WorldWideScience

Sample records for cultivated mushroom pleurotus

  1. Cultivation of Pleurotus ostreatus and other edible mushrooms.

    Science.gov (United States)

    Sánchez, Carmen

    2010-02-01

    Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

  2. Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

    African Journals Online (AJOL)

    An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

  3. Evaluation of biomass of some invasive weed species as substrate for oyster mushroom (Pleurotus spp.) cultivation.

    Science.gov (United States)

    Mintesnot, Birara; Ayalew, Amare; Kebede, Ameha

    2014-01-15

    This study assessed the bioconversion of Agriculture wastes like invasive weeds species (Lantana camara, Prosopis juliflora, Parthenium hysterophorus) as a substrate for oyster mushroom (Pleurotus species) cultivation together with wheat straw as a control. The experiment was laid out in factorial combination of substrates and three edible oyster mushroom species in a Completely Randomized Design (CRD) with three replications. Pleurotus ostreatus gave significantly (p mushroom cultivation could contribute to alleviating ecological impact of invasive weed species while offering practical option to mitigating hunger and malnutrition in areas where the invasive weeds became dominant.

  4. DNA marking of some quantitative trait loci in the cultivated edible mushroom Pleurotus ostreatus (Fr.) Kumm

    NARCIS (Netherlands)

    Sivolapova, A.B.; Shnyreva, A.V.; Sonnenberg, A.S.M.; Baars, J.J.P.

    2012-01-01

    Fungi of the genus Pleurotus, in particular, species Pleurotus ostreatus (common oyster mushroom) are among most cultivated fungi in the world. Due to intense rates of development of studies in this field, efficient breeding programs are highly required in the search for new P. ostreatus strains.

  5. Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

    Science.gov (United States)

    Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

    2010-10-01

    Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

  6. Comparison of mushroom yield for Pleurotus Sajor Caju and Pleurotus Florida in different number of flushes

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Meswan Maskom

    2006-01-01

    This paper aimed at comparing the mushroom yield of Pleurotus sajor caju and Pleurotus florida which was harvested in five flushes. The γ-irradiated empty fruit bunch (EFB) at 25kGy was used as cultivation substrate. About 1 to 2% liquid seed of P. sajor caju and P. florida was inoculated into cultivation substrate. After 30 days, the inoculated substrate was opened for fruiting. For both species, the maximum mushroom yield was obtained in first flush and the lowest yield from the fifth flush. This show the mushroom yield is affected by number of flush. From analysis, the mushroom yield of P. florida was much better compared to P. sajor caju for all flushes. (Author)

  7. Cultivation Techniques and Medicinal Properties of Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Andrej Gregori

    2007-01-01

    Full Text Available The genus Pleurotus (oyster mushroom comprises some most popular edible mushrooms due to their favourable organoleptic and medicinal properties, vigorous growth and undemanding cultivation conditions. It can be cultivated on log and a wide variety of agroforestry (by-products, weeds and wastes for the production of food, feed, enzymes and medicinal compounds, or for waste degradation and detoxification. Many different techniques and substrates have been successfully utilized for mushroom cultivation and biomass production by means of solid-state and submerged liquid fermentation. However, in contrast to submerged liquid fermentation, solid-state fermentation is not often used in large scale due to severe engineering problems. Various Pleurotus species have been shown to possess a number of medicinal properties, such as antitumour, immunomodulatory, antigenotoxic, antioxidant, anti-inflammatory, hypocholesterolaemic, antihypertensive, antiplatelet-aggregating, antihyperglycaemic, antimicrobial and antiviral activities. These therapeutic activities are exhibited by extracts or isolated compounds from Pleurotus spp. fermentation broth, mycelia and fruiting bodies. In particular, polysaccharides appear to be potent antitumour and immuno-enhancing substances, besides possessing other beneficial activities. However, the biochemical mechanisms of these therapeutic activities still remain largely unknown. This review focuses on recent advances in the biotechnology of Pleurotus spp., with emphasis on the production of fruiting bodies, the production of mycelium and bioactive compounds by solid-state and submerged liquid fermentation. The medicinal properties of this mushroom are also outlined.

  8. Diseases and pests noxious to Pleurotus spp. mushroom crops.

    Science.gov (United States)

    Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

    The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Maize Residue as a Viable Substrate for Farm Scale Cultivation of Oyster Mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Abena O. Adjapong

    2015-01-01

    Full Text Available In the search for alternatives to sawdust as growing media in commercial mushroom cultivation, three organic substrates obtainable as crop residue, maize husk, maize cob, and maize stalk, with each being supplemented with rice bran, were evaluated as growth media for the oyster mushroom, Pleurotus ostreatus (Kummer. For the tested alternatives to sawdust, the harvested weight of fruiting bodies that sprouted on a kilogram maize husk media per crop (32.99 g was the highest. Sawdust media supported significantly (P<0.001 heavier fruiting bodies (42.18 than the maize residues. The peak mushroom harvests for the various substrates were obtained between the first and seventh fruiting body flushes. The biological efficiency of the substrates, which measured usable nutrients indicated that maize stalk supplemented with rice bran, was 39% compared to that of the sawdust media (60%. The maize husk media and the maize cob media had biological efficiencies of 32% and 9.5%, respectively. These results indicate that two of the tested growing media (maize stalk or husk produced mushrooms with yield characteristics that were comparable to the well-used sawdust in the cultivation of oyster mushrooms. The environmental and economic parameters involved in the use and carting of sawdust make these on-farm crop residues a viable alternative for mushroom cultivation in especially nonforest zones of Ghana.

  10. Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...

    African Journals Online (AJOL)

    Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...

  11. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  12. Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

    Directory of Open Access Journals (Sweden)

    Petcharat, V. and

    2004-09-01

    Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

  13. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

    OpenAIRE

    Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

    2015-01-01

    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  14. Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

    Science.gov (United States)

    Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

    2018-04-20

    Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  15. An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

    Science.gov (United States)

    Panjikkaran, Seeja Thomachan; Mathew, Deepu

    2013-03-15

    The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

  16. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Nam Wai Lun

    2017-01-01

    Full Text Available Microwave vacuum pyrolysis of waste palm shell (WPS was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus. The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g and a low moisture content (≤ 10 wt%, exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days and the highest yield of Oyster mushroom (550 g was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  17. Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

    Science.gov (United States)

    Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

    2017-11-01

    Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

  18. Researches on Pleurotus ostreatus mushroom’s quality cultivated on coffee grounds

    Directory of Open Access Journals (Sweden)

    Sorina Ropciuc

    2016-10-01

    Full Text Available The objectives of this work were to evaluate the possibility of using coffee grounds for cultivating Pleurotus ostreatus mushrooms and determine the nutritional composition of Pleurotus ostreatus mushrooms produced on coffee grounds substrate. The results revealed a good fruiting of the fungus on coffee grounds and the biological effectiveness (weight of fresh mushroom reached about 97% after 30 days. We determined the total protein content in vitamin C, the total polyphenols and the activity of Polyphenol oxidases (PPOs enzyme on 32 samples of fresh Pleurotus ostreatus mushroom (top and bottom and subjected to heat treatments (blanching, boiling and freezing. The protein content was ranged between the values of 16.9 and 25.1g/ 100g and the Vitamin C content within the range of values presented 64.32-564.95 mg/100g. The polyphenol content results varied significantly in the analyzed samples varying between 1.887 – 7.667 mg GAE / 100 g vegetable product. The determination of the polyphenol oxidase enzyme responsible for enzymatically blackening of the fungus presented values in the range 0.274- 0.610mg / 100g.

  19. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity

    Czech Academy of Sciences Publication Activity Database

    Synytsya, Andriy.; Míčková, K.; Synytsya, A.; Jablonský, I.; Spěváček, Jiří; Erban, V.; Kováříková, E.; Čopíková, J.

    2009-01-01

    Roč. 76, č. 4 (2009), s. 548-556 ISSN 0144-8617 R&D Projects: GA ČR GA525/05/0273 Institutional research plan: CEZ:AV0Z40500505 Keywords : glucans * oyster mushroom Pleurotus * isolation Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.167, year: 2009

  20. Optimization of King Oyster Mushroom (Pleurotus eryngii Substrate Using Lignocellulosic Affordable Wastes

    Directory of Open Access Journals (Sweden)

    javad janpoor

    2018-03-01

    Full Text Available Introduction: King oyster mushroom (Pleurotus eryngii belongs to Basidiomycota division, Agaricomycetes class and Pleurotaceae family. This mushroom generally grows on wood wastes of Apiaceae family. The Pleurotus eryngii is found in pastures, meadows, gardens and seldom in grassy forest clearings and hilly areas. The Pleurotus of the Umbellifers occupy an area in the Northern hemisphere between the 30 and 50º N. These species are mainly found in the subtropical regions of the Mediterranean, Central Europe, Russia, Ukraine, Central Asia and Iran. The P. eryngii sensulato is the only taxon within the genus, which grows in association with plants. P. eryngii has distinguishable characteristics such as coherent texture, unique form, favorable taste and high durability. Mushroom cultivation represents the only current economically viable biotechnology process for the conversion of waste plant residues from forests and agriculture. The species of these genera show much diversity in their adaptation the varying agro-climatic condition which makes more cultivated species than other mushrooms. Special ability of Pleurotus family is growing in lingocellulosic plant or agricultural wastes without needing to prepared compost and casing soil. Pleurotus is an efficient lignin- degrading mushroom and can grow and yield well on different types of lignocellulolosic materials. Type of substrates for mushroom growing depends on available plant or agricultural wastes. In Europe, wheat straw is used for mushroom growing; whereas in Asian South-East countries sawdust is more popular. Different materials for cultivating of P. eryngii have been suggested in different regions of the world; but a few studies have been done on suitability of various lignocellulosic affordable wastes for P. eryngii production in Iran. Therefore, the current study aims to evaluate effects of various locally available agro wastes on the growth characteristics of King oyster mushroom (P

  1. Electrical stimulation in white oyster mushroom (Pleurotus florida) production

    Science.gov (United States)

    Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

    2017-09-01

    White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

  2. The fungistatic activity of organic selenium and its application to the production of cultivated mushrooms Agaricus bisporus and Pleurotus spp.

    Directory of Open Access Journals (Sweden)

    Savic Milena

    2012-01-01

    Full Text Available The activity of organic selenium against pathogenic molds and its use as a potential selenium source in the production of enriched mushrooms were examined. The effect of commercial selenized yeast on mycelia growth was examined using a method with mycelia disks and a well diffusion method. For mushroom enrichment, different concentrations of selenium were added to a growth substrate. The results presented in this paper suggest that the most suitable concentration of selenized yeast that inhibits the growth of the mycopathogenic molds is 70-100 mg/kg of selenium. With the addition of this concentration to the substrate, mushroom fruit bodies will uptake a high level of selenium, about 100 μg/g for Pleurotus spp., and 200 μg/g for Agaricus bisporus in dry weight of the mushroom. Thereby a double effect in the cultivation of mushrooms is achieved. [Projekat Ministarstva nauke Republike Srbije, br. III 46010 and br. III46001

  3. Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

    Science.gov (United States)

    Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

    2018-03-01

    Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

  4. Cultivo do cogumelo Pleurotus sajor-caju em diferentes resíduos agrícolas Cultivation of the mushroom Pleurotus sajor-caju in different agricultural residues

    Directory of Open Access Journals (Sweden)

    Eustáquio Souza Dias

    2003-12-01

    Full Text Available Diferentes resíduos agrícolas disponíveis na região sul de Minas Gerais foram testados para o cultivo do cogumelo Pleurotus sajor-caju. Foram avaliados os seguintes substratos: palha de feijão pura (PFP, palha de milho pura (PMP, casca de café pura (CCP, palha de feijão enriquecida com 2% de calcário, 2% de gesso e 10% de farelo de trigo (PFE, palha de milho enriquecida (PME e casca de café enriquecida (CCE. Todos os substratos receberam 2% de inoculante e foram incubados a 24°C. Após a colonização, os sacos foram mantidos abertos em ambiente a 24°C e umidade a 80%. PFP, PFE e PME apresentaram os melhores resultados na produção de cogumelos, com uma eficiência biológica de 85,7; 81,4 e 83,4%, respectivamente. A palha de feijão foi considerada o melhor resíduo para a produção do cogumelo P. sajor-caju, porque apresentou a melhor eficiência biológica sem necessidade de enriquecimento.Several agricultural residues available in the South of Minas Gerais were tested for cultivation of the mushroom Pleurotus sajor-caju. The following substrates were investigated: Bean (BS, Corn (CS straws and Coffee husk (CH without nutrient supplementation and straws of bean (BSS, corn (CSS and coffee husk (CHS supplemented with 2% of CaCO3, 2% of gypsum and 10% of wheat flour. All the substrates were inoculated with 2% of spawn and incubated at 24ºC. After the fungi had colonized the substrate, the plastic bags were open and maintained at room temperature with 80% of humidity. BS, BSS and CSS showed higher mushroom production than the others, showing a biological efficiency of 85.7, 81.4 and 83.6% respectively. The beans straw (BS without nutrient supplementation was considered the best residue for the growth and cultivation of the mushroom Pleurotus sajor-caju. This substrate showed higher levels of biological efficiency than the others substrates analysed.

  5. Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    O. M. Alekseenko

    2010-07-01

    Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

  6. Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

    Science.gov (United States)

    Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

    2009-07-30

    This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

  7. Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

    Science.gov (United States)

    Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

    2017-06-01

    Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

  8. Oil palm empty fruit bunch as media for mushroom cultivation

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi

    1998-01-01

    The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting

  9. Microbiological effects of olive mill waste addition to substrates for Pleurotus pulmonarius cultivation

    NARCIS (Netherlands)

    Soler-Rivas, C.; Garcia-Rosado, A.; Polonia, I.; Junca-Blanch, G.; Marin, F.R.; Wichers, H.J.

    2006-01-01

    When olive mill wastes (OMWs) and vegetation waters (VWs) obtained during the manufacture of olive oil were added as substrate supplements for the cultivation of Pleurotus pulmonarius the material modified growth of the mushroom and the endemic microbiota of the substrate, in particular the

  10. Concentration of radiocesium in cultivated mushrooms and substrates

    International Nuclear Information System (INIS)

    Miyake, Sadaaki; Higasa, Mamoru; Urabe, Ken-ichi; Haraguchi, Masato; Omura, Toshitaka

    2008-01-01

    Concentrations of 134 Cs, 137 Cs and 40 K in mushrooms cultivated in Saitama prefecture and those substrates were measured by gamma-ray spectrometry. In all mushrooms and substrates, 134 Cs was not detected. Concentrations of 137 Cs in mushrooms were in the range of 0.012 - 2.1 Bq/kg·fresh, and those in substrates were in the range of 0.080 - 1.8 Bq/kg·dry. Concentrations of 137 Cs in mushrooms varied widely with mushroom species, and the average concentration of 137 Cs in Lentinus edodes (Shiitake) was over 30 times higher than that in Pleurotus ostreatus (Hiratake). Mushroom-to-substrate concentration ratios of 137 Cs (fresh/dry) were 0.11-0.53. They were higher than the reported transfer factors for common agricultural plants. (author)

  11. The Management of Humidifying Treatment for Low Contamination Risks During Indoor Cultivation of Grey Oyster Mushroom (Pleurotus pulmonarius

    Directory of Open Access Journals (Sweden)

    Islam Md. Tariqul

    2017-01-01

    Full Text Available In this study, grey oyster mushroom (Pleurotus pulmonarius was cultivated in indoor controlled environment to seeking out the possible risks of contamination and ways of treatment to avoid the contamination. For this, mushroom was cultivated in providing artificial humidifying and ventilation system to ensure optimum humidity (80-90% and fresh air recirculation in different ways of treatment. The ways of treatment were included as in position of humidifier, frequency of humidifying, plastic cork of bags opening part and cleaning of humidifier water container. Maximum percentages of bag contamination (2.5-25.30%, cap contamination (5.6-30.75%, stalk contamination (4.75-23.25% and root contamination (2.6-18.45% were found in front to front humidifier position, long humidifying with long interval frequency, without plastic cork, without cleaning and bi-monthly cleaning of humidifier water container treatment but no diseases and pest infection was found. Whereas, very low percentages of contamination (0.1-0.5% were found in surrounding humidifying position, short humidifying duration with short interval frequency, with plastic cork and weekly cleaning of humidifier water container treatment.

