blends (eastern apple and eastern downy hawthorn). Fruit volatiles also displayed more variation among trapping studies conducted at different sites, in different host trees, and across years than AC. The results imply that traps baited with AC represent the best approach to monitoring R. pomonella in Washington State.

  4. Assessment of Injuries Caused by Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) on the Incidence of Bunch Rot Diseases in Table Grape.

    Science.gov (United States)

    Machota, R; Bortoli, L C; Cavalcanti, F R; Botton, M; Grützmacher, A D

    2016-08-01

    Anastrepha fraterculus (Wied.) is the main insect pest of table grapes (Vitis vinifera) in the Southern Region of Brazil. In this study, we aimed to investigate the effect of fruit puncturing by adult females and larval infestation by A. fraterculus on the occurrence of bunch rot disease in the grape (cultivar "Itália") by evaluating grapes (a) punctured for oviposition by females of A. fraterculus, sterilized in laboratory with novaluron (40 mg L(-1)) and further spray-inoculated separately with Botrytis cinerea (1 × 10(6) conidia mL(-1)), Glomerella cingulata (1 × 10(6) conidia mL(-1)), and bacteria and yeast that cause sour rot (1 × 10(5) cells mL(-1)), (b) grapes punctured for oviposition by non-sterilized females with pathogen spraying, (c) grapes with mechanical wounds and pathogen spraying, (d) grapes with no wounds and with pathogen spraying, (e) grapes punctured for oviposition by A. fraterculus chemically sterilized in laboratory with novaluron, (f) grapes punctured for oviposition by A. fraterculus non-sterilized in laboratory with novaluron, (g) grapes with mechanical wounds, and (h) grapes with no sterilization or pathogen spraying. Our data indicated that the mechanical and oviposition wounds caused by A. fraterculus increased the percentage of grapes infected by B. cinerea, G. cingulata, and microorganisms of acid rot. The grape puncturing by A. fraterculus and the mechanical wound allows the penetration of B. cinerea and microorganisms leading to acid rot. We conclude that the fruit fly A. fraterculus may facilitate phytopathogens penetration leading to bunch rots in the table grape Itália.

  5. Use of alpha-ionol + cade oil for detection and monitoring of Bactrocera latifrons (Diptera: Tephritidae) populations

    Energy Technology Data Exchange (ETDEWEB)

    McQuate, Grant T.; Jang, Eric B., E-mail: grant.mcquate@ars.usda.go, E-mail: eric.jang@ars.usda.go [U.S. Department of Agriculture (USDA/ARS), Hilo, HI (United States). Pacific Basin Agricultural Research Center; Bokonon-Ganta, Aime H., E-mail: aimehbg@hawaii.ed [University of Hawaii (CTAHR/PEPS/UH), Honolulu, HI (United States). Coll. of Tropical Agriculture and Human Resources. Dept. of Plant and Environmental Protection Sciences

    2006-07-01

    Bactrocera latifrons (Hendel) is a tephritid fruit fly that primarily infests solanaceous fruits. Although primarily of Asian distribution, it has invaded Hawaii and, more recently, the continent of Africa (Tanzania and Kenya). Male B. latifrons uniquely respond to alpha-ionol + cade oil, rather than to either methyl eugenol or cuelure, to which males of the majority of other Dacine fruit flies respond. Here we present research results detailing the age of male B. latifrons response to alpha-ionol + cade oil, the persistence of wick attractiveness, and the effectiveness of alpha-ionol + cade oil in detecting B. latifrons populations. Based on wind tunnel studies with wild flies, male response steadily increased from 5% at age 2 to 45% at age 28, with male response exceeding 50% of the peak response by Day 7 and exceeding 75% and 90% by days 14 and 21, respectively. The attractiveness of wicks treated with 2.0 ml alpha-ionol and 1.0 ml cade oil (on separate wicks) declined over time, with wick response reduced to about 50% of the fresh catch after 6 1/2 weeks. Based on concurrent alpha-ionol + cade oil based trapping and collections of turkey berry, Solanum torvum (Solanaceae), fruits, the presence of B. latifrons was detected at the time of fruit collection, 75.5 % of the time. (author)

  6. First record of Anastrepha zacharyi Norrbom (Diptera, Tephritidae) in Brazil, and notes on its host plant and parasitoid

    Science.gov (United States)

    Cryptodacus bernardoi Rodriguez & Rodriguez, new species, is described from Colombia. It was reared from fruits of Phoradendron sp. near piperoides (Kunth) Trel. New distribution records are reported for Cryptodacus ornatus Norrbom from Colombia and Peru, for Cryptodacus trinotatus Norrbom & Korytko...

  7. Comparative Responses of Anastrepha ludens and Anastrepha obliqua (Diptera: Tephritidae) to the Synthetic Attractant BioLure.

    Science.gov (United States)

    Déctor, Nayeli; Malo, Edi A; Rojas, Julio C; Liedo, Pablo

    2016-10-01

    The responses of wild and sterile Anastrepha ludens (Loew) and Anastrepha obliqua (Mcquart) fruit flies to the synthetic attractant BioLure were determined by electroantennography (EAG), in field cage tests using MultiLure traps, and by release-recapture field experiments using sterile flies. In EAG bioassays, no differences were found between species, sexes, sterile and wild flies. There were only specific differences and interactions in dose responses. More A. ludens than A. obliqua individuals were captured in multilure traps in field cage test. In A. ludens, there was not significant difference between the number of females and males captured, whereas in A. obliqua more females than males were caught. Age showed a bimodal response in both species and both sexes, with peaks at 4 and 14 d old. In the release-recapture experiments, there were significant differences between species, sexes, and orchards and among the days after release. More individuals of A. ludens than A obliqua were recaptured. Only in A. obliqua the difference between the sexes was significant, with a 3.60:1 female:male ratio. Orchard conditions affected the recapture rate, but in both orchards the largest number of flies recaptured occurred during the first day after release (46 and 88% in each orchard). Our results show that the response to this synthetic lure is species-specific and contribute to better interpret trapping data. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Species of Anastrepha (Diptera: Tephritidae captured in a guava orchard (Psidium guajava L., Myrtaceae in Boa Vista, Roraima, Brazil

    Directory of Open Access Journals (Sweden)

    AL Marsaro Júnior

    Full Text Available The guava fruit (Psidium guajava is among the most strongly affected by fruit flies in Brazil. In the Brazilian Amazon, 11 species of Anastrepha have been reported in guava orchards to date. This work aimed to identify the species of Anastrepha present in a guava orchard in the municipality of Boa Vista, determine the species infesting the fruits, and identify any parasitoids present. Two McPhail traps with food bait were installed and weekly collections were made between January and December 2008. Fruits were also collected systematically during this period, with a view to determining the association between host plant and tephritid species. Nine species of Anastrepha were identified, in addition to one specimen belonging to a probable new species. Anastrepha striata Schiner, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart, and Anastrepha fraterculus (Wiedemann were the dominant species in the orchard, accounting for 84.8% of all captured individuals. All females collected directly from fruits were A. striata. Doryctobracon areolatus (Szépligeti was the only parasitoid species obtained. In this work, Anastrepha ethalea (Walker is reported for the first time in the state of Roraima.

  9. Faunistic analysis of the species of Anastrepha Schiner (Diptera: Tephritidae) in three municipalities of the state of Roraima, Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Nascimento, D B; Ronchi-Teles, B; Adaime, R

    2012-11-01

    The purpose of this work was to describe the population patterns of Anastrepha in three municipalities of the state of Roraima, Brazil, via faunistic analysis. Weekly collections were performed from January through December 2008, using McPhail traps containing 5% hydrolysed protein, in domestic orchards in the municipalities of Boa Vista, Bonfim and Pacaraima. We captured 301 females of Anastrepha in Boa Vista, 212 in Bonfim, and 167 in Pacaraima. Boa Vista presented the highest species richness (S = 10) and Pacaraima the lowest (S = 4). Anastrepha striata was the predominant species in Boa Vista (47.18%) and Pacaraima (65.87%), whereas A. obliqua predominated in Bonfim (46.23%). Boa Vista presented the highest Shannon-Wiener diversity index (H' = 1.19) and Margalef index (α = 1.58), and Bonfim presented the highest Pielou's evenness index (J' = 0.69). In Pacaraima the cumulative curves reached stability, confirming that the observed and expected species richness were the same. In the other two municipalities, the curves showed a moderate growth, suggesting that the sampling effort was not sufficient to produce an accurate depiction of species richness. In this study, Anastrepha zernyi is reported for the first time in Roraima.

  10. Development, genetic and cytogenetic analyses of genetic sexing strains of the Mexican fruit fly, Anastrepha ludens Loew (Diptera: Tephritidae).

    Science.gov (United States)

    Zepeda-Cisneros, Cristina Silvia; Meza Hernández, José Salvador; García-Martínez, Víctor; Ibañez-Palacios, Jorge; Zacharopoulou, Antigone; Franz, Gerald

    2014-01-01

    Anastrepha ludens is among the pests that have a major impact on México's economy because it attacks fruits as citrus and mangoes. The Mexican Federal government uses integrated pest management to control A. ludens through the Programa Nacional Moscas de la Fruta [National Fruit Fly Program, SAGARPA-SENASICA]. One of the main components of this program is the sterile insect technique (SIT), which is used to control field populations of the pest by releasing sterile flies. To increase the efficiency of this technique, we have developed a genetic sexing strain (GSS) in which the sexing mechanism is based on a pupal colour dimorphism (brown-black) and is the result of a reciprocal translocation between the Y chromosome and the autosome bearing the black pupae (bp) locus. Ten strains producing wild-type (brown pupae) males and mutant (black pupae) females were isolated. Subsequent evaluations for several generations were performed in most of these strains. The translocation strain named Tapachula-7 showed minimal effect on survival and the best genetic stability of all ten strains. Genetic and cytogenetic analyses were performed using mitotic and polytene chromosomes and we succeeded to characterize the chromosomal structure of this reciprocal translocation and map the autosome breakpoint, despite the fact that the Y chromosome is not visible in polytene nuclei following standard staining. We show that mitotic and polytene chromosomes can be used in cytogenetic analyses towards the development of genetic control methods in this pest species. The present work is the first report of the construction of GSS of Anastrepha ludens, with potential use in a future Moscafrut operational program.

  11. Precocious sexual signalling and mating in Anastrepha fraterculus (Diptera: Tephritidae) sterile males achieved through juvenile hormone treatment and protein supplements.

    Science.gov (United States)

    Liendo, M C; Devescovi, F; Bachmann, G E; Utgés, M E; Abraham, S; Vera, M T; Lanzavecchia, S B; Bouvet, J P; Gómez-Cendra, P; Hendrichs, J; Teal, P E A; Cladera, J L; Segura, D F

    2013-02-01

    Sexual maturation of Anastrepha fraterculus is a long process. Methoprene (a mimic of juvenile hormone) considerably reduces the time for sexual maturation in males. However, in other Anastrepha species, this effect depends on protein intake at the adult stage. Here, we evaluated the mating competitiveness of sterile laboratory males and females that were treated with methoprene (either the pupal or adult stage) and were kept under different regimes of adult food, which varied in the protein source and the sugar:protein ratio. Experiments were carried out under semi-natural conditions, where laboratory flies competed over copulations with sexually mature wild flies. Sterile, methoprene-treated males that reached sexual maturity earlier (six days old), displayed the same lekking behaviour, attractiveness to females and mating competitiveness as mature wild males. This effect depended on protein intake. Diets containing sugar and hydrolyzed yeast allowed sterile males to compete with wild males (even at a low concentration of protein), while brewer´s yeast failed to do so even at a higher concentration. Sugar only fed males were unable to achieve significant numbers of copulations. Methoprene did not increase the readiness to mate of six-day-old sterile females. Long pre-copulatory periods create an additional cost to the management of fruit fly pests through the sterile insect technique (SIT). Our findings suggest that methoprene treatment will increase SIT effectiveness against A. fraterculus when coupled with a diet fortified with protein. Additionally, methoprene acts as a physiological sexing method, allowing the release of mature males and immature females and hence increasing SIT efficiency.

  12. Redescription of three species of Anastrepha (Diptera, Tephritidae) rediscovered in Brazil, with the establishment of a new synonym.

    Science.gov (United States)

    Uramoto, Keiko; Zucchi, Roberto A; Norrbom, Allen L

    2015-01-20

    The descriptions of Anastrepha matertela Zucchi and A. tenella Zucchi were based exclusively on the holotypes (female). Based on additional specimens collected in Brazil since their original descriptions, both species are redescribed and illustrated. A lectotype is designated for Anastrepha bivittata (Macquart, 1843), which also is redescribed and considered to be the senior synonym of A. fumipennis Lima, 1934. 

  13. Costly nutritious diets do not necessarily translate into better performance of artificaially reared fruit files (Diptera: Tephritidae)

    Science.gov (United States)

    Protein, lipid, carbohydrate and energy contents of three artificial diets (Xal2, Met1 and Met2) used for laboratory-rearing and mass-rearing the Mexican fruit fly, Anastrepha ludens (Loew), for a sterile insect technique (SIT) program were measured. The larval survival, pupation, pupal weight, adu...

  14. New records of fruit flies (Diptera: Tephritidae), wild hosts and parasitoids (Hymenoptera: Braconidae) in the Brazilian Amazon

    Energy Technology Data Exchange (ETDEWEB)

    Jesus, Cristiane R. de; Oliveira, Manoela N. de; Silva, Ricardo A. da [EMBRAPA Amapa, Macapa, AP (Brazil); Pereira, Julia D.B. [Universidade Federal do Amapa, Macapa, AP (Brazil); Souza Filho, Miguel F. [Instituto Biologico, Campinas, SP (Brazil); Costa Neto, Salustiano V. da [Instituto de Pesquisas Cientificas e Tecnologicas do Amapa, Macapa, AP (Brazil); Marinho, Claudia F.; Zucchi, Roberto A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2008-11-15

    Anastrepha anomala Stone was obtained from Parahancornia amapa (Huber) Ducke (Apocynaceae) fruits, and Anastrepha hastata Stone from Cheiloclinium cognatum (Miers.) (Hippocrateaceae) in the State of Amapa, Brazil. Two braconids, Doryctobracon sp. and Opius bellus Gahan, were reared from the latter fruit fl y species. This is the fi rst record of P. amapa as a fruit fl y host. C. cognatum is the fi rst host known to A. hastata. Both braconids are also the fi rst records of parasitoids for this species. (author)

  15. Taxonomy and phenotypic relationships of the Anastrepha fraterculus complex in the Mesoamerican and Pacific Neotropical dominions (Diptera, Tephritidae).

    Science.gov (United States)

    Hernández-Ortiz, Vicente; Canal, Nelson A; Salas, Juan O Tigrero; Ruíz-Hurtado, Freddy M; Dzul-Cauich, José F

    2015-01-01

    Previous morphometric studies based on linear measurements of female structures of the aculeus, mesonotum, and wing revealed the existence of seven morphotypes within the Anastrepha fraterculus cryptic species complex along the Neotropical Region. The current research followed linear and geometric morphometric approaches in 40 population samples of the nominal species Anastrepha fraterculus (Wiedemann) spread throughout the Meso-American and Pacific Neotropical dominions (including Mexico, Central America, Venezuela, Colombia, Ecuador, and Peru). The goals were to explore the phenotypic relationships of the morphotypes in these biogeographical areas; evaluate the reliability of procedures used for delimitation of morphotypes; and describe their current distribution. Findings determined that morphotypes previously recognized via the linear morphometrics were also supported by geometric morphometrics of the wing shape. In addition, we found an eighth morphotype inhabiting the highlands of Ecuador and Peru. Morphotypes are related into three natural phenotypic groups nominated as Mesoamerican-Caribbean lineage, Andean lineage, and Brazilian lineage. The hypothesis that lineages are not directly related to each other is discussed, supported by their large morphological divergence and endemicity in these three well-defined biogeographic areas. In addition, this hypothesis of the non-monophyly of the Anastrepha fraterculus complex is also supported by evidence from other authors based on molecular studies and the strong reproductive isolation between morphs from different lineages.

  16. Morphometric study of third-instar larvae from five morphotypes of the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae).

    Science.gov (United States)

    Canal, Nelson A; Hernández-Ortiz, Vicente; Salas, Juan O Tigrero; Selivon, Denise

    2015-01-01

    The occurrence of cryptic species among economically important fruit flies strongly affects the development of management tactics for these pests. Tools for studying cryptic species not only facilitate evolutionary and systematic studies, but they also provide support for fruit fly management and quarantine activities. Previous studies have shown that the South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species, but few studies have been performed on the morphology of its immature stages. An analysis of mandible shape and linear morphometric variability was applied to third-instar larvae of five morphotypes of the Anastrepha fraterculus complex: Mexican, Andean, Ecuadorian, Peruvian and Brazilian-1. Outline geometric morphometry was used to study the mouth hook shape and linear morphometry analysis was performed using 24 linear measurements of the body, cephalopharyngeal skeleton, mouth hook and hypopharyngeal sclerite. Different morphotypes were grouped accurately using canonical discriminant analyses of both the geometric and linear morphometry. The shape of the mandible differed among the morphotypes, and the anterior spiracle length, number of tubules of the anterior spiracle, length and height of the mouth hook and length of the cephalopharyngeal skeleton were the most significant variables in the linear morphometric analysis. Third-instar larvae provide useful characters for studies of cryptic species in the Anastrepha fraterculus complex.

  17. Population fluctuation of fruit flies (Diptera, Tephritidae in peach and passion fruit orchards in Iraceminha, Santa Catarina

    Directory of Open Access Journals (Sweden)

    Sheila Alberti

    2012-06-01

    Full Text Available The objective of this study was learn more about the population fluctuation of fruit flies in peach and passion fruit orchards in the municipality of Iraceminha, Santa Catarina. In order to carry out the survey, McPhail traps were set up with 10% inverted glucose from April 2006 to March 2007. Captured flies were identified at the Laboratório de Entomologia at UNOCHAPECÓ. The collected females belonged to twelve species and four genera. The adults of Anastrepha fraterculus were trapped during all seasons, with a population peak in October 2006 in the peach orchards. The population levels of Anastrepha grandis remained higher during the first five months in the passion fruit orchard. There were low infestation rates by flies of the genera Ceratitis, Blepharoneura and Tomoplagia when compared to flies of the genus Anastrepha. The results showed that the presence of flies in the orchards was associated with the availability of host fruit and not with climatic conditions.

  18. Effects of male nutrition on sperm storage and remating behavior in wild and laboratory Anastrepha fraterculus (Diptera: Tephritidae) females.

    Science.gov (United States)

    Abraham, Solana; Goane, Lucía; Cladera, Jorge; Vera, M Teresa

    2011-11-01

    Male physiological condition can affect his ability to modulate female sexual receptivity. Thus, studying this aspect can have biological and practical implications. Here, we examine how male nutritional status affected the amount of sperm stored, remating rate and refractory period of the tephritid fruit fly Anastrepha fraterculus (Wiedemann) females. Both wild and laboratory flies were evaluated. We also examine female sperm storage patterns. Experiments were carried out by manipulating male adult diet and exposing these males to virgin females. Females mated with differently treated males were either dissected to count the amount of sperm stored or exposed to virgin males to determine remating rate and the length of the refractory period. We found that male nutritional status affected the amount of the sperm stored and the renewal of sexual receptivity in wild flies. For laboratory flies, male nutritional status affected the length of the refractory period but not the amount of sperm stored by females. In addition, we report that the ventral receptacle is not an important organ of sperm storage in this species. We conclude that male nutritional condition influences the ability to modulate female sexual receptivity, possibly through a combination of the quantity and quality of the ejaculate. From an applied perspective, providing males with an enriched diet will likely result in increased efficacy of the sterile insect technique. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Comparison of aggregation and feeding responses by normal and irradiated fruit flies, Ceratitis capitata and Anastrepha suspensa (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Galun, R.; Gothilf, S.; Blondheim, S.; Sharp, J.L.; Mazor, M.; Lachman, A.

