Combined culture-based and culture-independent approaches provide insights into diversity of jakobids, an extremely plesiomorphic eukaryotic lineage

Directory of Open Access Journals (Sweden)

Tomáš ePánek

2015-11-01

Full Text Available We used culture-based and culture-independent approaches to discover diversity and ecology of anaerobic jakobids (Excavata: Jakobida, an overlooked, deep-branching lineage of free-living nanoflagellates related to Euglenozoa. Jakobids are among a few lineages of nanoflagellates frequently detected in anoxic habitats by PCR-based studies, however only two strains of a single jakobid species have been isolated from those habitats. We recovered 712 environmental sequences and cultured 21 new isolates of anaerobic jakobids that collectively represent at least ten different species in total, from which four are uncultured. Two cultured species have never been detected by environmental, PCR-based methods. Surprisingly, culture-based and culture-independent approaches were able to reveal a relatively high proportion of overall species diversity of anaerobic jakobids - 60 % or 80 %, respectively. Our phylogenetic analyses based on SSU rDNA and six protein-coding genes showed that anaerobic jakobids constitute a clade of morphologically similar, but genetically and ecologically diverse protists – Stygiellidae fam. nov. Our investigation combines culture-based and environmental molecular-based approaches to capture a wider extent of species diversity and shows Stygiellidae as a group that ordinarily inhabits anoxic, sulfide- and ammonium-rich marine habitats worldwide.

Molecular profiling of fungal communities in moisture damaged buildings before and after remediation - a comparison of culture-dependent and culture-independent methods

Directory of Open Access Journals (Sweden)

Auvinen Petri

2011-10-01

Full Text Available Abstract Background Indoor microbial contamination due to excess moisture is an important contributor to human illness in both residential and occupational settings. However, the census of microorganisms in the indoor environment is limited by the use of selective, culture-based detection techniques. By using clone library sequencing of full-length internal transcribed spacer region combined with quantitative polymerase chain reaction (qPCR for 69 fungal species or assay groups and cultivation, we have been able to generate a more comprehensive description of the total indoor mycoflora. Using this suite of methods, we assessed the impact of moisture damage on the fungal community composition of settled dust and building material samples (n = 8 and 16, correspondingly. Water-damaged buildings (n = 2 were examined pre- and post- remediation, and compared with undamaged reference buildings (n = 2. Results Culture-dependent and independent methods were consistent in the dominant fungal taxa in dust, but sequencing revealed a five to ten times higher diversity at the genus level than culture or qPCR. Previously unknown, verified fungal phylotypes were detected in dust, accounting for 12% of all diversity. Fungal diversity, especially within classes Dothideomycetes and Agaricomycetes tended to be higher in the water damaged buildings. Fungal phylotypes detected in building materials were present in dust samples, but their proportion of total fungi was similar for damaged and reference buildings. The quantitative correlation between clone library phylotype frequencies and qPCR counts was moderate (r = 0.59, p Conclusions We examined a small number of target buildings and found indications of elevated fungal diversity associated with water damage. Some of the fungi in dust were attributable to building growth, but more information on the material-associated communities is needed in order to understand the dynamics of microbial communities between

Microbiological study of lactic acid bacteria in kefir grains by culture-dependent and culture-independent methods.

Science.gov (United States)

Chen, Hsi-Chia; Wang, Sheng-Yao; Chen, Ming-Ju

2008-05-01

Lactic acid bacteria (LAB) in different original kefir grains were first assessed using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) by a culture-dependent way, and were further confirmed by DNA sequencing techniques. Results indicated that a combined method of cultivation with PCR-DGGE and subsequent DNA sequencing could successfully identify four LAB strains from three kefir grains from Taiwan (named Hsinchu, Mongolia and Ilan). Lactobacillus kefiri accounted, in the three kefir grains, for at least half of the isolated colonies while Lb. kefiranofaciens was the second most frequently isolated species. Leuconostoc mesenteroides was less frequently found but still in the three kefir grains conversely to Lactococcus lactis which based on culture-dependent isolation was only found in two of the kefir grains. It was interesting to find that all three kefir grains contain similar LAB species. Furthermore, the DGGE as a culture-independent method was also applied to detect the LAB strains. Results indicated that Lb. kefiranofaciens was found in all three kefir grains, whereas Lb. kefiri was only observed in Hsinchu kefir grain and Lc. lactis was found in both Mongolia and Ilan samples. Two additional strains, Pseudomonas spp. and E. coli, were also detected in kefir grains.

Culture dependent and independent analysis of bacterial communities associated with commercial salad leaf vegetables.

Science.gov (United States)

Jackson, Colin R; Randolph, Kevin C; Osborn, Shelly L; Tyler, Heather L

2013-12-01

Plants harbor a diverse bacterial community, both as epiphytes on the plant surface and as endophytes within plant tissue. While some plant-associated bacteria act as plant pathogens or promote plant growth, others may be human pathogens. The aim of the current study was to determine the bacterial community composition of organic and conventionally grown leafy salad vegetables at the point of consumption using both culture-dependent and culture-independent methods. Total culturable bacteria on salad vegetables ranged from 8.0 × 10(3) to 5.5 × 10(8) CFU g(-1). The number of culturable endophytic bacteria from surface sterilized plants was significantly lower, ranging from 2.2 × 10(3) to 5.8 × 10(5) CFU g(-1). Cultured isolates belonged to six major bacterial phyla, and included representatives of Pseudomonas, Pantoea, Chryseobacterium, and Flavobacterium. Eleven different phyla and subphyla were identified by culture-independent pyrosequencing, with Gammaproteobacteria, Betaproteobacteria, and Bacteroidetes being the most dominant lineages. Other bacterial lineages identified (e.g. Firmicutes, Alphaproteobacteria, Acidobacteria, and Actinobacteria) typically represented less than 1% of sequences obtained. At the genus level, sequences classified as Pseudomonas were identified in all samples and this was often the most prevalent genus. Ralstonia sequences made up a greater portion of the community in surface sterilized than non-surface sterilized samples, indicating that it was largely endophytic, while Acinetobacter sequences appeared to be primarily associated with the leaf surface. Analysis of molecular variance indicated there were no significant differences in bacterial community composition between organic versus conventionally grown, or surface-sterilized versus non-sterilized leaf vegetables. While culture-independent pyrosequencing identified significantly more bacterial taxa, the dominant taxa from pyrosequence data were also detected by traditional

Culture dependent and independent analysis of bacterial communities associated with commercial salad leaf vegetables

Science.gov (United States)

2013-01-01

Background Plants harbor a diverse bacterial community, both as epiphytes on the plant surface and as endophytes within plant tissue. While some plant-associated bacteria act as plant pathogens or promote plant growth, others may be human pathogens. The aim of the current study was to determine the bacterial community composition of organic and conventionally grown leafy salad vegetables at the point of consumption using both culture-dependent and culture-independent methods. Results Total culturable bacteria on salad vegetables ranged from 8.0 × 103 to 5.5 × 108 CFU g-1. The number of culturable endophytic bacteria from surface sterilized plants was significantly lower, ranging from 2.2 × 103 to 5.8 × 105 CFU g-1. Cultured isolates belonged to six major bacterial phyla, and included representatives of Pseudomonas, Pantoea, Chryseobacterium, and Flavobacterium. Eleven different phyla and subphyla were identified by culture-independent pyrosequencing, with Gammaproteobacteria, Betaproteobacteria, and Bacteroidetes being the most dominant lineages. Other bacterial lineages identified (e.g. Firmicutes, Alphaproteobacteria, Acidobacteria, and Actinobacteria) typically represented less than 1% of sequences obtained. At the genus level, sequences classified as Pseudomonas were identified in all samples and this was often the most prevalent genus. Ralstonia sequences made up a greater portion of the community in surface sterilized than non-surface sterilized samples, indicating that it was largely endophytic, while Acinetobacter sequences appeared to be primarily associated with the leaf surface. Analysis of molecular variance indicated there were no significant differences in bacterial community composition between organic versus conventionally grown, or surface-sterilized versus non-sterilized leaf vegetables. While culture-independent pyrosequencing identified significantly more bacterial taxa, the dominant taxa from pyrosequence data were also detected by

The independent molecular interaction sites model. Pt. 1

International Nuclear Information System (INIS)

Naumann, K.H.; Lippert, E.

1981-01-01

A new reference system for the treatment of molecular fluids within the framework of thermodynamic perturbation theory is presented. The basic ingredient of our approach is a potential transformation which allows us to view molecular liquids and gases as mixtures of formally independent molecular interaction sites (IMIS model). Some relations between out method and the RAM theory are discussed. (orig.)

Culture-independent molecular approaches reveal a mostly unknown high diversity of active nitrogen-fixing bacteria associated with Pennisetum purpureum—a bioenergy crop

NARCIS (Netherlands)

Videira, Sandy Sampaio; de Cássia Pereira e Silva, Michele; Galisa, Pericles de Souza; Franco Dias, Armando Cavalcante; Nissinen, Riitta; Baldani Divan, Vera Lucia; van Elsas, Jan Dirk; Baldani, Jose Ivo; Salles, Joana Falcao

2013-01-01

Previous studies have shown that elephant grass is colonized by nitrogen-fixing bacterial species; however, these results were based on culture-dependent methods, an approach that introduces bias due to an incomplete assessment of the microbial community. In this study, we used culture-independent

Detection and identification of microbes in prosthetic joint infections by culture and molecular methods

DEFF Research Database (Denmark)

Xu, Yijuan; Schønheyder, Henrik Carl; Ehrlich, Garth

, indicating biofilm formation. In conclusion, this study indicated that to improve the microbiological diagnosis of prosthetic joint infections molecular methods may be useful supplements to routine cultures, and the current intraoperative sampling strategy needs to be optimized.......Bacterial biofilms have been observed in many device-related infections including orthopedic implants. This mode of growth makes the infection difficult to treat and constitutes a challenge to current sampling procedures and culture practices to obtain a reliable diagnosis. The aim of the study...... uncovered many more species including known pathogens and species not previously reported in orthopedic infections, and polymicrobial communities were commonly observed. Additionally the molecular findings suggested the bacterial composition and yield varied depending on the position and type of samples...

Comparing culture and molecular methods for the identification of microorganisms involved in necrotizing soft tissue infections

DEFF Research Database (Denmark)

Rudkjøbing, Vibeke Børsholt; Thomsen, Trine Rolighed; Xu, Yijuan

2016-01-01

BACKGROUND: Necrotizing soft tissue infections (NSTIs) are a group of infections affecting all soft tissues. NSTI involves necrosis of the afflicted tissue and is potentially life threatening due to major and rapid destruction of tissue, which often leads to septic shock and organ failure. The gold...... to culture. Although the molecular methods generally gave concordant results, our results indicate that Microseq may misidentify or overlook microorganisms that can be detected by other molecular methods. Half of the patients were found to be infected with S. pyogenes, but several atypical findings were also...... that clinicians should be prepared to diagnose and treat any combination of microbial pathogens. Some of the tested molecular methods offer a faster turnaround time combined with a high specificity, which makes supplemental use of such methods attractive for identification of microorganisms, especially...

An in vitro, short-term culture method for mammalian haploid round spermatids amenable for molecular manipulation.

Science.gov (United States)

Dehnugara, Tushna; Dhar, Surbhi; Rao, M R Satyanarayana

2012-01-01

Extensive chromatin remodeling is a characteristic feature of mammalian spermiogenesis. To date, methods for the molecular manipulation of haploid spermatids are not available as there is a lack of a well-established culture system. Biochemical experiments and knockout studies reveal only the final outcome; studying the incremental details of the intricate mechanisms involved is still a challenge. We have established an in vitro culture system for pure haploid round spermatids isolated from rat testes that can be maintained with good viability for up to 72 hr. Changes in cell morphology and flagellar growth were also studied in the cultured spermatids. Further, we have demonstrated that upon treatment of cells with specific histone deacetylase inhibitors, sodium butyrate and trichostatin A, there is an increase in the hyperacetylation status of histone H4, mimicking an important event characteristic of histone replacement process that occurs during later stages of spermiogenesis. We have also tried various methods for introducing DNA and protein into these round spermatids in culture, and report that while DNA transfection is still a challenging task, protein transfection could be achieved using Chariot™ peptide as a transfection reagent. Thus, the method described here sets a stage to study the molecular roles of spermatid-specific proteins and chromatin remodelers in the cellular context. Copyright © 2011 Wiley Periodicals, Inc.

Culture-Dependent and -Independent Methods Capture Different Microbial Community Fractions in Hydrocarbon-Contaminated Soils

OpenAIRE

Stefani, Franck O. P.; Bell, Terrence H.; Marchand, Charlotte; de la Providencia, Ivan E.; El Yassimi, Abdel; St-Arnaud, Marc; Hijri, Mohamed

2015-01-01

Bioremediation is a cost-effective and sustainable approach for treating polluted soils, but our ability to improve on current bioremediation strategies depends on our ability to isolate microorganisms from these soils. Although culturing is widely used in bioremediation research and applications, it is unknown whether the composition of cultured isolates closely mirrors the indigenous microbial community from contaminated soils. To assess this, we paired culture-independent (454-pyrosequenci...

Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

Directory of Open Access Journals (Sweden)

Jun Mei

Full Text Available The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR-denaturing gradient gel electrophoresis (DGGE analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates. Meanwhile, Kazachstania servazzii (51 isolates represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates. However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

Microbial Diversity of a Camembert-Type Cheese Using Freeze-Dried Tibetan Kefir Coculture as Starter Culture by Culture-Dependent and Culture-Independent Methods

Science.gov (United States)

Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

2014-01-01

The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese. PMID:25360757

Microbial diversity of a Camembert-type cheese using freeze-dried Tibetan kefir coculture as starter culture by culture-dependent and culture-independent methods.

Science.gov (United States)

Mei, Jun; Guo, Qizhen; Wu, Yan; Li, Yunfei

2014-01-01

The biochemical changes occurring during cheese ripening are directly and indirectly dependent on the microbial associations of starter cultures. Freeze-dried Tibetan kefir coculture was used as a starter culture in the Camembert-type cheese production for the first time. Therefore, it's necessary to elucidate the stability, organization and identification of the dominant microbiota presented in the cheese. Bacteria and yeasts were subjected to culture-dependent on selective media and culture-independent polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE) analysis and sequencing of dominant bands to assess the microbial structure and dynamics through ripening. In further studies, kefir grains were observed using scanning electron microscopy (SEM) methods. A total of 147 bacteria and 129 yeasts were obtained from the cheese during ripening. Lactobacillus paracasei represents the most commonly identified lactic acid bacteria isolates, with 59 of a total of 147 isolates, followed by Lactococcus lactis (29 isolates). Meanwhile, Kazachstania servazzii (51 isolates) represented the mainly identified yeast isolate, followed by Saccharomyces cerevisiae (40 isolates). However, some lactic acid bacteria detected by sequence analysis of DGGE bands were not recovered by plating. The yeast S. cerevisiae and K. servazzii are described for the first time with kefir starter culture. SEM showed that the microbiota were dominated by a variety of lactobacilli (long and curved) cells growing in close association with a few yeasts in the inner portion of the grain and the short lactobacilli were observed along with yeast cells on the exterior portion. Results indicated that conventional culture method and PCR-DGGE should be combined to describe in maximal detail the microbiological composition in the cheese during ripening. The data could help in the selection of appropriate commercial starters for Camembert-type cheese.

Has the use of molecular methods for the characterization of the human oral microbiome changed our understanding of the role of bacteria in the pathogenesis of periodontal disease?

Science.gov (United States)

Wade, William Geoffrey

2011-03-01

Only around half of oral bacteria can be grown in the laboratory using conventional culture methods. Molecular methods based on 16S rRNA gene sequence are now available and are being used to characterize the periodontal microbiota in its entirety. This review describes the cultural characterization of the oral and periodontal microbiotas and explores the influence of the additional data now available from culture-independent molecular analyses on current thinking on the role of bacteria in periodontitis. Culture-independent molecular analysis of the periodontal microbiota has shown it to be far more diverse than previously thought. A number of species including some that have yet to be cultured are as strongly associated with disease as those organisms traditionally regarded as periodontal pathogens. Sequencing of bacterial genomes has revealed a high degree of intra-specific genetic diversity. The use of molecular methods for the characterization of the periodontal microbiome has greatly expanded the range of bacterial species known to colonize this habitat. Understanding the interactions between the human host and its commensal bacterial community at the functional level is a priority. © 2011 John Wiley & Sons A/S.

Culture-independent diagnostic testing: have we opened Pandora's box for good?

Science.gov (United States)

Janda, J Michael; Abbott, Sharon A

2014-11-01

The ability to accurately and quickly identify microbial agents associated with infectious diseases has been a longstanding and continuous goal of diagnostic microbiology laboratories. Over the course of several decades, technology and testing methodologies in this field have gradually evolved from traditional- or classic-based culture and identification approaches to antigen capture systems and more molecular-oriented applications. Recently, these molecular-based applications have signaled a new era in clinical diagnostic microbiology with the commercial introduction of culture-independent diagnostic testing (CIDT) systems. The first major commercial venture into the CIDT arena involves the detection of acute bacterial gastroenteritis. Several commercial products are now on the market globally with at least 4 Food and Drug Administration approved since January of 2013. These new systems offer the direct detection of a variety of enteropathogens quickly without the need for traditional culture. In Greek mythology, Pandora opened a "jar" or "box" out of curiosity thereby releasing all of humanity's evils most notably diseases and plagues according to Hesiod's Theogony. While not ill-intentioned the only thing left in the box was Hope. Copyright © 2014 Elsevier Inc. All rights reserved.

Culture-independent discovery of natural products from soil metagenomes.

Science.gov (United States)

Katz, Micah; Hover, Bradley M; Brady, Sean F

2016-03-01

Bacterial natural products have proven to be invaluable starting points in the development of many currently used therapeutic agents. Unfortunately, traditional culture-based methods for natural product discovery have been deemphasized by pharmaceutical companies due in large part to high rediscovery rates. Culture-independent, or "metagenomic," methods, which rely on the heterologous expression of DNA extracted directly from environmental samples (eDNA), have the potential to provide access to metabolites encoded by a large fraction of the earth's microbial biosynthetic diversity. As soil is both ubiquitous and rich in bacterial diversity, it is an appealing starting point for culture-independent natural product discovery efforts. This review provides an overview of the history of soil metagenome-driven natural product discovery studies and elaborates on the recent development of new tools for sequence-based, high-throughput profiling of environmental samples used in discovering novel natural product biosynthetic gene clusters. We conclude with several examples of these new tools being employed to facilitate the recovery of novel secondary metabolite encoding gene clusters from soil metagenomes and the subsequent heterologous expression of these clusters to produce bioactive small molecules.

Cultural Relativism: Occupation and Independence Reconsidered.

Science.gov (United States)

Whiteford, Gail Elizabeth; Wilcock, Ann Allart

2000-01-01

A study focused on the experiences of 22 occupational therapy students working with people from different social and cultural backgrounds in New Zealand over a 3-year period. Results highlight issues about how occupation and independence are conceptualized across cultures. (Contains 102 references.) (JOW)

Bacterial population in traditional sourdough evaluated by molecular methods.

Science.gov (United States)

Randazzo, C L; Heilig, H; Restuccia, C; Giudici, P; Caggia, C

2005-01-01

To study the microbial communities in artisanal sourdoughs, manufactured by traditional procedure in different areas of Sicily, and to evaluate the lactic acid bacteria (LAB) population by classical and culture-independent approaches. Forty-five LAB isolates were identified both by phenotypic and molecular methods. The restriction fragment length polymorphism and 16S ribosomal DNA gene sequencing gave evidence of a variety of species with the dominance of Lactobacillus sanfranciscensis and Lactobacillus pentosus, in all sourdoughs tested. Culture-independent method, such as denaturing gradient gel electrophoresis (DGGE) of the V6-V8 regions of the 16S rDNA, was applied for microbial community fingerprint. The DGGE profiles revealed the dominance of L. sanfranciscensis species. In addition, Lactobacillus-specific primers were used to amplify the V1-V3 regions of the 16S rDNA. DGGE profiles flourished the dominance of L. sanfranciscensis and Lactobacillus fermentum in the traditional sourdoughs, and revealed that the closely related species Lactobacillus kimchii and Lactobacillus alimentarius were not discriminated. Lactobacillus-specific PCR-DGGE analysis is a rapid tool for rapid detection of Lactobacillus species in artisanal sourdough. This study reports a characterization of Lactobacillus isolates from artisanal sourdoughs and highlights the value of DGGE approach to detect uncultivable Lactobacillus species.

Variation of the Pseudomonas community structure on oak leaf lettuce during storage detected by culture-dependent and -independent methods.

Science.gov (United States)

Nübling, Simone; Schmidt, Herbert; Weiss, Agnes

2016-01-04

The genus Pseudomonas plays an important role in the lettuce leaf microbiota and certain species can induce spoilage. The aim of this study was to investigate the occurrence and diversity of Pseudomonas spp. on oak leaf lettuce and to follow their community shift during a six day cold storage with culture-dependent and culture-independent methods. In total, 21 analysed partial Pseudomonas 16S rRNA gene sequences matched closely (> 98.3%) to the different reference strain sequences, which were distributed among 13 different phylogenetic groups or subgroups within the genus Pseudomonas. It could be shown that all detected Pseudomonas species belonged to the P. fluorescens lineage. In the culture-dependent analysis, 73% of the isolates at day 0 and 79% of the isolates at day 6 belonged to the P. fluorescens subgroup. The second most frequent group, with 12% of the isolates, was the P. koreensis subgroup. This subgroup was only detected at day 0. In the culture-independent analysis the P. fluorescens subgroup and P. extremaustralis could not be differentiated by RFLP. Both groups were most abundant and amounted to approximately 46% at day 0 and 79% at day 6. The phytopathogenic species P. salmonii, P. viridiflava and P. marginalis increased during storage. Both approaches identified the P. fluorescens group as the main phylogenetic group. The results of the present study suggest that pseudomonads found by plating methods indeed represent the most abundant part of the Pseudomonas community on oak leaf lettuce. Copyright © 2015 Elsevier B.V. All rights reserved.

Culture independent PCR: an alternative enzyme discovery strategy

DEFF Research Database (Denmark)

Jacobsen, Jonas; Lydolph, Magnus; Lange, Lene

2005-01-01

Degenerate primers were designed for use in a culture-independent PCR screening of DNA from composite fungal communities, inhabiting residues of corn stovers and leaves. According to similarity searches and alignments amplified clone sequences affiliated with glycosyl hydrolase family 7 and glyco...... the value of culture-independent PCR in microbial diversity studies and could add to development of a new enzyme screening technology....

Culture-dependent and -independent investigations of microbial diversity on urinary catheters

DEFF Research Database (Denmark)

Xu, Yijuan; Moser, Claus Ernst; Abu Al-Soud, Waleed

2012-01-01

Catheter-associated urinary tract infection is caused by bacteria, which ascend the catheter along its external or internal surface to the bladder and subsequently develop into biofilms on the catheter and uroepithelium. Antibiotic-treated bacteria and bacteria residing in biofilm can be difficult...... to culture. In this study we used culture-based and 16S rRNA gene-based culture-independent methods (fingerprinting, cloning, and pyrosequencing) to determine the microbial diversity of biofilms on 24 urinary catheters. Most of the patients were catheterized for...

Microbiological characterization of traditional dough fermentation starter (Jiaozi) for steamed bread making by culture-dependent and culture-independent methods.

Science.gov (United States)

Li, Zhijian; Li, Haifeng; Bian, Ke

2016-10-03

In this study, the microbial composition of two types of Jiaozi (a dough fermentation starter in making steamed bread) was investigated using both culture-dependent and culture-independent (PCR-DGGE) methods. The numbers of the cultivable bacteria on MRS at 30°C and yeast on YPD at 28°C in the maize flour Jiaozi (MFJ) were 9.21±0.16 Log CFU/g and 9.18±0.05 Log CFU/g, respectively, which were higher than that in the rice flour Jiaozi (RFJ) (Pyeasts were isolated and identified on the basis of the sequences of their 16S rRNA gene and ITS region. The culture-dependent method showed that Acetobacter tropicalis and Enterococcus durans were the predominant bacteria strains in MFJ, and accounted for 45.7% and 25.7% of the bacteria, and Lactobacillus plantarum and Pediococcus pentosaceus represented 12.8% and 8.6%. In the RFJ sample, the most prominent isolate was P. pentosaceus (38.6%), followed by L. plantarum (24.3%), A. tropicalis (22.8%), and E. durans (5.7%). P. pentosaceus and L. plantarum were also detected in both starters by PCR-DGGE, while some bacteria species such as A. tropicalis and E. durans, recovered as pure cultures, were not detected by direct PCR-DGGE. On the other hand, Lactobacillus brevis, Weissella sp. and Lactobacillus alimentarius detected by PCR-DGGE were not recovered in any of the media and conditions used. In the MFJ sample, the isolated main yeast species were identified as Wickerhamomyces anomalus (67.2%), Saccharomyces cerevisiae (27.9%) and Torulaspora delbrueckii (4.9%). In addition to S. cerevisiae (42.9%), W. anomalus (27.0%) and T. delbrueckii (7.9%), Saccharomycopsis fibuligera was also identified as the predominant isolate in RFJ samples and accounted for 22.2%. PCR-DGGE also indicated the presence of W. anomalus and S. cerevisiae in both MFJ and RFJ starters and S. fibuligera was also detected in RFJ, but T. delbrueckii was not detected in both samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Independence and Interdependence in Diverse Cultural Contexts.

Science.gov (United States)

Killen, Melanie; Wainryb, Cecilia

2000-01-01

Argues that the individualistic-collectivistic dichotomy results in mislabeling both cultures and individuals. Discusses ways in which individualistic concerns with independence and collectivistic concerns with interdependence coexist in Western and non-Western cultures. Outlines a theoretical framework explaining the coexistence of diverse social…

OSART Independent Safety Culture Assessment (ISCA) Guidelines

International Nuclear Information System (INIS)

2016-01-01

Safety culture is understood as an important part of nuclear safety performance. This has been demonstrated by the analysis of significant events such as Chernobyl, Davis Besse, Vandellos II, Asco, Paks, Mihamma and Forsmark, among others. In order to enhance safety culture, one essential activity is to perform assessments. IAEA Safety Standard Series No. GS-R-3, The Management System for Facilitites and Activities, states requirements for continuous improvement of safety culture, of which self, peer and independent safety culture assessments constitute an essential part. In line with this requirement, the Independent Safety Culture Assessment (ISCA) module is offered as an add-on module to the IAEA Operational Safety Review Team (OSART) programme. The OSART programme provides advice and assistance to Member States to enhance the safety of nuclear power plants during commissioning and operation. By including the ISCA module in an OSART mission, the receiving organization benefits from the synergy between the technical and the safety culture aspects of the safety review. The joint operational safety and safety culture assessment provides the organization with the opportunity to better understand the interactions between technical, human, organizational and cultural aspects, helping the organization to take a systemic approach to safety through identifying actions that fully address the root causes of any identified issue. Safety culture assessments provide insight into the fundamental drivers that shape organizational patterns of behaviour, safety consciousness and safety performance. The complex nature of safety culture means that the analysis of the results of such assessments is not as straightforward as for other types of assessment. The benefits of the results of nuclear safety culture assessments are maximized only if appropriate tools and guidance for these assessments is used; hence, this comprehensive guideline has been developed. The methodology explained

Methods for plant molecular biology

National Research Council Canada - National Science Library

Weissbach, Arthur; Weissbach, Herbert

1988-01-01

.... Current techniques to carry out plant cell culture and protoplast formation are described as are methods for gene and organelle transfer. The detection of DNA and RNA viruses by molecular probes or ELISA assays and the cloning and transcription of viral RNA complete the volume.

Independent Learning Crossing Cultures: Learning Cultures and Shifting Meanings

Science.gov (United States)

Spiro, Jane; Henderson, Juliet; Clifford, Valerie

2012-01-01

This paper contrasts the notion of "independent learning" as perceived by two informant groups at a UK institution of higher education: (1) teachers, educators and providers of education and (2) their students or "consumers" of education. Both informant groups are staff and students studying in a culture different to that of…

The comparison of pyrosequencing molecular Gram stain, culture, and conventional Gram stain for diagnosing orthopaedic infections.

Science.gov (United States)

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W

2006-08-01

We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.

Analyses of Dynamics in Dairy Products and Identification of Lactic Acid Bacteria Population by Molecular Methods

Directory of Open Access Journals (Sweden)

Aytül Sofu

2017-01-01

Full Text Available Lactic acid bacteria (LAB with different ecological niches are widely seen in fermented meat, vegetables, dairy products and cereals as well as in fermented beverages. Lactic acid bacteria are the most important group of bacteria in dairy industry due to their probiotic characteristics and fermentation agents as starter culture. In the taxonomy of the lactic acid bacteria; by means of rep-PCR, which is the analysis of repetitive sequences that are based on 16S ribosomal RNA (rRNA gene sequence, it is possible to conduct structural microbial community analyses such as Restriction Fragment Length Polymorphism (RFLP analysis of DNA fragments of different sizes cut with enzymes, Random Amplified Polymorphic DNA (RAPD polymorphic DNA amplified randomly at low temperatures and Amplified Fragment-Length Polymorphism (AFLP-PCR of cut genomic DNA. Besides, in the recent years, non-culture-based molecular methods such as Pulse Field Gel Electrophoresis (PFGE, Denaturing Gradient Gel Electrophoresis (DGGE, Thermal Gradient Gel Electrophoresis (TGGE, and Fluorescence In-situ Hybridization (FISH have replaced classical methods once used for the identification of LAB. Identification of lactic acid bacteria culture independent regardless of the method will be one of the most important methods used in the future pyrosequencing as a Next Generation Sequencing (NGS techniques. This paper reviews molecular-method based studies conducted on the identification of LAB species in dairy products.

Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

Science.gov (United States)

Panosyan, Hovik; Birkeland, Nils-Kåre

2014-11-01

The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Method to Increase Undergraduate Laboratory Student Confidence in Performing Independent Research

Directory of Open Access Journals (Sweden)

Colton E. Kempton

2017-05-01

Full Text Available The goal of an undergraduate laboratory course should be not only to introduce the students to biology methodologies and techniques, but also to teach them independent analytical thinking skills and proper experiment design.  This is especially true for advanced biology laboratory courses that undergraduate students typically take as a junior or senior in college.  Many courses achieve the goal of teaching techniques, but fail to approach the larger goal of teaching critical thinking, experimental design, and student independence.  Here we describe a study examining the application of the scaffolding instructional philosophy in which students are taught molecular techniques with decreasing guidance to force the development of analytical thinking skills and prepare undergraduate students for independent laboratory research. This method was applied to our advanced molecular biology laboratory class and resulted in an increase of confidence among the undergraduate students in their abilities to perform independent research.

Interactions between contemporary American independent cinema and popular music culture

OpenAIRE

Nicholls, Matthew

2011-01-01

In recent years, many American independent films have become increasingly engaged with popular music culture and have used various forms of pop music in their soundtracks to various effects. Disparate films from a variety of genres use different forms of popular music in different ways, however these negotiations with pop music and its cultural surroundings have one true implication: that the 'independentness' (or 'indieness') of these movies is informed, anchored and embellished by their rel...

Morphological, cultural, pathogenic and molecular variability ...

African Journals Online (AJOL)

Alternaria blight (Alternaria brassicae) causes severe foliar damage to Indian mustard in Uttarakhand. Ten (10) isolates of A. brassicae were collected from different hosts and characterized for cultural, morphological, pathogenic and molecular variations. A. brassicae colonies varied in their cultural behaviour ranging from ...

DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan.

Science.gov (United States)

Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro

2016-10-11

Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.

Cultural, morphological, pathogenic and molecular characterization ...

African Journals Online (AJOL)

Alternaria blotch (Alternaria mali) causes severe foliar damage to apple trees in Kashmir. Twenty one (21) isolates of A. mali were collected from different locations and characterized for cultural, morphological, pathogenic and molecular variations. A. mali colonies varied in their cultural behaviour ranging from velvety to ...

Identification and characterization of lactic acid bacteria and yeasts of PDO Tuscan bread sourdough by culture dependent and independent methods.

Science.gov (United States)

Palla, Michela; Cristani, Caterina; Giovannetti, Manuela; Agnolucci, Monica

2017-06-05

Sourdough fermentation has been increasingly used worldwide, in accordance with the demand of consumers for tasty, natural and healthy food. The high diversity of lactic acid bacteria (LAB) and yeast species, detected in sourdoughs all over the world, may affect nutritional, organoleptic and technological traits of leavened baked goods. A wide regional variety of traditional sourdough breads, over 200 types, has been recorded in Italy, including special types selected as worthy of either Protected Geographical Indication (PGI) or Protected Designation of Origin (PDO), whose sourdough microbiota has been functionally and molecularly characterized. As, due to the very recent designation, the microbiota of Tuscan bread sourdough has not been investigated so far, the aim of the present work was to isolate and characterize the species composition of LAB and yeasts of PDO Tuscan bread sourdough by culture-independent and dependent methods. A total of 130 yeasts from WLN medium and 193 LAB from both mMRS and SDB media were isolated and maintained to constitute the germplasm bank of PDO Tuscan bread. Ninety six LAB from mMRS medium and 68 yeasts from WLN medium were randomly selected and molecularly identified by ARDRA (Amplified Ribosomal DNA Restriction Analysis) and PCR-RFLP analysis of the ITS region, respectively, and sequencing. The yeast identity was confirmed by 26S D1/D2 sequencing. All bacterial isolates showed 99% identity with Lactobacillus sanfranciscensis, 65 yeast isolates were identified as Candida milleri, and 3 as Saccharomyces cerevisiae. Molecular characterization of PDO Tuscan bread sourdough by PCR-DGGE confirmed such data. The distinctive tripartite species association, detected as the microbiota characterizing the sourdough used to produce PDO Tuscan bread, encompassed a large number of L. sanfranciscensis and C. milleri strains, along with a few of S. cerevisiae. The relative composition and specific physiological characteristics of such microbiota

INDICATORS AND DIAGNOSTICS OF INDEPENDENT WORK CULTURE FORMATION IN FUTURE MATHEMATICS TEACHERS

Directory of Open Access Journals (Sweden)

Олена Соя

2015-09-01

Full Text Available The article highlights the results of research of formation the culture of independent work of future mathematics teachers, indicating the effectiveness of selected theoretically grounded and practically implemented pedagogical conditions of its formation. Its semantic components that are interconnected and interdependent unity of cognitive, procedural, technological and motivational components were singled out on the basis of definition of independent work culture of future mathematics teachers. The system of indicators, which assessed the degree of mastering by students the culture of independent work by value-orientation, content-effective, reflective, constructive and operationally-activity criteria is reviewed.

Molecular detection methods of resistance to antituberculosis drugs in Mycobacterium tuberculosis.

Science.gov (United States)

Brossier, F; Sougakoff, W

2017-09-01

Molecular methods predict drug resistance several weeks before phenotypic methods and enable rapid implementation of appropriate therapeutic treatment. We aimed to detail the most representative molecular tools used in routine practice for the rapid detection of resistance to antituberculosis drugs among Mycobacterium tuberculosis strains. The molecular diagnosis of resistance to antituberculosis drugs in clinical samples or from in vitro cultures is based on the detection of the most common mutations in the genes involved in the development of resistance in M. tuberculosis strains (encoding either protein targets of antibiotics, or antibiotic activating enzymes) by commercial molecular kits or by sequencing. Three hypotheses could explain the discrepancies between the genotypic results and the phenotypic drug susceptibility testing results: a low percentage of resistant mutants precluding the detection by genotypic methods on the primary culture; a low level of resistance not detected by phenotypic testing; and other resistance mechanisms not yet characterized. Molecular methods have varying sensitivity with regards to detecting antituberculosis drug resistance; that is why phenotypic susceptibility testing methods are mandatory for detecting antituberculosis drug-resistant isolates that have not been detected by molecular methods. The questionable ability of existing phenotypic and genotypic drug susceptibility testing to properly classify strains as susceptible or resistant, and at what level of resistance, was raised for several antituberculosis agents. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Analysis of culture-dependent versus culture-independent techniques for identification of bacteria in clinically obtained bronchoalveolar lavage fluid.

Science.gov (United States)

Dickson, Robert P; Erb-Downward, John R; Prescott, Hallie C; Martinez, Fernando J; Curtis, Jeffrey L; Lama, Vibha N; Huffnagle, Gary B

2014-10-01

The diagnosis and management of pneumonia are limited by the use of culture-based techniques of microbial identification, which may fail to identify unculturable, fastidious, and metabolically active viable but unculturable bacteria. Novel high-throughput culture-independent techniques hold promise but have not been systematically compared to conventional culture. We analyzed 46 clinically obtained bronchoalveolar lavage (BAL) fluid specimens from symptomatic and asymptomatic lung transplant recipients both by culture (using a clinical microbiology laboratory protocol) and by bacterial 16S rRNA gene pyrosequencing. Bacteria were identified in 44 of 46 (95.7%) BAL fluid specimens by culture-independent sequencing, significantly more than the number of specimens in which bacteria were detected (37 of 46, 80.4%, P ≤ 0.05) or "pathogen" species reported (18 of 46, 39.1%, P ≤ 0.0001) via culture. Identification of bacteria by culture was positively associated with culture-independent indices of infection (total bacterial DNA burden and low bacterial community diversity) (P ≤ 0.01). In BAL fluid specimens with no culture growth, the amount of bacterial DNA was greater than that in reagent and rinse controls, and communities were markedly dominated by select Gammaproteobacteria, notably Escherichia species and Pseudomonas fluorescens. Culture growth above the threshold of 10(4) CFU/ml was correlated with increased bacterial DNA burden (P Microbiology. All Rights Reserved.

Distribution-independent hierarchicald N-body methods

International Nuclear Information System (INIS)

Aluru, S.

1994-01-01

The N-body problem is to simulate the motion of N particles under the influence of mutual force fields based on an inverse square law. The problem has applications in several domains including astrophysics, molecular dynamics, fluid dynamics, radiosity methods in computer graphics and numerical complex analysis. Research efforts have focused on reducing the O(N 2 ) time per iteration required by the naive algorithm of computing each pairwise interaction. Widely respected among these are the Barnes-Hut and Greengard methods. Greengard claims his algorithm reduces the complexity to O(N) time per iteration. Throughout this thesis, we concentrate on rigorous, distribution-independent, worst-case analysis of the N-body methods. We show that Greengard's algorithm is not O(N), as claimed. Both Barnes-Hut and Greengard's methods depend on the same data structure, which we show is distribution-dependent. For the distribution that results in the smallest running time, we show that Greengard's algorithm is Ω(N log 2 N) in two dimensions and Ω(N log 4 N) in three dimensions. We have designed a hierarchical data structure whose size depends entirely upon the number of particles and is independent of the distribution of the particles. We show that both Greengard's and Barnes-Hut algorithms can be used in conjunction with this data structure to reduce their complexity. Apart from reducing the complexity of the Barnes-Hut algorithm, the data structure also permits more accurate error estimation. We present two- and three-dimensional algorithms for creating the data structure. The multipole method designed using this data structure has a complexity of O(N log N) in two dimensions and O(N log 2 N) in three dimensions

Application of molecular techniques for the assessment of microorganism diversity on cultural heritage objects.

Science.gov (United States)

Otlewska, Anna; Adamiak, Justyna; Gutarowska, Beata

2014-01-01

As a result of their unpredictable ability to adapt to varying environmental conditions, microorganisms inhabit different types of biological niches on Earth. Owing to the key role of microorganisms in many biogeochemical processes, trends in modern microbiology emphasize the need to know and understand the structure and function of complex microbial communities. This is particularly important if the strategy relates to microbial communities that cause biodeterioration of materials that constitute our cultural heritage. Until recently, the detection and identification of microorganisms inhabiting objects of cultural value was based only on cultivation-dependent methods. In spite of many advantages, these methods provide limited information because they identify only viable organisms capable of growth under standard laboratory conditions. However, in order to carry out proper conservation and renovation, it is necessary to know the complete composition of microbial communities and their activity. This paper presents and characterizes modern techniques such as genetic fingerprinting and clone library construction for the assessment of microbial diversity based on molecular biology. Molecular methods represent a favourable alternative to culture-dependent methods and make it possible to assess the biodiversity of microorganisms inhabiting technical materials and cultural heritage objects.

Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

Science.gov (United States)

Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

2006-05-25

We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

Culture-independent quantification of Salmonella enterica in carcass gauze swabs by flotation prior to real-time PCR

DEFF Research Database (Denmark)

Löfström, Charlotta; Schelin, Jenny; Norling, Börje

2011-01-01

To facilitate quantitative risk assessment in the meat production chain, there is a need for culture-independent quantification methods. The aim of this study was to evaluate the use of flotation, a non-destructive sample preparation method based on traditional buoyant density centrifugation...

Molecular diagnostic methods for invasive fungal disease: the horizon draws nearer?

Science.gov (United States)

Halliday, C L; Kidd, S E; Sorrell, T C; Chen, S C-A

2015-04-01

Rapid, accurate diagnostic laboratory tests are needed to improve clinical outcomes of invasive fungal disease (IFD). Traditional direct microscopy, culture and histological techniques constitute the 'gold standard' against which newer tests are judged. Molecular diagnostic methods, whether broad-range or fungal-specific, have great potential to enhance sensitivity and speed of IFD diagnosis, but have varying specificities. The use of PCR-based assays, DNA sequencing, and other molecular methods including those incorporating proteomic approaches such as matrix-assisted laser desorption ionisation-time of flight mass spectroscopy (MALDI-TOF MS) have shown promising results. These are used mainly to complement conventional methods since they require standardisation before widespread implementation can be recommended. None are incorporated into diagnostic criteria for defining IFD. Commercial assays may assist standardisation. This review provides an update of molecular-based diagnostic approaches applicable to biological specimens and fungal cultures in microbiology laboratories. We focus on the most common pathogens, Candida and Aspergillus, and the mucormycetes. The position of molecular-based approaches in the detection of azole and echinocandin antifungal resistance is also discussed.

Detection of Candida spp. in the vagina of a cohort of nulliparous pregnant women by culture and molecular methods: Is there an association between maternal vaginal and infant oral colonisation?

Science.gov (United States)

Payne, Matthew S; Cullinane, Meabh; Garland, Suzanne M; Tabrizi, Sepehr N; Donath, Susan M; Bennett, Catherine M; Amir, Lisa H

2016-04-01

Most studies describing vaginal Candida spp. in pregnancy focus on symptomatic vaginitis, rather than asymptomatic colonisation, and solely utilise microbiological culture. The extent to which asymptomatic vaginal carriage may represent a reservoir for infant oral colonisation has been highly debated. This study formed part of the Candida and Staphylococcus Transmission Longitudinal Evaluation (CASTLE) study, in Melbourne, Australia, from 2009 to 2011 and used culture and molecular methods to examine vaginal swabs collected late in the third trimester of pregnancy for Candida spp. Oral swabs from infants were also examined using culture methods. Overall, 80 of 356 (22%) women were positive for Candida spp; the majority being Candida albicans (83%). Candida glabrata and other Candida spp. were also identified, but in much lower numbers. Molecular analysis identified numerous positive samples not detected by culture, including 13 cases of C. albicans. In addition, some positive samples only recorded to genus level by culture were accurately identified as either C. albicans or C. glabrata following molecular analyses. Eighteen infants recorded positive Candida spp. cultures, predominantly C. albicans. However, there were only four (25%) mother/infant dyads where C. albicans was detected. This study provides valuable data on asymptomatic colonisation rates of Candida spp. within an asymptomatic population of women late in pregnancy. The utilisation of molecular methods improved the rate of detection and provided a more accurate means for identification of non-albicans Candida spp. The low mother/infant colonisation rate suggests that non-maternal sources are likely involved in determining infant oral colonisation status. © 2015 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

Cultural orientations, parental beliefs and practices, and latino adolescents' autonomy and independence.

Science.gov (United States)

Roche, Kathleen M; Caughy, Margaret O; Schuster, Mark A; Bogart, Laura M; Dittus, Patricia J; Franzini, Luisa

2014-08-01

Despite the salience of behavioral autonomy and independence to parent-child interactions during middle adolescence, little is known about parenting processes pertinent to youth autonomy development for Latino families. Among a diverse sample of 684 Latino-origin parent-adolescent dyads in Houston, Texas, this study examines how parents' cultural orientations are associated directly and indirectly, through parental beliefs, with parenting practices giving youth behavioral autonomy and independence. Informed by social domain theory, the study's parenting constructs pertain to youth behaviors in an "ambiguously personal" domain-activities that adolescents believe are up to youth to decide, but which parents might argue require parents' supervision, knowledge, and/or decision-making. Results for latent profile analyses of parents' cultural identity across various facets of acculturation indicate considerable cultural heterogeneity among Latino parents. Although 43% of parents have a Latino cultural orientation, others represent Spanish-speaking/bicultural (21%), bilingual/bicultural (15%), English-speaking/bicultural (15%), or US (6%) cultural orientations. Structural equation modeling results indicate that bilingual/bicultural, English-speaking/bicultural, and US-oriented parents report less emphasis on the legitimacy of parental authority and younger age expectations for youth to engage in independent behaviors than do Latino-oriented parents. Parental beliefs endorsing youth's behavioral independence and autonomy, in turn, are associated with less stringent parental rules (parental report), less parental supervision (parental and youth report), and more youth autonomy in decision-making (parental and youth report). Evidence thus supports the idea that the diverse cultural orientations of Latino parents in the US may result in considerable variations in parenting processes pertinent to Latino adolescents' development.

Bacterial population in traditional sourdough evaluated by molecular methods

NARCIS (Netherlands)

Randazzo, C.L.; Heilig, G.H.J.; Restuccia, C.; Giudici, P.; Caggia, C.

2005-01-01

Aims: To study the microbial communities in artisanal sourdoughs, manufactured by traditional procedure in different areas of Sicily, and to evaluate the lactic acid bacteria (LAB) population by classical and culture-independent approaches. Methods and Results: Forty-five LAB isolates were

[Comparative characterization of cultured methane-oxidizing bacteria by serological and molecular methods].

Science.gov (United States)

Slobodova, N V; Kolganova, T V; Bulygina, E S; Kuznetsov, B B; Turova, T P; Kravchenko, I K

2006-01-01

Three stable methane-oxidizing enrichment cultures, SB26, SB31, and SB31A were analyzed by transmission electron microscopy and by serological and molecular techniques. Electron microscopy revealed the presence of both type I and type II methanotrophs in SB31 and SB31A enrichments; only type II methanotrophs were found in SB26 enrichment. Methylosinus trichosporium was detected in all three enrichments by the application of species-specific antibodies. Additionally, Methylocystis echinoides was found in SB26 culture; Methylococcus capsulatus, in SB31 and SB31A; and Methylomonas methanica, in SB31. The analysis with pmoA and nifH gene sequences as phylogenetic markers revealed the presence of Methylosinus/Methylocystis group in all communities. Moreover, the analysis of pmoA sequences revealed the presence of Methylomonas in SB31. Methylocella was detected in SB31 and SB31A enrichments only by nifH analysis. It was concluded that the simultaneous application of different approaches reveals more reliable information on the diversity of methanotrophs.

Molecular characterization of some lignicolous species from fungal culture collection

Directory of Open Access Journals (Sweden)

Stević Nevena

2014-01-01

Full Text Available Culture collections of microorganisms, including fungi, are strain deposits recognised as Biological Resource Centers (BRCs with a great importance in science, industry and education. Their objective is to preserve the purity, viability and genomic integrity of every single strain as a member of such collection. Since improvement of molecular methods nowadays brought many novel approaches in manipulation with strains of microorganisms, they can also be useful for characterization of existing stored strains. ITS1 region in nuclear DNA is preferred barcoding marker for taxon identification, which can be explained by its great inter-species variability. This paper presents results from analysing ITS1 region sequences (17 obtained from fungal DNA of culture collection of autochthonous, lignicolous genera Piptoporus, Pleurotus, Ganoderma and Schizophyllum cultured on malt agar plates for 14 days at 25°C. BLAST (Basic Local Alignment Search Tool was used for comparison with online databases, while alignment of sequences was made with MEGA 5.10 software. Morphological determination of species or genus was confirmed for 13 cultures, while the others were disproved. The resulting alignment indicated small intra-species variability of ITS1 region and pointed to it as an ideal marker for verification of fungal culture collections' authenticity. [Projekat Ministarstva nauke Republike Srbije, br. III43002 and by the Provincial Secretariat for Science and Technological Development, Vojvodina, Serbia APV 114-4513592/2013-03: Molecular and phenotypic diversity of taxa of economical and epidemiological importance, and endangered and endemic species in Europe

Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector

Directory of Open Access Journals (Sweden)

Adak Tridibesh

2009-05-01

Full Text Available Abstract Background Mosquitoes are intermediate hosts for numerous disease causing organisms. Vector control is one of the most investigated strategy for the suppression of mosquito-borne diseases. Anopheles stephensi is one of the vectors of malaria parasite Plasmodium vivax. The parasite undergoes major developmental and maturation steps within the mosquito midgut and little is known about Anopheles-associated midgut microbiota. Identification and characterization of the mosquito midgut flora is likely to contribute towards better understanding of mosquito biology including longevity, reproduction and mosquito-pathogen interactions that are important to evolve strategies for vector control mechanisms. Results Lab-reared and field-collected A. stephensi male, female and larvae were screened by "culture-dependent and culture-independent" methods. Five 16S rRNA gene library were constructed form lab and field-caught A. stephensi mosquitoes and a total of 115 culturable isolates from both samples were analyzed further. Altogether, 68 genera were identified from midgut of adult and larval A. stephensi, 53 from field-caught and 15 from lab-reared mosquitoes. A total of 171 and 44 distinct phylotypes having 85 to 99% similarity with the closest database matches were detected among field and lab-reared A. stephensi midgut, respectively. These OTUs had a Shannon diversity index value of 1.74–2.14 for lab-reared and in the range of 2.75–3.49 for field-caught A. stephensi mosquitoes. The high species evenness values of 0.93 to 0.99 in field-collected adult and larvae midgut flora indicated the vastness of microbial diversity retrieved by these approaches. The dominant bacteria in field-caught adult male A. stephensi were uncultured Paenibacillaceae while in female and in larvae it was Serratia marcescens, on the other hand in lab-reared mosquitoes, Serratia marcescens and Cryseobacterium meninqosepticum bacteria were found to be abundant. Conclusion

Evidence for a Cultural Influence on Field-Independence in Autism Spectrum Disorder

Science.gov (United States)

Koh, Hwan Cui; Milne, Elizabeth

2012-01-01

Field-independence, or weak central coherence, is a recognised phenotype of autism spectrum disorder (ASD). There is also evidence of cultural variation in this perceptual style, as neurotypical individuals from Western nations are more field-independent than neurotypical individuals from East-Asian nations. The majority of research on perceptual…

Culture Media and Individual Hosts Affect the Recovery of Culturable Bacterial Diversity from Amphibian Skin.