  12. Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...

    African Journals Online (AJOL)

    Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...

  13. Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

    Science.gov (United States)

    Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

    2011-01-01

    Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

  14. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  15. Oyster mushroom cultivation with rice and wheat straw.

    Science.gov (United States)

    Zhang, Ruihong; Li, Xiujin; Fadel, J G

    2002-05-01

    Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.

  16. Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2017-01-01

    Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

  17. DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)

    OpenAIRE

    Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.

    2014-01-01

    The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...

  18. Alternative substrates for higher mushrooms mycelia cultivation

    Directory of Open Access Journals (Sweden)

    TETIANA KRUPODOROVA

    2015-12-01

    Full Text Available Cultivation of 29 species of higher mushroom mycelia on alternative substrates – wastes of Ukrainian oil-fat industry, has been investigated. The amount of mushroom mycelia obtaining on 12 investigated substrates varied significantly, from 1.0 g/L to 22.9 g/L on the 14th day of cultivation. The superficial cultivation adopted in this study allows for easy to choose appropriate medium (substrate for mycelia production. Alternative substrates (compared to glucose-peptone-yeast medium were selected for all studied species, from soybean cake – most suitable for the mycelial growth of 24 species, to walnut cake − suitable only for 2 species. The utilization of substrates has been evaluated by biological efficiency. The best index of biological efficiency varied from 19.0% to 41.6% depending on the mushroom species. It was established high biological efficiency of mycelia cultivation on substrates: wheat seed cake – Pleurotus djamor, Lyophyllum shimeji, Crinipellis schevczenkovi, Phellinus igniarius, Spongipellis litschaueri; oat seed cake – Ganoderma applanatum and G. lucidum; soybean cake – Hohenbuehelia myxotricha, Trametes versicolor, Morchella esculenta, Cordyceps sinensis, C. militaris, and Agrocybe aegerita; rape seed cake – Auriporia aurea; camelina seed cake – Fomes fomentarius. The cultivation of these species are perspective as a biotechnological process of agricultural wastes converted into mycelia, which could be used in different forms of products with therapeutic action: powder or tablets nutraceuticals or ingredients for functional foods.

  19. Proximate compositions and bioactive compounds of edible wild and cultivated mushrooms from Northeast Thailand

    Directory of Open Access Journals (Sweden)

    Amporn Srikram

    2016-11-01

    Full Text Available Mushrooms are known as an excellent source of nutrients including macronutrients and bioactive compounds. Nutritional values were investigated involving proximate analysis, total antioxidant capacity (TAC, total phenol content (TPC and total flavonoid content (TFC of 10 edible wild mushroom species—Amanita calyptroderma Ark. et al., Amanita princeps Corner et Bas, A., Astraeus odoratus, Heimiella retispora (Pat. et. Bak. Boedijn., Mycoamaranthus cambodgensis (Pat. Trappe, Russula alboareolata Hongo, Russula cyanoxantha Schaeff.ex.Fr., Russula emetic (Schaeff. ex Fr. S.F.Gray., Russula virescens (Schaeff. fr., Termitomyces clypeatus Heim—and five cultivated mushroom species—Auricularia auricula-judae, Lentinus polychrous Lev., Lentinus squarrosulus Mont., Pleurotus sajor-caju (Fr. Sing, Volvariella vovacea (Bull. Ex.Fr. Sing. From the proximate analysis, the moisture contents of both wild and cultivated mushrooms ranged from 84.15% fresh weight (FW to 90.21% FW. The ash, crude protein, fat, crude fiber and carbohydrate contents of both wild and cultivated mushrooms were in the dry weight ranges 2.56–13.96%, 11.16–50.29%, 1.43–21.94%, 2.11–38.11% and 9.56–59.73%, respectively, and the contents of macronutrients in the mushrooms varied by variety. Wild mushrooms had a high fiber content compared to cultivated mushrooms. The contents of biologically active compounds of both wild and cultivated mushrooms also varied depending on the variety. Values for the TAC, TPC and TFC of wild mushrooms were higher than those of cultivated mushrooms. In conclusion, the proximate analysis for both wild and cultivated mushrooms was variety dependent and wild mushrooms contained a higher fiber content and more biologically active compounds than cultivated mushrooms.

  20. DETERIORATION AND SOME OF APPLIED PRESERVATION TECHNIQUES FOR COMMON MUSHROOMS (AGARICUS BISPORUS, FOLLOWED BY LENTINUS EDODES, PLEUROTUS SPP.

    Directory of Open Access Journals (Sweden)

    Hamid Akbarirad

    2013-06-01

    Full Text Available Mushrooms are consider as a nutritional and health beneficial product. Three most cultivated mushrooms worldwide are Agaricus bisporus, Lentinus edodes and Pleurotus spp. Mushrooms are highly perishable. They tend to lose quality after harvest, mainly because of their high respiration rate and the fact that they have no barrier to protect them from water loss. Mushrooms’ shelf-life is limited to a few days under normal refrigeration conditions, which is a constraint on the distribution and marketing of fresh product, making extension of mushroom’s shelf life a constant quest. Modified atmosphere packaging provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. However, modified atmosphere packaging conditions should be carefully designed. Inappropriate modified atmosphere conditions may be ineffective or even shorten the shelf life of the product due to damage of tissues. Preservation techniques and specially use of MAP, specifically for Agaricus, Lentinus edodes and Pleurotus, is reviewed.

  1. Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

    Science.gov (United States)

    Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

    2016-11-01

    In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

  2. Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

    Science.gov (United States)

    Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

    2014-12-01

    Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

  3. Total Phenolics, Flavonoids, Tannin Contents and Antioxidant Properties of Pleurotus ostreatus Cultivated on Different Wastes and Sawdust

    Directory of Open Access Journals (Sweden)

    Ayşenur Yılmaz

    2017-01-01

    Full Text Available In this study, the usage possibilities of some agro-industrial wastes such as; peanut wastes, potatoes farm wastes, walnut and orange tree sawdust in Pleurotus ostreatus cultivation were investigated and total phenolic, flavonoid, condensed tannin content and antioxidant properties of these methanolic mushroom extracts were examined. For the determination of the total phenolic contents, the Folin-Ciocalteau procedure was used. The content of total flavonoid present in the methanolic extracts was measured using a spectrophotometric assay. Condensed tannins were determined according to the method by Julkunen-Tıtto. The antioxidant capacity was determined using ferric reducing antioxidant power (FRAP and free radical scavenging activity of DPPH. The highest total phenolic content (2.672 ± 0.003 mg GAE/g was found in mushroom cultivated on walnut sawdust. The highest condensed tannin (1.011 ± 0.088 CE mg/g and ferric reducing antioxidant power (FRAP (12.332 ± 0.017 μmol FeSO4.7H2O/g were observed in the same mushroom extract. The highest total flavonoid and free radical scavenging activity of DPPH were found in extract of mushroom cultivated on potatoes handle. Bioactive properties of P. ostreatus cultivated on walnut tree sawdust were generally exhibited remarkable results.

  4. Chemical composition of Pleurotus pulmonarius (Fr. Quél., substrates and residue after cultivation

    Directory of Open Access Journals (Sweden)

    Silva Sueli Oliveira

    2002-01-01

    Full Text Available The cultivation of Pleurotus pulmonarius was carried out on different substrate: cotton waste (A leaves of Cymbopogon citratus (B and leaves of Panicum maximum Jacq. (C. The mushroom had a varied chemical composition; nevertheless they contained a good composition for to be used as a good source of protein for human kind. The results showed the higher protein content (29.19% and fibre (9.0% for the mushroom that were cultivated on cotton peel. The substrate composition and the residue composition after the mushroom harvest were: Protein for the substrate "A" (10.63% and 9.35%, "B" (7.87% and 4.24% and "C" (7.55% and 5.90 %; Lipids "A" (4.17% and 2.03%, "B"(2.77% and 3.20% and "C" (0.91% and 2.05%; Fibres "A" (49.02% and 37.02%, "B" (28.40% and 23.26% and "C" (37.50% and 26.66% respectively. The substrate "A" showed 0.048% of iron and "C" 0.14% of magnesium, 0.31% of potassium and 0.26% of calcium. In the substrate "B" the quantity of the minerals were very low in comparison to the other substrates. The residues after the harvest of mushroom could be used as fertiliser or as complement in the composition for animal feed.

  5. Radiopasteurization of sawdust media used in propagation of mushrooms

    International Nuclear Information System (INIS)

    Ito, Hitoshi; Sato, Tomotaro

    1975-01-01

    In our country, cultivation of mushrooms such as Pleurotus ostreatus, Kuehneromyces nameko, and Lentinus edodes (Cortinellus shiitake) are expanding, and has reached considerable amounts. These mushrooms are cultivated generally on decaying logs of broad leaf trees. Recently, these mushrooms are also cultivated artificially on the sawdust-media containing rice bran and other nutrient in the room of which temperature is controlled. However, these artificial culture media must be germicidated for 2 or 6 hours at 100 to 120 0 C before inoculation of mushroom spawn. In this study, attempts were made to cultivate Pleurotus ostreatus on the sawdust-media pasteurized by ionizing radiation. Inhibition of mushrooms growth were caused mainly by multiplication of Citrobacter and Fusarium, and these organisms were eliminated by a dose of 0.5 Mrad gamma irradiation. A surprising result was that many of sawdust media subjected to 0.5, 1.0 and 2.0 Mrad increased mycelial growth rates more than heat treatments, and also mushroom yields were enhanced. The multiplication of remaining microorganisms such as Bacillus and yeasts after irradiation with a dose of 0.5 Mrad or 1.0 Mrad did not inhibit the mycelial growth of mushrooms. (auth.)

  6. Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2015-12-01

    Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

  7. Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.

    Science.gov (United States)

    Morales, Viviana; Sánchez, Jose E

    2017-01-01

    The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.

  8. Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

    Directory of Open Access Journals (Sweden)

    Maria Teresa Branà

    Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

  9. Análise química de corpos de frutificação de Pleurotus sajor-caju cultivado em diferentes concentrações de nitrogênio Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    Directory of Open Access Journals (Sweden)

    Evânia Geralda Silva

    2007-03-01

    Full Text Available Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúcar, farelo de trigo e diferentes teores de nitrogênio. Apenas os substratos com teores de nitrogênio de 0,65 a 1,30% foram colonizados, enquanto que nos substratos com 1,75 e 2,20% de nitrogênio não houve colonização. Não houve diferença significativa na produção de cogumelos, porém o teor de proteína dos cogumelos produzidos no substrato com 1,30% de N foi significativamente superior em relação aos substratos com menor teor de N.Mushrooms of Pleurotus genus usually grow well in substrates containing low amounts of nitrogen, whereas Agaricus mushrooms require substrates with a high content of nitrogen. On the other hand, the nutritional values of mushrooms depend on the chemical composition of the substrate in use and the conditions of cultivation. The aim of this work is to measure the protein content of the fructification bodies of Pleurotus sajor-caju cultivated in coast-cross grass, sugar cane bagasse, whole wheat meal and various nitrogen concentrations. Only the substrates with nitrogen content ranging from 0.65 to 1.30% were colonized, while in the substrates with 1.75 and 2.20% of nitrogen, colonization did not occur. There was no significant difference in the production of mushrooms, however the protein content of the mushrooms produced on the substrate with 1.30% of N was considerably higher in relation to those mushrooms grown in substrates with a reduced nitrogen content.

  10. Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

    African Journals Online (AJOL)

    Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

  11. Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

    Science.gov (United States)

    Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

    2014-01-01

    Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

  12. Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

  13. Oyster mushroom (Pleurotus spp.) cultivation technique using re ...

    African Journals Online (AJOL)

    SARAH

    2014-08-31

    Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.

  14. Efficiency of treatments for controlling Trichoderma spp during spawning in cultivation of lignicolous mushrooms.

    Science.gov (United States)

    Colavolpe, María Belén; Mejía, Santiago Jaramillo; Albertó, Edgardo

    2014-01-01

    Trichoderma spp is the cause of the green mold disease in mushroom cultivation production. Many disinfection treatments are commonly applied to lignocellulose substrates to prevent contamination. Mushroom growers are usually worried about the contaminations that may occur after these treatments during handling or spawning. The aim of this paper is to estimate the growth of the green mold Trichoderma sp on lignocellulose substrates after different disinfection treatments to know which of them is more effective to avoid contamination during spawning phase. Three different treatments were assayed: sterilization (121 °C), immersion in hot water (60 and 80 °C), and immersion in alkalinized water. Wheat straw, wheat seeds and Eucalyptus or Populus sawdust were used separately as substrates. After the disinfection treatments, bagged substrates were sprayed with 3 mL of suspension of conidia of Trichoderma sp (10(5) conidia/mL) and then separately spawned with Pleurotus ostreatus or Gymnopilus pampeanus. The growth of Trichoderma sp was evaluated based on a qualitative scale. Trichoderma sp could not grow on non-sterilized substrates. Immersions in hot water treatments and immersion in alkalinized water were also unfavorable treatments for its growth. Co- cultivation with mushrooms favored Trichoderma sp growth. Mushroom cultivation disinfection treatments of lignocellulose substrates influence on the growth of Trichoderma sp when contaminations occur during spawning phase. The immersion in hot water at 60 °C for 30 min or in alkalinized water for 36 h, are treatments which better reduced the contaminations with Trichoderma sp during spawning phase for the cultivation of lignicolous species.

  15. Composted versus Raw Olive Mill Waste as Substrates for the Production of Medicinal Mushrooms: An Assessment of Selected Cultivation and Quality Parameters

    Directory of Open Access Journals (Sweden)

    Georgios I. Zervakis

    2013-01-01

    Full Text Available Two-phase olive mill waste (TPOMW, “alperujo” is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota, that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium. Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

  16. Composted versus raw olive mill waste as substrates for the production of medicinal mushrooms: an assessment of selected cultivation and quality parameters.

    Science.gov (United States)

    Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis

    2013-01-01

    Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

  17. Vitamin D2 Stability During the Refrigerated Storage of Ultraviolet B-Treated Cultivated Culinary-Medicinal Mushrooms.