    1985-12-01

    Olfactory, aggregatory, and feeding responses of normal (untreated) laboratory stocks of Mediterranean fruit fly (medfly), Ceratitis capitata (Wiedemann), and of Caribbean fruit fly (caribfly), Anastrepha suspensa (Loew), were compared to those of flies irradiated (10 krad in air) 2 days before eclosion. Females of both species consumed greater quantities of protein hydrolysate solutions, entered protein hydrolysate-baited olfactory traps, and aggregated on agar plates containing protein hydrolysate in greater numbers than males of the same age and condition. However, male medflies consumed more sucrose than did females of the same age and condition. In the medfly, irradiation resulted in reduced olfactory response, reduced total food intake by flies of both sexes, and a significant reduction in aggregation on and intake of protein hydrolysate by females and of sugar consumption by males. In the irradiated caribfly, there was a significant reduction in olfactory response of females to yeast hydrolysate. In both sexes, aggregation on and consumption of yeast hydrolysate were reduced. Effects of irradiation on feeding behavior are discussed in relation to the biology of the flies and their control by the sterile insect release method.

  20. Intrinsic competition and competitor-free-space influence the coexistence of parasitoids (Hymenoptera: Braconidae: Opiinae) of neotropical tephritidae (Diptera)

    Science.gov (United States)

    Endoparasitoid larvae may eliminate heterospecific competitors by physical or physiological means. The outcomes of these intrinsic competitions are often predictable with one species typically eliminating the other. The opiine braconids Doryctobracon areolatus (Szepligeti) and Utetes anastrephae (Vi...

  1. Capture of Anastrepha suspensa and sterile male Ceratitis capitata (Diptera: Tephritidae) in multilure traps versus phase 4 traps

    Science.gov (United States)

    Field trials were conducted in south Florida to compare capture of wild Caribbean fruit flies, Anastrepha suspensa (Loew), and sterile male Mediterranean fruit flies, Ceratitis capitata (Wiedemann), in Multilure traps, which are McPhail-type traps that use an aqueous solution to retain attracted fli...

  2. First instar larvae morphology of Opiinae (Hymenoptera: Braconidae) parasitoids of Anastrepha (Diptera: Tephritidae) fruit flies. Implications for interspecific competition.

    Science.gov (United States)

    Murillo, Félix D; Liedo, Pablo; Nieto-López, María Guadalupe; Cabrera-Mireles, Héctor; Barrera, Juan F; Montoya, Pablo

    2016-05-01

    The morphology of the first instars of the Opiinae braconids Diachasmimorpha longicaudata, Doryctobracon areolatus, Doryctobracon crawfordi, Utetes anastrephae and Opius hirtus (the first is exotic, and the others are natives to Mexico), parasitoids of Anastrepha fruit flies, are described and compared. The possible implications on interspecific competition among these species are discussed. The most significant adaptations found were: (1) the mouth apparatus, where the large mandibles and fang-shaped maxillary lobes present in D. longicaudata and U. anastrephae larvae were absent in O. hirtus, D. areolatus and D. crawfordi larvae, and (2) the degree of mobility for exploration and escape, such as the lateral and caudal appendages that were only present in D. longicaudata (ventrolateral appendages in the base of the head capsule), U. anastrephae (caudal lobe with two appendages) and D. areolatus (caudal lobe with a round apex with a globular shape). The first instar larvae of the species D. longicaudata show morphological adaptations that apparently confer competitive advantages against the larvae of D. areolatus, D. crawfordi and O. hirtus. However, the first instar larvae of U. anastrephae show larger mandibles, an adaptation that could enable this species to resist competition from D. longicaudata. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Asymmetry of frontal bristles and postocular setae in species and hybrids of the Anastrepha fraterculus complex (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    João Maria G.A. Souza

    2007-01-01

    Full Text Available Asymmetry of the frontal bristles and postocular setae was studied in samples from natural populations and laboratory colonies of Anastrepha sp. 1 aff. fraterculus, of A. sp. 2 aff. fraterculus, and in F1 hybrids obtained from laboratory reciprocal crosses. Natural populations were sampled in a zone of sympatry and in two geographically distant regions with different climatic conditions. Asymmetry was scored as the differences between the number of bristles and of setae on the right and left sides of the head, males and females analyzed independently. The two traits exhibited variability according to the model of fluctuating asymmetry (FA. No significant differences among samples were found in the FA of frontal bristles. A significant FA was observed for the postocular setae of A. sp. 1 males from a southern population (Vacaria, RS as compared to the asymmetry exhibited by males and females of some other samples. No significant differences in FA were observed among the interspecific hybrids and the laboratory samples of both parental species. The higher FA found in the males from Vacaria was attributed to climatic conditions prevailing in that region. The absence of a higher FA in hybrids may be related to the relatively recent evolutionary history of the two species.

  4. Diversity of Anastrepha spp. (Diptera: Tephritidae) and associated braconid parasitoids from native and exotic hosts in southeastern Bahia, Brazil.

    Science.gov (United States)

    Silva, Janisete G; Dutra, Vivian S; Santos, Mirian S; Silva, Nívea M O; Vidal, Daniela B; Nink, Ricardo A; Guimarães, Jorge A; Araujo, Elton L

    2010-10-01

    We documented fruit fly-host associations and infestation rates over 5 yr in the state of Bahia, Brazil, by systematically collecting native and introduced fruits in backyard and commercial orchards, experimental stations, and patches of native vegetation. Fruit were collected in multiple sites in the southern and southernmost regions of Bahia. A total of 942.22 kg from 27 fruit species in 15 plant families was collected throughout this study. Of these, 15 plant species from six families were infested by Anastrepha species. A total of 11,614 fruit flies was reared from the fruit (5,178 females and 6,436 males). No specimens of Ceratitis capitata (Wiedemann) were recovered. Eleven Anastrepha species were recovered from the collected fruit: Anastrepha antunesi Lima (0.04%), Anastrepha distincta Greene (0.1%), Anastrepha fraterculus (Wiedemann) (53.5%), Anastrepha leptozona Hendel (4.5%), Anastrepha manihoti Lima (0.1%), Anastrepha montei Lima (1.0%), Anastrepha obliqua (Macquart) (33.0%), Anastrepha pickeli Lima (2.0%), Anastrepha serpentina (Wiedemann) (1.0%), Anastrepha sororcula Zucchi (3.0%), and Anastrepha zenildae Zucchi (1.8%). We recovered 1,265 parasitoids (Hymenoptera: Braconidae) from Anastrepha pupae. Three species of braconids were found to parasitize larvae of nine Anastrepha species. The most common parasitoid species recovered was Doryctobracon areolatus (Szépligeti) (81.7%), followed by Utetes anastrephae (Viereck) (12.2%) and Asobara anastrephae (Muesebeck) (6.1%). We report A. fraterculus infesting Malay apple Syzygium malaccense (L.) Merr. & L. M. Perry and A. fraterculus, A. sororcula, and A. zenildae infesting araza Eugenia stipitata McVaugh for the first time in Brazil.

  5. Species of Anastrepha (Diptera: Tephritidae) captured in a guava orchard (Psidium guajava L., Myrtaceae) in Boa Vista, Roraima, Brazil.

    Science.gov (United States)

    Marsaro Júnior, A L; Deus, E G; Ronchi-Teles, B; Adaime, R; Silva Júnior, R J

    2013-11-01

    The guava fruit (Psidium guajava) is among the most strongly affected by fruit flies in Brazil. In the Brazilian Amazon, 11 species of Anastrepha have been reported in guava orchards to date. This work aimed to identify the species of Anastrepha present in a guava orchard in the municipality of Boa Vista, determine the species infesting the fruits, and identify any parasitoids present. Two McPhail traps with food bait were installed and weekly collections were made between January and December 2008. Fruits were also collected systematically during this period, with a view to determining the association between host plant and tephritid species. Nine species of Anastrepha were identified, in addition to one specimen belonging to a probable new species. Anastrepha striata Schiner, Anastrepha sororcula Zucchi, Anastrepha obliqua (Macquart), and Anastrepha fraterculus (Wiedemann) were the dominant species in the orchard, accounting for 84.8% of all captured individuals. All females collected directly from fruits were A. striata. Doryctobracon areolatus (Szépligeti) was the only parasitoid species obtained. In this work, Anastrepha ethalea (Walker) is reported for the first time in the state of Roraima.

  6. Juvenile hormone analog enhances calling behavior, mating success, and quantity of volatiles released by Anastrepha obliqua (Diptera: Tephritidae).

    Science.gov (United States)

    Chacón-Benavente, Roxana; López-Guillen, Guillermo; Hernández, Emilio; Rojas, Julio C; Malo, Edi A

    2013-04-01

    The application of a juvenile hormone analog, methoprene, to newly emerged adult males reduced the time required for sexual maturation and enhanced mating success in several species of tephritid fruit flies. In this work, we investigated the effect of topical methoprene application on West Indian fruit fly, Anastrepha obliqua (Macquart), male calling, mating, and volatile release. Males treated with topical methoprene exhibited sexual maturation and reproductive behavior 2 d earlier when compared with control males treated with acetone. Methoprene-treated males began calling and mating at 4 d old, whereas control males did not call and mate until 6 d old. The gas chromotography-mass spectrometry analysis of volatiles showed that during calling A. obliqua males consistently released four compounds; three of them were identified as (Z)-3-nonenol, (Z,E)-α-farnesene, (E,E)-α-farnesene, and a fourth compound with the appearance of a farnesene isomer. Both treated and control males released the same compounds, although treated males started to release volatiles before that control males. The results are discussed in view of possible methoprene application with the aim of reducing costs in fly emergence and release facilities before eventual release of A. obliqua in the field, thus improving the sterile insect technique.

  7. Development of Anastrepha fraterculus (Diptera: Tephritidae) Related to the Phenology of Blueberry, Blackberry, Strawberry Guava, and Surinam Cherry Fruits.

    Science.gov (United States)

    Bisognin, M; Nava, D E; Diez-Rodríguez, G I; Valgas, R A; Garcia, M S; Krolow, A C R; Antunes, L E C

    2015-02-01

    Anastrepha fraterculus (Wiedemann, 1830) is the main pest of temperate climate orcharding. The study investigated the development of A. fraterculus related to phenological stage of blueberry, blackberry, strawberry guava, and Surinam cherry trees. The phenological stages I (green fruits), II (intermediate ripening stage of fruits), and III (fruits close to harvesting) were determined, and they are from 8th, 10th, and 11th week; 6th, 8th, and 9th week; 8th, 13th, and 16th week; and 5th, 6th, and 7th week after the first flowering of blueberry, blackberry, strawberry guava, and Surinam cherry trees, respectively. We collected fruits from orchards to determine the infestation index using the formula: number of pupa/fruit weight. To investigate the development of A. fraterculus, we determined the following biological parameters: egg-to-adult period, weight of pupae, oviposition period, fecundity, number of pupae, and number of infested fruits. The infestation index for the fruits collected in the field was greater in strawberry guava and Surinam cherry fruits. In the laboratory, the development of A. fraterculus occurred in stage III of blueberry. In blackberry, besides stage III, we also observed the development in stage II, however, at lower infestation. In strawberry guava, the development of A. fraterulus occurred in stages II and III, and the development in both stages was similar. For Surinam cherry, the development occurred in the three phenological stages with similar values for biological parameters. Overall, of the four hosts studied, the strawberry guava and Surinam cherry fruits allowed a better biological development of A. fraterculus, corroborating its preference for fruits native to Brazil. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Characterisation of the chemical profiles of Brazilian and Andean morphotypes belonging to the Anastrepha fraterculus complex (Diptera, Tephritidae)

    Science.gov (United States)

    Vaníčková, Lucie; Břízová, Radka; Pompeiano, Antonio; Ferreira, Luana Lima; de Aquino, Nathaly Costa; Tavares, Raphael de Farias; Rodriguez, Laura D.; Mendonça, Adriana de Lima; Canal, Nelson Augusto; do Nascimento, Ruth Rufino

    2015-01-01

    Abstract Fruit fly sexual behaviour is directly influenced by chemical and non-chemical cues that play important roles in reproductive isolation. The chemical profiles of pheromones and cuticular hydrocarbons (CHs) of eight fruit fly populations of the Andean, Brazilian-1 and Brazilian-3 morphotypes of the Anastrepha fraterculus cryptic species complex originating from Colombia (four populations) and Brazil (four populations) were analysed using two-dimensional gas chromatography with mass spectrometric detection. The resulting chemical diversity data were studied using principal component analyses. Andean morphotypes could be discriminated from the Brazilian-1 and Brazilian-3 morphotypes by means of male-borne pheromones and/or male and female CH profiles. The Brazilian-1 and Brazilian-3 morphotypes were found to be monophyletic. The use of chemical profiles as species- and sex-specific signatures for cryptic species separations is discussed. PMID:26798260

  9. Natural field infestation of Mangifera casturi and M.lalijiwa by oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae)

    Science.gov (United States)

    Mango, Mangifera indica, is a crop cultivated pantropically. There are, however, many other Mangifera spp. (“mango relatives”) which have much more restricted distributions and are poorly known, but have potential to produce mango-like fruits in areas where mangoes do not grow well or could be tapp...

  10. Genetically Engineered Ricin Suppresses Bactrocera dorsalis (Diptera: Tephritidae) based on Demographic Analysis of Group-Reared Life Table.

    Science.gov (United States)

    Chang, Cheng; Huang, Chun-Yen; Dai, Shu-Mei; Atlihan, Remzi; Chi, Hsin

    2016-04-27

    The oriental fruit fly, Bactrocera dorsalis (Hendel), reduces the quantity and quality of many host fruits through the process of oviposition and larval feeding, and this insect has been considered a major insect pest in several Asian countries for decades. Using an earlier-developed, female-specific system that combines the toxicity of the ricin A chain (RTA) and the alternative RNA splicing property of doublesex (Bddsx), we show that transgenic male flies harboring the RTA-Bddsx transgene unevenly repress the pest population through inheritable effects. In age-stage, two-sex life-table analyses, high larval mortality and a delay in pupation were observed after introducing the transgene. The high male to female ratio in DsRed(+) flies demonstrates the lethal effect of ricin on females. The fitness of both the DsRed(+)- and DsRed(-)-transformed females was reduced as shown in the decrease of the net reproductive rate (R0), intrinsic rate (r), and finite rate (λ) values compared with the wild-type populations. The integrity of the RTA-Bddsx transgene remained in more than 80% of DsRed(+) males after ten generations, supporting the stable inheritance of the transgene. All of the data from this study support the proposed RTA-Bddsx SIT approach, which provides a species-specific and environmentally friendly method of suppressing, rather than eradiating, B. dorsalis. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Field estimates of attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to methyl eugenol in varying environments

    Science.gov (United States)

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation and control of invasive pests. Here we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel)...

  12. Molecular characterization and functional analysis of BdFoxO gene in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Wu, Yi-Bei; Yang, Wen-Jia; Xie, Yi-Fei; Xu, Kang-Kang; Tian, Yi; Yuan, Guo-Rui; Wang, Jin-Jun

    2016-03-10

    The forkhead box O transcription factor (FoxO) is an important downstream transcription factor in the well-conserved insulin signaling pathway, which regulates the body size and development of insects. In this study, the FoxO gene (BdFoxO) was identified from the oriental fruit fly, Bactrocera dorsalis (Hendel). The open reading frame of BdFoxO (2732 bp) encoded a 910 amino acid protein, and the sequence was well conserved with other insect species. The BdFoxO was highly expressed in larvae and pupae among different development stages, and the highest tissue-specific expression level was found in the fat bodies compared to the testis, ovary, head, thorax, midgut, and Malpighian tubules of adults. Interestingly, we found BdFoxO expression was also up-regulated by starvation, but down-regulated when re-fed. Moreover, the injection of BdFoxO double-stranded RNAs into third-instar larvae significantly reduced BdFoxO transcript levels, which in turn down-regulated the expression of other four genes in the insulin signaling pathway. The silencing of BdFoxO resulted in delayed pupation, and the insect body weight increased significantly compared with that of the control. These results suggested that BdFoxO plays an important role in body size and development in B. dorsalis. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Phenoloxidase and its zymogen are required for the larval-pupal transition in Bactrocera dorsalis (Diptera: Tephritidae).

    Science.gov (United States)

    Bai, Ping-Ping; Xie, Yi-Fei; Shen, Guang-Mao; Wei, Dan-Dan; Wang, Jin-Jun

    2014-12-01

    Phenoloxidases (POs) play a key role in melanin production, are involved in invertebrate immune mechanisms, and are considered important enzymes in the insect development process. In the present study, we report the developmental stage and tissue-specific expression patterns of BdPPO1 and PO activity from Bactrocera dorsalis. The results showed that the activity of PO and its zymogen expression were closely related to the development of B. dorsalis during the larval-pupal transition, particularly in the integument. Additionally, biochemical characterization showed that PO from different developmental stages and tissues all had maximum activity at pH 7.5 and 37°C. After feeding a metal ion-containing artificial diet, the activity of PO and expression of BdPPO1 were significantly increased, indicating that PO was a metalloprotein and it could be activated by Zn2+, Mg2+, Ca2+, and Cu2+. The functional analysis showed that the expression of BdPPO1 could be regulated by 20-hydroxyecdysone (20E) after injection. Furthermore, injection of the double-stranded RNA of BdPPO1 into the 3rd instar larvae significantly reduced mRNA levels after 24 h and 48 h, and resulted in a lower pupation rate and abnormal phenotype. These results expand the understanding of the important role of PO and its zymogen in the growth of B. dorsalis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Genetic diversity of Bactrocera dorsalis (Diptera: Tephritidae) on the Hawaiian Islands: Implications for an introduction pathway into California

    Science.gov (United States)

    Population genetic diversity of the oriental fruit fly, Bactrocera dorsalis, on the Hawaiian islands of Oahu, Maui, Kauai, and Hawaii (the Big Island) was estimated using DNA sequences of the mitochondrial cytochrome c oxidase subunit I gene. A total of 932 flies representing 36 sampled sites across...

  15. A safe and effective propylene glycol based capture liquid for fruit fly (Diptera: Tephritidae) traps baited with synthetic lures

    Science.gov (United States)

    Antifreeze is often used as the capture liquid in insect traps for its preservation and evaporation attributes. In tests reported herein, fruit fly traps using non-toxic household propylene glycol based antifreeze captured significantly more Anastrepha ludens than did traps with the automotive anti...

  16. Cryptodacus Hendel, 1914 (Insecta: Diptera: TEPHRITIDAE): Proposed conservation by suppression of Cryptodacus Gundlach, 1862 (Reptilia: Serpentes: COLUBRIDAE)

    Science.gov (United States)

    The purpose of this application under Articles 78.1, 80.2.2, and 81.2.1 is to conserve current usage of the well-established genus-group name Cryptodacus Hendel, 1914 for a genus of Neotropical fruit flies by suppression of the earlier name Cryptodacus Gundlach, 1862, currently a junior synonym of A...

  17. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae)

    Science.gov (United States)

    Steck, Gary J.; Ekesi, Sunday

    2015-01-01

    Abstract Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis. PMID:26798272

  18. Parasitismo natural em moscas-das-frutas (Diptera: Tephritidae no semiárido do sudoeste da Bahia, Brasil

    Directory of Open Access Journals (Sweden)

    Ricardo Falcão de Sá

    2012-12-01

    Full Text Available Parasitoides são importantes agentes de controle natural de tefritídeos, e os conhecimentos sobre as relações tritróficas podem subsidiar o manejo destas pragas. Este trabalho objetivou estimar índices de parasitismo em moscas-das-frutas, em 21 espécies vegetais, e identificar as espécies de parasitoides associados, nas condições do semiárido do sudoeste da Bahia. Oito hospedeiros apresentaram infestação por Anastrepha spp. e, destes, em quatro, ocorreu parasitismo superior a 20,0%, sendo: 20,8% (Ziziphus joazeiro L.; 21,3% (Spondias tuberosa L.; 32,4% (Spondias purpurea L. e 57,1% (Malpighia emarginata L.. Os parasitoides coletados pertencem à família Braconidae, sendo 89% de Doryctobracon areolatus e 11% de Asobara anastrephae.

  19. Efficacy of new mass-trapping devices against Bactrocera oleae (Diptera tephritidae) for minimizing pesticide input in agroecosystems.