Science.gov (United States)

Medina, Daniel; Walke, Jenifer B; Gajewski, Zachary; Becker, Matthew H; Swartwout, Meredith C; Belden, Lisa K

2017-01-01

One current challenge in microbial ecology is elucidating the functional roles of the large diversity of free-living and host-associated bacteria identified by culture-independent molecular methods. Importantly, the characterization of this immense bacterial diversity will likely require merging data from culture-independent approaches with work on bacterial isolates in culture. Amphibian skin bacterial communities have become a recent focus of work in host-associated microbial systems due to the potential role of these skin bacteria in host defense against the pathogenic fungus Batrachochytrium dendrobatidis (Bd), which is associated with global amphibian population declines and extinctions. As there is evidence that some skin bacteria may inhibit growth of Bd and prevent infection in some cases, there is interest in using these bacteria as probiotic therapy for conservation of at-risk amphibians. In this study, we used skin swabs from American toads ( Anaxyrus americanus ) to: (1) assess the diversity and community structure of culturable amphibian skin bacteria grown on high and low nutrient culture media, (2) determine which culture media recover the highest proportion of the total skin bacterial community of individual toads relative to culture-independent data, and (3) assess whether the plated communities from the distinct media types vary in their ability to inhibit Bd growth in in-vitro assays. Overall, we found that culture media with low nutrient concentrations facilitated the growth of more diverse bacterial taxa and grew distinct communities relative to media with higher nutrient concentrations. Use of low nutrient media also resulted in culturing proportionally more of the bacterial diversity on individual toads relative to the overall community defined using culture-independent methods. However, while there were differences in diversity among media types, the variation among individual hosts was greater than variation among media types, suggesting

Independent random sampling methods

CERN Document Server

Martino, Luca; Míguez, Joaquín

2018-01-01

This book systematically addresses the design and analysis of efficient techniques for independent random sampling. Both general-purpose approaches, which can be used to generate samples from arbitrary probability distributions, and tailored techniques, designed to efficiently address common real-world practical problems, are introduced and discussed in detail. In turn, the monograph presents fundamental results and methodologies in the field, elaborating and developing them into the latest techniques. The theory and methods are illustrated with a varied collection of examples, which are discussed in detail in the text and supplemented with ready-to-run computer code. The main problem addressed in the book is how to generate independent random samples from an arbitrary probability distribution with the weakest possible constraints or assumptions in a form suitable for practical implementation. The authors review the fundamental results and methods in the field, address the latest methods, and emphasize the li...

The diagnosis of chronic endometritis in infertile asymptomatic women: a comparative study of histology, microbial cultures, hysteroscopy, and molecular microbiology.

Science.gov (United States)

Moreno, Inmaculada; Cicinelli, Ettore; Garcia-Grau, Iolanda; Gonzalez-Monfort, Marta; Bau, Davide; Vilella, Felipe; De Ziegler, Dominique; Resta, Leonardo; Valbuena, Diana; Simon, Carlos

2018-06-01

Chronic endometritis is a persistent inflammation of the endometrial mucosa caused by bacterial pathogens such as Enterobacteriaceae, Enterococcus, Streptococcus, Staphylococcus, Mycoplasma, and Ureaplasma. Although chronic endometritis can be asymptomatic, it is found in up to 40% of infertile patients and is responsible for repeated implantation failure and recurrent miscarriage. Diagnosis of chronic endometritis is based on hysteroscopy of the uterine cavity, endometrial biopsy with plasma cells being identified histologically, while specific treatment is determined based on microbial culture. However, not all microorganisms implicated are easily or readily culturable needing a turnaround time of up to 1 week. We sought to develop a molecular diagnostic tool for chronic endometritis based on real-time polymerase chain reaction equivalent to using the 3 classic methods together, overcoming the bias of using any of them alone. Endometrial samples from patients assessed for chronic endometritis (n = 113) using at least 1 or several conventional diagnostic methods namely histology, hysteroscopy, and/or microbial culture, were blindly evaluated by real-time polymerase chain reaction for the presence of 9 chronic endometritis pathogens: Chlamydia trachomatis, Enterococcus, Escherichia coli, Gardnerella vaginalis, Klebsiella pneumoniae, Mycoplasma hominis, Neisseria gonorrhoeae, Staphylococcus, and Streptococcus. The sensitivity and specificity of the molecular analysis vs the classic diagnostic techniques were compared in the 65 patients assessed by all 3 recognized classic methods. The molecular method showed concordant results with histological diagnosis in 30 samples (14 double positive and 16 double negative) with a matching accuracy of 46.15%. Concordance of molecular and hysteroscopic diagnosis was observed in 38 samples (37 double positive and 1 double negative), with an accuracy of 58.46%. When the molecular method was compared to microbial culture

Prevalence of periodontopathogenic bacteria in patients suffering from periodontitis using culture and PCR methods

Directory of Open Access Journals (Sweden)

Amir Aliramezani

2012-01-01

Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.

Development of the KINS Safety Culture Maturity Model for Self and Independent Assessment

International Nuclear Information System (INIS)

Sheen, C.; Choi, Y.S.

2016-01-01

Safety culture of an organization is cultivated and affected not only by societal and regulatory environment of the organization, but by its philosophies, policies, events and activities experienced in the process of accomplishing its mission. The safety culture would be continuously changed by the interactions between its members along with time as an organic entity. In order to perform a systematic self- or independent assessment of safety culture, a safety culture assessment model (SCAM) properly reflecting cultural characteristics should be necessary. In addition, a SCAM should be helpful not only to establish correct directions, goals, and strategies for safety culture development, but should anticipating obstacles against safety culture development in the implementation process derived from the assessment. In practical terms, a SCAM should be useful for deriving effective guidelines and implementing of corrective action programs for the evaluated organization. Korea Institute of Nuclear Safety (KINS) performed a research project for six years to develop a SCAM satisfying the above prerequisites for self- and independent assessment. The KINS SCAM was developed based on the five stage safety culture maturity model proposed by Professor Patrick Hudson and was modified into four stages to reflect existing safety culture assessment experiences at Korean nuclear power plants. In order to define the change mechanism of safety culture for development and reversion, the change model proposed by Prochaska and DiClemente was introduced into KINS SCAM and developed into the Spiral Change Model.

Revisiting bovine pyometra-New insights into the disease using a culture-independent deep sequencing approach

DEFF Research Database (Denmark)

Knudsen, Lif Rødtness Vesterby; Karstrup, Cecilia Christensen; Pedersen, Hanne Gervi

2015-01-01

-independent studies have demonstrated that the bacterial diversity in most environments is underestimated in culture-based studies. Consequently, fastidious pyometra-associated pathogens may have been overlooked. Therefore, the primary purpose of this study was to investigate the diversity of bacteria in the uterus......The bacteria present in the uterus during pyometra have previously been studied using bacteriological culturing. These studies identified Fusobacterium necrophorum and Trueperella pyogenes as the major contributors to the pathogenesis of pyometra. However, an increasing number of culture...... of cows with pyometra by using culture-independent 16S rRNA PCR combined with next generation sequencing. We investigated the microbial composition in the uterus of 21 cows with pyometra, which were obtained from a Danish slaughterhouse. Similar to the observations from the culture studies...

Culture- and molecular-based detection of swine-adapted Salmonella shed by avian scavengers.

Science.gov (United States)

Blanco, Guillermo; Díaz de Tuesta, Juan A

2018-04-13

Salmonella can play an important role as a disease agent in wildlife, which can then act as carriers and reservoirs of sanitary importance at the livestock-human interface. Transmission from livestock to avian scavengers can occur when these species consume contaminated carcasses and meat remains in supplementary feeding stations and rubbish dumps. We compared the performance of PCR-based detection with conventional culture-based methods to detect Salmonella in the faeces of red kites (Milvus milvus) and griffon vultures (Gyps fulvus) in central Spain. The occurrence of culturable Salmonella was intermediate in red kites (1.9%, n=52) and high in griffon vultures (26.3%, n=99). These proportions were clearly higher with PCR-based detection (13.5% and 40.4%, respectively). Confirmation cultures failed to grow Salmonella in all faecal samples positive by the molecular assay but negative by the initial conventional culture in both scavenger species, indicating the occurrence of false (non-culturable) positives by PCR-based detection. This suggests that the molecular assay is highly sensitive to detecting viable Salmonella in cultures, but also partial genomes and dead or unviable bacteria from past infections or contamination. Thus, the actual occurrence of Salmonella in a particular sampling time period can be underestimated when using only culture detection. The serovars found in the scavenger faeces were among the most frequently isolated in pigs from Spain and other EU countries, especially those generally recognized as swine-adapted monophasic variants of S. Typhimurium. Because the studied species obtain much of their food from pig carcasses, this livestock may be the primary source of Salmonella via direct ingestion of infected carcasses and indirectly via contamination due to the unsanitary conditions found in supplementary feeding stations established for scavenger conservation. Combining culture- and molecular-based detection is encouraged to understand the

Fusarium diversity in soil using a specific molecular approach and a cultural approach.

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Mounier, Arnaud; Steinberg, Christian

2015-04-01

Fusarium species are ubiquitous in soil. They cause plant and human diseases and can produce mycotoxins. Surveys of Fusarium species diversity in environmental samples usually rely on laborious culture-based methods. In the present study, we have developed a molecular method to analyze Fusarium diversity directly from soil DNA. We designed primers targeting the translation elongation factor 1-alpha (EF-1α) gene and demonstrated their specificity toward Fusarium using a large collection of fungi. We used the specific primers to construct a clone library from three contrasting soils. Sequence analysis confirmed the specificity of the assay, with 750 clones identified as Fusarium and distributed among eight species or species complexes. The Fusarium oxysporum species complex (FOSC) was the most abundant one in the three soils, followed by the Fusarium solani species complex (FSSC). We then compared our molecular approach results with those obtained by isolating Fusarium colonies on two culture media and identifying species by sequencing part of the EF-1α gene. The 750 isolates were distributed into eight species or species complexes, with the same dominant species as with the cloning method. Sequence diversity was much higher in the clone library than in the isolate collection. The molecular approach proved to be a valuable tool to assess Fusarium diversity in environmental samples. Combined with high throughput sequencing, it will allow for in-depth analysis of large numbers of samples. Published by Elsevier B.V.

Definition and dynamic control of a continuous chromatography process independent of cell culture titer and impurities.

Science.gov (United States)

Chmielowski, Rebecca A; Mathiasson, Linda; Blom, Hans; Go, Daniel; Ehring, Hanno; Khan, Heera; Li, Hong; Cutler, Collette; Lacki, Karol; Tugcu, Nihal; Roush, David

2017-12-01

Advances in cell culture technology have enabled the production of antibody titers upwards of 30g/L. These highly productive cell culture systems can potentially lead to productivity bottlenecks in downstream purification due to lower column loadings, especially in the primary capture chromatography step. Alternative chromatography solutions to help remedy this bottleneck include the utilization of continuous processing systems such as periodic counter-current chromatography (PCC). Recent studies have provided methods to optimize and improve the design of PCC for cell culture titers up to about 3g/L. This paper defines a continuous loading strategy for PCC that is independent of cell culture background and encompasses cell culture titers up to about 31g/L. Initial experimentation showed a challenge with determining a difference in change in UV280nm signal (ie. ΔUV) between cell culture feed and monoclonal antibody (mAb) concentration. Further investigation revealed UV280nm absorbance of the cell culture feedstock without antibody was outside of the linear range of detection for a given cell pathlength. Additional experimentation showed the difference in ΔUV for various cell culture feeds can be either theoretically predicted by Beer's Law given a known absorbance of the media background and impurities or experimentally determined using various UV280nm cell pathlengths. Based on these results, a 0.35mm pathlength at UV280nm was chosen for dynamic control to overcome the background signal. The pore diffusion model showed good agreement with the experimental frontal analysis data, which resulted in definition of a ΔUV setpoint range between 20 and 70% for 3C-PCC experiments. Product quality of the elution pools was acceptable between various cell culture feeds and titers up to about 41g/L. Results indicated the following ΔUV setpoints to achieve robust dynamic control and maintain 3C-PCC yield: ∼20-45% for titers greater than 10g/L depending on UV absorbance of

Empirical evaluation of data normalization methods for molecular classification.

Science.gov (United States)

Huang, Huei-Chung; Qin, Li-Xuan

2018-01-01

Data artifacts due to variations in experimental handling are ubiquitous in microarray studies, and they can lead to biased and irreproducible findings. A popular approach to correct for such artifacts is through post hoc data adjustment such as data normalization. Statistical methods for data normalization have been developed and evaluated primarily for the discovery of individual molecular biomarkers. Their performance has rarely been studied for the development of multi-marker molecular classifiers-an increasingly important application of microarrays in the era of personalized medicine. In this study, we set out to evaluate the performance of three commonly used methods for data normalization in the context of molecular classification, using extensive simulations based on re-sampling from a unique pair of microRNA microarray datasets for the same set of samples. The data and code for our simulations are freely available as R packages at GitHub. In the presence of confounding handling effects, all three normalization methods tended to improve the accuracy of the classifier when evaluated in an independent test data. The level of improvement and the relative performance among the normalization methods depended on the relative level of molecular signal, the distributional pattern of handling effects (e.g., location shift vs scale change), and the statistical method used for building the classifier. In addition, cross-validation was associated with biased estimation of classification accuracy in the over-optimistic direction for all three normalization methods. Normalization may improve the accuracy of molecular classification for data with confounding handling effects; however, it cannot circumvent the over-optimistic findings associated with cross-validation for assessing classification accuracy.

Biodiversity and dynamics of meat fermentations: the contribution of molecular methods for a better comprehension of a complex ecosystem.

Science.gov (United States)

Cocolin, Luca; Dolci, Paola; Rantsiou, Kalliopi

2011-11-01

The ecology of fermented sausages is complex and includes different species and strains of bacteria, yeasts and molds. The developments in the field of molecular biology, allowed for new methods to become available, which could be applied to better understand dynamics and diversity of the microorganisms involved in the production of sausages. Methods, such as denaturing gradient gel electrophoresis (DGGE), employed as a culture-independent approach, allow to define the microbial dynamics during the fermentation and ripening. Such approach has highlighted that two main species of lactic acid bacteria, namely Lactobacillus sakei and Lb. curvatus, are involved in the transformation process and that they are accompanied by Staphylococcus xylosus, as representative of the coagulase-negative cocci. These findings were repeatedly confirmed in different regions of the world, mainly in the Mediterranean countries where dry fermented sausages have a long tradition and history. The application of molecular methods for the identification and characterization of isolated strains from fermentations highlighted a high degree of diversity within the species mentioned above, underlining the need to better follow strain dynamics during the transformation process. While there is an important number of papers dealing with bacterial ecology by using molecular methods, studies on mycobiota of fermented sausages are just a few. This review reports on how the application of molecular methods made possible a better comprehension of the sausage fermentations, opening up new fields of research that in the near future will allow to unravel the connection between sensory properties and co-presence of multiple strains of the same species. Copyright © 2011 Elsevier Ltd. All rights reserved.

The dopamine D4 receptor gene (DRD4) moderates cultural difference in independent versus interdependent social orientation.

Science.gov (United States)

Kitayama, Shinobu; King, Anthony; Yoon, Carolyn; Tompson, Steve; Huff, Sarah; Liberzon, Israel

2014-06-01

Prior research suggests that cultural groups vary on an overarching dimension of independent versus interdependent social orientation, with European Americans being more independent, or less interdependent, than Asians. Drawing on recent evidence suggesting that the dopamine D4 receptor gene (DRD4) plays a role in modulating cultural learning, we predicted that carriers of DRD4 polymorphisms linked to increased dopamine signaling (7- or 2-repeat alleles) would show higher levels of culturally dominant social orientations, compared with noncarriers. European Americans and Asian-born Asians (total N = 398) reported their social orientation on multiple scales. They were also genotyped for DRD4. As in earlier work, European Americans were more independent, and Asian-born Asians more interdependent. This cultural difference was significantly more pronounced for carriers of the 7- or 2-repeat alleles than for noncarriers. Indeed, no cultural difference was apparent among the noncarriers. Implications for potential coevolution of genes and culture are discussed. © The Author(s) 2014.

Culture-dependent and culture-independent characterization of potentially functional biphenyl-degrading bacterial community in response to extracellular organic matter from Micrococcus luteus.

Science.gov (United States)

Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng

2015-05-01

Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Healing in Herero culture and Namibian African independent churches

Directory of Open Access Journals (Sweden)

Selaelo T. Kgatla

2015-09-01

Full Text Available The current phenomenon of Namibian African Independent Churches (NAICs draws attention from various people in civil society in Namibia. Although the ministries of NAICs are engaged with activities which are unusual for Christian churches, such as healing the people, fighting against evil spirits and power, performing certain rituals, prophesying and leading the worship services with African Traditional Religion (ATR as a frame of reference in 21st century, they do have a very big influence on various aspects of society in Namibia, which cannot be ignored. This is because those activities are familiar to the everyday lives of Africans and in touch with their culture. With regards to this, this article focuses on the causes of integration or harmony between the Herero culture and the NAICs.

Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

Directory of Open Access Journals (Sweden)

Kavita Diddi

2013-01-01

Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

Characterization of microbial communities in pest colonized books by molecular biology tools

Directory of Open Access Journals (Sweden)

Franco Palla

2011-08-01

Full Text Available This work presents the identification of bacteria and fungi colonies in insect infesting books, by cultural-independent methodologies based on molecular biology techniques. Microbial genomic DNA extraction, in vitro amplification of specific target sequences by polymerase chain reactions (PCR, sequencing and sequence analysis were performed. These procedures minimized the samples amount, optimized the diagnostic studies on bacteria and fungi colonization and allowed the identification of many species also in complex microbial consortia. The molecular techniques for sure accomplish and integrate the microbiological standard methods (in vitro culture and morphological analyses (OM, SEM, CLSM, in order to understand the role of microorganisms in bio-deterioration of cultural assets. This monitoring is also indispensable to shed light on the risk for visitors and/or professionals to contract potential illnesses within indoor environments.

Bacterial diversity determination using culture-dependent and culture-independent methods

Directory of Open Access Journals (Sweden)

M. Ghiasian

2017-04-01

Full Text Available Mud volcanoes are taken into consideration by geologists and oil industry experts have given their association with oil and gas reserves and methane greenhouse gas production in hydrosphere and atmosphere. Gomishan mud volcano phenomenon in the southeastern edge of the Caspian Sea, given its oil and gas resources, has been studied by some geologists in terms of geology and tectonics but not in terms of microbiology. Accordingly, it seems necessary to study this phenomenon from the perspective of microbiology in order to identify prokaryotes living in this area. Prokaryotes diversity in Mud volcano has been studied by cultivation techniques, fluorescence in situ hybridization, and denaturing gradient gel electrophoresis of PCR-amplified fragments of 16S rRNA genes. Total cell abundance in the mud volcano from 1×101-6×101per milliliter was determined by 4', 6-diamidino-2-phenylindole direct count. The detectable proportion of Archaea to Bacteria in the community by FISH was one to five. High viable counts (1 – 3 × 106 were obtained in culture media. A total of 122 isolates were obtained, 46 colonies were selected based on primarily morphological and physiological traits, and their 16S rRNA sequences were determined. The isolated genera included Halomonas (20%, Arthrobacter (5%, Kocuria (5%, Thalassobacillus (5%, Marinobacter (20%, Paracoccus (5%, Roseovarius (5%, Jeotgalicoccus (5%, Bacillus (15%, and Staphylococcus (15%. Regarding DGGE analysis, selected bands were obtained from the gels, reamplified and sequenced. Overall, 75% of the bacterial sequences were related to Rahnella and 25% related to Serratia.

Impact of serology and molecular methods on improving the microbiologic diagnosis of infective endocarditis in Egypt.

Science.gov (United States)

El-Kholy, Amany Aly; El-Rachidi, Nevine Gamal El-din; El-Enany, Mervat Gaber; AbdulRahman, Eiman Mohammed; Mohamed, Reem Mostafa; Rizk, Hussien Hasan

2015-10-01

Conventional diagnosis of infective endocarditis (IE) is based mainly on culture-dependent methods that may fail because of antibiotic therapy or fastidious microorganisms. We aimed to evaluate the added values of serological and molecular methods for diagnosis of infective endocarditis. One hundred and fifty-six cases of suspected endocarditis were enrolled in the study. For each patient, three sets of blood culture were withdrawn and serum sample was collected for Brucella, Bartonella and Coxiella burnetii antibody testing. Galactomannan antigen was added if fungal endocarditis was suspected. Broad range PCR targeting bacterial and fungal pathogens were done on blood culture bottles followed by sequencing. Culture and molecular studies were done on excised valve tissue when available. One hundred and thirty-two cases were diagnosed as definite IE. Causative organisms were detected by blood cultures in 40 (30.3 %) of cases. Blood culture-negative endocarditis (BCNE) represented 69.7 %. Of these cases, PCR followed by sequencing on blood and valvular tissue could diagnose five cases of Aspergillus flavus. Eleven patients with BCNE (8.3 %) were diagnosed as zoonotic endocarditis by serology and PCR including five cases of Brucella spp, four cases of Bartonella spp and two cases of Coxiella burnetii. PCR detected three cases of Brucella spp and two cases of Bartonella spp, while cases of Coxiella burnetii were PCR negative. The results of all diagnostic tools decreased the percentage of non-identified cases of BCNE from 69.7 to 49.2 %. Our data underline the role of serologic and molecular tools for the diagnosis of blood culture-negative endocarditis.

[Identification of mycobacteria to the species level by molecular methods in the Public Health Laboratory of Bogotá, Colombia].

Science.gov (United States)

Hernández-Toloza, Johana Esther; Rincón-Serrano, María de Pilar; Celis-Bustos, Yamile Adriana; Aguillón, Claudia Inés

2016-01-01

Global epidemiology of non-tuberculous mycobacteria (NTM) is unknown due to the fact that notification is not required in many countries, however the number of infection reports and outbreaks caused by NTM suggest a significant increase in the last years. Traditionally, mycobacteria identification is made through biochemical profiles which allow to differentiate M. tuberculosis from NTM, and in some cases the mycobacteria species. Nevertheless, these methods are technically cumbersome and time consuming. On the other hand, the introduction of methods based on molecular biology has improved the laboratory diagnosis of NTM. To establish the NTM frequency in positive cultures for acid-fast bacilli (AAFB) which were sent to Laboratorio de Salud Pública de Bogotá over a 12 month period. A total of 100 positive cultures for acid-fast bacilli from public and private hospitals from Bogotá were identified by both biochemical methods and the molecular methods PRA (PCR-restriction enzyme analysis) and multiplex-PCR. Furthermore, low prevalence mycobacteria species and non-interpretable results were confirmed by 16SrDNA sequentiation analysis. Identification using the PRA method showed NMT occurrence in 11% of cultures. In addition, this molecular methodology allowed to detect the occurrence of more than one mycobacteria in 4% of the cultures. Interestingly, a new M. kubicae pattern of PCR-restriction analysis is reported in our study. Using a mycobacteria identification algorithm, which includes the molecular method PRA, improves the diagnostic power of conventional methods and could help to advance both NTM epidemiology knowledge and mycobacteriosis control. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Ethos of independence across regions in the United States: the production-adoption model of cultural change.

Science.gov (United States)

Kitayama, Shinobu; Conway, Lucian Gideon; Pietromonaco, Paula R; Park, Hyekyung; Plaut, Victoria C

2010-09-01

Contemporary U.S. culture has a highly individualistic ethos. Nevertheless, exactly how this ethos was historically fostered remains unanalyzed. A new model of dynamic cultural change maintains that sparsely populated, novel environments that impose major threats to survival, such as the Western frontier in the United States during the 18th and 19th centuries, breed strong values of independence, which in turn guide the production of new practices that encourage self-promotion and focused, competitive work. Faced with few significant threats to survival, residents in traditional areas are likely to seek social prestige by adopting existing practices of other, higher status groups. Because of both the massive economic success of the frontier and the official endorsement of the frontier by the federal government, eastern residents of the United States in the 18th and 19th centuries may have actively adopted the frontier practices of independence, thus incorporating the frontier ethos of independence to form the contemporary U.S. national culture. Available evidence is reviewed, and implications for further research on cultural change are suggested. Copyright 2010 APA, all rights reserved.

Culture-dependent and culture-independent characterization of microbial assemblages associated with high-temperature petroleum reservoirs.

Science.gov (United States)

Orphan, V J; Taylor, L T; Hafenbradl, D; Delong, E F

2000-02-01

Recent investigations of oil reservoirs in a variety of locales have indicated that these habitats may harbor active thermophilic prokaryotic assemblages. In this study, we used both molecular and culture-based methods to characterize prokaryotic consortia associated with high-temperature, sulfur-rich oil reservoirs in California. Enrichment cultures designed for anaerobic thermophiles, both autotrophic and heterotrophic, were successful at temperatures ranging from 60 to 90 degrees C. Heterotrophic enrichments from all sites yielded sheathed rods (Thermotogales), pleomorphic rods resembling Thermoanaerobacter, and Thermococcus-like isolates. The predominant autotrophic microorganisms recovered from inorganic enrichments using H(2), acetate, and CO(2) as energy and carbon sources were methanogens, including isolates closely related to Methanobacterium, Methanococcus, and Methanoculleus species. Two 16S rRNA gene (rDNA) libraries were generated from total community DNA collected from production wellheads, using either archaeal or universal oligonucleotide primer sets. Sequence analysis of the universal library indicated that a large percentage of clones were highly similar to known bacterial and archaeal isolates recovered from similar habitats. Represented genera in rDNA clone libraries included Thermoanaerobacter, Thermococcus, Desulfothiovibrio, Aminobacterium, Acidaminococcus, Pseudomonas, Halomonas, Acinetobacter, Sphingomonas, Methylobacterium, and Desulfomicrobium. The archaeal library was dominated by methanogen-like rDNAs, with a lower percentage of clones belonging to the Thermococcales. Our results strongly support the hypothesis that sulfur-utilizing and methane-producing thermophilic microorganisms have a widespread distribution in oil reservoirs and the potential to actively participate in the biogeochemical transformation of carbon, hydrogen, and sulfur in situ.

Alignment independent 3D-QSAR, quantum calculations and molecular docking of Mer specific tyrosine kinase inhibitors as anticancer drugs

Directory of Open Access Journals (Sweden)

Fereshteh Shiri

2016-03-01

Full Text Available Mer receptor tyrosine kinase is a promising novel cancer therapeutic target in many human cancers, because abnormal activation of Mer has been implicated in survival signaling and chemoresistance. 3D-QSAR analyses based on alignment independent descriptors were performed on a series of 81 Mer specific tyrosine kinase inhibitors. The fractional factorial design (FFD and the enhanced replacement method (ERM were applied and tested as variable selection algorithms for the selection of optimal subsets of molecular descriptors from a much greater pool of such regression variables. The data set was split into 65 molecules as the training set and 16 compounds as the test set. All descriptors were generated by using the GRid INdependent descriptors (GRIND approach. After variable selection, GRIND were correlated with activity values (pIC50 by PLS regression. Of the two applied variable selection methods, ERM had a noticeable improvement on the statistical parameters of PLS model, and yielded a q2 value of 0.77, an rpred2 of 0.94, and a low RMSEP value of 0.25. The GRIND information contents influencing the affinity on Mer specific tyrosine kinase were also confirmed by docking studies. In a quantum calculation study, the energy difference between HOMO and LUMO (gap implied the high interaction of the most active molecule in the active site of the protein. In addition, the molecular electrostatic potential energy at DFT level confirmed results obtained from the molecular docking. The identified key features obtained from the molecular modeling, enabled us to design novel kinase inhibitors.

Alignment independent 3D-QSAR, quantum calculations and molecular docking of Mer specific tyrosine kinase inhibitors as anticancer drugs.

Science.gov (United States)

Shiri, Fereshteh; Pirhadi, Somayeh; Ghasemi, Jahan B

2016-03-01

Mer receptor tyrosine kinase is a promising novel cancer therapeutic target in many human cancers, because abnormal activation of Mer has been implicated in survival signaling and chemoresistance. 3D-QSAR analyses based on alignment independent descriptors were performed on a series of 81 Mer specific tyrosine kinase inhibitors. The fractional factorial design (FFD) and the enhanced replacement method (ERM) were applied and tested as variable selection algorithms for the selection of optimal subsets of molecular descriptors from a much greater pool of such regression variables. The data set was split into 65 molecules as the training set and 16 compounds as the test set. All descriptors were generated by using the GRid INdependent descriptors (GRIND) approach. After variable selection, GRIND were correlated with activity values (pIC50) by PLS regression. Of the two applied variable selection methods, ERM had a noticeable improvement on the statistical parameters of PLS model, and yielded a q (2) value of 0.77, an [Formula: see text] of 0.94, and a low RMSEP value of 0.25. The GRIND information contents influencing the affinity on Mer specific tyrosine kinase were also confirmed by docking studies. In a quantum calculation study, the energy difference between HOMO and LUMO (gap) implied the high interaction of the most active molecule in the active site of the protein. In addition, the molecular electrostatic potential energy at DFT level confirmed results obtained from the molecular docking. The identified key features obtained from the molecular modeling, enabled us to design novel kinase inhibitors.

Validation of the prognostic gene portfolio, ClinicoMolecular Triad Classification, using an independent prospective breast cancer cohort and external patient populations

Science.gov (United States)

2014-01-01

Introduction Using genome-wide expression profiles of a prospective training cohort of breast cancer patients, ClinicoMolecular Triad Classification (CMTC) was recently developed to classify breast cancers into three clinically relevant groups to aid treatment decisions. CMTC was found to be both prognostic and predictive in a large external breast cancer cohort in that study. This study serves to validate the reproducibility of CMTC and its prognostic value using independent patient cohorts. Methods An independent internal cohort (n = 284) and a new external cohort (n = 2,181) were used to validate the association of CMTC between clinicopathological factors, 12 known gene signatures, two molecular subtype classifiers, and 19 oncogenic signalling pathway activities, and to reproduce the abilities of CMTC to predict clinical outcomes of breast cancer. In addition, we also updated the outcome data of the original training cohort (n = 147). Results The original training cohort reached a statistically significant difference (p risk groups. Conclusions Both prospective internal cohorts and the independent external cohorts reproduced the triad classification of CMTC and its prognostic significance. CMTC is an independent prognostic predictor, and it outperformed 12 other known prognostic gene signatures, molecular subtype classifications, and all other standard prognostic clinicopathological factors. Our results support further development of CMTC portfolio into a guide for personalized breast cancer treatments. PMID:24996446

A review of the public health management of shigellosis in Australia in the era of culture-independent diagnostic testing.

Science.gov (United States)

Tai, Alex Y C; Easton, Marion; Encena, Jess; Rotty, Jessica; Valcanis, Mary; Howden, Benjamin P; Slota-Kan, Simon; Gregory, Joy

2016-12-01

To review the national case definition for shigellosis following the introduction of culture independent diagnostic testing by clinical laboratories and provide evidence to reform jurisdictional public health practices for the management shigellosis., . A review of all Australian jurisdictional public health guidelines for shigellosis was conducted. Victorian 2014 shigellosis data were analysed: demographics and risk factors for cases identified by conventional culture or culture-independent diagnostic methods were described. There was considerable variation in reporting of cases to the National Notifiable Disease Surveillance System (NNDSS) by the eight Australian jurisdictions, with an array of classifications based on diagnostic testing methodologies. Analysis of Victorian 2014 shigellosis data found that culture positive cases were more likely to have reported men who have sex with men (MSM) as a risk factor than PCR positive only cases (p<0.0001) and less likely to have reported overseas travel during their incubation period (p<0.0001). Over a 10-year period (2005 to 2014), only two of 86 cases who were employed in high-risk occupations had ongoing positive faecal cultures after appropriate treatment. The national surveillance case definition for shigellosis should be reviewed to facilitate standardised reporting across Australia. All jurisdictions must consider the public health significance of PCR positive only results in their surveillance risk assessments to inform management of shigellosis cases. © 2016 Public Health Association of Australia.

[Molecular diagnostic methods of respiratory infections. Has the scheme diagnosis changed?].

Science.gov (United States)

Vila Estapé, Jordi; Zboromyrska, Yuliya; Vergara Gómez, Andrea; Alejo Cancho, Izaskun; Rubio García, Elisa; Álvarez-Martínez, Miriam José; la Bellacasa Brugada, Jorge Puig de; Marcos Maeso, M Ángeles

2016-07-01

Lower respiratory tract infections remain one of the most common causes of mortality worldwide, which is why early diagnosis is crucial. Traditionally the microbiological diagnosis of these infections has been based on conventional methods including culture on artificial media for isolation of bacteria and fungi and cell cultures for virus and antibody or antigen detection using antigen-antibody reactions. The main drawback of the above mentioned methods is the time needed for an etiological diagnosis of the infection. The techniques based on molecular biology have drawn much attention in recent decades as tools for rapid diagnosis of infections. Some techniques are very expensive, especially those that can detect various microorganisms in the same reaction, therefore the question that arises is whether the cost of such testing is justified by the information obtained and by the clinical impact that its implementation will determine. In this article we make a review of the various techniques of molecular biology applied to the diagnosis of pneumonia and focus primarily on analysing the impact they may have on the management of patients with acute respiratory tract infections. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

Novel co-culture plate enables growth dynamic-based assessment of contact-independent microbial interactions.

Directory of Open Access Journals (Sweden)

Thomas J Moutinho

Full Text Available Interactions between microbes are central to the dynamics of microbial communities. Understanding these interactions is essential for the characterization of communities, yet challenging to accomplish in practice. There are limited available tools for characterizing diffusion-mediated, contact-independent microbial interactions. A practical and widely implemented technique in such characterization involves the simultaneous co-culture of distinct bacterial species and subsequent analysis of relative abundance in the total population. However, distinguishing between species can be logistically challenging. In this paper, we present a low-cost, vertical membrane, co-culture plate to quantify contact-independent interactions between distinct bacterial populations in co-culture via real-time optical density measurements. These measurements can be used to facilitate the analysis of the interaction between microbes that are physically separated by a semipermeable membrane yet able to exchange diffusible molecules. We show that diffusion across the membrane occurs at a sufficient rate to enable effective interaction between physically separate cultures. Two bacterial species commonly found in the cystic fibrotic lung, Pseudomonas aeruginosa and Burkholderia cenocepacia, were co-cultured to demonstrate how this plate may be implemented to study microbial interactions. We have demonstrated that this novel co-culture device is able to reliably generate real-time measurements of optical density data that can be used to characterize interactions between microbial species.

A method to identify dependencies between organizational factors using statistical independence test

International Nuclear Information System (INIS)

Kim, Y.; Chung, C.H.; Kim, C.; Jae, M.; Jung, J.H.

2004-01-01

A considerable number of studies on organizational factors in nuclear power plants have been made especially in recent years, most of which have assumed organizational factors to be independent. However, since organizational factors characterize the organization in terms of safety and efficiency etc. and there would be some factors that have close relations between them. Therefore, from whatever point of view, if we want to identify the characteristics of an organization, the dependence relationships should be considered to get an accurate result. In this study the organization of a reference nuclear power plant in Korea was analyzed for the trip cases of that plant using 20 organizational factors that Jacobs and Haber had suggested: 1) coordination of work, 2) formalization, 3) organizational knowledge, 4) roles and responsibilities, 5) external communication, 6) inter-department communications, 7) intra-departmental communications, 8) organizational culture, 9) ownership, 10) safety culture, 11) time urgency, 12) centralization, 13) goal prioritization, 14) organizational learning, 15) problem identification, 16) resource allocation, 17) performance evaluation, 18) personnel selection, 19) technical knowledge, and 20) training. By utilizing the results of the analysis, a method to identify the dependence relationships between organizational factors is presented. The statistical independence test for the analysis result of the trip cases is adopted to reveal dependencies. This method is geared to the needs to utilize many kinds of data that has been obtained as the operating years of nuclear power plants increase, and more reliable dependence relations may be obtained by using these abundant data

Culture-Independent Identification of Mycobacterium avium Subspecies paratuberculosis in Ovine Tissues: Comparison with Bacterial Culture and Histopathological Lesions

Directory of Open Access Journals (Sweden)

Kamal R. Acharya

2017-12-01

Full Text Available Johne’s disease is a chronic debilitating enteropathy of ruminants caused by Mycobacterium avium subspecies paratuberculosis (MAP. Current abattoir surveillance programs detect disease via examination of gross lesions and confirmation by histopathological and/or tissue culture, which is time-consuming and has relatively low sensitivity. This study aimed to investigate whether a high-throughput quantitative PCR (qPCR test is a viable alternative for tissue testing. Intestine and mesenteric lymph nodes were sourced from sheep experimentally infected with MAP and the DNA extracted using a protocol developed for tissues, comprised enzymatic digestion of the tissue homogenate, chemical and mechanical lysis, and magnetic bead-based DNA purification. The extracted DNA was tested by adapting a previously validated qPCR for fecal samples, and the results were compared with culture and histopathology results of the corresponding tissues. The MAP tissue qPCR confirmed infection in the majority of sheep with gross lesions on postmortem (37/38. Likewise, almost all tissue culture (61/64 or histopathology (52/58 positives were detected with good to moderate agreement (Cohen’s kappa statistic and no significant difference to the reference tests (McNemar’s Chi-square test. Higher MAP DNA quantities corresponded to animals with more severe histopathology (odds ratio: 1.82; 95% confidence interval: 1.60, 2.07. Culture-independent strain typing on tissue DNA was successfully performed. This MAP tissue qPCR method had a sensitivity equivalent to the reference tests and is thus a viable replacement for gross- and histopathological examination of tissue samples in abattoirs. In addition, the test could be validated for testing tissue samples intended for human consumption.

A COMPARISON OF METHODS FOR DETERMINING THE MOLECULAR CONTENT OF MODEL GALAXIES

International Nuclear Information System (INIS)

Krumholz, Mark R.; Gnedin, Nickolay Y.

2011-01-01

Recent observations indicate that star formation occurs only in the molecular phase of a galaxy's interstellar medium. A realistic treatment of star formation in simulations and analytic models of galaxies therefore requires that one determine where the transition from the atomic to molecular gas occurs. In this paper, we compare two methods for making this determination in cosmological simulations where the internal structures of molecular clouds are unresolved: a complex time-dependent chemistry network coupled to a radiative transfer calculation of the dissociating ultraviolet (UV) radiation field and a simple time-independent analytic approximation. We show that these two methods produce excellent agreement at all metallicities ∼>10 -2 of the Milky Way value across a very wide range of UV fields. At lower metallicities the agreement is worse, likely because time-dependent effects become important; however, there are no observational calibrations of molecular gas content at such low metallicities, so it is unclear if either method is accurate. The comparison suggests that, in many but not all applications, the analytic approximation provides a viable and nearly cost-free alternative to full time-dependent chemistry and radiative transfer.

Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

Science.gov (United States)

Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

2016-11-21

Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

On the number of independent cultural traits carried by individuals and populations.

Science.gov (United States)

Lehmann, Laurent; Aoki, Kenichi; Feldman, Marcus W

2011-02-12

In species subject to individual and social learning, each individual is likely to express a certain number of different cultural traits acquired during its lifetime. If the process of trait innovation and transmission reaches a steady state in the population, the number of different cultural traits carried by an individual converges to some stationary distribution. We call this the trait-number distribution. In this paper, we derive the trait-number distributions for both individuals and populations when cultural traits are independent of each other. Our results suggest that as the number of cultural traits becomes large, the trait-number distributions approach Poisson distributions so that their means characterize cultural diversity in the population. We then analyse how the mean trait number varies at both the individual and population levels as a function of various demographic features, such as population size and subdivision, and social learning rules, such as conformism and anti-conformism. Diversity at the individual and population levels, as well as at the level of cultural homogeneity within groups, depends critically on the details of population demography and the individual and social learning rules.

The IRIDICA BAC BSI Assay: Rapid, Sensitive and Culture-Independent Identification of Bacteria and Candida in Blood

Science.gov (United States)

Rothman, Richard E.; Peterson, Stephen; Carroll, Karen C.; Zhang, Sean X.; Avornu, Gideon D.; Rounds, Megan A.; Carolan, Heather E.; Toleno, Donna M.; Moore, David; Hall, Thomas A.; Massire, Christian; Richmond, Gregory S.; Gutierrez, Jose R.; Sampath, Rangarajan; Ecker, David J.; Blyn, Lawrence B.

2016-01-01

Bloodstream infection (BSI) and sepsis are rising in incidence throughout the developed world. The spread of multi-drug resistant organisms presents increasing challenges to treatment. Surviving BSI is dependent on rapid and accurate identification of causal organisms, and timely application of appropriate antibiotics. Current culture-based methods used to detect and identify agents of BSI are often too slow to impact early therapy and may fail to detect relevant organisms in many positive cases. Existing methods for direct molecular detection of microbial DNA in blood are limited in either sensitivity (likely the result of small sample volumes) or in breadth of coverage, often because the PCR primers and probes used target only a few specific pathogens. There is a clear unmet need for a sensitive molecular assay capable of identifying the diverse bacteria and yeast associated with BSI directly from uncultured whole blood samples. We have developed a method of extracting DNA from larger volumes of whole blood (5 ml per sample), amplifying multiple widely conserved bacterial and fungal genes using a mismatch- and background-tolerant PCR chemistry, and identifying hundreds of diverse organisms from the amplified fragments on the basis of species-specific genetic signatures using electrospray ionization mass spectrometry (PCR/ESI-MS). We describe the analytical characteristics of the IRIDICA BAC BSI Assay and compare its pre-clinical performance to current standard-of-care methods in a collection of prospectively collected blood specimens from patients with symptoms of sepsis. The assay generated matching results in 80% of culture-positive cases (86% when common contaminants were excluded from the analysis), and twice the total number of positive detections. The described method is capable of providing organism identifications directly from uncultured blood in less than 8 hours. Disclaimer: The IRIDICA BAC BSI Assay is not available in the United States. PMID:27384540

Molecular methods for diagnosis of odontogenic infections.

Science.gov (United States)

Flynn, Thomas R; Paster, Bruce J; Stokes, Lauren N; Susarla, Srinivas M; Shanti, Rabie M

2012-08-01

Historically, the identification of microorganisms has been limited to species that could be cultured in the microbiology laboratory. The purpose of the present study was to apply molecular techniques to identify microorganisms in orofacial odontogenic infections (OIs). Specimens were obtained from subjects with clinical evidence of OI. To identify the microorganisms involved, 16S rRNA sequencing methods were used on clinical specimens. The name and number of the clones of each species identified and the combinations of species present were recorded for each subject. Descriptive statistics were computed for the study variables. Specimens of pus or wound fluid were obtained from 9 subjects. A mean of 7.4 ± 3.7 (standard deviation) species per case were identified. The predominant species detected in the present study that have previously been associated with OIs were Fusobacterium spp, Parvimonas micra, Porphyromonas endodontalis, and Prevotella oris. The predominant species detected in our study that have not been previously associated with OIs were Dialister pneumosintes and Eubacterium brachy. Unculturable phylotypes accounted for 24% of the species identified in our study. All species detected were obligate or facultative anaerobes. Streptococci were not detected. Molecular methods have enabled us to detect previously cultivated and not-yet-cultivated species in OIs; these methods could change our understanding of the pathogenic flora of orofacial OIs. Copyright © 2012 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Culture and Healthy Eating: The Role of Independence and Interdependence in the U.S. and Japan

Science.gov (United States)

Levine, Cynthia S.; Miyamoto, Yuri; Markus, Hazel Rose; Rigotti, Attilio; Boylan, Jennifer Morozink; Park, Jiyoung; Kitayama, Shinobu; Karasawa, Mayumi; Kawakami, Norito; Coe, Christopher L.; Love, Gayle D.; Ryff, Carol D.

2016-01-01

Healthy eating is important for physical health. Using large probability samples of middle-aged adults in the U.S. and Japan, we show that fitting with the culturally normative way of being predicts healthy eating. In the U.S, a culture that prioritizes and emphasizes independence, being independent predicts eating a healthy diet (an index of fish, protein, fruit, vegetables, reverse-coded sugared beverages, and reverse-coded high fat meat consumption; Study 1) and not using food as a way to cope with stress (Study 2a). In Japan, a culture that prioritizes and emphasizes interdependence, being interdependent predicts eating a healthy diet (Studies 1 and 2b). Further, reflecting the types of agency that are prevalent in each context, these relationships are mediated by autonomy in the U.S. and positive relations with others in Japan. These findings highlight the importance of understanding cultural differences in shaping healthy behavior and have implications for designing health-promoting interventions. PMID:27516421

Real-world comparison of two molecular methods for detection of respiratory viruses

Directory of Open Access Journals (Sweden)

Miller E Kathryn

2011-06-01

Full Text Available Abstract Background Molecular polymerase chain reaction (PCR based assays are increasingly used to diagnose viral respiratory infections and conduct epidemiology studies. Molecular assays have generally been evaluated by comparing them to conventional direct fluorescent antibody (DFA or viral culture techniques, with few published direct comparisons between molecular methods or between institutions. We sought to perform a real-world comparison of two molecular respiratory viral diagnostic methods between two experienced respiratory virus research laboratories. Methods We tested nasal and throat swab specimens obtained from 225 infants with respiratory illness for 11 common respiratory viruses using both a multiplex assay (Respiratory MultiCode-PLx Assay [RMA] and individual real-time RT-PCR (RT-rtPCR. Results Both assays detected viruses in more than 70% of specimens, but there was discordance. The RMA assay detected significantly more human metapneumovirus (HMPV and respiratory syncytial virus (RSV, while RT-rtPCR detected significantly more influenza A. We speculated that primer differences accounted for these discrepancies and redesigned the primers and probes for influenza A in the RMA assay, and for HMPV and RSV in the RT-rtPCR assay. The tests were then repeated and again compared. The new primers led to improved detection of HMPV and RSV by RT-rtPCR assay, but the RMA assay remained similar in terms of influenza detection. Conclusions Given the absence of a gold standard, clinical and research laboratories should regularly correlate the results of molecular assays with other PCR based assays, other laboratories, and with standard virologic methods to ensure consistency and accuracy.

Effects of transfer of embryos independently cultured in essential and sequential culture media on pregnancy rates in assisted reproduction cycles.

Science.gov (United States)

Geber, Selmo; Bossi, Renata; Guimarães, Fernando; Valle, Marcello; Sampaio, Marcos

2012-10-01

Several culture media are available to be used in ART. However it is uncertain whether embryos would preferably benefit from one type of medium or the association of different media. We performed this study to evaluate the impact of simultaneous transfer of embryos independently cultured in two distinct culture media, on pregnancy outcome. A total of 722 couples who underwent infertility treatment were sequentially allocated into three groups: those who had half of the embryos individually cultured in MEM and the other half cultured in sequential media (MEM + Seq Group) (n = 243); those who had all embryos cultured only in sequential medium (Seq Group) (n = 239); and those who had all embryos cultured only in MEM (MEM Group) (n = 240). The pregnancy rate was higher in the MEM + Seq group (51.8 %) than the Seq group (36.7 %) (p < 0.001). However the pregnancy rate observed in the MEM group was similar to the others (44.2 %). When a logistic regression test was applied it demonstrated that the number of transferred embryos did not interfere in the pregnancy rates. Our results suggests that offering different culture conditions for sibling embryos with subsequent transfer of embryos that were kept in distinct culture media, might increase pregnancy rates in assisted reproduction cycles.

Culture and Healthy Eating: The Role of Independence and Interdependence in the United States and Japan.

Science.gov (United States)

Levine, Cynthia S; Miyamoto, Yuri; Markus, Hazel Rose; Rigotti, Attilio; Boylan, Jennifer Morozink; Park, Jiyoung; Kitayama, Shinobu; Karasawa, Mayumi; Kawakami, Norito; Coe, Christopher L; Love, Gayle D; Ryff, Carol D

2016-10-01

Healthy eating is important for physical health. Using large probability samples of middle-aged adults in the United States and Japan, we show that fitting with the culturally normative way of being predicts healthy eating. In the United States, a culture that prioritizes and emphasizes independence, being independent predicts eating a healthy diet (an index of fish, protein, fruit, vegetables, reverse-coded sugared beverages, and reverse-coded high fat meat consumption; Study 1) and not using nonmeat food as a way to cope with stress (Study 2a). In Japan, a culture that prioritizes and emphasizes interdependence, being interdependent predicts eating a healthy diet (Studies 1 and 2b). Furthermore, reflecting the types of agency that are prevalent in each context, these relationships are mediated by autonomy in the United States and positive relations with others in Japan. These findings highlight the importance of understanding cultural differences in shaping healthy behavior and have implications for designing health-promoting interventions. © 2016 by the Society for Personality and Social Psychology, Inc.