    Science.gov (United States)

    Slawinska, Aneta; Fornal, Emilia; Radzki, Wojciech; Jablonska-Rys, Ewa; Parfieniuk, Ewa

    2017-01-01

    The effects of ultraviolet B (UVB) irradiation on the synthesis of vitamin D2 and its stability during refrigerated storage was determined in fresh cultivated culinary-medicinal mushrooms (Agaricus bisporus, Pleurotus ostreatus, and Lentinus edodes) after harvest. The irradiated mushrooms were stored at 4°C for up to 10 days. The concentrations of vitamin D2 and ergosterol were determined using ultrahigh-performance liquid chromatography/tandem mass spectrometry. The cultivated mushrooms not treated with UVB were devoid of vitamin D2. After UVB irradiation, we obtained mushrooms with a large amount of ergocalciferol. A. bisporus showed the lowest vitamin D2 content (3.55 ± 0.11 μg D2/g dry weight); P. ostreatus contained 58.96 ± 1.15 μg D2/g dry weight, and L. edodes contained 29.46 ± 2.21 μg/g dry weight. During storage at 4°C, the amount of vitamin D2 was gradually decreased in P. ostreatus and L. edodes, whereas in A. bisporus vitamin D2 gradually increased until the sixth day, then decreased. Mushrooms exposed to UVB radiation contain a significant amount of vitamin D2 and are therefore an excellent food source of vitamin D.

  18. Usage of Edible Mushrooms in Various Food Products

    Directory of Open Access Journals (Sweden)

    Özge Süfer

    2016-03-01

    Full Text Available Using of edible mushrooms which are generally consumed in houses in dried form is based on mainly instant soup and sauce formulations. Recently, the cultivations of Agaricus bisporus and Pleurotus ostreatus species have become widespread. Utilization of these cultivated mushrooms in recipes would bring added value to related food products. For this purpose, Agaricus bisporus and Pleurotus ostreatus species farmed in Osmaniye Korkut Ata University Mushroom House were dried and then pulverized. Firstly, a snack was prepared with Agaricus bisporus powder. Agaricus bisporus powder was substituted for wheat flour at the rates of 5 %, 10 %, 20 % and 30 % and thus the potential of food product which had relatively lower carbohydrate and fat level and higher fiber content was investigated. In the second part of the study, either 5 %, 10 % of Agaricus bisporus powder or 5 %, 10 % of Pleurotus ostreatus powder were added into traditional Turkish meatball (beef mince, salt which was cooked in conventional oven, so meat flavor could be replaced by herbal flavor coming from mushroom. This property mat obey the purpose that, the created new product will be consumed fondly especially by children. Sensory and physical (colour and texture analysis were performed in both snack and meatball samples and the results were evaluated statistically.

  19. Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

    Science.gov (United States)

    Thongsook, T; Kongbangkerd, T

    2011-08-01

    Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

  20. [Effect of cultivation in zinc media on the growth of and the degree of zinc in organic form in transgenic metallothionein mushroom].

    Science.gov (United States)

    Sheng, Ji-Ping; Shen, Lin; Ru, Bing-Gen

    2009-03-01

    Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich and metal-binding functional proteins. Transgenic MT mushroom can be used as functional food additives, but its zinc-enriching ability has not been studied systemically until now. The zinc contents in mycelia of transgenic MT mushroom (Pleurotus ostreatus) and wild type mushroom mycelia cultivated in different zinc concentration media were analyzed by ICP-OES. The growth status, zinc-enriching ability and degree of zinc in organic form (DZOF) were also analyzed. Results showed that MT mushroom mycelia grew rapidly, but the growth was inhibited when the zinc content in solid media was higher than 1.6 mmol x L(-1). MT mushroom mycelia could enrich more zinc than that of wild type, and the zinc content in MT mushroom mycelia could be 2.56-27.49 mg x kg(-1) when it was cultivated in a liquid media with 0.6-1.2 mmol x L(-1) zinc. DZOF of MT mushroom mycelia in a liquid media with 0.6 mmol x L(-1) zinc at 7 d was significantly higher (88.7%) than that in the wild type (82.1%, alpha = 0.05), but there was no significant difference in DZOF when the MT mushroom mycelia was cultivated in a liquid media with different zinc content at 7 d.

  1. Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

    Science.gov (United States)

    Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

    Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

  2. Laccase Enzymes in Inocula Pleurotus spp

    Directory of Open Access Journals (Sweden)

    Nora García-Oduardo

    2017-01-01

    Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

  3. INTENSIFICATION OF JELLY MUSHROOM CULTIVATION IN PAKEM SLEMAN

    OpenAIRE

    Sulistiya; Retno Lantarsih; Titop Dwiwinarno*

    2015-01-01

    Mushroom cultivation is long enough to be a source of income for some people in Pakem, Sleman. However, cultivation techniques that do not yet meet the standards for technical, so that productivity is still low. Marketing mushrooms are limited to the traditional market. Waste mushroom has not been used well, so potentially to pollute the environment mushroom. This service activities include the provision of mushroom cultivation equipment, such as water pumps and termohygrome...

  4. Molecular identification and artificial cultivation of a wild isolate of oyster mushroom in Albania

    Directory of Open Access Journals (Sweden)

    Jordan Merkuri

    2016-03-01

    Full Text Available Basidiomata of a wild mushroom macroscopically recognised as Pleurotus ostreatus were observed on an oak trunk in a mixed wood of northern Albania. Pure cultures of the fungus were then obtained on potato-dextrose-agar medium. Molecular analyses of genomic DNA of the fungus confirmed its identification. The rDNA ITS region nucleotide sequence of the studied Pleurotacea matched at 99% those of two P. ostreatus strains already present in NCBI GenBank database. The rDNA ITS nucelotide sequences of two pure cultures of the Albanian P. ostreatus were deposited in EMBL database under the accession numbers LN849458 and LN849459. One of the fungus isolates was subsequently cultivated under protected and semi-natural conditions. Productivity and biological efficiency of the Albanian P. ostreatus ranged from about 10% to 16% and from 33 to 53.33%, respectively. This seems to be the first report on the artificial cultivation of P. ostreatus in Albania and could have, in the next future, a high economic impact on development and diffusion of this important edible mushroom over the country.

  5. [The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

    Science.gov (United States)

    Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

    2009-01-01

    The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

  6. Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh

    Directory of Open Access Journals (Sweden)

    Mostak Ahmed

    2013-02-01

    Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.

  7. Influence of growing conditions on heavy metals content in cultivated mushrooms

    International Nuclear Information System (INIS)

    Kmitene, L.

    1997-01-01

    The aim of the research was to investigate the influence of growing terms, microclimate conditions and growing medium on the mushroom harvest and quality. Champignons were grown according to the Polish technology. Pleurotus ostreatus was grown in perforate sacks using chopped wheat straw. Mycelium was sowed in different terms. It was established that the harvest of mushrooms, especially their quality, depends not only on growing conditions, but also on the kind of mushrooms, composte quality, mushroom size (diameter of cap), picking of mushrooms, storage time and other conditions. The technology of mushroom growing will be developed after studying all the factors determining the content of heavy metals and radiation in mushrooms

  8. Performance of Pleurotus pulmonarius mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    2017-10-01

    Full Text Available Abstract The use of supplemented agricultural waste in mushroom cultivation can be one of the environmentally friendly strategies for poverty alleviation. The study evaluated the performance of Pleurotus pulmonarius mushroom grown on maize stalk supplemented with varying levels of wheat bran (WB and maize flour (MF. A completely random design was used for the experiments. It was observed that Pleurotus pulmonarius was significantly affected by varying levels of supplementation, as 20% WB supplementation encountered higher contamination. The lower supplementation levels gave significantly shorter colonisation period with better mycelial growth rate (MGR. The 2% MF, 2% WB and 4% WB gave significantly higher MGR and faster colonisation. The shortest pinning time (TP was observed at the first flush with the minimum of 2 days. Higher supplementation levels gave maximum yield and biological efficiency (BE. With further increase of supplementation above a 12% WB and 14% MF, the BE and yield declined. Lower supplementation levels resulted in quicker colonisation period and improved growth rate, whereas high supplementation gave better production in terms of yield and BE. Therefore, for the purpose of maximum production, 12% WB and 14% MF may be recommended while for fast production time, 2% MF and 2% WB are recommended.

  9. Radiocesium uptake mechanisms in wild and culture mushrooms

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi.

    1993-01-01

    Concentrations of 137 Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of 137 Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of 137 Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of 137 Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high 137 Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of 137 Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of 137 Cs concentration were stable in the order of 10 0 when the culture substrate was containing 10 000 Bq/kg (wet wt.) of 137 Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of 137 Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of 137 Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author)

  10. Effectiveness of Training Programme on Mushroom Cultivation

    OpenAIRE

    Rahman, Md. Sazzadur; Hossain, Kh. Zulfikar; Ali, Md. Sekender; Afroz, Fauzia

    2017-01-01

    Effectiveness is one of the key parameters to assess success of any programs. However, the effectiveness of training programme on mushroom cultivation was not well addressed. The purposes of this study were to investigate the effectiveness of training programme on mushroom cultivation and to explore the relationships of each of the selected characteristics of the trained mushroom farmers with their effectiveness of training programme. Data were collected from the trained mushroom farmers of s...

  11. Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

    Science.gov (United States)

    Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

    2008-07-01

    Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

  12. Preliminary study of platinum accumulation in the fruitbodies of a model fungal species: king oyster mushroom (Pleurotus eryngii)

    International Nuclear Information System (INIS)

    Urban, P.L.; Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Pianka, D.; Steborowski, R.; Asztemborska, M.; Kowalska, J.; Manjon, J.L.; Kuthan, R.T.

    2005-01-01

    A model species of saprophytic fungus, king oyster mushroom (Pleurotus eryngii), was cultivated on barley substrate supplied with [Pt(NH 3 ) 4 ](NO 3 ) 2 , under well defined conditions. The samples of the collected fruiting bodies were digested and analyzed for total platinum content by means of ICP-MS. The results proved that platinum is not accumulated in the fruitbodies of Pleurotus eryngii for a wide range of Pt concentrations in the culture substrate (100-1000 ppb Pt in 50 ml of water solution added to ca. 450 g of hydrated barley seeds per container). Observable levels of Pt were only found in the fruitbodies obtained from the medium contaminated with 10000 ppb (10 ppm) platinum solution. This demonstrates significant difference in the effectiveness of platinum extraction in fungi and plants, which are capable to accumulate platinum even when supplied at lower concentration (<500 ppb). It also shows different physiological pathways of platinum and other elements which are easily accumulated in the fruitbodies of the same species. (author)

  13. Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

    Science.gov (United States)

    Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

    2014-10-15

    Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. INTENSIFICATION OF JELLY MUSHROOM CULTIVATION IN PAKEM SLEMAN

    Directory of Open Access Journals (Sweden)

    Sulistiya

    2015-01-01

    Full Text Available Mushroom cultivation is long enough to be a source of income for some people in Pakem, Sleman. However, cultivation techniques that do not yet meet the standards for technical, so that productivity is still low. Marketing mushrooms are limited to the traditional market. Waste mushroom has not been used well, so potentially to pollute the environment mushroom. This service activities include the provision of mushroom cultivation equipment, such as water pumps and termohygrometer and nozzle, and education and training bookkeeping, marketing, and processing waste into mushroom compost. The results showed an increase in the production of mushroom seen from the Biological Conversion Efficiency (BCE are in the top 30 percent. Partners also has a business bookkeeping and have Blog to market the mushroom by on-line. Partners also have the skills to process the manure (compost made from the waste of mushroom which can be used to help fertilize their crops.

  15. Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

    Directory of Open Access Journals (Sweden)

    Marli Camassola

    2013-01-01

    Full Text Available Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc and manganese peroxidase (MnP. New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm-1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm-1, respectively. The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes.

  16. Phenylhydrazines in the cultivated mushroom (Agaricus bisporus)

    DEFF Research Database (Denmark)

    Andersson, H. C.; Gry, Jørn

    2004-01-01

    In 1991, the Nordic Working Group on Food Toxicology and Risk Evaluation (NNT) reviewed the available data on phenylhydrazines naturally occurring in the cultivated mushroom. It was concluded that the mushroom may contain about 500 mg of the hydrazine derivatives per kg fresh weight. The hydrazine...... derivatives as well as extracts of the cultivated mushroom were mutagenic to a variable degree in most of the reported short-term tests. The raw mushroom and several of the hydrazines induced tumours when administered to Swiss mice as reported by American scientists. However, reservations were expressed...... as to the design of the studies. Based on this review, and due to the concern expressed, a Nordic project (coordinated by Jørn Gry, Danish Veterinary and Food Administration) was initiated dealing with toxicological and chemical studies on the cultivated mushroom and its phenylhydrazine derivatives in order...

  17. Mushroom cultivation in Brazil: challenges and potential for growth

    OpenAIRE

    Dias,Eustáquio Souza

    2010-01-01

    Mushroom cultivation is rapidly expanding in Brazil because Brazilians have discovered the medicinal and culinary value of mushrooms and their economic situation has improved. However, the horticultural technology for cultivating mushrooms under Brazilian conditions is lacking. For many years, the mushroom cultivation technology used in Brazil was adapted from developed countries whose materials and climate were different from those of Brazil. In order to exploit the Brazilian potential for m...

  18. Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

    Directory of Open Access Journals (Sweden)

    Nualsri, C.

    2005-01-01

    Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

  19. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  20. The medicinal Agaricus mushroom cultivated in Brazil: biology, cultivation and non-medicinal valorisation.

    Science.gov (United States)

    Largeteau, Michèle L; Llarena-Hernández, Régulo Carlos; Regnault-Roger, Catherine; Savoie, Jean-Michel

    2011-12-01

    Sun mushroom is a cultivated mushroom extensively studied for its medicinal properties for several years and literature abounds on the topic. Besides, agronomical aspects were investigated in Brazil, the country the mushroom comes from, and some studies focus on the biology of the fungus. This review aimed to present an overview of the non-medicinal knowledge on the mushroom. Areas of commercial production and marketing trends are presented. Its specific fragrance, taste, nutritional value and potential use of extracts as food additives are compared to those of the most cultivated fungi and laboratory models. The interest of the mushroom for lignocellulosic enzyme production and source of biomolecules for the control of plant pathogens are shown. Investigation of genetic variability among cultivars is reported. Growing and storage of mycelium, as well as cultivation conditions (substrate and casing generally based on local products; indoor and outdoor cultivation; diseases and disorders) are described and compared to knowledge on Agaricus bisporus.

  1. [Status of termite-mushroom artificial domestication cultivation--a review].

    Science.gov (United States)

    Zhang, Yujin; Guo, Huachun; Li, Rongchun

    2010-10-01

    Two models of domestication and cultivation of termite-mushroom were discussed: the cultivation of termitomyces model, which method of woodrotting fungi cultivation was emphasized and the original ecological model, which multiplication of symbiotic termites was focused. The problems and possible solutions during termite-mushroom cultivation were also discussed.