    Science.gov (United States)

    Noce, Maria E; Belfiore, Tiziana; Scalercio, Stefano; Vizzarri, Veronica; Iannotta, Nino

    2009-06-01

    Decreasing pesticide use in olive groves is central to controlling pathogens and pests such as Bactrocera oleae. This has led to the development of mass trapping devices which not only minimize pesticide use but, with improved efficacy of attractants, also decrease costs associated with pest control and ensures that the quality of olive oil is safe for human consumption. This study was undertaken to test a new device which utilizes reduced quantities of both insecticide (lambda-cyalothrin) as well as the female olive fly pheromone (1,7-dioxaspiro-(5.5)-undecane). The new device was tested against an older device manufactured by the same company. The use of plastic polymers as substrate for encapsulating the pheromone allowed for a slower pheromone release, prolonging the efficacy and duration and thus reducing costs. The density of adult populations was monitored using yellow chromotropic traps that were checked every ten days and the degree of olive infestation, as determined by preimago stages, was assessed by analyzing 100 drupes per plot. Infestation analyses were performed every ten days. The control plot had the lowest density of adults and the highest drupe infestation rate. The new devices were more effective than the older devices in both attracting adults and controlling infestation of drupes. Moreover, the new devices containing reduced amounts of pheromone and insecticide were cheaper and exhibited longer functional efficacy. In addition to the slower release of attractants, the plastic polymers used in these newer devices were also more resistant to mechanical and weather degradations. Results demonstrate that mass trapping can indeed be an effective means of controlling B. oleae via eco-sustainable olive farming.

  20. Pupal development of Ceratitis capitata (Diptera: Tephritidae) and Diachasmimorpha longicaudata (Hymenoptera: Braconidae) at different moisture values in four soil types.

    Science.gov (United States)

    Bento, F de M M; Marques, R N; Costa, M L Z; Walder, J M M; Silva, A P; Parra, J R P

    2010-08-01

    This study aimed to evaluate adult emergence and duration of the pupal stage of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann), and emergence of the fruit fly parasitoid, Diachasmimorpha longicaudata (Ashmead), under different moisture conditions in four soil types, using soil water matric potential. Pupal stage duration in C. capitata was influenced differently for males and females. In females, only soil type affected pupal stage duration, which was longer in a clay soil. In males, pupal stage duration was individually influenced by moisture and soil type, with a reduction in pupal stage duration in a heavy clay soil and in a sandy clay, with longer duration in the clay soil. As matric potential decreased, duration of the pupal stage of C. capitata males increased, regardless of soil type. C. capitata emergence was affected by moisture, regardless of soil type, and was higher in drier soils. The emergence of D. longicaudata adults was individually influenced by soil type and moisture factors, and the number of emerged D. longicaudata adults was three times higher in sandy loam and lower in a heavy clay soil. Always, the number of emerged adults was higher at higher moisture conditions. C. capitata and D. longicaudata pupal development was affected by moisture and soil type, which may facilitate pest sampling and allow release areas for the parasitoid to be defined under field conditions.

  1. Field Estimates of Attraction of Ceratitis capitata to Trimedlure and Bactrocera dorsalis (Diptera: Tephritidae) to Methyl Eugenol in Varying Environments.

    Science.gov (United States)

    Manoukis, Nicholas C; Siderhurst, Matthew; Jang, Eric B

    2015-06-01

    Measuring and modeling the attractiveness of semiochemical-baited traps is of significant importance to detection, delimitation, and control of invasive pests. Here, we describe the results of field mark-release-recapture experiments with Ceratitis capitata (Wiedemann) and Bactrocera dorsalis (Hendel) to estimate the relationship between distance from a trap baited with trimedlure and methyl eugenol, respectively, and probability of capture for a receptive male insect. Experiments were conducted using a grid of traps with a central release point at two sites on Hawaii Island, a Macadamia orchard on the East side of the island and a lava field on the West side. We found that for B. dorsalis and methyl eugenol there is a 65% probability of capture at ∼36 m from a single trap, regardless of habitat. For C. capitata, we found a 65% probability of capture at a distance of ∼14 m from a single trap in the orchard and 7 m in the lava field. We also present results on the spatial and temporal pattern of recaptures. The attraction data are analyzed via a hyperbolic secant-based capture probability model. Published by Oxford University Press on behalf of Entomological Society of America 2015. This work is written by US Government employees and is in the public domain in the US.

  2. Intensity of Attack Caused by Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera, Tephritidae on Mandarin along the Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2011-01-01

    Full Text Available Along the Montenegrin seacoast, all cultivated citrus species (mandarin, orange, lemon,grapefruit, fig, loquat and ziziphus were detected as host plants of the Ceratitis capitata Wiedem.Among those found, in economic sense, the most important host plant is mandarinUnšiu.Intensity of the attack were monitored on mandarin in 2003 and 2004 in localities Baošići,Lastva Grbaljska and Bar, and was determined as higher in 2003. The first symptoms ofattack were detected, depending on locality, from middle of September until beginning ofOctober, one to two months earlier then in 2004. The maximum number of larvae per fruitwere detected in October and November (average from 13.44±0.16 to 22.82±0.13. Timeof the first symptoms appearence on mandarin in September and October 2003 and in November2004, indicate on crucial importance of alternative host plants (figs and loquat forreproduction and increasing of C. capitata population, because later during a season its intensityof attack on mandarin, depend largely on their presence.

  3. Interspecific Competition Between Ceratitis capitata and Two Bactrocera Spp. (Diptera: Tephritidae) Evaluated via Adult Behavioral Interference Under Laboratory Conditions.

    Science.gov (United States)

    Liu, Hui; Zhang, Can; Hou, Bo-Hua; Ou-Yang, Ge-Cheng; Ma, Jun

    2017-06-01

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is considered one of the most invasive tephritid species. It has spread and established populations successfully throughout many of the tropical temperate regions, partially owing to the increase in global trading activity that facilitates diffusion of species. However, C. capitata has never been detected in China, even though some areas of the country have favorable climate and ample food resources. Historically, some researchers have hypothesized that the principal reasons for its absence are the defenses mounted by native Bactrocera species against C. capitata. We evaluated the modes and strengths of interspecific competition between C. capitata and two Bactrocera species (Bactrocera dorsalis Hendel and Bactrocera correcta Bezzi) by conducting experiments on behavioral interference between the adults of these fruit fly species. Under appropriate conditions, the two Bactrocera species showed a distinct advantage in competition for oviposition, noticeably suppressing C. capitata. Although no mating interference between C. capitata and the two Bactrocera species was observed, the role of interference competition in the prevention of C. capitata invasion is still worthy of being discussed. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Response of Ceratitis capitata, Bactrocera dorsalis, and Bactrocera cucurbitae (Diptera:Tephritidae) to metabolic stress disinfection and disinfestation treatment

    Science.gov (United States)

    Metabolic stress disinfection and disinfestation (MSDD) is a postharvest treatment designed to control pathogens and arthropod pests on commodities that combines short cycles of low pressure/vacuum and high CO2 with ethanol vapor. Experiments were conducted to evaluate the effect of MSDD treatment o...

  5. Dispersion of the Mediterranean Fruit Fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Mandarin Orchards on Montenegrin Seacoast

    Directory of Open Access Journals (Sweden)

    Sanja Radonjić

    2013-01-01

    Full Text Available The Mediterranean fruit fly Ceratitis capitata Widem. has been an established pest onthe Montenegrin seacoast for more than ten years, although with variable abundance indifferent years and localities.From an economic aspect, its most important host in Montenegro is the mandarinunshiu (Citrus unshiu Marc., particularly its cultivar Owari. Dispersion of C. capitata in citrusorchards (prevailingly mandarin was monitored on Baošići, Lastva Grbaljska and Bar localitiesduring 2003 and 2004.The results of this study showed that, during both years, peripheral-row trees (primarily thefirst row in citrus orchards were more exposed to attacks by C. capitata than middle and lastrows. In 2003, the average number of larvae in mandarin fruits in first rows varied from 11.4±0.59to 40.1±0.67, from 7.04±0.47 to 28.8±0.48 and from 2.9±0.07 to 17.3±0.54 on the localities ofBaošići, Lastva Grbaljska and Bar, respectively. On the same localities, it ranged from 7.4±0.34 to16.9±0.4, from 0.0 to 18.7±0.32 and from 0.0 to 9.93±0.56 in middle rows, and from 3.0±0.28 to16.8±0.77, from 0.0 to 20.9±0.38 and from 0.0 to 13.1±0.39 in last rows. Data collected at Baošići,Lastva Grbaljska and Bar in 2003 also suggest that the average number of larvae per mandarinfruit in first rows was 1.78-2.08 times higher than in middle rows, and 1.25-1.77 times higher thanin last rows. In 2004, the average number of larvae in mandarin fruits in first rows varied from7.3±0.27 to 8.3±0.45, from 7.2±0.23 to 17.6±0.59 and from 3.8±0.1 to 8.8±0.25 on the localitiesof Baošići, Lastva Grbaljska and Bar, respectively. On these localities, it ranged from 1.7 ±0.17 to3.3±0.19, from 1.1±0.12 to 3.5±0.8 and from 0.0 to 0.8±0.14 in middle rows, and from 1.7±0.17 to3.6±0.32, from 0.0 to 4.0±0.26 and from 0.0 to 0.2±0.06 in last rows. Data collected in 2004also showed that the average number of larvae in mandarin fruits in first rows on the samelocalities was 3.12-15.75 times higher than in middle rows, and 2.94 -6.3 times higher than inlast rows.

  6. Influence of protein on feeding behavior of Ceratitis capitata Wiedemann (Diptera: Tephritidae): comparison between immature males and females

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do C.; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Inst. de Biologia. Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Dept. de Biologia

    2005-07-15

    The objective of this work was to compare the influence of dietary protein on performance and feeding behavior of immature males and females of Ceratitis capitata (Wiedemann). The protein source was beer yeast at 6.5 and 1.5 g.100 ml-1. The following parameters were evaluated: percentage of emergence, total life cycle, adult size, diet consumption, feeding preference and discrimination threshold for yeast. Immature adults showed similar protein requirements regardless of sex. Both males and females showed similar feeding behavior, preferring to feed on the diet with higher protein content. The discrimination threshold for levedure in both sexes was 0.4 g.100 ml-1. We concluded that immature males of C. capitata show similar protein requirements as the immature females. (author)

  7. Development of a transgenic sexing system based on female-specific embryonic lethality in Ceratitis capitata (Diptera: Tephritidae)

    Science.gov (United States)

    The Sterile Insect Technique (SIT) is more efficient and cost-effective when only sterile males are released. A female-specific lethality system based on a female-specifically spliced intron was developed for transgenic sexing in Ceratitis capitata (Fu et al., 2007) possibly to overcome the fitness ...

  8. Short range attraction of Ceratitis capitata (Diptera: Tephritidae) sterile males to six commercially available plant essential oils

    Science.gov (United States)

    Plant essential oils have a number of roles in insect pest management. For male Ceratitis capitata, this includes use of angelica seed oil as long range attractants and ginger root oil as aromatherapy, which is exposure to sterile males to increase mating success. Neither of these plants are hosts f...

  9. MOSCAS-DAS-FRUTAS (DIPTERA: TEPHRITIDAE EM POMARES DA ÁREA URBANA NO NORTE DE MINAS GERAIS

    Directory of Open Access Journals (Sweden)

    CLARICE DINIZ ALVARENGA

    2010-01-01

    Full Text Available The aim this work was know the species of fruit fly and host plants in orchards in the urban area in the north of Minas Gerais. Were selected 10 orchards with wide variety of fruit species, which were distributed in equidistant way in the urban area of Janaúba, MG. Weekly, were collected systematically fruit flies through trap type McPhail and ripe fruit and in ripening one, on those orchards. Were collected 7.016 tephritid obtained from trap (5.226 and fruit (1.790, from which 1.044 belonged to genus Anastrepha and 5.972 were Ceratitis capitata. The specimens number of C. capitata (85.1% was around six times superior to Anastrepha spp. (14.9%, demonstrating the preference of this species for urban orchards. Eight species of Anastrepha occur in urban orchards of Janaúba, MG. Ceratitis capitata was found infesting 10 species of host fruits, being the main S. purpurea and guava. In fruits were collected three species of Anastrepha (A. obliqua, A. sororcula and A. zenildae which were associated with five species of fruit (Malpighia glabra L, Psidium guayava L, S. dulcis, S. purpurea and S. tuberosa. The predominant species of Anastrepha was A. obliqua, and S. tuberosa and S. purpurea being the main hosts of this species in the urban area of Janaúba, MG.

  10. Description of third instar larvae of Ceratitis fasciventris, C. anonae, C. rosa (FAR complex) and C. capitata (Diptera, Tephritidae).

    Science.gov (United States)

    Steck, Gary J; Ekesi, Sunday

    2015-01-01

    Third instar larvae of members of the Ceratitis FAR complex, including Ceratitis fasciventris (Bezzi), Ceratitis anonae Graham, and Ceratitis rosa Karsch are described and compared with those of Ceratitis capitata (Wiedemann). Diagnostic characters, such as presence vs. absence of a secondary tooth on the mandibles, previously used to separate Ceratitis capitata from Ceratitis rosa, are shown to vary in each species. Significant variation in diagnostic morphological characters among populations of Ceratitis rosa from east and south Africa is documented; however, the differences are not simply congruent with the R1 and R2 designations based on other studies. Quantitative measures of numerous morphological characters are consistently smaller in the larvae of Ceratitis fasciventris and distinguish them from other species of the FAR complex. Larvae of Ceratitis capitata can be distinguished from those of the FAR complex by characters such as absence of accessory plates of the oral ridges, the shape of the anterior spiracle, and the pattern of dorsal spinules. Previous studies indicated that absence of accessory lobes separate the genus Ceratitis from Bactrocera, but this is shown to be incorrect, as accessory lobes are in fact present in several species of Ceratitis.

  11. Relación entre tiempo de desarrollo larvario y fecundidad de la hembra en Ceratitis capitata (Diptera:Tephritidae

    Directory of Open Access Journals (Sweden)

    Fanny C. MANSO

    2006-01-01

    Full Text Available Se estudió la relación entre tiempo de desarrollo larvario y fecundidad en la hembra de Ceratitis capitata Wiedemann, comparando individuos de una cepa salvaje, con individuos de una cepa portadora de la mutación sw, la cual provoca atrasos en el desarrollo larvario. Se observaron caracteres de la morfología del ovario y su herencia entre los segregantes, para «tiempo de desarrollo» en la progenie del cruzamiento entre mutante y silvestre. El estudio mostró que las hembras sw(- que quedan muy retrasadas en su desarrollo, tienen menos ovariolas y una distribución de tamaños de óvulos menos homogénea que las que se desarrollan antes. Se encontró asimismo que entre las larvas de tipo salvaje, las más retrasadas también producen hembras con menor número de ovariolas y menos huevos totalmente desarrollados, que las que se desarrollan antes. Tanto en las hembras sw(- como en las sw(+, los atrasos del desarrollo obran en desmedro de la postura de huevos de las hembras que se desarrollan más tarde, efecto que se manifiesta en el número menor de ovariolas y en las diferencias del ritmo de maduración del ovario. Bajo condiciones apropiadas de cría, las hembras mutantes para sw son capaces de alcanzar la misma fecundidad que las normales.

  12. Solid phase microextraction of volatile emissions of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae): influence of fly sex, age, and mating status.

    Science.gov (United States)

    Alfaro, Cristina; Vacas, Sandra; Zarzo, Manuel; Navarro-Llopis, Vicente; Primo, Jaime

    2011-01-12

    Considerable efforts have been devoted to understanding the courtship behavior and pheromone communication of medflies; however, the sex pheromone composition is still a controversial subject. The discovery of new components affecting medfly behavior would be of interest for medfly control methods based on semiochemicals. This work describes volatile compounds emitted by Ceratitis capitata collected using solid phase microextraction. The volatile study was conducted according to an experimental design with three factors (sex, age, and mating status) assumed to be relevant for better understanding the chemical communication. Emission data were treated by means of principal component analysis, a statistical methodology not previously applied to the study of volatiles emitted by fruit flies. The characterization of emission patterns could be useful for the selection of compounds to be further investigated in biological assays to improve knowledge of the key semiochemicals involved in medfly behavior.

  13. Risk of introducing exotic fruit flies, Ceratitis capitata, Ceratitis cosyra, and Ceratitis rosa (Diptera: Tephritidae), into southern China.

    Science.gov (United States)

    Li, Baini; Ma, Jun; Hu, Xuenan; Liu, Haijun; Wu, Jiajiao; Chen, Hongjun; Zhang, Runjie

    2010-08-01

    Exotic fruit flies (Ceratitis spp.) are often serious agricultural pests. Here, we used, pathway analysis and Monte Carlo simulations to assess the risk of introduction of Ceratitis capitata (Wiedemann), Ceratitis cosyra (Walker), and Ceratitis rosa Karsch, into southern China with fruit consignments and incoming travelers. Historical data, expert opinions, relevant literature, and archives were used to set appropriate parameters in the pathway analysis. Based on the ongoing quarantine/ inspection strategies of China, as well as the interception records, we estimated the annual number of each fruit fly species entering Guangdong province undetected with commercially imported fruit, and the associated risk. We also estimated the gross number of pests arriving at Guangdong ports with incoming travelers and the associated risk. Sensitivity analysis also was performed to test the impact of parameter changes and to assess how the risk could be reduced. Results showed that the risk of introduction of the three fruit fly species into southern China with fruit consignments, which are mostly transported by ship, exists but is relatively low. In contrast, the risk of introduction with incoming travelers is high and hence deserves intensive attention. Sensitivity analysis indicated that either ensuring all shipments meet current phytosanitary requirements or increasing the proportion of fruit imports sampled for inspection could substantially reduce the risk associated with commercial imports. Sensitivity analysis also provided justification for banning importation of fresh fruit by international travelers. Thus, inspection and quarantine in conjunction with intensive detection were important mitigation measures to reduce the risk of Ceratitis spp. introduced into China.

  14. Effects of different protein concentrations on longevity and feeding behavior of two adult populations of Ceratitis capitata Wiedemann (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Placido-Silva, Maria do Carmo; Silva Neto, Alberto M. da; Joachim-Bravo, Iara S. [Universidade Federal da Bahia (UFBA), Salvador, BA (Brazil). Dept. de Biologia Geral; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia Ciencias e Letras. Dept. de Biologia

    2006-11-15

    The effects of protein intake on two adult male and female populations of Ceratitis capitata Wiedemann were assessed. One population consisted of flies reared for twenty years in the laboratory (Lab-pop); the other population consisted both of flies reared in the laboratory for approximately fifteen years and of the periodically introduced wild flies (Hybrid-pop). Three diets were tested: a no-yeast diet and two diets containing yeast (protein source) at the concentrations 6.5 g or 1.5 g per 100 ml diet. The parameters analyzed were: adult longevity, diet intake with and without yeast, and discrimination threshold for yeast. Protein intake increased Lab-pop adult longevity and did not affect longevity of the Hybrid-pop. Longevity in each population was similar for males and females fed on the same diet. Food behavior were similar for male and female adults of both populations; all preferred diets containing protein (yeast). Males and females in both populations ingested similar amounts of each diet. The discrimination threshold for yeast was similar for all males (0.5 g yeast/100 ml diet); Lab-pop females were able to detect the presence of smaller quantities of yeast in their diet, thus having a higher discrimination capacity (0.4 g/100 ml diet) as compared to the Hybrid-pop females (0.6 g/ 100 ml diet). (author)

  15. Capacidad dispersiva de Ceratitis capitata (Diptera: Tephritidae entre valles agrícolas en San Juan, Argentina

    Directory of Open Access Journals (Sweden)

    Leonardo M. DÍAZ

    2008-01-01

    Full Text Available Ceratitis capitata (Wiedemann, díptero tefrítido cosmopolita originario del norte de África, es la principal plaga de los frutales en muchos países de América. El objetivo de este trabajo fue conocer las características de la capacidad de dispersión de Ceratitis capitata , mediante la liberación de moscas estériles en condiciones de campo, con el propósito de predecir las posibles invasiones de valles agrícolas vecinos. Se liberaron 54.000 moscas estériles marcadas de ambos sexos, en localidades del valle de Tulum, cercanas a los ingresos de los valles de Ullum y Zonda. Para el monitoreo del vuelo dispersivo se instalaron trampas Jackson y Mc Phail. Se capturaron 1.213 adultos durante el periodo de muestreo. No hubo propagación de los adultos liberados desde el valle de Tulum a los valles de Ullum y Zonda. La presencia de hospederos, posición geográfica de cada Quebrada y la orientación respecto al viento predominante, podrían explicar la diferencia de difusión entre ambas Quebradas. La dispersión duró cinco semanas. La distancia media de los adultos liberados fue de 3.764 m (S= 2.897 m sin encontrar diferencias entre ambos sexos.