Beyond Blood Culture and Gram Stain Analysis: A Review of Molecular Techniques for the Early Detection of Bacteremia in Surgical Patients.

Science.gov (United States)

Scerbo, Michelle H; Kaplan, Heidi B; Dua, Anahita; Litwin, Douglas B; Ambrose, Catherine G; Moore, Laura J; Murray, Col Clinton K; Wade, Charles E; Holcomb, John B

2016-06-01

Sepsis from bacteremia occurs in 250,000 cases annually in the United States, has a mortality rate as high as 60%, and is associated with a poorer prognosis than localized infection. Because of these high figures, empiric antibiotic administration for patients with systemic inflammatory response syndrome (SIRS) and suspected infection is the second most common indication for antibiotic administration in intensive care units (ICU)s. However, overuse of empiric antibiotics contributes to the development of opportunistic infections, antibiotic resistance, and the increase in multi-drug-resistant bacterial strains. The current method of diagnosing and ruling out bacteremia is via blood culture (BC) and Gram stain (GS) analysis. Conventional and molecular methods for diagnosing bacteremia were reviewed and compared. The clinical implications, use, and current clinical trials of polymerase chain reaction (PCR)-based methods to detect bacterial pathogens in the blood stream were detailed. BC/GS has several disadvantages. These include: some bacteria do not grow in culture media; others do not GS appropriately; and cultures can require up to 5 d to guide or discontinue antibiotic treatment. PCR-based methods can be potentially applied to detect rapidly, accurately, and directly microbes in human blood samples. Compared with the conventional BC/GS, particular advantages to molecular methods (specifically, PCR-based methods) include faster results, leading to possible improved antibiotic stewardship when bacteremia is not present.

Serotonin regulates C. elegans fat and feeding through independent molecular mechanisms

DEFF Research Database (Denmark)

Srinivasan, Supriya; Sadegh, Leila; Elle, Ida C

2008-01-01

We investigated serotonin signaling in C. elegans as a paradigm for neural regulation of energy balance and found that serotonergic regulation of fat is molecularly distinct from feeding regulation. Serotonergic feeding regulation is mediated by receptors whose functions are not required for fat...... feeding behavior. These findings suggest that, as in mammals, C. elegans feeding behavior is regulated by extrinsic and intrinsic cues. Moreover, obesity and thinness are not solely determined by feeding behavior. Rather, feeding behavior and fat metabolism are coordinated but independent responses...

Metagenomics: The Next Culture-Independent Game Changer

Directory of Open Access Journals (Sweden)

Jessica D. Forbes

2017-07-01

Full Text Available A trend towards the abandonment of obtaining pure culture isolates in frontline laboratories is at a crossroads with the ability of public health agencies to perform their basic mandate of foodborne disease surveillance and response. The implementation of culture-independent diagnostic tests (CIDTs including nucleic acid and antigen-based assays for acute gastroenteritis is leaving public health agencies without laboratory evidence to link clinical cases to each other and to food or environmental substances. This limits the efficacy of public health epidemiology and surveillance as well as outbreak detection and investigation. Foodborne outbreaks have the potential to remain undetected or have insufficient evidence to support source attribution and may inadvertently increase the incidence of foodborne diseases. Next-generation sequencing of pure culture isolates in clinical microbiology laboratories has the potential to revolutionize the fields of food safety and public health. Metagenomics and other ‘omics’ disciplines could provide the solution to a cultureless future in clinical microbiology, food safety and public health. Data mining of information obtained from metagenomics assays can be particularly useful for the identification of clinical causative agents or foodborne contamination, detection of AMR and/or virulence factors, in addition to providing high-resolution subtyping data. Thus, metagenomics assays may provide a universal test for clinical diagnostics, foodborne pathogen detection, subtyping and investigation. This information has the potential to reform the field of enteric disease diagnostics and surveillance and also infectious diseases as a whole. The aim of this review will be to present the current state of CIDTs in diagnostic and public health laboratories as they relate to foodborne illness and food safety. Moreover, we will also discuss the diagnostic and subtyping utility and concomitant bias limitations of

Mixed-culture transcriptome analysis reveals the molecular basis of mixed-culture growth in Streptococcus thermophilus and Lactobacillus bulgaricus.

Science.gov (United States)

Sieuwerts, Sander; Molenaar, Douwe; van Hijum, Sacha A F T; Beerthuyzen, Marke; Stevens, Marc J A; Janssen, Patrick W M; Ingham, Colin J; de Bok, Frank A M; de Vos, Willem M; van Hylckama Vlieg, Johan E T

2010-12-01

Many food fermentations are performed using mixed cultures of lactic acid bacteria. Interactions between strains are of key importance for the performance of these fermentations. Yogurt fermentation by Streptococcus thermophilus and Lactobacillus bulgaricus (basonym, Lactobacillus delbrueckii subsp. bulgaricus) is one of the best-described mixed-culture fermentations. These species are believed to stimulate each other's growth by the exchange of metabolites such as folic acid and carbon dioxide. Recently, postgenomic studies revealed that an upregulation of biosynthesis pathways for nucleotides and sulfur-containing amino acids is part of the global physiological response to mixed-culture growth in S. thermophilus, but an in-depth molecular analysis of mixed-culture growth of both strains remains to be established. We report here the application of mixed-culture transcriptome profiling and a systematic analysis of the effect of interaction-related compounds on growth, which allowed us to unravel the molecular responses associated with batch mixed-culture growth in milk of S. thermophilus CNRZ1066 and L. bulgaricus ATCC BAA-365. The results indicate that interactions between these bacteria are primarily related to purine, amino acid, and long-chain fatty acid metabolism. The results support a model in which formic acid, folic acid, and fatty acids are provided by S. thermophilus. Proteolysis by L. bulgaricus supplies both strains with amino acids but is insufficient to meet the biosynthetic demands for sulfur and branched-chain amino acids, as becomes clear from the upregulation of genes associated with these amino acids in mixed culture. Moreover, genes involved in iron uptake in S. thermophilus are affected by mixed-culture growth, and genes coding for exopolysaccharide production were upregulated in both organisms in mixed culture compared to monocultures. The confirmation of previously identified responses in S. thermophilus using a different strain combination

Investigating the diversity of Pseudomonas spp. in soil using culture dependent and independent techniques

DEFF Research Database (Denmark)

Li, Lili; Abu Al-Soud, Waleed; Bergmark, Lasse

2013-01-01

Less than 1% of bacterial populations present in environmental samples are culturable, meaning that cultivation will lead to an underestimation of total cell counts and total diversity. However, it is less clear whether this is also true for specific well-defined groups of bacteria for which sele...... selective culture media is available. In this study, we use culture dependent and independent techniques to describe whether isolation of Pseudomonas spp. on selective nutrient-poor NAA 1: 100 agar-medium can reflect the full diversity, found by ...

Computational methods for molecular imaging

CERN Document Server

Shi, Kuangyu; Li, Shuo

2015-01-01

This volume contains original submissions on the development and application of molecular imaging computing. The editors invited authors to submit high-quality contributions on a wide range of topics including, but not limited to: • Image Synthesis & Reconstruction of Emission Tomography (PET, SPECT) and other Molecular Imaging Modalities • Molecular Imaging Enhancement • Data Analysis of Clinical & Pre-clinical Molecular Imaging • Multi-Modal Image Processing (PET/CT, PET/MR, SPECT/CT, etc.) • Machine Learning and Data Mining in Molecular Imaging. Molecular imaging is an evolving clinical and research discipline enabling the visualization, characterization and quantification of biological processes taking place at the cellular and subcellular levels within intact living subjects. Computational methods play an important role in the development of molecular imaging, from image synthesis to data analysis and from clinical diagnosis to therapy individualization. This work will bring readers fro...

Cross-cultural validation of the Persian version of the Functional Independence Measure for patients with stroke.

Science.gov (United States)

Naghdi, Soofia; Ansari, Noureddin Nakhostin; Raji, Parvin; Shamili, Aryan; Amini, Malek; Hasson, Scott

2016-01-01

To translate and cross-culturally adapt the Functional Independence Measure (FIM) into the Persian language and to test the reliability and validity of the Persian FIM (PFIM) in patients with stroke. In this cross-sectional study carried out in an outpatient stroke rehabilitation center, 40 patients with stroke (mean age 60 years) were participated. A standard forward-backward translation method and expert panel validation was followed to develop the PFIM. Two experienced occupational therapists (OTs) assessed the patients independently in all items of the PFIM in a single session for inter-rater reliability. One of the OTs reassessed the patients after 1 week for intra-rater reliability. There were no floor or ceiling effects for the PFIM. Excellent inter-rater and intra-rater reliability was noted for the PFIM total score, motor and cognitive subscales (ICC(agreement)0.88-0.98). According to the Bland-Altman agreement analysis, there was no systematic bias between raters and within raters. The internal consistency of the PFIM was with Cronbach's alpha from 0.70 to 0.96. The principal component analysis with varimax rotation indicated a three-factor structure: (1) self-care and mobility; (2) sphincter control and (3) cognitive that jointly accounted for 74.8% of the total variance. Construct validity was supported by a significant Pearson correlation between the PFIM and the Persian Barthel Index (r = 0.95; p Persian patients with stroke. The Functional Independence Measure (FIM) is an outcome measure for disability based on the International Classification of Functioning, Disability and Health (ICF). The FIM was cross-culturally adapted and validated into Persian language. The Persian version of the FIM (PFIM) is reliable and valid for assessing functional status of patients with stroke. The PFIM can be used in Persian speaking countries to assess the limitations in activities of daily living of patients with stroke.

Microbial ecology of artisanal italian cheese: Molecular microbial characterization by culture-independent method

International Nuclear Information System (INIS)

Colombo, E.; Scarpellini, M.; Franzatti, L.; Dioguardi, L.

2009-01-01

Present study will treat the next topics: ecology of the natural and man made environments and functional diversity of bacteria. The microbial communities in artisanal goat cheeses produced in mountain pastures (typical farms) in Piemonte mountain (North of Italy) change a lot during precessing and ripening time. Moreover cheese microbial ecosystems are different in each small dairy because adventitious microflora can come from the environment and contamination the milk before the cheese making process and the product during manufacture and ripening. (Author)

Microbial ecology of artisanal italian cheese: Molecular microbial characterization by culture-independent method

Energy Technology Data Exchange (ETDEWEB)

Colombo, E.; Scarpellini, M.; Franzatti, L.; Dioguardi, L.

2009-07-01

Present study will treat the next topics: ecology of the natural and man made environments and functional diversity of bacteria. The microbial communities in artisanal goat cheeses produced in mountain pastures (typical farms) in Piemonte mountain (North of Italy) change a lot during precessing and ripening time. Moreover cheese microbial ecosystems are different in each small dairy because adventitious microflora can come from the environment and contamination the milk before the cheese making process and the product during manufacture and ripening. (Author)

The Optimization of Molecular Detection of Clinical Isolates of Brucella in Blood Cultures by eryD Transcriptase Gene for Confirmation of Culture-Negative Samples.

Science.gov (United States)

Tabibnejad, Mahsa; Alikhani, Mohammad Yousef; Arjomandzadegan, Mohammad; Hashemi, Seyed Hamid; Naseri, Zahra

2016-04-01

Brucellosis is a zoonosis disease which is widespread across the world. The aim of the present study is the evaluation of culture-negative blood samples. A total of 100 patients with suspected brucellosis were included in this experimental study and given positive serological tests. Diagnosis was performed on patients with clinical symptoms of the disease, followed by the detection of a titer that was equal to or more than 1:160 (in endemic areas) by the standard tube agglutination method. Blood samples were cultured by a BACTEC 9050 system, and subsequently by Brucella agar. At the same time, DNA from all blood samples was extracted by Qiagen Kit Company (Qia Amp Mini Kit). A molecular assay of blood samples was carried out by detection of eryD transcriptase and bcsp 31 genes in specific double PCR reactions. The specificity of the primers was evaluated by DNA from pure and approved Brucella colonies found in the blood samples, by DNA from other bacteria, and by ordinary PCR. DNA extraction from the pure colonies was carried out by both Qiagen Kit and Chelex 100 methods; the two were compared. 39 cases (39%) had positive results when tested by the BACTEC system, and 61 cases (61%) became negative. 23 culture-positive blood samples were randomly selected for PCR reactions; all showed 491 bp for the eryD gene and 223 bp for the bcsp 31 gene. Interestingly, out of 14 culture-negative blood samples, 13 cases showed positive bonds in PCR. The specificity of the PCR method was equal to 100%. DNA extraction from pure cultures was done by both Chelex 100 and Qiagen Kit; these showed the same results for all samples. The results prove that the presented double PCR method could be used to detect positive cases from culture-negative blood samples. The Chelex 100 method is simpler and safer than the use of Qiagen Kit for DNA extraction.

Model independent method to deconvolve hard X-ray spectra

Energy Technology Data Exchange (ETDEWEB)

Polcaro, V.F.; Bazzano, A.; Ubertini, P.; La Padula, C. (Consiglio Nazionale delle Ricerche, Frascati (Italy). Lab. di Astrofisica Spaziale); Manchanda, R.K. (Tata Inst. of Fundamental Research, Bombay (India))

1984-07-01

A general purpose method to deconvolve the energy spectra detected by means of the use of a hard X-ray telescope is described. The procedure does not assume any form of input spectrum and the observed energy loss spectrum is directly deconvolved into the incident photon spectrum, the form of which can be determined independently of physical interpretation of the data. Deconvolution of the hard X-ray spectrum of Her X-1, detected during the HXR 81M experiment, by the method independent method is presented.

Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene

Directory of Open Access Journals (Sweden)

Jalal Mardaneh

2013-11-01

Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.

Immobilization with Metal Hydroxides as a Means To Concentrate Food-Borne Bacteria for Detection by Cultural and Molecular Methods†

OpenAIRE

Lucore, Lisa A.; Cullison, Mark A.; Jaykus, Lee-Ann

2000-01-01

The application of nucleic acid amplification methods to the detection of food-borne pathogens could be facilitated by concentrating the organisms from the food matrix before detection. This study evaluated the utility of metal hydroxide immobilization for the concentration of bacterial cells from dairy foods prior to detection by cultural and molecular methods. Using reconstituted nonfat dry milk (NFDM) as a model, two food-borne pathogens (Listeria monocytogenes and Salmonella enterica sero...

Salesperson Self-Regulation of Pride: Effects on Adaptability, Effort, and Citizenship Behaviors between Independent-Based and Interdependent-Based Cultures

NARCIS (Netherlands)

Bagozzi, R.P.; Belschak, F.; Verbeke, W.; Gavino, J.R.

2016-01-01

We investigate and compare how salespersons within an independent-based culture (the Netherlands) and an interdependent-based culture (the Philippines) experience and self-regulate pride that is evoked through praise and recognition by their managers. This self-regulation differentially influences

Direct Detection and Identification of Enteroviruses from Faeces of Healthy Nigerian Children Using a Cell-Culture Independent RT-Seminested PCR Assay

Directory of Open Access Journals (Sweden)

Temitope Oluwasegun Cephas Faleye

2016-01-01

Full Text Available Recently, a cell-culture independent protocol for detection of enteroviruses from clinical specimen was recommended by the WHO for surveillance alongside the previously established protocols. Here, we investigated whether this new protocol will show the same enterovirus diversity landscape as the established cell-culture dependent protocols. Faecal samples were collected from sixty apparently healthy children in Ibadan, Nigeria. Samples were resuspended in phosphate buffered saline, RNA was extracted, and the VP1 gene was amplified using WHO recommended RT-snPCR protocol. Amplicons were sequenced and sequences subjected to phylogenetic analysis. Fifteen (25% of the 60 samples yielded the expected band size. Of the 15 amplicons sequenced, 12 were exploitable. The remaining 3 had electropherograms with multiple peaks and were unexploitable. Eleven of the 12 exploitable sequences were identified as Coxsackievirus A1 (CVA1, CVA3, CVA4, CVA8, CVA20, echovirus 32 (E32, enterovirus 71 (EV71, EVB80, and EVC99. Subsequently, the last exploitable sequence was identified as enterobacteriophage baseplate gene by nucleotide BLAST. The results of this study document the first description of molecular sequence data on CVA1, CVA8, and E32 strains present in Nigeria. The result further showed that species A enteroviruses were more commonly detected in the region when cell-culture bias is bypassed.

Culture-independent analysis of aerosol microbiology in a metropolitan subway system.

Science.gov (United States)

Robertson, Charles E; Baumgartner, Laura K; Harris, J Kirk; Peterson, Kristen L; Stevens, Mark J; Frank, Daniel N; Pace, Norman R

2013-06-01

The goal of this study was to determine the composition and diversity of microorganisms associated with bioaerosols in a heavily trafficked metropolitan subway environment. We collected bioaerosols by fluid impingement on several New York City subway platforms and associated sites in three sampling sessions over a 1.5-year period. The types and quantities of aerosolized microorganisms were determined by culture-independent phylogenetic analysis of small-subunit rRNA gene sequences by using both Sanger (universal) and pyrosequencing (bacterial) technologies. Overall, the subway bacterial composition was relatively simple; only 26 taxonomic families made up ~75% of the sequences determined. The microbiology was more or less similar throughout the system and with time and was most similar to outdoor air, consistent with highly efficient air mixing in the system. Identifiable bacterial sequences indicated that the subway aerosol assemblage was composed of a mixture of genera and species characteristic of soil, environmental water, and human skin commensal bacteria. Eukaryotic diversity was mainly fungal, dominated by organisms of types associated with wood rot. Human skin bacterial species (at 99% rRNA sequence identity) included the Staphylococcus spp. Staphylococcus epidermidis (the most abundant and prevalent commensal of the human integument), S. hominis, S. cohnii, S. caprae, and S. haemolyticus, all well-documented human commensal bacteria. We encountered no organisms of public health concern. This study is the most extensive culture-independent survey of subway microbiota so far and puts in place pre-event information required for any bioterrorism surveillance activities or monitoring of the microbiological impact of recent subway flooding events.

Culture -independent Pathogenic Bacterial Communities in Bottled Mineral Water

Directory of Open Access Journals (Sweden)

Hamdy A. Hassan

2015-08-01

Full Text Available Bottled mineral water (BMW is an alternative to mains water and consider it to be better and safer. Access to safe BMW from the bacteria involving potential health hazard is essential to health. Cultivation-independent technique PCR-based single-strand conformation polymorphism (SSCP for genetic profiling of PCR-amplified 16S rRNA genes was performed using Com primer set targeting the 16S rRNA genes for detection of pathogenic bacteria in bottled mineral water from the final product of six factories for bottled mineral drinking water in Wadi El-natron region- Egypt. These factories use often ozone technology to treat large quantities of water because of its effectiveness in purifying and conditioning water. A total of 27 single products were isolated from the profiles by PCR re-amplification and cloning. Sequence analysis of 27 SSCP bands revealed that the 16S rRNA sequences were clustered into seven operational taxonomic units (OTUs and the compositions of the communities of the six samples were all common. The results showed that most communities from phyla Alphaproteobacteria and certainly in the Sphingomonas sp. Culture-independent approaches produced complementary information, thus generating a more accurate view for the bacterial community in the BMW, particularly in the disinfection step, as it constitutes the final barrier before BMW distribution to the consumer

[Molecular typing methods for Pasteurella multocida-A review].

Science.gov (United States)

Peng, Zhong; Liang, Wan; Wu, Bin

2016-10-04

Pasteurella multocida is an important gram-negative pathogenic bacterium that could infect wide ranges of animals. Humans could also be infected by P. multocida via animal bite or scratching. Current typing methods for P. multocida include serological typing methods and molecular typing methods. Of them, serological typing methods are based on immunological assays, which are too complicated for clinical bacteriological studies. However, the molecular methods including multiple PCRs and multilocus sequence typing (MLST) methods are more suitable for bacteriological studies of P. multocida in clinic, with their simple operation, high efficiency and accurate detection compared to the traditional serological typing methods, they are therefore widely used. In the current review, we briefly describe the molecular typing methods for P. multocida. Our aim is to provide a knowledge-foundation for clinical bacteriological investigation especially the molecular investigation for P. multocida.

Microbial diversity and dynamics throughout manufacturing and ripening of surface ripened semi-hard Danish Danbo cheeses investigated by culture-independent techniques

DEFF Research Database (Denmark)

Ryssel, Mia; Johansen, Pernille; Abu Al-Soud, Waleed

2015-01-01

) and pyrosequencing, using amplicons of 16S and 26S rRNA genes for prokaryotes and eukaryotes, respectively. With minor exceptions, the results from the culture-independent analyses correlated to the culture-dependent plating results. Even though the predominant microorganisms detected with the two culture...

Biodeterioration of epoxy resin: a microbial survey through culture-independent and culture-dependent approaches.

Science.gov (United States)

Pangallo, Domenico; Bučková, Maria; Kraková, Lucia; Puškárová, Andrea; Šaková, Nikoleta; Grivalský, Tomaš; Chovanová, Katarina; Zemánková, Milina

2015-02-01

During the 20th century, synthetic polymers were greatly used in the field of art. In particular, the epoxy resins were used for both conservation and for creating sculptures. The biodeterioration of these polymers has not been adequately studied. The aim of this investigation was to examine the microflora responsible for the deterioration of an epoxy statue exposed to outdoor conditions. Fungal and bacterial microflora were isolated from the art object, clustered by fluorescence-ITS (internal transcribed spacer), identified by ITS and 16S rRNA sequencing and tested for their lipolytic abilities by three agar assays. Different algal, bacterial, cyanobacterial and fungal clone libraries were constructed. The surrounding airborne microflora was analyzed using culture-dependent and culture-independent approaches. The results indicated the presence, on the statue surface, of an interesting and differentiate microbial community composed of rock-inhabiting members, algal photobionts (Trebouxia spp., Chloroidium ellipsoideum and Chlorella angustoellipsoidea), Cyanobacteria (Leptolyngbya sp., Phormidium sp., Cylindrospermum stagnale, Hassallia byssoidea and Geitlerinema sp.), black yeasts related to the species Friedmanniomyces endolithicus, Pseudotaeniolina globosa, Phaeococcomyces catenatus and Catenulostroma germanicum and several plant-associated fungi. This investigation provides new information on the potential microfloral inhabitants of epoxy resin discovering a new ecological niche, occupied mainly by several members of rock-colonizing microbial species. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Low Fluid Shear Culture of Staphylococcus Aureus Represses hfq Expression and Induces an Attachment-Independent Biofilm Phenotype

Science.gov (United States)

Ott, C. Mark; Castro, S. L.; Nickerson, C. A.; Nelman-Gonzalez, M.

2011-01-01

Background: The opportunistic pathogen, Staphylococcus aureus, experiences fluctuations in fluid shear during infection and colonization of a human host. Colonization frequently occurs at mucus membrane sites such as in the gastrointestinal tract where the bacterium may experience low levels of fluid shear. The response of S. aureus to low fluid shear remains unclear. Methods: S. aureus was cultured to stationary phase using Rotating-Wall Vessel (RWV) bioreactors which produce a physiologically relevant low fluid shear environment. The bacterial aggregates that developed in the RWV were evaluated by electron microscopy as well as for antibiotic resistance and other virulence-associated stressors. Genetic expression profiles for the low-shear cultured S. aureus were determined by microarray analysis and quantitative real-time PCR. Results: Planktonic S. aureus cultures in the low-shear environment formed aggregates completely encased in high amounts of extracellular polymeric substances. In addition, these aggregates demonstrated increased antibiotic resistance indicating attachment-independent biofilm formation. Carotenoid production in the low-shear cultured S. aureus was significantly decreased, and these cultures displayed an increased susceptibility to oxidative stress and killing by whole blood. The hfq gene, associated with low-shear growth in Gram negative organisms, was also found to be down-regulated in S. aureus. Conclusions: Collectively, this data suggests that S. aureus decreases virulence characteristics in favor of a biofilm-dwelling colonization phenotype in response to a low fluid shear environment. Furthermore, the identification of an Hfq response to low-shear culture in S. aureus, in addition to the previously reported responses in Gram negative organisms, strongly suggests an evolutionarily conserved response to mechanical stimuli among structurally diverse prokaryotes.

Application of culture dependent and cultural-independent techniques to investigate the dynamics of microorganisms during industrial cheese making of a Gouda type cheese

OpenAIRE

Perolari, Alessandra

2012-01-01

The aim of this work was to study the microbial dynamic in a Gouda type cheese applying a comparison between culture-dependent technique, plate count, and culture-independent technique as PCR-DGGE. The study was also focus on the analyse of the efficiency of the pasteurizer, and its cleaning steps. The study was conducted analysing 4 batches for each of the two days of production, Monday and Friday. Between batch 16 and 17 there was a quick cleaning, and between batch 32 and batch 1, of th...

Detection of microbial diversity in endocarditis using cultivation-independent molecular techniques

DEFF Research Database (Denmark)

Wolff, Tine Y; Moser, Claus Ernst; Bundgaard, Henning

2011-01-01

Background: The aim of this study was to investigate whether the diagnosis of infective endocarditis (IE) could be improved using molecular tools in addition to standard microscopy and cultivation methods. Methods: Cultivation was performed on blood or tissue samples as recommended in the modified...

Molecular screening for Candida orthopsilosis and Candida metapsilosis among Danish Candida parapsilosis group blood culture isolates: proposal of a new RFLP profile for differentiation

DEFF Research Database (Denmark)

Mirhendi, Hossein; Bruun, Brita; Schønheyder, Henrik Carl

2010-01-01

Candida orthopsilosis and Candida metapsilosis are recently described species phenotypically indistinguishable from Candida parapsilosis . We evaluated phenotyping and molecular methods for the detection of these species among 79 unique blood culture isolates of the C. parapsilosis group obtained...

Cultural and Molecular Evidence of Legionella spp. Colonization in Dental Unit Waterlines: Which Is the Best Method for Risk Assessment?

Science.gov (United States)

Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M

2016-02-06

Legionella spp. are ubiquitous in aquatic habitats and water distribution systems, including dental unit waterlines (DUWLs). The aim of the present study was to determine the prevalence of Legionella in DUWLs and tap water samples using PMA-qPCR and standard culture methods. The total viable counts (TVCs) of aerobic heterotrophic bacteria in the samples were also determined. Legionella spp. were detected and quantified using the modified ISO 11731 culture method. Extracted genomic DNA was analysed using the iQ-Check Quanti Legionella spp. kit, and the TVCs were determined according to the ISO protocol 6222. Legionella spp. were detected in 100% of the samples using the PMA-qPCR method, whereas these bacteria were detected in only 7% of the samples using the culture method. The number of colony forming units (CFUs) of the TVCs in the DUWL and tap water samples differed, with the bacterial load being significantly lower in the tap water samples (p-value = 0). The counts obtained were within the Italian standard range established for potable water in only 5% of the DUWL water samples and in 77% of the tap water samples. Our results show that the level of Legionella spp. contamination determined using the culture method does not reflect the true scale of the problem, and consequently we recommend testing for the presence of aerobic heterotrophic bacteria based on the assumption that Legionella spp. are components of biofilms.

Detection of Mycobacterium avium subsp. paratuberculosis from cattle and buffaloes in Egypt using traditional culture, serological and molecular based methods

Directory of Open Access Journals (Sweden)

G. S. Abdellrazeq

2014-08-01

Full Text Available Background: Johne's disease (JD caused by Mycobacterium avium subsp. paratuberculosis (MAP represents a real threat to the agriculture and dairy food industries and believed to be a potential public health problem. Signs of infection in ruminant include weight loss, diarrhea, decreased milk production, and eventually death. The definition of an infected animal based either on the presence of anti-MAP antibodies, or positive bacterial culture. No treatment for the disease exists and controlling the disease is difficult due to its long latent period. JD is a worldwide problem and multiple studies in many countries have been carried out to determine the prevalence of MAP infections. Although some primary non intensive studies confirm presence of JD in Egypt, the disease is currently neglected by the official Egyptian veterinary agencies. There is no official data, no national control program, and no used vaccine. Aim: This study aimed to evaluate three conventional diagnostic methods for MAP under the Egyptian circumstances with a general aim to determine the appropriate strategy to develop a JD control program. These methods were pooled fecal culture, humoral response and insertion sequence IS900 targets polymerase chain reaction (IS900 PCR. Materials and Methods: Fecal and serum samples (500 each were collected from Holstein-Friesian cattle and buffaloes housed in five Egyptian governorates. Fecal samples were examined for MAP on the basis of a strategic pooling procedure and performed on Herrold's Egg Yolk Agar Medium (HEYM. Smears were prepared from developed colonies and stained using a Ziehl-Neelsen (ZN technique. The identity of developed colonies was further confirmed by PCR analysis of IS900 sequence. Sera from both culture-positive and culture-negative animals were evaluated individually for humoral response. Results: Out of 50 pooled specimens, 34 (68% fecal cultures were positive for MAP. Serum positive samples of culture

Statistical adjustment of culture-independent diagnostic tests for trend analysis in the Foodborne Diseases Active Surveillance Network (FoodNet), USA.

Science.gov (United States)

Gu, Weidong; Dutta, Vikrant; Patrick, Mary; Bruce, Beau B; Geissler, Aimee; Huang, Jennifer; Fitzgerald, Collette; Henao, Olga

2018-03-19

Culture-independent diagnostic tests (CIDTs) are increasingly used to diagnose Campylobacter infection in the Foodborne Diseases Active Surveillance Network (FoodNet). Because CIDTs have different performance characteristics compared with culture, which has been used historically and is still used to diagnose campylobacteriosis, adjustment of cases diagnosed by CIDT is needed to compare with culture-confirmed cases for monitoring incidence trends. We identified the necessary parameters for CIDT adjustment using culture as the gold standard, and derived formulas to calculate positive predictive values (PPVs). We conducted a literature review and meta-analysis to examine the variability in CIDT performance and Campylobacter prevalence applicable to FoodNet sites. We then developed a Monte Carlo method to estimate test-type and site-specific PPVs with their associated uncertainties. The uncertainty in our estimated PPVs was largely derived from uncertainty about the specificity of CIDTs and low prevalence of Campylobacter in tested samples. Stable CIDT-adjusted incidences of Campylobacter cases from 2012 to 2015 were observed compared with a decline in culture-confirmed incidence. We highlight the lack of data on the total numbers of tested samples as one of main limitations for CIDT adjustment. Our results demonstrate the importance of adjusting CIDTs for understanding trends in Campylobacter incidence in FoodNet.

A safety culture assessment by mixed methods at a public maternity and infant hospital in China

Directory of Open Access Journals (Sweden)

Listyowardojo TA

2017-07-01

Full Text Available Tita Alissa Listyowardojo,1 Xiaoling Yan,2,3 Stephen Leyshon,1 Bobbie Ray-Sannerud,1 Xin Yan Yu,4 Kai Zheng,4 Tao Duan2,3 1Life Sciences Program, Group Technology and Research, DNV GL, Hovik, Norway; 2Quality and Safety Department, Shanghai First Maternity and Infant Hospital, 3Tongji University School of Medicine, Shanghai, 4Healthcare Department, Business Assurance, DNV GL, Beijing, China Objective: To assess safety culture at a public maternity hospital in Shanghai, China, using a sequential mixed methods approach. The study was part of a bigger study looking at the application of the mixed methods approach to assess safety culture in health care in different organizations and countries.Methodology: A mixed methods approach was utilized by first distributing the Safety Attitudes Questionnaire measuring six safety culture dimensions and five independent items to all hospital staff (n=1482 working in 18 departments at a single hospital. Afterward, semistructured interviews were conducted using convenience sampling, where 48 hospital staff from nine departments at the same hospital were individually interviewed.Results: The survey received a response rate of 96%. The survey findings show significant differences between the hospital departments in almost all safety culture dimensions and independent items. Similarly, the interview findings revealed that there were different, competing priorities between departments perceived to result in a reduced quality of collaboration and bottlenecks in care delivery. Another major finding was that staff who worked more hours per week would perceive working conditions significantly more negatively. Issues related to working conditions were also the most common concerns discussed in the interviews, especially the issue on high workload. High workload was also reflected in the fact that 91.45% of survey respondents reported that they worked 40 hours or longer per week. Finally, interview findings complemented

The frequency-independent control method for distributed generation systems

DEFF Research Database (Denmark)

Naderi, Siamak; Pouresmaeil, Edris; Gao, Wenzhong David

2012-01-01

In this paper a novel frequency-independent control method suitable for distributed generation (DG) is presented. This strategy is derived based on the . abc/. αβ transformation and . abc/. dq transformation of the ac system variables. The active and reactive currents injected by the DG are contr......In this paper a novel frequency-independent control method suitable for distributed generation (DG) is presented. This strategy is derived based on the . abc/. αβ transformation and . abc/. dq transformation of the ac system variables. The active and reactive currents injected by the DG...

Cellular Molecular Changes in Nerium oleander (L.) Cell Culture Under Gamma Radiation Stress

International Nuclear Information System (INIS)

Salama, I.M.; Abd EL-Megid, M.H.M.

2017-01-01

This study was done to analyze the relationship between the various effects of five different doses of gamma ray treatments (control, 0, 100, 200, 300 and 400 rad) on cell suspension culture of Nerium oleander belonging to the family Apocynaceae, Plant samples were collected from Egyptian flora. The five treatments of the plants were characterized by analyzing variability in frozen biomass cell suspension culture of N. oleander through SDS PAGE and peroxidase is ozymes. The electrophorogram showed a total of 36 bands of proteins with molecular weight ranging from 10 to 225 KDa. The protein diversity analysis was done based on the presence or the absence of bands trhus interpreting their relevance. The his togram analysis clearly showed a high degree of diversity a long these five treatments of the plant. The results of electrophoretic patterns of peroxidase is ozymes that was extracted from frozen biomass cell suspension cultures after receiving the different gamma doses revealed remarkable molecular changes in all treatments. These changes in peroxidase isozymes and protein bands indicate the effect of the different irradiation treatments on the gene expiration

A model independent method to deconvolve hard X-ray spectra

International Nuclear Information System (INIS)

Polcaro, V.F.; Bazzano, A.; Ubertini, P.; La Padula, C.

1984-01-01

A general purpose method to deconvolve the energy spectra detected by means of the use of a hard X-ray telescope is described. The procedure does not assume any form of input spectrum and the observed energy loss spectrum is directly deconvolved into the incident photon spectrum, the form of which can be determined independently of physical interpretation of the data. Deconvolution of the hard X-ray spectrum of Her X-1, detected during the HXR 81M experiment, by the method independent method is presented. (orig.)

Capture of cell culture-derived influenza virus by lectins: strain independent, but host cell dependent.

Science.gov (United States)

Opitz, Lars; Zimmermann, Anke; Lehmann, Sylvia; Genzel, Yvonne; Lübben, Holger; Reichl, Udo; Wolff, Michael W

2008-12-01

Strategies to control influenza outbreaks are focused mainly on prophylactic vaccination. Human influenza vaccines are trivalent blends of different virus subtypes. Therefore and due to frequent antigenic drifts, strain independent manufacturing processes are required for vaccine production. This study verifies the strain independency of a capture method based on Euonymus europaeus lectin-affinity chromatography (EEL-AC) for downstream processing of influenza viruses under various culture conditions propagated in MDCK cells. A comprehensive lectin binding screening was conducted for two influenza virus types from the season 2007/2008 (A/Wisconsin/67/2005, B/Malaysia/2506/2004) including a comparison of virus-lectin interaction by surface plasmon resonance technology. EEL-AC resulted in a reproducible high product recovery rate and a high degree of contaminant removal in the case of both MDCK cell-derived influenza virus types demonstrating clearly the general applicability of EEL-AC. In addition, host cell dependency of EEL-AC was studied with two industrial relevant cell lines: Vero and MDCK cells. However, the choice of the host cell lines is known to lead to different product glycosylation profiles. Hence, altered lectin specificities have been observed between the two cell lines, requiring process adaptations between different influenza vaccine production systems.

Microbial diversity and dynamics throughout manufacturing and ripening of surface ripened semi-hard Danish Danbo cheeses investigated by culture-independent techniques.

Science.gov (United States)

Ryssel, Mia; Johansen, Pernille; Al-Soud, Waleed Abu; Sørensen, Søren; Arneborg, Nils; Jespersen, Lene

2015-12-23

Microbial successions on the surface and in the interior of surface ripened semi-hard Danish Danbo cheeses were investigated by culture-dependent and -independent techniques. Culture-independent detection of microorganisms was obtained by denaturing gradient gel electrophoresis (DGGE) and pyrosequencing, using amplicons of 16S and 26S rRNA genes for prokaryotes and eukaryotes, respectively. With minor exceptions, the results from the culture-independent analyses correlated to the culture-dependent plating results. Even though the predominant microorganisms detected with the two culture-independent techniques correlated, a higher number of genera were detected by pyrosequencing compared to DGGE. Additionally, minor parts of the microbiota, i.e. comprising surface and the interior of the cheeses diverged. During cheese production pyrosequencing determined Lactococcus as the dominating genus on cheese surfaces, representing on average 94.7%±2.1% of the OTUs. At day 6 Lactococcus spp. declined to 10.0% of the OTUs, whereas Staphylococcus spp. went from 0.0% during cheese production to 75.5% of the OTUs at smearing. During ripening, i.e. from 4 to 18 weeks, Corynebacterium was the dominant genus on the cheese surface (55.1%±9.8% of the OTUs), with Staphylococcus (17.9%±11.2% of the OTUs) and Brevibacterium (10.4%±8.3% of the OTUs) being the second and third most abundant genera. Other detected bacterial genera included Clostridiisalibacter (5.0%±4.0% of the OTUs), as well as Pseudoclavibacter, Alkalibacterium and Marinilactibacillus, which represented surface ripened semi-hard cheeses. Copyright © 2015 Elsevier B.V. All rights reserved.

Multiple independent identification decisions: a method of calibrating eyewitness identifications.

Science.gov (United States)

Pryke, Sean; Lindsay, R C L; Dysart, Jennifer E; Dupuis, Paul

2004-02-01

Two experiments (N = 147 and N = 90) explored the use of multiple independent lineups to identify a target seen live. In Experiment 1, simultaneous face, body, and sequential voice lineups were used. In Experiment 2, sequential face, body, voice, and clothing lineups were used. Both studies demonstrated that multiple identifications (by the same witness) from independent lineups of different features are highly diagnostic of suspect guilt (G. L. Wells & R. C. L. Lindsay, 1980). The number of suspect and foil selections from multiple independent lineups provides a powerful method of calibrating the accuracy of eyewitness identification. Implications for use of current methods are discussed. ((c) 2004 APA, all rights reserved)

The place of molecular methods in the identification of dermatophytes and the determination of their feasibility

Directory of Open Access Journals (Sweden)

Fatma Bıyık

2013-03-01

Full Text Available Background and Design: Unlike opportunistic fungi, dermatophytes cannot be isolated on the conventional culture media in a few days. Their growing periods cover approximately two weeks in a suitable media and identification are made with conventional methods as typical macroscopic and microscopic appearance. However, successful results are not always obtained with the phenotypic features, and thus, diagnostic problems and delay in diagnosis and treatment may arise. For this reason, the methods based on nucleic acid amplification have been necessary. In this study, we aimed to identify 56 dermatophytes strains, which were identified by conventional methods, by molecular methods and to investigate the correlation between the two methods and to determine the usability of molecular methods in routine laboratories. Materials and Methods: Several clinical samples of 270 patients with suspected dermatophytoses (hair+scalp, skin and nail scrapings were examined by conventional methods; Sabouraud dextrose agar, corn meal agar and potato dextrose agar were used for isolation. In case of necessity to hydrolyze urea, to be used different vitamins in Trichophyton agar media were investigated. Polymerase chain reaction (PCR and sequence analyses were done for the molecular diagnosis. Results: Using conventional methods, 37 strains (66,1% were identified as Trichophyton(T rubrum, four (7.1% - T.mentagrophytes, four (7.1% - T.tonsurans, one (1.8% - T.violaceum, eight (14.3% - Trichophyton spp., one (1.8% - Microsporum(M canis, and one (1.8% - Microsporum spp. According to the molecular and sequence analyses results (T1PCR, 25GAPCR, ITSPCR-RFLP and sequence analyses, 41 (73.8% strains were identified as T.rubrum, 10 (17.8% - T.interdigitale, one (1.8% - T. violaceum, two (3.6% - M. canis, one (1.8% - Peacilomyces lilacinus, and one (1,8% - Aspergillus fumigatus. Discussion: This study suggests that, molecular methods offer fast and reliable results in

FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

Directory of Open Access Journals (Sweden)

Lu Jia

2011-10-01

Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

A simple transformation independent method for outlier definition.

Science.gov (United States)

Johansen, Martin Berg; Christensen, Peter Astrup

2018-04-10

Definition and elimination of outliers is a key element for medical laboratories establishing or verifying reference intervals (RIs). Especially as inclusion of just a few outlying observations may seriously affect the determination of the reference limits. Many methods have been developed for definition of outliers. Several of these methods are developed for the normal distribution and often data require transformation before outlier elimination. We have developed a non-parametric transformation independent outlier definition. The new method relies on drawing reproducible histograms. This is done by using defined bin sizes above and below the median. The method is compared to the method recommended by CLSI/IFCC, which uses Box-Cox transformation (BCT) and Tukey's fences for outlier definition. The comparison is done on eight simulated distributions and an indirect clinical datasets. The comparison on simulated distributions shows that without outliers added the recommended method in general defines fewer outliers. However, when outliers are added on one side the proposed method often produces better results. With outliers on both sides the methods are equally good. Furthermore, it is found that the presence of outliers affects the BCT, and subsequently affects the determined limits of current recommended methods. This is especially seen in skewed distributions. The proposed outlier definition reproduced current RI limits on clinical data containing outliers. We find our simple transformation independent outlier detection method as good as or better than the currently recommended methods.

Why are price stability and statutory independence of central banks negatively correlated? : the role of culture

NARCIS (Netherlands)

Jong, Eelke de

2001-01-01

This paper investigates whether in OECD-countries the negative relation between central bank independence and inflation is related to culture, in the sense of common values and norms. It appears that inflation is lower in countries where people dislike uncertainty. The tolerance in a society with

Culture, Interface Design, and Design Methods for Mobile Devices

Science.gov (United States)

Lee, Kun-Pyo

Aesthetic differences and similarities among cultures are obviously one of the very important issues in cultural design. However, ever since products became knowledge-supporting tools, the visible elements of products have become more universal so that the invisible parts of products such as interface and interaction are getting more important. Therefore, the cultural design should be extended to the invisible elements of culture like people's conceptual models beyond material and phenomenal culture. This chapter aims to explain how we address the invisible cultural elements in interface design and design methods by exploring the users' cognitive styles and communication patterns in different cultures. Regarding cultural interface design, we examined users' conceptual models while interacting with mobile phone and website interfaces, and observed cultural difference in performing tasks and viewing patterns, which appeared to agree with cultural cognitive styles known as Holistic thoughts vs. Analytic thoughts. Regarding design methods for culture, we explored how to localize design methods such as focus group interview and generative session for specific cultural groups, and the results of comparative experiments revealed cultural difference on participants' behaviors and performance in each design method and led us to suggest how to conduct them in East Asian culture. Mobile Observation Analyzer and Wi-Pro, user research tools we invented to capture user behaviors and needs especially in their mobile context, were also introduced.

Is perceived emotional support beneficial? Well-being and health in independent and interdependent cultures.

Science.gov (United States)

Uchida, Yukiko; Kitayama, Shinobu; Mesquita, Batja; Reyes, Jose Alberto S; Morling, Beth

2008-06-01

Previous studies show there is little or no association between perceived emotional support and well-being in European American culture. The authors hypothesized that this paradoxical absence of any benefit of perceived support is unique to cultural contexts that privilege independence rather than interdependence of the self. Study 1 tested college students and found, as predicted, that among Euro-Americans a positive effect of perceived emotional support on subjective well-being (positive affect) was weak and, moreover, it disappeared entirely once self-esteem was statistically controlled. In contrast, among Asians in Asia (Japanese and Filipinos) perceived emotional support positively predicted subjective well-being even after self-esteem was controlled. Study 2 extended Study 1 by testing both Japanese and American adults in midlife with respect to multiple indicators of well-being and physical health. Overall, the evidence underscores the central significance of culture as a moderator of the effectiveness of perceived emotional support.

Effects of chitosan oligosaccharides on microbiota composition of silver carp (Hypophthalmichthys molitrix) determined by culture-dependent and independent methods during chilled storage.

Science.gov (United States)

Jia, Shiliang; Liu, Xiaochang; Huang, Zhan; Li, Yan; Zhang, Longteng; Luo, Yongkang

2018-03-02

This study evaluated the effects of chitosan oligosaccharides (COS) on the changes in quality and microbiota of silver carp fillets stored at 4 °C. During storage, 1% (w/v) COS treated samples maintained good quality, as evidenced by retarding sensory deterioration, inhibiting microbial growth, attenuating the production of total volatile basic nitrogen, putrescine, cadaverine and hypoxanthine, and delaying degradation of inosine monophosphate and hypoxanthine ribonucleotide. Meanwhile, variability in the predominant microbiota in different samples was investigated by culture-dependent and -independent methods. Based on sensory analysis, shelf-life of silver carp fillets was 4 days for the control and 6 days for COS treated samples. Meanwhile, Pseudomonas, followed by Aeromonas, Acinetobacter, and Shewanella were dominated in the control samples at day 4 and contributed to fish spoilage at day 6. However, COS inhibited the growth of Pseudomonas, Aeromonas, and Shewanella significantly. Consequently, Acinetobacter followed by Pseudomonas became the predominant microbiota in COS treated samples at day 6. With the growth of Pseudomonas, COS treated samples were spoiled at day 8. Therefore, COS improved the quality of fillets and prolonged the shelf life of silver carp fillets by 2 days during chilled storage, which was mainly due to their modulating effects on microbiota. Copyright © 2018 Elsevier B.V. All rights reserved.

Culture and molecular identification of fungal contaminants in edible bird nests.

Science.gov (United States)

Chen, Jennifer Xiao Jing; Wong, Shew Fung; Lim, Patricia Kim Chooi; Mak, Joon Wah

2015-01-01

Widespread food poisoning due to microbial contamination has been a major concern for the food industry, consumers and governing authorities. This study is designed to determine the levels of fungal contamination in edible bird nests (EBNs) using culture and molecular techniques. Raw EBNs were collected from five house farms, and commercial EBNs were purchased from five Chinese traditional medicine shops (companies A-E) in Peninsular Malaysia. The fungal contents in the raw and commercial EBNs, and boiled and unboiled EBNs were determined. Culturable fungi were isolated and identified. In this study, the use of these methods revealed that all EBNs had fungal colony-forming units (CFUs) that exceeded the limit set by Standards and Industrial Research Institute of Malaysia (SIRIM) for yeast and moulds in EBNs. There was a significant difference (p 0.05). The types of fungi isolated from the unboiled raw EBNs were mainly soil, plant and environmental fungi, while the types of fungi isolated from the boiled raw EBNs, unboiled and boiled commercial EBNs were mainly environmental fungi. Aspergillus sp., Candida sp., Cladosporium sp., Neurospora sp. and Penicillum sp. were the most common fungi isolated from the unboiled and boiled raw and commercial EBNs. Some of these fungi are mycotoxin producers and cause opportunistic infections in humans. Further studies to determine the mycotoxin levels and methods to prevent or remove these contaminations from EBNs for safe consumption are necessary. The establishment and implementation of stringent regulations for the standards of EBNs should be regularly updated and monitored to improve the quality of the EBNs and consumer safety.

Classical trajectory methods in molecular collisions

International Nuclear Information System (INIS)

Porter, R.N.; Raff, L.M.

1976-01-01

The discussion of classical trajectory methods in molecular collisions includes classical dynamics, Hamiltonian mechanics, classical scattering cross sections and rate coefficients, statistical averaging, the selection of initial states, integration of equations of motion, analysis of final states, consecutive collisions, and the prognosis for classical molecular scattering calculations. 61 references

Halo-independent methods for inelastic dark matter scattering

International Nuclear Information System (INIS)

Bozorgnia, Nassim; Schwetz, Thomas; Herrero-Garcia, Juan; Zupan, Jure

2013-01-01

We present halo-independent methods to analyze the results of dark matter direct detection experiments assuming inelastic scattering. We focus on the annual modulation signal reported by DAMA/LIBRA and present three different halo-independent tests. First, we compare it to the upper limit on the unmodulated rate from XENON100 using (a) the trivial requirement that the amplitude of the annual modulation has to be smaller than the bound on the unmodulated rate, and (b) a bound on the annual modulation amplitude based on an expansion in the Earth's velocity. The third test uses the special predictions of the signal shape for inelastic scattering and allows for an internal consistency check of the data without referring to any astrophysics. We conclude that a strong conflict between DAMA/LIBRA and XENON100 in the framework of spin-independent inelastic scattering can be established independently of the local properties of the dark matter halo

Platform-independent method for computer aided schematic drawings

Science.gov (United States)

Vell, Jeffrey L [Slingerlands, NY; Siganporia, Darius M [Clifton Park, NY; Levy, Arthur J [Fort Lauderdale, FL

2012-02-14

A CAD/CAM method is disclosed for a computer system to capture and interchange schematic drawing and associated design information. The schematic drawing and design information are stored in an extensible, platform-independent format.

Molecular methods for pathogen and microbial community detection and characterization: current and potential application in diagnostic microbiology.

Science.gov (United States)

Sibley, Christopher D; Peirano, Gisele; Church, Deirdre L

2012-04-01

Clinical microbiology laboratories worldwide have historically relied on phenotypic methods (i.e., culture and biochemical tests) for detection, identification and characterization of virulence traits (e.g., antibiotic resistance genes, toxins) of human pathogens. However, limitations to implementation of molecular methods for human infectious diseases testing are being rapidly overcome allowing for the clinical evaluation and implementation of diverse technologies with expanding diagnostic capabilities. The advantages and limitation of molecular techniques including real-time polymerase chain reaction, partial or whole genome sequencing, molecular typing, microarrays, broad-range PCR and multiplexing will be discussed. Finally, terminal restriction fragment length polymorphism (T-RFLP) and deep sequencing are introduced as technologies at the clinical interface with the potential to dramatically enhance our ability to diagnose infectious diseases and better define the epidemiology and microbial ecology of a wide range of complex infections. Copyright © 2012 Elsevier B.V. All rights reserved.

Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

Directory of Open Access Journals (Sweden)

Rhoads Daniel D

2012-11-01

Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.

Characterization of molecularly imprinted polymers using a new polar solvent titration method.

Science.gov (United States)

Song, Di; Zhang, Yagang; Geer, Michael F; Shimizu, Ken D

2014-07-01

A new method of characterizing molecularly imprinted polymers (MIPs) was developed and tested, which provides a more accurate means of identifying and measuring the molecular imprinting effect. In the new polar solvent titration method, a series of imprinted and non-imprinted polymers were prepared in solutions containing increasing concentrations of a polar solvent. The polar solvent additives systematically disrupted the templation and monomer aggregation processes in the prepolymerization solutions, and the extent of disruption was captured by the polymerization process. The changes in binding capacity within each series of polymers were measured, providing a quantitative assessment of the templation and monomer aggregation processes in the imprinted and non-imprinted polymers. The new method was tested using three different diphenyl phosphate imprinted polymers made using three different urea functional monomers. Each monomer had varying efficiencies of templation and monomer aggregation. The new MIP characterization method was found to have several advantages. To independently verify the new characterization method, the MIPs were also characterized using traditional binding isotherm analyses. The two methods appeared to give consistent conclusions. First, the polar solvent titration method is less susceptible to false positives in identifying the imprinting effect. Second, the method is able to differentiate and quantify changes in binding capacity, as measured at a fixed guest and polymer concentration, arising from templation or monomer aggregation processes in the prepolymerization solution. Third, the method was also easy to carry out, taking advantage of the ease of preparing MIPs. Copyright © 2014 John Wiley & Sons, Ltd.

Evaluation of microbial diversity in the pilot-scale beer brewing process by culture-dependent and culture-independent method.

Science.gov (United States)

Takahashi, M; Kita, Y; Kusaka, K; Mizuno, A; Goto-Yamamoto, N

2015-02-01

In the brewing industry, microbial management is very important for stabilizing the quality of the product. We investigated the detailed microbial community of beer during fermentation and maturation, to manage beer microbiology in more detail. We brewed a beer (all-malt) and two beerlike beverages (half- and low-malt) in pilot-scale fermentation and investigated the microbial community of them using a next-generation sequencer (454 GS FLX titanium), quantitative PCR, flow cytometry and a culture-dependent method. From 28 to 88 genera of bacteria and from 9 to 38 genera of eukaryotic micro-organisms were detected in each sample. Almost all micro-organisms died out during the boiling process. However, bacteria belonging to the genera Acidovorax, Bacillus, Brevundimonas, Caulobacter, Chryseobacterium, Methylobacterium, Paenibacillus, Polaromonas, Pseudomonas, Ralstonia, Sphingomonas, Stenotrophomonas, Tepidimonas and Tissierella were detected at the early and middle stage of fermentation, even though their cell densities were low (below approx. 10(3) cells ml(-1) ) and they were not almost detected at the end of fermentation. We revealed that the microbial community of beer during fermentation and maturation is very diverse and several bacteria possibly survive during fermentation. In this study, we revealed the detailed microbial communities of beer using next-generation sequencing. Some of the micro-organisms detected in this study were found in beer brewing process for the first time. Additionally, the possibility of growth of several bacteria at the early and middle stage of fermentation was suggested. © 2014 The Society for Applied Microbiology.

Traditional and Modern Cell Culture in Virus Diagnosis.

Science.gov (United States)

Hematian, Ali; Sadeghifard, Nourkhoda; Mohebi, Reza; Taherikalani, Morovat; Nasrolahi, Abbas; Amraei, Mansour; Ghafourian, Sobhan

2016-04-01

Cell cultures are developed from tissue samples and then disaggregated by mechanical, chemical, and enzymatic methods to extract cells suitable for isolation of viruses. With the recent advances in technology, cell culture is considered a gold standard for virus isolation. This paper reviews the evolution of cell culture methods and demonstrates why cell culture is a preferred method for identification of viruses. In addition, the advantages and disadvantages of both traditional and modern cell culture methods for diagnosis of each type of virus are discussed. Detection of viruses by the novel cell culture methods is considered more accurate and sensitive. However, there is a need to include some more accurate methods such as molecular methods in cell culture for precise identification of viruses.

Culture-independent investigation of the microbiome associated with the nematode Acrobeloides maximus.

Directory of Open Access Journals (Sweden)

Jean-Paul Baquiran

Full Text Available BACKGROUND: Symbioses between metazoans and microbes are widespread and vital to many ecosystems. Recent work with several nematode species has suggested that strong associations with microbial symbionts may also be common among members of this phylu. In this work we explore possible symbiosis between bacteria and the free living soil bacteriovorous nematode Acrobeloides maximus. METHODOLOGY: We used a soil microcosm approach to expose A. maximus populations grown monoxenically on RFP labeled Escherichia coli in a soil slurry. Worms were recovered by density gradient separation and examined using both culture-independent and isolation methods. A 16S rRNA gene survey of the worm-associated bacteria was compared to the soil and to a similar analysis using Caenorhabditis elegans N2. Recovered A. maximus populations were maintained on cholesterol agar and sampled to examine the population dynamics of the microbiome. RESULTS: A consistent core microbiome was extracted from A. maximus that differed from those in the bulk soil or the C. elegans associated set. Three genera, Ochrobactrum, Pedobacter, and Chitinophaga, were identified at high levels only in the A. maximus populations, which were less diverse than the assemblage associated with C. elegans. Putative symbiont populations were maintained for at least 4 months post inoculation, although the levels decreased as the culture aged. Fluorescence in situ hybridization (FISH using probes specific for Ochrobactrum and Pedobacter stained bacterial cells in formaldehyde fixed nematode guts. CONCLUSIONS: Three microorganisms were repeatedly observed in association with Acrobeloides maximus when recovered from soil microcosms. We isolated several Ochrobactrum sp. and Pedobacter sp., and demonstrated that they inhabit the nematode gut by FISH. Although their role in A. maximus is not resolved, we propose possible mutualistic roles for these bacteria in protection of the host against pathogens and

Complex microbiota of a Chinese "Fen" liquor fermentation starter (Fen-Daqu), revealed by culture-dependent and culture-independent methods

NARCIS (Netherlands)

Zheng, X.; Zheng, Y.; Han, B.; Zwietering, M.H.; Samson, R.A.; Boekhout, T.; Nout, M.J.R.

2012-01-01

Daqu is a traditional fermentation starter that is used for Chinese liquor production. Although partly mechanized, its manufacturing process has remained traditional. We investigated the microbial diversity of Fen-Daqu, a starter for light-flavour liquor, using combined culture-dependent and

Use of cultivation-dependent and -independent techniques to assess contamination of central venous catheters: a pilot study

Directory of Open Access Journals (Sweden)

Høiby Niels

2008-10-01

Full Text Available Abstract Background Catheters are the most common cause of nosocomial infections and are associated with increased risk of mortality, length of hospital stay and cost. Prevention of infections and fast and correct diagnosis is highly important. Methods In this study traditional semiquantitative culture-dependent methods for diagnosis of bacteria involved in central venous catheter-related infections as described by Maki were compared with the following culture-independent molecular biological methods: Clone libraries, denaturant gradient gel electrophoresis, phylogeny and fluorescence in situ hybridization. Results In accordance with previous studies, the cultivation of central venous catheters from 18 patients revealed that S. epidermidis and other coagulase-negative staphylococci were most abundant and that a few other microorganisms such as P. aeruginosa and K. pneumoniae occasionally were found on the catheters. The molecular analysis using clone libraries and sequencing, denaturant gradient gel electrophoresis and sequencing provided several important results. The species found by cultivation were confirmed by molecular methods. However, many other bacteria belonging to the phyla Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes were also found, stressing that only a minor portion of the species present were found by cultivation. Some of these bacteria are known to be pathogens, some have not before been described in relation to human health, and some were not closely related to known pathogens and may represent new pathogenic species. Furthermore, there was a clear difference between the bacterial species found in biofilm on the external (exluminal and internal (luminal side of the central venous catheter, which can not be detected by Maki's method. Polymicrobial biofilms were observed on most of the catheters and were much more common than the cultivation-dependent methods indicated. Conclusion The results show that diagnosis

Method for efficient storage and transportation of sputum specimens for molecular testing of tuberculosis.

Science.gov (United States)

Guio, H; Okayama, H; Ashino, Y; Saitoh, H; Xiao, P; Miki, M; Yoshihara, N; Nakanowatari, S; Hattori, T

2006-08-01

The polymerase chain reaction (PCR) is a highly sensitive method for the detection of Mycobacterium tuberculosis and is available in most countries, though to a lesser extent in rural areas. To amplify M. tuberculosis DNA sequences of sputum spotted on FTA cards and compare them with the results of microscopic examination among culture-positive samples. A total of 102 sputum specimens of TB patients in treatment were spotted on FTA cards and stored at room temperature until DNA analysis. We assessed the IS6110 region of M. tuberculosis. The efficacy of the PCR assay for the direct detection of M. tuberculosis was evaluated and compared with the results of cultures (Middlebrook 7H9 broth) and smears of fresh sputum specimens. We were able to detect 10 fg/microl of mycobacterial DNA even after 6 months in storage. The PCR sensitivity and specificity using the FTA card system were 82% and 96%, while microscopic examination showed 41% and 95%, respectively. The FTA card system for the storage of bacterial DNA from sputum samples should be considered for the molecular diagnosis of tuberculosis. Samples can easily be obtained from geographically isolated populations and shipped by mail for accurate molecular diagnosis.

Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.

Science.gov (United States)

Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A

2011-11-01

To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.

Generalist palliative care in hospital - Cultural and organisational interactions. Results of a mixed-methods study.

Science.gov (United States)

Bergenholtz, Heidi; Jarlbaek, Lene; Hølge-Hazelton, Bibi

2016-06-01

It can be challenging to provide generalist palliative care in hospitals, owing to difficulties in integrating disease-oriented treatment with palliative care and the influences of cultural and organisational conditions. However, knowledge on the interactions that occur is sparse. To investigate the interactions between organisation and culture as conditions for integrated palliative care in hospital and, if possible, to suggest workable solutions for the provision of generalist palliative care. A convergent parallel mixed-methods design was chosen using two independent studies: a quantitative study, in which three independent datasets were triangulated to study the organisation and evaluation of generalist palliative care, and a qualitative, ethnographic study exploring the culture of generalist palliative nursing care in medical departments. A Danish regional hospital with 29 department managements and one hospital management. Two overall themes emerged: (1) 'generalist palliative care as a priority at the hospital', suggesting contrasting issues regarding prioritisation of palliative care at different organisational levels, and (2) 'knowledge and use of generalist palliative care clinical guideline', suggesting that the guideline had not reached all levels of the organisation. Contrasting issues in the hospital's provision of generalist palliative care at different organisational levels seem to hamper the interactions between organisation and culture - interactions that appear to be necessary for the provision of integrated palliative care in the hospital. The implementation of palliative care is also hindered by the main focus being on disease-oriented treatment, which is reflected at all the organisational levels. © The Author(s) 2015.

A molecular method for typing Herpes simplex virus isolates as an alternative to immunofluorescence methods

Directory of Open Access Journals (Sweden)

Abraham A

2009-01-01

Full Text Available Background: Typing of Herpes simplex virus (HSV isolates is required to identify the virus isolated in culture. The methods available for this include antigen detection by immunofluorescence (IF assays and polymerase chain reaction (PCR. This study was undertaken to standardize a molecular method for typing of HSV and compare it with a commercial IF reagent for typing. Objectives: To compare a molecular method for typing HSV isolates with a monoclonal antibody (MAb based IF test. Study design : This cross-sectional study utilized four reference strains and 42 HSV isolates obtained from patients between September 1998 and September 2004. These were subjected to testing using an MAb-based IF test and a PCR that detects the polymerase ( pol gene of HSV isolates. Results: The observed agreement of the MAb IF assay with the pol PCR was 95.7%. Fifty four point eight percent (23/42 of isolates tested by IF typing were found to be HSV-1, 40.5% (17/42 were HSV-2, and two (4.8% were untypable using the MAb IF assay. The two untypable isolates were found to be HSV-2 using the pol PCR. In addition, the cost per PCR test for typing is estimated to be around Rs 1,300 (USD 30, whereas the cost per MAb IF test is about Rs 1,500 (USD 35 including all overheads (reagents, instruments, personnel time, and consumables. Conclusion: The pol PCR is a cheaper and more easily reproducible method for typing HSV isolates as compared to the IF test. It could replace the IF-based method for routine typing of HSV isolates as availability of PCR machines (thermal cyclers is now more widespread than fluorescence microscopes in a country like India.

Assessment of Flagellate Diversity at Deep-Sea Hydrothermal Vents Using the Combined Approach of Culture-Dependent and Culture-Independent Methods

National Research Council Canada - National Science Library

Atkins, Michael

2000-01-01

.... Molecular and ultrastructural evidence point to one of the isolates. Ancyromonas, as a plausible candidate for the closest relative to the common ancestor of Metazoans, Fungi, and Choanoglagellates...

Efficacy of the FilmArray blood culture identification panel for direct molecular diagnosis of infectious diseases from samples other than blood.

Science.gov (United States)

Micó, Miquel; Navarro, Ferran; de Miniac, Daniela; González, Yésica; Brell, Albert; López, Cristina; Sánchez-Reus, Ferran; Mirelis, Beatriz; Coll, Pere

2015-12-01

Molecular-based techniques reduce the delay in diagnosing infectious diseases and therefore contribute to better patient outcomes. We assessed the FilmArray blood culture identification (BCID) panel (Biofire Diagnostics/bioMérieux) directly on clinical specimens other than blood: cerebrospinal, joint, pleural and ascitic fluids, bronchoscopy samples and abscesses. We compared the results from 88 samples obtained by culture-based techniques. The percentage of agreement between the two methods was 75 % with a Cohen κ value of 0.51. Global sensitivity and specificity using the FilmArray BCID panel were 71 and 97 %, respectively. Sensitivity was poorer in samples with a low bacterial load, such as ascitic and pleural fluids (25 %), whereas the sensitivity for abscess samples was high (89 %). These findings suggest that the FilmArray BCID panel could be useful to perform microbiological diagnosis directly from samples other than positive blood cultures, as it offers acceptable sensitivity and moderate agreement with conventional microbiological methods. Nevertheless, cost-benefit studies should be performed before introducing this method into algorithms for microbiological diagnostics.

A method for establishing human primary gastric epithelial cell culture from fresh surgical gastric tissues.

Science.gov (United States)

Aziz, Faisal; Yang, Xuesong; Wen, Qingping; Yan, Qiu

2015-08-01

At present, biopsy specimens, cancer cell lines and tissues obtained by gastric surgery are used in the study and analysis of gastric cancer, including the molecular mechanisms and proteomics. However, fibroblasts and other tissue components may interfere with these techniques. Therefore, the present study aimed to develop a procedure for the isolation of viable human gastric epithelial cells from gastric surgical tissues. A method was developed to culture human gastric epithelial cells using fresh, surgically excised tissues and was evaluated using immunocytochemistry, periodic acid-Schiff (PAS) staining and cell viability assays. Low cell growth was observed surrounding the gastric tissue on the seventh day of tissue explant culture. Cell growth subsequently increased, and at 12 days post-explant a high number of pure epithelial cells were detected. The gastric cancer cells exhibited rapid growth with a doubling time of 13-52 h, as compared to normal cells, which had a doubling time of 20-53 h. Immunocytochemical analyses of primary gastric cells revealed positive staining for cytokeratin 18 and 19, which indicated that the culture was comprised of pure epithelial cells and contained no fibroblasts. Furthermore, PAS staining demonstrated that the cultured gastric cells produced neutral mucin. Granulin and carbohydrate antigen 724 staining confirmed the purity of gastric cancer and normal cells in culture. This method of cell culture indicated that the gastric cells in primary culture consisted of mucin-secreting gastric epithelial cells, which may be useful for the study of gastric infection with Helicobacter pylori and gastric cancer.

The impact of culture collections on molecular identification, taxonomy, and solving real problems

Science.gov (United States)

Among the fungi, Fusarium has stood out as a major focus for culture collection resource development over the last century. This has facilitated unprecedented molecular taxonomic advancements, which in turn has led to problem solving in plant pathology, mycotoxicology, medical mycology, and basic re...

Puerto Rican understandings of child disability: methods for the cultural validation of standardized measures of child health.

Science.gov (United States)

Gannotti, Mary E; Handwerker, W Penn

2002-12-01

Validating the cultural context of health is important for obtaining accurate and useful information from standardized measures of child health adapted for cross-cultural applications. This paper describes the application of ethnographic triangulation for cultural validation of a measure of childhood disability, the Pediatric Evaluation of Disability Inventory (PEDI) for use with children living in Puerto Rico. The key concepts include macro-level forces such as geography, demography, and economics, specific activities children performed and their key social interactions, beliefs, attitudes, emotions, and patterns of behavior surrounding independence in children and childhood disability, as well as the definition of childhood disability. Methods utilize principal components analysis to establish the validity of cultural concepts and multiple regression analysis to identify intracultural variation. Findings suggest culturally specific modifications to the PEDI, provide contextual information for informed interpretation of test scores, and point to the need to re-standardize normative values for use with Puerto Rican children. Without this type of information, Puerto Rican children may appear more disabled than expected for their level of impairment or not to be making improvements in functional status. The methods also allow for cultural boundaries to be quantitatively established, rather than presupposed. Copyright 2002 Elsevier Science Ltd.

Development of the Fragment Molecular Orbital Method for Calculating Nonlocal Excitations in Large Molecular Systems.

Science.gov (United States)

Fujita, Takatoshi; Mochizuki, Yuji

2018-04-19

We developed the fragment-based method for calculating nonlocal excitations in large molecular systems. This method is based on the multilayer fragment molecular orbital method and the configuration interaction single (CIS) wave function using localized molecular orbitals. The excited-state wave function for the whole system is described as a superposition of configuration state functions (CSFs) for intrafragment excitations and for interfragment charge-transfer excitations. The formulation and calculations of singlet excited-state Hamiltonian matrix elements in the fragment CSFs are presented in detail. The efficient approximation schemes for calculating the matrix elements are also presented. The computational efficiency and the accuracy were evaluated using the molecular dimers and molecular aggregates. We confirmed that absolute errors of 50 meV (relative to the conventional calculations) are achievable for the molecular systems in their equilibrium geometries. The perturbative electron correlation correction to the CIS excitation energies is also demonstrated. The present theory can compute a large number of excited states in large molecular systems; in addition, it allows for the systematic derivation of a model exciton Hamiltonian. These features are useful for studying excited-state dynamics in condensed molecular systems based on the ab initio electronic structure theory.

Calcium-independent phospholipase A₂, group VIA, is critical for RPE cell survival

DEFF Research Database (Denmark)

Kolko, Miriam; Vohra, Rupali; Westlund, Barbro S.

2014-01-01

PURPOSE: To investigate the significance of calcium-independent phospholipase A₂, group VIA (iPLA2-VIA), in RPE cell survival following responses to sodium iodate (SI) in cell cultures. METHODS: The human retinal pigment epithelium (RPE) cell line (ARPE-19) cells and primary mouse-RPE cultures were...

Molecular dynamics with deterministic and stochastic numerical methods

CERN Document Server

Leimkuhler, Ben

2015-01-01

This book describes the mathematical underpinnings of algorithms used for molecular dynamics simulation, including both deterministic and stochastic numerical methods. Molecular dynamics is one of the most versatile and powerful methods of modern computational science and engineering and is used widely in chemistry, physics, materials science and biology. Understanding the foundations of numerical methods means knowing how to select the best one for a given problem (from the wide range of techniques on offer) and how to create new, efficient methods to address particular challenges as they arise in complex applications.  Aimed at a broad audience, this book presents the basic theory of Hamiltonian mechanics and stochastic differential equations, as well as topics including symplectic numerical methods, the handling of constraints and rigid bodies, the efficient treatment of Langevin dynamics, thermostats to control the molecular ensemble, multiple time-stepping, and the dissipative particle dynamics method...

Validation of the prognostic gene portfolio, ClinicoMolecular Triad Classification, using an independent prospective breast cancer cohort and external patient populations.

Science.gov (United States)

Wang, Dong-Yu; Done, Susan J; Mc Cready, David R; Leong, Wey L

2014-07-04

Using genome-wide expression profiles of a prospective training cohort of breast cancer patients, ClinicoMolecular Triad Classification (CMTC) was recently developed to classify breast cancers into three clinically relevant groups to aid treatment decisions. CMTC was found to be both prognostic and predictive in a large external breast cancer cohort in that study. This study serves to validate the reproducibility of CMTC and its prognostic value using independent patient cohorts. An independent internal cohort (n = 284) and a new external cohort (n = 2,181) were used to validate the association of CMTC between clinicopathological factors, 12 known gene signatures, two molecular subtype classifiers, and 19 oncogenic signalling pathway activities, and to reproduce the abilities of CMTC to predict clinical outcomes of breast cancer. In addition, we also updated the outcome data of the original training cohort (n = 147). The original training cohort reached a statistically significant difference (p value of the triad classification was reproduced in the second independent internal cohort and the new external validation cohort. CMTC achieved even higher prognostic significance when all available patients were analyzed (n = 4,851). Oncogenic pathways Myc, E2F1, Ras and β-catenin were again implicated in the high-risk groups. Both prospective internal cohorts and the independent external cohorts reproduced the triad classification of CMTC and its prognostic significance. CMTC is an independent prognostic predictor, and it outperformed 12 other known prognostic gene signatures, molecular subtype classifications, and all other standard prognostic clinicopathological factors. Our results support further development of CMTC portfolio into a guide for personalized breast cancer treatments.

The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

Energy Technology Data Exchange (ETDEWEB)

Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub [KHNP Central Research Institute, Daejeon (Korea, Republic of)

2012-10-15

After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology.

The awareness of employees in safety culture through the improved nuclear safety culture evaluation method

International Nuclear Information System (INIS)

Kim, Young Ga; Sung, Chan Ho; Jung, Yeon Sub

2012-01-01

After the Chernobyl nuclear accident in 1986, nuclear safety culture terminology was at first introduced emphasizing the importance of employees' attitude and organizational safety. The concept of safety culture was spread by INSAG 4 published in 1991. From that time, IAEA had provided the service of ASCOT for the safety culture assessment. However, many people still are thinking that safety culture is abstract and is not clear. It is why the systematic and reliable assessment methodology was not developed. Assessing safety culture is to identify what is the basic assumption for any organization to accept unconsciously. Therefore, it is very difficult to reach a meaningful conclusion by a superficial investigation alone. KHNP had been doing the safety culture assessment which was based on ASCOT methodology every 2 years. And this result had contributed to improving safety culture. But this result could not represent the level of organization's safety culture due to the limitation of method. So, KHNP has improved the safety culture method by benchmarking the over sea assessment techniques in 2011. The effectiveness of this improved methodology was validated through a pilot assessment. In this paper, the level of employees' safety culture awareness was analyzed by the improved method and reviewed what is necessary for the completeness and objectivity of the nuclear safety culture assessment methodology

Molecular Genetic Methods Implementation for Phytopathogen Identification in Forest Stands and Nurseries of the Russian Federation

Directory of Open Access Journals (Sweden)

T. S. Alimova

2014-08-01

Full Text Available The results of the application of molecular genetics methods for the analysis of the plant pathogens present in forest plantations and nurseries of the Russian Federation, including doughnut fungus and annosum root rot are presented. The prospects and benefits of using DNA analysis for early diagnosis of plant diseases without isolation of the pathogen in pure culture, shortening time of analysis, and the possibility of mass screening are discussed.

The effects of culture independent diagnostic testing on the diagnosis and reporting of enteric bacterial pathogens in Queensland, 2010 to 2014.

Science.gov (United States)

May, Fiona J; Stafford, Russell J; Carroll, Heidi; Robson, Jennifer Mb; Vohra, Renu; Nimmo, Graeme R; Bates, John; Kirk, Martyn D; Fearnley, Emily J; Polkinghorne, Benjamin G

2017-09-01

Changes in diagnostic laboratory testing procedures can impact on the number of cases notified and the public health surveillance of enteric pathogens. Culture independent diagnostic testing using a multiplex polymerase chain reaction (PCR) test was introduced for the rapid detection of bacterial enteric pathogens in pathology laboratories in Queensland, Australia, from late 2013 onwards. We conducted a retrospective descriptive study using laboratory data to assess the impact of the introduction of PCR testing on four common enteric pathogens, Salmonella, Campylobacter, Shigella and Yersinia, in Queensland between 2010 and 2014. The number of stool specimens tested and the proportion positive for each of the four pathogens increased in 2014 after the introduction of culture independent diagnostic testing. Among the specimens tested by both PCR and culture, 12% of Salmonella positive stools, 36% of Campylobacter positive stools, 74% of Shigella / enteroinvasive Escherichia coli positive stools and 65% of Yersinia positive stools were PCR positive only. Including those where culture was not performed, 19% of Salmonella positive stools, 44% of Campylobacter positive stools, 83% of Shigella positive stools and 79% of Yersinia positive stools had no cultured isolate available for further characterisation. The detection and tracking of foodborne and non-foodborne gastrointestinal outbreaks will become more difficult as culture independent diagnostic testing becomes more widespread. Until new techniques for characterisation of pathogens directly from clinical specimens have been developed, we recommend laboratories continue to culture specimens concurrently or reflexively with culture independent diagnostic tests. This work is copyright. You may download, display, print and reproduce the whole or part of this work in unaltered form for your own personal use or, if you are part of an organisation, for internal use within your organisation, but only if you or your

Features of method of medical physical culture at insufficiency of aortic valve

Directory of Open Access Journals (Sweden)

S.A. Kalmykov

2013-01-01

Full Text Available The basic approaches are considered to application of facilities of medical physical education at aortic insufficiency on the stages of physical rehabilitation. An analysis is conducted more than 20 literary sources. The mechanisms of medical action of physical exercises are specified - restorative influence, forming of temporal indemnifications, trophic action, normalization of the broken functions. It is set that task, forms, facilities, the methods of medical physical culture depend on the degree of weight of disease, degree of cardio-vascular insufficiency and stage of physical rehabilitation. Engaged in a medical physical culture conducted in form morning hygienical gymnastics, medical gymnastics, independent employments, dosed walks, walking on steps, mobile and sporting games. It is marked that sparing training and training the motive modes are instrumental in the gradual training of the cardio-vascular system. Recommended the dosed walking to lead to a to 5-8 km on the sparing training and to 8-12 km on training modes.

Molecular Combing of DNA: Methods and Applications

DEFF Research Database (Denmark)

Nazari, Zeniab Esmail; Gurevich, Leonid

2013-01-01

studies to nanoelectronics. While molecular combing has been applied in a variety of DNA-related studies, no comprehensive review has been published on different combing methods proposed so far. In this review, the underlying mechanisms of molecular combing of DNA are described followed by discussion...

Activity coefficients from molecular simulations using the OPAS method

Science.gov (United States)

Kohns, Maximilian; Horsch, Martin; Hasse, Hans

2017-10-01

A method for determining activity coefficients by molecular dynamics simulations is presented. It is an extension of the OPAS (osmotic pressure for the activity of the solvent) method in previous work for studying the solvent activity in electrolyte solutions. That method is extended here to study activities of all components in mixtures of molecular species. As an example, activity coefficients in liquid mixtures of water and methanol are calculated for 298.15 K and 323.15 K at 1 bar using molecular models from the literature. These dense and strongly interacting mixtures pose a significant challenge to existing methods for determining activity coefficients by molecular simulation. It is shown that the new method yields accurate results for the activity coefficients which are in agreement with results obtained with a thermodynamic integration technique. As the partial molar volumes are needed in the proposed method, the molar excess volume of the system water + methanol is also investigated.

Gas flow parameter determination by molecular beam method

International Nuclear Information System (INIS)

Zarvin, A.E.; Sharafutdinov, R.G.

1977-01-01

This paper describes a molecular-beam system intended for studying nonequilibrium processes in supersonic rarefied gas flows. The system represented is a small molecular beam source placed inside the low intensity wind tunnel of the Institute of Thermophysics, Siberian Branch of the USSR Academy of Sciences. The time-of-flight method is used for measuring molecular velocity distribution functions on molecular beam axis. (Auth.)

Non-Adiabatic Molecular Dynamics Methods for Materials Discovery

Energy Technology Data Exchange (ETDEWEB)

Furche, Filipp [Univ. of California, Irvine, CA (United States); Parker, Shane M. [Univ. of California, Irvine, CA (United States); Muuronen, Mikko J. [Univ. of California, Irvine, CA (United States); Roy, Saswata [Univ. of California, Irvine, CA (United States)

2017-04-04

The flow of radiative energy in light-driven materials such as photosensitizer dyes or photocatalysts is governed by non-adiabatic transitions between electronic states and cannot be described within the Born-Oppenheimer approximation commonly used in electronic structure theory. The non-adiabatic molecular dynamics (NAMD) methods based on Tully surface hopping and time-dependent density functional theory developed in this project have greatly extended the range of molecular materials that can be tackled by NAMD simulations. New algorithms to compute molecular excited state and response properties efficiently were developed. Fundamental limitations of common non-linear response methods were discovered and characterized. Methods for accurate computations of vibronic spectra of materials such as black absorbers were developed and applied. It was shown that open-shell TDDFT methods capture bond breaking in NAMD simulations, a longstanding challenge for single-reference molecular dynamics simulations. The methods developed in this project were applied to study the photodissociation of acetaldehyde and revealed that non-adiabatic effects are experimentally observable in fragment kinetic energy distributions. Finally, the project enabled the first detailed NAMD simulations of photocatalytic water oxidation by titania nanoclusters, uncovering the mechanism of this fundamentally important reaction for fuel generation and storage.

Storm loads of culturable and molecular fecal indicators in an inland urban stream.

Science.gov (United States)

Liao, Hehuan; Krometis, Leigh-Anne H; Cully Hession, W; Benitez, Romina; Sawyer, Richard; Schaberg, Erin; von Wagoner, Emily; Badgley, Brian D

2015-10-15

Elevated concentrations of fecal indicator bacteria in receiving waters during wet-weather flows are a considerable public health concern that is likely to be exacerbated by future climate change and urbanization. Knowledge of factors driving the fate and transport of fecal indicator bacteria in stormwater is limited, and even less is known about molecular fecal indicators, which may eventually supplant traditional culturable indicators. In this study, concentrations and loading rates of both culturable and molecular fecal indicators were quantified throughout six storm events in an instrumented inland urban stream. While both concentrations and loading rates of each fecal indicator increased rapidly during the rising limb of the storm hydrographs, it is the loading rates rather than instantaneous concentrations that provide a better estimate of transport through the stream during the entire storm. Concentrations of general fecal indicators (both culturable and molecular) correlated most highly with each other during storm events but not with the human-associated HF183 Bacteroides marker. Event loads of general fecal indicators most strongly correlated with total runoff volume, maximum discharge, and maximum turbidity, while event loads of HF183 most strongly correlated with the time to peak flow in a hydrograph. These observations suggest that collection of multiple samples during a storm event is critical for accurate predictions of fecal indicator loading rates and total loads during wet-weather flows, which are required for effective watershed management. In addition, existing predictive models based on general fecal indicators may not be sufficient to predict source-specific genetic markers of fecal contamination. Copyright © 2015 Elsevier B.V. All rights reserved.

Explaining the Effectiveness of the Contrast Culture Method for Managing Interpersonal Interactions across Cultures

Science.gov (United States)

Hiratsuka, Hiroyoshi; Suzuki, Hanako; Pusina, Alexis

2016-01-01

One of the current challenges in the field of intercultural education comes from the limited availability of training efficacy studies. The present study focused on explaining the effectiveness of the Contrast Culture Method (CCM) as an intercultural education method for managing interpersonal interactions across cultures between graduate…

Cytokinesis-block micronucleus method in micro-blood cultures

International Nuclear Information System (INIS)

Liu Jinwen; Wang Lianzhi; Yang Cangzhen; Yao Yanyu

1991-01-01

This paper reports the cytokinesis-block micronucleus method in micro-blood cultures. The observations on detection induced micronuclei of different doses of 60 Co γ-rays irradiation and spontaneous micronucleus of different ages were performed with CB method in comporison with conventional micronucleus (CM) method. The results showed that with direct peripheral micro-blood cultures the cytoknesis-block micronuclei is also obtained. Using CB method, the micronuclei fequency of different ages was linear relationship, Y = 1.62 + 0.74 D, the spontaneous micronuclei frequency of different ages was 4.14%, the induced micronuclei also was a linear relationship, Y = 6.01 + 0.692 D. Using CM method, it showed that the induced micronuclei was a linear relationship, Y = 0.486 D - 1.968, but there is no significant difference between the micronuclei frequency of different ages. Comparison with CM and direct blood smear methods confirmed that the cytokinesis-block method of micro-blood cultures is more sensitive and precise

A modified time-of-flight method for precise determination of high speed ratios in molecular beams

Energy Technology Data Exchange (ETDEWEB)

Salvador Palau, A.; Eder, S. D., E-mail: sabrina.eder@uib.no; Kaltenbacher, T.; Samelin, B.; Holst, B. [Department of Physics and Technology, University of Bergen, Allégaten 55, 5007 Bergen (Norway); Bracco, G. [Department of Physics and Technology, University of Bergen, Allégaten 55, 5007 Bergen (Norway); CNR-IMEM, Department of Physics, University of Genova, V. Dodecaneso 33, 16146 Genova (Italy)

2016-02-15

Time-of-flight (TOF) is a standard experimental technique for determining, among others, the speed ratio S (velocity spread) of a molecular beam. The speed ratio is a measure for the monochromaticity of the beam and an accurate determination of S is crucial for various applications, for example, for characterising chromatic aberrations in focussing experiments related to helium microscopy or for precise measurements of surface phonons and surface structures in molecular beam scattering experiments. For both of these applications, it is desirable to have as high a speed ratio as possible. Molecular beam TOF measurements are typically performed by chopping the beam using a rotating chopper with one or more slit openings. The TOF spectra are evaluated using a standard deconvolution method. However, for higher speed ratios, this method is very sensitive to errors related to the determination of the slit width and the beam diameter. The exact sensitivity depends on the beam diameter, the number of slits, the chopper radius, and the chopper rotation frequency. We present a modified method suitable for the evaluation of TOF measurements of high speed ratio beams. The modified method is based on a systematic variation of the chopper convolution parameters so that a set of independent measurements that can be fitted with an appropriate function are obtained. We show that with this modified method, it is possible to reduce the error by typically one order of magnitude compared to the standard method.

Isothermal multiple displacement amplification: a methodical approach enhancing molecular routine diagnostics of microcarcinomas and small biopsies.

Science.gov (United States)

Mairinger, Fabian D; Walter, Robert Fh; Vollbrecht, Claudia; Hager, Thomas; Worm, Karl; Ting, Saskia; Wohlschläger, Jeremias; Zarogoulidis, Paul; Zarogoulidis, Konstantinos; Schmid, Kurt W

2014-01-01

Isothermal multiple displacement amplification (IMDA) can be a powerful tool in molecular routine diagnostics for homogeneous and sequence-independent whole-genome amplification of notably small tumor samples, eg, microcarcinomas and biopsies containing a small amount of tumor. Currently, this method is not well established in pathology laboratories. We designed a study to confirm the feasibility and convenience of this method for routine diagnostics with formalin-fixed, paraffin-embedded samples prepared by laser-capture microdissection. A total of 250 μg DNA (concentration 5 μg/μL) was generated by amplification over a period of 8 hours with a material input of approximately 25 cells, approximately equivalent to 175 pg of genomic DNA. In the generated DNA, a representation of all chromosomes could be shown and the presence of elected genes relevant for diagnosis in clinical samples could be proven. Mutational analysis of clinical samples could be performed without any difficulty and showed concordance with earlier diagnostic findings. We established the feasibility and convenience of IMDA for routine diagnostics. We also showed that small amounts of DNA, which were not analyzable with current molecular methods, could be sufficient for a wide field of applications in molecular routine diagnostics when they are preamplified with IMDA.

Molecular predictors of 3D morphogenesis by breast cancer cell lines in 3D culture.

Directory of Open Access Journals (Sweden)

Ju Han

2010-02-01

Full Text Available Correlative analysis of molecular markers with phenotypic signatures is the simplest model for hypothesis generation. In this paper, a panel of 24 breast cell lines was grown in 3D culture, their morphology was imaged through phase contrast microscopy, and computational methods were developed to segment and represent each colony at multiple dimensions. Subsequently, subpopulations from these morphological responses were identified through consensus clustering to reveal three clusters of round, grape-like, and stellate phenotypes. In some cases, cell lines with particular pathobiological phenotypes clustered together (e.g., ERBB2 amplified cell lines sharing the same morphometric properties as the grape-like phenotype. Next, associations with molecular features were realized through (i differential analysis within each morphological cluster, and (ii regression analysis across the entire panel of cell lines. In both cases, the dominant genes that are predictive of the morphological signatures were identified. Specifically, PPARgamma has been associated with the invasive stellate morphological phenotype, which corresponds to triple-negative pathobiology. PPARgamma has been validated through two supporting biological assays.

Molecular Predictors of 3D Morphogenesis by Breast Cancer Cell Lines in 3D Culture

Energy Technology Data Exchange (ETDEWEB)

Han, Ju; Chang, Hang; Giricz, Orsi; Lee, Genee; Baehner, Frederick; Gray, Joe; Bissell, Mina; Kenny, Paraic; Parvin, Bahram

2010-02-01

Correlative analysis of molecular markers with phenotypic signatures is the simplest model for hypothesis generation. In this paper, a panel of 24 breast cell lines was grown in 3D culture, their morphology was imaged through phase contrast microscopy, and computational methods were developed to segment and represent each colony at multiple dimensions. Subsequently, subpopulations from these morphological responses were identified through consensus clustering to reveal three clusters of round, grape-like, and stellate phenotypes. In some cases, cell lines with particular pathobiological phenotypes clustered together (e.g., ERBB2 amplified cell lines sharing the same morphometric properties as the grape-like phenotype). Next, associations with molecular features were realized through (i) differential analysis within each morphological cluster, and (ii) regression analysis across the entire panel of cell lines. In both cases, the dominant genes that are predictive of the morphological signatures were identified. Specifically, PPAR? has been associated with the invasive stellate morphological phenotype, which corresponds to triple-negative pathobiology. PPAR? has been validated through two supporting biological assays.

Spheroid Culture of Head and Neck Cancer Cells Reveals an Important Role of EGFR Signalling in Anchorage Independent Survival.

Science.gov (United States)

Braunholz, Diana; Saki, Mohammad; Niehr, Franziska; Öztürk, Merve; Borràs Puértolas, Berta; Konschak, Robert; Budach, Volker; Tinhofer, Ingeborg

2016-01-01

In solid tumours millions of cells are shed into the blood circulation each day. Only a subset of these circulating tumour cells (CTCs) survive, many of them presumable because of their potential to form multi-cellular clusters also named spheroids. Tumour cells within these spheroids are protected from anoikis, which allows them to metastasize to distant organs or re-seed at the primary site. We used spheroid cultures of head and neck squamous cell carcinoma (HNSCC) cell lines as a model for such CTC clusters for determining the role of the epidermal growth factor receptor (EGFR) in cluster formation ability and cell survival after detachment from the extra-cellular matrix. The HNSCC cell lines FaDu, SCC-9 and UT-SCC-9 (UT-SCC-9P) as well as its cetuximab (CTX)-resistant sub-clone (UT-SCC-9R) were forced to grow in an anchorage-independent manner by coating culture dishes with the anti-adhesive polymer poly-2-hydroxyethylmethacrylate (poly-HEMA). The extent of apoptosis, clonogenic survival and EGFR signalling under such culture conditions was evaluated. The potential of spheroid formation in suspension culture was found to be positively correlated with the proliferation rate of HNSCC cell lines as well as their basal EGFR expression levels. CTX and gefitinib blocked, whereas the addition of EGFR ligands promoted anchorage-independent cell survival and spheroid formation. Increased spheroid formation and growth were associated with persistent activation of EGFR and its downstream signalling component (MAPK/ERK). Importantly, HNSCC cells derived from spheroid cultures retained their clonogenic potential in the absence of cell-matrix contact. Addition of CTX under these conditions strongly inhibited colony formation in CTX-sensitive cell lines but not their resistant subclones. Altogether, EGFR activation was identified as crucial factor for anchorage-independent survival of HNSCC cells. Targeting EGFR in CTC cluster formation might represent an attractive anti

Role of non-governmental organizations in formation of non-proliferation culture in new independent countries (NIC)

International Nuclear Information System (INIS)

Sevchik, M.

2000-01-01

Purpose of the report is demonstrate the non-governmental organizations (NGO) role in formation of non-proliferation culture in former Soviet Union. Activity of Center of Non-proliferation Problems Investigation (CNPI) of Monterey Institute of International Investigations and its collaboration with existing in Commonwealth of Independent States (CIS) non-governmental organizations is considered as example. Brief information about CNPI and reasons for it representatives opening of in Kazakhstan and in other CIS-countries, as well as cooperation of NGO in Belarus, Kazakhstan, Russia and Ukraine for creation on Central Asia zone free from nuclear weapon ia given. Some measures which could promote to formation of non-proliferation culture in region are suggested

Studying generalised dark matter interactions with extended halo-independent methods

Energy Technology Data Exchange (ETDEWEB)

Kahlhoefer, Felix [DESY, Notkestraße 85,D-22607 Hamburg (Germany); Wild, Sebastian [Physik-Department T30d, Technische Universität München,James-Franck-Straße 1, D-85748 Garching (Germany)

2016-10-20

The interpretation of dark matter direct detection experiments is complicated by the fact that neither the astrophysical distribution of dark matter nor the properties of its particle physics interactions with nuclei are known in detail. To address both of these issues in a very general way we develop a new framework that combines the full formalism of non-relativistic effective interactions with state-of-the-art halo-independent methods. This approach makes it possible to analyse direct detection experiments for arbitrary dark matter interactions and quantify the goodness-of-fit independent of astrophysical uncertainties. We employ this method in order to demonstrate that the degeneracy between astrophysical uncertainties and particle physics unknowns is not complete. Certain models can be distinguished in a halo-independent way using a single ton-scale experiment based on liquid xenon, while other models are indistinguishable with a single experiment but can be separated using combined information from several target elements.

Studying generalised dark matter interactions with extended halo-independent methods

International Nuclear Information System (INIS)

Kahlhoefer, Felix; Wild, Sebastian

2016-07-01

The interpretation of dark matter direct detection experiments is complicated by the fact that neither the astrophysical distribution of dark matter nor the properties of its particle physics interactions with nuclei are known in detail. To address both of these issues in a very general way we develop a new framework that combines the full formalism of non-relativistic effective interactions with state-of-the-art halo-independent methods. This approach makes it possible to analyse direct detection experiments for arbitrary dark matter interactions and quantify the goodness-of-fit independent of astrophysical uncertainties. We employ this method in order to demonstrate that the degeneracy between astrophysical uncertainties and particle physics unknowns is not complete. Certain models can be distinguished in a halo-independent way using a single ton-scale experiment based on liquid xenon, while other models are indistinguishable with a single experiment but can be separated using combined information from several target elements.

Independent cellular effects of cold ischemia and reperfusion: experimental molecular study.

Science.gov (United States)

Lledó-García, E; Humanes-Sánchez, B; Mojena-Sánchez, M; Rodrígez, J C J; Hernández-Fernández, C; Tejedor-Jorge, A; Fernández, A L

2013-04-01

There is less information available on cell cultures on the exclusive effects of either duration of cold ischemia (CI) or rewarming-reperfusion in the kidney subjected to initial warm ischemia (WI). Therefore, the goals of our work were: (1) to evaluate the consequences on tubular cellular viability of different durations of CI on a kidney after an initial period of WI, and (2) to analyze the additional effect on tubular cell viability of rewarming of the same kidney. Sixteen mini-pig were used. All the animals were performed a right nephrectomy after 45-minute occlusion of the vascular pedicle. The kidneys were then divided into 2 groups (phase 1): cold storage in university of wisconsin (UW) solution for 3 hours (group A, n = 8) at 4°C, or cold storage in UW for 12 hours (group B, n = 8) at 4°C. Four organs of group A and four organs of group B were autotrasplanted (AT) and reperfused for 1 hour (phase 2). Nephrectomy was finally done. Biopsies were taken from all groups to perform cultures of proximal tubule epithelium cells. The biopsies were subjected to studies of cellular morphological viability (contrast phase microscopy [CPM]) and quantitative (confluence cell [CC]) parameters. Phase of pure CI effects (phase 1): Both CC rate and CPM parameters were significantly lower in group B compared with group A, where cell activity reached almost normal results. Phase of CI + AT (phase 2): At produced additional harmful effects in cell cultures compared with those obtained in phase 1, more evident in group B cells. The presence of cold storage followed by rewarming-reperfusion induces independent and cumulative detrimental effects in viability of renal proximal tubule cells. CI periods ≤ 3 hours may ameliorate the injuries secondary to reperfusion in comparison with longer CI periods. Copyright © 2013 Elsevier Inc. All rights reserved.

Molecular methods for biofilms

KAUST Repository

Ferrera, Isabel

2014-08-30

This chapter deals with both classical and modern molecular methods that can be useful for the identification of microorganisms, elucidation and comparison of microbial communities, and investigation of their diversity and functions. The most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples; these are discussed in the first part. The second part provides an overview over DNA polymerase chain reaction (PCR) amplification and DNA sequencing methods. Protocols and analysis software as well as potential pitfalls associated with application of these methods are discussed. Community fingerprinting analyses that can be used to compare multiple microbial communities are discussed in the third part. This part focuses on Denaturing Gradient Gel Electrophoresis (DGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP) and Automated rRNA Intergenic Spacer Analysis (ARISA) methods. In addition, classical and next-generation metagenomics methods are presented. These are limited to bacterial artificial chromosome and Fosmid libraries and Sanger and next-generation 454 sequencing, as these methods are currently the most frequently used in research. Isolation of nucleic acids: This chapter discusses, the most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples. Nucleic acid isolation methods generally include three steps: cell lysis, removal of unwanted substances, and a final step of DNA purification and recovery. The first critical step is the cell lysis, which can be achieved by enzymatic or mechanical procedures. Removal of proteins, polysaccharides and other unwanted substances is likewise important to avoid their interference in subsequent analyses. Phenol-chloroform-isoamyl alcohol is commonly used to recover DNA, since it separates nucleic acids into an aqueous phase and precipitates proteins and

Molecular methods for biofilms

KAUST Repository

Ferrera, Isabel; Balagué , Vanessa; Voolstra, Christian R.; Aranda, Manuel; Bayer, Till; Abed, Raeid M.M.; Dobretsov, Sergey; Owens, Sarah M.; Wilkening, Jared; Fessler, Jennifer L.; Gilbert, Jack A.

2014-01-01

This chapter deals with both classical and modern molecular methods that can be useful for the identification of microorganisms, elucidation and comparison of microbial communities, and investigation of their diversity and functions. The most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples; these are discussed in the first part. The second part provides an overview over DNA polymerase chain reaction (PCR) amplification and DNA sequencing methods. Protocols and analysis software as well as potential pitfalls associated with application of these methods are discussed. Community fingerprinting analyses that can be used to compare multiple microbial communities are discussed in the third part. This part focuses on Denaturing Gradient Gel Electrophoresis (DGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP) and Automated rRNA Intergenic Spacer Analysis (ARISA) methods. In addition, classical and next-generation metagenomics methods are presented. These are limited to bacterial artificial chromosome and Fosmid libraries and Sanger and next-generation 454 sequencing, as these methods are currently the most frequently used in research. Isolation of nucleic acids: This chapter discusses, the most important and critical steps necessary for all molecular methods is DNA isolation from microbial communities and environmental samples. Nucleic acid isolation methods generally include three steps: cell lysis, removal of unwanted substances, and a final step of DNA purification and recovery. The first critical step is the cell lysis, which can be achieved by enzymatic or mechanical procedures. Removal of proteins, polysaccharides and other unwanted substances is likewise important to avoid their interference in subsequent analyses. Phenol-chloroform-isoamyl alcohol is commonly used to recover DNA, since it separates nucleic acids into an aqueous phase and precipitates proteins and

Microbial community dynamics in thermophilic undefined milk starter cultures.

Science.gov (United States)

Parente, Eugenio; Guidone, Angela; Matera, Attilio; De Filippis, Francesca; Mauriello, Gianluigi; Ricciardi, Annamaria

2016-01-18

Model undefined thermophilic starter cultures were produced from raw milk of nine pasta-filata cheesemaking plants using a selective procedure based on pasteurization and incubation at high temperature with the objective of studying the microbial community dynamics and the variability in performances under repeated (7-13) reproduction cycles with backslopping. The traditional culture-dependent approach, based on random isolation and molecular characterization of isolates was coupled to the determination of pH and the evaluation of the ability to produce acid and fermentation metabolites. Moreover, a culture-independent approach based on amplicon-targeted next-generation sequencing was employed. The microbial diversity was evaluated by 16S rRNA gene sequencing (V1-V3 regions), while the microdiversity of Streptococcus thermophilus populations was explored by using novel approach based on sequencing of partial amplicons of the phosphoserine phosphatase gene (serB). In addition, the occurrence of bacteriophages was evaluated by qPCR and by multiplex PCR. Although it was relatively easy to select for a community dominated by thermophilic lactic acid bacteria (LAB) within a single reproduction cycle, final pH, LAB populations and acid production activity fluctuated over reproduction cycles. Both culture-dependent and -independent methods showed that the cultures were dominated by either S. thermophilus or Lactobacillus delbrueckii subsp. lactis or by both species. Nevertheless, subdominant mesophilic species, including lactococci and spoilage organisms, persisted at low levels. A limited number of serB sequence types (ST) were present in S. thermophilus populations. L. delbrueckii and Lactococcus lactis bacteriophages were below the detection limit of the method used and high titres of cos type S. thermophilus bacteriophages were detected in only two cases. In one case a high titre of bacteriophages was concurrent with a S. thermophilus biotype shift in the culture

A method for culturing human hair follicle cells.