  2. Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

    Science.gov (United States)

    Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

    2016-12-01

    Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

  3. Submerged cultivation of medicinal mushrooms: bioprocesses and products (review).

    Science.gov (United States)

    Elisashvili, Vladimir

    2012-01-01

    Medicinal mushrooms belonging to higher Basidiomycetes are an immensely rich yet largely untapped resource of useful, easily accessible, natural compounds with various biological activities that may promote human well-being. The medicinal properties are found in various cellular components and secondary metabolites (polysaccharides, proteins and their complexes, phenolic compounds, polyketides, triterpenoids, steroids, alkaloids, nucleotides, etc.), which have been isolated and identified from the fruiting bodies, culture mycelium, and culture broth of mushrooms. Some of these compounds have cholesterol-lowering, anti-diabetic, antioxidant, antitumor, immunomodulating, antimicrobial, and antiviral activities ready for industrial trials and further commercialization, while others are in various stages of development. Recently, the submerged cultivation of medicinal mushrooms has received a great deal of attention as a promising and reproducible alternative for the efficient production of mushroom mycelium and metabolites. Submerged cultivation of mushrooms has significant industrial potential, but its success on a commercial scale depends on increasing product yields and development of novel production systems that address the problems associated with this technique of mushroom cultivation. In spite of many researchers' efforts for the production of bioactive metabolites by mushrooms, the physiological and engineering aspects of submerged cultures are still far from being thoroughly studied. The vast majority of studies have focused on polysaccharide and ganoderic acid production in submerged cultivation of medicinal mushrooms, and very little has been written so far on the antioxidant and hemagglutinating activity of submerged mushroom cultures. The purpose of this review is to provide an update of the present state of the art and future prospects of submerged cultivation of medicinal mushrooms to produce mycelium and bioactive metabolites, and to make a

  4. Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

    Directory of Open Access Journals (Sweden)

    M. Abu Sayeed

    2014-01-01

    Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

  5. Recycling of Vineyard and Winery Wastes as Nutritive Composts for Edible Mushroom Cultivation

    Science.gov (United States)

    Petre, Marian; Teodorescu, Alexandru

    2011-01-01

    Every year, in Romania huge amounts of wine and vine wastes cause serious environmental damages in vineyards as well as nearby winery factories, for instance, by their burning on the soil surface or their incorporation inside soil matrix. The optimal and efficient way to solve these problems is to recycle these biomass wastes as main ingredients in nutritive composts preparation that could be used for edible mushrooms cultivation. In this respect, the main aim of this work was to establish the best biotechnology of winery and vine wastes recycling by using them as appropriate growth substrata for edible and medicinal mushrooms. According to this purpose, two mushroom species of Basidiomycetes, namely Lentinula edodes as well as Pleurotus ostreatus were used as pure mushroom cultures in experiments. The experiments of inoculum preparation were set up under the following conditions: constant temperature, 23° C; agitation speed, 90-120 rev min-1 pH level, 5.0-6.0. All mycelia mushroom cultures were incubated for 120-168 h. In the next stage of experiments, the culture composts for mushroom growing were prepared from the lignocellulose wastes as vine cuttings and marc of grapes in order to be used as substrata in mycelia development and fruit body formation. The tested culture variants were monitored continuously to keep constant the temperature during the incubation as well as air humidity, air pressure and a balanced ratio of the molecular oxygen and carbon dioxide. In every mushroom culture cycle all the physical and chemical parameters that could influence the mycelia growing as well as fruit body formation of L. edodes and P. ostreatus were compared to the same fungal cultures that were grown on poplar logs used as control samples.

  6. Cultivo e características nutricionais de Pleurotus em substrato pasteurizado Cultivation and nutritional characteristics of Pleurotus grown in pasteurized substrate

    Directory of Open Access Journals (Sweden)

    Eduardo Bernardi

    2009-01-01

    Full Text Available O objetivo deste trabalho foi avaliar a produtividade, eficiência biológica, massa fresca, composição centesimal dos cogumelos Pleurotus ostreatus (BF24 e Pleurotus sajor-caju (PSC96/03 e PSC01/06 produzidos no substrato capim-elefante (Pennisetum purpureum pasteurizado e a relação Carbono/Nitrogênio inicial e final do substrato. O substrato seco e particulado a 2 cm foi umedecido por 24 horas e pasteurizado a 100 ºC durante 30 minutos. Adicionaram-se 3% de inóculo de cada linhagem, sendo acondicionado em embalagens de polipropileno com 1 kg cada uma. Os substratos foram incubados a 26 ºC e na fase de frutificação a 23±3 ºC e umidade relativa de 75% a 90%. Na linhagem BF24 observou-se maior massa fresca (281,19g, eficiência biológica (112,46% e produtividade (28,11%. O substrato com relação Carbono:Nitrogênio inicial de 162:1 foi o de menor relação (68:1 após o cultivo do P. sajor-caju (PSC01/06. A linhagem PSC96/03 proporcionou maior teor de proteína em relação às demais, tendo a BF24 maior teor de lipídios. Quanto ao teor de carboidratos e cinzas, nas diferentes espécies e linhagens não houve diferenças significativas; já para a quantidade de fibras, as linhagens BF24 e PSC01/06 foram similares, porém superiores a PSC96/03. As duas espécies de Pleurotus podem ser cultivadas em capim-elefante pasteurizado, suprimindo o processo de compostagem.The objective of this work was to evaluate the productivity, biological efficiency, fresh matter, and centesimal composition of mushroom Pleurotus ostreatus (BF24 and Pleurotus sajor-caju (PSC96/03 and PSC01/06 grown in pasteurized elephant grass substrate (Pennisetum purpureum. It was also assessed the initial and final Carbon/Nitrogen ratio. The dried 2-cm-particulate substrate was moist for 24 hours and pasteurized at 100ºC during 30 minutes. Then, it was added 3% of inoculum of each strain. The substrate was placed into 1-kg polypropylene bags. The bags were incubated

  7. Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates

    OpenAIRE

    Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

    2016-01-01

    Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...

  8. Mineral Composition of Four Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    S. E. Mallikarjuna

    2013-01-01

    Full Text Available Two cultivated mushroom species, namely, Lentinula edodes and Pleurotus florida and two wild growing species Lentinus cladopus and Pleurotus djamor were studied for their mineral contents such as Ca, Mg, Na, K, Fe, Zn, Mn, Cu, Ni, Se, Pb, and Cd by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES and also Atomic Absorption Spectroscopy, (AAS. Phosphorus was estimated by spectrophotometric method. K, Ca, Na, and P were in higher concentrations ranging from 59.3 mg to 3634 mg, 8.27 mg–174.9 mg, 22.2 mg–327.4 mg, and 100.5 mg–769.9 mg/100 g dry weight respectively in the four mushroom species studied. Fe, Zn, Mg and Se were ranging from 6.27 mg to 35.3 mg, 1.58 mg–9.44 mg, 21.1 mg–40.7 mg and 0.048 mg–0.182 mg/100 g dry weight, respectively, amongst the mushroom species analyzed. However, Ni, Cu, and Mn contents showed relatively lower concentrations, whereas Pb and Cd were below detectable level. The mushrooms were safe for consumption, in accordance with the permissible tolerance limits of the estimated toxic metals. Implications of the mineral contents on mushroom nutritional value are highlighted.

  9. Analysis of Major Nutritional Components of Pleurotus pulmonarius During the Cultivation in Different Indoor Environmental Conditions on Sawdust

    Directory of Open Access Journals (Sweden)

    Tariqul Islam

    2017-03-01

    Full Text Available Pleurotus pulmonarius was cultivated in three different environmental conditions, in ambient indoor environment (System 1, in humidifying without ventilation (System 2 and in humidifying with ventilation (System 3 to analyse the major nutritional contents. Sawdust was the main substrate for all the cultivation systems. The lowest temperature and the highest optimal humidity were found in System 3. The temperature and humidity had shown statistically significant among the three cultivation Systems. The highest numbers of flushes was found both in System 2 and System 3 but System 1 was produced mushrooms till 3rd flush. About 29.5%, 28.3%, 28.5% protein; 59.0%, 55.8%, 54.3% carbohydrate and 3.8%, 3.5%, 3.3% lipid were found in System 1, System 2 and System 3 respectively. The protein, carbohydrate, and lipid contents were shown statistically insignificant among the cultivation systems. The highest value of protein, carbohydrate and lipid were found for the sample of 1st flush in all the cultivation systems but the values were started to decrease with the increased numbers of flushes significantly. So, this study shown that, although the environmental conditions of the three cultivation systems were varied significantly but the protein, carbohydrate and lipid contents were existed their normal values in all cases but the values were decreased by the increased numbers of flushes.

  10. The Problems Detected in Mushroom Cultivation in Ankara

    Directory of Open Access Journals (Sweden)

    Mürüvvet Ulusoy Deniz

    2016-03-01

    Full Text Available Development of the cultivated mushroom farming which began to be produced in the 1960s in Turkey, has been more faster in the Mediterranean region than other regions. The development of mushroom cultivation has began to seen Marmara and İç Anadolu regions in recent years. The mushroom production which is very important for human health and nutrition, has been changing year to year (sometimes increase, sometimes decrease in the province of Ankara. The first private mushrrom cultivation company had been established in1963. Up to date, the number of private enterprises has changed over the years in Ankara. This study was carried out by doing a survey with an active 12 enterprises which the annual production capacity of 10-600 ton. The enterprises were visited and problems were determined during the cultivation. As a result of the study, It was observed that there are problems in production and marketing phases and with surface soil material

  11. Bacteria associated with compost used for cultivation of Nigerian ...

    African Journals Online (AJOL)

    The bacteria involved in an outdoor single phase composting using sawdust and wheat bran as substrates for cultivation of Pleurotus tuber-regium (Fr.) Singer, and Lentinus squarrosulus (Berk.), two Nigerian edible mushrooms were identified. Composting was carried out for 2 weeks. The highest core and peripheral ...

  12. Produção de três espécies de cogumelos Pleurotus e avaliação da qualidade em atmosfera modificada Production of three species of Pleurotus mushrooms and quality evaluation in modified atmosphere

    Directory of Open Access Journals (Sweden)

    Cristina Ramos

    2011-01-01

    maintain quality, minimal processing is reported to be an economical and effective method of extending the mushrooms shelf life. The purpose of this study was tested three species of the Pleurotus genus yield cultivated in wheat straw, in order to determine the most productive one and also evaluate the combined effects of modified atmosphere packaging on quality and shelf life of these packaged fresh mushrooms. The results indicate that P. ostreatus was the most productive, followed by P. sajor-caju and P. eryngii and the studied storage conditions improved P. eryngii quality.

  13. Plant growth and gas balance in a plant and mushroom cultivation system

    Science.gov (United States)

    Kitaya, Y.; Tani, A.; Kiyota, M.; Aiga, I.

    1994-11-01

    In order to obtain basic data for construction of a plant cultivation system incorporating a mushroom cultivation subsystem in the CELSS, plant growth and atmospheric CO2 balance in the system were investigated. The plant growth was promoted by a high level of CO2 which resulted from the respiration of the mushroom mycelium in the system. The atmospheric CO2 concentration inside the system changed significantly due to the slight change in the net photosynthetic rate of plants and/or the respiration rate of the mushroom when the plant cultivation system combined directly with the mushroom cultivation subsystem.

  14. EFFECT OF USING VARIOUS SUBSTRATES ON CULTIVATION OF PLEUROTUS SAJOR-CAJU

    Directory of Open Access Journals (Sweden)

    S. N. FASEHAH

    2017-04-01

    Full Text Available The unmanageable agricultural waste comprises of structural polymers, cellulose, hemicellulose and lignin can be led to pollutions, thus it can be used as a mushroom substrate. Lignocellulosic materials are most favorable feedstock as renewable and natural resource. Forestry and agricultural practices generated a large amount of ligncelluosic waste and promoted to serious problematic environmental pollution. It can be easily broken down by lignocellulotic enzymes. In this study, an attempt was made to evaluate the effect of various substrates on cultivation of Pleurotus sajor-caju. The substrates used in this study were tissue paper, rice husk ash and rubber sawdust. All of the substrates were added with rice bran and calcium carbonate (CaCO3. Then, the mixtures were transferred into plastic sized 8 cm × 4.5 cm and were pasteurized in the steamer for 1 hour at60 °C - 100 °C. After that they were cooled overnight at 25 °C - 30 °C. The spawn were inoculated into the bag and incubated in incubation room. The media bags were incubated until mycelium fully colonized and watering was done twice a day. The parameters studies were included spawn running, number of fruit body, total of stipe length, weight of fruit body and biological efficiency. Results showed that the fastest spawn running and highest number of fruits body, total of stipe length, weight of fruit body and biological efficiency are found using tissue paper substrates. In contrast the rubber sawdust showed the lowest values of spawn running, total of stipe length, weight of fruit body and biological efficiency. It can be concluded that the tissue paper is one of promising substrate which can be used in growing of Pleurotus sajor-caju due to lower cost and easy to purchase as compared to other substrates.

  15. UTILIZATION OF AREN (Arenga pinnata Merr. SAWMILLING WASTE FOR EDIBLE MUSHROOM CULTIVATION MEDIA

    Directory of Open Access Journals (Sweden)

    Djarwanto

    2016-04-01

    Full Text Available Aren (Arenga pinnata Merr. is a multipurpose tree that can be utilized for palm sugar, alcoholic drinks, beverages and construction wood. The use of aren sawdust has not been studied intensively. This study examines the utilization of aren sawdust as cultivation media for edible mushrooms. Aren sawdust was mixed with rice bran, CaCO3, gypsum, fertilizers and distilled water before sterilization in 30 minutes pressurized autoclave at 1210C and 1.5atm. The mixed media was inoculated with pure cultures containing four mushrooms species (Pleurotus flabellatus, P. ostreatus, P. sajor-caju and Lentinula edodes and incubated for five weeks to allow mycelium growth producing fruit bodies. The fruit bodies were harvested everyday within four months and examined for its gained mushroom-weight and biological conversion efficiency/BE. The core part of aren trunk was cut into smaller pieces of 10 cm (width by 5 cm (thickness, by 120 cm (length. Each core sample was bored from the surface inward, creating holes with a particular distance apart. Each hole was inoculated with pure cultures containing 6 mushroom species (four species above, P. cystidiosus and Auricularia polytricha. The inoculated samples were slanted on bamboo support, and placed in a bamboo hut. Harvesting was carried out everyday after the fruiting body became mature and examined for its gained mushroom weight. Results show that the use of sawdust supplemented with nutritious material is more likely to improve the mushroom yield than that of aren sawn-timber core. In this case, the BE values with aren-sawdust media were 21.97-89.45% (P. flabellatus, 15.36-105.36% (P. ostreatus, 63.88-76.86% (P. sajor-caju, and up to 62.88% (L. edodes. Meanwhile, the yields (gained mushroom weight with aren sawn-timber media were 210g (P. ostreatus, 368g (P. flabellatus, 331g (P. sajor-caju and 48g (A. polytricha; however, P. cystidiosus and L. edodes inoculated on aren stem core failed to grow.

  16. The pathogenic fungi in mushroom cultivation of Agaricus bisporus (Lange.) Imbach.

    OpenAIRE

    Agata Tekiela

    2012-01-01

    The research was conducted in a mushroom growing facility located near Rzeszów, consisting of three production cycles. The number and composition of microorganisms which accompany the mushroom cultivation depended on the healthiness of: the compost, casing and spawn of Agaricus bisporus. The presence of pathogenic fungi in the cultivation halls at the beginning of the production cycle is a serious threat to the cultivation of common mushroom because their rapid development shortens the span o...

  17. Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

    Science.gov (United States)

    Guan, Qinlan; Gong, Mingfu; Tang, Mei

    2018-04-01

    The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

  18. The pathogenic fungi in mushroom cultivation of Agaricus bisporus (Lange. Imbach.

    Directory of Open Access Journals (Sweden)

    Agata Tekiela

    2012-12-01

    Full Text Available The research was conducted in a mushroom growing facility located near Rzeszów, consisting of three production cycles. The number and composition of microorganisms which accompany the mushroom cultivation depended on the healthiness of: the compost, casing and spawn of Agaricus bisporus. The presence of pathogenic fungi in the cultivation halls at the beginning of the production cycle is a serious threat to the cultivation of common mushroom because their rapid development shortens the span of fruiting body harvests.