  16. Comparison of synthetic food-based lures and liquid protein baits for capture of Anastrepha suspensa (Diptera: Tephritidae) adults

    Science.gov (United States)

    Field tests that were conducted in south Florida to compare capture of the Caribbean fruit fly, Anastrepha suspensa (Loew), in Multilure traps baited with liquid protein baits torula yeast/borax or NuLure/borax, or with food-based synthetic lures including two component (ammonium acetate, putrescine...

  17. Captures of bactrocera fruit flies (Diptera: Tephritidae) and nontarget insects in biolure and torula yeast traps in Hawaii

    Science.gov (United States)

    BioLure, a synthetic food attractant for Mediterranean fruit fly (Ceratitis capitata (Wiedemann)) that uses a combination of three chemical components (ammonium acetate, trimethylamine hydrochloride and putrescine), was deployed in MultiLure traps in predominantly native forests, non-native forests,...

  18. Dynamics of pH modification of an acidic protein bait used for tropical fruit flies (Diptera: Tephritidae)

    Science.gov (United States)

    Traps baited with synthetic food-based lures that include blends of ammonia, either as ammonium acetate or ammonium bicarbonate, and putrescine capture a number of Anastrepha and Bactrocera species fruit flies. However, for many of these species, more flies are captured in traps baited with the pro...

  19. Antennal responses of West Indian and Caribbean fruit flies (Diptera: Tephritidae) to ammonium bicarbonate and putrescine lures

    Science.gov (United States)

    Efforts to monitor and detect tephritid fruit flies in the genus Anastrepha currently involve MultiLure traps baited with two food-based synthetic attractants; ammonium acetate and putrescine (1,4-diaminobutane). These baits are used in Central America, Florida, Texas, and the Caribbean, each region...

  20. Genetic Diversity of Bactrocera dorsalis (Diptera: Tephritidae) on the Hawaiian Islands: Implications for an Introduction Pathway Into California.

    Science.gov (United States)

    Barr, Norman B; Ledezma, Lisa A; Leblanc, Luc; San Jose, Michael; Rubinoff, Daniel; Geib, Scott M; Fujita, Brian; Bartels, David W; Garza, Daniel; Kerr, Peter; Hauser, Martin; Gaimari, Stephen

    2014-10-01

    Population genetic diversity of the oriental fruit fly, Bactrocera dorsalis (Hendel), on the Hawaiian islands of Oahu, Maui, Kauai, and Hawaii (the Big Island) was estimated using DNA sequences of the mitochondrial cytochrome c oxidase subunit I gene. In total, 932 flies representing 36 sampled sites across the four islands were sequenced for a 1,500-bp fragment of the gene named the C1500 marker. Genetic variation was low on the Hawaiian Islands with >96% of flies having just two haplotypes: C1500-Haplotype 1 (63.2%) or C1500-Haplotype 2 (33.3%). The other 33 flies (3.5%) had haplotypes similar to the two dominant haplotypes. No population structure was detected among the islands or within islands. The two haplotypes were present at similar frequencies at each sample site, suggesting that flies on the various islands can be considered one population. Comparison of the Hawaiian data set to DNA sequences of 165 flies from outbreaks in California between 2006 and 2012 indicates that a single-source introduction pathway of Hawaiian origin cannot explain many of the flies in California. Hawaii, however, could not be excluded as a maternal source for 69 flies. There was no clear geographic association for Hawaiian or non-Hawaiian haplotypes in the Bay Area or Los Angeles Basin over time. This suggests that California experienced multiple, independent introductions from different sources.

  1. Alternative fumigants to methyl bromide for killing pupae and preventing emergence of apple maggot fly (Diptera:Tephritidae)

    Science.gov (United States)

    Effects of methyl bromide, ECO2FUME (phosphine gas + CO2), Vapam (sodium methyldithiocarbamate), chloropicrin, Telone II (1, 3 dichloropropene), and chloropicrin + Telone II on killing the pupae and preventing adult emergence of apple maggot fly, Rhagoletis pomonella (Walsh) was determined. In an e...

  2. Establishment of a colony of Anastrepha ludens (Diptera: Tephritidae) under relaxed mass-rearing conditions in Mexico

    Energy Technology Data Exchange (ETDEWEB)

    Orozco-Davila, Dina; Hernandez, Refugio; Solis, Eduardo; Quintero, J. Luis; Dominguez, Julio, E-mail: dorozco1@prodigy.net.m [United States Department of Agriculture, Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural, and Veterinary Entomology; Sigma Space Corporation, MD(United States); Programa Moscamed Moscafrut-Desarrollo de Metodos, Chiapas (Mexico)

    2006-07-01

    Several studies have suggested that maintaining a line of insects under laboratory conditions reduces their biological attributes. With this principle in mind, the mass production of Anastrepha ludens originating from a colony raised under relaxed rearing conditions was evaluated over a period of three years. The results of the evaluation indicated that insects kept under these conditions reached their larval maturity in 10 days, and attained a greater weight, which has a direct influence on pupal quality. In adult cages having a fly density of 70,000 individuals, there was a lower level of stress which favored fecundity. Fertility was apparently not affected by the cage density. These results suggest that keeping a production line under relaxed conditions optimizes insect production and promotes higher quality. (author)

  3. Attraction of wild-like and colony-reared Bactrocera cucurbitae (Diptera: Tephritidae) to Cuelure in the field

    Science.gov (United States)

    The attraction of wild tephritids to semiochemical-based lures are the ideal basis for trap network design in detection programs, but in practice, mass-reared colony insects are usually used to determine trap efficiency. For Bactrocera cucurbitae Coquillett, a lower response by wild males compared w...

  4. Integration of insecticidal, phagostimulatory, and visual elements of an attract-and-kill system for apple maggot fly (Diptera: Tephritidae)

    Science.gov (United States)

    In development of a trap-based control system for apple maggot fly, we evaluated lethality of spinosad in cylindrical and contoured controlled-release caps atop visually stimulating sphere bases. For both trap styles, spinosad at or near 1.0% (a.i.) proved to be a useful and relatively durable fly-...

  5. Infestation of grape Vitis vinifera by Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) in sub-medium Sao Francisco valley, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Habibe, Tuffi C.; Viana, Rodrigo E.; Damasceno, Itala Cruz; Malavasi, Aldo [Biofabrica Moscamed Brasil, Juazeiro, BA (Brazil). Distrito Industrial do Sao Francisco; Nascimento, Antonio S., E-mail: antnasc@cnpmf.embrapa.b [EMBRAPA Mandioca e Fruticultura Tropical, Cruz das Almas, BA (Brazil); Paranhos, Beatriz A.J.; Haji, Francisca Nemaura P., E-mail: bjodao@cpatsa.embrapa.b [EMBRAPA Semi-Arido, Petrolina, PE (Brazil); Carvalho, Raimundo S. [Agencia de Defesa Agropecuaria da Bahia (ADAB), Salvador, BA (Brazil)

    2006-07-01

    The objective of this study was to assess the infestation level in grapes, Vitis vinifera, by the medfly,Ceratitis capitata in the Sao Francisco River Valley. The adult population was monitored with Jackson trap baited with trimedlure. Samples of grapes for larval infestation assessment were taken along three months, with a total of 116 kg. The average FTD (flies/trap/day) for medfly males was 0.26. The number of pupae obtained from the fruit samples was 471; 287 adults emerged (60.4%), all Ceratitis capitata. The infestation level was 4.0 pupa/kg of fresh fruit. We conclude that grape is a medfly host in SFV, occasionally causing high damage to production. (author)

  6. Establishment of the west indian fruit fly (Diptera: Tephritidae) parasitoid Doryctobracon areolatus (Hymenoptera: Braconidae)in the Dominican Republic

    Science.gov (United States)

    The West Indian fruit fly, Anastrepha obliqua (Macquart), infests numerous fruit species, particularly Anacardiaceae and most importantly mango (Mangifera indica L.). Widespread in the Neotropics, it was first reported in Hispaniola nearly 70 years ago. Continental populations are attacked by the op...

  7. Olive Volatiles from Portuguese Cultivars Cobrancosa, Madural and Verdeal Transmontana: Role in Oviposition Preference of Bactrocera oleae (Rossi (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Ricardo Malheiro

    Full Text Available The olive fly, Bactrocera oleae (Rossi, a serious threat to the olive crop worldwide, displays ovipositon preference for some olive cultivars but the causes are still unclear. In the present work, three Portuguese olive cultivars with different susceptibilities to olive fly (Cobrançosa, Madural, and Verdeal Transmontana were studied, aiming to determine if the olive volatiles are implicated in this interaction. Olive volatiles were assessed by SPME-GC-MS in the three cultivars during maturation process to observe possible correlations with olive fly infestation levels. Overall, 34 volatiles were identified in the olives, from 7 chemical classes (alcohols, aldehydes, aromatic hydrocarbons, esters, ketones, sesquiterpenes, and terpenes. Generally, total volatile amounts decrease during maturation but toluene, the main compound, increased in all cultivars, particularly in those with higher susceptibility to olive fly. Sesquiterpenes also raised, mainly α-copaene. Toluene and α-copaene, recognized oviposition promoters to olive fly, were correlated with the infestation level of cvs. Madural and Verdeal Trasnmontana (intermediate and highly susceptible cultivars respectively, while no correlations were established with cv. Cobrançosa (less susceptible. No volatiles with inverse correlation were observed. Volatile composition of olives may be a decisive factor in the olive fly choice to oviposit and this could be the basis for the development of new control strategies for this pest.

  8. The oviposition of the chili fruit fly (Bactrocera latifrons Hendel (Diptera: Tephritidae with reference to reproductive capacity

    Directory of Open Access Journals (Sweden)

    Anothai Wingsanoi

    2012-11-01

    Full Text Available The chili fruit fly, Bactrocera latifrons Hendel, is a serious pest of chili fruit production in Thailand. To determine theeffective control planning of the fly population, the oviposition related to reproductive capacity of the female were observed.The female ovary was daily dissected through the entire life span and the eggs inside the ovary were examined and counted.There were 44.84±19.60 eggs/ovary. The oviposition of female was simultaneously conducted. Eggs inside the ovarypresented on 8th day and the female oviposited on 10th day of the life span. The female laid 4.25±2.28 eggs, which was 12.45±9.56 fold less than the reproductive capacity. The female longevity was 31.1±8.40 days and the oviposition period was 40days.

  9. Complete Mitochondrial Genome of Three Bactrocera Fruit Flies of Subgenus Bactrocera (Diptera: Tephritidae and Their Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Hoi-Sen Yong

    Full Text Available Bactrocera latifrons is a serious pest of solanaceous fruits and Bactrocera umbrosa is a pest of Artocarpus fruits, while Bactrocera melastomatos infests the fruit of Melastomataceae. They are members of the subgenus Bactrocera. We report here the complete mitochondrial genome of these fruit flies determined by next-generation sequencing and their phylogeny with other taxa of the subgenus Bactrocera. The whole mitogenomes of these three species possessed 37 genes namely, 13 protein-coding genes (PCGs, 2 rRNA and 22 tRNA genes. The mitogenome of B. latifrons (15,977 bp was longer than those of B. melastomatos (15,954 bp and B. umbrosa (15,898 bp. This difference can be attributed to the size of the intergenic spacers (283 bp in B. latifrons, 261 bp in B. melastomatos, and 211 bp in B. umbrosa. Most of the PCGs in the three species have an identical start codon, except for atp8 (adenosine triphosphate synthase protein 8, which had an ATG instead of GTG in B. umbrosa, whilst the nad3 (NADH dehydrogenase subunit 3 and nad6 (NADH dehydrogenase subunit 6 genes were characterized by an ATC instead of ATT in B. melastomatos. The three species had identical stop codon for the respective PCGs. In B. latifrons and B. melastomatos, the TΨC (thymidine-pseudouridine-cytidine-loop was absent in trnF (phenylalanine and DHU (dihydrouracil-loop was absent in trnS1 (serine S1. In B. umbrosa, trnN (asparagine, trnC (cysteine and trnF lacked the TψC-loop, while trnS1 lacked the DHU-stem. Molecular phylogeny based on 13 PCGs was in general concordant with 15 mitochondrial genes (13 PCGs and 2 rRNA genes, with B. latifrons and B. umbrosa forming a sister group basal to the other species of the subgenus Bactrocera which was monophyletic. The whole mitogenomes will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general.

  10. Enhancement of attraction of alpha-ionol to male Bactrocera latifrons (Diptera: Tephritidae) by addition of a synergist, cade oil.

    Science.gov (United States)

    McQuate, G T; Peck, S L

    2001-02-01

    Male lures are known for many tephritid fruit fly species and are often preferred over food bait based traps for detection trapping because of their high specificity and ability to attract flies over a wide area. Alpha-ionol has been identified as a male lure for the tephritid fruit fly Bactrocera latifrons (Hendel). The attraction of this compound to male B. latifrons individuals, however, is not as strong as is the attraction of other tephritid fruit fly species to their respective male lures. Cade oil, an essential oil produced by destructive distillation of juniper (Juniperus oxycedrus L.) twigs, synergizes the attraction of alpha-ionol to male B. latifrons. Catches of male B. latifrons at traps baited with a mixture of alpha-ionol and cade oil were more than three times greater than at traps baited with alpha-ionol alone. Substitution of alpha-ionol + cade oil for alpha-ionol alone in detection programs could considerably improve the chance of detecting invading or incipient populations of B. latifrons. However, detection programs should not rely solely on this lure but also make use of protein baited traps as well as fruit collections. Further work with fractions of cade oil may help to identify the active ingredient(s), which could help to further improve this male lure for B. latifrons.

  11. Active ingredients in cade oil that synergize attractiveness of alpha-ionol to male Bactrocera latifrons (Diptera: Tephritidae).

    Science.gov (United States)

    McQuate, Grant T; Keum, Young Soo; Sylva, Charmaine D; Li, Qing X; Jang, Eric B

    2004-06-01

    Cade oil, a commercially available essential oil produced by destructive distillation of juniper, Juniperus oxycedrus L., twigs, is known to synergize the attractancy of alpha-ionol to male Bactrocera latifrons (Hendel). Through chemical fractionation and outdoor olfactometer-based bioassays, seven compounds in cade oil were identified that potentially could provide some level of synergism. Tests with sterile laboratory flies showed that four of the seven compounds (eugenol, isoeugenol, 2-methoxy-4-ethylphenol, and 2-methoxy-4-propylphenol), together with a closely related compound not found in cade oil, 2-methoxy-4-methylphenol, are capable of synergizing the attractiveness of alpha-ionol to male B. latifrons under field conditions. The similarity in structures of these five synergistic compounds shows that there is a response to a core 2-methoxyphenol structure, with fly response little affected by some variation in the composition of the side chain on the number 4 carbon. Because identified synergists were structurally similar, only one compound, eugenol, was selected for further field studies. In an 8-wk weathering test, using released sterile flies, traps baited with alpha-ionol + eugenol had catches comparable with catches at traps baited with alpha-ionol + cade oil, with catches generally increased with a higher eugenol loading. For both eugenol and cade oil, catches tended to be better when these synergists were deployed on separate wicks from the alpha-ionol. Eugenol and alpha-ionol, however, were unable to provide attraction comparable with that of cade oil and alpha-ionol in tests with wild fly populations.

  12. Raspberry Ketone Analogs: Vapour Pressure Measurements and Attractiveness to Queensland Fruit Fly, Bactrocera tryoni (Froggatt (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Soo J Park

    Full Text Available The Queensland fruit fly, Bactrocera tryoni (Froggatt (Q-fly, is a major horticultural pest in Eastern Australia. Effective monitoring, male annihilation technique (MAT and mass trapping (MT are all important for control and require strong lures to attract flies to traps or toxicants. Lure strength is thought to be related in part to volatility, but little vapour pressure data are available for most Q-fly lures. Raspberry ketone (4-(4-hydroxyphenyl-2-butanone and analogs that had esters (acetyl, difluoroacetyl, trifluoroacetyl, formyl, propionyl and ethers (methyl ether, trimethylsilyl ether in replacement of the phenolic group, and in one case also had modification of the 2-butanone side chain, were measured for their vapour pressures by differential scanning calorimetry (DSC, and their attractiveness to Q-fly was assessed in small cage environmentally controlled laboratory bioassays. Maximum response of one category of compounds, containing both 2-butanone side chain and ester group was found to be higher than that of the other group of compounds, of which either of 2-butanone or ester functionality was modified. However, linear relationship between vapour pressure and maximum response was not significant. The results of this study indicate that, while volatility may be a factor in lure effectiveness, molecular structure is the dominating factor for the series of molecules investigated.

  13. Seasonal changes in english walnut (Juglans regia L.) (Juglandaceae), fruit properties and host use patterns by Rhagoletis zoqui (Diptera: Tephritidae)

    Science.gov (United States)

    Rhagoletis zoqui Bush is a Neosubtropical, univoltine, frugivorous tephritid fly that exploits both native Juglans spp. and the introduced, Palearctic English walnut, Juglans regia. The seasonal development of commercial J. regia fruit and the pattern of host exploitation by R. zoqui were tracked ov...

  14. Rhythmicity of Bactrocera cucurbitae (Diptera:Tephritidae) attraction to cuelure: Insights from an interruptable lure and computer vision

    Science.gov (United States)

    We describe and validate an Agent-Based Simulation (ABS) of invasive insects and use it to investigate the time to extirpation of Ceratitis capitata using data from seven outbreaks that occurred in California from 2008-2010. Results are compared with the length of intervention and quarantine imposed...

  15. Olive fruit fly (Diptera: Tephritidae) populations in relation to region, trap type, season, and availability of fruit.

    Science.gov (United States)

    Yokoyama, Victoria Y; Miller, Gina T; Stewart-Leslie, Judy; Rice, Richard E; Phillips, Phil A

    2006-12-01

    Olive fruit fly, Bactrocera oleae (Gmelin), was monitored with adult captures by season and trap type, and was related to fruit volume and nonharvested fruit to elucidate the occurrence of the newly introduced pest in California. The highest numbers of adults captured in ChamP traps in olive trees, Olea europaea, were in October in an inland valley location, and in September in a coastal location. Comparisons of trap types showed that the number of olive fruit fly adults captured in Pherocon AM traps in a commercial orchard was significantly greater than in ChamP traps. A significantly greater number of females were captured in Pherocon AM traps with bait packets and pheromone lures than traps with pheromone lures alone, while a significantly greater number of adults and males were captured in traps with pheromone lures alone. Significantly more adults were captured in ChamP traps with bait packets and pheromone lures versus traps with bait packets alone. Fruit volume increased by four times from mid-June to mid-November. Olive fruit fly was found to oviposit on small olive fruit fruit set, the maximum number of ovipositional sites per fruit occurred in October, and the greatest number of pupae and adults were reared from fruit collected in September and October. The highest numbers of pupae were collected from nonharvested fruit in March when high numbers of adults were captured in the same orchard.

  16. Diversity of bacterial communities in the midgut of Bactrocera cucurbitae (Diptera: Tephritidae) populations and their potential use as attractants.