Science.gov (United States)

Weterings, P J; Vermorken, A J; Bloemendal, H

1981-01-01

For the first time a method for culturing human hair follicle cells is described. The bovine eye lens capsule, a basement membrane-like structure, is used as the substrate for the cultures. In a culture medium supplemented with hydrocortisone and insulin about 70% of the original follicles will form growing colonies of diploid keratinocytes.

Molecular separation method and apparatus

International Nuclear Information System (INIS)

Villa-Aleman, E.

1996-01-01

A method and apparatus are disclosed for separating a gaseous mixture of chemically identical but physically different molecules based on their polarities. The gaseous mixture of molecules is introduced in discrete quantities into the proximal end of a porous glass molecular sieve. The molecular sieve is exposed to microwaves to excite the molecules to a higher energy state from a lower energy state, those having a higher dipole moment being excited more than those with a lower energy state. The temperature of the sieve kept cold by a flow of liquid nitrogen through a cooling jacket so that the heat generated by the molecules colliding with the material is transferred away from the material. The molecules thus alternate between a higher energy state and a lower one, with the portion of molecules having the higher dipole moment favored over the others. The former portion can then be extracted separately from the distal end of the molecular sieve. 2 figs

Comparison of PCR method with the culture method for identification of gonococci from endocervical swabs

Directory of Open Access Journals (Sweden)

Alam A

2002-01-01

Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.

Application of culture-dependent and culture-independent methods for the identification of Lactobacillus kefiranofaciens in microbial consortia present in kefir grains.

Science.gov (United States)

Hamet, Maria Fernanda; Londero, Alejandra; Medrano, Micaela; Vercammen, Elisabeth; Van Hoorde, Koenraad; Garrote, Graciela L; Huys, Geert; Vandamme, Peter; Abraham, Analía G

2013-12-01

The biological and technological characteristics of kefiran as well as its importance in grain integrity led us to analyze the microbial kefir grain consortium with focus on Lactobacillus kefiranofaciens. The presence of L. kefiranofaciens in the nine kefir grains studied was demonstrated by denaturing gradient gel electrophoresis. By culture dependent methods applying a methodology focused on the search of this species, 22 isolates with typical morphology were obtained and identified applying a combination of SDS-PAGE of whole cell proteins, (GTG)5-PCR and sequence analysis of the housekeeping gene encoding the α-subunit of bacterial phenylalanyl-tRNA synthase (pheS). This polyphasic approach allowed the reliable identification of 11 L. kefiranofaciens, 5 Lactobacillus paracasei, 4 Lactobacillus kefiri and 2 Lactobacillus parakefiri isolates. Isolated L. kefiranofaciens strains produced polysaccharide in strain-dependent concentrations and EPS produced by them also differed in the degree of polymerization. The isolation and accurate identification of L. kefiranofaciens is relevant taking into account the important role of this microorganism in the grain ecosystem as well as its potential application as starter in food fermentations. Copyright © 2013 Elsevier Ltd. All rights reserved.

Comparison of classical and molecular techniques for the determination of microbial biodiversity in Mediterranean crop soils

Energy Technology Data Exchange (ETDEWEB)

Munoz, A.; Lopez-Pineiro, A.; Ramirez, M.

2009-07-01

Soil microbe ecology has lately become increasingly important in the study of soil microbe populations. direct extraction of soil bacteria DNA allows PCR and DGGE analyses for the microorganism identification of these complex samples, avoiding the need for time-consuming culture-dependent techniques. The aim of the present study was to compare the two techniques (culture-dependent and molecular culture-independent) in four different plots of maize (Zea mays L.) crop under irrigation in south-western Spain. (Author)

A low-density culture method of cerebellar granule neurons with paracrine support applicable for the study of neuronal morphogenesis.

Science.gov (United States)

Kubota, Kenta; Seno, Takeshi; Konishi, Yoshiyuki

2013-11-20

Cerebellar granule neuronal cultures have been used to study the molecular mechanisms underlying neuronal functions, including neuronal morphogenesis. However, a limitation of this system is the difficulty to analyze isolated neurons because these are required to be maintained at a high density. Therefore, in the present study, we aimed to develop a simple and cost-effective method for culturing low-density cerebellar granule neurons. Cerebellar granule cells at two different densities (low- and high-density) were co-cultivated in order for the low-density culture to be supported by the paracrine signals from the high-density culture. This method enabled morphology analysis of isolated cerebellar granule neurons without astrocytic feeder cultures or supplements such as B27. Using this method, we investigated the function of a polarity factor. Studies using hippocampal neurons suggested that glycogen synthase kinase-3 (GSK-3) is an essential regulator of neuronal polarity, and inhibition of GSK-3 results in the formation of multiple axons. Pharmacological inhibitors for GSK-3 (6-bromoindirubin-3'-oxime and lithium chloride) did not cause the formation of multiple axons of cerebellar granule neurons but significantly reduced their length. Consistent results were obtained by introducing kinase-dead form of GSK-3 beta (K85A). These results indicated that GSK-3 is not directly involved in the control of neuronal polarity in cerebellar granule neurons. Overall, this study provides a simple method for culturing low-density cerebellar granule neurons and insights in to the neuronal-type dependent function of GSK-3 in neuronal morphogenesis. © 2013 Elsevier B.V. All rights reserved.

VALUE-MOTIVATIONAL COMPONENT OF METHODICAL CULTURE OF PRIMARY SCHOOL TEACHER: THE ESSENCE AND WAYS OF FORMATION

Directory of Open Access Journals (Sweden)

Natalia Nikula

2017-03-01

Full Text Available One of the main conditions of formation of methodological culture of primary school teacher, a factor that encourages the assimilation of effective models of professional and methodical activity is value-motivational component. In order to clearly understand the content of the phenomenon appointed its author selected criteria: system values orientation and professional and personal motivation. The value orientation as a set of values focus on professional and methodological activities which manifest themselves in individual positive attitude of students to it is determined on the base of the analysis of scientific and pedagogical sources. The indicators of value orientations are: human values (truth, goodness, beauty, life and health; personal values of teachers (humanity, justice, diligence, responsibility; teacher professional values (commitment, independence, initiative, organization, value orientation on professional and methodical activities. The essence of professional and personal motivation as individual education teacher's personality, which includes professional and personal motives, interests, needs, formation of which is a clear reference and internal impetus for the formation of methodological culture. The indicators of this criterion are: professional and methodical motivation; methodically-focused orientation teacher; interest in the success in professional and methodical work of the teacher; the need for professional self-realization and self-affirmation; desire career advancement; focus on student mastery of methodological culture. The system measure of the formation of values and motivational component: discussions, exercises, training exercises, collective creative discussion, a role play, a workshop is analysed.

Identification by culture, PCR, and immunohistochemistry of mycoplasmas and their molecular typing in sheep and lamb lungs with pneumonia in Eastern Turkey.

Science.gov (United States)

Kılıc, Ayşe; Kalender, Hakan; Eroksuz, Hatice; Muz, Adile; Tasdemir, Bülent

2013-10-01

This study used cultures, polymerase chain reaction (PCR), and immunoperoxidase to examine samples from 216 lungs from sheep and lambs with macroscopic pneumonia lesions for the presence of Mycoplasma species. DNA was extracted from lung tissue samples and broth cultures with the help of a DNA extraction kit and replicated using genus-specific and species-specific primers for mycoplasma. The lung samples were examined by the immunoperoxidase method using hyperimmune Mycoplasma ovipneumoniae serum. The randomly amplified polymorphic DNA (RAPD) test was used for the molecular typing of M. ovipneumoniae isolates. Mycoplasma was isolated in the cultures of 80 (37.03 %) of a total of 216 lung samples. Genus-specific mycoplasma DNA was identified by PCR in 96 (44.44 %) samples in broth cultures and 36 (16.66 %) directly in the lung tissue. Of these 96 cases in which genus-specific identification was made, 57 (59.37 %) were positive for reaction with species-specific primers for M. ovipneumoniae and 31 (32.29 %) for Mycoplasma arginini. The DNA of neither of the latter two species could be identified in the remaining eight samples (8.33 %) where mycoplasma had been identified. As for the immunoperoxidase method, it identified M. ovipneumoniae in 61 of 216 lung samples (28 %). Positive staining was concentrated in the bronchial epithelium cell cytoplasm and cell surface. RAPD analysis resulted in 15 different profiles. Our results suggest that PCR methods could be successfully used in the diagnosis of mycoplasma infections as an alternative to culture method and identifying this agent at the species level.

Slifers revisited: a method for determining yields independent of radiochemical measurements

International Nuclear Information System (INIS)

Rambo, J.T.

1976-01-01

It would be very desirable if an independent method other than radiochemical measurement were available to determine the yields of low-yield events in the alluviums and tuffs of areas 2, 9, and 10 at the Nevada Test Site. The successful application of slifers to the measurement of yields from high-yield events suggests that under some conditions they may also be usable with low-yield events. This view is supported by the evidence discussed here, which is based on direct experience with slifer yield measurements for low-yield events in porous media. Suggested methods for improving slifer yield determinations and a method for determining yields independent of radiochemical measurements are offered

Infection with Pathogens Transmitted Commonly Through Food and the Effect of Increasing Use of Culture-Independent Diagnostic Tests on Surveillance--Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 2012-2015.

Science.gov (United States)

Huang, Jennifer Y; Henao, Olga L; Griffin, Patricia M; Vugia, Duc J; Cronquist, Alicia B; Hurd, Sharon; Tobin-D'Angelo, Melissa; Ryan, Patricia; Smith, Kirk; Lathrop, Sarah; Zansky, Shelley; Cieslak, Paul R; Dunn, John; Holt, Kristin G; Wolpert, Beverly J; Patrick, Mary E

2016-04-15

To evaluate progress toward prevention of enteric and foodborne illnesses in the United States, the Foodborne Diseases Active Surveillance Network (FoodNet) monitors the incidence of laboratory-confirmed infections caused by nine pathogens transmitted commonly through food in 10 U.S. sites. This report summarizes preliminary 2015 data and describes trends since 2012. In 2015, FoodNet reported 20,107 confirmed cases (defined as culture-confirmed bacterial infections and laboratory-confirmed parasitic infections), 4,531 hospitalizations, and 77 deaths. FoodNet also received reports of 3,112 positive culture-independent diagnostic tests (CIDTs) without culture-confirmation, a number that has markedly increased since 2012. Diagnostic testing practices for enteric pathogens are rapidly moving away from culture-based methods. The continued shift from culture-based methods to CIDTs that do not produce the isolates needed to distinguish between strains and subtypes affects the interpretation of public health surveillance data and ability to monitor progress toward prevention efforts. Expanded case definitions and strategies for obtaining bacterial isolates are crucial during this transition period.

A hanging drop culture method to study terminal erythroid differentiation.

Science.gov (United States)

Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak

2005-10-01

To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.

Usability in a cultural context

DEFF Research Database (Denmark)

Clemmensen, Torkil; Yammiyavar, Pradeep; Ørngreen, Rikke

2010-01-01

This paper focuses on presenting and discussing the aim, context, challenges, results, and impact of the Cultural usability project named as CultUsab. This project was a four year international research effort from 2006 to 2009, which was supported by a grant for the Danish Research Councils...... for Independent Research in Culture and Communication. The project aimed at innovating processes in Information and Communication Technology development through an understanding of culturally sensitive aspects of usability evaluation methods....

A simple method for multiday imaging of slice cultures.

Science.gov (United States)

Seidl, Armin H; Rubel, Edwin W

2010-01-01

The organotypic slice culture (Stoppini et al. A simple method for organotypic cultures of nervous tissue. 1991;37:173-182) has become the method of choice to answer a variety of questions in neuroscience. For many experiments, however, it would be beneficial to image or manipulate a slice culture repeatedly, for example, over the course of many days. We prepared organotypic slice cultures of the auditory brainstem of P3 and P4 mice and kept them in vitro for up to 4 weeks. Single cells in the auditory brainstem were transfected with plasmids expressing fluorescent proteins by way of electroporation (Haas et al. Single-cell electroporation for gene transfer in vivo. 2001;29:583-591). The culture was then placed in a chamber perfused with oxygenated ACSF and the labeled cell imaged with an inverted wide-field microscope repeatedly for multiple days, recording several time-points per day, before returning the slice to the incubator. We describe a simple method to image a slice culture preparation during the course of multiple days and over many continuous hours, without noticeable damage to the tissue or photobleaching. Our method uses a simple, inexpensive custom-built insulator constructed around the microscope to maintain controlled temperature and uses a perfusion chamber as used for in vitro slice recordings. (c) 2009 Wiley-Liss, Inc.

Simple and convenient method for culturing anaerobic bacteria.

OpenAIRE

Behbehani, M J; Jordan, H V; Santoro, D L

1982-01-01

A simple and convenient method for culturing anaerobic bacteria is described. Cultures can be grown in commercially available flasks normally used for preparation of sterile external solutions. A special disposable rubber flask closure maintains anaerobic conditions in the flask after autoclaving. Growth of a variety of anaerobic oral bacteria was comparable to that obtained after anaerobic incubation of broth cultures in Brewer Anaerobic Jars.

Management Technology of Students’ Independent Work

Directory of Open Access Journals (Sweden)

Melis K. Asanaliev

2012-09-01

Full Text Available The researchers are convinced that for an intensification of educational process in higher education institution it is necessary development of essentially new approaches, forms and the methods of social and pedagogical interaction adequate to new requirements, new pedagogical thinking. Among them we can choose the methods of social and psychological training (SPT which received their development in experimental psychology by synthesis of wide practical experience educational, creative, administrative, and other types of interrelation between people. These methods conditionally divide on: debatable (group discussion, analysis of a situation of a moral choice, game methods (didactic, creative, role-playing games, sensitive training (training of interpersonal sensitivity which are formations of independent informative activity of students on the basis of modern technologies, as the mechanism of improvement of independent work. Researches are expressed in search and finding enough effective forms and means of activation of educational and informative process of preparation of young teachers of vocational training, theoretically and practically prepared in the field of the independent informative activity, use the modern technology of training and its further realization in work with students of technical secondary. It is offered the model of the organization and application in educational process of the complex of these methods in contents complex of training programs of systems of tasks as one of ways of formation of social and psychological culture of future teacher.

The method of sections in molecular physics

International Nuclear Information System (INIS)

Natarajan, P.; Zygelman, B.

1993-01-01

In the standard Born-Oppenheimer theory the nuclear wave-function for a bound, rotating, di-atom system is described by the Wigner functions. Unlike the spherical harmonics, the Wigner functions exhibit cusp singularities at the poles of the space-fixed coordinate system. These singularities are identical to the ones encountered in the quantum mechanics treatment of a charged particle under the influence of a magnetic monopole. In the latter case the method of sectional was introduced to eliminate the singularities. The method of sections was also introduced in molecular physics. We discuss here, in detail, their properties and advantage of using this construction in molecular physics

Multicenter evaluation of molecular and culture-dependent diagnostics for Shigella species and Entero-invasive Escherichia coli in the Netherlands.

Science.gov (United States)

van den Beld, Maaike J C; Friedrich, Alexander W; van Zanten, Evert; Reubsaet, Frans A G; Kooistra-Smid, Mirjam A M D; Rossen, John W A

2016-12-01

An inter-laboratory collaborative trial for the evaluation of diagnostics for detection and identification of Shigella species and Entero-invasive Escherichia coli (EIEC) was performed. Sixteen Medical Microbiological Laboratories (MMLs) participated. MMLs were interviewed about their diagnostic methods and a sample panel, consisting of DNA-extracts and spiked stool samples with different concentrations of Shigella flexneri, was provided to each MML. The results of the trial showed an enormous variety in culture-dependent and molecular diagnostic techniques currently used among MMLs. Despite the various molecular procedures, 15 out of 16 MMLs were able to detect Shigella species or EIEC in all the samples provided, showing that the diversity of methods has no effect on the qualitative detection of Shigella flexneri. In contrast to semi quantitative analysis, the minimum and maximum values per sample differed by approximately five threshold cycles (Ct-value) between the MMLs included in the study. This indicates that defining a uniform Ct-value cut-off for notification to health authorities is not advisable. Copyright © 2016 Elsevier B.V. All rights reserved.

Green close-quote s function method with energy-independent vertex functions

International Nuclear Information System (INIS)

Tsay Tzeng, S.Y.; Kuo, T.T.; Tzeng, Y.; Geyer, H.B.; Navratil, P.

1996-01-01

In conventional Green close-quote s function methods the vertex function Γ is generally energy dependent. However, a model-space Green close-quote s function method where the vertex function is manifestly energy independent can be formulated using energy-independent effective interaction theories based on folded diagrams and/or similarity transformations. This is discussed in general and then illustrated for a 1p1h model-space Green close-quote s function applied to a solvable Lipkin many-fermion model. The poles of the conventional Green close-quote s function are obtained by solving a self-consistent Dyson equation and model space calculations may lead to unphysical poles. For the energy-independent model-space Green close-quote s function only the physical poles of the model problem are reproduced and are in satisfactory agreement with the exact excitation energies. copyright 1996 The American Physical Society

Polyphony: superposition independent methods for ensemble-based drug discovery.

Science.gov (United States)

Pitt, William R; Montalvão, Rinaldo W; Blundell, Tom L

2014-09-30

Structure-based drug design is an iterative process, following cycles of structural biology, computer-aided design, synthetic chemistry and bioassay. In favorable circumstances, this process can lead to the structures of hundreds of protein-ligand crystal structures. In addition, molecular dynamics simulations are increasingly being used to further explore the conformational landscape of these complexes. Currently, methods capable of the analysis of ensembles of crystal structures and MD trajectories are limited and usually rely upon least squares superposition of coordinates. Novel methodologies are described for the analysis of multiple structures of a protein. Statistical approaches that rely upon residue equivalence, but not superposition, are developed. Tasks that can be performed include the identification of hinge regions, allosteric conformational changes and transient binding sites. The approaches are tested on crystal structures of CDK2 and other CMGC protein kinases and a simulation of p38α. Known interaction - conformational change relationships are highlighted but also new ones are revealed. A transient but druggable allosteric pocket in CDK2 is predicted to occur under the CMGC insert. Furthermore, an evolutionarily-conserved conformational link from the location of this pocket, via the αEF-αF loop, to phosphorylation sites on the activation loop is discovered. New methodologies are described and validated for the superimposition independent conformational analysis of large collections of structures or simulation snapshots of the same protein. The methodologies are encoded in a Python package called Polyphony, which is released as open source to accompany this paper [http://wrpitt.bitbucket.org/polyphony/].

Development of a New Safety Culture Assessment Method for Nuclear Power Plants (NPPs) (A study to suggest a new safety culture assessment method in nuclear power plants)

International Nuclear Information System (INIS)

Han, Sang Min; Seong, Poong Hyun

2014-01-01

This study is conducted to suggest a new safety culture assessment method in nuclear power plants. Criteria with various existing safety culture analysis methods are united, and reliability analysis methods are applied. The concept of the most representative methods, Fault Tree Analysis (FTA) and Failure Mode and Effect Analysis (FMEA), are adopted to assess safety culture. Through this application, it is expected that the suggested method will bring results with convenience and objectiveness

Development of a New Safety Culture Assessment Method for Nuclear Power Plants (NPPs) (A study to suggest a new safety culture assessment method in nuclear power plants)

Energy Technology Data Exchange (ETDEWEB)

Han, Sang Min; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)

2014-08-15

This study is conducted to suggest a new safety culture assessment method in nuclear power plants. Criteria with various existing safety culture analysis methods are united, and reliability analysis methods are applied. The concept of the most representative methods, Fault Tree Analysis (FTA) and Failure Mode and Effect Analysis (FMEA), are adopted to assess safety culture. Through this application, it is expected that the suggested method will bring results with convenience and objectiveness.

In vitro culture method of powdery mildew (Oidium heveae ...

African Journals Online (AJOL)

ELOHO

2012-08-23

Aug 23, 2012 ... A method for culturing powdery mildew (Oidium heveae) from isolated leaves of ... solution; d, Colour phase leaves with nutrient solution in culture dish; e, in vitro ... Plant and fungus materials .... same change trend during whole culture period. ... consistent with the field resistance identification results of.

Application of numerical methods to the determination of molecular wave functions

International Nuclear Information System (INIS)

Douady, Jerome

1969-01-01

A simplified SCF Method is developed. The wave function of molecular systems and spin densities in the case of free radicals are computed from geometrical data. This method, including at the beginning a delocalization of electrons over all the molecular system, two methods which clear out bonding and anti-bonding interactions have been studied and programmed: a) overlap population analysis, b) localisation of molecular orbitals. These methods have been carried out in the case of organic compounds and free radicals. (author) [fr

Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

Science.gov (United States)

Stachelska, M A

2017-09-26

The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

Development of molecular markers for zebrafish (Danio rerio) ovarian follicle growth assessment following in-vitro culture in cryopreservation studies.

Science.gov (United States)

Anil, Siji; Rawson, David; Zhang, Tiantian

2018-05-29

Development of in vitro culture protocol for early stage ovarian follicles of zebrafish is important since cryopreserved early stage ovarian follicles would need to be matured in vitro following cryopreservation before they can be fertilised. Development of molecular markers for zebrafish (Danio rerio) ovarian follicle growth assessment following in vitro culture of early stage zebrafish ovarian follicles in ovarian tissue fragments is reported here for the first time although some work has been reported for in vitro culture of isolated early stage zebrafish ovarian follicles. The main aim of the present study was to develop molecular markers in an optimised in vitro culture protocol for stage I and stage II zebrafish ovarian follicles in ovarian tissue fragments. The effect of concentration of the hormones human chorionic gonadotropin and follicle stimulating hormones, and additives such as Foetal Bovine Serum and Bovine Serum Albumin were studied. The results showed that early stage zebrafish ovarian fragments containing stage I and stage II follicles which are cultured in vitro for 24 h in 20% FBS and 100mIU/ml FSH in 90% L-15 medium at 28 °C can grow to the size of stage II and stage III ovarian follicles respectively. More importantly the follicle growth from stage I to stage II and from stage II to stage III were confirmed using molecular markers such as cyp19a1a (also known as P450aromA) and vtg1 genes respectively. However, no follicle growth was observed following cryopreservation and in vitro culture. Copyright © 2018 Elsevier Inc. All rights reserved.

Method for improved selectivity in photo-activation of molecular agents

Science.gov (United States)

Fisher, Walter G.; Wachter, Eric A.; Dees, H. Craig

1998-01-01

A method for the treatment of a particular volume of plant or animal tissue comprising the steps of treating the plant or animal tissue with at least one photo-active molecular agent, wherein the particular volume of the plant or animal tissue retains at least a portion of the at least one photo-active molecular agent, and then treating the particular volume of the plant or animal tissue with light sufficient to promote a simultaneous two-photon excitation of at least one of the at least one photo-active molecular agent retained in the particular volume of the plant or animal tissue, wherein the at least one photo-active molecular agent becomes active in the particular volume of the plant or animal tissue. There is also disclosed a method for the treatment of cancer in plant or animal tissue and a method for producing at least one photo-activated molecular agent in a particular volume of a material.

Culture, Method, and the Content of Self-Concepts: Testing Trait, Individual-Self-Primacy, and Cultural Psychology Perspectives.

Science.gov (United States)

Del Prado, Alicia M; Church, A Timothy; Katigbak, Marcia S; Miramontes, Lilia G; Whitty, Monica; Curtis, Guy J; de Jesús Vargas-Flores, José; Ibáñez-Reyes, Joselina; Ortiz, Fernando A; Reyes, Jose Alberto S

2007-12-01

Three theoretical perspectives on cultural universals and differences in the content of self-concepts were tested in individualistic (United States, n = 178; Australia, n = 112) and collectivistic (Mexico, n = 157; Philippines, n = 138) cultures, using three methods of self-concept assessment. Support was found for both trait perspectives and the individual-self-primacy hypothesis. In contrast, support for cultural psychology hypotheses was limited because traits and other personal attributes were not more salient, or social attributes less salient, in individualistic cultures than collectivistic cultures. The salience of some aspects of self-concept depended on the method of assessment, calling into question conclusions based on monomethod studies.

Method of independent timesteps in the numerical solution of initial value problems

International Nuclear Information System (INIS)

Porter, A.P.

1976-01-01

In the numerical solution of initial-value problems in several independent variables, the timestep is controlled, especially in the presence of shocks, by a small portion of the logical mesh, what one may call the crisis zone. One is frustrated by the necessity of doing in the whole mesh frequent calculations required by only a small part of the mesh. It is shown that it is possible to choose different timesteps natural to different parts of the mesh and to advance each zone in time only as often as is appropriate to that zone's own natural timestep. Prior work is reviewed and for the first time an investigation of the conditions for well-posedness, consistency and stability in independent timesteps is presented; a new method results. The prochronic and parachronic Cauchy surfaces are identified; and the reasons (well-posedness) for constraining the Cauchy surfaces to be prochronic (as distinct from the method of Grandey), that is, to lie prior to the time of the crisis zone (the zone of least timestep), are indicated. Stability (in the maximum norm) of parabolic equations and (in the L2 norm) of hyperbolic equations is reviewed, without restricting the treatment to linear equations or constant coefficients, and stability of the new method is proven in this framework. The details of the method of independent timesteps, the rules for choosing timesteps and for deciding when to update and when to skip zones, and the method of joining adjacent regions of differing timestep are described. The stability of independent timestep difference schemes is analyzed and exhibited. The economic advantages of the method, which often amount to an order-of-magnitude decrease in running time relative to conventional or implicit difference methods, are noted

Method of independent timesteps in the numerical solution of initial value problems

Energy Technology Data Exchange (ETDEWEB)

Porter, A.P.

1976-07-21

In the numerical solution of initial-value problems in several independent variables, the timestep is controlled, especially in the presence of shocks, by a small portion of the logical mesh, what one may call the crisis zone. One is frustrated by the necessity of doing in the whole mesh frequent calculations required by only a small part of the mesh. It is shown that it is possible to choose different timesteps natural to different parts of the mesh and to advance each zone in time only as often as is appropriate to that zone's own natural timestep. Prior work is reviewed and for the first time an investigation of the conditions for well-posedness, consistency and stability in independent timesteps is presented; a new method results. The prochronic and parachronic Cauchy surfaces are identified; and the reasons (well-posedness) for constraining the Cauchy surfaces to be prochronic (as distinct from the method of Grandey), that is, to lie prior to the time of the crisis zone (the zone of least timestep), are indicated. Stability (in the maximum norm) of parabolic equations and (in the L2 norm) of hyperbolic equations is reviewed, without restricting the treatment to linear equations or constant coefficients, and stability of the new method is proven in this framework. The details of the method of independent timesteps, the rules for choosing timesteps and for deciding when to update and when to skip zones, and the method of joining adjacent regions of differing timestep are described. The stability of independent timestep difference schemes is analyzed and exhibited. The economic advantages of the method, which often amount to an order-of-magnitude decrease in running time relative to conventional or implicit difference methods, are noted.

The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

Science.gov (United States)

Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

2016-08-03

of Mycobacterium tuberculosis would provide a clinically useful readout. The methods described in this study provide a means by which the technical performance of quantitative molecular methods can be evaluated independently of clinical variability to improve accuracy of measurement results. These will assist in ultimately increasing the likelihood that such approaches could be used to improve patient management of TB.

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Directory of Open Access Journals (Sweden)

Pui-Ying Iroh Tam

Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Science.gov (United States)

Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K

2016-01-01

Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

Dialectical Method and the Critical Political Economy of Culture

Directory of Open Access Journals (Sweden)

Brice Nixon

2012-05-01

Full Text Available This article argues that the quality that defines critical political economy is its critical method. Definitions of the critical political economy of culture are considered and shown to focus on specific theoretical concerns while not fully addressing the fundamental issue of method. Method is here discussed in terms of the way human reason is used to produce knowledge. A critical method for Marx is a historical materialist dialectical method, thus this paper argues for a deeper consideration of the Marxist dialectical method in relation to critical political-economic theorizing. Sources for methodological consideration from Marx to 20th-century Western Marxists are outlined. The potential contribution of the Marxist dialectical method in the continued development of the critical political economy of culture is demonstrated by showing the possibility of developing a complementary critical political economy of consciousness. Smythe’s theorizing of audiences as workers is considered as a useful starting point, and its potential development through incorporation of the work of other critical scholars of media and culture is outlined.

Performance assessment of semiempirical molecular orbital methods in describing halogen bonding: quantum mechanical and quantum mechanical/molecular mechanical-molecular dynamics study.

Science.gov (United States)

Ibrahim, Mahmoud A A

2011-10-24

The performance of semiempirical molecular-orbital methods--MNDO, MNDO-d, AM1, RM1, PM3 and PM6--in describing halogen bonding was evaluated, and the results were compared with molecular mechanical (MM) and quantum mechanical (QM) data. Three types of performance were assessed: (1) geometrical optimizations and binding energy calculations for 27 halogen-containing molecules complexed with various Lewis bases (Two of the tested methods, AM1 and RM1, gave results that agree with the QM data.); (2) charge distribution calculations for halobenzene molecules, determined by calculating the solvation free energies of the molecules relative to benzene in explicit and implicit generalized Born (GB) solvents (None of the methods gave results that agree with the experimental data.); and (3) appropriateness of the semiempirical methods in the hybrid quantum-mechanical/molecular-mechanical (QM/MM) scheme, investigated by studying the molecular inhibition of CK2 protein by eight halobenzimidazole and -benzotriazole derivatives using hybrid QM/MM molecular-dynamics (MD) simulations with the inhibitor described at the QM level by the AM1 method and the rest of the system described at the MM level. The pure MM approach with inclusion of an extra point of positive charge on the halogen atom approach gave better results than the hybrid QM/MM approach involving the AM1 method. Also, in comparison with the pure MM-GBSA (generalized Born surface area) binding energies and experimental data, the calculated QM/MM-GBSA binding energies of the inhibitors were improved by replacing the G(GB,QM/MM) solvation term with the corresponding G(GB,MM) term.

The Independent Evolution Method Is Not a Viable Phylogenetic Comparative Method.

Directory of Open Access Journals (Sweden)

Randi H Griffin

Full Text Available Phylogenetic comparative methods (PCMs use data on species traits and phylogenetic relationships to shed light on evolutionary questions. Recently, Smaers and Vinicius suggested a new PCM, Independent Evolution (IE, which purportedly employs a novel model of evolution based on Felsenstein's Adaptive Peak Model. The authors found that IE improves upon previous PCMs by producing more accurate estimates of ancestral states, as well as separate estimates of evolutionary rates for each branch of a phylogenetic tree. Here, we document substantial theoretical and computational issues with IE. When data are simulated under a simple Brownian motion model of evolution, IE produces severely biased estimates of ancestral states and changes along individual branches. We show that these branch-specific changes are essentially ancestor-descendant or "directional" contrasts, and draw parallels between IE and previous PCMs such as "minimum evolution". Additionally, while comparisons of branch-specific changes between variables have been interpreted as reflecting the relative strength of selection on those traits, we demonstrate through simulations that regressing IE estimated branch-specific changes against one another gives a biased estimate of the scaling relationship between these variables, and provides no advantages or insights beyond established PCMs such as phylogenetically independent contrasts. In light of our findings, we discuss the results of previous papers that employed IE. We conclude that Independent Evolution is not a viable PCM, and should not be used in comparative analyses.

The agony of choice in dermatophyte diagnostics-performance of different molecular tests and culture in the detection of Trichophyton rubrum and Trichophyton interdigitale.

Science.gov (United States)

Kupsch, C; Ohst, T; Pankewitz, F; Nenoff, P; Uhrlaß, S; Winter, I; Gräser, Y

2016-08-01

Dermatophytosis caused by dermatophytes of the genera Trichophyton and Microsporum belong to the most frequent mycoses worldwide. Molecular detection methods proved to be highly sensitive and enable rapid and accurate detection of dermatophyte species from clinical specimens. For the first time, we compare the performance of different molecular methods with each other and with conventional diagnostics in the detection of dermatophytoses caused by Trichophyton rubrum and Trichophyton interdigitale in clinical specimens (nail, skin and hair). The compared molecular methods comprise two already published PCR-ELISAs, a published quantitative RT-PCR as well as a newly developed PCR-ELISA targeting the internal transcribed spacer region. We investigated the sensitivity of the assays by analysing 375 clinical samples. In 148 specimens (39.5%) a positive result was gained in at least one of the four molecular tests or by culture, but the number of detected agents differed significantly between some of the assays. The most sensitive assay, a PCR-ELISA targeting a microsatellite region, detected 81 T. rubrum infections followed by an internal transcribed spacer PCR-ELISA (60), quantitative RT-PCR (52) and a topoisomerase II PCR-ELISA (51), whereas cultivation resulted in T. rubrum identification in 37 samples. The pros and cons of all four tests in routine diagnostics are discussed. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Cultural adaptation and translation of measures: an integrated method.

Science.gov (United States)

Sidani, Souraya; Guruge, Sepali; Miranda, Joyal; Ford-Gilboe, Marilyn; Varcoe, Colleen

2010-04-01

Differences in the conceptualization and operationalization of health-related concepts may exist across cultures. Such differences underscore the importance of examining conceptual equivalence when adapting and translating instruments. In this article, we describe an integrated method for exploring conceptual equivalence within the process of adapting and translating measures. The integrated method involves five phases including selection of instruments for cultural adaptation and translation; assessment of conceptual equivalence, leading to the generation of a set of items deemed to be culturally and linguistically appropriate to assess the concept of interest in the target community; forward translation; back translation (optional); and pre-testing of the set of items. Strengths and limitations of the proposed integrated method are discussed. (c) 2010 Wiley Periodicals, Inc.

THE CURRENT METHODS FOR MOLECULAR DIAGNOSTICS OF FISH DISEASES (REVIEW

Directory of Open Access Journals (Sweden)

O. Zaloilo

2016-06-01

Full Text Available Purpose. The methods of molecular diagnostic (MMD gradually become widespread in modern fish farming. MMD contain a wide variety of specific approaches, each of which has distinct limits of their possible applications and is characterized by individual peculiarities in practical performance. In addition to high sensitivity and the possibility of rapid diagnostics, the main advantage of molecular methods is to determine the uncultivated infectious agents. DNA amplification allows identifying pathogenic microorganisms at very small quantities even in the minimum sample volume. Molecular methods of diagnostic enable the determination of infection in latent or acute phases. These methods allow showing the differences between pathogens with similar antigenic structures. The current literature data on this subject usually show a methodology in the narrow context of the tasks or practical results obtained through such approaches. Thus, a synthesis of existing information on the mechanisms of action and the limits of the typical problems of basic methods of molecular diagnostics are an urgent task of fish breeding. In particular, the following description will more effectively choose one or several approaches to identify pathogens in fish. Findings. This paper reviews the basic molecular methods that are used in the world's aquaculture for diagnosis of various diseases in commercial fish species. Originality. This work is a generalization of data on the principles and mechanisms for the implementation of diagnostics based on modern molecular techniques. For each of the mentioned approaches, the most promising areas of application were shown. The information is provided in the form of a comparative analysis of each methodology, indicating positive and negative practical aspects. Practical value. The current review of modern methods of molecular diagnostic in aquaculture is focused on practical application. Generalizing and analytical information can be

Advances in Time Estimation Methods for Molecular Data.

Science.gov (United States)

Kumar, Sudhir; Hedges, S Blair

2016-04-01

Molecular dating has become central to placing a temporal dimension on the tree of life. Methods for estimating divergence times have been developed for over 50 years, beginning with the proposal of molecular clock in 1962. We categorize the chronological development of these methods into four generations based on the timing of their origin. In the first generation approaches (1960s-1980s), a strict molecular clock was assumed to date divergences. In the second generation approaches (1990s), the equality of evolutionary rates between species was first tested and then a strict molecular clock applied to estimate divergence times. The third generation approaches (since ∼2000) account for differences in evolutionary rates across the tree by using a statistical model, obviating the need to assume a clock or to test the equality of evolutionary rates among species. Bayesian methods in the third generation require a specific or uniform prior on the speciation-process and enable the inclusion of uncertainty in clock calibrations. The fourth generation approaches (since 2012) allow rates to vary from branch to branch, but do not need prior selection of a statistical model to describe the rate variation or the specification of speciation model. With high accuracy, comparable to Bayesian approaches, and speeds that are orders of magnitude faster, fourth generation methods are able to produce reliable timetrees of thousands of species using genome scale data. We found that early time estimates from second generation studies are similar to those of third and fourth generation studies, indicating that methodological advances have not fundamentally altered the timetree of life, but rather have facilitated time estimation by enabling the inclusion of more species. Nonetheless, we feel an urgent need for testing the accuracy and precision of third and fourth generation methods, including their robustness to misspecification of priors in the analysis of large phylogenies and data

Methods in Molecular Biology: Germline Stem Cells | Center for Cancer Research

Science.gov (United States)

The protocols in Germline Stem Cells are intended to present selected genetic, molecular, and cellular techniques used in germline stem cell research. The book is divided into two parts. Part I covers germline stem cell identification and regulation in model organisms. Part II covers current techniques used in in vitro culture and applications of germline stem cells.

Bringing the banjo back to life: The field of dutch independent folk music as participatory culture

OpenAIRE

Poecke, Niels; Michael, Janna

2016-01-01

textabstractIn this paper we investigate factors underlying the production of independent folk music (indie folk) in the Netherlands. By studying the creation, distribution and reception of indie folk music through in-depth interviewing, we argue that the social production of indie folk music is affected by a shift towards 'participatory culture' brought about by the rise of the Internet and Web 2.0. We note how Web 2.0 helps musicians to educate themselves and to develop careers in music. Se...

Molecular features contributing to virus-independent intracellular localization and dynamic behavior of the herpesvirus transport protein US9.

Directory of Open Access Journals (Sweden)

Manuela Pedrazzi

Full Text Available Reaching the right destination is of vital importance for molecules, proteins, organelles, and cargoes. Thus, intracellular traffic is continuously controlled and regulated by several proteins taking part in the process. Viruses exploit this machinery, and viral proteins regulating intracellular transport have been identified as they represent valuable tools to understand and possibly direct molecules targeting and delivery. Deciphering the molecular features of viral proteins contributing to (or determining this dynamic phenotype can eventually lead to a virus-independent approach to control cellular transport and delivery. From this virus-independent perspective we looked at US9, a virion component of Herpes Simplex Virus involved in anterograde transport of the virus inside neurons of the infected host. As the natural cargo of US9-related vesicles is the virus (or its parts, defining its autonomous, virus-independent role in vesicles transport represents a prerequisite to make US9 a valuable molecular tool to study and possibly direct cellular transport. To assess the extent of this autonomous role in vesicles transport, we analyzed US9 behavior in the absence of viral infection. Based on our studies, Us9 behavior appears similar in different cell types; however, as expected, the data we obtained in neurons best represent the virus-independent properties of US9. In these primary cells, transfected US9 mostly recapitulates the behavior of US9 expressed from the viral genome. Additionally, ablation of two major phosphorylation sites (i.e. Y32Y33 and S34ES36 have no effect on protein incorporation on vesicles and on its localization on both proximal and distal regions of the cells. These results support the idea that, while US9 post-translational modification may be important to regulate cargo loading and, consequently, virion export and delivery, no additional viral functions are required for US9 role in intracellular transport.

Long-term storage of clinical samples in CyMol® medium for PNA- FISH® and culturing from the eSwab™ system

DEFF Research Database (Denmark)

Larsen, Lone Heimann; Xu, Yijuan; Pedersen, Malene Schibler

Objectives: A steadily growing diversity of bacteria is reported in foreign body infections, and culture-independent methods have been shown to supplement established culture methods. Therefore, sampling and preservation of specimens have become an important issue. We report here experience from...... analytical methods. Methods: Sampling for both culture-dependent and -independent analyses were done over a period of two years. Specimens were transferred directly to the lab, and cultures of tissue biopsies, joint fluid, sonication fluid from the prosthesis components, and eSwab™ (Copan, Italy) were...... performed within 24 h after sampling. The corresponding specimens for culture-independent methods were stored at -80°C until analyzed in batchs. Specimens for fluorescence in situ hybridization (FISH) analysis were stored for app. one year at -80°C in CyMol® (Copan, Italy), an alcohol based media, before...

Can we trust intraoperative culture results in nonunions?

Science.gov (United States)

Palmer, Michael P; Altman, Daniel T; Altman, Gregory T; Sewecke, Jeffrey J; Ehrlich, Garth D; Hu, Fen Z; Nistico, Laura; Melton-Kreft, Rachel; Gause, Trent M; Costerton, John W

2014-07-01

To identify the presence of bacterial biofilms in nonunions comparing molecular techniques (multiplex polymerase chain reaction and mass spectrometry, fluorescent in situ hybridization) with routine intraoperative cultures. Thirty-four patients with nonunions were scheduled for surgery and enrolled in this ongoing prospective study. Intraoperative specimens were collected from removed implants, surrounding tissue membrane, and local soft tissue followed by standard culture analysis, Ibis's second generation molecular diagnostics (Ibis Biosystems), and bacterial 16S rRNA-based fluorescence in situ hybridization (FISH). Confocal microscopy was used to visualize the tissue specimens reacted with the FISH probes, which were chosen based on the Ibis analysis. Thirty-four patient encounters were analyzed. Eight were diagnosed as infected nonunions by positive intraoperative culture results. Ibis confirmed the presence of bacteria in all 8 samples. Ibis identified bacteria in a total of 30 of 34 encounters, and these data were confirmed by FISH. Twenty-two of 30 Ibis-positive samples were culture-negative. Four samples were negative by all methods of analysis. No samples were positive by culture, but negative by molecular techniques. Our preliminary data indicate that molecular diagnostics are more sensitive for identifying bacteria than cultures in cases of bony nonunion. This is likely because of the inability of cultures to detect biofilms and bacteria previously exposed to antibiotic therapy. Diagnostic Level I. See Instructions for Authors for a complete description of levels of evidence.

Microbial community composition of the ileum and cecum of broiler chickens as revealed by molecular and culture-based techniques.

Science.gov (United States)

Bjerrum, L; Engberg, R M; Leser, T D; Jensen, B B; Finster, K; Pedersen, K

2006-07-01

The microbial communities of the ileum and cecum of broiler chickens from a conventional and an organic farm were investigated using conventional culture techniques as well as cloning and sequencing of 16S rRNA genes. Eighty-five percent of the 557 cloned sequences were <97% related to known cultured species. The chicken ileum was dominated by lactobacilli, whereas the cecum harbored a more diverse microbial community. The cecum was dominated by a large group of bacteria with hitherto no close cultured relatives but most closely related to Faecalibacterium prausnitzii. Approximately 49 and 20% of the cecal clones belonged to this cluster in conventional and organic broiler chickens, respectively. We were, however, able to recover a number of these phylotypes by cultivation, and the isolates were shown to be butyric acid producers. The investigation was a descriptive rather than a comparative study of 2 different rearing systems; however, several differences were observed. For instance, Clostridium perfringens was found in significantly higher numbers in the birds from the organic farm compared with the conventional broilers, probably due to the addition of salinomycin to the conventional feed. In the ileum, the abundance of the different Lactobacillus species differed between the 2 broiler types. The culture-based and culture-independent techniques complemented each other well. Strengths and limitations of the different methods are discussed.

The discussion on the qualitative and quantitative evaluation methods for safety culture

International Nuclear Information System (INIS)

Gao Kefu

2005-01-01

The fundamental methods for safely culture evaluation are described. Combining with the practice of the quantitative evaluation of safety culture in Daya Bay NPP, the quantitative evaluation method for safety culture are discussed. (author)

Molecular analysis of the oral microbiota of dental diseases

OpenAIRE

Kanasi, Eleni

2008-01-01

Traditionally, bacterial culture has been used for bacterial detection, allowing study of living microorganisms. Molecular methods are rapid and allow simultaneous identification of numerous species and uncultivated phylotypes. The objective of this doctoral thesis was to investigate the role of the oral microbiota, including poorly characterized and uncultivated bacteria, in dental caries and periodontitis, by comprehensive molecular, clinical, and statistical methods. The microbiota of 275 ...

Suggestions on the Development of Safety Culture Assessment Method

International Nuclear Information System (INIS)

Choi, Young Sung; Choi, Kwang Sik; Kim, Woong Sik

2006-01-01

Several efforts have been made to assess safety culture of organization that operates nuclear power plants in Korea. The MOST and KINS played a major role to develop assessment methods and KHNP applied them to its NPPs. This paper explains the two methods developed by KINS briefly and presents the insights obtained from the two different applications. It concludes with some suggestions for safety culture assessment based on the insights

Independent introduction of two lactase-persistence alleles into human populations reflects different history of adaptation to milk culture

DEFF Research Database (Denmark)

Enattah, Nabil Sabri; Jensen, Tine G K; Boyd, Mette

2008-01-01

the same history, probably related to the same cattle domestication event. In contrast, the compound Arab allele shows a different, highly divergent ancestral haplotype, suggesting that these two major global LP alleles have arisen independently, the latter perhaps in response to camel milk consumption....... These results support the convergent evolution of the LP in diverse populations, most probably reflecting different histories of adaptation to milk culture....

Beyond the 'east-west' dichotomy: Global variation in cultural models of selfhood.

Science.gov (United States)

Vignoles, Vivian L; Owe, Ellinor; Becker, Maja; Smith, Peter B; Easterbrook, Matthew J; Brown, Rupert; González, Roberto; Didier, Nicolas; Carrasco, Diego; Cadena, Maria Paz; Lay, Siugmin; Schwartz, Seth J; Des Rosiers, Sabrina E; Villamar, Juan A; Gavreliuc, Alin; Zinkeng, Martina; Kreuzbauer, Robert; Baguma, Peter; Martin, Mariana; Tatarko, Alexander; Herman, Ginette; de Sauvage, Isabelle; Courtois, Marie; Garðarsdóttir, Ragna B; Harb, Charles; Schweiger Gallo, Inge; Prieto Gil, Paula; Lorente Clemares, Raquel; Campara, Gabriella; Nizharadze, George; Macapagal, Ma Elizabeth J; Jalal, Baland; Bourguignon, David; Zhang, Jianxin; Lv, Shaobo; Chybicka, Aneta; Yuki, Masaki; Zhang, Xiao; Espinosa, Agustín; Valk, Aune; Abuhamdeh, Sami; Amponsah, Benjamin; Özgen, Emre; Güner, E Ülkü; Yamakoğlu, Nil; Chobthamkit, Phatthanakit; Pyszczynski, Tom; Kesebir, Pelin; Vargas Trujillo, Elvia; Balanta, Paola; Cendales Ayala, Boris; Koller, Silvia H; Jaafar, Jas Laile; Gausel, Nicolay; Fischer, Ronald; Milfont, Taciano L; Kusdil, Ersin; Çağlar, Selinay; Aldhafri, Said; Ferreira, M Cristina; Mekonnen, Kassahun Habtamu; Wang, Qian; Fülöp, Márta; Torres, Ana; Camino, Leoncio; Lemos, Flávia Cristina Silveira; Fritsche, Immo; Möller, Bettina; Regalia, Camillo; Manzi, Claudia; Brambilla, Maria; Bond, Michael Harris

2016-08-01

Markus and Kitayama's (1991) theory of independent and interdependent self-construals had a major influence on social, personality, and developmental psychology by highlighting the role of culture in psychological processes. However, research has relied excessively on contrasts between North American and East Asian samples, and commonly used self-report measures of independence and interdependence frequently fail to show predicted cultural differences. We revisited the conceptualization and measurement of independent and interdependent self-construals in 2 large-scale multinational surveys, using improved methods for cross-cultural research. We developed (Study 1: N = 2924 students in 16 nations) and validated across cultures (Study 2: N = 7279 adults from 55 cultural groups in 33 nations) a new 7-dimensional model of self-reported ways of being independent or interdependent. Patterns of global variation support some of Markus and Kitayama's predictions, but a simple contrast between independence and interdependence does not adequately capture the diverse models of selfhood that prevail in different world regions. Cultural groups emphasize different ways of being both independent and interdependent, depending on individualism-collectivism, national socioeconomic development, and religious heritage. Our 7-dimensional model will allow future researchers to test more accurately the implications of cultural models of selfhood for psychological processes in diverse ecocultural contexts. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Cutibacterium acnes molecular typing: time to standardize the method.

Science.gov (United States)

Dagnelie, M-A; Khammari, A; Dréno, B; Corvec, S

2018-03-12

The Gram-positive, anaerobic/aerotolerant bacterium Cutibacterium acnes is a commensal of healthy human skin; it is subdivided into six main phylogenetic groups or phylotypes: IA1, IA2, IB, IC, II and III. To decipher how far specific subgroups of C. acnes are involved in disease physiopathology, different molecular typing methods have been developed to identify these subgroups: i.e. phylotypes, clonal complexes, and types defined by single-locus sequence typing (SLST). However, as several molecular typing methods have been developed over the last decade, it has become a difficult task to compare the results from one article to another. Based on the scientific literature, the aim of this narrative review is to propose a standardized method to perform molecular typing of C. acnes, according to the degree of resolution needed (phylotypes, clonal complexes, or SLST types). We discuss the existing different typing methods from a critical point of view, emphasizing their advantages and drawbacks, and we identify the most frequently used methods. We propose a consensus algorithm according to the needed phylogeny resolution level. We first propose to use multiplex PCR for phylotype identification, MLST9 for clonal complex determination, and SLST for phylogeny investigation including numerous isolates. There is an obvious need to create a consensus about molecular typing methods for C. acnes. This standardization will facilitate the comparison of results between one article and another, and also the interpretation of clinical data. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Conventional and molecular diagnostic strategies for prosthetic joint infections.