  19. Enzyme-assisted extraction enhancing the umami taste amino acids recovery from several cultivated mushrooms

    DEFF Research Database (Denmark)

    Poojary, Mahesha Manjunatha; Orlien, Vibeke; Passamonti, Paolo

    2017-01-01

    In this study, enzyme-assisted extraction was performed to extract umami taste and total free amino acids (FAAs) from the six different mushrooms including shiitake (Lentinus edodes), oyster (Pleurotus ostreatus), tea tree (Agrocybe aegerita) and, white, brown and portobello champignons (Agaricus...

  20. Antimicrobial activity and mineral composition of shiitake mushrooms cultivated on agricultural waste

    Directory of Open Access Journals (Sweden)

    Kérley Braga Pereira Bento Casaril

    2011-10-01

    Full Text Available The antimicrobial activity and mineral composition of shiitake mushrooms were evaluated in four isolates of Lentinula edodes. Mushrooms were cultivated on artificial logs, based on eucalyptus sawdust enriched with 20% rice, wheat, or soybean bran, or combination of 10% of two of these supplements. The substrates were humidified with a 0.1% mate tea extract or water. Logs of Eucalyptus grandis were also used to cultivate the shiitake mushrooms. The antimicrobial activity of an aqueous extract, corresponding to 40 mg of mushroom dry matter, was in some cases, depending on the isolate, able to inhibit both Bacillus subtilis and Escherichia coli K-12, independent of substrate composition or the growth stage of the mushrooms. Nitrogen, phosphorus, potassium, magnesium and calcium concentrations varied according to the substrate on which the mushrooms were cultivated, being, generally, higher with cultivation on artificial rather than natural eucalyptus logs. It could be concluded that, in addition to the fungal isolate, substrate composition and, processing methods must be considered during the production of antimicrobial substance(s as well as in the mushroom nutritional composition.

  1. Rice straw addition as sawdust substitution in oyster mushroom (Pleurotus ostreatus) planted media

    Science.gov (United States)

    Utami, Christine Pamardining; Susilawati, Puspita Ratna

    2017-08-01

    Oyster mushroom is favorite by the people because of the high nutrients. The oyster mushroom cultivation usually using sawdust. The availability of sawdust become difficult to find. It makes difficulties of mushroom cultivation. Rice straw as an agricultural waste can be used as planted media of oyster mushroom because they contain much nutrition needed to the mushroom growth. The aims of this research were to analysis the influence of rice straw addition in a baglog as planted media and to analysis the concentration of rice straw addition which can substitute sawdust in planted media of oyster mushroom. This research used 4 treatment of sawdust and rice straw ratio K = 75 % : 0 %, P1 = 60 % : 15 %, P2 = 40 % : 35 %, P3 = 15 % : 60 %. The same material composition of all baglog was bran 20%, chalk 5%, and water 70%. The parameters used in this research were wet weight, dry weight, moisture content and number of the mushroom fruit body. Data analysis was used ANOVA test with 1 factorial. The results of this research based on statistical analysis showed that there was no influence of rice straw addition in a planted media on the oyster mushroomgrowth. 15% : 60% was the concentrationof rice straw additionwhich can substitute the sawdust in planted media of oyster mushroom.

  2. A Comprehensive Review of Tropical Milky White Mushroom (Calocybe indica P&C).

    Science.gov (United States)

    Subbiah, Krishnamoorthy Akkanna; Balan, Venkatesh

    2015-09-01

    A compressive description of tropical milky white mushroom (Calocybe indica P&C var. APK2) is provided in this review. This mushroom variety was first identified in the eastern Indian state of West Bengal and can be cultivated on a wide variety of substrates, at a high temperature range (30~38℃). However, no commercial cultivation was made until 1998. Krishnamoorthy 1997 rediscovered the fungus from Tamil Nadu, India and standardized the commercial production techniques for the first time in the world. This edible mushroom has a long shelf life (5~7 days) compared to other commercially available counterparts. A comprehensive and critical review on physiological and nutritional requirements viz., pH, temperature, carbon to nitrogen ratio, best carbon source, best nitrogen source, growth period, growth promoters for mycelia biomass production; substrate preparation; spawn inoculation; different supplementation and casing requirements to increase the yield of mushrooms has been outlined. Innovative and inexpensive methods developed to commercially cultivate milky white mushrooms on different lignocellulosic biomass is also described in this review. The composition profiles of milky white mushroom, its mineral contents and non-enzymatic antioxidants are provided in comparison with button mushroom (Agaricus bisporus) and oyster mushroom (Pleurotus ostreatus). Antioxidant assay results using methanol extract of milky white mushroom has been provided along with the information about the compounds that are responsible for flavor profile both in fresh and dry mushrooms. Milky white mushroom extracts are known to have anti-hyperglycemic effect and anti-lipid peroxidation effect. The advantage of growing at elevated temperature creates newer avenues to explore milky white mushroom cultivation economically around the world, especially, in humid tropical and sub-tropical zones. Because of its incomparable productivity and shelf life to any other cultivated mushrooms in the

  3. Mushroom cultivation, processing and value added products: a patent based review.

    Science.gov (United States)

    Singhal, Somya; Rasane, Prasad; Kaur, Sawinder; Garba, Umar; Singh, Jyoti; Raj, Nishant; Gupta, Neeru

    2018-06-03

    Edible mushrooms are an abundant source of carbohydrates, proteins, and multiple antioxidants and phytonutrients. This paper presents a general overview on the edible fungus describing the inventions made in the field of its cultivation, equipment and value added products. To understand and review the innovations and nutraceutical benefits of mushrooms as well as to develop interest regarding the edible mushrooms. Information provided in this review is based on the available research investigations and patents. Mushrooms are an edible source of a wide variety of antioxidants and phytonutrients with a number of nutraceutical properties including anti-tumor and anti-carcinogenic. Thus, several investigations are made for cultivation and improvement of the yield of mushrooms through improvisation of growth substrates and equipment used for mushroom processing. The mushroom has been processed into various products to increase its consumption, providing the health and nutritional benefit to mankind. This paper summarizes the cultivation practices of mushroom, its processing equipments, methods of preservation, value added based products, and its nutraceutical properties. The review also highlights the various scientific feats achieved in terms of patents and research publications promoting mushroom as a wholesome food. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. Avaliação do cultivo de Pleurotus sajor-caju (fries sing. sobre o resíduo de algodão da industria têxtil para a produção de cogumelos e para alimentação animal Evaluation of the cultivation of Pleurotus sajor-caju (fries sing. on cotton textile mill waste for mushroom production and animal feeding

    Directory of Open Access Journals (Sweden)

    Clenderson Corradi de Mattos Gonçalves

    2010-02-01

    + 40% sawdust + 20% wheat bran and T5- 80% waste + 20% wheat bran. T5 showed the best results for productivity (22.46% and biologic efficiency (71.48%. Fungus altered the constitution of the substrates in the stages of production of the mushroom. Therefore, the use of cotton textile mill waste in the cultivation of Pleurotus sajor-caju may become a viable alternative for mushroom production, and also improve the quality of this waste for use in animal feeding.

  5. Risk of alpha radionuclides presence in cultivating substrate of oyster mushrooms - Pleurotus ostreatus

    International Nuclear Information System (INIS)

    Galanda, D.

    2006-01-01

    The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by ? -spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated. (author)

  6. Cultivation of Schizophyllum commune mushroom on different wood substrates

    Directory of Open Access Journals (Sweden)

    P.N. Dasanayaka

    2017-07-01

    Full Text Available Schizophyllum commune is an edible mushroom grown on wood under natural conditions. Present study focused on cultivation of S.commune on different wood substrates since it is not commercially cultivated. A pure culture of S. commune was obtained by growing a tissue of the mushroom on Potato Dextrose Agar (PDA medium. Spawns were produced by growing the mycelium on paddy grains. Mushroom was cultivated on sawdust of seven different wood substrates. The maximum yield was observed in sawdust of jackfruit (Artocarpusheterophyllus followed by sawdust of rambutan (Nepheliumlappaceum and country almond (Terminaliacatappa. A significant difference was not observed when mango (Mangiferaindica elephant apple (Dilleniaindica, tulip wood tree (Harpulliaarborea and thungfaa (Alstoniamacrophylla sawdust used as substrate. The lowest yield was observed in thungfaa (Alstoniamacrophylla sawdust. Effect of some additives on the yield was studied and significant difference in yield was observed when rice bran and used-tea leaves used as additives. Effect of rice bran on yield was studied using different ratios of sawdust to rice bran and the highest was observed in 2:1 ratio of sawdust to rice bran. The best incubating temperature for mycelial growth on the substrate was 350C. The composition of the mushroom on a dry weight basis was; 71.4% moisture, 23.35% crude protein and 6% ash. Tested wood species are promising substrates for cultivation of S.communeas cottage industry.

  7. Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

    Science.gov (United States)

    Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

    2018-04-01

    Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

  8. Effects of indoor and outdoor cultivation conditions on 137 Cs concentrations in cultivated mushrooms produced after the Fukushima Daiichi Nuclear Power Plant accident.

    Science.gov (United States)

    Tagami, Keiko; Uchida, Shigeo; Ishii, Nobuyoshi

    2017-01-01

    Radiocesium ( 134 Cs and 137 Cs) in mushrooms has been a matter of public concern after the accident at Fukushima Daiichi Nuclear Power Plant. To minimize the internal dose by ingestion of cultivated mushrooms, the Japanese government set a guideline level with respect to the radiocesium concentration in bed-logs and mushroom beds; however, the effects of indoor and outdoor cultivation methods on radiocesium concentrations in cultivated mushrooms were not clear. The effects of indoor and outdoor cultivation on the radiocesium concentrations in mushroom were examined using published food monitoring data. 137 Cs concentration data in Lentinula edodes from the Aizu area in Fukushima Prefecture and seven prefectures outside Fukushima were used for the analysis. No statistically significant 137 Cs concentration differences were found between these two cultivation methods. Using detected 137 Cs data in shiitake, the geometric means from each prefecture were less than one-quarter of the standard limit (100 Bq kg -1 ) for total radiocesium under both cultivation conditions. It was suspected that re-suspended radiocesium might have been taken up by mushrooms or that radiocesium might have been absorbed into the mushrooms from the soil in the outdoor cultures. However, neither effect was significant for cultivated mushrooms in the areas examined. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  9. Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

    2000-01-01

    Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

  10. The first report on mushroom green mould disease in Croatia.

    Science.gov (United States)

    Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

    2012-12-01

    Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

  11. Interaction of uranium with Pleurotus sp

    International Nuclear Information System (INIS)

    Ohnuki, Toshihiko; Sakamoto, Fuminori; Kozaki, Naofumi; Ozaki, Takuro; Samadfam, Mohammad

    2002-01-01

    Uptake of uranium by higher fungi, such as mushroom is little elucidated. We have studied the interaction of uranium with Pleurotus sp. (a mushroom) in pure culture over a wide range of U concentration (50-3000 mg/L). The Pleurotus sp. was cultured in two different media. One was rice bran medium, and the other was agar (yeast extract, peptone and dextrose) medium. The uptake of uranium in Pleurotus sp. was examined by alpha ray autoradiography (A,A), X-ray fluorescence spectroscopy (XRF) and scanning microcopy (SEM) equipped with EDS. In the agar medium, the higher uranium concentration gave lower growth of mycelia, and no fruiting body was observed. In the rice bran medium, the fruiting body was grown at U concentrations up to 1000 mg/L. The AA and XRF analysis showed that uranium taken up in the fruiting body was below the detection limit. The SEM-EDS analysis indicated that U was distributed in the limited region and was not transported to the mycelia far from U containing medium. It is concluded that uranium affects the growth of Pleurotus sp., and little uranium is taken up by Pleurotus sp. during the growth of both mycelia and fruiting body. (author)

  12. Preparation of culinary-medicinal king oyster mushroom Pleurotus eryngii-fermented products with high ergothioneine content and their taste quality.

    Science.gov (United States)

    Chen, Shih-Yu; Ho, Kung-Jui; Liang, Chih-Hung; Tsai, Ching-Hsuan; Huang, Ling-Yi; Mau, Jeng-Leun

    2012-01-01

    Pleurotus eryngii (DC. : Fr.) Ouel. was used in solid-state fermentation to develop novel mushroom products with a high amount of ergothioneine. The correlation coefficients between ergothioneine content and biomass were 0.8878 and 0.9206 for fermented adlay and buckwheat, respectively. Using optimal conditions, Pleurotus-fermented adlay and buckwheat (PFA and PFB) with the ergothioneine contents of 795.5 and 786.1 mg/ kg, respectively, were prepared. However, mycelia contained the highest ergothioneine content of 1514.6 mg/kg. As a result of SSF by P. eryngii, PFA and PFB contained more taste components than adlay and buckwheat, as evidenced by higher contents of total sugars and polyols, total free amino acids and monosodium glutamate-like components, and total and flavor 5'-nucleotides. In addition, PFB and buckwheat showed comparable equivalent umami concentration (EUC) values, whereas PFA showed a higher EUC value than adlay. Overall, Pleurotus-fermented products with a high amount of ergothioneine will be a novel functional food.

  13. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  14. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  15. ANTIMICROBIAL PROPERTIES OF PLEUROTUS ERYNGII AND LENTINUS EDODES HYDRO-ALCOHOLIC EXTRACTS

    Directory of Open Access Journals (Sweden)

    Gabriela Popa

    2016-11-01

    Full Text Available Besides superior nutritional values mushrooms posed significant medicinal properties. Hydro-alcoholic extracts of several isolates of Pleurotus eryngii and Lentinus edodes mushroom species were investigated for their antimicrobial activities against pathogenic microorganisms with medicinal importance. Antimicrobial activities of the extracts were evaluated by the agar disk diffusion method. Results revealed that the 70% ethylic alcohol extracts have significant inhibitory activities against Bacillus subtilis var. spizizinii, Escherichia coli and Staphylococcus aureus. The results showed that the 70% ethanol extracts of Pleurotus eryngii and Lentinus edodes mushroom isolates may have biopharmaceutical potentiality.

  16. EVALUATION OF GIN WASTE AS A GROWING SUBSTRATE, ENRICHED WITH DIFFERENT VOLUME PERCENTAGE OF THE WHEAT BRAN FOR CULTIVATION OF OYSTER MUSHROOM (PLEUROTUS OSTREATUS

    Directory of Open Access Journals (Sweden)

    M. M. Akhtar

    2016-08-01

    Full Text Available Pleurotusostreatus mushroom was cultivated on cotton gin waste amended with wheat bran in order to judge its growth potential. Two substrates (cotton gin waste and wheat bran were employed alone and with different combinations. Experiment consisted of four treatments T0 (100 % cotton gin waste, T1(97% cotton gin waste + 3% wheat bran, T2(94% cotton gin waste + 6% wheat bran and T3(91% cotton gin waste + 9% wheat bran. Data about time needed for commencement of spawn run, time needed for completion of mycelial growth, time needed for initiation of pinheads, time needed for harvesting of 1st, 2nd and 3rd flush, fresh weight of 1st, 2nd and 3rd flush harvested, total yield, pH of mushroom, total soluble solids of mushroom, acidity and ascorbic acid contents, reducing sugars, non-reducing sugars and total sugars of mushroom, total nitrogen, phosphorus and potassium contents of mushroom was recorded. T0 (100 % cotton gin waste performed better as compared to other treatments.