    Science.gov (United States)

    Hadapad, Ashok B; Prabhakar, Chandra S; Chandekar, Snehal C; Tripathi, Jyoti; Hire, Ramesh S

    2016-06-01

    The microbiota plays an important role in insect development and fitness. Understanding the gut microbiota composition is essential for the development of pest management strategies. Midgut bacteria were isolated from nine wild B. cucurbitae populations collected from different agroecological zones of India. These isolates were further studied for attractant potential of fruit fly adults, and the chemical constituents in the supernatants of gut bacteria were analysed. Twenty-six bacterial isolates belonging to the families Enterobacteriaceae, Bacillaceae, Micrococcaceae and Staphylococcaceae were isolated and identified on the basis of 16S rRNA gene sequence analysis. The dominant species in the midgut of melon fly were from the genera Enterobacter (34.6%), Klebsiella (19.2%), Citrobacter (7.7%), Bacillus (15.4%) and Providencia (7.7%), and 3.8% each of Micrococcus, Staphylococcus, Leclercia and Exiguobacterium. Bactrocera cucurbitae and B. dorsalis adults were significantly attracted to bacterial whole cell cultures and their supernatants in the fruit fly attraction bioassays. Bacillus cereus, Enterobacter, Klebsiella, Citrobacter and Providencia species attracted both male and females of Bactrocera species. The supernatants of Klebsiella, Citrobacter and Providencia species attracted a significantly greater number of females than males. The most abundant chemical constituents in supernatants of K. oxytoca and C. freundii were 3-methyl-1-butanol, 2-phenylethanol, butyl isocyanatoacetate, 2-methyl-1-propanol and 3-hydroxy-2-butanone, as identified by gas chromatography-mass spectrometry. The bacterial endosymbionts associated with melon fly exhibited attractant potential which could facilitate eco-friendly insect control strategies. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  17. Incipient speciation revealed in Anastrepha fraterculus (Diptera; Tephritidae) by studies on mating compatibility, sex pheromones, hybridisation and cytology

    Science.gov (United States)

    It is suggested that the nominal species Anastrepha fraterculus is a species complex and previous studies showed high levels of pre-zygotic isolation between two laboratory strains from Argentina and Peru. To further analyze this observation, experiments were carried out on the same populations and...

  18. Phenetic structure of two Bactrocera tau cryptic species (Diptera: Tephritidae) infesting Momordica cochinchinensis (Cucurbitaceae) in Thailand and Laos.

    Science.gov (United States)

    Dujardin, Jean-Pierre; Kitthawee, Sangvorn

    2013-04-01

    Morphometric variation with respect to wing venation patterns was explored for 777 specimens of the Bactrocera tau complex collected in Thailand (nine provinces) and Laos (one locality). Cryptic species B. tau A and C were identified based on their wing shape similarity to published reference images. In Thailand, the B. tau A species was identified in four provinces and the B. tau C species in seven provinces, and both species in one locality of Laos. The objective of the study was to explain the geographic variation of size and shape in two cryptic species collected from the same host (Momordica cochinchinensis). Although collected from the same host, the two species did not show the same morphological variance: it was higher in the B. tau A species, which currently infests a wide range of different fruit species, than in the B. tau C species, which is specific to only one fruit (M. cochinchinensis). Moreover, the two species showed a different population structure. An isolation by distance model was apparent in both sexes of species C, while it was not detected in species A. Thus, the metric differences were in apparent accordance with the known behavior of these species, either as a generalist (species A) or as a specialist (species C), and for each species our data suggested different sources of shape diversity: genetic drift for species C, variety of host plants (and probably also pest-host-relationship) for species A. In addition to these distinctions, the larger species, B. tau C, showed less sexual size and shape dimorphism. The data presented here confirm the previously established wing shape differences between the two cryptic species. Character displacement has been discussed as a possible origin of this interspecific variation. The addition of previously published data on species A from other hosts allowed the testing of the character displacement hypothesis. The hypothesis was rejected for interspecific shape differences, but was maintained for size differences. Copyright © 2012 Elsevier GmbH. All rights reserved.

  19. Historical perspective on the synonymization of the four major pest species belonging to the Bactrocera dorsalis species complex (Diptera, Tephritidae).

    Science.gov (United States)

    Hee, Alvin K W; Wee, Suk-Ling; Nishida, Ritsuo; Ono, Hajime; Hendrichs, Jorge; Haymer, David S; Tan, Keng-Hong

    2015-01-01

    An FAO/IAEA-sponsored coordinated research project on integrative taxonomy, involving close to 50 researchers from at least 20 countries, culminated in a significant breakthrough in the recognition that four major pest species, Bactrocera dorsalis, Bactrocera philippinensis, Bactrocera papayae and Bactrocera invadens, belong to the same biological species, Bactrocera dorsalis. The successful conclusion of this initiative is expected to significantly facilitate global agricultural trade, primarily through the lifting of quarantine restrictions that have long affected many countries, especially those in regions such as Asia and Africa that have large potential for fresh fruit and vegetable commodity exports. This work stems from two taxonomic studies: a revision in 1994 that significantly increased the number of described species in the Bactrocera dorsalis species complex; and the description in 2005 of Bactrocera invadens, then newly incursive in Africa. While taxonomically valid species, many biologists considered that these were different names for one biological species. Many disagreements confounded attempts to develop a solution for resolving this taxonomic issue, before the FAO/IAEA project commenced. Crucial to understanding the success of that initiative is an accounting of the historical events and perspectives leading up to the international, multidisciplinary collaborative efforts that successfully achieved the final synonymization. This review highlights the 21 year journey taken to achieve this outcome.

  20. Ecotoxicology of pesticides on natural enemies of olive groves. Potential of ecdysone agonists for controlling Bactrocera oleae (Rossi) (Diptera: Tephritidae)

    OpenAIRE

    2012-01-01

    Pesticide applications are still one of the most common control methods against the main olive grove pests and diseases: the olive fruit fly, Bactrocera oleae (Rossi), the olive moth, Prays oleae (Bernard), the black scale, Saissetia oleae (Olivier), and the olive leaf spot, caused by the fungus Spilocaea oleagina Fries. However, and because the new pesticide legislation is aimed at an integrated pest and disease management, it is still important to evaluate and to know the ecotoxicology of p...

  1. Notes on the frugivorous fruit fly (Diptera: Tephritidae fauna of western Africa, with description of a new Dacus species

    Directory of Open Access Journals (Sweden)

    Kim F.M. Goodger

    2013-07-01

    Full Text Available The species richness of the frugivorous fruit fly fauna of western African (in particular of Ivory Coast, Ghana, Togo, Benin and Nigeria is discussed. The diversity is compared at a national level and between the ecoregions within the national boundaries of the study area. A new species, Dacus goergeni sp. nov. is described and additional taxonomic notes are presented.

  2. Evaluación de colores para la oviposición de Ceratitis capitata (Diptera, Tephritidae en Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Suárez

    2013-04-01

    Full Text Available Ceratitis capitata es una de las principales plagas de la fruticultura mundial y en Argentina es la Mosca de los Frutos de mayor abundancia y distribución. El desarrollo de una trampa artificial de oviposición, puede ser una herramienta útil de monitoreo para hembras grávidas. El objetivo de este trabajo fue evaluar la capacidad atrayente para la oviposición de C. capitata sobre esferas de agar de color amarillo, rojo, verde, negro y sin color; en condiciones de laboratorio. Se observaron diferencias estadísticamente significativas, siendo las esferas rojas y negras las más atractivas sobre las verdes, amarillas y sin color. En laboratorio, la mayor atracción alcanzada por el rojo y negro sustentaría la hipótesis de que el fuerte contraste respecto al fondo incrementaría la atracción de los colores más oscuros.

  3. Monitoring and Varietal Screening Cucurbit Fruit Fly, Bactrocera cucurbitae Coquillett (Diptera: Tephritidae on Cucumber in Bhaktapur and Kathmandu, Nepal

    Directory of Open Access Journals (Sweden)

    Ranju Maharjan

    2015-12-01

    Full Text Available Monitoring of cucurbit fruit fly by using four different types of traps was conducted in Sipadole VDC of Bhaktapur district during 2012 to observe the population dynamics. Three different types of fruit flies were recorded, in which the number of B. cucurbitae dominated to other species. Only B. cucurbitae damaged the cucumber, which was trapped 92.68%, 87.05%, 90.61%, and 69.38% in cue-lure, banana pulp bait, sticky traps and fly catcher, respectively. The highest number of fruit flies (167.5 male fruit flies/3traps was recorded in cue-lure trap during the first week of September, which coincided with 85.45% RH and 21.67°C and 25.04°C minimum and maximum temperature, respectively. Positive relation of temperature, relative humidity and fruit fly catches was observed. Thus, cue-lure was the most effective traps for monitoring of fruit fly population. In varietal screening, among the six different varieties of cucumber, i.e. Kathmandu local, Kusle, Kamini, Malini, Kasinda and Mahyco Green Long, they were highly significant difference in yield. Kamini gave the highest marketable fruit 26.66 mt/ha yield and the lowest by Kusle (5.05 mt/ha. All the varieties were affected by cucurbit fruit fly. The highest number of unmarketable fruit set was observed in Kamini (22.29 fruits/plant.

  4. MicroRNAs in the oriental fruit fly, Bactrocera dorsalis: extending Drosophilid miRNA clusters to the Tephritidae

    Science.gov (United States)

    The oriental fruit fly, Bactrocera dorsalis, is an important pest species in the family Tephritidae. It is a phytophagous species with broad host range, and while not established in the mainland United States, is a species of great concern for introduction. Despite of the vast amount of informatio...

  5. Fluctuación y distribución espacio-temporal de Tuthillia cognata (Hemiptera, Psyllidae y de Ocyptamus persimilis (Diptera, Syrphidae en el cultivo de camu-camu Myrciaria dubia (Myrtaceae en Ucayali, Perú Fluctuation and temporal-spatial distribution of Tuthillia cognata (Hemiptera, Psyllidae and Ocyptamus persimilis (Diptera, Syrphidae on camu-camu Myrciaria dubia (Myrtaceae in Ucayali, Peru

    Directory of Open Access Journals (Sweden)

    Diana Pérez

    2009-12-01

    Full Text Available Tuthillia cognata Hodkinson, Brown & Burckhardt, 1986 (Hemiptera, Psyllidae es una plaga importante en el cultivo de camu-camu, Myrciaria dubia H.B.K. Mc Vaugh (Myrtaceae en la Amazonía Peruana. El objetivo del presente estudio fue determinar la fluctuación y la distribución espacio-temporal de T. cognata y de su controlador biológico Ocyptamus persimilis (Curran, 1930 (Diptera, Syrphidae, entre enero a noviembre del 2004 en los caseríos San Juan y Padre Bernardo, Pucallpa, Ucayali, Perú. El número de ninfas y adultos de T. cognata fue mayor en la época lluviosa que en la seca, pero no en el número de huevos, ni en el número de colonias. Los huevos, ninfas y adultos prefirieron el tercio superior de la planta en comparación con el tercio medio e inferior en ambos caseríos. La excepción fue la presencia de huevos en el caserío San Juan que no mostró preferencias por ninguno de los tercios. No se observaron diferencias en el porcentaje de infestación por T. cognata entre ambos caseríos y entre la época seca y lluviosa. En O. persimilis, no se encontró diferencias en el número de huevos, larvas y pupas entre la época seca y lluviosa. Se observó que los huevos, larvas y pupas prefirieron el tercio superior de la planta en comparación con el tercio medio e inferior en ambos caseríos. Ambas especies, T. cognata y O. persimilis presentaron un patrón de distribución espacial - temporal agregado. Se encontró una relación directa entre el número de colonias de T. cognata y O. persimilis. Sin embargo, el número de huevos, ninfas y adultos de T. cognata no se encontraron correlacionados con el número de huevos, larvas y pupas de O. persimilis.Tuthillia cognata Hodkinson, Brown & Burckhardt, 1986 (Hemiptera, Psyllidae, is a main pest on camu-camu culture Myrciaria dubia H.B.K. Mc Vaugh (Myrtaceae in the Peruvian Amazon. The aim of the current research was to evaluate the fluctuation and spatial and temporal distribution of T

  6. De edelherthorzel Cephenemyia auribarbis gekweekt (Diptera: Oestridae)

    NARCIS (Netherlands)

    Aartsen, van B.; Zeegers, Th.

    1999-01-01

    The rearing of the botfly Cephenemyia auribarbis (Diptera: Oestridae) After several failures we finally succeeded in rearing botflies Cephenemyia from third-instar larvae. From a red deer shot at 13 March 1998 about one hundred larvae of Cephenemyia auribarbis (Meigen, 1824) were collected. Ten

  7. Tabanid flies (Insecta: Diptera from Chhattisgarh, India

    Directory of Open Access Journals (Sweden)

    Kailash Chandra

    2015-08-01

    Full Text Available The paper presents an account on the Tabanidae (Diptera from Chhattisgarh, which includes 16 species representing five genera under three subfamilies: Pangoniinae, Chrysopsinae and Tabaninae. Among these species, Haematopota latifascia Ricardo is new addition to the fauna of Chhattisgarh. The distributional area of the collection localities, key characters are also provided. 

  8. Nieuwe en zeldzame vliegen voor de Nederlandse fauna (Diptera)

    NARCIS (Netherlands)

    Aartsen, van B.

    1997-01-01

    New and rare flies for the Dutch fauna (Diptera) In this paper an overview is given of captures of rare and interesting Diptera, belonging to different families, mainly from the years 19941996. In total 46 species are presented, of which 13 are new to the Dutch fauna (marked with an *), viz.: Spania

  9. Een nieuwe daas voor Nederland: Hybomitra arpadi (Diptera: Tabanidae)

    NARCIS (Netherlands)

    Zeegers, T.

    2002-01-01

    A new horsefly for the Netherlands: Hybomitra arpadi (Diptera: Tabanidae) The horsefly Hybomitra arpadi (Diptera: Tabanidae) is recorded for the first time from the Netherlands. New features for the recognition of the males and some notes on the biology are given.

  10. Metalimnobia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo

    2016-06-30

    Korean species of the crane fly genus Metalimnobia Matsumura, 1911 (Diptera: Limoniidae), are taxonomically revised. Metalimnobia (Metalimnobia) channpayna new species, is described and figured, M. (M.) bifasciata (Schrank, 1781), M. (M.) quadrinotata (Meigen, 1818) and M. (M.) zetterstedti (Tjeder, 1968) are listed for the first time in Korea, new information for previously known species, M. (M.) quadrimaculata (Linnaeus, 1760) is added. Identification key for all Korean Metalimnobia species is given. Wings, male and female terminalia are illustrated for all species.

  11. Revision of the Neotropical Xanthandrus Verral (Diptera, Syrphidae

    Directory of Open Access Journals (Sweden)

    Borges Zuleica M.

    2003-01-01

    Full Text Available The Neotropical genus Xanthandrus Verral, 1901 is revised. Six species are redescribed: X. bucephalus (Wiedemann, 1830, X. cubanus Fluke, 1936, X. mellinoides (Macquart, 1846, X. mexicanus Curran, 1930, X. nitidulus Fluke, 1937, and X. plaumanni Fluke, 1937. Three species are included based on original descriptions: X. flavomaculatus Shannon, 1927, X. palliatus (Fluke, 1945, and X. simplex (Loew, 1861. New synonyms proposed: Argentinomyia longicornis (Walker, 1837 = Xanthandrus biguttatus Hull, 1945 syn. nov., and Xanthandrus bucephalus (Wiedemann, 1830 = Melanostoma quadrinotata Bigot, 1884 syn. nov. Description of terminalia, a key for Neotropical species, and illustrations are also presented.

  12. Numerous transitions of sex chromosomes in Diptera.

    Science.gov (United States)

    Vicoso, Beatriz; Bachtrog, Doris

    2015-04-01

    Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot), but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes). Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  13. Numerous transitions of sex chromosomes in Diptera.

    Directory of Open Access Journals (Sweden)

    Beatriz Vicoso

    2015-04-01

    Full Text Available Many species groups, including mammals and many insects, determine sex using heteromorphic sex chromosomes. Diptera flies, which include the model Drosophila melanogaster, generally have XY sex chromosomes and a conserved karyotype consisting of six chromosomal arms (five large rods and a small dot, but superficially similar karyotypes may conceal the true extent of sex chromosome variation. Here, we use whole-genome analysis in 37 fly species belonging to 22 different families of Diptera and uncover tremendous hidden diversity in sex chromosome karyotypes among flies. We identify over a dozen different sex chromosome configurations, and the small dot chromosome is repeatedly used as the sex chromosome, which presumably reflects the ancestral karyotype of higher Diptera. However, we identify species with undifferentiated sex chromosomes, others in which a different chromosome replaced the dot as a sex chromosome or in which up to three chromosomal elements became incorporated into the sex chromosomes, and others yet with female heterogamety (ZW sex chromosomes. Transcriptome analysis shows that dosage compensation has evolved multiple times in flies, consistently through up-regulation of the single X in males. However, X chromosomes generally show a deficiency of genes with male-biased expression, possibly reflecting sex-specific selective pressures. These species thus provide a rich resource to study sex chromosome biology in a comparative manner and show that similar selective forces have shaped the unique evolution of sex chromosomes in diverse fly taxa.

  14. Temporal patterns of abundance of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) and mitochondrial DNA analysis of Ae. albopictus in the Central African Republic

    National Research Council Canada - National Science Library

    Kamgang, Basile; Ngoagouni, Carine; Manirakiza, Alexandre; Nakouné, Emmanuel; Paupy, Christophe; Kazanji, Mirdad

    2013-01-01

    The invasive Asian tiger mosquito Aedes albopictus (Diptera: Culicidae) was first reported in central Africa in 2000, in Cameroon, with the indigenous mosquito species Ae. aegypti (Diptera: Culicidae...

  15. Revision of the family Nothybidae (Diptera: Schizophora).

    Science.gov (United States)

    Lonsdale, O; Marshall, S A

    2016-04-05

    The family Nothybidae (Diptera: Schizophora) is revised. The family consists of 11 species in the single genus Nothybus Rondani, which occurs in Papua New Guinea, Nepal and much of the Oriental Region. Three species are described as new: N. absens spec. nov. (China), N. cataractus spec. nov. (Laos, Thailand) and N. procerus spec. nov. (India). Nothybus longithorax Rondani, 1875 is treated as a junior synonym of N. longicollis (Walker, 1856). Nothybus decorus Meijere, 1924 syn. nov. is included as a junior synonym of N. lineifer Enderlein, 1922.

  16. Rhipidia crane flies (Diptera: Limoniidae) from Korea.

    Science.gov (United States)

    Podenas, Sigitas; Byun, Hye-Woo; Kim, Sam-Kyu

    2016-07-07

    Korean species of the crane fly genus Rhipidia Meigen, 1818 (Diptera: Limoniidae), are taxonomically revised. Rhipidia (Rhipidia) serena, new species, is described and figured. Rhipidia (R.) longa Zhang, Li, Yang, 2014, R. (R.) maculata Meigen, 1818 and R. (R.) sejuga Zhang, Li, Yang, 2014 are recorded for the first time in Korea. Previously known species, Rhipidia (R.) septentrionis Alexander, 1913 is redescribed and illustrated. Identification key for all Korean Rhipidia species is given. Most antennae, wings, male and female terminalia of all species are illustrated for the first time.

  17. Recombination rate predicts inversion size in Diptera.

    Science.gov (United States)

    Cáceres, M; Barbadilla, A; Ruiz, A

    1999-09-01

    Most species of the Drosophila genus and other Diptera are polymorphic for paracentric inversions. A common observation is that successful inversions are of intermediate size. We test here the hypothesis that the selected property is the recombination length of inversions, not their physical length. If so, physical length of successful inversions should be negatively correlated with recombination rate across species. This prediction was tested by a comprehensive statistical analysis of inversion size and recombination map length in 12 Diptera species for which appropriate data are available. We found that (1) there is a wide variation in recombination map length among species; (2) physical length of successful inversions varies greatly among species and is inversely correlated with the species recombination map length; and (3) neither the among-species variation in inversion length nor the correlation are observed in unsuccessful inversions. The clear differences between successful and unsuccessful inversions point to natural selection as the most likely explanation for our results. Presumably the selective advantage of an inversion increases with its length, but so does its detrimental effect on fertility due to double crossovers. Our analysis provides the strongest and most extensive evidence in favor of the notion that the adaptive value of inversions stems from their effect on recombination.

  18. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae) and their parasitoids (Hymenoptera: Braconidae and Figitidae) in orchards of guava, loquat and peach

    Energy Technology Data Exchange (ETDEWEB)

    Souza-Filho, M.F.; Raga, A. [Instituto Biologico, Campinas, SP (Brazil)], e-mail: miguelf@biologico.sp.gov.br; Azevedo-Filho, J.A. [Agencia Paulista de Tecnologia dos Agronegocios (APTA), Monte Alegre do Sul, SP (Brazil). Polo Regional do Leste Paulista; Strikis, P.C. [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Biologia. Dept. de Parasitologia; Guimaraes, J.A. [EMBRAPA Agroindustria Tropical, Fortaleza, CE (Brazil); Zucchi, R.A. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Entomologia, Fitopatologia e Zoologia Agricola

    2009-02-15

    This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann), A. obliqua (Macquart), A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker), N. glaberrima (Wiedemann), N. pendula (Bezzi), N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis), as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck), Doryctobracon areolatus (Szepligeti), D. brasiliensis (Szepligeti), Opius bellus Gahan, and Utetes anastrephae (Viereck), and five figitids: Aganaspis pelleranoi (Brethes), Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower), Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut), and Trybliographa infuscata Diaz, Gallardo and Uchoa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years. (author)

  19. Regional-Scale Spatio-Temporal Analysis of Anastrepha ludens (Diptera: Tephritidae) Populations in the Citrus Region of Santa Engracia, Tamaulipas, Mexico.