Science.gov (United States)

Esteban, Jaime; Sorlí, Luisa; Alentorn-Geli, Eduard; Puig, Lluís; Horcajada, Juan P

2014-01-01

An accurate diagnosis of prosthetic joint infection (PJI) is the mainstay for an optimized clinical management. This review analyzes different diagnostic strategies of PJI, with special emphasis on molecular diagnostic tools and their current and future applications. Until now, the culture of periprosthetic tissues has been considered the gold standard for the diagnosis of PJI. However, sonication of the implant increases the sensitivity of those cultures and is being increasingly adopted by many centers. Molecular diagnostic methods compared with intraoperative tissue culture, especially if combined with sonication, have a higher sensitivity, a faster turnaround time and are not influenced by previous antimicrobial therapy. However, they still lack a system for detection of antimicrobial susceptibility, which is crucial for an optimized and less toxic therapy of PJI. More studies are needed to assess the clinical value of these methods and their cost-effectiveness.

Nucleic acid extraction, oligonucleotide probes and PCR methods

International Nuclear Information System (INIS)

Zhongtang Yu; Forster, R.J.

2005-01-01

Complex microbiomes of rumen and gastrointestinal tracts. Bacteria, fungi and protozoa, present in rumen and gastrointestinal (GI) tracts, interact with feed, with each other, and with their host animals, resulting in a complex symbiotic microbiota of distinctive composition and structure. Such microbiota is dynamic and highly responsive to a variety of biotic and abiotic factors, such as diet, feed additives, age, health and physiological status of the host animal, geographical locations, season and feeding regimen (reviewed in Ref. [39]). This symbiotic microbiota has been the focus of microbial research for over half a century in search for improved ruminant nutrition. Before the advent of molecular biology techniques, microorganisms in rumen and GI tracts, as in other habitats, were studied with cultivation-based techniques, which only allows for the isolation and characterization of a limited number of readily culturable species. As estimated, there are more than 400 species of bacteria and up to 100 species of protozoa and fungi inhabiting rumen and GI tracts. In human GI tracts, as much as 60% of these members cannot be isolated on agar plates and, thus, remain unknown. In ruminants, although it is not known, the culturable species of the microbiota are probably in the same range. Even among the culturable species, probably only some of them have been isolated and described. The application of cultivation-independent, more sensitive and accurate molecular techniques to the study of ruminal and GI microorganisms provided an alternative to directly examining the diversity and the community structure of ruminal and GI microbiota on the basis of genotypes, instead of phenotypes. Both polymerase chain reaction (PCR)-based methods, such as denaturing gradient gel electrophoresis (DGGE), ribosomal intergenic spacer analysis, terminal restriction fragment length polymorphism, cloning and sequencing of PCR amplicons and amplified 16S ribosomal DNA restriction

Mechanistic insights into Mg2+-independent prenylation by CloQ from classical molecular mechanics and hybrid quantum mechanics/molecular mechanics molecular dynamics simulations.

Science.gov (United States)

Bayse, Craig A; Merz, Kenneth M

2014-08-05

Understanding the mechanism of prenyltransferases is important to the design of engineered proteins capable of synthesizing derivatives of naturally occurring therapeutic agents. CloQ is a Mg(2+)-independent aromatic prenyltransferase (APTase) that transfers a dimethylallyl group to 4-hydroxyphenylpyruvate in the biosynthetic pathway for clorobiocin. APTases consist of a common ABBA fold that defines a β-barrel containing the reaction cavity. Positively charged basic residues line the inside of the β-barrel of CloQ to activate the pyrophosphate leaving group to replace the function of the Mg(2+) cofactor in other APTases. Classical molecular dynamics simulations of CloQ, its E281G and F68S mutants, and the related NovQ were used to explore the binding of the 4-hydroxyphenylpyruvate (4HPP) and dimethylallyl diphosphate substrates in the reactive cavity and the role of various conserved residues. Hybrid quantum mechanics/molecular mechanics potential of mean force (PMF) calculations show that the effect of the replacement of the Mg(2+) cofactor with basic residues yields a similar activation barrier for prenylation to Mg(2+)-dependent APTases like NphB. The topology of the binding pocket for 4HPP is important for selective prenylation at the ortho position of the ring. Methylation at this position alters the conformation of the substrate for O-prenylation at the phenol group. Further, a two-dimensional PMF scan shows that a "reverse" prenylation product may be a possible target for protein engineering.

Variational methods in molecular modeling

CERN Document Server

2017-01-01

This book presents tutorial overviews for many applications of variational methods to molecular modeling. Topics discussed include the Gibbs-Bogoliubov-Feynman variational principle, square-gradient models, classical density functional theories, self-consistent-field theories, phase-field methods, Ginzburg-Landau and Helfrich-type phenomenological models, dynamical density functional theory, and variational Monte Carlo methods. Illustrative examples are given to facilitate understanding of the basic concepts and quantitative prediction of the properties and rich behavior of diverse many-body systems ranging from inhomogeneous fluids, electrolytes and ionic liquids in micropores, colloidal dispersions, liquid crystals, polymer blends, lipid membranes, microemulsions, magnetic materials and high-temperature superconductors. All chapters are written by leading experts in the field and illustrated with tutorial examples for their practical applications to specific subjects. With emphasis placed on physical unders...

Establishment and Characterization of Primary Cultures from Iranian Oral Squamous Cell Carcinoma Patients by Enzymatic Method and Explant Culture

Directory of Open Access Journals (Sweden)

Meysam Ganjibakhsh

2017-10-01

Full Text Available Objectives: Oral Squamous Cell Carcinoma (OSCC is the most frequent oral cancer worldwide. It is known as the eighth most common cancer in men and as the fifth most common cancer in women. Cytogenetic and biochemical studies in recent decades have emphasized the necessity of providing an appropriate tool for such researches. Cancer cell culture is a useful tool for investigations on biochemical, genetic, molecular and immunological characteristics of different cancers, including oral cancer. Here, we explain the establishment process of five primary oral cancer cells derived from an Iranian population.Materials and Methods: The specimens were obtained from five oral cancer patients. Enzymatic, explant culture and magnetic-activated cell sorting (MACS methods were used for cell isolation. After quality control tests, characterization and authentication of primary oral cancer cells were performed by short tandem repeats (STR profiling, chromosome analysis, species identification, and monitoring the growth, morphology and the expression of CD326 and CD133 markers.Results: Five primary oral cancer cells were established from an Iranian population. The flow cytometry results showed that the isolated cells were positive for CD326 and CD133 markers. Furthermore, the cells were free from mycoplasma, bacterial and fungal contamination. No misidentified or cross-contaminated cells were detected by STR analysis.Conclusions: Human primary oral cancer cells provide an extremely useful platform for studying carcinogenesis pathways of oral cancer in Iranian population. They may be helpful in explaining the ethnic differences in cancer biology and the individuality in anticancer drug response in future studies.

An Evaluation Method for Team Competencies to Enhance Nuclear Safety Culture

International Nuclear Information System (INIS)

Hang, S. M.; Seong, P. H.; Kim, A. R.

2016-01-01

Safety culture has received attention in safety-critical industries, including nuclear power plants (NPPs), due to various prominent accidents such as concealment of a Station Blackout (SBO) of Kori NPP unit 1 in 2012, the Sewol ferry accident in 2014, and the Chernobyl accident in 1986. Analysis reports have pointed out that one of the major contributors to the cause of the accidents is ‘the lack of safety culture’. The term, nuclear safety culture, was firstly defined after the Chernobyl accident by the IAEA in INSAG report no. 4, as follows “Safety culture is that assembly of characteristics and attitudes in organizations and individuals which establishes that, as an overriding priority, nuclear plant safety issues receive the attention warranted their significance.” Afterwards, a wide consensus grew among researchers and nuclear-related organizations, that safety culture should be evaluated and managed in a certain manner. Consequently, each nuclear-related organization defined and developed their own safety culture definitions and assessment methods. However, none of these methods provides a way for an individual or a team to enhance the safety culture of an organization. Especially for a team, which is the smallest working unit in NPPs, team members easily overlook their required practices to improve nuclear safety culture. Therefore in this study, we suggested a method to estimate nuclear safety culture of a team, by approaching with the ‘competency’ point of view. The competency is commonly focused on individuals, and defined as, “underlying characteristics of an individual that are causally related to effective or superior performance in a job.” Similar to safety culture, the definition of competency focuses on characteristics and attitudes of individuals. Thus, we defined ‘safety culture competency’ as “underlying characteristics and outward attitudes of individuals that are causally related to a healthy and strong nuclear safety

Concentration independent modulation of local micromechanics in a fibrin gel.

Directory of Open Access Journals (Sweden)

Maxwell A Kotlarchyk

Full Text Available Methods for tuning extracellular matrix (ECM mechanics in 3D cell culture that rely on increasing the concentration of either protein or cross-linking molecules fail to control important parameters such as pore size, ligand density, and molecular diffusivity. Alternatively, ECM stiffness can be modulated independently from protein concentration by mechanically loading the ECM. We have developed a novel device for generating stiffness gradients in naturally derived ECMs, where stiffness is tuned by inducing strain, while local mechanical properties are directly determined by laser tweezers based active microrheology (AMR. Hydrogel substrates polymerized within 35 mm diameter Petri dishes are strained non-uniformly by the precise rotation of an embedded cylindrical post, and exhibit a position-dependent stiffness with little to no modulation of local mesh geometry. Here we present the device in the context of fibrin hydrogels. First AMR is used to directly measure local micromechanics in unstrained hydrogels of increasing fibrin concentration. Changes in stiffness are then mapped within our device, where fibrin concentration is held constant. Fluorescence confocal imaging and orbital particle tracking are used to quantify structural changes in fibrin on the micro and nano levels respectively. The micromechanical strain stiffening measured by microrheology is not accompanied by ECM microstructural changes under our applied loads, as measured by confocal microscopy. However, super-resolution orbital tracking reveals nanostructural straightening, lengthening, and reduced movement of fibrin fibers. Furthermore, we show that aortic smooth muscle cells cultured within our device are morphologically sensitive to the induced mechanical gradient. Our results demonstrate a powerful cell culture tool that can be used in the study of mechanical effects on cellular physiology in naturally derived 3D ECM tissues.

A procedure to evaluate the efficiency of surface sterilization methods in culture-independent fungal endophyte studies

Directory of Open Access Journals (Sweden)

R.J. Burgdorf

2014-09-01

Full Text Available Extraneous DNA interferes with PCR studies of endophytic fungi. A procedure was developed with which to evaluate the removal of extraneous DNA. Wheat (Triticum aestivum leaves were sprayed with Saccharomyces cerevisiae and then subjected to physical and chemical surface treatments. The fungal ITS1 products were amplified from whole tissue DNA extractions. ANOVA was performed on the DNA bands representing S. cerevisiae on the agarose gel. Band profile comparisons using permutational multivariate ANOVA (PERMANOVA and non-metric multidimensional scaling (NMDS were performed on DGGE gel data, and band numbers were compared between treatments. Leaf surfaces were viewed under variable pressure scanning electron microscopy (VPSEM. Yeast band analysis of the agarose gel showed that there was no significant difference in the mean band DNA quantity after physical and chemical treatments, but they both differed significantly (p < 0.05 from the untreated control. PERMANOVA revealed a significant difference between all treatments (p < 0.05. The mean similarity matrix showed that the physical treatment results were more reproducible than those from the chemical treatment results. The NMDS showed that the physical treatment was the most consistent. VPSEM indicated that the physical treatment was the most effective treatment to remove surface microbes and debris. The use of molecular and microscopy methods for the post-treatment detection of yeast inoculated onto wheat leaf surfaces demonstrated the effectiveness of the surface treatment employed, and this can assist researchers in optimizing their surface sterilization techniques in DNA-based fungal endophyte studies.

A procedure to evaluate the efficiency of surface sterilization methods in culture-independent fungal endophyte studies.

Science.gov (United States)

Burgdorf, R J; Laing, M D; Morris, C D; Jamal-Ally, S F

2014-01-01

Extraneous DNA interferes with PCR studies of endophytic fungi. A procedure was developed with which to evaluate the removal of extraneous DNA. Wheat (Triticum aestivum) leaves were sprayed with Saccharomyces cerevisiae and then subjected to physical and chemical surface treatments. The fungal ITS1 products were amplified from whole tissue DNA extractions. ANOVA was performed on the DNA bands representing S. cerevisiae on the agarose gel. Band profile comparisons using permutational multivariate ANOVA (PERMANOVA) and non-metric multidimensional scaling (NMDS) were performed on DGGE gel data, and band numbers were compared between treatments. Leaf surfaces were viewed under variable pressure scanning electron microscopy (VPSEM). Yeast band analysis of the agarose gel showed that there was no significant difference in the mean band DNA quantity after physical and chemical treatments, but they both differed significantly (p PERMANOVA revealed a significant difference between all treatments (p < 0.05). The mean similarity matrix showed that the physical treatment results were more reproducible than those from the chemical treatment results. The NMDS showed that the physical treatment was the most consistent. VPSEM indicated that the physical treatment was the most effective treatment to remove surface microbes and debris. The use of molecular and microscopy methods for the post-treatment detection of yeast inoculated onto wheat leaf surfaces demonstrated the effectiveness of the surface treatment employed, and this can assist researchers in optimizing their surface sterilization techniques in DNA-based fungal endophyte studies.

[CONTEMPORARY MOLECULAR-GENETIC METHODS USED FOR ETIOLOGIC DIAGNOSTICS OF SEPSIS].

Science.gov (United States)

Gavrilov, S N; Skachkova, T S; Shipulina, O Yu; Savochkina, Yu A; Shipulin, G A; Maleev, V V

2016-01-01

Etiologic diagnostics of sepsis is one of the most difficult problems of contemporary medicine due to a wide variety of sepsis causative agents, many of which are components of normal human microflora. Disadvantages of contemporary "golden standard" of microbiologic diagnostics of sepsis etiology by seeding of blood for sterility are duration of cultivation, limitation in detection of non-cultivable forms of microorganisms, significant effect of preliminary empiric antibiotics therapy on results of the analysis. Methods of molecular diagnostics that are being actively developed and integrated during the last decade are deprived of these disadvantages. Main contemporary methods of molecular-biological diagnostics are examined in the review, actualdata on their diagnostic characteristic are provided. Special attention is given to methods of PCR-diagnostics, including novel Russian developments. Methods of nucleic acid hybridization and proteomic analysis are examined in comparative aspect. Evaluation of application and perspectives of development of methods of molecular diagnostics of sepsis is given.

Characterization of microbial communities in pest colonized books by molecular biology tools

OpenAIRE

Franco Palla

2011-01-01

This work presents the identification of bacteria and fungi colonies in insect infesting books, by cultural-independent methodologies based on molecular biology techniques. Microbial genomic DNA extraction, in vitro amplification of specific target sequences by polymerase chain reactions (PCR), sequencing and sequence analysis were performed. These procedures minimized the samples amount, optimized the diagnostic studies on bacteria and fungi colonization and allowed the identification of man...

Equilibrium Molecular Thermodynamics from Kirkwood Sampling

OpenAIRE

Somani, Sandeep; Okamoto, Yuko; Ballard, Andrew J.; Wales, David J.

2015-01-01

We present two methods for barrierless equilibrium sampling of molecular systems based on the recently proposed Kirkwood method (J. Chem. Phys. 2009, 130, 134102). Kirkwood sampling employs low-order correlations among internal coordinates of a molecule for random (or non-Markovian) sampling of the high dimensional conformational space. This is a geometrical sampling method independent of the potential energy surface. The first method is a variant of biased Monte Carlo, wher...

Metabolomics reveals distinct, antibody-independent, molecular signatures of MS, AQP4-antibody and MOG-antibody disease.

Science.gov (United States)

Jurynczyk, Maciej; Probert, Fay; Yeo, Tianrong; Tackley, George; Claridge, Tim D W; Cavey, Ana; Woodhall, Mark R; Arora, Siddharth; Winkler, Torsten; Schiffer, Eric; Vincent, Angela; DeLuca, Gabriele; Sibson, Nicola R; Isabel Leite, M; Waters, Patrick; Anthony, Daniel C; Palace, Jacqueline

2017-12-06

conditions are indeed different at a molecular level. The metabolites identified provide a molecular signature of each condition which is independent of antibody titre and EDSS, with potential use for disease monitoring and diagnosis.

Estimation of effective lens position using a method independent of preoperative keratometry readings.

LENUS (Irish Health Repository)

Dooley, Ian

2012-02-01

PURPOSE: To evaluate the validity of a keratometry (K)-independent method of estimating effective lens position (ELP) before phacoemulsification cataract surgery. SETTING: Institute of Eye Surgery, Whitfield Clinic, Waterford, Ireland. DESIGN: Evaluation of diagnostic test or technology. METHODS: The anterior chamber diameter and corneal height in eyes scheduled for cataract surgery were measured with a rotating Scheimpflug camera. Corneal height and anterior chamber diameter were used to estimate the ELP in a K-independent method (using the SRK\\/T [ELP(rs)] and Holladay 1 [ELP(rh)] formulas). RESULTS: The mean ELP was calculated using the traditional (mean ELP(s) 5.59 mm +\\/- 0.52 mm [SD]; mean ELP(h) 5.63 +\\/- 0.42 mm) and K-independent (mean ELP(rs) 5.55 +\\/- 0.42 mm; mean ELP(rh) +\\/- SD 5.60 +\\/- 0.36 mm) methods. Agreement between ELP(s) and ELP(rs) and between ELP(h) and ELP(rh) were represented by Bland-Altman plots, with mean differences (+\\/- 1.96 SD) of 0.06 +\\/- 0.65 mm (range -0.59 to +0.71 mm; P=.08) in association with ELP(rs) and -0.04 +\\/- 0.39 mm (range -0.43 to +0.35 mm; P=.08) in association with ELP(rh). The mean absolute error for ELP(s) versus ELP(rs) estimation and for ELP(h) versus ELP(rh) estimation was 0.242 +\\/- 0.222 mm (range 0.001 to 1.272 mm) and 0.152 +\\/- 0.137 mm (range 0.001 to 0.814 mm), respectively. CONCLUSION: This study confirms that the K-independent ELP estimation method is comparable to traditional K-dependent methods and may be useful in post-refractive surgery patients.

Audit of Trichomonas vaginalis test requesting by community referrers after a change from culture to molecular testing, including a cost analysis.

Science.gov (United States)

Bissessor, Liselle; Wilson, Janet; McAuliffe, Gary; Upton, Arlo

2017-06-16

Trichomonas vaginalis (TV) prevalence varies among different communities and peoples. The availability of robust molecular platforms for the detection of TV has advanced diagnosis; however, molecular tests are more costly than phenotypic methodologies, and testing all urogenital samples is costly. We recently replaced culture methods with the Aptima Trichomonas vaginalis nucleic acid amplification test on specific request and as reflex testing by the laboratory, and have audited this change. Data were collected from August 2015 (microbroth culture and microscopy) and August 2016 (Aptima TV assay) including referrer, testing volumes, results and test cost estimates. In August 2015, 10,299 vaginal swabs, and in August 2016, 2,189 specimens (urogenital swabs and urines), were tested. The positivity rate went from 0.9% to 5.3%, and overall more TV infections were detected in 2016. The number needed to test and cost for one positive TV result respectively was 111 and $902.55 in 2015, and 19 and $368.92 in 2016. Request volumes and positivity rates differed among referrers. The methodology change was associated with higher overall detection of TV, and reductions in the numbers needed to test/cost for one TV diagnosis. Our audit suggests that there is room for improvement with TV test requesting in our community.

Establishment of primary bovine intestinal epithelial cell culture and clone method.

Science.gov (United States)

Zhan, Kang; Lin, Miao; Liu, Ming-Mei; Sui, Yang-Nan; Zhao, Guo-Qi

2017-01-01

The aim of this study was to establish bovine intestinal epithelial cell (BIEC) line and provide a novel clone cell method. Although various strategies of bovine cell culture and clone techniques have been reported, these methods remain not established. Here, we culture successfully primary BIECs and establish a novel clone cell method. Our result showed that BIECs could be successfully cultured and passaged about generation 5. These cellular aggregates and clusters were adherent loosely at day 2 of culture. Cell aggregates and clusters start to proliferate after approximately 4 d. The BIECs showed positive reaction against cytokeratin 18, E-cadherin, and characteristics of epithelial-like morphology. In addition, the fatty acid-binding proteins (FABPs), villin, and intestinal peptidase (IP) band were positive in BIECs. Our results suggest that the establishment of culturing and clone BIEC methods will apply to isolate and clone other primary cells. These BIECs could therefore contribute to the study of bovine intestinal nutrient absorption and regulation, immune regulation, and the pathogenesis of the bovine intestinal disease, which will provide intestinal cell model in vitro.

Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

Directory of Open Access Journals (Sweden)

Zineb Tlamçani

2013-06-01

Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

Scanning probe methods applied to molecular electronics

Energy Technology Data Exchange (ETDEWEB)

Pavlicek, Niko

2013-08-01

Scanning probe methods on insulating films offer a rich toolbox to study electronic, structural and spin properties of individual molecules. This work discusses three issues in the field of molecular and organic electronics. An STM head to be operated in high magnetic fields has been designed and built up. The STM head is very compact and rigid relying on a robust coarse approach mechanism. This will facilitate investigations of the spin properties of individual molecules in the future. Combined STM/AFM studies revealed a reversible molecular switch based on two stable configurations of DBTH molecules on ultrathin NaCl films. AFM experiments visualize the molecular structure in both states. Our experiments allowed to unambiguously determine the pathway of the switch. Finally, tunneling into and out of the frontier molecular orbitals of pentacene molecules has been investigated on different insulating films. These experiments show that the local symmetry of initial and final electron wave function are decisive for the ratio between elastic and vibration-assisted tunneling. The results can be generalized to electron transport in organic materials.

Culture-independent identification and quantification of Gallibacterium anatis (G. anatis) by real-time quantitative PCR

DEFF Research Database (Denmark)

Wang, Chong; Robles, Francisco; Ramirez, Saul

2016-01-01

Gallibacterium is a genus within the family Pasteurellaceae characterized by a high level of phenotypic and genetic diversity. No diagnostic method has yet been described, which allows species-specific identification of Gallibacterium anatis. The aim of this study was to develop a real...... published conventional PCR method and culture-based identification, respectively. The detection rates were 97%, 78% and 34% for the current qPCR, the conventional PCR and the culture-based identification method, respectively. The qPCR assay was able to detect the gene gyrB in serial dilutions of 10......-time quantitative PCR (qPCR) method allowing species-specific identification and quantification of G. anatis. A G. anatis specific DNA sequence was identified in the gyrase subunit B gene (gyrB) and used to design a TaqMan probe and corresponding primers. The specificity of the assay was tested on 52 bacterial...

Culture methods of allograft musculoskeletal tissue samples in Australian bacteriology laboratories.

Science.gov (United States)

Varettas, Kerry

2013-12-01

Samples of allograft musculoskeletal tissue are cultured by bacteriology laboratories to determine the presence of bacteria and fungi. In Australia, this testing is performed by 6 TGA-licensed clinical bacteriology laboratories with samples received from 10 tissue banks. Culture methods of swab and tissue samples employ a combination of solid agar and/or broth media to enhance micro-organism growth and maximise recovery. All six Australian laboratories receive Amies transport swabs and, except for one laboratory, a corresponding biopsy sample for testing. Three of the 6 laboratories culture at least one allograft sample directly onto solid agar. Only one laboratory did not use a broth culture for any sample received. An international literature review found that a similar combination of musculoskeletal tissue samples were cultured onto solid agar and/or broth media. Although variations of allograft musculoskeletal tissue samples, culture media and methods are used in Australian and international bacteriology laboratories, validation studies and method evaluations have challenged and supported their use in recovering fungi and aerobic and anaerobic bacteria.

Systems and Methods for Gravity-Independent Gripping and Drilling

Science.gov (United States)

Parness, Aaron (Inventor); Frost, Matthew A. (Inventor); Thatte, Nitish (Inventor); King, Jonathan P. (Inventor)

2016-01-01

Systems and methods for gravity independent gripping and drilling are described. The gripping device can also comprise a drill or sampling devices for drilling and/or sampling in microgravity environments, or on vertical or inverted surfaces in environments where gravity is present. A robotic system can be connected with the gripping and drilling devices via an ankle interface adapted to distribute the forces realized from the robotic system.

Method-independent, Computationally Frugal Convergence Testing for Sensitivity Analysis Techniques

Science.gov (United States)

Mai, J.; Tolson, B.

2017-12-01

The increasing complexity and runtime of environmental models lead to the current situation that the calibration of all model parameters or the estimation of all of their uncertainty is often computationally infeasible. Hence, techniques to determine the sensitivity of model parameters are used to identify most important parameters. All subsequent model calibrations or uncertainty estimation procedures focus then only on these subsets of parameters and are hence less computational demanding. While the examination of the convergence of calibration and uncertainty methods is state-of-the-art, the convergence of the sensitivity methods is usually not checked. If any, bootstrapping of the sensitivity results is used to determine the reliability of the estimated indexes. Bootstrapping, however, might as well become computationally expensive in case of large model outputs and a high number of bootstraps. We, therefore, present a Model Variable Augmentation (MVA) approach to check the convergence of sensitivity indexes without performing any additional model run. This technique is method- and model-independent. It can be applied either during the sensitivity analysis (SA) or afterwards. The latter case enables the checking of already processed sensitivity indexes. To demonstrate the method's independency of the convergence testing method, we applied it to two widely used, global SA methods: the screening method known as Morris method or Elementary Effects (Morris 1991) and the variance-based Sobol' method (Solbol' 1993). The new convergence testing method is first scrutinized using 12 analytical benchmark functions (Cuntz & Mai et al. 2015) where the true indexes of aforementioned three methods are known. This proof of principle shows that the method reliably determines the uncertainty of the SA results when different budgets are used for the SA. The results show that the new frugal method is able to test the convergence and therefore the reliability of SA results in an

Acid protease and formation of multiple forms of glucoamylase in batch and continuous cultures of Aspergillus niger

DEFF Research Database (Denmark)

Aalbæk, Thomas; Reeslev, Morten; Jensen, Bo

2002-01-01

with molecular weights of approx. 91 (GAI), 73 (GAII), and 59 kDa (GAIII). Data from batch fermentations with constant pH 3.0 and 5.0 showed a uniform distribution of extracellular GA forms throughout the fermentations and independent of culture growth phases. Furthermore, steady-state data from chemostat...

A Capacity-Restraint Transit Assignment Model When a Predetermination Method Indicates the Invalidity of Time Independence

Directory of Open Access Journals (Sweden)

Haoyang Ding

2015-01-01

Full Text Available The statistical independence of time of every two adjacent bus links plays a crucial role in deciding the feasibility of using many mathematical models to analyze urban transit networks. Traditional research generally ignores the time independence that acts as the ground of their models. Assumption is usually made that time independence of every two adjacent links is sound. This is, however, actually groundless and probably causes problematic conclusions reached by corresponding models. Many transit assignment models such as multinomial probit-based models lose their effects when the time independence is not valid. In this paper, a simple method to predetermine the time independence is proposed. Based on the predetermination method, a modified capacity-restraint transit assignment method aimed at engineering practice is put forward and tested through a small contrived network and a case study in Nanjing city, China, respectively. It is found that the slope of regression equation between the mean and standard deviation of normal distribution acts as the indicator of time independence at the same time. Besides, our modified assignment method performs better than the traditional one with more reasonable results while keeping the property of simplicity well.

Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

Science.gov (United States)

Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

2012-07-01

Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

Science.gov (United States)

Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

2015-10-19

We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

Culture-dependent and -independent approaches establish the complexity of a PAH-degrading microbial consortium

Energy Technology Data Exchange (ETDEWEB)

Vinas, M.; Sabate, J.; Solanas, A.M. [Barcelona Univ., Barcelona (Spain). Dept. of Microbiology; Guasp, C.; Lalucat, J. [Illes Balears Univ., Palma de Mallorca (Spain). Dept. of Biology

2005-11-15

Microbial consortia are used in the decontamination of polluted environmental sites. A microbial consortium obtained by batch enrichment culture is a closed system with controlled conditions in which micro-organisms with a potentially high growth rate are selected and become dominant. The aim of this study was to identify the members of consortium AM, in which earlier batch enrichment work had shown high biodegradation rates of the aromatic fraction of polycyclic aromatic hydrocarbon (PAH). The AM consortium was obtained by sequential enrichment in liquid culture with a PAH mixture of 3- and 4- ringed PAHs as the sole source of carbon and energy. The consortium was examined using a triple approach method based on various cultivation strategies, denaturing gradient electrophoresis (DGGE) and the screening of 16S and 18S rRNA gene clone libraries. Eleven different sequences by culture-dependent techniques and 7 by both DGGE and clone libraries were obtained, yielding 19 different microbial components. Proteobacteria were the dominant group, representing 83 per cent of the total, while the Cytophaga-Flexibactor-Bacteroides group (CFB) was 11 per cent, and Ascomycota fungi were 6 per cent. It was determined that {beta}-Proteobacteria were predominant in the DGGE and clone library methods, whereas they were a minority in culturable strains. The highest diversity and number of noncoincident sequences was achieved by the cultivation method that showed members of the {alpha},{beta}, and {gamma}-Proteobacteria, CFB bacterial group, and Ascomycota fungi. Only 6 of the 11 strains isolated showed PAH-degrading capability. The bacterial strain (AMS7) and the fungal strain (AMF1) achieved the greatest PAH depletion. Results indicated that polyphasic assessment is necessary for a proper understanding of the composition of a microbial consortium. It was concluded that microbial consortia are more complex than previously realized. 54 refs., 3 tabs., 3 figs.

FEL induced molecular operation on cultured fibroblast and cholesterol ester

International Nuclear Information System (INIS)

Awazu, Kunio; Ogino, Seiji; Nishimura, Eiichi; Tomimasu, Takio; Yasumoto, Masato.

1997-01-01

Free Electron Lasers can be used to molecular operation such as the delivery of a number of molecules into cells or the separation of cholesterol ester. First, cultured NIH3T3 cells are exposed to high-intensity short pulse Free Electron Laser (FEL). The FEL is tuned to an absorption maximum wavelength, 6.1 μm, which was measured by microscopic FTIR. A fluorescence dye in the cell suspension is more absorbed into the cell with the FEL exposure due to the FEL-induced mechanical stress to the cell membrane. A quantitative fluorescence microscopy is used to determine the efficiency of delivery. Second, as a compound in a lipid cell, cholesterol ester was exposed to 5.75 μm FEL. FTIR measurement was done to evaluate the modification of the cholesterol ester. The result showed that the fluorescence intensity of sample cells were higher than that of control cells, and there was significant difference between the control and the sample group. Blebbing and the colony formation of the cells were observed for cells with mechanical stress. As for the cholesterol ester, it can be modified by the FEL irradiation. These results showed that FEL can be used as a molecular operational tool by photo-chemical and photo-mechanical interaction. (author)

New molecular methods for the detection of hepatitis A and Norwalk viruses in shellfish.

Science.gov (United States)

Romalde, J L

1996-12-01

Outbreaks of viral enteric diseases after consumption of shellfish are a major health risk. Methodological problems (such as toxicity for cell cultures and low viral concentrations) and the unculturability of some strains (i.e. hepatitis A virus, Norwalk virus) have made it difficult to study those viruses in the environmental samples. Currently, the analysis of the hygienic quality of marketable shellfish is determined by the use of fecal indicator bacteria, but their reliability in determining viral pollution of shellfish is very low. Recent biotechnology developments are providing available rapid, sensitive, and specific tools for detecting food-borne viruses in shellfish and in shellfish-growing waters. In this paper, a review of these new molecular methods is carried out, discussing their advantages and possible applications.

A review of gastrointestinal microbiology with special emphasis on molecular microbial ecology approaches

International Nuclear Information System (INIS)

Mackie, R.I.; Cann, I.K.O.

2005-01-01

All animals, including humans, are adapted to life in a microbial world. Large populations of micro-organisms inhabit the gastrointestinal tract of all animals and form a closely integrated ecological unit with the host. This complex, mixed, microbial culture can be considered the most metabolically adaptable and rapidly renewable organ of the body, which plays a vital role in the normal nutritional, physiological, immunological and protective functions of the host animal. Bacteria have traditionally been classified mainly on the basis of phenotypic properties. Despite the vast amount of knowledge generated for ruminal and other intestinal ecosystems using traditional techniques, the basic requisites for ecological studies, namely, enumeration and identification of all community members, have limitations. The two major problems faced by microbial ecologists are bias introduced by culture-based enumeration and characterization techniques, and the lack of a phylogenetically-based classification scheme. Modem molecular ecology techniques based on sequence comparisons of nucleic acids (DNA or RNA) can be used to provide molecular characterization while at the same time providing a classification scheme that predicts natural evolutionary relationships. These molecular methods provide results that are independent of growth conditions and media used. Also, using these techniques, bacteria can be classified and identified before they can be grown in pure culture. These nucleic acid-based techniques will enable gut microbiologists to answer the most difficult question in microbial ecology: namely, describing the exact role or function a specific bacterium plays in its natural environment and its quantitative contribution to the whole. However, rather than replacing the classical culture-based system, the new molecular-based techniques can be used in combination with the classical approach to improve cultivation, speciation and evaluation of diversity. The study of microbial

Molecular Structural Transformation of 2:1 Clay Minerals by a Constant-Pressure Molecular Dynamics Simulation Method

International Nuclear Information System (INIS)

Wang, J.; Gutierre, M.S.

2010-01-01

This paper presents results of a molecular dynamics simulation study of dehydrated 2:1 clay minerals using the Parrinello-Rahman constant-pressure molecular dynamics method. The method is capable of simulating a system under the most general applied stress conditions by considering the changes of MD cell size and shape. Given the advantage of the method, it is the major goal of the paper to investigate the influence of imposed cell boundary conditions on the molecular structural transformation of 2:1 clay minerals under different normal pressures. Simulation results show that the degrees of freedom of the simulation cell (i.e., whether the cell size or shape change is allowed) determines the final equilibrated crystal structure of clay minerals. Both the MD method and the static method have successfully revealed unforeseen structural transformations of clay minerals upon relaxation under different normal pressures. It is found that large shear distortions of clay minerals occur when full allowance is given to the cell size and shape change. A complete elimination of the interlayer spacing is observed in a static simulation. However, when only the cell size change is allowed, interlayer spacing is retained, but large internal shear stresses also exist.

Quantification of Iodine-123-FP-CIT SPECT with a resolution-independent method

International Nuclear Information System (INIS)

Dobbeleir, A.A.; Ham, H.R.; Hambye, A.E.; Vervaet, A.M.

2005-01-01

Accurate quantification of small-sized objects by SPECT is hampered by the partial volume effect. The present work evaluates the magnitude of this phenomenon with Iodine- 123 in phantom studies, and presents a resolution- independent method to quantify striatal I-123 FP-CIT uptake in patients. At first five syringes with internal diameters varying between 9 and 29mm and an anthropomorphic striatal phantom were filled with known concentrations of Iodine-123 and imaged by SPECT using different collimators and radii of rotation. Data were processed with and without scatter correction. From the measured activities, calibration factors were calculated for each specific collimator. Then a resolution-independent method for FP-CIT quantification using large regions of interest was developed and validated in 34 human studies (controls and patients) acquired in 2 different hospitals, by comparing its results to those obtained by a semi- quantitative striatal-to-occipital analysis. Taking the injected activity and decay into account, the measured counts/volume could be converted into absolute tracer concentrations. For the fan-beam, high resolution and medium energy collimators, the measured maximum activity in comparison to the 29 mm-diameter syringe was respectively 38%, 16% and 9% for the 9 mm-diameter syringe and 82%, 80% and 30% for the 16 mm syringe, and not significantly modified after scatter correction. For the anthropomorphic phantom, the error in measurement in % of the true concentration ranged between 0.3-9.5% and was collimator dependent. Medium energy collimators yielded the most homogeneous results. In the human studies, inter- observer variability was 11.4% for the striatal-to-occipital ratio and 3.1% for the resolution-independent method, with correlation coefficients >0.8 between both. The resolution- independent method was 89%-sensitive and 100%-specific to separate the patients without and with abnormal FP-CIT uptake (accuracy: 94%). Also the

Comparative studies on different molecular methods for ...

African Journals Online (AJOL)

The present study aims to evaluate two molecular methods for epidemiological typing of multi drug resistant Klebsiella pneumoniae isolated from Mansoura Hospitals. In this study, a total of 300 clinical isolates were collected from different patients distributed among Mansoura Hospitals, Dakahlia governorate, Egypt.

A new cell primo-culture method for freshwater benthic diatom communities

OpenAIRE

Debenest, Timothée; Silvestre, Jérôme; Coste, Michel; Delmas, François; Pinelli, Eric

2009-01-01

A new cell primo-culture method was developed for the benthic diatom community isolated from biofilm sampled in rivers. The approach comprised three steps: (1) scraping biofilm from river pebbles, (2) diatom isolation from biofilm, and (3) diatom community culture. With a view to designing a method able to stimulate the growth of diatoms, to limit the development of other microorganisms, and to maintain in culture a community similar to the original natural one, different factors were test...

The effect of three culture methods on intensive culture system of pacific white shrimp ( Litopenaeus vannamei)

Science.gov (United States)

Ma, Zhen; Wan, Rong; Song, Xiefa; Gao, Lei

2013-09-01

Different culture methods may affect the intensive culture system of Pacific white shrimp ( Litopenaeus vannamei) regarding water quality and growth and economic performance. This study evaluated the potential effects of three culture methods through cultivation of juvenile shrimps under consistent tank management conditions for 84 d. The three methods involved shrimp cultivation in different tanks, i.e., outdoor tanks with cement bottom (mode-C), greenhouse tanks with cement bottom (mode-G) and outdoor tanks with mud-substrate (mode-M). Results showed that water temperature was significantly higher in mode-G than that in mode-C ( P shrimps. In the mid-late period, the average concentrations of TAN, NO2-N, DIP and COD were significantly lower in mode-M and mode-G compared with those in mode-C ( P shrimp weight among different treatments ( P > 0.05), mode-M had significantly higher shrimp yield, survival rate and feed conversion rate ( P < 0.05) than other modes. There were significant differences in revenue and net return among different treatments ( P < 0.05). These demonstrated that the treatments of mode-G and mode-M were conductive to the intensive culture system of L. vannamei.

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

Directory of Open Access Journals (Sweden)

Akiko Edagawa

2015-10-01

Full Text Available We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR, and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%. Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%. In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8% compared with real-time qPCR alone (46/68, 67.6%. Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1% compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%. Legionella was not detected in the remaining six samples (6/68, 8.8%, irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

Molecular methods for the detection of mutations.

Science.gov (United States)

Monteiro, C; Marcelino, L A; Conde, A R; Saraiva, C; Giphart-Gassler, M; De Nooij-van Dalen, A G; Van Buuren-van Seggelen, V; Van der Keur, M; May, C A; Cole, J; Lehmann, A R; Steinsgrimsdottir, H; Beare, D; Capulas, E; Armour, J A

2000-01-01

We report the results of a collaborative study aimed at developing reliable, direct assays for mutation in human cells. The project used common lymphoblastoid cell lines, both with and without mutagen treatment, as a shared resource to validate the development of new molecular methods for the detection of low-level mutations in the presence of a large excess of normal alleles. As the "gold standard, " hprt mutation frequencies were also measured on the same samples. The methods under development included i) the restriction site mutation (RSM) assay, in which mutations lead to the destruction of a restriction site; ii) minisatellite length-change mutation, in which mutations lead to alleles containing new numbers of tandem repeat units; iii) loss of heterozygosity for HLA epitopes, in which antibodies can be used to direct selection for mutant cells; iv) multiple fluorescence-based long linker arm nucleotides assay (mf-LLA) technology, for the detection of substitutional mutations; v) detection of alterations in the TP53 locus using a (CA) array as the target for the screening; and vi) PCR analysis of lymphocytes for the presence of the BCL2 t(14:18) translocation. The relative merits of these molecular methods are discussed, and a comparison made with more "traditional" methods.

Characterisation of prototype Nurmi cultures using culture-based microbiological techniques and PCR-DGGE.

Science.gov (United States)

Waters, Sinéad M; Murphy, Richard A; Power, Ronan F G

2006-08-01

Undefined Nurmi-type cultures (NTCs) have been used successfully to prevent salmonella colonisation in poultry for decades. Such cultures are derived from the caecal contents of specific-pathogen-free birds and are administered via drinking water or spray application onto eggs in the hatchery. These cultures consist of many non-culturable and obligately anaerobic bacteria. Due to their undefined nature it is difficult to obtain approval from regulatory agencies to use these preparations as direct fed microbials for poultry. In this study, 10 batches of prototype NTCs were produced using an identical protocol over a period of 2 years. Traditional microbiological techniques and a molecular culture-independent methodology, polymerase chain reaction combined with denaturing gradient gel electrophoresis (PCR-DGGE), were applied to characterise these cultures and also to examine if the constituents of the NTCs were identical. Culture-dependent analysis of these cultures included plating on a variety of selective and semi-selective agars, examination of colony morphology, Gram-staining and a series of biochemical tests (API, BioMerieux, France). Two sets of PCR-DGGE studies were performed. These involved the amplification of universal and subsequently lactic acid bacteria (LAB)-specific hypervariable regions of a 16S rRNA gene by PCR. Resultant amplicons were subjected to DGGE. Sequence analysis was performed on subsequent bands present in resultant DGGE profiles using the Basic Local Alignment Search Tool (BLAST). Microbiological culturing techniques tended to isolate common probiotic bacterial species from the genera Lactobacillus, Lactococcus, Bifidobacterium, Enterococcus, Clostridium, Escherichia, Pediococcus and Enterobacterium as well as members of the genera, Actinomyces, Bacteroides, Propionibacterium, Capnocytophaga, Proteus, and Klebsiella. Bacteroides, Enterococcus, Escherichia, Brevibacterium, Klebsiella, Lactobacillus, Clostridium, Bacillus, Eubacterium

Characteristics of ovulation method acceptors: a cross-cultural assessment.

Science.gov (United States)

Klaus, H; Labbok, M; Barker, D

1988-01-01

Five programs of instruction in the ovulation method (OM) in diverse geographic and cultural settings are described, and characteristics of approximately 200 consecutive OM acceptors in each program are examined. Major findings include: the religious background and family size of acceptors are variable, as is the level of previous contraceptive use. Acceptors are drawn from a wide range of socioeconomic and religious backgrounds; however, family planning intention was similarly distributed in all five countries. In sum, the ovulation method is accepted by persons from a variety of backgrounds within and between cultural setting.

Isothermal multiple displacement amplification: a methodical approach enhancing molecular routine diagnostics of microcarcinomas and small biopsies

Directory of Open Access Journals (Sweden)

Mairinger FD

2014-08-01

Full Text Available Fabian D Mairinger,1 Robert FH Walter,2 Claudia Vollbrecht,3 Thomas Hager,1 Karl Worm,1 Saskia Ting,1 Jeremias Wohlschläger,1 Paul Zarogoulidis,4 Konstantinos Zarogoulidis,4 Kurt W Schmid1 1Institute of Pathology, 2Ruhrlandklinik, West German Lung Center, University Hospital Essen, Essen, 3Institute of Pathology, University Hospital Cologne, Cologne, Germany; 4Pulmonary Department, Oncology Unit, G Papanikolaou General Hospital, Aristotle University of Thessaloniki, Thessaloniki, Greece Background and methods: Isothermal multiple displacement amplification (IMDA can be a powerful tool in molecular routine diagnostics for homogeneous and sequence-independent whole-genome amplification of notably small tumor samples, eg, microcarcinomas and biopsies containing a small amount of tumor. Currently, this method is not well established in pathology laboratories. We designed a study to confirm the feasibility and convenience of this method for routine diagnostics with formalin-fixed, paraffin-embedded samples prepared by laser-capture microdissection. Results: A total of 250 µg DNA (concentration 5 µg/µL was generated by amplification over a period of 8 hours with a material input of approximately 25 cells, approximately equivalent to 175 pg of genomic DNA. In the generated DNA, a representation of all chromosomes could be shown and the presence of elected genes relevant for diagnosis in clinical samples could be proven. Mutational analysis of clinical samples could be performed without any difficulty and showed concordance with earlier diagnostic findings. Conclusion: We established the feasibility and convenience of IMDA for routine diagnostics. We also showed that small amounts of DNA, which were not analyzable with current molecular methods, could be sufficient for a wide field of applications in molecular routine diagnostics when they are preamplified with IMDA. Keywords: isothermal multiple displacement amplification, isothermal, whole

Research on fuzzy comprehensive assessment method of nuclear power plant safety culture

International Nuclear Information System (INIS)

Xiang Yuanyuan; Chen Xukun; Xu Rongbin

2012-01-01

Considering the traits of safety culture in nuclear plant, 38 safety culture assessment indexes are established from 4 aspects such as safety values, safety institution, safety behavior and safety sub- stances. Based on it, a comprehensive assessment method for nuclear power plant safety culture is constructed by using AHP (Analytic Hierarchy Process) approach and fuzzy mathematics. The comprehensive assessment method has the quality of high precision and high operability, which can support the decision making of safety culture development. (authors)

NATO Advanced Study Institute on Methods in Computational Molecular Physics

CERN Document Server

Diercksen, Geerd

1992-01-01

This volume records the lectures given at a NATO Advanced Study Institute on Methods in Computational Molecular Physics held in Bad Windsheim, Germany, from 22nd July until 2nd. August, 1991. This NATO Advanced Study Institute sought to bridge the quite considerable gap which exist between the presentation of molecular electronic structure theory found in contemporary monographs such as, for example, McWeeny's Methods 0/ Molecular Quantum Mechanics (Academic Press, London, 1989) or Wilson's Electron correlation in moleeules (Clarendon Press, Oxford, 1984) and the realization of the sophisticated computational algorithms required for their practical application. It sought to underline the relation between the electronic structure problem and the study of nuc1ear motion. Software for performing molecular electronic structure calculations is now being applied in an increasingly wide range of fields in both the academic and the commercial sectors. Numerous applications are reported in areas as diverse as catalysi...

Supervision of the safety culture in nuclear facilities

International Nuclear Information System (INIS)

2014-11-01

This brochure issued by the Swiss Federal Nuclear Safety Inspectorate ENSI reports on safety culture aspects in nuclear facilities and ENSI’s activities as a supervisory instance. ENSI is the independent supervisory authority for the nuclear sector in Switzerland. A definition of safety culture is presented and the development of the concepts used in its monitoring are discussed. The main attributes of a good safety culture are discussed. Further, the conceptual basics and principles of such monitoring are looked at and the methods used for the supervision of safety culture in nuclear facilities are described

Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

NARCIS (Netherlands)

Lievens, B.; Thomma, B.P.H.J.

2005-01-01

The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

Science.gov (United States)

Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

2003-01-01

The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

Advances in the application of molecular microbiological methods in the oil and gas industry and links to microbiologically influenced corrosion

DEFF Research Database (Denmark)

Eckert, Rickard; Skovhus, Torben Lund

2018-01-01

While the oil and gas industry has witnessed increased applications of molecular microbiological methods (MMMs) for diagnosing and managing microbiologically influenced corrosion (MIC) in the past decade, the process for establishing clear links between microbiological conditions and corrosion...... mechanisms is still emerging. Different MMMs provide various types of information about microbial diversity, abundance, activity and function, all of which are quite different from the culture-based results that are familiar to oil and gas industry corrosion professionals. In addition, a multidisciplinary...

A Fourier-series-based kernel-independent fast multipole method

International Nuclear Information System (INIS)

Zhang Bo; Huang Jingfang; Pitsianis, Nikos P.; Sun Xiaobai

2011-01-01

We present in this paper a new kernel-independent fast multipole method (FMM), named as FKI-FMM, for pairwise particle interactions with translation-invariant kernel functions. FKI-FMM creates, using numerical techniques, sufficiently accurate and compressive representations of a given kernel function over multi-scale interaction regions in the form of a truncated Fourier series. It provides also economic operators for the multipole-to-multipole, multipole-to-local, and local-to-local translations that are typical and essential in the FMM algorithms. The multipole-to-local translation operator, in particular, is readily diagonal and does not dominate in arithmetic operations. FKI-FMM provides an alternative and competitive option, among other kernel-independent FMM algorithms, for an efficient application of the FMM, especially for applications where the kernel function consists of multi-physics and multi-scale components as those arising in recent studies of biological systems. We present the complexity analysis and demonstrate with experimental results the FKI-FMM performance in accuracy and efficiency.

Molecular techniques: An overview of methods for the detection of ...

African Journals Online (AJOL)

Several DNA molecular markers are now available for use in surveillance and investigation of food-borne outbreaks that were previously difficult to detect. The results from several sources of literature indicate substantially different degrees of sensitivities between conventional detection methods and molecular-based ...

Improved Cell Culture Method for Growing Contracting Skeletal Muscle Models

Science.gov (United States)

Marquette, Michele L.; Sognier, Marguerite A.

2013-01-01

An improved method for culturing immature muscle cells (myoblasts) into a mature skeletal muscle overcomes some of the notable limitations of prior culture methods. The development of the method is a major advance in tissue engineering in that, for the first time, a cell-based model spontaneously fuses and differentiates into masses of highly aligned, contracting myotubes. This method enables (1) the construction of improved two-dimensional (monolayer) skeletal muscle test beds; (2) development of contracting three-dimensional tissue models; and (3) improved transplantable tissues for biomedical and regenerative medicine applications. With adaptation, this method also offers potential application for production of other tissue types (i.e., bone and cardiac) from corresponding precursor cells.