  17. Use of Irradiation to Extend the Shelf Life of Dried White Oyster Mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Idrus Kadir

    2010-01-01

    Irradiation is an alternative technology to extend the shelf life of food-stuffs. White oyster mushroom (Pleurotus ostreatus) which is a perishable food stuff having a short shelf life. Effects of gamma irradiation at the dose of 5 kGy on the quality of dried white oyster mushroom during storage was observed. The objective of the experiment was to improve the hygienic quality and to extend the shelf life of dried white oyster mushroom using irradiation technology. Fresh mushroom was cleaned, sorted, washed, and drained. The mushroom was then dried in two ways, namely: sun drying method and electrical oven drying method. Dried mushroom was vacuum packed in polypropylene (PP) pouch then irradiated at a of dose 5 kGy and an unirradiated control was also applied. The vacuum packed samples was stored at low temperature (18-20 o C) with a relative humidity (RH) of 65-70% and observed periodically every month up to 3 months of storage. The samples were analyzed according to the following parameters i.e, : total bacterial count, total mould and yeast count, moisture content, pH, a w , contents of protein, fat, carbohydrate, carotenoid and organoleptic properties, respectively. The results showed that irradiation at the dose of 5 kGy could eliminate significantly microbial growth 2 log cycle in the samples, while there were no changes in physico-chemical and organoleptic properties up to 3 months of storage, while control samples were still acceptable only up to 2 months of storage. (author)

  18. Tea waste: an effective and economic substrate for oyster mushroom cultivation.

    Science.gov (United States)

    Yang, Doudou; Liang, Jin; Wang, Yunsheng; Sun, Feng; Tao, Hong; Xu, Qiang; Zhang, Liang; Zhang, Zhengzhu; Ho, Chi-Tang; Wan, Xiaochun

    2016-01-30

    Tea waste is the residue that remains after tea leaves have been extracted by hot water to obtain water-soluble components. The waste contains a re-usable energy substrate and nutrients which may pollute the environment if they are not dealt with appropriately. Other agricultural wastes have been widely studied as substrates for cultivating mushrooms. In the present study, we cultivated oyster mushroom using tea waste as substrate. To study the feasibility of re-using it, tea waste was added to the substrate at different ratios in different experimental groups. Three mushroom strains (39, 71 and YOU) were compared and evaluated. Mycelia growth rate, yield, biological efficiency and growth duration were measured. Substrates with different tea waste ratios showed different growth and yield performance. The substrate containing 40-60% of tea waste resulted in the highest yield. Tea waste could be used as an effective and economic substrate for oyster mushroom cultivation. This study also provided a useful way of dealing with massive amounts of tea waste. © 2015 Society of Chemical Industry.

  19. First study of hormesis effect on mushroom cultivation.

    Science.gov (United States)

    Zied, Diego Cunha; Dourado, Fernanda Aparecida; Dias, Eustáquio Souza; Pardo-Giménez, Arturo

    2017-10-05

    The use of fungicides is common in mushroom cultivation, but no study was carried out applying reduced doses of fungicides in order to increase yield, taking account the hormesis effect. The aim of this manuscript was to verify the effects of different concentrations of fungicides to stimulate the productivity of different strains of Agaricus bisporus. Two stages were developed, an in vitro study to define the best concentration to be applied in the second experiment an agronomic study, which consisted of the application of the selected fungicides, in their respective concentrations, in an experiment carried out in the mushroom chamber. Clearly, the result of the hormesis effect on mushroom cultivation can be verified. The results obtained in the 1st stage of the study (in vitro) were not always reproduced in the 2nd stage of the study (in vivo). The kresoxim methyl active ingredient may be an important chemical agent, while strain ABI 15/01 may be an extremely important biological agent to increase yield in the study of hormesis effects.

  20. Identification and characterization of Trichoderma species aggressive to Pleurotus in Italy

    Institute of Scientific and Technical Information of China (English)

    Woo S L; Di Benedetto P; Senatore M; Abadi K; Gigante S; Soriente I; Ferraioli S; Scala F; Lorito M

    2004-01-01

    @@ In the late 1980's the development of a severe epidemic of green mold caused by Trichoderma spp.was noted in the commercial production of Agaricus bisporus (champignon) in the United Kingdom,North America, Spain and Holland, which caused extensive economic losses. The parasitic fungi isolated from the edible mushroom belonged to four biotypes, Thl, Th2, Th3 and Th4 of T.harzianum. However, among these biotypes, only Th2 (since classified as T. aggressivum f.europaeum) and Th4 (T. aggressivum f. aggressivum) were identified as the fungi causing problems in Agaricus production. In general, mushroom compost hosts both aggressive and innocuous isolates of Trichoderma, which are not morphologically distinguishable. About four years ago, a problem with green mold became apparent in the production of Pleurotus ostreatus in Northern Italy,which eventually developed to a crisis situation in the South two years later and threatened to seriously compromise the Pleurotus market. This study was initiated to: isolate and identify the aggressive fungi, then morphologically, physiologically and genetically characterize the isolates, determine the source and phases of infection, and study methods of control. Samples were obtained from different phases of compost preparation at the locality of a major producer and supplier of compost to the mushroom industry in Southern Italy, and microbial counts were conducted. Although the presence of Trichoderma was detected in the initial stages of composting, this value was reduced to zero from the phase of pasteurization to seeding with Pleurotus. Trichoderma infestations were noted in the packaged Pleurotus bales at various times during the incubation phase (7-15 days after seeding) and after shipping to the mushroom greenhouses, where the pathogen infestations greatly reduced the quality and quantity of the mushroom yield, as well as the number of potential harvest cycles.Preliminary results from the morphological and genetic

  1. Cultivation of Pleurotus sajor-caju on banana stalk and Bahia grass based substrates Cultivo de Pleurotus sajor-caju em substratos a base de grama batatais e engaço de bananeira

    Directory of Open Access Journals (Sweden)

    Félix G de Siqueira

    2011-06-01

    Full Text Available Banana stalks and Bahia grass were utilized as basic starting materials for the production of the mushroom Pleurotus sajor-caju. Banana stalks were combined with other waste or supplement products (wheat bran, coast-cross hay, bean straw and cotton textile mill to obtain different nitrogen concentrations. Since Bahia grass is relatively rich in protein, it was combined with other substrates (banana stalk, coast-cross hay and bean straw to maintain a substrate nitrogen concentration of about 1.5%. Banana stalks and Bahia grass were both more efficient in the production of the mushroom P. sajor-caju when utilized without the addition of other substrates, with biological efficiencies of 74.4% and 74.12%, respectively. When combined with other substrates or grasses, there was a drop in biological efficiency, independent of the concentration of nitrogen. Furthermore, the addition of protein-rich waste to banana stalks resulted in a decrease or absence of fructification, which indicates that high concentrations of nitrogen in the cultivation substrate may hinder the cultivation of this mushroom. On the other hand, results reveal that the ideal concentration of nitrogen may depend on other physicochemical factors and these factors may determine the success in cultivating P. sajor-caju. Therefore, we conclude that P. sajor-caju may be cultivated on banana stalk and Bahia grass as pure substrates, not being necessary their supplementation or combine them with another substrates.O engaço de bananeira e a grama batatais foram utilizados como matérias-primas básicas para a produção do substrato de cultivo do cogumelo Pleurotus sajor-caju. O engaço de bananeira foi combinado com outros resíduos (farelo de trigo, capim "Coast-cross", palha de feijão e resíduo de lixadeira de algodão, com o objetivo de se obter substratos com diferentes concentrações de nitrogênio. Como a grama batatais é relativamente rica em proteína, a mesma foi combinada com

  2. Reduction of energy use in mushroom cultivation; Reductie energiegebruik in de champignonteelt

    Energy Technology Data Exchange (ETDEWEB)

    Baar, J; Amsing, J G.M.; Rutjens, A J

    2005-01-15

    The aim of this project was to examine options for reducing energy use in mushroom cultivation. The project focused particularly on the reduction of energy use in making the mushrooms disease-free through use of steam prior to the next cultivation round. To this end, various methods were examined that could lead to a 50% energy use reduction for mushroom cultivation, or higher [Dutch] Het doel van dit project was om te onderzoeken welke mogelijkheden er zijn om het energiegebruik in de teelt van champignons te verminderen. Met name richtte het project zich op de reductie van het energiegebruik bij het ziektevrij maken van de teeltcellen door stomen voorafgaande aan de volgende teelt. Hiertoe werden diverse methoden onderzocht die kunnen leiden tot een reductie van het energieverbruik van 50% of meer voor de champignonteelt.

  3. The Edibility and Cultivation of the Oyster Mushroom.

    Science.gov (United States)

    Brenneman, James; Guttman, Mark C.

    1994-01-01

    Describes an enjoyable and fascinating experience that involves the cultivation of oyster mushrooms. By allowing students to participate in this process, the students are able to better understand the biology and utility of fungi. (ZWH)

  4. Identification and Control of Cladobotryum spp., Causal Agents of Cobeweb Disease of Cultivated Mushroom

    OpenAIRE

    Ivana Potočnik

    2009-01-01

    Cladobotryum spp. are causal agents of cobweb disease, one of the most serious diseases of cultivated mushroom (Agaricus bisporus (Lange) Imbach) in Serbia and worldwide, which affects product quality and yield. The disease symptoms are: cottony fluffy white or yellowish to pink colonies on mushroom casing, rapid colonization of casing surface, covering of host basidiomata by mycelia, and their decay. Prochloraz-Mn has been officially recommended for mushroom cultivation in EU countries. Howe...

  5. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  6. Bioavailability and Digestibility of Nutrients from the Dried Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Agaricomycetes): In Vivo Experiments.

    Science.gov (United States)

    Regula, Julita; Suliburska, Joanna; Siwulski, Marek

    2016-01-01

    There is a limited number of publications on the bioavailability and digestibility of nutrients contained in macrofungi. The aim of this study was to assess the bioavailability and digestibility of macronutrients using in vivo experiments on laboratory animals. The experiments were conducted with the commercial oyster mushroom Pleurotus ostreatus. Semisynthetic diets were prepared based on the modified AIN-93M diet and were supplemented with 4% and 8% mushroom powder. Between days 4 and 13, apparent digestibility indexes were determined for all animals using the conventional balance method. The hematological indexes-that is, hemoglobin, hematocrit, red blood cells, white blood cells, mean corpuscular volume, mean corpuscular hemoglobin, and mean corpuscular hemoglobin concentration-were determined using a Sysmex K-1000 hematological analyzer. Feeding rats with semisynthetic diets supplemented with dried oyster mushroom had no negative effect on body weight gain or feeding efficiency, expressed in the amount of body weight gain per unit of metabolic energy uptake. Introduction of dried oyster mushroom to the diet resulted in reduced digestibility of the diet and the protein and fat it contained, as well as decreased apparent energy availability. These changes were dependent on the volume of dried mushroom added to the semisynthetic diet. The addition of dried oyster mushroom to the semisynthetic diet considerably reduced passage time through the alimentary tract of rats.

  7. The relationship between lignin peroxidase and manganese peroxidase production capacities and cultivation periods of mushrooms.

    Science.gov (United States)

    Xu, Jian Z; Zhang, Jun L; Hu, Kai H; Zhang, Wei G

    2013-05-01

    Mushrooms are able to secrete lignin peroxidase (LiP) and manganese peroxidase (MnP), and able to use the cellulose as sources of carbon. This article focuses on the relation between peroxidase-secreting capacity and cultivation period of mushrooms with non-laccase activity. Methylene blue and methyl catechol qualitative assay and spectrophotometry quantitative assay show LiP secreting unvaryingly accompanies the MnP secreting in mushroom strains. The growth rates of hyphae are detected by detecting the dry hyphal mass. We link the peroxidase activities to growth rate of mushrooms and then probe into the relationship between them. The results show that there are close relationships between LiP- and/or MnP-secretory capacities and the cultivation periods of mushrooms. The strains with high LiP and MnP activities have short cultivation periods. However, those strains have long cultivation periods because of the low levels of secreted LiP and/or MnP, even no detectable LiP and/or MnP activity. This study provides the first evidence on the imitate relation between the level of secreted LiP and MnP activities and cultivation periods of mushrooms with non-laccase activity. Our study has significantly increased the understanding of the role of LiP and MnP in the growth and development of mushrooms with non-laccase activity. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  8. Determination of polysaccharide yield from the fruiting bodies and mycelium of selected mushroom species

    International Nuclear Information System (INIS)

    Shaiful Azuar Mohamad; Mat Rasol Awang

    2006-01-01

    Numerous polysaccharides and polysaccharides-protein complexes have been isolated from mushrooms and used as a source of therapeutic agents. The mycelium of Pleurotus sajor caju, Pleurotus tuber-regium, black ganoderma, and the fruiting bodies of Pleurotus sajor caju and Pleurotus florida were used to determine the percentage of polysaccharides obtained from the mushroom raw material. Hot water extraction method was used followed by refrigerated centrifuge and lyophilization. The yield from the various species will be compared. (Author)

  9. Mycelial growth observation of Pleurotus eryngii (Higher Basidiomycota In Vitro

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2016-09-01

    Full Text Available Five agro-substrates including date palm fibers (fibrillum, wheat straw, white sawdust and their combinations were investigated to grow Pleurotus eryngii. The longer mycelium complete time within bags was 20 days on sawdust (S4, in contrast, the shorter time for mycelium overgrew was completed after 15 days on date palm fiber (S5. In significant (p<0.05, S5 showed the higher growth intensity level (vigorous growth than other substrates. Thus use of date palm wastes (S5 medium may be useful for successfully cultivation king oyster mushroom in farm.International Journal of Environment Vol.5(3 2016, pp.1-10

  10. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  11. Radiocaesium - 137 in cultivated and woodland mushrooms

    International Nuclear Information System (INIS)

    Stankovic, S.; Stankovic, A.

    1997-01-01

    In the present work the results obtained for activity levels of 137 Cs in samples of cultivated mushrooms (Champignons - Agaricus Silvicola Vitt. Peck.) and woodland fruits ( Chantarelle - Cantarelus Cibarius Fr.; Bollets -Boletus Edulis. ex Fr. and Black Trumpets - Cratarelus Conucopioides) are presented. These samples were collected from 1991 to 1996. Biodiversity of the mushrooms regarding their uptake of radionuclides was found. Thus, the maximum value of 137 Cs activity was found in the sample of dry Bollets 375 Bq/kg in 1993. Moreover, the mean activity level of this species was much higher (126 + - 10 Bq/kg) in 1996. than, levels found in any samples taken from the same environment. (author)

  12. The production of Pleurotus sajor-caju in peach palm leaves (Bactris gasipaes and evaluation of its use to enrich wheat flour

    Directory of Open Access Journals (Sweden)

    Paula Fernanda Bomfim Oliveira Cogorni

    2014-06-01

    Full Text Available The aim of this study was to evaluate of Pleurotus sajor-caju production in peach palm leaves and the addition of different fractions of mushroom powder to wheat flour to increase its nutritional value without changing its characteristics. The best yield (48.4%, biologic efficiency (4.5%, and Pr (0.36 g/day values were obtained using 20% inoculum fraction and 10% rice bran fraction. The Pleurotus sajor-caju fruiting body cultivated under these conditions had the following composition in 100 g: 29.91 g (carbohydrates, 42.92 g (proteins, 1.24 g (lipids, 15.93 g (fibers, 7.42 g (ashes, 1.6 g (phosphorus, 2.7 g (potassium, 8.73 mg (iron, 23.75 mg (sodium, 0.34 mg (thiamine, and 0.57 mg (riboflavin. The wheat flour with mushroom powder had reduced sugar content, but it did not have increased fat content. The fiber, protein, phosphorus, potassium, iron, and riboflavin contents were increased mainly when 10% mushroom powder was added to the wheat flour. Furthermore, this flour does not undergo drastic alterations in its physicochemical characteristics such as in moisture, wet gluten, color, and falling number.