    Science.gov (United States)

    Vanoye-Eligio, Venancio; Barrientos-Lozano, Ludivina; Pérez-Castañeda, Roberto; Gaona-García, Griselda; Lara-Villalon, Manuel

    2015-08-01

    Large citrus areas in Tamaulipas are affected by Anastrepha ludens (Loew) populations. Here we report the findings of a spatio-temporal analysis of A. ludens on an extended citrus area from 2008-2011 aimed at analyzing the probabilities of A. ludens infestation and developing an infestation risk classification for citrus production. A Geographic Information System combined with the indicator kriging geostatistics technique was used to assess A. ludens adult densities in the spring and fall. During the spring, our models predicted higher probabilities of infestation in the western region, close to the Sierra Madre Oriental, than in the east. Although a patchy distribution of probabilities was observed in the fall, there was a trend toward higher probabilities of infestation in the west than east. The final raster models summarized the probability maps using a three-tiered infestation risk classification (low-, medium-, and high risk). These models confirmed the greater infestation risk in the west in both seasons. These risk classification data support arguments for the use of the sterile insect technique and biological control in this extended citrus area and will have practical implications for the area-wide integrated pest management carried out by the National Program Against Fruit Flies in Tamaulipas, Mexico.

  20. Demographic Analysis of Sex Ratio on Population Growth of Bactrocera dorsalis (Diptera: Tephritidae) With Discussion of Control Efficacy Using Male Annihilation.

    Science.gov (United States)

    Yu-Bing Huang, Kevin; Atlihan, Remzi; Gökçe, Ayhan; Yu-Bing Huang, Joyce; Chi, Hsin

    2016-09-30

    The life table data for the oriental fruit fly, Bactrocera dorsalis (Hendel), at different adult sex ratios (1♀: 1♂, 1♀: 50♂, 50♀: 1♂ free-choice mating, and 50♀: 1♂ no-choice mating) were collected to determine the effects of sex-ratio manipulation on current pest control procedures. At 1♀: 1♂, females mated, on average, 2.3 times during their lifetime with a mean fecundity (F) of 1,122 eggs. The net reproductive rate (R0), intrinsic rate of increase (r), finite rate (λ), and mean generation time (T) were 561.0 offspring, 0.1693 d(-)  (1), 1.1844 d(-)  (1), and 37.4 d, respectively. At 50♀: 1♂ free-choice mating, males mated 46.7 times during their lifetime, while at 50♀: 1♂ no-choice mating, males mated on average 50 times during their lifetime, and all females mating only once in both treatments. The values for F, r, and λ were significantly lower for both 50♀: 1♂ treatments than those in the 1♀: 1♂ group; the R0 values, however, were either equal to or even higher than those in the 1♀: 1♂ treatment. In the male-biased sex ratio (1♀: 50♂), fecundity was the highest (1,610 eggs) and female average life span the longest (166 d), while the R0 was the lowest (31.6 offspring) among all treatments. Population projections showed that even at a sex ratio of 50♀: 1♂, B. dorsalis could still produce a large number of offspring. These findings demonstrate that management strategies for controlling B. dorsalis could be properly evaluated by using demographic methods. Because female annihilation appears to be a more effective control strategy, it should be considered as a viable alternative.

  1. Inclusion of Specialist and Generalist Stimuli in Attract-and-Kill Programs: Their Relative Efficacy in Apple Maggot Fly (Diptera: Tephritidae) Pest Management.

    Science.gov (United States)

    Morrison, William R; Lee, Doo-Hyung; Reissig, W Harvey; Combs, David; Leahy, Kathleen; Tuttle, Arthur; Cooley, Daniel; Leskey, Tracy C

    2016-08-01

    Investigating the chemical ecology of agricultural systems continues to be a salient part of integrated pest management programs. Apple maggot fly, a key pest of apple in eastern North America, is a visual specialist with attraction to host fruit-mimicking cues. These cues have been incorporated into red spherical traps used for both monitoring and behaviorally based management. Incorporating generalist or specialist olfactory cues can potentially increase the overall success of this management system. The primary aim of this study was to evaluate the attractiveness of a generalist olfactory cue, ammonium carbonate, and the specialist olfactory cue, a five-component apple volatile blend, when included as a component of a red attracticidal sphere system. Secondly, we assessed how critical it was to maintain minimal deviation from the optimal, full-round specialist visual stimulus provided by red spheres. Finally, attracticidal spheres were deployed with specialist olfactory cues in commercial apple orchards to evaluate their potential for effective management of apple maggot. Ammonium carbonate did not increase residency, feeding time, or mortality in the laboratory-based trials. Field deployment of specialist olfactory cues increased apple maggot captures on red spheres, while the generalist cue did not. Apple maggot tolerated some deviation from the optimal visual stimulus without reducing captures on red spheres. Attracticidal spheres hung in perimeter trees in orchards resulted in acceptable and statistically identical levels of control compared with standard insecticide programs used by growers. Overall, our study contributes valuable information for developing a reliable attract-and-kill system for apple maggot.

  2. Performance of a Genetically Modified Strain of the Mediterranean Fruit Fly (Diptera: Tephritidae) for Area-Wide Integrated Pest Management With the Sterile Insect Technique.

    Science.gov (United States)

    Ramírez-Santos, Edwin M; Rendón, Pedro; Ruiz-Montoya, Lorena; Toledo, Jorge; Liedo, Pablo

    2016-12-23

    The genetically modified strain of Ceratitis capitata (Wiedemann) VIENNA 8 1260 has two morphological markers that exhibit fluorescence in body and sperm. To assess the feasibility of its use in area-wide integrated pest management (AW-IPM) programs using the sterile insect technique, its rearing performance and quality control profile under small, medium, and large scales was evaluated, as well as in field cages. The VIENNA 8 1260 strain had a lower yield than the control strains, VIENNA 8 with D53 inversion (VIENNA 8) and without D53 inversion (VIENNA 8 D53-). At mass-rearing scale, yield gradually increased in three generations without reaching the control strain values. The VIENNA 8 1260 strain was stable in the genetic sexing mechanism (>99.9%) and expression of fluorescence (100%). In field cages, the VIENNA 8 1260 males reduced the mating potential of wild males in the same magnitude as the VIENNA 8, when evaluated in independent cage tests. However, the relative sterility index and the strain male relative performance index of VIENNA 8 1260 males were significantly lower than those of the VIENNA 8. There were no significant differences in longevity of these strains. The potential application of the VIENNA 8 1260 in AW-IPM programs is further discussed.

  3. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    Science.gov (United States)

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  4. Weathering and chemical degradation of methyl eugenol and raspberry ketone solid dispensers for detection, monitoring and male annihilation of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae) in Hawaii

    Science.gov (United States)

    Solid male lure dispensers containing methyl eugenol (ME) and raspberry ketone (RK), or mixtures of the lures (ME + RK), and dimethyl dichloro-vinyl phosphate (DDVP) were evaluated in AWPM bucket or Jackson traps in commercial papaya (Carica papaya L.) orchards where both oriental fruit fly, Bactroc...

  5. Faunistic analysis of Anastrepha spp. (Diptera: Tephritidae) on a guava orchard under organic management in the municipality of Una, Bahia, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Vivian S.; Santos, Mirian S; Souza Filho, Zilton A.; Silva, Janisete G. [Universidade Estadual de Santa Cruz (UESC), Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Araujo, Elton L. [Universidade Federal Rural do Semi-Arido, Mossoro, RN (Brazil). Dept. de Ciencias Vegetais

    2009-01-15

    We carried out a study to characterize fruit fly populations on an organic guava orchard (Psidium guajava cv. Paluma) in the municipality of Una, southern region of the state of Bahia, Brazil, using faunistic analysis of the adult fruit f y specimens captured in McPhail traps from January 2004 through March 2007. A total of 22,673 specimens of Anastrepha (15,306 females and 7,367 males) were captured. Thirteen species of Anastrepha were recorded. A. fraterculus and A. obliqua were the more frequent and dominant species, accounting for 90.1% of all females captured in the traps. A. fraterculus was the predominant species (more frequent, constant and dominant). The high value of the Simpson index (0.62) and the low values of Shannon-Wiener (0.83) and equitability (0.49) indices indicated the dominance and high frequency of A. fraterculus and A. obliqua on the guava orchard despite the presence of other fruit species as potential hosts of fruit flies. (author)

  6. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    OpenAIRE

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava,Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez,Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca,Jeniffer K.; Zapata,Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and t...

  7. Isolation of entomopathogenic nematodes in an apple orchard in Southern Brazil and its virulence to Anastrepha fraterculus (Diptera: Tephritidae) larvae, under laboratory conditions.

    Science.gov (United States)

    Foelkel, E; Voss, M; Monteiro, L B; Nishimura, G

    2017-03-01

    Entomopathogenic nematodes (EPNs) are a promising alternative to integrated control in many fruit pests. Few studies were made on the relationship of Anastrepha fraterculus natural population with native EPNs population and other biotic and abiotic factors. The aim of this work was to verify the occurrence of endemic nematodes in an apple orchard, concerning environmental conditions and technical procedure, and access isolates virulence to A. fraterculus larvae. The experiment was conducted during a year taking monthly soil samples from an apple orchard, with and without fallen fruits just above the soil. Samples were baited with Tenebrium molitor and A. fraterculus larvae in laboratory. Canopy and fallen fruits were sampled to access the pest infestation. Seventy three EPN isolates were captured, in 23.2% soil samples, more with T. molitor than with A. fraterculus baits. From the 20 isolates tested against A. fraterculus, only five were pathogenic, and they were identified as Oscheius sp. The nematodes were captured during all seasons in a similar frequency. Soil and weather conditions, presence of fruit over the orchard soil, and A. fraterculus pupae in the fruits had no significant influence on the capture. As a conclusion, nematodes of the genera Oscheius are found in an apple orchard of Porto Amazonas constantly along the year, independently of fluctuations in A. fraterculus population, climate conditions and presence of fruit over the soil. Some of the isolates are pathogenic to A. fraterculus.

  8. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The IT...

  9. Host plant oviposition preference of Bactrocera cucurbitae (Coquillett) (Diptera : Tephritidae)%瓜实蝇对寄主植物的产卵选择性

    Institute of Scientific and Technical Information of China (English)

    彭帅; 郑丽霞; 吴伟坚

    2013-01-01

    The melon fruit fly, Bactrocera cucurbitae ( Coquillett) has been reported to damage more than 100 host plants and is a major pest of cucurbitaceous vegetables. Choice oviposition experiments were conducted under laboratory conditions to help assess host plant specificity of the fruit fly. Six host species: Momordica charantiap, Luffa cylindrical, Cucumis sativus, Cucurbita moschata, Carica papaya and Cucurbita pepo were tested. Oviposition rates were highest on M. charantiap (56. 18% of eggs) and C. sativus (29. 00% ) , with low rates on C. papaya (1. 85% ) and C. moschata (0. 00% ) . In contrast, Oviposition rates were highest on C. sativus ( 34. 64% ) , C. pepo ( 30. 37% ) and C. moschata (18. 05% ) , with low rates on C. papaya (0. 60% ) when the fruit peel were pared. Oviposition rates of B. cucurbitae females on fruits with peel had a significant negative correlation with the hardness of peel, and the correlation coefficient was - 0. 8772. The results imply that in addition to the in - built chemical compounds, plants have physical barrier like hard fruit peel, which impact melon fruit fly oviposition.%瓜实蝇Bactrocera cucurbitae (Coquillett)可危害100多种寄主植物,是葫芦科蔬菜的重要害虫.为了探明瓜实蝇的寄主特异性,在实验室条件下研究了瓜实蝇对黄瓜Cucumis sativus、苦瓜Momordica charantiap、丝瓜Luffa cylindrica、南瓜Cucurbita moschata、番木瓜Carica papaya和西葫芦Cucurbita pepo的产卵选择性.瓜实蝇在苦瓜和黄瓜上的产卵比率较高,分别为56.18%和29.00%,在番木瓜和南瓜上产卵比率较低,分别为1.85%和0.00%,但是在去掉果皮后,黄瓜、西葫芦和南瓜的产卵比率较高,分别达到34.64%、30.37%和18.05%,在番木瓜上的产卵率较低仅为0.60%.瓜实蝇雌虫在带皮果实上的产卵比率与果皮硬度呈显著的负相关关系,相关系数为-0.8772结果表明除了自身的化合物之外,植物具有的物理屏障如坚硬的表皮会影响瓜实蝇产卵.

  10. Male sexual enhancement after methoprene treatment in Anastrepha fraterculus (Diptera: Tephritidae): A sustained response that does not fade away after sexual maturation.

    Science.gov (United States)

    Bachmann, G E; Devescovi, F; Nussenbaum, A L; Cladera, J L; Fernández, P C; Vera, M T; Teal, P E A; Segura, D F

    2017-08-01

    The juvenile hormone (JH) of insects triggers physiological changes related to reproduction in adults of both sexes. Methoprene is a sesquiterpene with some effects that are analogous to those of JH. Treatments with methoprene accelerate sexual maturation in males of the South American fruit fly Anastrepha fraterculus, giving young males a mating advantage over non-treated males of the same age. Here, we evaluated the effects of methoprene treatment on A. fraterculus males after the sexual maturation phase and tested whether this compound provides a long-term mating advantage. Moreover, we took the first step to unravel the mechanisms that underlie male sexual enhancement. We treated males 1day or 8days after adult emergence and compared mate choice between recently matured (young) females and females that had been mature for ca. 10days (aged females). We also addressed methoprene treatment effects on male sexual signalling. We found that methoprene treatment enhanced male sexual competitiveness even after the sexual maturation phase, and the effect did not decrease until males were older than 20days. However, when methoprene treatment was carried out close to sexual maturity, the mating enhancement was no longer observed, suggesting a non-immediate effect and excluding the possibility that methoprene acts as a pheromonal compound. Young and aged females tended to mate more frequently with treated-males. This might indicate that in a context of sexual selection, the potential benefits associated with reproductive success would be similar for females of both ages. Treated males released larger amounts of pheromonal compounds than non-treated males, but their courtship behaviour was not altered to the same extent, suggesting that methoprene treatment may accelerate differently the components of male courtship. We discuss potential benefits of using methoprene to increase the efficiency of the sterile insect technique, which is an environmentally safe method to control this important South American fruit pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Revised irradiation doses to control melon fly, Mediterranean fruit fly, and oriental fruit fly (Diptera: Tephritidae) and a generic dose for tephritid fruit flies.

    Science.gov (United States)

    Follett, Peter A; Armstrong, John W

    2004-08-01

    Currently approved irradiation quarantine treatment doses for Bactrocera cucurbitae (Coquillet), melon fly; Ceratitis capitata (Wiedemann), Mediterranean fruit fly; and Bactrocera dorsalis (Hendel), oriental fruit fly, infesting fruits and vegetables for export from Hawaii to the continental United States are 210, 225, and 250 Gy, respectively. Irradiation studies were initiated to determine whether these doses could be reduced to lower treatment costs, minimize any adverse effects on quality, and support a proposed generic irradiation dose of 150 Gy for fruit flies. Dose-response tests were conducted with late third instars of wild and laboratory strains of the three fruit fly species, both in diet and in fruit. After x-ray irradiation treatment, data were taken on adult emergence, and adult female fecundity and fertility. Melon fly was the most tolerant of the three species to irradiation, and oriental fruit fly was more tolerant than Mediterranean fruit fly. Laboratory and wild strains of each species were equally tolerant of irradiation, and larvae were more tolerant when irradiated in fruit compared with artificial diet. An irradiation dose of 150 Gy applied to 93,666 melon fly late third instars in papayas resulted in no survival to the adult stage, indicating that this dose is sufficient to provide quarantine security. Irradiation doses of 100 and 125 Gy applied to 31,920 Mediterranean fruit fly and 55,743 oriental fruit fly late third instars, respectively, also resulted in no survival to the adult stage. Results support a proposed generic irradiation quarantine treatment dose of 150 Gy for all tephritid fruit flies.

  12. Population fluctuation of adult males of the fruit fly, Bactrocera tau Walker (Diptera: Tephritidae) in passion fruit orchards in relation to abiotic factors and sanitation

    NARCIS (Netherlands)

    Hasyim, A.; Muryati, M.; Kogel, de W.J.

    2008-01-01

    Fruit fly (Bactrocera tau) is the most destructive pest on some fruits in Indonesia. Monitoring of the pest population is essential as one of the procedures in the IPM concept. The study aimed to investigate the seasonal fluctuation of adult males of B. tau and their damage on passion fruits in rela

  13. Temporal Diversity and Abundance Patterns of Parasitoids of Fruit-Infesting Tephritidae (Diptera) in the Argentinean Yungas: Implications for Biological Control.

    Science.gov (United States)

    Schliserman, Pablo; Aluja, Martin; Rull, Juan; Ovruski, Sergio M

    2016-10-01

    A 4-yr study was done to analyze seasonal patterns underlying host plant-fruit fly-parasitoid interactions in a secondary forest in the Argentinean Yunga and its importance for the implementation of conservation and augmentative biological control. Larval-pupal hymenopteran parasitoids associated with all host plants and fruit fly species were identified and the seasonal occurrence of fruit, infestation levels, parasitism percentage, and relative parasitoid abundance were determined. Three fruit fly species in two genera were found in association with surveyed plants, two of which (Ceratitis capitata (Wiedemann) and Anastrepha fraterculus (Wiedemann)) are of major economic importance. Infestation levels were strongly influenced by environmental factors and peak fruit availability. Five fruit fly parasitoid species were recovered from fly pupae, four braconid species, and one figitid. Time windows for fruit fly population growth were pinpointed. Based on results, the present analysis proposes an effective fruit fly biological control strategy tailored for the northwestern Argentinean citrus-producing area.

  14. Natural Parasitism in Fruit Fly (Diptera: Tephritidae) Populations in Disturbed Areas Adjacent to Commercial Mango Orchards in Chiapas and Veracruz, Mexico.

    Science.gov (United States)

    Montoya, Pablo; Ayala, Amanda; López, Patricia; Cancino, Jorge; Cabrera, Héctor; Cruz, Jassmin; Martinez, Ana Mabel; Figueroa, Isaac; Liedo, Pablo

    2016-04-01

    To determine the natural parasitism in fruit fly populations in disturbed areas adjacent to commercial mango orchards in the states of Chiapas and Veracruz, Mexico, we recorded over one year the fruit fly-host associations, fly infestation, and parasitism rates in backyard orchards and patches of native vegetation. We also investigated the relationship between fruit size, level of larval infestation, and percent of parasitism, and attempted to determine the presence of superparasitism. The most recurrent species in trap catches was Anastrepha obliqua (Macquart), followed by Anastrepha ludens (Loew), in both study zones. The fruit infestation rates were higher in Chiapas than in Veracruz, with A. obliqua again being the most conspicuous species emerging from collected fruits. The diversity of parasitoids species attacking fruit fly larvae was greater in Chiapas, with a predominance of Doryctobracon areolatus (Szépligeti) in both sites, although the exotic Diachasmimorpha longicaudata (Ashmead) was well established in Chiapas. Fruit size was positively correlated with the number of larvae per fruit, but this relationship was not observed in the level of parasitism. The number of oviposition scars was not related to the number of immature parasitoids inside the pupa of D. areolatus emerging from plum fruits. Mass releases of Di. longicaudata seem not to affect the presence or prevalence of the native species. Our findings open new research scenarios on the role and impact of native parasitoid species attacking Anastrepha flies that can contribute to the development of sound strategies for using these species in projects for augmentative biological control.

  15. Forest fragments as barriers to fruit fly dispersal: Anastrepha (Diptera: Tephritidae) populations in orchards and adjacent forest fragments in Puerto Rico.