Comparing rapid and culture indicator bacteria methods at inland lake beaches

Science.gov (United States)

Francy, Donna S.; Bushon, Rebecca N.; Brady, Amie M.G.; Kephart, Christopher M.

2013-01-01

A rapid method, quantitative polymerase chain reaction (qPCR), for quantifying indicator bacteria in recreational waters is desirable for public health protection. We report that replacing current Escherichia coli standards with new US Environmental Protection Agency beach action values (BAVs) for enterococci by culture or qPCR may result in more advisories being posted at inland recreational lakes. In this study, concentrations of E. coli and enterococci by culture methods were compared to concentrations of Enterococcus spp. by qPCR at 3 inland lake beaches in Ohio. The E. coli and enterococci culture results were significantly related at all beaches; however, the relations between culture results and Enterococcus spp. qPCR results were not always significant and differed among beaches. All the qPCR results exceeded the new BAV for Enterococcus spp. by qPCR, whereas only 23.7% of culture results for E. coli and 79% of culture results for enterococci exceeded the current standard for E. coli or BAV for enterococci.

Triangulation and the importance of establishing valid methods for food safety culture evaluation.

Science.gov (United States)

Jespersen, Lone; Wallace, Carol A

2017-10-01

The research evaluates maturity of food safety culture in five multi-national food companies using method triangulation, specifically self-assessment scale, performance documents, and semi-structured interviews. Weaknesses associated with each individual method are known but there are few studies in food safety where a method triangulation approach is used for both data collection and data analysis. Significantly, this research shows that individual results taken in isolation can lead to wrong conclusions, resulting in potentially failing tactics and wasted investments. However, by applying method triangulation and reviewing results from a range of culture measurement tools it is possible to better direct investments and interventions. The findings add to the food safety culture paradigm beyond a single evaluation of food safety culture using generic culture surveys. Copyright © 2017. Published by Elsevier Ltd.

Identification of Mucorales isolates from soil using morphological and molecular methods

Directory of Open Access Journals (Sweden)

Ardeshir Ziaee

2016-03-01

Full Text Available Background and Purpose: Soil is the main habitat of saprophytic and pathogenic fungi. Mucormycetes are one of the most parts of soil fungi and certain members are among opportunistic fungi and can cause systemic fungal infections in immunocompromised patients. The majority of human and animal infections are caused by members of the genera Rhizopus, Mucor, Rhizomucor, Lichtheimia (Absidia, Cunninghamella and Mortierella. The objective of this research was to isolate and identify the main genera of Zygomycetes, using molecular assay and morphological features. Materials and Methods: A total of 340 soil samples were collected from different sites of seven public parks and 14 municipality districts in Isfahan. All samples were cultured on appropriate media and incubated at 27° C for 2 to 4 days, and then examined daily for visible fungal growth. PCR-RFLP method and macroscopic, microscopic and physiological characteristics were applied to identify fungal colonies. Results: Four hundred pure colonies belonging to six genera of Zygomycetes including Lichtheimia, Rhizopus, Rhizomucor, Mucor, Cunninghamella and Mortierella were identified. The genus Rhizopus (35.5% was the most frequent isolate, followed by Mucor (32.25% and Rhizomucor (27.5%. Conclusion: These finding may help us to understand about the importance of opportunistic fungi in public areas and the risk of exposure with immunocompromised persons.

A Novel Microfluidic Cell Co-culture Platform for the Study of the Molecular Mechanisms of Parkinson's Disease and Other Synucleinopathies.

Science.gov (United States)

Fernandes, João T S; Chutna, Oldriska; Chu, Virginia; Conde, João P; Outeiro, Tiago F

2016-01-01

Although, the precise molecular mechanisms underlying Parkinson's disease (PD) are still elusive, it is now known that spreading of alpha-synuclein (aSyn) pathology and neuroinflammation are important players in disease progression. Here, we developed a novel microfluidic cell-culture platform for studying the communication between two different cell populations, a process of critical importance not only in PD but also in many biological processes. The integration of micro-valves in the device enabled us to control fluid routing, cellular microenvironments, and to simulate paracrine signaling. As proof of concept, two sets of experiments were designed to show how this platform can be used to investigate specific molecular mechanisms associated with PD. In one experiment, naïve H4 neuroglioma cells were co-cultured with cells expressing aSyn tagged with GFP (aSyn-GFP), to study the release and spreading of the protein. In our experimental set up, we induced the release of the contents of aSyn-GFP producing cells to the medium and monitored the protein's diffusion. In another experiment, H4 cells were co-cultured with N9 microglial cells to assess the interplay between two cell lines in response to environmental stimuli. Here, we observed an increase in the levels of reactive oxygen species in H4 cells cultured in the presence of activated N9 cells, confirming the cross talk between different cell populations. In summary, the platform developed in this study affords novel opportunities for the study of the molecular mechanisms involved in PD and other neurodegenerative diseases.

On reliable discovery of molecular signatures

Directory of Open Access Journals (Sweden)

Björkegren Johan

2009-01-01

Full Text Available Abstract Background Molecular signatures are sets of genes, proteins, genetic variants or other variables that can be used as markers for a particular phenotype. Reliable signature discovery methods could yield valuable insight into cell biology and mechanisms of human disease. However, it is currently not clear how to control error rates such as the false discovery rate (FDR in signature discovery. Moreover, signatures for cancer gene expression have been shown to be unstable, that is, difficult to replicate in independent studies, casting doubts on their reliability. Results We demonstrate that with modern prediction methods, signatures that yield accurate predictions may still have a high FDR. Further, we show that even signatures with low FDR may fail to replicate in independent studies due to limited statistical power. Thus, neither stability nor predictive accuracy are relevant when FDR control is the primary goal. We therefore develop a general statistical hypothesis testing framework that for the first time provides FDR control for signature discovery. Our method is demonstrated to be correct in simulation studies. When applied to five cancer data sets, the method was able to discover molecular signatures with 5% FDR in three cases, while two data sets yielded no significant findings. Conclusion Our approach enables reliable discovery of molecular signatures from genome-wide data with current sample sizes. The statistical framework developed herein is potentially applicable to a wide range of prediction problems in bioinformatics.

Independence and totalness of subspaces in phase space methods

Science.gov (United States)

Vourdas, A.

2018-04-01

The concepts of independence and totalness of subspaces are introduced in the context of quasi-probability distributions in phase space, for quantum systems with finite-dimensional Hilbert space. It is shown that due to the non-distributivity of the lattice of subspaces, there are various levels of independence, from pairwise independence up to (full) independence. Pairwise totalness, totalness and other intermediate concepts are also introduced, which roughly express that the subspaces overlap strongly among themselves, and they cover the full Hilbert space. A duality between independence and totalness, that involves orthocomplementation (logical NOT operation), is discussed. Another approach to independence is also studied, using Rota's formalism on independent partitions of the Hilbert space. This is used to define informational independence, which is proved to be equivalent to independence. As an application, the pentagram (used in discussions on contextuality) is analysed using these concepts.

Mental health service user participation in Chinese culture: a model of independence or interdependence?

Science.gov (United States)

Tang, Jessica Pui-Shan; Tse, Samson Shu-Ki; Davidson, Larry; Cheng, Patrick

2017-12-22

Current models of user participation in mental health services were developed within Western culture and thus may not be applicable to Chinese communities. To present a new model of user participation, which emerged from research within a Chinese community, for understanding the processes of and factors influencing user participation in a non-Western culture. Multiple qualitative methods, including focus groups, individual in-depth interviews, and photovoice, were applied within the framework of constructivist grounded theory and collaborative research. Diverging from conceptualizations of user participation with emphasis on civil rights and the individual as a central agent, participants in the study highlighted the interpersonal dynamics between service users and different players affecting the participation intensity and outcomes. They valued a reciprocal relationship with their caregivers in making treatment decisions, cooperated with staff to observe power hierarchies and social harmony, identified the importance of peer support in enabling service engagement and delivery, and emphasized professional facilitation in advancing involvement at the policy level. User participation in Chinese culture embeds dynamic interdependence. The proposed model adds this new dimension to the existing frameworks and calls for attention to the complex local ecology and cultural consistency in realizing user participation.

Quantitative Methods for Molecular Diagnostic and Therapeutic Imaging

OpenAIRE

Li, Quanzheng

2013-01-01

This theme issue provides an overview on the basic quantitative methods, an in-depth discussion on the cutting-edge quantitative analysis approaches as well as their applications for both static and dynamic molecular diagnostic and therapeutic imaging.

An independent accurate reference method for the determination of chromium in biological materials

NARCIS (Netherlands)

Lagerwaard, A.; Woittiez, J.R.W.; de Goeij, J.J.M.

1994-01-01

A method for the determination of Cr in biological materials with high accuracy is reported for use as an independent reference method. It is based on radiochemical neutron activation analysis (RNAA) in combination with an individual yield determination based on the online yield principle. A

Method for improved selectivity in photo-activation and detection of molecular diagnostic agents

Science.gov (United States)

Wachter, Eric A.; Fisher, Walter G.; Dees, H. Craig

1998-01-01

A method for the imaging of a particular volume of plant or animal tissue, wherein the plant or animal tissue contains at least one photo-active molecular agent. The method includes the steps of treating the particular volume of the plant or animal tissue with light sufficient to promote a simultaneous two-photon excitation of the photo-active molecular agent contained in the particular volume of the plant or animal tissue, photo-activating at least one of the at least one photo-active molecular agent in the particular volume of the plant or animal tissue, thereby producing at least one photo-activated molecular agent, wherein the at least one photo-activated molecular agent emits energy, detecting the energy emitted by the at least one photo-activated molecular agent, and producing a detected energy signal which is characteristic of the particular volume of plant or animal tissue. The present invention is also a method for the imaging of a particular volume of material, wherein the material contains at least one photo-active molecular agent.

Methods for improved selectivity in photo-activation and detection of molecular diagnostic agents

Science.gov (United States)

Wachter, Eric A [Oak Ridge, TN; Fisher, Walter G [Knoxville, TN; Dees, H Craig [Knoxville, TN

2008-03-18

A method for the imaging of a particular volume of plant or animal tissue, wherein the plant or animal tissue contains at least one photo-active molecular agent. The method comprises the steps of treating the particular volume of the plant or animal tissue with light sufficient to promote a simultaneous two-photon excitation of the photo-active molecular agent contained in the particular volume of the plant or animal tissue, photo-activating at least one of the at least one photo-active molecular agent in the particular volume of the plant or animal tissue, thereby producing at least one photo-activated molecular agent, wherein the at least one photo-activated molecular agent emits energy, detecting the energy emitted by the at least one photo-activated molecular agent, and producing a detected energy signal which is characteristic of the particular volume of plant or animal tissue. The present invention also provides a method for the imaging of a particular volume of material, wherein the material contains at least one photo-active molecular agent.

Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

Science.gov (United States)

Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

2015-11-01

The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Application of molecular methods for monitoring transmission stages of malaria parasites

International Nuclear Information System (INIS)

Babiker, Hamza A; Schneider, Petra

2008-01-01

Recent technical advances in malaria research have allowed specific detection of mRNA of genes that are expressed exclusively in sexual stages (gametocytes) of malaria parasites. The specificity and sensitivity of these techniques were validated on cultured laboratory clones of both human malaria parasites (Plasmodium falciparum) and rodent parasites (P. chabaudi). More recently, quantitative molecular techniques have been developed to quantify these sexual stages and used to monitor gametocyte dynamics and their transmission to mosquitoes. Molecular techniques showed that the infectious reservoir for malaria is larger than expected from previous microscopic studies; individual parasite genotypes within an infection can simultaneously produce infectious gametocytes; gametocyte production can be sustained for several months, and is modulated by environmental factors. The above techniques have empowered approaches for in-depth analysis of the biology of the transmission stages of the parasite and epidemiology of malaria transmission

Molecular detection of eukaryotes in a single human stool sample from Senegal.

Directory of Open Access Journals (Sweden)

Ibrahim Hamad

Full Text Available BACKGROUND: Microbial eukaryotes represent an important component of the human gut microbiome, with different beneficial or harmful roles; some species are commensal or mutualistic, whereas others are opportunistic or parasitic. The diversity of eukaryotes inhabiting humans remains relatively unexplored because of either the low abundance of these organisms in human gut or because they have received limited attention from a whole-community perspective. METHODOLOGY/PRINCIPAL FINDING: In this study, a single fecal sample from a healthy African male was studied using both culture-dependent methods and extended molecular methods targeting the 18S rRNA and ITS sequences. Our results revealed that very few fungi, including Candida spp., Galactomyces spp., and Trichosporon asahii, could be isolated using culture-based methods. In contrast, a relatively a high number of eukaryotic species could be identified in this fecal sample when culture-independent methods based on various primer sets were used. A total of 27 species from one sample were found among the 977 analyzed clones. The clone libraries were dominated by fungi (716 clones/977, 73.3%, corresponding to 16 different species. In addition, 187 sequences out of 977 (19.2% corresponded to 9 different species of plants; 59 sequences (6% belonged to other micro-eukaryotes in the gut, including Entamoeba hartmanni and Blastocystis sp; and only 15 clones/977 (1.5% were related to human 18S rRNA sequences. CONCLUSION: Our results revealed a complex eukaryotic community in the volunteer's gut, with fungi being the most abundant species in the stool sample. Larger investigations are needed to assess the generality of these results and to understand their roles in human health and disease.

Methods and Techniques of Sampling, Culturing and Identifying of Subsurface Bacteria

International Nuclear Information System (INIS)

Lee, Seung Yeop; Baik, Min Hoon

2010-11-01

This report described sampling, culturing and identifying of KURT underground bacteria, which existed as iron-, manganese-, and sulfate-reducing bacteria. The methods of culturing and media preparation were different by bacteria species affecting bacteria growth-rates. It will be possible for the cultured bacteria to be used for various applied experiments and researches in the future

Benchmarking Quantum Mechanics/Molecular Mechanics (QM/MM) Methods on the Thymidylate Synthase-Catalyzed Hydride Transfer.

Science.gov (United States)

Świderek, Katarzyna; Arafet, Kemel; Kohen, Amnon; Moliner, Vicent

2017-03-14

Given the ubiquity of hydride-transfer reactions in enzyme-catalyzed processes, identifying the appropriate computational method for evaluating such biological reactions is crucial to perform theoretical studies of these processes. In this paper, the hydride-transfer step catalyzed by thymidylate synthase (TSase) is studied by examining hybrid quantum mechanics/molecular mechanics (QM/MM) potentials via multiple semiempirical methods and the M06-2X hybrid density functional. Calculations of protium and tritium transfer in these reactions across a range of temperatures allowed calculation of the temperature dependence of kinetic isotope effects (KIE). Dynamics and quantum-tunneling effects are revealed to have little effect on the reaction rate, but are significant in determining the KIEs and their temperature dependence. A good agreement with experiments is found, especially when computed for RM1/MM simulations. The small temperature dependence of quantum tunneling corrections and the quasiclassical contribution term cancel each other, while the recrossing transmission coefficient seems to be temperature-independent over the interval of 5-40 °C.

Use of the Culture Care Theory and ethnonursing method to discover how nursing faculty teach culture care.

Science.gov (United States)

Mixer, Sandra J

2008-04-01

As the world becomes increasingly multicultural, transcultural nursing education is critical to ensuring a culturally competent workforce. This paper presents a comprehensive review of literature and results of an ethnonursing pilot study using the Culture Care Theory (CCT) to discover how nursing faculty teach culture care. The literature revealed that despite 50 years of transcultural nursing knowledge development through theory, research and practice, there remains a lack of formal, integrated culture education in nursing. The importance of faculty providing generic and professional care to nursing students and using an organising framework to teach culture care was discovered. Additionally, care was essential for faculty health and well-being to enable faculty to teach culture care. This unique use of the theory and method demonstrates its usefulness in discovering and describing the complex nature of teaching culture care. Larger scale studies are predicted to further substantiate the CCT, building the discipline of nursing.

A protocol for preparation and transfection of rat entorhinal cortex organotypic cultures for electrophysiological whole-cell recordings

Directory of Open Access Journals (Sweden)

Nicholas I. Cilz

2017-01-01

Full Text Available Understanding how neuromodulators influence synaptic transmission and intrinsic excitability within the entorhinal cortex (EC is critical to furthering our understanding of the molecular and cellular aspects of this region. Organotypic cultures can provide a cost-effective means to employ selective molecular biological strategies in elucidating cellular mechanisms of neuromodulation in the EC. We therefore adapted our acute slice model for organotypic culture applications and optimized a protocol for the preparation and biolistic transfection of cultured horizontal EC slices. Here, we present our detailed protocol for culturing EC slices. Using an n-methyl-d-glucamine (NMDG-containing cutting solution, we obtain healthy EC slice cultures for electrophysiological recordings. We also present our protocol for the preparation of “bullets” carrying one or more constructs and demonstrate successful transfection of EC slices. We build upon previous methods and highlight specific aspects in our method that greatly improved the quality of our results. We validate our methods using immunohistochemical, imaging, and electrophysiological techniques. The novelty of this method is that it provides a description of culturing and transfection of EC neurons for specifically addressing their functionality. This method will enable researchers interested in entorhinal function to quickly adopt a similar slice culture transfection system for their own investigations.

Evolutionary Mechanisms Involved in Emergence of Viral Haemorrhagic Septicaemia Virus (VHSV) into Cultured Rainbow Trout, Oncorhynchus mykiss

DEFF Research Database (Denmark)

Schönherz, Anna A.

virulence, causing extensive losses to the aquacultre industry. Cross-species transmission and subsequent adaptation to cultured raibow trout is observed occasionally. However, the biological background facilitationg VHSV emergense has yet to be identified. In the present PhD project potential mechanisms...... facilitation VHSV emergence into cultured raibow trout were explored. In vivo infection trials and in selico based molecular analysis were performed to independently investigate the first two steps of viral emergence, namely initial introduction to- and subsequent adaptation and establishment within the new...... of genetic variation, and that VHSV emergence into cultured rainbow torut was accompanied by rapid adaptive evolution within the viral glucoprotein...

A method for independent component graph analysis of resting-state fMRI

DEFF Research Database (Denmark)

de Paula, Demetrius Ribeiro; Ziegler, Erik; Abeyasinghe, Pubuditha M.

2017-01-01

Introduction Independent component analysis (ICA) has been extensively used for reducing task-free BOLD fMRI recordings into spatial maps and their associated time-courses. The spatially identified independent components can be considered as intrinsic connectivity networks (ICNs) of non-contiguou......Introduction Independent component analysis (ICA) has been extensively used for reducing task-free BOLD fMRI recordings into spatial maps and their associated time-courses. The spatially identified independent components can be considered as intrinsic connectivity networks (ICNs) of non......-contiguous regions. To date, the spatial patterns of the networks have been analyzed with techniques developed for volumetric data. Objective Here, we detail a graph building technique that allows these ICNs to be analyzed with graph theory. Methods First, ICA was performed at the single-subject level in 15 healthy...... parcellated regions. Third, between-node functional connectivity was established by building edge weights for each networks. Group-level graph analysis was finally performed for each network and compared to the classical network. Results Network graph comparison between the classically constructed network...

Novel cell separation method for molecular analysis of neuron-astrocyte cocultures

Directory of Open Access Journals (Sweden)

Andrea eGoudriaan

2014-01-01

Full Text Available Over the last decade, the importance of astrocyte-neuron communication in neuronal development and synaptic plasticity has become increasingly clear. Since neuron-astrocyte interactions represent highly dynamic and reciprocal processes, we hypothesized that many astrocyte genes may be regulated as a consequence of their interactions with maturing neurons. In order to identify such neuron-responsive astrocyte genes in vitro, we sought to establish an expedite technique for separation of neurons from co-cultured astrocytes. Our newly established method makes use of cold jet, which exploits different adhesion characteristics of subpopulations of cells (Jirsova et al., 1997, and is rapid, performed under ice-cold conditions and avoids protease-mediated isolation of astrocytes or time-consuming centrifugation, yielding intact astrocyte mRNA with approximately 90% of neuronal RNA removed. Using this purification method, we executed genome-wide profiling in which RNA derived from astrocyte-only cultures was compared with astrocyte RNA derived from differentiating neuron-astrocyte co-cultures. Data analysis determined that many astrocytic mRNAs and biological processes are regulated by neuronal interaction. Our results validate the cold jet as an efficient method to separate astrocytes from neurons in co-culture, and reveals that neurons induce robust gene-expression changes in co-cultured astrocytes.

A method comparison of total and HMW adiponectin: HMW/total adiponectin ratio varies versus total adiponectin, independent of clinical condition.

Science.gov (United States)

van Andel, Merel; Drent, Madeleine L; van Herwaarden, Antonius E; Ackermans, Mariëtte T; Heijboer, Annemieke C

2017-02-01

Total and high-molecular-weight (HMW) adiponectin have been associated with endocrine and cardiovascular pathology. As no gold standard is available, the discussion about biological relevance of isoforms is complicated. In our study we perform a method comparison between two commercially available assays measuring HMW and total adiponectin, in various patient groups, thus contributing further to this discussion. We determined levels of HMW and total adiponectin using assays by Lumipulse® and Millipore® respectively, in 126 patients with different clinical characteristics (n=29 healthy volunteers, n=22 dialysis patients, n=25 elderly with body mass index (BMI) LUMIPULSE ∗0.5-0.9=total adiponectin MILLIPORE , albeit with significant deviation from linearity (p<0.001). Pearson's correlation was R=0.987 (p=0.000). No significant differences between patient groups were observed (p=0.190). The HMW/total adiponectin ratio varies with total adiponectin concentration independent of clinical conditions studied. Our results imply that total and HMW adiponectin have similar utility when assessing adiponectin levels in blood, as the ratio is independent of clinical condition. Copyright © 2016 Elsevier B.V. All rights reserved.

Culture and identification of Borrelia spirochetes in human vaginal and seminal secretions [version 3; referees: 2 approved, 2 not approved

Directory of Open Access Journals (Sweden)

Marianne J. Middelveen

2015-04-01

Full Text Available Background: Recent reports indicate that more than 300,000 cases of Lyme disease are diagnosed yearly in the USA. Preliminary clinical, epidemiological and immunological studies suggest that infection with the Lyme disease spirochete Borrelia burgdorferi (Bb could be transferred from person to person via intimate human contact without a tick vector. Failure to detect viable Borrelia spirochetes in vaginal and seminal secretions would argue against this hypothesis. Methods: Patients with and without a history of Lyme disease were selected for the study after informed consent was obtained. Serological testing for Bb was performed on all subjects. Semen or vaginal secretions were inoculated into BSK-H medium and cultured for four weeks. Examination of genital cultures and culture concentrates for the presence of spirochetes was performed using light and darkfield microscopy, and spirochete concentrates were subjected to Dieterle silver staining, anti-Bb immunohistochemical staining, molecular hybridization and PCR analysis for further characterization. Immunohistochemical and molecular testing was performed in three independent laboratories in a blinded fashion. Positive and negative controls were included in all experiments. Results: Control subjects who were asymptomatic and seronegative for Bb had no detectable spirochetes in genital secretions by PCR analysis. In contrast, spirochetes were observed in cultures of genital secretions from 11 of 13 subjects diagnosed with Lyme disease, and motile spirochetes were detected in genital culture concentrates from 12 of 13 Lyme disease patients using light and darkfield microscopy. Morphological features of spirochetes were confirmed by Dieterle silver staining and immunohistochemical staining of culture concentrates. Molecular hybridization and PCR testing confirmed that the spirochetes isolated from semen and vaginal secretions were strains of Borrelia, and all cultures were negative for treponemal

Molecular photoionization using the complex Kohn variational method

International Nuclear Information System (INIS)

Lynch, D.L.; Schneider, B.I.

1992-01-01

We have applied the complex Kohn variational method to the study of molecular-photoionization processes. This requires electron-ion scattering calculations enforcing incoming boundary conditions. The sensitivity of these results to the choice of the cutoff function in the Kohn method has been studied and we have demonstrated that a simple matching of the irregular function to a linear combination of regular functions produces accurate scattering phase shifts

Short-peptide-based molecular hydrogels: novel gelation strategies and applications for tissue engineering and drug delivery

Science.gov (United States)

Wang, Huaimin; Yang, Zhimou

2012-08-01

Molecular hydrogels hold big potential for tissue engineering and controlled drug delivery. Our lab focuses on short-peptide-based molecular hydrogels formed by biocompatible methods and their applications in tissue engineering (especially, 3D cell culture) and controlled drug delivery. This feature article firstly describes our recent progresses of the development of novel methods to form hydrogels, including the strategy of disulfide bond reduction and assistance with specific protein-peptide interactions. We then introduce the applications of our hydrogels in fields of controlled stem cell differentiation, cell culture, surface modifications of polyester materials by molecular self-assembly, and anti-degradation of recombinant complex proteins. A novel molecular hydrogel system of hydrophobic compounds that are only formed by hydrolysis processes was also included in this article. The hydrogels of hydrophobic compounds, especially those of hydrophobic therapeutic agents, may be developed into a carrier-free delivery system for long term delivery of therapeutic agents. With the efforts in this field, we believe that molecular hydrogels formed by short peptides and hydrophobic therapeutic agents can be practically applied for 3D cell culture and long term drug delivery in near future, respectively.

Multiparametric comparison of chromogenic-based culture methods used to assess the microbiological quality of drinking water and the mFC method combined with a molecular confirmation procedure.

Science.gov (United States)

Maheux, Andrée F; Dion-Dupont, Vanessa; Bisson, Marc-Antoine; Bouchard, Sébastien; Jubinville, Éric; Nkuranga, Martine; Rodrigue, Lynda; Bergeron, Michel G; Rodriguez, Manuel J

2015-03-01

MI agar and Colilert(®), as well as mFC agar combined with an Escherichia coli-specific molecular assay (mFC + E. coli rtPCR), were compared in terms of their sensitivity, ease of use, time to result and affordability. The three methods yielded a positive E. coli signal for 11.5, 10.8, and 11.5% of the 968 well water samples tested, respectively. One hundred and thirty-six (136) samples gave blue colonies on mFC agar and required confirmation. E. coli-specific rtPCR showed false-positive results in 23.5% (32/136) of cases. In terms of ease of use, Colilert was the simplest method to use while the MI method provided ease of use comparable to all membrane filtration methods. However, the mFC + E. coli rtPCR assay required highly trained employees for confirmation purposes. In terms of affordability, and considering contamination rate of well water samples tested, the Colilert method and the mFC + E. coli rtPCR assay were at least five times more costly than the MI agar method. Overall, compared with the other two methods tested, the MI agar method offers the most advantages to assess drinking water quality.

Cultural pathways through universal development.

Science.gov (United States)

Greenfield, Patricia M; Keller, Heidi; Fuligni, Andrew; Maynard, Ashley

2003-01-01

We focus our review on three universal tasks of human development: relationship formation, knowledge acquisition, and the balance between autonomy and relatedness at adolescence. We present evidence that each task can be addressed through two deeply different cultural pathways through development: the pathways of independence and interdependence. Whereas core theories in developmental psychology are universalistic in their intentions, they in fact presuppose the independent pathway of development. Because the independent pathway is therefore well-known in psychology, we focus a large part of our review on empirically documenting the alternative, interdependent pathway for each developmental task. We also present three theoretical approaches to culture and development: the ecocultural, the sociohistorical, and the cultural values approach. We argue that an understanding of cultural pathways through human development requires all three approaches. We review evidence linking values (cultural values approach), ecological conditions (ecocultural approach), and socialization practices (sociohistorical approach) to cultural pathways through universal developmental tasks.

Molecular Methods for the Detection of Mycoplasma and Ureaplasma Infections in Humans

Science.gov (United States)

Waites, Ken B.; Xiao, Li; Paralanov, Vanya; Viscardi, Rose M.; Glass, John I.

2012-01-01

Mycoplasma and Ureaplasma species are well-known human pathogens responsible for a broad array of inflammatory conditions involving the respiratory and urogenital tracts of neonates, children, and adults. Greater attention is being given to these organisms in diagnostic microbiology, largely as a result of improved methods for their laboratory detection, made possible by powerful molecular-based techniques that can be used for primary detection in clinical specimens. For slow-growing species, such as Mycoplasma pneumoniae and Mycoplasma genitalium, molecular-based detection is the only practical means for rapid microbiological diagnosis. Most molecular-based methods used for detection and characterization of conventional bacteria have been applied to these organisms. A complete genome sequence is available for one or more strains of all of the important human pathogens in the Mycoplasma and Ureaplasma genera. Information gained from genome analyses and improvements in efficiency of DNA sequencing are expected to significantly advance the field of molecular detection and genotyping during the next few years. This review provides a summary and critical review of methods suitable for detection and characterization of mycoplasmas and ureaplasmas of humans, with emphasis on molecular genotypic techniques. PMID:22819362

Revisiting a model-independent dark energy reconstruction method

Energy Technology Data Exchange (ETDEWEB)

Lazkoz, Ruth; Salzano, Vincenzo; Sendra, Irene [Euskal Herriko Unibertsitatea, Fisika Teorikoaren eta Zientziaren Historia Saila, Zientzia eta Teknologia Fakultatea, Bilbao (Spain)

2012-09-15

In this work we offer new insights into the model-independent dark energy reconstruction method developed by Daly and Djorgovski (Astrophys. J. 597:9, 2003; Astrophys. J. 612:652, 2004; Astrophys. J. 677:1, 2008). Our results, using updated SNeIa and GRBs, allow to highlight some of the intrinsic weaknesses of the method. Conclusions on the main dark energy features as drawn from this method are intimately related to the features of the samples themselves, particularly for GRBs, which are poor performers in this context and cannot be used for cosmological purposes, that is, the state of the art does not allow to regard them on the same quality basis as SNeIa. We find there is a considerable sensitivity to some parameters (window width, overlap, selection criteria) affecting the results. Then, we try to establish what the current redshift range is for which one can make solid predictions on dark energy evolution. Finally, we strengthen the former view that this model is modest in the sense it provides only a picture of the global trend and has to be managed very carefully. But, on the other hand, we believe it offers an interesting complement to other approaches, given that it works on minimal assumptions. (orig.)

Are molecular haplotypes worth the time and expense? A cost-effective method for applying molecular haplotypes.

Directory of Open Access Journals (Sweden)

Mark A Levenstien

2006-08-01

Full Text Available Because current molecular haplotyping methods are expensive and not amenable to automation, many researchers rely on statistical methods to infer haplotype pairs from multilocus genotypes, and subsequently treat these inferred haplotype pairs as observations. These procedures are prone to haplotype misclassification. We examine the effect of these misclassification errors on the false-positive rate and power for two association tests. These tests include the standard likelihood ratio test (LRTstd and a likelihood ratio test that employs a double-sampling approach to allow for the misclassification inherent in the haplotype inference procedure (LRTae. We aim to determine the cost-benefit relationship of increasing the proportion of individuals with molecular haplotype measurements in addition to genotypes to raise the power gain of the LRTae over the LRTstd. This analysis should provide a guideline for determining the minimum number of molecular haplotypes required for desired power. Our simulations under the null hypothesis of equal haplotype frequencies in cases and controls indicate that (1 for each statistic, permutation methods maintain the correct type I error; (2 specific multilocus genotypes that are misclassified as the incorrect haplotype pair are consistently misclassified throughout each entire dataset; and (3 our simulations under the alternative hypothesis showed a significant power gain for the LRTae over the LRTstd for a subset of the parameter settings. Permutation methods should be used exclusively to determine significance for each statistic. For fixed cost, the power gain of the LRTae over the LRTstd varied depending on the relative costs of genotyping, molecular haplotyping, and phenotyping. The LRTae showed the greatest benefit over the LRTstd when the cost of phenotyping was very high relative to the cost of genotyping. This situation is likely to occur in a replication study as opposed to a whole-genome association study.

Pole orientation of 16 Psyche by two independent methods

Science.gov (United States)

Tedesco, E. F.; Taylor, R. C.

1985-01-01

Nineteen new lightcurves of 16 Psyche are presented along with a pole orientation derived using two independent methods, namely, photometric astrometry and magnitude-amplitude-shape-aspect. The pole orientations found using these two methods agree to within 4 deg. The results from applying photometric astrometry were prograde rotation, a sidereal period of 0.1748143 days + or - 0.0000003 days, and a pole at longitude 223 deg and latitude +37 deg, with an uncertainty of 10 deg, and, from applying magnitude-amplitude-shape-aspect a pole at 220 + or - 1 deg, +40 + or - 4 deg, and a modeled triaxial ellipsoid shape (a greater than b greater than c) and a/b = 1.33 + or - 0.07. The discrepancy between the high-pole latitude found here and the low latitudes reported by Lupishko et al. (1982) and Zhou and Yang (1982) is discussed.

Simple Calculation Programs for Biology Methods in Molecular ...

Indian Academy of Sciences (India)

First page Back Continue Last page Overview Graphics. Simple Calculation Programs for Biology Methods in Molecular Biology. GMAP: A program for mapping potential restriction sites. RE sites in ambiguous and non-ambiguous DNA sequence; Minimum number of silent mutations required for introducing a RE sites; Set ...

Independence and Interdependence in Early Childhood Services

Science.gov (United States)

Whitington, Victoria

2004-01-01

It is through culture that children make sense of their worlds (Trevarthen, 1998). Cross- cultural models show that families are likely to primarily foster either independence or interdependence in their children (Gonzalez-Mena, 1997; Greenfield, 1994). Young children are likely to pay the "price of acculturation" when they enter early…

Fast and accurate methods of independent component analysis: A survey

Czech Academy of Sciences Publication Activity Database

Tichavský, Petr; Koldovský, Zbyněk

2011-01-01

Roč. 47, č. 3 (2011), s. 426-438 ISSN 0023-5954 R&D Projects: GA MŠk 1M0572; GA ČR GA102/09/1278 Institutional research plan: CEZ:AV0Z10750506 Keywords : Blind source separation * artifact removal * electroencephalogram * audio signal processing Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 0.454, year: 2011 http://library.utia.cas.cz/separaty/2011/SI/tichavsky-fast and accurate methods of independent component analysis a survey.pdf

A method for isolating identifying and culturing of rat trachea-bronchia epithelial cells

International Nuclear Information System (INIS)

Cui Fengmei; Su Shibiao; Nie Jihua; Li Bingyan; Tong Jian

2005-01-01

Objective: To explore a method for isolating identifying and culturing the rat trachea-bronchia epithelial cells. Methods: The rat trachea-bronchia epithelial cells were isolated by digestion with pronase and brushing with cell brush, identified using confocul and cultured in entire F12 media with no serum. Results: With this method, cells in high purity and high viability could be obtained, and about 10 6 cells per rat. The cells grow well in entire F12 media with no serum. Conclusion: The method is useful for isolating rate trachea-bronchia epithelial cells and the entire F12 media with no serum is effective for culturing. (authors)

Conceptions of ‘culture' in international communication - Limits to cultural explanations?

DEFF Research Database (Denmark)

Froholdt, Lisa Loloma; Knudsen, Fabienne

2008-01-01

The paper addresses a critical approach to static, objective and context-independent concept of culture. Conceiving of another culture as objective, persistent, and evenly shared features within a nation may bring some basic order while facing an unknown culture, but it may also have unintentional...

Making Mavericks: Preparing Musicians for Independent Artistic Culture

Science.gov (United States)

Canham, Nicole L.

2016-01-01

This essay explores the role that maverick qualities--"independent or unorthodox behaviour" ("The Oxford Dictionary," 2015)--play in developing and sustaining musician employability. Whilst career education for musicians often highlights new career models (Bridgstock, 2005), there is limited evidence of how these concepts work…

Cultural Consonance, Religion and Psychological Distress in an Urban Community

Directory of Open Access Journals (Sweden)

William W. Dressler

2013-08-01

Full Text Available Cultural consonance is the degree to which individuals approximate prototypes encoded in cultural models. Low cultural consonance is associated with higher psychological distress. Religion may moderate the association between cultural consonance and psychological distress. Brazil, with substantial variation in religion, is an important society for the examination of this hypothesis. Research was conducted in Ribeirão Preto, Brazil, using a mixed-methods design. Measures of cultural consonance were derived using ethnographic methods and then applied in a survey of 271 individuals drawn from four distinct social strata. Low cultural consonance was associated with higher psychological distress in multiple regression analysis ( B = -.430, p < .001. Members of Pentecostal Protestant churches reported lower psychological distress independently of the effect of cultural consonance ( B = -.409, p < .05. There was no buffering effect of religion. Implications of these results for the study of religion and health are discussed.

Culture-dependent and culture-independent analyses reveal no prokaryotic community shifts or recovery of Serratia marcescens in Acropora palmata with white pox disease.

Science.gov (United States)

Lesser, Michael P; Jarett, Jessica K

2014-06-01

Recently, the etiological agent of white pox (WP) disease, also known as acroporid serratiosis, in the endangered coral Acropora palmata is the enteric bacterium Serratia marcescens with the source being localized sewage release onto coastal coral reef communities. Here, we show that both culture-dependent and culture-independent approaches could not recover this bacterium from samples of tissue and mucus from A. palmata colonies affected by WP disease in the Bahamas, or seawater collected adjacent to A. palmata colonies. Additionally, a metagenetic 16S rRNA pyrosequencing study shows no significant difference in the bacterial communities of coral tissues with and without WP lesions. As recent studies have shown for other coral diseases, S. marcescens cannot be identified in all cases of WP disease in several geographically separated populations of A. palmata with the same set of signs. As a result, its identification as the etiological agent of WP disease, and cause of a reverse zoonosis, cannot be broadly supported. However, the prevalence of WP disease associated with S. marcescens does appear to be associated with proximity to population centers, and research efforts should be broadened to examine this association, and to identify other causes of this syndrome. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Comparison of traditional physico-chemical methods and molecular ...

African Journals Online (AJOL)

This study was aim to review the efficiency of molecular markers and traditional physico-chemical methods for the identification of basmati rice. The study involved 44 promising varieties of Indica rices collected from geographically distant places and adapted to irrigated and aerobic agro-ecosystems. Quality data for ...

Fragrance analysis using molecular and biochemical methods in ...

African Journals Online (AJOL)

For molecular and biochemical analysis of aroma, a mapping population comprising 208 recombinant inbred lines (RILs) derived from a diverse cross between CSR10 and Taraori Basmati through Single seed descent (SSD) method was used. RILs are among the best mapping populations, which provide a novel material ...

MOLECULAR GENETIC MARKERS AND METHODS OF THEIR IDENTIFICATION IN MODERN FISH-FARMING

Directory of Open Access Journals (Sweden)

I. Hrytsyniak

2014-03-01

Full Text Available Purpose. The application of molecular genetic markers has been widely used in modern experimental fish-farming in recent years. This methodology is currently presented by a differentiated approach with individual mechanisms and clearly defined possibilities. Numerous publications in the scientific literature that are dedicated to molecular genetic markers for the most part offer purely practical data. Thus, the synthesis and analysis of existing information on the general principles of action and the limits of the main methods of using molecular genetic markers is an actual problem. In particular, such a description will make it possible to plan more effectively the experiment and to obtain the desired results with high reliability. Findings. The main types of variable parts of DNA that can be used as molecular genetic markers in determining the level of stock hybridization, conducting genetic inventory of population and solving other problems in modern fish-farming are described in this paper. Also, the article provides an overview of principal modern methods that can be used to identify molecular genetic markers. Originality. This work is a generalization of modern ideas about the mechanisms of experiments with molecular genetic markers in fish-farming. Information is provided in the form of consistent presentation of the principles and purpose of each method, as well as significant advances during their practical application. Practical value. The proposed review of classic and modern literature data on molecular genetic markers can be used for planning, modernization and correction of research activity in modern fish-farming.

Development of an Evaluation Method for Team Safety Culture Competencies using Social Network Analysis

International Nuclear Information System (INIS)

Han, Sang Min; Kim, Ar Ryum; Seong, Poong Hyun

2016-01-01

In this study, team safety culture competency of a team was estimated through SNA, as a team safety culture index. To overcome the limit of existing safety culture evaluation methods, the concept of competency and SNA were adopted. To estimate team safety culture competency, we defined the definition, range and goal of team safety culture competencies. Derivation of core team safety culture competencies is performed and its behavioral characteristics were derived for each safety culture competency, from the procedures used in NPPs and existing criteria to assess safety culture. Then observation was chosen as a method to provide the input data for the SNA matrix of team members versus insufficient team safety culture competencies. Then through matrix operation, the matrix was converted into the two meaningful values, which are density of team members and degree centralities of each team safety culture competency. Density of tem members and degree centrality of each team safety culture competency represent the team safety culture index and the priority of team safety culture competency to be improved

Development of an Evaluation Method for Team Safety Culture Competencies using Social Network Analysis

Energy Technology Data Exchange (ETDEWEB)

Han, Sang Min; Kim, Ar Ryum; Seong, Poong Hyun [KAIST, Daejeon (Korea, Republic of)

2016-05-15

In this study, team safety culture competency of a team was estimated through SNA, as a team safety culture index. To overcome the limit of existing safety culture evaluation methods, the concept of competency and SNA were adopted. To estimate team safety culture competency, we defined the definition, range and goal of team safety culture competencies. Derivation of core team safety culture competencies is performed and its behavioral characteristics were derived for each safety culture competency, from the procedures used in NPPs and existing criteria to assess safety culture. Then observation was chosen as a method to provide the input data for the SNA matrix of team members versus insufficient team safety culture competencies. Then through matrix operation, the matrix was converted into the two meaningful values, which are density of team members and degree centralities of each team safety culture competency. Density of tem members and degree centrality of each team safety culture competency represent the team safety culture index and the priority of team safety culture competency to be improved.

Implementation of surface hopping molecular dynamics using semiempirical methods

International Nuclear Information System (INIS)

Fabiano, E.; Keal, T.W.; Thiel, W.

2008-01-01

A molecular dynamics driver and surface hopping algorithm for nonadiabatic dynamics has been implemented in a development version of the MNDO semiempirical electronic structure package. The required energies, gradients and nonadiabatic couplings are efficiently evaluated on the fly using semiempirical configuration interaction methods. The choice of algorithms for the time evolution of the nuclear motion and quantum amplitudes is discussed, and different schemes for the computation of nonadiabatic couplings are analysed. The importance of molecular orbital tracking and electronic state following is underlined in the context of configuration interaction calculations. The method is applied to three case studies (ethylene, methaniminium ion, and methanimine) using the orthogonalization corrected OM2 Hamiltonian. In all three cases decay times and dynamics paths similar to high-level ab initio results are obtained

Improvement in the independence of relaxation method-based particle tracking velocimetry

International Nuclear Information System (INIS)

Jia, P; Wang, Y; Zhang, Y

2013-01-01

New techniques are developed to improve the independence of relaxation method-based particle tracking velocimetry (RM-PTV). Firstly, Delaunay tessellation (DT) is employed to form clusters of neighboring particles with similar motion in the same frame; and then a bidirectional calculation concept is adopted to improve the way of particle pairing. These new techniques are tested with both self-defined particle images and the particle image velocimetry standard synthetic particle images. The results indicate that the DT method performs well and efficiently in determining the particle clusters, and the particle pairing process is well optimized by the bidirectional calculation concept. With these methods, three computation parameters are eliminated, which makes RM-PTV more autonomous in applications. (paper)

Detection of Candida species in pregnant Chinese women with a molecular beacon method.

Science.gov (United States)

Zhai, Yanhong; Liu, Jing; Zhou, Li; Ji, Tongzhen; Meng, Lingxin; Gao, Yang; Liu, Ran; Wang, Xiao; Li, Lin; Lu, Binghuai; Cao, Zheng

2018-04-20

Candida pathogens are commonly found in women and can cause vulvovaginal candidiasis (VVC), whose infection rate is further increased during pregnancy. We aimed to study the Candida prevalence and strain distribution in pregnant Chinese women with a molecular beacon assay. From March 2016 to February 2017, a total of 993 pregnant women attending routine antenatal visits at the Beijing Obstetrics and Gynecology Hospital were enrolled. For Candida detection and identification, a unique molecular beacon assay was presented and compared with a traditional phenotypic method. Antifungal susceptibility was tested with the following agents: 5-flucytosine, amphotericin B, fluconazole, itraconazole and voriconazole. The prevalence of Candida was found to be 21.8 % when using the molecular method and 15.0 % when using the phenotypic method. The distribution of the Candida spp. was listed in order of decreasing prevalence: Candida albicans (79.8 %), Candida glabrata (13.5 %), Candida parapsilosis (3.7 %), Candida krusei (2.2 %) and Candida tropicalis (1.1 %). We found that 90.7 % of the Candida detection results were consistent between the molecular and the phenotypic methods. In the cases where the sequencing analyses for the Candida isolates resulted in inconsistent identification, the molecular method showed higher sensitivity than the phenotypic method (96.0 vs 64.6 %). C. albicans, C. glabrata and C. parapsilosis were essentially susceptible to all five antifungal agents tested, whereas C. tropicalis and C. krusei were susceptible to voriconazole and amphotericin B. By exhibiting good sensitivity and specificity, the molecular assay may offer a fast and accurate Candida screening platform for pregnant women.

Genetic fallout in biocultural landscapes: molecular imperialism and the cultural politics of (not) seeing transgenes in Mexico.

Science.gov (United States)

Christophe Bonneuil; Foyer, Jean; Wynne, Brian

2014-12-01

This article explores the trajectory of the global controversy over the introgression (or not) of transgenes from genetically modified maize into Mexican indigenous maize landraces. While a plurality of knowledge-making processes were deployed to render transgenes visible or invisible, we analyze how a particular in vitro based DNA-centered knowledge came to marginalize other forms of knowledge, thus obscuring other bio-cultural dimensions key to the understanding of gene flow and maize diversity. We show that dominant molecular norms of proof and standards of detection, which co-developed with the world of industrial monocropping and gene patenting, discarded and externalized non-compliant actors (i.e. complex maize genomes, human dimensions of gene flow). Operating in the name of high science, they hence obscured the complex biological and cultural processes that maintain crop diversity and enacted a cultural-political domination over the world of Mexican landraces and indigenous communities.

Novel and unexpected bacterial diversity in an arsenic-rich ecosystem revealed by culture-dependent approaches

Directory of Open Access Journals (Sweden)

Delavat François

2012-09-01

Full Text Available Abstract Background Acid Mine Drainages (AMDs are extreme environments characterized by very acid conditions and heavy metal contaminations. In these ecosystems, the bacterial diversity is considered to be low. Previous culture-independent approaches performed in the AMD of Carnoulès (France confirmed this low species richness. However, very little is known about the cultured bacteria in this ecosystem. The aims of the study were firstly to apply novel culture methods in order to access to the largest cultured bacterial diversity, and secondly to better define the robustness of the community for 3 important functions: As(III oxidation, cellulose degradation and cobalamine biosynthesis. Results Despite the oligotrophic and acidic conditions found in AMDs, the newly designed media covered a large range of nutrient concentrations and a pH range from 3.5 to 9.8, in order to target also non-acidophilic bacteria. These approaches generated 49 isolates representing 19 genera belonging to 4 different phyla. Importantly, overall diversity gained 16 extra genera never detected in Carnoulès. Among the 19 genera, 3 were previously uncultured, one of them being novel in databases. This strategy increased the overall diversity in the Carnoulès sediment by 70% when compared with previous culture-independent approaches, as specific phylogenetic groups (e.g. the subclass Actinobacteridae or the order Rhizobiales were only detected by culture. Cobalamin auxotrophy, cellulose degradation and As(III-oxidation are 3 crucial functions in this ecosystem, and a previous meta- and proteo-genomic work attributed each function to only one taxon. Here, we demonstrate that other members of this community can also assume these functions, thus increasing the overall community robustness. Conclusions This work highlights that bacterial diversity in AMDs is much higher than previously envisaged, thus pointing out that the AMD system is functionally more robust than expected

The effect of Montessori Method on teaching cultural and creative ...

African Journals Online (AJOL)

The Effect of the Montessori Method on teaching was investigated among children to discover their artistic development in Zaria, Kaduna State. The problem of the study is that the Montessori Method on teaching cultural and creative arts is not adequately explored in the primary schools, while other teaching methods used, ...

[Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

Science.gov (United States)

Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

2011-01-01

The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Optimized molecular resolution of cross-contamination alerts in clinical mycobacteriology laboratories

Directory of Open Access Journals (Sweden)

de Viedma Darío

2008-02-01

Full Text Available Abstract Background The phenomenon of misdiagnosing tuberculosis (TB by laboratory cross-contamination when culturing Mycobacterium tuberculosis (MTB has been widely reported and it has an obvious clinical, therapeutic and social impact. The final confirmation of a cross-contamination event requires the molecular identification of the same MTB strain cultured from both the potential source of the contamination and from the false-positive candidate. The molecular tool usually applied in this context is IS6110-RFLP which takes a long time to provide an answer, usually longer than is acceptable for microbiologists and clinicians to make decisions. Our purpose in this study is to evaluate a novel PCR-based method, MIRU-VNTR as an alternative to assure a rapid and optimized analysis of cross-contamination alerts. Results MIRU-VNTR was prospectively compared with IS6110-RFLP for clarifying 19 alerts of false positivity from other laboratories. MIRU-VNTR highly correlated with IS6110-RFLP, reduced the response time by 27 days and clarified six alerts unresolved by RFLP. Additionally, MIRU-VNTR revealed complex situations such as contamination events involving polyclonal isolates and a false-positive case due to the simultaneous cross-contamination from two independent sources. Conclusion Unlike standard RFLP-based genotyping, MIRU-VNTR i could help reduce the impact of a false positive diagnosis of TB, ii increased the number of events that could be solved and iii revealed the complexity of some cross-contamination events that could not be dissected by IS6110-RFLP.

Molecular diagnostics for human leptospirosis.