  13. Essential trace elements in edible mushrooms by Neutron Activation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Moura, Patricia L.C.; Maihara, Vera A.; Castro, Lilian P. de [Instituto de Pesquisa e Energetica e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mail: patricialandim@ig.com.br; vmaihara@ipen.br; lilian.Pavanelli@terra.com.br; Figueira, Rubens C.L. [Universidade Cruzeiro do Sul, Sao Paulo, SP (Brazil)]. E-mail: figueiraru@yahoo.com.br

    2007-07-01

    Mushrooms are excellent nutritional sources since they provide proteins, fibers and mineral, such as K, P, Fe. They have also been the focus of medical research. In Brazil mushrooms are not consumed in large quantities by the general population since people know little about the nutritional and medicinal benefits that mushrooms offer. Hence, this study intends to contribute to a better understanding of the essential element content in edible mushrooms, which are currently commercialized in Sao Paulo state. Br Fe, K, Na and Zn concentrations were determined by Instrumental Neutron Activation Analysis in the following mushroom species: Shitake (Lentinus edodes), Shimeji (Pleurotus ssp), Paris Champignon (Agaricus bisporus), Hiratake ( Pleurotus ssp) and Eringue (Pleurotus Eryngu. The mushroom samples were acquired from commercial establishments in the city of Sao Paulo and directly from the producers. Essential element contents in mushrooms varied between Br 0.03 to 4.1 mg/kg; Fe 20 to 267 mg/kg; K 1.2 to 5.3 g/kg, Na 10 to 582 mg/kg and Zn 60 to 120 mg/kg. The results confirm that mushrooms can be considered a good source of K, Fe and Zn. The low Na level is a good nutritional benefit for the consumer. (author)

  14. Influence of Different Supplements on the Commercial Cultivation of Milky White Mushroom

    Science.gov (United States)

    Alam, Nuhu; Amin, Ruhul; Khair, Abul

    2010-01-01

    Calocybe indica, known as milky white mushroom, grows and cultivated in the sub-tropical and temperate zones of South Asia. We investigated the most suitable supplements and their levels for the commercial cultivation of milky white mushroom. Rice bran, maize powder, and wheat bran with their different levels (10, 20, 30, 40, and 50%) were used as supplements to evaluate the yield and yield contributing characteristics of C. indica. Primordia initiation was observed between 13.5 and 19.3 days. The results indicated that the 30% maize powder supplement was effective for producing viable fruiting bodies. The maximum diameters of the pileus and stalk were observed with 30% maize powder. The highest biological and economic yield and biological efficiency were also obtained with 30% maize powder as a supplement. The results indicate that increasing the supplement level resulted in less biological efficiency, and that 30% maize powder was the best supplement level for rice straw substrate to cultivate milky white mushrooms. PMID:23956652

  15. Enhancement of β-Glucan Content in the Cultivation of Cauliflower Mushroom (Sparassis latifolia) by Elicitation.

    Science.gov (United States)

    Park, Hyun; Ka, Kang-Hyeon; Ryu, Sung-Ryul

    2014-03-01

    The effectiveness of three kinds of enzymes (chitinase, β-glucuronidase, and lysing enzyme complex), employed as elicitors to enhance the β-glucan content in the sawdust-based cultivation of cauliflower mushroom (Sparassis latifolia), was examined. The elicitors were applied to the cauliflower mushroom after primordium formation, by spraying the enzyme solutions at three different levels on the sawdust-based medium. Mycelial growth was fully accomplished by the treatments, but the metabolic process during the growth of fruiting bodies was affected. The application of a lysing enzyme resulted in an increase in the β-glucan concentration by up to 31% compared to that of the control. However, the treatment resulted in a decrease in mushroom yield, which necessitated the need to evaluate its economic efficiency. Although we still need to develop a more efficient way for using elicitors to enhance functional metabolites in mushroom cultivation, the results indicate that the elicitation technique can be applied in the cultivation of medicinal/edible mushrooms.

  16. Cultivation of three types of indigenous wild edible mushrooms ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-17

    Dec 17, 2008 ... effects related to their disposal (Mshandete et al., 2008). Cultivation of mushroom can .... The holes facilitated drainage, aeration (free diffusion of gases and .... sium, iron, copper, manganese, zinc and cobalt) were determined.

  17. Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

    Directory of Open Access Journals (Sweden)

    Wei-Jie Wu

    Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

  18. Transition pathway for climate-neutral mushroom cultivation. The agenda for a climate-neutral and economic effective mushroom cultivation in 2020; Transitiepad klimaatneutrale paddenstoelenteelt. De agenda voor een klimaatneutrale en economisch rendabele paddenstoelenteelt in 2020

    Energy Technology Data Exchange (ETDEWEB)

    Suurmeijer, J.M. [Grontmij, Amersfoort (Netherlands); Hilkens, J. [AdVisie, Herkenbosch (Netherlands)

    2011-11-15

    To realize the ambition of climate-neutral and economically viable mushroom cultivation in new businesses as of 2020, a vision and a transition pathway need to be developed. The energy saving options discussed in the report 'Onderzoek naar het energiezuinig paddenstoelenbedrijf anno 2010' ('Study of an energy efficient mushroom cultivation business in 2010') serve as starting point. Three transition pathways have been developed. Each transition pathway contributes to a future-proof mushroom cultivation sector, to increasing energy efficiency or to deployment of sustainable energy in the mushroom cultivation sector [Dutch] Voor het realiseren van de ambitie om vanaf 2020 in nieuwe bedrijven klimaatneutraal en economisch rendabel paddenstoelen te kunnen telen, dient een visie en een transitiepad te worden opgesteld. De energiebesparingsopties uit het rapport 'Onderzoek naar het energiezuinig paddenstoelenbedrijf anno 2010' dienen hierbij als uitgangspunt. Er zijn drie transitiepaden ontwikkeld. Elk transitiepad geeft zijn bijdrage aan een toekomstbestendige paddenstoelensector, aan het verhogen van de energie-efficiency of aan de toepassing van duurzame energie in de paddenstoelensector.

  19. Preliminary studies on productivity of white Pleurotus eryngii isolates in protected cultivation

    Directory of Open Access Journals (Sweden)

    Gian Luigi Rana

    2013-03-01

    Full Text Available Four isolates of Pleurotus eryngii species-complex, originating from different basidiomata growing in a mountainous area of the Basilicata region (southern Italy and characterized by white pileus cuticle (Wh A, Wh B, Wh C, and Wh D were compared, in artificial cultivation conditions, to other isolates of the same mushroom with beige (Be 3, Be 5 or brown cap (Br 1, Br 2 originating from the same area of the former or selected among the commercial ones (Com 142 and Com 164 in order to evaluate their productivity and morphological features. The experiments were carried out in a greenhouse belonging to the Faculty of Agriculture, University of Bari Aldo Moro, in autumn winter 2010-2011, using substrate bags well colonized by P. eryngii mycelium and kept at 4-6°C for 5 months. Wh A and Wh D and, less significantly, Wh C, Be 5 and Com 142, produced a fresh basidioma yield significantly higher than the five other tested isolates (Wh B, Be 3, Br 1, Br 2 and Com 164. Only Com 142 produced the basidiomata of medium and maximum size significantly heavier and with larger pileus diameter than other tested isolates. Com 142 also resulted significantly different, for the basidiomata number/substrate bag, from the white pileus cuticle isolates except for Wh B. All tested isolates concentrated almost all (90-95% of the sporophore yield in the first basidioma flush. No significant differences were found among all tested P. eryngii isolates in terms of yield earliness.

  20. Cultivation experiments on uptake of radionuclides by mushrooms

    International Nuclear Information System (INIS)

    Ban-nai, Tadaaki; Yoshida, Satoshi; Muramatsu, Yasuyuki

    1994-01-01

    After the Chernobyl accident, high concentrations of radiocesium in mushrooms were found in Europe. In our previous studies, we found that 137 Cs concentrations in mushrooms were markedly higher than autotrophic plants. In order to study radionuclide uptake by mushrooms, cultivation experiments in flasks were carried out using radiotracers, 137 Cs, 85 Sr, 60 Co, 54 Mn and 65 Zn. Three mushroom species Hebeloma vinosophyllum, Flammulina velutipes and Coprinus phlyctidosporus were used. In addition, a plant sample, Medicago sativa, was also tested. We found mushrooms tended to accumulate Cs, although there was a large difference between mushroom species. The concentration ratio, which was defined as 'activity of radionuclide in mushroom (Bq/g, wet wt.)' divided by 'activity of radionuclide in medium (Bq/g, wet wt.)', had the highest value of 21 for Cs in H. vinosophyllum. The value was much higher than that in the plant sample. The present findings agreed with previous observations in which Hebeloma species collected in forests contained large amount of 137 Cs. Considerable accumulations were not found for Sr and Co. The concentration ratio of Mn for the mushrooms was about 10, while the ratio of Zn ranged from 15 to 30. The effects of stable elements in the medium on the accumulations were investigated and was found the concentration ratios of Cs, Sr and Co were not influenced highly by coexisting stable elements in the medium. But the concentration ratio of Mn decreased as the amount of coexisting stable elements in the medium was increased. (author)

  1. Decontamination Trials for the Bed-Log Cultivation of Mushroom in Fukushima

    Energy Technology Data Exchange (ETDEWEB)

    Yokota, Kahori; Arai, Shio; Hirano, Yurika; Yoshida, Hirohisa [Graduate School of Urban Environmental Science, Tokyo Metropolitan University, Minami-Osawa, Hachioji, Tokyo 192-0397 (Japan); Ogawa, Hideki [Graduate School of Urban Environmental Science, Tokyo Metropolitan University, Minami-Osawa, Hachioji, Tokyo 192-0397 (Japan); Fukushima Prefectural Forestry Research Centre, Nishi-Shimasaka, Asaka, Koriyama, Fukushima 963-0112 (Japan); Ito, Hirohisa; Kumata, Atsushi [Fukushima Prefectural Forestry Research Centre, Nishi-Shimasaka, Asaka, Koriyama, Fukushima 963-0112 (Japan); Murayama, Kazunari [Macoho Co. Ltd., Nagaoka, Niigata (Japan); Suzuki, Kin-ichi [Abukuma Cooperative for Best Use of Broad-leaved Trees (Japan)

    2014-07-01

    Radioactive nuclear dispersed in environment from Fukushima Dai-ichi Nuclear Power Plant (FNP) Accident-contaminated forests in Fukushima Prefecture, especially in Abukuma mountainous region located 10 to 20 Km west from FNP. Broad-leaved trees such as Quercus serrata, chestnut tree, oak, chinquapin tree, Japanese beech are widely planting in Abukuma area. Many prefectures in Japan depends on supply of bed-log from Fukushima prefecture, especially Abukuma area. North part of Abukuma mountain area has highly contaminated by radioactive nuclear, however, the contamination level in the south part of Abkuma area was about ten times lower than the north part. The outside (bark, leaves and twigs) of broad-leaved trees was highly contaminated above 10,000 Bq/kg in Iidate and Kawamata villages located the north part of Abkuma ears, 35 to 40 km from FNP. On the other hand, the contamination level of the outside of broad-leaved trees in the south part of Abukuma ears was 100-500 Bq/kg and the contamination of the inside tree was lower than 10 Bq/kg. For the bed-log cultivation of mushrooms using broad-leaved trees, two methods were used in Japan. The mushrooms incubated broad-leaved trees (90 cm of length and 15 cm of diameter) were setting in the lack on the ground in forest from winter to autumn. This method was mainly used for the cultivation of shiitake mushroom (Lentinus edodes). The second method was used for Maitake (Grifola frondosa) cultivation. The mushroom incubated broad-leaved trees (20 cm of length and 20 cm of diameter) were setting in the ground holes and covered by soil (2 cm) and litters. The maitake (Grifola frondosa) mushrooms harvesting October 2013 at Iidate, the evaluation area, contained 120 Bq/kg, even though the soil on the broad-leaved trees contained more than 20,000 Bq/kg. The outside contamination of broad-leaved trees supplied from the south part of Abkuma ears were washed by the wet blasting. 80 % of radiocesium on the bark was efficiently

  2. Feasibility Study on Sterilization of Badge using Radiation and Cultivation by Nano-bubble Water for Matsutake Mushroom Cultivation

    International Nuclear Information System (INIS)

    Jung, Inha

    2013-12-01

    This report on the 'Sterilization of Badge using Radiation and Cultivation by Nano-bubble Water for Matsutake Mushroom Cultivation' is belonged to the final report on the preliminary study of the first subject in 2013 for civilian project. This was complimented on the responsible of the Korea Atomic Energy Research Institute for 1 st of June 2013 to 30 th of November 2013. We are going to make sterilization the badge using the gamma ray and supplying the oxygen by nano-bubble oxygen rich water for cultivating the Matsutake Mushroom, instead of the conventional process of sterilization of the badge by hot steam over 120 .deg. C consuming over 8 hours and expensive ventilation system for supplying the fresh air for delivering the oxygen

  3. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  4. Use of medicinal plants in different composts for yield improvement of various strains of oyster mushroom

    International Nuclear Information System (INIS)

    Inam-ul-Haq, M.; Khan, M.N.; Khan, M.A.; Khan, M.A.; Javed, N.; Binyamin, R.; Irshad, G.

    2010-01-01

    Different of concentration of four medicinal plants viz., Eucalyptus camaldulensis, Azadirachta indica, Citrus lemon, Cymbopogon marginatus were investigated for the effect of certain active components in their parts, capable of increasing mushroom yield and controlling mushrooms pathogenic microbes which cause great loss in mushroom yield. Four strains of Oyster mushroom were selected on the basis of their well mycelial growth on MEA. For selection of best compost simple composts were also prepared without any medicinal plant products i.e., cotton, wheat, paddy straw. Corn stover composts and cotton compost gave the maximum yield. The dried leaves of the Citrus lemons, lemon grass and Neem cake (dried) were crushed, and the sawdust of the logs of Eucalyptus were incorporated with different doses of 2%, 3%, 4%, 5% w/w of substrates with cotton substrate before compost fermentation. Each of the compost bag having specific medicinal plant product with specific concentration were spawned with selected four strains of Oyster mushroom i.e., two local strain Pleurotus florida (P-17), Pleurotus ostreatus (P- 19) and two exotic strains Pleurotus (florida) ostreatus (WC536), Pleurotus ostreatus (WC-522). Spawn running and mushroom fruitification were allowed to develop under optimum environmental condition. The mushroom yield data of compost bags with different concentration of medicinal plant products plants were calculated. The results showed that presence of Neem cake and Citrus lemon in the substrate increased the yield of Oyster mushroom strains i.e. Pleurotus florida) ostreatus (WC-536) followed by P. ostreatus (WC-522) strain. Neem cake and Citrus lemon were more promising in improving yield of mushroom. These results led to the conclusion that addition of specific medicinal plants concentration to compost increases the yield of Oyster mushroom by reducing the incidence of microbes and is more preferable than chemicals due to their lethal effects during human

  5. Feasibility Study on Sterilization of Badge using Radiation and Cultivation by Nano-bubble Water for Matsutake Mushroom Cultivation

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Inha

    2013-12-15

    This report on the 'Sterilization of Badge using Radiation and Cultivation by Nano-bubble Water for Matsutake Mushroom Cultivation' is belonged to the final report on the preliminary study of the first subject in 2013 for civilian project. This was complimented on the responsible of the Korea Atomic Energy Research Institute for 1{sup st} of June 2013 to 30{sup th} of November 2013. We are going to make sterilization the badge using the gamma ray and supplying the oxygen by nano-bubble oxygen rich water for cultivating the Matsutake Mushroom, instead of the conventional process of sterilization of the badge by hot steam over 120 .deg. C consuming over 8 hours and expensive ventilation system for supplying the fresh air for delivering the oxygen.