    Science.gov (United States)

    Jenkins, David A; Kendra, Paul E; Van Bloem, Skip; Whitmire, Stefanie; Mizell, Russ; Goenaga, Ricardo

    2013-04-01

    McPhail-type traps baited with ammonium acetate and putrescine were used to monitor populations of Anastrepha obliqua (Macquart) and Anastrepha suspensa (Loew) in two orchards with hosts of these flies (mango, Mangifera indica L., and carambola, Averrhoa carambola L.), as well as in forest fragments bordering these orchards. Contour maps were constructed to measure population distributions in and around orchards. Our results indicate that Anastrepha populations are focused around host fruit in both space and time, that traps do not draw fruit flies away from hosts, even when placed within 15 m of the host, and that lures continue to function for 6 mo in the field. The contour mapping analyses reveal that populations of fruit flies are focused around ovipositional hosts. Although the trapping system does not have a very long effective sampling range, it is ideal, when used in combination with contour analyses, for assessing fine-scale (on the order of meters) population distributions, including identifying resources around which fly populations are focused or, conversely, assessing the effectiveness of management tools. The results are discussed as they pertain to monitoring and detecting Anastrepha spp. with the McPhail-type trap and ammonium acetate and putrescine baiting system and the dispersal of these flies within Puerto Rico.

  16. Regional Suppression of Bactrocera Fruit Flies (Diptera: Tephritidae in the Pacific through Biological Control and Prospects for Future Introductions into Other Areas of the World

    Directory of Open Access Journals (Sweden)

    Roger I. Vargas

    2012-08-01

    Full Text Available Bactrocera fruit fly species are economically important throughout the Pacific. The USDA, ARS U.S. Pacific Basin Agricultural Research Center has been a world leader in promoting biological control of Bactrocera spp. that includes classical, augmentative, conservation and IPM approaches. In Hawaii, establishment of Bactrocera cucurbitae (Coquillett in 1895 resulted in the introduction of the most successful parasitoid, Psyttalia fletcheri (Silvestri; similarly, establishment of Bactrocera dorsalis (Hendel in 1945 resulted in the introduction of 32 natural enemies of which Fopius arisanus (Sonan, Diachasmimorpha longicaudata (Ashmead and Fopius vandenboschi (Fullaway were most successful. Hawaii has also been a source of parasitoids for fruit fly control throughout the Pacific region including Australia, Pacific Island Nations, Central and South America, not only for Bactrocera spp. but also for Ceratitis and Anastrepha spp. Most recently, in 2002, F. arisanus was introduced into French Polynesia where B. dorsalis had invaded in 1996. Establishment of D. longicaudata into the new world has been important to augmentative biological control releases against Anastrepha spp. With the rapid expansion of airline travel and global trade there has been an alarming spread of Bactrocera spp. into new areas of the world (i.e., South America and Africa. Results of studies in Hawaii and French Polynesia, support parasitoid introductions into South America and Africa, where B. carambolae and B. invadens, respectively, have become established. In addition, P. fletcheri is a candidate for biological control of B. cucurbitae in Africa. We review past and more recent successes against Bactrocera spp. and related tephritids, and outline simple rearing and release methods to facilitate this goal.

  17. Spatial dynamics of two oriental fruit fly (Diptera: Tephritidae) parasitoids, Fopius arisanus and Diachasmimorpha longicaudata (Hymenoptera: Braconidae), in a Guava orchard in Hawaii.

    Science.gov (United States)

    Vargas, Roger I; Stark, John D; Banks, John; Leblanc, Luc; Manoukis, Nicholas C; Peck, Steven

    2013-10-01

    We examined spatial patterns of both sexes of oriental fruit fly, Bactrocera dorsalis (Hendel), and its two most abundant parasitoids, Fopius arisanus (Sonan) and Diachasmimorpha longicaudata (Ashmead) in a commercial guava (Psidium guajava L.) orchard. Oriental fruit fly spatial patterns were initially random, but became highly aggregated with host fruit ripening and the subsequent colonization of, first, F. arisanus (egg-pupal parasitoid) and, second, D. longicaudata (larval-pupal parasitoid). There was a significant positive relationship between populations of oriental fruit fly and F. arisanus during each of the F. arisanus increases, a pattern not exhibited between oriental fruit fly and D. longicaudata. Generally, highest total numbers of males and females (oriental fruit fly, F. arisanus, and D. longicaudata) occurred on or about the same date. There was a significant positive correlation between male and female populations of all three species; we measured a lag of 2-4 wk between increases of female F. arisanus and conspecific males. There was a similar trend in one of the two years for the second most abundant species, D. longicaudata, but no sign of a time lag between the sexes for oriental fruit fly. Spatially, we found a significant positive relationship between numbers of F. arisanus in blocks and the average number in adjoining blocks. We did not find the same effect for oriental fruit fly and D. longicaudata, possibly a result of lower overall numbers of the latter two species or less movement of F. arisanus within the field.

  18. Evidence for potential of managing some African fruit fly species (Diptera: Tephritidae) using the mango fruit fly host-marking pheromone.

    Science.gov (United States)

    Kachigamba, Donald L; Ekesi, Sunday; Ndungu, Mary W; Gitonga, Linus M; Teal, Peter E A; Torto, Baldwyn

    2012-12-01

    We investigated conspecific and heterospecific oviposition host discrimination among four economically important fruit fly pests of mango in Africa (Ceratitis capitata, Wiedemann; C. fasciventris, Bezzi; C. rosa, Karsch, and C. cosyra, Walker) with regard to host-marking behavior and fecal matter aqueous solutions. The objective of the study was to get insight into the potential of managing these pests using the host-marking technique. Observations were done on mango slices marked by the flies and treated with aqueous solutions of fecal matter of the flies, respectively. In both host-marking and fecal matter experiments, C. cosyra, which is the most destructive species of the four on mango, was exceptional. It only discriminated against hosts treated with its fecal matter but with lower sensitivity while C. capitata and C.fasciventris discriminated against hosts marked by it or treated with its fecal matter and with higher sensitivity. Our results provide evidence for potential of managing some of the major fruit fly species infesting mango in Africa using the host-marking pheromone of the mango fruit fly, C. cosyra.

  19. Analysis of Seasonal Risk for Importation of the Mediterranean Fruit Fly, Ceratitis capitata (Diptera: Tephritidae), via Air Passenger Traffic Arriving in Florida and California.

    Science.gov (United States)

    Szyniszewska, A M; Leppla, N C; Huang, Z; Tatem, A J

    2016-09-04

    The Mediterranean fruit fly, Ceratitis capitata (Wiedemann), is one of the most economically damaging pests in the world and has repeatedly invaded two major agricultural states in the United States, Florida and California, each time requiring costly eradication. The Mediterranean fruit fly gains entry primarily in infested fruit carried by airline passengers and, since Florida and California each receive about 13 million international passengers annually, the risk of Mediterranean fruit fly entering the United States is potentially very high. The risk of passengers bringing the pest into Florida or California from Mediterranean fruit fly-infested countries was determined with two novel models, one estimated seasonal variation in airline passenger number and the other defined the seasonal and spatial variability in Mediterranean fruit fly abundance. These models elucidated relationships among the risk factors for Mediterranean fruit fly introduction, such as amount of passenger traffic, routes traveled, season of travel, abundance of Mediterranean fruit fly in countries where flights departed, and risk of the pest arriving at destination airports. The risk of Mediterranean fruit fly being introduced into Florida was greatest from Colombia, Brazil, Panama, Venezuela, Argentina, and Ecuador during January-August, whereas primarily the risk to California was from Brazil, Panama, Colombia, and Italy in May-August. About three times more Mediterranean fruit flies were intercepted in passenger baggage at airports in Florida than California, although the data were compromised by a lack of systematic sampling and other limitations. Nevertheless, this study achieved the goal of analyzing available data on seasonal passenger flow and Mediterranean fruit fly population levels to determine when surveillance should be intensified at key airports in Florida and California.

  20. Adult population dynamics of the bolivian fruit flies Anastrepha sp. (Diptera: Tephritidae at Municipality Coroico, Department of The La Paz, Bolivia

    Directory of Open Access Journals (Sweden)

    Gonzáles Manuel

    2011-08-01

    Full Text Available The investigation was carried out in Paco (1603 msnm communities, it Marca (1511 msnm and Capellania (1720 msnm, of the Municipality of Coroico, department of La Paz, Bolivia. In orchards frutícolas semicomerciales, they settled 15 traps distributed McPhail in a similar way among areas, five for community, sampling" "points. The censuses were carried out with an interval of 15 days, they were identified and they quantified the mature flies of the fruit. For the captures of the individuals, they settled the traps McPhail, using the attractive (Buminal one and as conserving borax. The traps were distributed in representative parcels, having as main cultivations, orange, mandarin, grapefruit, guava and avocado. The identification taxonómica of the captured species was carried out in the laboratory of the National Program of Control of Flies of the fruit (PROMOSCA, clerk of the National Service of Agricultural Sanity and Alimentary (SENASAG Inocuidad. 1210 mature flies of the fruit were captures, those that grouped for species, sex, capture dates and community, corresponding to the seven carried out censuses. The species of Anastrepha fraterculus (Wiedeman were identified, Anastrepha striata Schiner, Anastrepha serpentine (Wiedeman, Anastrepha sp, Ceratitis capitata (Wiedemann, Blepharoneura sp Loew, Hexaresta sp Hering, Hexachaeta sp Loew, Tomoplagia sp Coquillett, Tetreuaresta sp Hendel, being that of more presence Anastrepha fraterculus (Wiedeman with 818 and Ceratitis capitata (Wiedemann, with 354. The temperature and presence of spices put up frutícolas of flies of the fruit in maturation state explain the observed fluctuations.

  1. Diversity and seasonality of fruit flies (Diptera: Tephritidae and Lonchaeidae and their parasitoids (Hymenoptera: Braconidae and Figitidae in orchards of guava, loquat and peach

    Directory of Open Access Journals (Sweden)

    MF. Souza-Filho

    Full Text Available This work was carried out in orchards of guava progenies, and loquat and peach cultivars, in Monte Alegre do Sul, SP, Brazil, in 2002 and 2003. Guavas and loquats were bagged and unbagged bi-weekly and weekly, respectively, for assessment of the infestation period. Peach was only bagged weekly. The assays started when the fruits were at the beginning of development, but still green. Ripe fruits were taken to the laboratory and placed individually into plastic cups. McPhail plastic traps containing torula yeast were hung from January 2002 to January 2004 to assess the fruit fly population in each orchard, but only the Ceratitis capitata population is here discussed. Five tephritid species were reared from the fruits: Anastrepha bistrigata Bezzi, A. fraterculus (Wiedemann, A. obliqua (Macquart, A. sororcula Zucchi, and C. capitata, in addition to six lonchaeid species: Neosilba certa (Walker, N. glaberrima (Wiedemann, N. pendula (Bezzi, N. zadolicha McAlpine and Steyskal, Neosilba sp. 4, and Neosilba sp. 10 (both species are in the process of being described by P. C. Strikis, as well as some unidentified Neosilba species. Ten parasitoid species were obtained from fruit fly puparia, of which five were braconids: Asobara anastrephae (Muesebeck, Doryctobracon areolatus (Szépligeti, D. brasiliensis (Szépligeti, Opius bellus Gahan, and Utetes anastrephae (Viereck, and five figitids: Aganaspis pelleranoi (Brèthes, Dicerataspis grenadensis Ashmead, Lopheucoila anastrephae (Rhower, Leptopilina boulardi (Barbotin, Carlton and Kelner-Pillaut, and Trybliographa infuscata Diaz, Gallardo and Uchôa. Ceratitis capitata showed a seasonal behavior with population density peaking at the second semester of each year. Anastrepha and Neosilba species remained in the orchards throughout both years.

  2. Irradiation of Anastrepha fraterculus (Diptera: Tephritidae) Eggs to Inhibit Fly Emergence in the Mass-Rearing of Diachasmimorpha longicaudata (Hymenoptera: Braconidae).

    Science.gov (United States)

    Costa, M L Z; Pacheco, M G; Lopes, L A; Botteon, V W; Mastrangelo, T

    2016-01-01

    As the incidence of Anastrepha fraterculus (Wiedemann) has increased in Southern Brazil in the past 3 yr, an initiative to release sterile flies and parasitoids has started. In order to make feasible the mass-rearing of the parasitoid Diachasmimorpha longicaudata (Ashmed), this study investigated the suitability of A. fraterculus larvae derived from irradiated eggs as host for D. longicaudata Two different ages of A. fraterculus eggs (24 and 48 h old) were analyzed for hatchability after the exposure to a range of radiation doses. The hatchability of 48-h-old eggs was not affected by radiation, and no fly emerged at doses higher than 27.5 Gy. The larvae derived from irradiated eggs proved to be suitable hosts for the parasitoid development, with observed parasitism rates higher than 70% and sex ratio values above 0.6. The parasitism capability and longevity of D. longicaudata reared on larvae derived from irradiated eggs were also assessed. During the 10 d of parasitism evaluated, D. longicaudata from the treatments were able to parasitize nonirradiated larvae similarly as the parasitoids from controls and the laboratory colony. The longevity of D. longicaudata from the treatments was not affected either, with survival rates higher than 80% after 20 d of evaluation. The age of 48 h and a dose of 30 Gy could be considered the best age and dose for A. fraterculus eggs to be used in the mass-rearing of D. longicaudata The results of this study will decrease the costs of mass-rearing D. longicaudata on A. fraterculus. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America.

  3. UTILIZAÇÃO DA ANÁLISE DISCRIMINANTE EM ESTUDOS TAXONÔMICOS DE MOSCAS-DAS-FRUTAS DO GÊNERO Anastrepha Schiner, 1868 (DIPTERA: TEPHRITIDAE

    Directory of Open Access Journals (Sweden)

    E.L. ARAUJO

    1998-01-01

    Full Text Available As moscas-das-frutas Anastrepha fraterculus (Wiedemann, 1830, A. obliqua (Macquart, 1835, A. sororcula (Zucchi, 1979 e A. zenildae (Zucchi, 1979 foram submetidas a uma análise discriminante. Essas espécies do grupo fraterculus distinguem-se unicamente com base em detalhes do ápice do acúleo, que por serem muito semelhantes, dificultam a identificação específica. A análise discriminante permitiu a separação das quatro espécies de Anastrepha, com base em oito medidas do acúleo. Portanto, essa é mais uma técnica para auxiliar as identificações de espécies de Anastrepha, como já acontece em muitos outros grupos de insetos.A discriminant analysis was carried out for four species of the fraterculus group, Anastrepha fraterculus (Wiedemann, 1830, A. obliqua (Macquart, 1835, A. sororcula (Zucchi, 1979 and A. zenildae (Zucchi, 1979. These species can be distinguished only by minor morphological characters of the aculeus apex and sometimes there is great difficulty in determining specific limits. The study was based on eight measurements of the aculeus and it was possible to separate the species using the discriminant analysis. Therefore, this analysis is an additional tool for the identification of Anastrepha species as it was already observed for many other groups of insects.

  4. Differences in sperm storage and remating propensity between adult females of two morphotypes of the Anastrepha fraterculus (Diptera: Tephritidae) cryptic species complex.

    Science.gov (United States)

    Abraham, S; Rull, J; Mendoza, M; Liendo, M C; Devescovi, F; Roriz, A K; Kovaleski, A; Segura, D F; Vera, M T

    2014-06-01

    The South American fruit fly, Anastrepha fraterculus, is a complex of cryptic species composed of at least seven morphotypes. Some of them, such as the Peruvian and Brazilian 1 morphotypes (which include Argentinean populations), exhibit strong pre-copulatory isolation, yet it is possible to obtain heterotypic crosses when forcing copulation of adults under laboratory conditions. The cross involving Peruvian males and Argentinean females produces F1 offspring with reduced viability in terms of egg hatch. This low hatchability could be caused by a reduced amount of sperm transferred to and stored by females mated with heterotypic males, which in turn could affect their post-copulatory behaviour. To test these hypotheses, we investigated sperm transfer and female mating and remating behaviour for homotypic and heterotypic crosses between adults of two morphotypes (Brazilian 1 [Argentina] and Peruvian [Peru]) of the A. fraterculus cryptic species complex. As reported before, Argentinean males and females mated earlier in the day than the other three mating combinations. Peruvian females engaged in shorter copulation times than Argentinean females. Peruvian females tended to store smaller quantities of sperm than Argentinean females, and almost a half of the crosses involving Argentinean males and Peruvian females were unsuccessful (no sperm transfer). However, there was no evidence that the cross between Peruvian males and Argentinean females resulted in storage of a critically small amount of sperm (posing risk of sperm shortage). Argentinean females were more willing to remate than Peruvian females, irrespective of male morphotype, but latency to remating was not affected by male or female morphotype. This study shows that mating behaviour differs between some of the A. fraterculus complex morphotypes, with female but not male morphotype determining female likelihood to remate.

  5. Effect of host plant chemistry on genetic differentiation and reduction of gene flow among Anastrepha fraterculus (Diptera: Tephritidae) populations exploiting sympatric, synchronic hosts.

    Science.gov (United States)

    Oroño, Luis; Paulin, Laura; Alberti, Andrea C; Hilal, Mirna; Ovruski, Sergio; Vilardi, Juan C; Rull, Juan; Aluja, Martin

    2013-08-01

    Herbivore host specialization includes changes in behavior, driven by locally induced adaptations to specific plants. These adaptations often result in sexual isolation that can be gauged through detection of reduced gene flow between host associated populations. Hypothetically, reduced gene flow can be mediated both by differential response to specific plant kairomones and by the influence of larval diet on some adult traits such as pheromone composition. These hypotheses could serve as a model to explain rapid radiation of phytophagous tephritid fruit flies, a group that includes several complexes of cryptic species. The South American Fruit Fly Anastrepha fraterculus (Wiedemann) is a complex of at least seven cryptic species among which pheromone mediated sexual isolation resulted in rapid differentiation. Cryptic species also exhibit differences in host affiliation. In search of a model explaining rapid radiation in this group, we studied host plant chemical composition and genetic structure of three host associated sympatric populations of A. fraterculus. Chemical composition among host plant fruit varied widely both for nutrient and potentially toxic secondary metabolite content. Adaptation to plant chemistry appears to have produced population differentiation. We found host mediated differentiation to be stronger between populations exploiting sympatric synchronic hosts differing in chemical composition, than between populations that exploit hosts that fruit in succession. Gene flow among such host associated populations was extremely low. We propose as a working hypothesis for future research, that for those differences to persist over time, isolating mechanisms such as male produced sex pheromones and female preferences resulting from adaptation to different larval diets should evolve.

  6. Male-specific Y-linked transgene markers to enhance biologically-based control of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Meza, J Salvador; Schetelig, Marc F; Zepeda-Cisneros, C Silvia; Handler, Alfred M

    2014-01-01

    Reliable marking systems are critical to the prospective field release of transgenic insect strains. This is to unambiguously distinguish released insects from wild insects in the field that are collected in field traps, and tissue-specific markers, such as those that are sperm-specific, have particular uses such as identifying wild females that have mated with released males. For tephritid fruit flies such as the Mexican fruit fly, Anastrepha ludens, polyubiquitin-regulated fluorescent protein body markers allow transgenic fly identification, and fluorescent protein genes regulated by the spermatocyte-specific β2-tubulin promoter effectively mark sperm. For sterile male release programs, both marking systems can be made male-specific by linkage to the Y chromosome. An A. ludens wild type strain was genetically transformed with a piggyBac vector, pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3}, having the polyubiquitin-regulated EGFP body marker, and the β2-tubulin-regulated DsRed.T3 sperm-specific marker. Autosomal insertion lines effectively expressed both markers, but a single Y-linked insertion (YEGFP strain) expressed only PUbnlsEGFP. This insertion was remobilized by transposase helper injection, which resulted in three new autosomal insertion lines that expressed both markers. This indicated that the original Y-linked Asβ2tub-DsRed.T3 marker was functional, but specifically suppressed on the Y chromosome. The PUbnlsEGFP marker remained effective however, and the YEGFP strain was used to create a sexing strain by translocating the wild type allele of the black pupae (bp+) gene onto the Y, which was then introduced into the bp- mutant strain. This allows the mechanical separation of mutant female black pupae from male brown pupae, that can be identified as adults by EGFP fluorescence. A Y-linked insertion of the pBXL{PUbnlsEGFP, Asβ2tub-DsRed.T3} transformation vector in A. ludens resulted in male-specific expression of the EGFP fluorescent protein marker, and was integrated into a black pupae translocation sexing strain (T(YEGFP/bp+), allowing the identification of male adults when used in sterile male release programs for population control. A unique observation was that expression of the Asβ2tub-DsRed.T3 sperm-specific marker, which was functional in autosomal insertions, was specifically suppressed in the Y-linked insertion. This may relate to the Y chromosomal regulation of male-specific germ-line genes in Drosophila.