Science.gov (United States)

Waggoner, Jesse J; Pinsky, Benjamin A

2016-10-01

The definitive diagnosis of leptospirosis, which results from infection with spirochetes of the genus Leptospira, currently relies on the use of culture, serological testing (microscopic agglutination testing), and molecular detection. The purpose of this review is to describe new molecular diagnostics for Leptospira and discuss advancements in the use of available methods. Efforts have been focused on improving the clinical sensitivity of Leptospira detection using molecular methods. In this review, we describe a reoptimized pathogenic species-specific real-time PCR (targeting lipL32) that has demonstrated improved sensitivity, findings by two groups that real-time reverse-transcription PCR assays targeting the 16S rrs gene can improve detection, and two new loop-mediated amplification techniques. Quantitation of leptospiremia, detection in different specimen types, and the complementary roles played by molecular detection and microscopic agglutination testing will be discussed. Finally, a protocol for Leptospira strain subtyping using variable number tandem repeat targets and high-resolution melting will be described. Molecular diagnostics have an established role for the diagnosis of leptospirosis and provide an actionable diagnosis in the acute setting. The use of real-time reverse-transcription PCR for testing serum/plasma and cerebrospinal fluid, when available, may improve the detection of Leptospira without decreasing clinical specificity.

Influence of ionizing radiation on synthesis and molecular heterogeneity of catalase in tissue culture of Rauwolfia serpentina

International Nuclear Information System (INIS)

Komov, V.P.; Bespalova, E.V.; Strelkova, M.A.

1998-01-01

Changes in activity and molecular heterogeneity of catalase in tissue culture of Rauwolfia serpentina following irradiation in early growth period at the doses of 8 and 50 Gy has been studied. Ionizing radiation accelerate the synthesis and degradation rates of catalase and total protein. A comparative study of changes in enzyme and protein turnover during growth on irradiated and non-irradiated medium has been made [ru

Optimization of an Efficient Non-Tissue Culture Transformation Method for Brassica Juncea

International Nuclear Information System (INIS)

Naeem, I.; Munir, I.; Iqbal, A.; Ullah, F.

2016-01-01

The major hurdles in successful in vitro transformation of Brassica juncea through standard tissue culture (STC) method are: culture contamination, somaclonal variations, and lack of expertise. Moreover, the current STC method is time consuming and needs continuous electricity. In the present study, the in planta transformation method through floral dip with or without vacuum infiltration was optimized for successful transformation of B. juncea. The B. juncea CV RAYA Anmol was used for transformation through Agrobacterium tumefaciens strain GV3101 harboring the binary vector plasmid pBinGlyBar4-EADcT. Based on the resistance reaction to the herbicide Basta, 20 and 40 resistant seedlings were obtained from 2000 seed germinated from the plants transformed through floral dip and vacuum infiltration methods, respectively. The PCR analyses further confirmed the presence of transgene in 3 floral dipped plants without vacuum infiltration and 17 floral dipped plants with vacuum infiltration, giving the transformation frequencies of 1.5*10/sup -3/ and 8.5*10/sup -3/, respectively. This method, which avoids tissue culture, will reduce the somaclonal variation accompanying prolonged culture of cells in a dedifferentiated state, will facilitate functional genomics and improvement of Brassica juncea with novel desirable traits while reducing time and expense. (author)

Simulating trait evolution for cross-cultural comparison.

Science.gov (United States)

Nunn, Charles L; Arnold, Christian; Matthews, Luke; Borgerhoff Mulder, Monique

2010-12-12

Cross-cultural anthropologists have increasingly used phylogenetic methods to study cultural variation. Because cultural behaviours can be transmitted horizontally among socially defined groups, however, it is important to assess whether phylogeny-based methods--which were developed to study vertically transmitted traits among biological taxa--are appropriate for studying group-level cultural variation. Here, we describe a spatially explicit simulation model that can be used to generate data with known degrees of horizontal donation. We review previous results from this model showing that horizontal transmission increases the type I error rate of phylogenetically independent contrasts in studies of correlated evolution. These conclusions apply to cases in which two traits are transmitted as a pair, but horizontal transmission may be less problematic when traits are unlinked. We also use the simulation model to investigate whether measures of homology (the consistency index and the retention index) can detect horizontal transmission of cultural traits. Higher rates of evolutionary change have a stronger depressive impact on measures of homology than higher rates of horizontal transmission; thus, low consistency or retention indices are not necessarily indicative of 'ethnogenesis'. Collectively, these studies demonstrate the importance of using simulations to assess the validity of methods in cross-cultural research.

Recent advances in molecular techniques to study microbial communities in food-associated matrices and processes

NARCIS (Netherlands)

Justé, A.; Thomma, B.P.H.J.; Lievens, B.

2008-01-01

In the last two decades major changes have occurred in how microbial ecologists study microbial communities. Limitations associated with traditional culture-based methods have pushed for the development of culture-independent techniques, which are primarily based on the analysis of nucleic acids.

Organizational Culture and the Deployment of Agile Methods: The Competing Values Model View

Science.gov (United States)

Iivari, Juhani; Iivari, Netta

A number of researchers have identified organizational culture as a factor that potentially affects the deployment of agile systems development methods. Inspired by the study of Iivari and Huisman (2007), which focused on the deployment of traditional systems development methods, the present paper proposes a number of hypotheses about the influence of organizational culture on the deployment of agile methods.

Comparison of Nested-PCR technique and culture method in ...

African Journals Online (AJOL)

USER

2010-04-05

Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

Methods for culturing saltwater rotifers (Brachionus plicatilis) for rearing larval zebrafish.

Science.gov (United States)

Lawrence, Christian; Sanders, Erik; Henry, Eric

2012-09-01

The saltwater rotifer, Brachionus plicatilis, is widely used in the aquaculture industry as a prey item for first-feeding fishes due to its ease of culture, small size, rapid reproductive rate, and amenability to enrichment with nutrients. Despite the distinct advantages of this approach, rotifers have only been sporadically utilized for rearing larval zebrafish, primarily because of the common misconception that maintaining cultures of rotifers is difficult and excessively time-consuming. Here we present simple methods for maintaining continuous cultures of rotifers capable of supporting even the very largest zebrafish aquaculture facility, with minimal investments in materials, time, labor, and space. Examples of the methods' application in one large, existing facility is provided, and troubleshooting of common problems is discussed.

Molecular detection of Aeromonas hydrophila in the aquarium gold fish and cultured rainbow trout in Chaharmahal va Bakhtiary province

Directory of Open Access Journals (Sweden)

firouz Fadaeifard

2014-05-01

Full Text Available Aeromonas hydrophilia   is the etiologic agent of motile aeromonas septicaemia, one of the most important bacterial diseases of fresh and marine water fishes. The aim of the present study was detection of A. hydrophilia in the aquarium goldfish and cultured rainbow trout in Chaharmahal va Bakhtiary province.  In this study 50 goldfish from aquarium fish shops and 60 rainbow trouts suspected of having the disease from 6 farms (10 fish in each farm were randomly collected. The average weight in goldfish and rainbow trout samples were 3-5 g and 10-20 g, respectively. Sampling was performed from kidney and liver, and inoculated into blood agar and incubated at 22°C for 24 hours. Pure colonies which are grown on the mediums were tested by catalase, oxidase and gram staining, then those of gram-negative, catalase and oxidase positive were diagnosed, and cultured on Shotts-Rimler medium (as selective medium for A. hydrophila. These mediums were incubated at 22 °C for 24-48 h. The typical colonies were tested by using oligonucleotide primers of lip gene by PCR method. In light of molecular analysis of all specimens, 9 and 6 isolates from rainbow trout and gold fishes were identified as A. hydrophila respectively. Due to the detection of A. hydrophila in both cultured rainbow trout and aquarium goldfish, the bacteria can lead to septicemia with mortality if the health management principles are not observed in fish farming.

The Effect of Culture Methods and Serum Supplementation on Developmental Competence of Bovine Embryos Cultured In Vitro

Science.gov (United States)

The objective of this study was to compare the developmental competence of bovine in vitro fertilized embryos in three different culture methods; microdrop method (50 µl of medium under mineral oil in petri dishes) compared to tube methods (1 ml of medium in tubes) with or without oil overlay, and t...

Many Forms of Culture

Science.gov (United States)

Cohen, Adam B.

2009-01-01

Psychologists interested in culture have focused primarily on East-West differences in individualism-collectivism, or independent-interdependent self-construal. As important as this dimension is, there are many other forms of culture with many dimensions of cultural variability. Selecting from among the many understudied cultures in psychology,…

Dereplication of plant phenolics using a mass-spectrometry database independent method.

Science.gov (United States)

Borges, Ricardo M; Taujale, Rahil; de Souza, Juliana Santana; de Andrade Bezerra, Thaís; Silva, Eder Lana E; Herzog, Ronny; Ponce, Francesca V; Wolfender, Jean-Luc; Edison, Arthur S

2018-05-29

Dereplication, an approach to sidestep the efforts involved in the isolation of known compounds, is generally accepted as being the first stage of novel discoveries in natural product research. It is based on metabolite profiling analysis of complex natural extracts. To present the application of LipidXplorer for automatic targeted dereplication of phenolics in plant crude extracts based on direct infusion high-resolution tandem mass spectrometry data. LipidXplorer uses a user-defined molecular fragmentation query language (MFQL) to search for specific characteristic fragmentation patterns in large data sets and highlight the corresponding metabolites. To this end, MFQL files were written to dereplicate common phenolics occurring in plant extracts. Complementary MFQL files were used for validation purposes. New MFQL files with molecular formula restrictions for common classes of phenolic natural products were generated for the metabolite profiling of different representative crude plant extracts. This method was evaluated against an open-source software for mass-spectrometry data processing (MZMine®) and against manual annotation based on published data. The targeted LipidXplorer method implemented using common phenolic fragmentation patterns, was found to be able to annotate more phenolics than MZMine® that is based on automated queries on the available databases. Additionally, screening for ascarosides, natural products with unrelated structures to plant phenolics collected from the nematode Caenorhabditis elegans, demonstrated the specificity of this method by cross-testing both groups of chemicals in both plants and nematodes. Copyright © 2018 John Wiley & Sons, Ltd.

Research progress in plant mutation by combining ion beam irradiations and tissue culture

International Nuclear Information System (INIS)

Zhou Linbin; Li Wenjian; Qu Ying; Li Ping

2007-01-01

About a new mutation breeding method which combines plant tissue culture technique with heavy ion beam irradiations were discussed in this paper with the principles, operation steps, molecular mechanisms, etc. The mutation method developed a few advantages coming from plant tissue culture, which can produce offspring by asexual ways. Meanwhile, using this method, the study of biological effects of high energy particles with different linear energy transfer values on plant tissues or cells can be explored and optimized in theory or practice. (authors)

Cultural factors in collegiate eating disorder pathology: When family culture clashes with individual culture

OpenAIRE

Tomiyama, AJ; Mann, T

2008-01-01

The authors evaluated the validity of familial enmeshment (extreme proximity in family relationships) as a risk factor for eating disorders across cultural value orientations. They tested the hypothesis that although familial enmeshment may be a risk factor for eating disorder pathology for (1) participants of non-Asian descent or (2) culturally independent participants, enmeshment will not be a risk factor for (1) participants of Asian descent or (2) culturally interdependent participants. P...

Reversible gelling culture media for in-vitro cell culture in three-dimensional matrices

Science.gov (United States)

An, Yuehuei H.; Mironov, Vladimir A.; Gutowska, Anna

2000-01-01

A gelling cell culture medium useful for forming a three dimensional matrix for cell culture in vitro is prepared by copolymerizing an acrylamide derivative with a hydrophilic comonomer to form a reversible (preferably thermally reversible) gelling linear random copolymer in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum gelling molecular weight cutoff, mixing the copolymer with an aqueous solvent to form a reversible gelling solution and adding a cell culture medium to the gelling solution to form the gelling cell culture medium. Cells such as chondrocytes or hepatocytes are added to the culture medium to form a seeded culture medium, and temperature of the medium is raised to gel the seeded culture medium and form a three dimensional matrix containing the cells. After propagating the cells in the matrix, the cells may be recovered by lowering the temperature to dissolve the matrix and centrifuging.

Identification of bacterial strains in viili by molecular taxonomy and ...

African Journals Online (AJOL)

Viili, also known as viilia, is a traditional fermented dairy product, which is popular in ... In this study, culture-dependent and independent methods had been used to ... Also, their synergistic effects on milk curd and exopolysaccharides (EPSs) ...

Significance of anaerobes and oral bacteria in community-acquired pneumonia.

Directory of Open Access Journals (Sweden)

Kei Yamasaki

Full Text Available BACKGROUND: Molecular biological modalities with better detection rates have been applied to identify the bacteria causing infectious diseases. Approximately 10-48% of bacterial pathogens causing community-acquired pneumonia are not identified using conventional cultivation methods. This study evaluated the bacteriological causes of community-acquired pneumonia using a cultivation-independent clone library analysis of the 16S ribosomal RNA gene of bronchoalveolar lavage specimens, and compared the results with those of conventional cultivation methods. METHODS: Patients with community-acquired pneumonia were enrolled based on their clinical and radiological findings. Bronchoalveolar lavage specimens were collected from pulmonary pathological lesions using bronchoscopy and evaluated by both a culture-independent molecular method and conventional cultivation methods. For the culture-independent molecular method, approximately 600 base pairs of 16S ribosomal RNA genes were amplified using polymerase chain reaction with universal primers, followed by the construction of clone libraries. The nucleotide sequences of 96 clones randomly chosen for each specimen were determined, and bacterial homology was searched. Conventional cultivation methods, including anaerobic cultures, were also performed using the same specimens. RESULTS: In addition to known common pathogens of community-acquired pneumonia [Streptococcus pneumoniae (18.8%, Haemophilus influenzae (18.8%, Mycoplasma pneumoniae (17.2%], molecular analysis of specimens from 64 patients with community-acquired pneumonia showed relatively higher rates of anaerobes (15.6% and oral bacteria (15.6% than previous reports. CONCLUSION: Our findings suggest that anaerobes and oral bacteria are more frequently detected in patients with community-acquired pneumonia than previously believed. It is possible that these bacteria may play more important roles in community-acquired pneumonia.

Molecular biological and immunohistological characterization of canine dermal papilla cells and the evaluation of culture conditions.

Science.gov (United States)

Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu

2011-10-01

The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

Laplacian manifold regularization method for fluorescence molecular tomography

Science.gov (United States)

He, Xuelei; Wang, Xiaodong; Yi, Huangjian; Chen, Yanrong; Zhang, Xu; Yu, Jingjing; He, Xiaowei

2017-04-01

Sparse regularization methods have been widely used in fluorescence molecular tomography (FMT) for stable three-dimensional reconstruction. Generally, ℓ1-regularization-based methods allow for utilizing the sparsity nature of the target distribution. However, in addition to sparsity, the spatial structure information should be exploited as well. A joint ℓ1 and Laplacian manifold regularization model is proposed to improve the reconstruction performance, and two algorithms (with and without Barzilai-Borwein strategy) are presented to solve the regularization model. Numerical studies and in vivo experiment demonstrate that the proposed Gradient projection-resolved Laplacian manifold regularization method for the joint model performed better than the comparative algorithm for ℓ1 minimization method in both spatial aggregation and location accuracy.

Culture-based and denaturing gradient gel electrophoresis analysis of the bacterial community from Chungkookjang, a traditional Korean fermented soybean food.

Science.gov (United States)

Hong, Sung Wook; Choi, Jae Young; Chung, Kun Sub

2012-10-01

The bacterial community of Chungkookjang and raw rice-straw collected from various areas in South Korea was investigated using both culture-dependent and culture-independent methods. Pure cultures were isolated from Chungkookjang and raw rice-straw on tryptic soy agar plates with 72 to 121 colonies and identified by 16S rDNA gene sequence analysis, respectively. The traditional culture-based method and denaturing gradient gel electrophoresis analysis of PCR-amplified 16S rDNA confirmed that Pantoea agglomerans and B. subtilis were identified as predominant in the raw rice-straw and Chungkookjang, respectively, from Iljuk district of Gyeonggi province, P. ananatis and B. licheniformis were identified as predominant in the raw rice-straw and Chungkookjang from Wonju district of Gangwon province, and Microbacterium sp. and B. licheniformis were identified as predominant in the raw rice-straw and Chungkookjang from Sunchang district of Jeolla province. Other strains, such as Bacillus, Enterococcus, Pseudomonas, Rhodococcus, and uncultured bacteria were also present in raw rice-straw and Chungkookjang. A comprehensive analysis of these microorganisms would provide a more detailed understanding of the biologically active components of Chungkookjang and help improve its quality. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis can be successfully applied to a fermented food to detect unculturable or more species than the culture-dependent method. This technique is an effective and convenient culture-independent method for studying the bacterial community in Chungkookjang. In this study, the bacterial community of Chungkookjang collected from various areas in South Korea was investigated using both culture-dependent and culture-independent methods. © 2012 Institute of Food Technologists®

THE EFFECTS OF THE ORGANIZATIONAL CULTURE ON DIVERSITY

Directory of Open Access Journals (Sweden)

Hakan Sezerel

2016-12-01

Full Text Available The success of diversity management practices relies on the combination of a series of variables properly. The relevant literature suggests that diversity management is highly depended on an adequate organizational culture. Thus, a research model that proposes that organizational culture has impact on diversity management perceptions of employees. There are two data sets in this research. The independent variable of the research is organizational culture and the dependent variable of the research is the level of diversity management perceptions. The research is adopted in quantitative method and the data collected via questionnaires. This research which is conducted in a hotel chain finds that the mission dimension of organizational culture impacts all three levels of diversity management.

Diagnostic performance of automated liquid culture and molecular line probe assay in smear-negative pulmonary tuberculosis.

Science.gov (United States)

Kotwal, Aarti; Biswas, Debasis; Raghuvanshi, Shailendra; Sindhwani, Girish; Kakati, Barnali; Sharma, Shweta

2017-04-01

The diagnosis of smear-negative pulmonary tuberculosis (PTB) is particularly challenging, and automated liquid culture and molecular line probe assays (LPA) may prove particularly useful. The objective of our study was to evaluate the diagnostic potential of automated liquid culture (ALC) technology and commercial LPA in sputum smear-negative PTB suspects. Spot sputum samples were collected from 145 chest-symptomatic smear-negative patients and subjected to ALC, direct drug susceptibility test (DST) testing and LPA, as per manufacturers' instructions. A diagnostic yield of 26.2% was observed among sputum smear-negative TB suspects with 47.4% of the culture isolates being either INH- and/or rifampicin-resistant. Complete agreement was observed between the results of ALC assay and LPA except for two isolates which demonstrated sensitivity to INH and rifampicin at direct DST but were rifampicin-resistant in LPA. Two novel mutations were also detected among the multidrug isolates by LPA. In view of the diagnostic challenges associated with the diagnosis of TB in sputum smear-negative patients, our study demonstrates the applicability of ALC and LPA in establishing diagnostic evidence of TB.

Segregation distortion in homozygous lines obtained via anther culture and maize doubled haploid methods in comparison to single seed descent in wheat (Triticum aestivum L.)

OpenAIRE

Adamski,Tadeusz; Krystkowiak,Karolina; Kuczynska,Anetta; Mikolajczak,Krzysztof; Ogrodowicz,Piotr; Ponitka,Aleksandra; Surma,Maria; Slusarkiewicz-Jarzina,Aurelia

2014-01-01

Background: The quality of wheat grain depends on several characteristics, among which the composition of high molecular weight glutenin subunits, encoded by Glu-1 loci, are the most important. Application of biotechnological tools to accelerate the attainment of homozygous lines may influence the proportion of segregated genotypes. The objective was to determine, whether the selection pressure generated by the methods based on in vitro cultures, may cause a loss of genotypes with desirable G...

Bacterial community structure associated with white band disease in the elkhorn coral Acropora palmata determined using culture-independent 16S rRNA techniques.

Science.gov (United States)

Pantos, Olga; Bythell, John C

2006-03-23

Culture-independent molecular (16S ribosomal RNA) techniques showed distinct differences in bacterial communities associated with white band disease (WBD) Type I and healthy elkhorn coral Acropora palmata. Differences were apparent at all levels, with a greater diversity present in tissues of diseased colonies. The bacterial community associated with remote, non-diseased coral was distinct from the apparently healthy tissues of infected corals several cm from the disease lesion. This demonstrates a whole-organism effect from what appears to be a localised disease lesion, an effect that has also been recently demonstrated in white plague-like disease in star coral Montastraea annularis. The pattern of bacterial community structure changes was similar to that recently demonstrated for white plague-like disease and black band disease. Some of the changes are likely to be explained by the colonisation of dead and degrading tissues by a micro-heterotroph community adapted to the decomposition of coral tissues. However, specific ribosomal types that are absent from healthy tissues appear consistently in all samples of each of the diseases. These ribotypes are closely related members of a group of alpha-proteobacteria that cause disease, notably juvenile oyster disease, in other marine organisms. It is clearly important that members of this group are isolated for challenge experiments to determine their role in the diseases.

A general SNP-based molecular barcode for Plasmodium falciparum identification and tracking

Directory of Open Access Journals (Sweden)

Rosen David

2008-10-01

Full Text Available Abstract Background Single nucleotide polymorphism (SNP genotyping provides the means to develop a practical, rapid, inexpensive assay that will uniquely identify any Plasmodium falciparum parasite using a small amount of DNA. Such an assay could be used to distinguish recrudescence from re-infection in drug trials, to monitor the frequency and distribution of specific parasites in a patient population undergoing drug treatment or vaccine challenge, or for tracking samples and determining purity of isolates in the laboratory during culture adaptation and sub-cloning, as well as routine passage. Methods A panel of twenty-four SNP markers has been identified that exhibit a high minor allele frequency (average MAF > 35%, for which robust TaqMan genotyping assays were constructed. All SNPs were identified through whole genome sequencing and MAF was estimated through Affymetrix array-based genotyping of a worldwide collection of parasites. These assays create a "molecular barcode" to uniquely identify a parasite genome. Results Using 24 such markers no two parasites known to be of independent origin have yet been found to have the same allele signature. The TaqMan genotyping assays can be performed on a variety of samples including cultured parasites, frozen whole blood, or whole blood spotted onto filter paper with a success rate > 99%. Less than 5 ng of parasite DNA is needed to complete a panel of 24 markers. The ability of this SNP panel to detect and identify parasites was compared to the standard molecular methods, MSP-1 and MSP-2 typing. Conclusion This work provides a facile field-deployable genotyping tool that can be used without special skills with standard lab equipment, and at reasonable cost that will unambiguously identify and track P. falciparum parasites both from patient samples and in the laboratory.

A discussion of molecular biology methods for protein engineering

CSIR Research Space (South Africa)

Zawaira, A

2011-09-01

Full Text Available A number of molecular biology techniques are available to generate variants from a particular start gene for eventual protein expression. The authors discuss the basic principles of these methods in a repertoire that may be used to achieve...

Molecular tools for bathing water assessment in Europe: Balancing social science research with a rapidly developing environmental science evidence-base.

Science.gov (United States)

Oliver, David M; Hanley, Nick D; van Niekerk, Melanie; Kay, David; Heathwaite, A Louise; Rabinovici, Sharyl J M; Kinzelman, Julie L; Fleming, Lora E; Porter, Jonathan; Shaikh, Sabina; Fish, Rob; Chilton, Sue; Hewitt, Julie; Connolly, Elaine; Cummins, Andy; Glenk, Klaus; McPhail, Calum; McRory, Eric; McVittie, Alistair; Giles, Amanna; Roberts, Suzanne; Simpson, Katherine; Tinch, Dugald; Thairs, Ted; Avery, Lisa M; Vinten, Andy J A; Watts, Bill D; Quilliam, Richard S

2016-02-01

The use of molecular tools, principally qPCR, versus traditional culture-based methods for quantifying microbial parameters (e.g., Fecal Indicator Organisms) in bathing waters generates considerable ongoing debate at the science-policy interface. Advances in science have allowed the development and application of molecular biological methods for rapid (~2 h) quantification of microbial pollution in bathing and recreational waters. In contrast, culture-based methods can take between 18 and 96 h for sample processing. Thus, molecular tools offer an opportunity to provide a more meaningful statement of microbial risk to water-users by providing near-real-time information enabling potentially more informed decision-making with regard to water-based activities. However, complementary studies concerning the potential costs and benefits of adopting rapid methods as a regulatory tool are in short supply. We report on findings from an international Working Group that examined the breadth of social impacts, challenges, and research opportunities associated with the application of molecular tools to bathing water regulations.

Oxygen diffusion pathways in a cofactor-independent dioxygenase

Science.gov (United States)

Di Russo, Natali V.; Condurso, Heather L.; Li, Kunhua; Bruner, Steven D.; Roitberg, Adrian E.

2015-01-01

Molecular oxygen plays an important role in a wide variety of enzymatic reactions. Through recent research efforts combining computational and experimental methods a new view of O2 diffusion is emerging, where specific channels guide O2 to the active site. The focus of this work is DpgC, a cofactor-independent oxygenase. Molecular dynamics simulations, together with mutagenesis experiments and xenon-binding data, reveal that O2 reaches the active site of this enzyme using three main pathways and four different access points. These pathways connect a series of dynamic hydrophobic pockets, concentrating O2 at a specific face of the enzyme substrate. Extensive molecular dynamics simulations provide information about which pathways are more frequently used. This data is consistent with the results of kinetic measurements on mutants and is difficult to obtain using computational cavity-location methods. Taken together, our results reveal that although DpgC is rare in its ability of activating O2 in the absence of cofactors or metals, the way O2 reaches the active site is similar to that reported for other O2-using proteins: multiple access channels are available, and the architecture of the pathway network can provide regio- and stereoselectivity. Our results point to the existence of common themes in O2 access that are conserved among very different types of proteins. PMID:26508997

Reproducibility of CSF quantitative culture methods for estimating rate of clearance in cryptococcal meningitis.

Science.gov (United States)

Dyal, Jonathan; Akampurira, Andrew; Rhein, Joshua; Morawski, Bozena M; Kiggundu, Reuben; Nabeta, Henry W; Musubire, Abdu K; Bahr, Nathan C; Williams, Darlisha A; Bicanic, Tihana; Larsen, Robert A; Meya, David B; Boulware, David R

2016-05-01

Quantitative cerebrospinal fluid (CSF) cultures provide a measure of disease severity in cryptococcal meningitis. The fungal clearance rate by quantitative cultures has become a primary endpoint for phase II clinical trials. This study determined the inter-assay accuracy of three different quantitative culture methodologies. Among 91 participants with meningitis symptoms in Kampala, Uganda, during August-November 2013, 305 CSF samples were prospectively collected from patients at multiple time points during treatment. Samples were simultaneously cultured by three methods: (1) St. George's 100 mcl input volume of CSF with five 1:10 serial dilutions, (2) AIDS Clinical Trials Group (ACTG) method using 1000, 100, 10 mcl input volumes, and two 1:100 dilutions with 100 and 10 mcl input volume per dilution on seven agar plates; and (3) 10 mcl calibrated loop of undiluted and 1:100 diluted CSF (loop). Quantitative culture values did not statistically differ between St. George-ACTG methods (P= .09) but did for St. George-10 mcl loop (Pmethods was high (r≥0.88). For detecting sterility, the ACTG-method had the highest negative predictive value of 97% (91% St. George, 60% loop), but the ACTG-method had occasional (∼10%) difficulties in quantification due to colony clumping. For CSF clearance rate, St. George-ACTG methods did not differ overall (mean -0.05 ± 0.07 log10CFU/ml/day;P= .14) on a group level; however, individual-level clearance varied. The St. George and ACTG quantitative CSF culture methods produced comparable but not identical results. Quantitative cultures can inform treatment management strategies. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Differential amplicons (ΔAmp)-a new molecular method to assess RNA integrity.

Science.gov (United States)

Björkman, J; Švec, D; Lott, E; Kubista, M; Sjöback, R

2016-01-01

Integrity of the mRNA in clinical samples has major impact on the quality of measured expression levels. This is independent of the measurement technique being next generation sequencing (NGS), Quantitative real-time PCR (qPCR) or microarray profiling. If mRNA is highly degraded or damaged, measured data will be very unreliable and the whole study is likely a waste of time and money. It is therefore common strategy to test the quality of RNA in samples before conducting large and costly studies. Most methods today to assess the quality of RNA are ignorant to the nature of the RNA and, therefore, reflect the integrity of ribosomal RNA, which is the dominant species, rather than of mRNAs, microRNAs and long non-coding RNAs, which usually are the species of interest. Here, we present a novel molecular approach to assess the quality of the targeted RNA species by measuring the differential amplification (ΔAmp) of an Endogenous RNase Resistant (ERR) marker relative to a reference gene, optionally combined with the measurement of two amplicons of different lengths. The combination reveals any mRNA degradation caused by ribonucleases as well as physical, chemical or UV damage. ΔAmp has superior sensitivity to common microfluidic electrophoretic methods, senses the integrity of the actual targeted RNA species, and allows for a smoother and more cost efficient workflow.

Differential amplicons (ΔAmp—a new molecular method to assess RNA integrity

Directory of Open Access Journals (Sweden)

J. Björkman

2016-01-01

Full Text Available Integrity of the mRNA in clinical samples has major impact on the quality of measured expression levels. This is independent of the measurement technique being next generation sequencing (NGS, Quantitative real-time PCR (qPCR or microarray profiling. If mRNA is highly degraded or damaged, measured data will be very unreliable and the whole study is likely a waste of time and money. It is therefore common strategy to test the quality of RNA in samples before conducting large and costly studies. Most methods today to assess the quality of RNA are ignorant to the nature of the RNA and, therefore, reflect the integrity of ribosomal RNA, which is the dominant species, rather than of mRNAs, microRNAs and long non-coding RNAs, which usually are the species of interest. Here, we present a novel molecular approach to assess the quality of the targeted RNA species by measuring the differential amplification (ΔAmp of an Endogenous RNase Resistant (ERR marker relative to a reference gene, optionally combined with the measurement of two amplicons of different lengths. The combination reveals any mRNA degradation caused by ribonucleases as well as physical, chemical or UV damage. ΔAmp has superior sensitivity to common microfluidic electrophoretic methods, senses the integrity of the actual targeted RNA species, and allows for a smoother and more cost efficient workflow.

A fluorescence anisotropy method for measuring protein concentration in complex cell culture media.

Science.gov (United States)

Groza, Radu Constantin; Calvet, Amandine; Ryder, Alan G

2014-04-22

The rapid, quantitative analysis of the complex cell culture media used in biopharmaceutical manufacturing is of critical importance. Requirements for cell culture media composition profiling, or changes in specific analyte concentrations (e.g. amino acids in the media or product protein in the bioprocess broth) often necessitate the use of complicated analytical methods and extensive sample handling. Rapid spectroscopic methods like multi-dimensional fluorescence (MDF) spectroscopy have been successfully applied for the routine determination of compositional changes in cell culture media and bioprocess broths. Quantifying macromolecules in cell culture media is a specific challenge as there is a need to implement measurements rapidly on the prepared media. However, the use of standard fluorescence spectroscopy is complicated by the emission overlap from many media components. Here, we demonstrate how combining anisotropy measurements with standard total synchronous fluorescence spectroscopy (TSFS) provides a rapid, accurate quantitation method for cell culture media. Anisotropy provides emission resolution between large and small fluorophores while TSFS provides a robust measurement space. Model cell culture media was prepared using yeastolate (2.5 mg mL(-1)) spiked with bovine serum albumin (0 to 5 mg mL(-1)). Using this method, protein emission is clearly discriminated from background yeastolate emission, allowing for accurate bovine serum albumin (BSA) quantification over a 0.1 to 4.0 mg mL(-1) range with a limit of detection (LOD) of 13.8 μg mL(-1). Copyright © 2014. Published by Elsevier B.V.

Preservation of live cultures of basidiomycetes - recent methods.

Science.gov (United States)

Homolka, Ladislav

2014-02-01

Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Molecular detection of Borrelia burgdorferi sensu lato

DEFF Research Database (Denmark)

Lager, Malin; Faller, Maximilian; Wilhelmsson, Peter

2017-01-01

the protocols using 16S rRNA as the target gene, however, this concordance was mainly related to cDNA as the type of template. When comparing cDNA and DNA as the type of template the analytical sensitivity was in general higher for the protocols using DNA as template regardless of the use of target gene...... molecular detection by polymerase chain reaction (PCR) may serve as a complement. Aim: The purpose of this study was to evaluate the analytical sensitivity, analytical specificity and concordance of eight different real-time PCR methods at five laboratories in Sweden, Norway and Denmark. Method: Each...... participating laboratory was asked to analyse three different sets of samples (reference panels; all blinded) i) cDNA extracted and transcribed from water spiked with cultured Borrelia strains, ii) cerebrospinal fluid spiked with cultured Borrelia strains, and iii) DNA dilution series extracted from cultured...

Molecular and functional analysis of anchorage independent, treatment-evasive neuroblastoma tumorspheres with enhanced malignant properties: A possible explanation for radio-therapy resistance.

Science.gov (United States)

Abou-Antoun, Tamara J; Nazarian, Javad; Ghanem, Anthony; Vukmanovic, Stanislav; Sandler, Anthony D

2018-01-01

Despite significant advances in cancer treatment and management, more than 60% of patients with neuroblastoma present with very poor prognosis in the form of metastatic and aggressive disease. Solid tumors including neuroblastoma are thought to be heterogeneous with a sub-population of stem-like cells that are treatment-evasive with highly malignant characteristics. We previously identified a phenomenon of reversible adaptive plasticity (RAP) between anchorage dependent (AD) cells and anchorage independent (AI) tumorspheres in neuroblastoma cell cultures. To expand our molecular characterization of the AI tumorspheres, we sought to define the comprehensive proteomic profile of murine AD and AI neuroblastoma cells. The proteomic profiles of the two phenotypic cell populations were compared to each other to determine the differential protein expression and molecular pathways of interest. We report exclusive or significant up-regulation of tumorigenic pathways expressed by the AI tumorspheres compared to the AD cancer cells. These pathways govern metastatic potential, enhanced malignancy and epithelial to mesenchymal transition. Furthermore, radio-therapy induced significant up-regulation of specific tumorigenic and proliferative proteins, namely survivin, CDC2 and the enzyme Poly [ADP-ribose] polymerase 1. Bio-functional characteristics of the AI tumorspheres were resistant to sutent inhibition of receptor tyrosine kinases (RTKs) as well as to 2.5 Gy radio-therapy as assessed by cell survival, proliferation, apoptosis and migration. Interestingly, PDGF-BB stimulation of the PDGFRβ led to transactivation of EGFR and VEGFR in AI tumorspheres more potently than in AD cells. Sutent inhibition of PDGFRβ abrogated this transactivation in both cell types. In addition, 48 h sutent treatment significantly down-regulated the protein expression of PDGFRβ, MYCN, SOX2 and Survivin in the AI tumorspheres and inhibited tumorsphere self-renewal. Radio-sensitivity in AI

Time-independent lattice Boltzmann method calculation of hydrodynamic interactions between two particles

Science.gov (United States)

Ding, E. J.

2015-06-01

The time-independent lattice Boltzmann algorithm (TILBA) is developed to calculate the hydrodynamic interactions between two particles in a Stokes flow. The TILBA is distinguished from the traditional lattice Boltzmann method in that a background matrix (BGM) is generated prior to the calculation. The BGM, once prepared, can be reused for calculations for different scenarios, and the computational cost for each such calculation will be significantly reduced. The advantage of the TILBA is that it is easy to code and can be applied to any particle shape without complicated implementation, and the computational cost is independent of the shape of the particle. The TILBA is validated and shown to be accurate by comparing calculation results obtained from the TILBA to analytical or numerical solutions for certain problems.

Simple method for culture of peripheral blood lymphocytes of Testudinidae.

Science.gov (United States)

Silva, T L; Silva, M I A; Venancio, L P R; Zago, C E S; Moscheta, V A G; Lima, A V B; Vizotto, L D; Santos, J R; Bonini-Domingos, C R; Azeredo-Oliveira, M T V

2011-12-06

We developed and optimized a simple, efficient and inexpensive method for in vitro culture of peripheral blood lymphocytes from the Brazilian tortoise Chelonoidis carbonaria (Testudinidae), testing various parameters, including culture medium, mitogen concentration, mitotic index, culture volume, incubation time, and mitotic arrest. Peripheral blood samples were obtained from the costal vein of four couples. The conditions that gave a good mitotic index were lymphocytes cultured at 37°C in minimum essential medium (7.5 mL), with phytohemagglutinin as a mitogen (0.375 mL), plus streptomycin/penicillin (0.1 mL), and an incubation period of 72 h. Mitotic arrest was induced by 2-h exposure to colchicine (0.1 mL), 70 h after establishing the culture. After mitotic arrest, the cells were hypotonized with 0.075 M KCl for 2 h and fixed with methanol/acetic acid (3:1). The non-banded mitotic chromosomes were visualized by Giemsa staining. The diploid chromosome number of C. carbonaria was found to be 52 in females and males, and sex chromosomes were not observed. We were able to culture peripheral blood lymphocytes of a Brazilian tortoise in vitro, for the preparation of mitotic chromosomes.

A 3D multi-mode geometry-independent RMP optimization method and its application to TCV

International Nuclear Information System (INIS)

Rossel, J X; Moret, J-M; Martin, Y

2010-01-01

Resonant magnetic perturbation (RMP) and error field correction (EFC) produced by toroidally and poloidally distributed coil systems can be optimized if each coil is powered with an independent power supply. A 3D multi-mode geometry-independent Lagrange method has been developed and appears to be an efficient way to minimize the parasitic spatial modes of the magnetic perturbation and the coil current requirements while imposing the amplitude and phase of a number of target modes. A figure of merit measuring the quality of a perturbation spectrum with respect to RMP independently of the considered coil system or plasma equilibrium is proposed. To ease the application of the Lagrange method, a spectral characterization of the system, based on a generalized discrete Fourier transform applied in current space, is performed to determine how spectral degeneracy and side-band creation limit the set of simultaneously controllable target modes. This characterization is also useful to quantify the efficiency of the coil system in each toroidal mode number and to know whether optimization is possible for a given number of target modes. The efficiency of the method is demonstrated in the special case of a multi-purpose saddle coil system proposed as part of a future upgrade of Tokamak a Configuration Variable (TCV). This system consists of three rows of eight internal coils, each coil having independent power supplies, and provides simultaneously EFC, RMP and fast vertical position control.

Design of a tablet computer app for facilitation of a molecular blood culture test in clinical microbiology and preliminary usability evaluation

DEFF Research Database (Denmark)

Samson, Lasse L.; Pape-Haugaard, Louise; Meltzer, Michelle C.

2016-01-01

through specialized applications (apps) while supporting the mobility of the users. The use of apps for mobile phones and tablet computers may support workflow of complex tasks, for example, molecular-based diagnostic tests in clinical microbiology. Multiplex Blood Culture Test (MuxBCT) is a molecular......-based diagnostic test used for rapid identification of pathogens in positive blood cultures. To facilitate the workflow of the MuxBCT, a specialized tablet computer app was developed as an accessory to the diagnostic test. The app aims to reduce the complexity of the test by step-by-step guidance of microscopy...... and to assist users in reaching an exact bacterial or fungal diagnosis based on blood specimen observations and controls. Additionally, the app allows for entry of test results, and communication thereof to the laboratory information system (LIS). OBJECTIVE: The objective of the study was to describe the design...

Molecular and Culture-Based Bronchoalveolar Lavage Fluid Testing for the Diagnosis of Cytomegalovirus Pneumonitis.

Science.gov (United States)

Tan, Susanna K; Burgener, Elizabeth B; Waggoner, Jesse J; Gajurel, Kiran; Gonzalez, Sarah; Chen, Sharon F; Pinsky, Benjamin A

2016-01-01

Background.  Cytomegalovirus (CMV) is a major cause of morbidity and mortality in immunocompromised patients, with CMV pneumonitis among the most severe manifestations of infection. Although bronchoalveolar lavage (BAL) samples are frequently tested for CMV, the clinical utility of such testing remains uncertain. Methods.  Retrospective analysis of adult patients undergoing BAL testing via CMV polymerase chain reaction (PCR), shell vial culture, and conventional viral culture between August 2008 and May 2011 was performed. Cytomegalovirus diagnostic methods were compared with a comprehensive definition of CMV pneumonitis that takes into account signs and symptoms, underlying host immunodeficiency, radiographic findings, and laboratory results. Results.  Seven hundred five patients underwent 1077 bronchoscopy episodes with 1090 BAL specimens sent for CMV testing. Cytomegalovirus-positive patients were more likely to be hematopoietic cell transplant recipients (26% vs 8%, P definition, the sensitivity and specificity of PCR, shell vial culture, and conventional culture were 91.3% and 94.6%, 54.4% and 97.4%, and 28.3% and 96.5%, respectively. Compared with culture, PCR provided significantly higher sensitivity and negative predictive value (P ≤ .001), without significantly lower positive predictive value. Cytomegalovirus quantitation did not improve test performance, resulting in a receiver operating characteristic curve with an area under the curve of 0.53. Conclusions.  Cytomegalovirus PCR combined with a comprehensive clinical definition provides a pragmatic approach for the diagnosis of CMV pneumonitis.

Petascale molecular dynamics simulation using the fast multipole method on K computer

KAUST Repository

Ohno, Yousuke; Yokota, Rio; Koyama, Hiroshi; Morimoto, Gentaro; Hasegawa, Aki; Masumoto, Gen; Okimoto, Noriaki; Hirano, Yoshinori; Ibeid, Huda; Narumi, Tetsu; Taiji, Makoto

2014-01-01

In this paper, we report all-atom simulations of molecular crowding - a result from the full node simulation on the "K computer", which is a 10-PFLOPS supercomputer in Japan. The capability of this machine enables us to perform simulation of crowded cellular environments, which are more realistic compared to conventional MD simulations where proteins are simulated in isolation. Living cells are "crowded" because macromolecules comprise ∼30% of their molecular weight. Recently, the effects of crowded cellular environments on protein stability have been revealed through in-cell NMR spectroscopy. To measure the performance of the "K computer", we performed all-atom classical molecular dynamics simulations of two systems: target proteins in a solvent, and target proteins in an environment of molecular crowders that mimic the conditions of a living cell. Using the full system, we achieved 4.4 PFLOPS during a 520 million-atom simulation with cutoff of 28 Å. Furthermore, we discuss the performance and scaling of fast multipole methods for molecular dynamics simulations on the "K computer", as well as comparisons with Ewald summation methods. © 2014 Elsevier B.V. All rights reserved.

Petascale molecular dynamics simulation using the fast multipole method on K computer

KAUST Repository

Ohno, Yousuke

2014-10-01

In this paper, we report all-atom simulations of molecular crowding - a result from the full node simulation on the "K computer", which is a 10-PFLOPS supercomputer in Japan. The capability of this machine enables us to perform simulation of crowded cellular environments, which are more realistic compared to conventional MD simulations where proteins are simulated in isolation. Living cells are "crowded" because macromolecules comprise ∼30% of their molecular weight. Recently, the effects of crowded cellular environments on protein stability have been revealed through in-cell NMR spectroscopy. To measure the performance of the "K computer", we performed all-atom classical molecular dynamics simulations of two systems: target proteins in a solvent, and target proteins in an environment of molecular crowders that mimic the conditions of a living cell. Using the full system, we achieved 4.4 PFLOPS during a 520 million-atom simulation with cutoff of 28 Å. Furthermore, we discuss the performance and scaling of fast multipole methods for molecular dynamics simulations on the "K computer", as well as comparisons with Ewald summation methods. © 2014 Elsevier B.V. All rights reserved.

Individualism-Collectivism and Power Distance Cultural Dimensions: How Each Influences Parental Disciplinary Methods

Science.gov (United States)

Schwab, Karen Walker

2013-01-01

This paper is a literature review using the Douglas-Widavasky Grid/Group theory as a framework to examine, from a cross cultural perspective, preferred parental disciplinary methods. The four rival cultures defined in the Grid/Group theory mirror the cultural dimensions of individualism-collectivism and power distance described by Geert Hofstede.…

Molecular Diagnosis of Tuberculosis.

Science.gov (United States)

Nurwidya, Fariz; Handayani, Diah; Burhan, Erlina; Yunus, Faisal

2018-01-01

Tuberculosis (TB) is one of the leading causes of adult death in the Asia-Pacific Region, including Indonesia. As an infectious disease caused by Mycobacterium tuberculosis (MTB), TB remains a major public health issue especially in developing nations due to the lack of adequate diagnostic testing facilities. Diagnosis of TB has entered an era of molecular detection that provides faster and more cost-effective methods to diagnose and confirm drug resistance in TB cases, meanwhile, diagnosis by conventional culture systems requires several weeks. New advances in the molecular detection of TB, including the faster and simpler nucleic acid amplification test (NAAT) and whole-genome sequencing (WGS), have resulted in a shorter time for diagnosis and, therefore, faster TB treatments. In this review, we explored the current findings on molecular diagnosis of TB and drug-resistant TB to see how this advancement could be integrated into public health systems in order to control TB.

Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods.

Science.gov (United States)

Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek

2014-03-07

The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species

Identification of Mucorales isolates from soil using morphological and molecular methods.

Science.gov (United States)

Ziaee, A; Zia, M; Bayat, M; Hashemi, J

2016-03-01

Soil is the main habitat of saprophytic and pathogenic fungi. Mucoromycotina constitutes a large group of soil fungi, with certain opportunistic members causing systemic infections in immunocompromised hosts. The majority of human and animal infections are caused by the members of the genera Rhizopus , Mucor , Rhizomucor , Lichtheimia ( Absidia) , Cunninghamella, and Mortierella . Accordingly, in the present study, we aimed to isolate and identify the main genera of the order Mucorales, using molecular assays and morphological features . In total, 340 soil samples were collected from seven public parks throughout the city and sidewalk gardens in 14 municipal districts in Isfahan, Iran. All the samples were cultured on the appropriate media, incubated at 27°C for 2- 4 days, and examined daily for visible fungal growth. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was applied and macroscopic, microscopic, and physiological characteristics were assessed to identify fungal colonies. 400 pure colonies, belonging to the orders Mucorales and Mortierellales, including the genera Lichtheimia , Rhizopus, Rhizomucor, Mucor, Cunninghamella, and Mortierella, were identified . The genus Rhizopus (35.5%) was the most frequent isolate, followed by Mucor (32.25%) and Rhizomucor (27.5%). The results emphasize the importance of opportunistic fungi in public areas and indicate the risk of exposure for immunocompromised individuals.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Directory of Open Access Journals (Sweden)

J.A. Khan

2013-09-01

Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

Current and future molecular diagnostics for ocular infectious diseases.

Science.gov (United States)

Doan, Thuy; Pinsky, Benjamin A

2016-11-01

Confirmation of ocular infections can pose great challenges to the clinician. A fundamental limitation is the small amounts of specimen that can be obtained from the eye. Molecular diagnostics can circumvent this limitation and have been shown to be more sensitive than conventional culture. The purpose of this review is to describe new molecular methods and to discuss the applications of next-generation sequencing-based approaches in the diagnosis of ocular infections. Efforts have focused on improving the sensitivity of pathogen detection using molecular methods. This review describes a new molecular target for Toxoplasma gondii-directed polymerase chain reaction assays. Molecular diagnostics for Chlamydia trachomatis and Acanthamoeba species are also discussed. Finally, we describe a hypothesis-free approach, metagenomic deep sequencing, which can detect DNA and RNA pathogens from a single specimen in one test. In some cases, this method can provide the geographic location and timing of the infection. Pathogen-directed PCRs have been powerful tools in the diagnosis of ocular infections for over 20 years. The use of next-generation sequencing-based approaches, when available, will further improve sensitivity of detection with the potential to improve patient care.

Choice of Appropriate Multimedia Technology and Teaching Methods for Different Culture Groups

Science.gov (United States)

Taratoukhina, Julia

2014-01-01

This paper describes the prerequisites for development in the area of cross-cultural multimedia didactics. This approach is based on research studies of differences between mentalities, ways of working with educational information, culturally-specific teaching methods and teaching techniques that determine differentiated approaches to the choice…

Dispatch Method for Independently Owned Hydropower Plants in the Same River Flow

Directory of Open Access Journals (Sweden)

Slavko Krajcar

2012-09-01

Full Text Available This paper proposes a coexistence model for two independent companies both operating hydropower plants in the same river flow, based on a case study of the Cetina river basin in Croatia. Companies are participants of the day-ahead electricity market. The incumbent company owns the existing hydropower plants and holds concessions for the water. The new company decides to build a pump storage hydropower plant that uses one of the existing reservoirs as its lower reservoir. Meeting reservoir water balance is affected by decisions by both companies which are independently seeking maximal profit. Methods for water use settlement and preventing of spillage are proposed. A mixed-integer linear programming approach is used. Head effects on output power levels are also considered. Existences of dispatches that satisfy both companies are shown.

Colonization of the Tongue Surface in Japanese Independent Elders: A Preliminary Study

Directory of Open Access Journals (Sweden)

Tomohisa Ohno

2017-09-01

Full Text Available Oral care is important to decrease oral bacteria, especially in the dependent elders. There have been some reports on oral microflora in the dependent elders. However, investigations involving healthy independent elders are limited. The purpose of this study was to obtain more information on the microflora in Japanese independent elders. One hundred Japanese independent elders aged 65 years or older participated in this study. Eighty-one independent elders (male: 44, female: 37, mean age: 72.7 ± 5.8 participated in this study. Their mean Barthel Index was 99.1 ± 3.1, and mean score of MMSE was 28.0 ± 2.3. The tongue bacterial flora was examinved to identify microorganisms by the culture method. The predominant aerobic organisms were Streptococcus spp. (detection rate: 100%, Neisseria spp. (96%, and Corynebacterium spp. (56%. Candida spp. was also isolated (32%. In this study, the oral microflora of the tongue in Japanese independent elders was clarified. The results of this investigation may contribute to research on oral bacteria in elder persons in the future.