  7. Danos de moscas-das-frutas (Diptera, Tephritidae em citros, manejados no sistema orgânico de produção

    Directory of Open Access Journals (Sweden)

    Fernando Felisberto da Silva

    2014-10-01

    Full Text Available As moscas-das-frutas são as principais pragas da fruticultura mundial. Consideradas chaves para a produção de citros, torna-se necessário o seu monitoramento, visando a evitar os danos diretos. O experimento teve como objetivos conhecer a variação populacional de Anastrepha fraterculus e a relação de sua população com danos em pomares orgânicos de Citrus sinensis, cultivar Céu e de C. sinensis x Citrus reticulata tangor 'Murcott'. Os dados foram coletados em 2003 e 2004 durante o período de maturação dos frutos, na região do vale do Caí, RS, Brasil. O número de moscas-das-frutas foi registrado, semanalmente, por meio de armadilhas McPhail, contendo suco de uva, a 25%. Danos aos frutos foram determinados pela razão entre frutos sadios e frutos danificados pela mosca. Registros meteorológicos de temperatura, umidade relativa e precipitação pluviométrica foram obtidos, em estação meteorológica distante 30 km das áreas experimentais. Verificou-se que, em condições ideais de precipitação pluvial, maiores foram as populações de A. fraterculus, espécie predominante na região. A população estimada capaz de causar danos aos frutos variou de acordo com o cultivar, sendo a laranjeira 'Céu' a mais susceptível. Os maiores picos populacionais ocorrem na fase de mudança de coloração dos frutos. Porém, na fase de maturação, as moscas causaram os maiores danos, dada a intolerância dos frutos ao ataque. Conclui-se que a infestação dos frutos de citros por A. fraterculus está relacionada com espécie e cultivar e com fatores climáticos, principalmente com a precipitação pluvial. O monitoramento constante da população de mosca-das-frutas é importante na determinação da infestação na colheita.

  8. Remating behavior in Anastrepha fraterculus (Diptera: Tephritidae) females is affected by male juvenile hormone analog treatment but not by male sterilization.

    Science.gov (United States)

    Abraham, S; Liendo, M C; Devescovi, F; Peralta, P A; Yusef, V; Ruiz, J; Cladera, J L; Vera, M T; Segura, D F

    2013-06-01

    The sterile insect technique (SIT) has been proposed as an area-wide method to control the South American fruit fly, Anastrepha fraterculus (Wiedemann). This technique requires sterilization, a procedure that affects, along with other factors, the ability of males to modulate female sexual receptivity after copulation. Numerous pre-release treatments have been proposed to counteract the detrimental effects of irradiation, rearing and handling and increase SIT effectiveness. These include treating newly emerged males with a juvenile hormone mimic (methoprene) or supplying protein to the male's diet to accelerate sexual maturation prior to release. Here, we examine how male irradiation, methoprene treatment and protein intake affect remating behavior and the amount of sperm stored in inseminated females. In field cage experiments, we found that irradiated laboratory males were equally able to modulate female remating behavior as fertile wild males. However, females mated with 6-day-old, methoprene-treated males remated more and sooner than females mated with naturally matured males, either sterile or wild. Protein intake by males was not sufficient to overcome reduced ability of methoprene-treated males to induce refractory periods in females as lengthy as those induced by wild and naturally matured males. The amount of sperm stored by females was not affected by male irradiation, methoprene treatment or protein intake. This finding revealed that factors in addition to sperm volume intervene in regulating female receptivity after copulation. Implications for SIT are discussed.

  9. Enhancing male sexual success in a lekking fly (Anastrepha suspensa Diptera: Tephritidae) through a juvenile hormone analog has no effect on adult mortality.

    Science.gov (United States)

    Pereira, Rui; Sivinski, John; Teal, Peter; Brockmann, Jane

    2010-11-01

    While defending lek-territories, male Anastrepha suspensa (Loew) produce chemical, acoustic and visual courtship signals. In the laboratory and under semi-natural conditions, topical application of the juvenile hormone analog methoprene doubles pheromone production and subsequently doubles sexual success. However, sexual signals and interactions are likely to be physiologically expensive and so result in higher male mortality. Comparison of males kept in isolation for 35 days, but provided daily with a potential mate or a rival male, revealed that both male- and female-interactors shortened focal-male lifespan. In addition, focal males were either treated with methoprene or not, then either provided with protein in their sucrose-based diet or not. Protein proved to similarly double sexual success and also resulted in longer male life spans in all of the interactor-categories. However, there was no evidence that methoprene induced hypersexuality resulted in higher rates of mortality, i.e., the longevity of males treated with methoprene did not significantly differ from untreated males in the same interactor/diet categories. This apparent lack of costs to a putatively sexually selected signal is unexpected but presents an opportunity to increase the sexual competence of sterile flies with few consequences to their survival following mass-release. Published by Elsevier Ltd.

  10. Radiation-induced changes in melanization and phenoloxidase in Caribbean fruit fly larvae (diptera:tephritidae) as the basis for a simple test of irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Nation, J.L.; Milne, K.; Smittle, B.J. [Univ. of Florida, Gainsville, FL (United States)

    1995-03-01

    First instars of the Caribbean fruit fly, Anastrepha suspensa (Loew), were irradiated with 0, 5, 10, 20, 50, 75, 100, and 150 Gy doses from a Cs-137 source, and observed for whole body melanization as late third instars. Control larvae rapidly melanized, whereas larvae irradiated at {ge}20 Gy failed to show typical melanization after freezing and thawing. Assays of phenoloxidase in control and irradiated larvae showed greatly decreased enzyme activity at {ge}20 Gy and substantial reduction at lower doses. Larvae were also irradiated on the 1st d of each instar, and phenoloxidase activity was determined when they became late third instars. Larvae irradiated on the 1st d of the first instar and on 1st d of the second instar has {approx}90% or greater reduction in phenoloxidase activity as late third instars. Larvae irradiated on the 1st d of the instar had {approx}50% reduction in phenoloxidase activity at the time they became late third instars leaving the food to pupate. A simple spot test for phenoloxidase was developed that produced a red color with a crushed control larvae and no color with a larva irradiated at {ge}25 Gy. The radiation induced changes in melanization and phenoloxidase activity, and a simple spot test may serve as tests for irradiation treatment of Caribbean fruit fly larvae. 10 refs., 2 figs., 2 tabs.

  11. Influence of male nutritional conditions on the performance and alimentary selection of wild females of Anastrepha obliqua (Macquart)(Diptera, Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando Sergio [Universidade Federal de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Fac. de Filosofia, Ciencias e Letras. Dept. de Biologia], e-mail: cresoni@usp.br, e-mail: zucoloto@ffclrp.usp.br

    2006-04-15

    The behavior of A. obliqua females is regulated by endogenous and exogenous factors and among these the presence of males. Experiments were carried out to investigate whether the presence of males and their nutritional condition may affect the behavior of self-selection feeding and the performance of A. obliqua females. Females were sorted in groups containing yeast-deprived females and males, and non-yeast deprived females and males. The females were maintained apart from the males by a transparent plastic screen. Several yeast and sucrose combinations were offered to the females in a single diet block or in separate blocks. Ingestion, egg production, longevity and diet efficiency were determined. The non-yeast-deprived males positively influenced the females performance when the latter were fed with yeast and sucrose in distinct diet blocks. Performance was better in the groups without males and with yeast-deprived males where the females could not select the nutrient proportions (yeast and sucrose in a single diet block). (author)

  12. Comparison of Anastrepha ludens (Diptera: Tephritidae) Bisexual and Genetic Sexing (Tapachula-7) Strains: Effect of Hypoxia, Fly Density, Chilling Period, and Food Type on Fly Quality.

    Science.gov (United States)

    Arredondo, José; Ruiz, Lía; Hernández, Emilio; Montoya, Pablo; Díaz-Fleischer, Francisco

    2016-04-01

    The use of genetic sexing strain (GSS) insects in the sterile insect technique (SIT) makes necessary the revision of quality parameters of some stressful steps used during the packing process for aerial release because of possible differences in tolerance between fly strains. Here, we determined the effect of three periods of hypoxia (12, 24, and 36 h at pupal stage), three cage densities (1.0, 1.3, and 1.5 flies/cm2), two different foods (protein/sugar (1/24) and Mubarqui), and three chilling times (20 min [control], 90, and 180 min) on the quality parameters of flies of two Anastrepha ludens (Loew) strains (bisexual and GSS Tapachula-7). In general, the response to stressful conditions of both fly strains was qualitatively equivalent but quantitatively different, as flies of both strains responded equally to the stressful factors; however, flies of Tapachula-7 exhibited lower quality parameters than the control flies. Thus, hypoxia affected the flying ability but not the emergence or longevity of flies. The food type affected the adult weight; protein/sugar produced heavier flies that also survived longer and had a greater mating propensity. Flies under the lowest density were better fliers that those at the other two densities. Increasing chilling time reduced flight ability but not longevity or mating propensity. The implications of these findings for the use of A. ludens GSS in SIT programs are discussed herein.

  13. Niche breadth and interspecific competition between Doryctobracon crawfordi and Diachasmimorpha longicaudata (Hymenoptera:Braconidae), native and introduced of Anastrepha spp. fruit files (Diptera:Tephritidae)

    Science.gov (United States)

    Interactions among multiple natural enemies can enhance or interfere with their impacts on host/ prey populations. Two species of Braconidae are currently considered for augmentative biological control of pestiferous tephritid fruit flies in Mexico, the exotic Diachasmimorpha longicaudata (Ashmead)...

  14. Fruit flies (Diptera: Tephritidae associated to native fruit of Spondias spp. (Anacardiaceae and Ximenia americana L. (Olacaceae and their parasitoids in the State of Piaui, Brazil

    Directory of Open Access Journals (Sweden)

    Almerinda Amélia Rodrigues Araújo

    2014-09-01

    Full Text Available This work aims to identify the species of fruit flies and their parasitoids associated to native fruit of Spondias spp. (caja S. mombin L., umbu-caja Spondias sp., umbu S. tuberosa Arr. Câm. and wild plum Ximenia americana L., in the State of Piaui, Brazil. Samples (63 of fruits were collected from November 2009 to July 2010, totalizing 4,495 fruits and 46,906 kg. It was possible to obtain 10,617 puparia, from which 4,497 tephritids and 1,118 braconid parasitoids emerged. Regarding Spondias spp., the highest occurrence was Anastrepha obliqua (Macquart, with 100% for umbu and umbu-caja. Caja presented an average of 99.52% of A. obliqua, 0.46% of Anastrepha fraterculus (Wied. and 0.97% of Ceratitis capitata (Wied.. Wild plum percentages were 97.83% for A. alveata Stone and 2.17% for A. fraterculus. Infestation rates were 429.2, 178.4, 158.9 and 43.3 puparia/kg in umbu-caja, caja, wild plum and umbu, respectively. Pupal viability was 77.8%, 69.3%, 52.5% and 41.1% to umbu, wild plum, umbu-caja and caja, respectively. By analyzing the sample parasitoids, the percentage was 21.39% for the Doryctobracon areolatus (Szépligeti species and 78.61% for Opius bellus Gahan. For the first time, it was recorded in Brazil X. americana as a host to A. alveata, as well as D. aleolatus and O. bellus as parasitoids of A. obliqua and A. alveata in Piaui.

  15. Fitness cost implications of PhiC31-mediated site-specific integrations in target-site strains of the Mexican fruit fly, Anastrepha ludens (Diptera: Tephritidae).

    Science.gov (United States)

    Meza, José S; Díaz-Fleischer, Francisco; Sánchez-Velásquez, Lázaro R; Zepeda-Cisneros, Cristina Silvia; Handler, Alfred M; Schetelig, Marc F

    2014-01-01

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understanding the fitness cost implications of these manipulations for transgenic strain applications is critical. In this study independent piggyBac-mediated attP target-sites marked with DsRed were created in several genomic positions in the Mexican fruit fly, Anastrepha ludens. Two of these strains, one having an autosomal (attP_F7) and the other a Y-linked (attP_2-M6y) integration, exhibited fitness parameters (dynamic demography and sexual competitiveness) similar to wild type flies. These strains were thus selected for targeted insertion using, for the first time in mexfly, the phiC31-integrase recombination system to insert an additional EGFP-marked transgene to determine its effect on host strain fitness. Fitness tests showed that the integration event in the int_2-M6y recombinant strain had no significant effect, while the int_F7 recombinant strain exhibited significantly lower fitness relative to the original attP_F7 target-site host strain. These results indicate that while targeted transgene integrations can be achieved without an additional fitness cost, at some genomic positions insertion of additional DNA into a previously integrated transgene can have a significant negative effect. Thus, for targeted transgene insertions fitness costs must be evaluated both previous to and subsequent to new site-specific insertions in the target-site strain.

  16. The presence of the sexual partner and nutritional condition alter the Anastrepha obliqua MacQuart (Diptera: Tephritidae) protein discrimination threshold

    Energy Technology Data Exchange (ETDEWEB)

    Cresoni-Pereira, Carla; Zucoloto, Fernando S. [Universidade de Sao Paulo (USP), Ribeirao Preto, SP (Brazil). Faculdade de Filosofia, Ciencias e Letras. Dept. de Biologia

    2005-11-15

    The minimum protein amount that Anastrepha obliqua MacQuart can detect in its alimentary source is variable, though the causes of such variation are not very well known. In this study, the authors tested whether the sexual partners nutritional condition and presence devoid of direct contact alter the A. obliqua protein discrimination threshold. Male and female insects were assigned to groups as follows: (1) newly emerged, (2) deprived of protein source (yeast) during 18 days, (3) non-yeast-deprived during 18 days, (4) yeast-deprived in the presence of equally yeast-deprived sexual partners, (5) yeast-deprived in the presence of non-yeast-deprived partners, (6) non-yeast-deprived with yeast-deprived partners and (7) non-yeast-deprived with non-yeast-deprived partners. The sexual partners were maintained apart by a transparent plastic screen with small holes. Not only the males presence but also their nutritional condition have altered the females discrimination threshold, particularly when the females were deprived and when non- deprived females cohabited with deprived males. Therefore, the females threshold was determined by their own nutritional condition in addition to recognition of the males nutritional condition. The males discrimination threshold was higher for non-deprived subjects than for the deprived ones. The occurrence of responses in the absence of direct contact between males and females has shown that they may use a chemical mechanism for mutual recognition of the sexual partner nutritional condition. (author)

  17. Sexual behavior and male volatile compounds in wild and mass-reared strains of the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae) held under different colony management regimes.

    Science.gov (United States)

    Bosa, Carlos Felipe; Cruz-López, Leopoldo; Zepeda-Cisneros, Cristina Silvia; Valle-Mora, Javier; Guillén-Navarro, Karina; Liedo, Pablo

    2016-02-01

    We compared the calling and mating behavior and volatile release of wild males Anastrepha ludens (Loew) with males from 4 mass-reared strains: (i) a standard mass-reared colony (control), (ii) a genetic sexing strain (Tap-7), (iii) a colony started from males selected on their survival and mating competitiveness abilities (selected), and (iv) a hybrid colony started by crossing wild males with control females. Selected and wild males were more competitive, achieving more matings under field cage conditions. Mass-reared strains showed higher percentages of pheromone calling males under field conditions except for Tap-7 males, which showed the highest percentages of pheromone calling males under laboratory cage conditions. For mature males of all strains, field-cage calling behavior increased during the last hour before sunset, with almost a 2 fold increase exhibited by wild males during the last half hour. The highest peak mating activity of the 4 mass-reared strains occurred 30 min earlier than for wild males. By means of solid phase microextraction (SPME) plus gas chromatography-mass spectrometry (GC-MS), the composition of volatiles released by males was analyzed and quantified. Wild males emitted significantly less amounts of (E,E)-α-farnesene but emitted significantly more amounts of (E,E)-suspensolide as they aged than mass-reared males. Within the 4 mass-reared strains, Tap-7 released significantly more amounts of (E,E)-α-farnesene and hybrid more of (E,E)-suspensolide. Differences in chemical composition could be explained by the intrinsic characteristics of the strains and the colony management regimes. Characterization of calling behavior and age changes of volatile composition between wild and mass-reared strains could explain the differences in mating competitiveness and may be useful for optimizing the sterile insect technique in A. ludens. © 2014 Institute of Zoology, Chinese Academy of Sciences.

  18. Co-Infestation and Spatial Distribution of Bactrocera carambolae and Anastrepha spp. (Diptera: Tephritidae) in Common Guava in the Eastern Amazon.

    Science.gov (United States)

    Deus, E G; Godoy, W A C; Sousa, M S M; Lopes, G N; Jesus-Barros, C R; Silva, J G; Adaime, R

    2016-01-01

    Field infestation and spatial distribution of introduced Bactrocera carambolae Drew and Hancock and native species of Anastrepha in common guavas [Psidium guajava (L.)] were investigated in the eastern Amazon. Fruit sampling was carried out in the municipalities of Calçoene and Oiapoque in the state of Amapá, Brazil. The frequency distribution of larvae in fruit was fitted to the negative binomial distribution. Anastrepha striata was more abundant in both sampled areas in comparison to Anastrepha fraterculus (Wiedemann) and B. carambolae The frequency distribution analysis of adults revealed an aggregated pattern for B. carambolae as well as for A. fraterculus and Anastrepha striata Schiner, described by the negative binomial distribution. Although the populations of Anastrepha spp. may have suffered some impact due to the presence of B. carambolae, the results are still not robust enough to indicate effective reduction in the abundance of Anastrepha spp. caused by B. carambolae in a general sense. The high degree of aggregation observed for both species suggests interspecific co-occurrence with the simultaneous presence of both species in the analysed fruit. Moreover, a significant fraction of uninfested guavas also indicated absence of competitive displacement. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

  19. Efeitos das misturas de alguns alimentos na produção de óvulos em Anastrepha obliqua (Diptera, Tephritidae

    Directory of Open Access Journals (Sweden)

    Creusa Maria Message

    1989-01-01

    Full Text Available Effect of mixtures of some foods on egg production in the fruit fly Anastrepha obliqua. Several diets based on mixtures of different foods (brewer's yeast Boneg, wheat germ Boneg and gevral Lederle were tested for their effect on egg production in Anastrepha obliqua. The best results were obtained with the mixture of brewer's yeast and wheat germ.

  20. The effect of dietary restriction on longevity, fecundity, and antioxidant responses in the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae).

    Science.gov (United States)

    Chen, Er-Hu; Wei, Dong; Wei, Dan-Dan; Yuan, Guo-Rui; Wang, Jin-Jun

    2013-10-01

    Recent studies in fruit flies have imposed dietary restriction (DR) by diluting yeast and have reported increased lifespan as the yeast-to-sugar ratio decreased. In this study, the effects of DR on the lifespan of Bactrocera dorsalis were investigated using constant-feeding diets with different yeast:sugar ratios and an intermittent-feeding diet in which flies ate every sixth day. Antioxidant enzyme activities and the malondialdehyde concentration were also measured in virgin females under constant-feeding DR protocols to investigate their relationships with lifespan. The results showed that B. dorsalis lifespan was significantly extended by DR, and carbohydrate-enriched diet may be important for lifespan-extension. Female flies lived significantly longer than males at all dietary levels under both feeding regimes, indicating no interaction between diet and sex in determining lifespan. Antioxidant enzyme activities increased with the amount of yeast increased in the diets (0-4.76%) between starvation and DR treatments, indicating that the antioxidants may have influences in determining lifespan in B. dorsalis under starvation and DR treatments. However, antioxidants cannot keep up with increased oxidative damage induced by the high yeast diet (25%). These results revealed that the extension of lifespan by DR is evolutionarily conserved in B. dorsalis and that yeast:sugar ratios significantly modulate lifespan in this species. Copyright © 2013 Elsevier Ltd. All rights reserved.