  6. FEATURES OF VENTILATION CONDITIONS BY MUSHROOM CULTIVATION IN MINING UNDERGROUND WORKINGS

    Directory of Open Access Journals (Sweden)

    Vladimir Rendulić

    1991-12-01

    Full Text Available The trial cultivation of mushrooms (Agaricus bisporus in one of the dead faces of the »Krš« pit of the Dalmatian bauxite mines Obrovac proved, that an optimal yield can be attained with the domestic mycelium. The decision has been brought to go on with investments into equipment for new growing-site locations in underground workings of the mine. In order to cultivate high-quality mushrooms, the ventilation of growing sites has been particularly considered. Compressive separate ventilation of growing fields has been applied using the main and the return ventilating pipeline, with the air current regulation according to the growing stage (the paper is published in Croatian.

  7. Dose Response for Monokaryon mycelium of Pleurotus pulmonarius After Acute Gamma Radiation

    International Nuclear Information System (INIS)

    Wan Safina Wan Abdul Razak; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus pulmonarius is locally known as Grey oyster. The species is popular and widely cultivated throughout the world mostly in Asia Europe as their simple and low cost production technology and higher biological efficiency. Mutation induction is an alternative ways for improving available commercial strain for better quality traits. Dose response is important in evaluating effects of mutagenesis via acute gamma radiation. Monokaryon mycelium of Pleurotus pulmonarius was exposed to acute gamma radiation ranged from 0 Gy, 0.1 kGy, 0.2 kGy, 0.3 kGy, 0.4 kGy, 0.5 kGy, 0.6 kGy, 0.7 kGy, 0.8 kGy, 0.9 kGy, 1.0 kGy, 1.5 Gy, 2.0 kGy, 3.0 kGy and 4.0 kGy at dose rate 0.013 kGy/ min. growth performance was measured at 2 days interval to get the LD_5_0. Increasing of the irradiation dose found to decrease the growth performance of the monokaryon mycelium. LD_5_0 was revealed at 1.56 kGy for mono karyon mycelium. Discoveries of the works are important for the improvement of Pleurotus species via acute gamma radiation and benefiting to growers and mushroom industries. (author)

  8. The cultivation of the mushroom Agaricus bisporus (Champignon) and some environmental and health aspects.

    Science.gov (United States)

    Zicari, Giuseppe; Rivetti, Daniela; Soardo, Vincenzo; Cerrato, Elena

    2012-01-01

    The cultivation of the mushroom Agaricus bisporus, also known as button mushroom, requires the use of substrates for its cultivation, such as chicken and/or horse manure and the application of manufacturing steps, such as storage and composting that produce odours. The odours may cause disturbance to people living near the plant and may be a problem for workers. This article examines some measures that can be taken to reduce the odorous emissions during the production of Agaricus bisporus. The possibility of recovery of some organic matter left from the cultivation is examined. Finally, some occupational hazards for workers are highlighted.

  9. Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

    Science.gov (United States)

    Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

    2016-08-01

    This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  10. Disposal of agro-industrial by-products by organic cultivation of the culinary and medicinal mushroom Hypsizygus marmoreus.

    Science.gov (United States)

    Akavia, E; Beharav, A; Wasser, S P; Nevo, E

    2009-05-01

    Organic mushroom cultivation is one of the fastest growing segments of agriculture. At the core of the organic philosophy lies a ban on the use of synthetic fertilizers, pesticides and herbicides, in addition to such tenets as animal welfare, energy efficiency, and social justice. Hypsizygus marmoreus (HM) is a highly praised cultivated culinary and medicinal mushroom. The objective of this paper was to assess the suitability of different spawn media and then the potential of various cultivation substrates to support HM mushroom production compatible with organic standards. This objective was met through the setup of a low-cost cultivation infrastructure. First, seven types of spawn media were tested; then we tested 24 substrates made from organic by-products for their biological efficiency (BE) with strain HM 830, using the liquid inoculation method. The best substrate in terms of BE was corn cob with bran and olive press cake, with a BE of 85.6%. The BE of the same composition but without olive press cake was only 67.5%. The next best substrates were cotton straw combinations with a BE of 31.5-53%. The spent mushroom substrate provides a good method for the disposal of solid waste. The guidance provided in this research complies with organic mushroom cultivation standards and can be used to produce certified organic mushrooms. In addition, it allows responsible and beneficial disposal of a large amount of solid agro-industrial waste.

  11. The cultivation of the mushroom Agaricus bisporus (Champignon): micro-organisms and preservability.

    Science.gov (United States)

    Zicari, Giuseppe; Rivetti, Daniela; Soardo, Vincenzo; Cerrato, Elena; Panata, Marisa

    2011-01-01

    Cultivation of Agaricus bisporus mushrooms requires the use of substrates that are potentially dangerous from the microbiological point of view, such as chicken and horse manure. Microorganisms can pose risks to consumers and workers, and generate lower profits. Packaging of fresh mushrooms with impermeable films is used to extend their shelf life but creates anaerobic and humidity conditions that could favour the growth of microorganisms such as Listeria monocytogenes and Clostridium botulinum. This paper examines some alternatives for packaging fresh mushrooms and the resulting potential microbiological hazards.

  12. Intrastrain Comparison of the Chemical Composition and Antioxidant Activity of an Edible Mushroom, Pleurotus giganteus, and Its Potent Neuritogenic Properties

    Directory of Open Access Journals (Sweden)

    Chia-Wei Phan

    2014-01-01

    Full Text Available Two strains of Pleurotus giganteus (commercial and wild were tested for their ability to induce neurite outgrowth in rat pheochromocytoma (PC12 and mouse neuroblastoma-2a (N2a cells. Treatment with the mushroom extracts resulted in neuronal differentiation and neuronal elongation, but not nerve growth factor (NGF production. Linoleic acid (4.5–5.0%, w/w which is a major fatty acid present in the ethanol extract promoted NGF biosynthesis when augmented with low concentration of NGF (5 ng/mL. The two strains of mushroom were found to be high in protein (154–192 g kg−1, total polysaccharides, phenolics, and flavonoids as well as vitamins B1, B2, and B3. The total phenolics present in the mushroom extracts were positively correlated to the antioxidant activity (free radical scavenging, ferric reducing power, and lipid peroxidation inhibition. To conclude, P. giganteus could potentially be used in well-balanced diet and as a source of dietary antioxidant to promote neuronal health.

  13. Edible Mushroom Cultivation for Food Security and Rural Development in China: Bio-Innovation, Technological Dissemination and Marketing

    OpenAIRE

    Yaoqi Zhang; Wei Geng; Yueqin Shen; Yanling Wang; Yu-Cheng Dai

    2014-01-01

    Mushrooms traditionally collected from forests and now more cultivated have recently become the products of the fifth-largest agricultural sector in China. It was estimated that more than 25 million farmers in China are currently engaged in the collection, cultivation processing and marketing of mushrooms. The total value of mushroom products amounted to 149 billion RMB Yuan (24 billion USD) in 2011. The raw materials have expanded from a few hardwoods to a variety of woods and increasing mor...

  14. Komparasi Laju Pertumbuhan Miselium Jamur Tiram Putih (Pleurotus ostreatus (Jacq. ex Fr Kummer pada Komposisi Media Bibit (F3 dan Baglog yang Berbeda

    Directory of Open Access Journals (Sweden)

    I MADE SUDARMA

    2015-09-01

    Full Text Available The growth rate comparison of white oyster mushroom (Pleurotus ostreatus (Jacq. ex FrKummer mycelium in the composition of different seed (F3 and baglog media . Cultivation ofoyster mushroom (Pleurotus ostreatus (Jacq. ex Fr Kummer has grown rapidly along with the increasein income and health awareness. Oyster mushrooms growing need for media with a particular compositionin order to grow optimally. Oyster mushroom production is determined by the quality of the seeds (F3is used, which is sourced from the media with good quality and composition. The research aimed todetermine the rate of growth of white oyster mushroom mycelium in the different composition of seedmedium (F3 (sawdust: fine bran: corn flour: CaCO3 . The experiments was conducted at nurseriesand oyster mushroom development, Jl. Siulan Gang Zella No. 7 Denpasar, from June to August 2013.Each treatment contained 50 bottles, and 10 bottles only used as a sample, in environmental conditionswith temperature and humidity ranges, 20-29oC and 59-86% respectively . T-test was used todifferentiate the growth rate of white oyster mushroom mycelium with different compositions. Theresults showed that seeds (F3 derived from the growing media composition, sawdust (1 week old:fine bran: corn flour: CaCO3 (10:4:2:0,5 significantly different and better than the composition sawdust(age 1 month : fine bran: corn flour (20:2:1:0.5, with a growth rate of mycelium in a mean 6.14±0.56cm/week and 1,81±0,82 cm/week, respectively. Spawn running in baglog with media composition10:4:2:0.5 was 2.77±1.22cm/week, but with composition media 20:2:1:0.5 mycelium could not grow.Effect of temperature and humidity on the growth rate of white oyster mushroom mycelium in seedmedia (F3 is not significantly.

  15. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation

    International Nuclear Information System (INIS)

    Moda, Evelise Moncaio

    2008-01-01

    The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 ± 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 ± 1 deg C and 90% UR for 8 days. CO 2 was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b * and enzymatic activity values in all treatments at the end of the storage period

  16. Crescimento micelial de Pleurotus ostreatus em resíduo de Simarouba amara Mycelial growth of Pleurotus ostreatus in Simarouba amara sawdust

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2008-11-01

    Full Text Available O objetivo deste trabalho foi avaliar o crescimento micelial do cogumelo Pleurotus ostreatus, cultivado na serragem da espécie madeireira Simarouba amara. Avaliaram-se: o efeito das temperaturas de 22, 25, 27, 30 e 35ºC sobre o crescimento micelial de P. ostreatus, nos meios malte-ágar 3% e SDA-MA (infusão da serragem de S. amara, enriquecida com farelo de soja-dextrose-ágar; e o crescimento micelial em substrato de cultivo de serragem de S. amara, com e sem suplementação de farelo de soja, a 25 e 30ºC. O melhor desenvolvimento de P. ostreatus ocorreu em meio malte-ágar 3% a 25ºC. A suplementação de farelo de soja na serragem de S. amara favorece o crescimento micelial.The objective of this work was to assess the mycelial growth of oyster mushroom (Pleurotus ostreatus cultivated in sawdust of Simarouba amara. Evaluations were made for the effect of temperatures 22, 25, 27, 30 and 35ºC on the mycelial growth of P. ostreatus in 3% malt-agar and SDA-MA (infusion of S. amara sawdust, enriched with soybean meal-dextrose-agar media; and the mycelial growth in cultivation substrate of S. amara sawdust, with and without supplementation of soybean meal, at 25 and 30ºC. The best development of P. ostreatus was in 3% malt-agar medium at 25ºC. Soybean meal supplementation on S. amara sawdust promoted mycelial growth.

  17. Effect of gamma and electron beam irradiation on the physico-chemical and nutritional properties of mushrooms: a review.

    Science.gov (United States)

    Fernandes, Ângela; Antonio, Amilcar L; Oliveira, M Beatriz P P; Martins, Anabela; Ferreira, Isabel C F R

    2012-11-15

    The short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. Thus, prolonging postharvest storage, while preserving their quality, would benefit the mushroom industry as well as consumers. There has been extensive research on finding the most appropriate technology for mushrooms preservation. Gamma, electron-beam and UV irradiation have been shown to be potential tools in extending the postharvest shelf-life of fresh mushrooms. Studies evaluating the effects of ionizing radiation are available mainly in cultivated species such as Agaricus bisporus, Lentinus edodes and Pleurotus ostreatus. This review comprises a comprehensive study of the effects of irradiation on physico-chemical parameters (weight, colour, texture and pH), chemical compounds including nutrients (proteins, sugars and vitamins) and non-nutrients (phenolics, flavonoids and flavour compounds), and on biochemical parameters such as enzymatic activity of mushrooms for different species and from different regions of the world. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Growth and fruit body formation of Pleurotus ostreatus on media supplemented with inorganic selenium

    Directory of Open Access Journals (Sweden)

    Savić Milena D.

    2009-01-01

    Full Text Available Selenium is a trace mineral chemically related to sulfur and tellurium. In the body selenium combines with protein molecules to form selenoproteins and it is distributed in low concentrations and unequally in air, soil and water all over the world. Edible mushrooms are known to be selenium accumulators. Since mushrooms contain relatively high protein levels, and they can accumulate large amounts of selenium, it is reasonable to expect that selenium could be incorporated into proteins. The growth of mycelia and fruit body formation of different medicinal mushroom strains of Pleurotus ostreatus (Hk-35 and P70 over the wide range of concentrations of inorganic form of selenium were examined. Mushrooms were cultivated on agar base media and on substrates based on sawdust. Vegetative growths of mycelium were measured as colony diameter in pure cultures supplemented with inorganic form of Se supplements, prepared as Na2SeO4 and Na2SeO3 in concentrations of: 1, 10, 25, 50, 75, 100 and 150 mg/l. Inorganic form of Se supplements, showed stimulation effects (in concentration of 1-50 mg/l and toxic effects in higher concentration. On the standard industrial sawdust based substrate, supplemented with 100 mg/kg Na2SeO4 and Na2SeO3, accumulation of Se in fruit bodies was determined by the method of flameless atomic absorption spectrophotometer. The readings were performed on Varian SpectrAA-10 spectrophotometer equipped with VGA-76. Se as Na2SeO4 and Na2SeO3 was effectively taken up from substrates and accumulated in fruit bodies. Mushrooms accumulated selenium between 120 and 250 mg/kg dry weight. In mushrooms cultivated without Se supplement, Se contents were only about 1 mg/kg and in substrate about 0.1 mg/kg.

  19. Bioremediation of industrial waste through mushroom cultivation.

    Science.gov (United States)

    Kulshreshtha, Shweta; Mathur, Nupur; Bhatnagar, Pradeep; Jain, B L

    2010-07-01

    Handmade paper and cardboard industries are involved in processing of cellulosic and ligno-cellulosic substances for making paper by hand or simple machinery. In the present study solid sludge and effluent of both cardboard and handmade paper industries was collected for developing a mushroom cultivation technique to achieve zero waste discharges. Findings of present research work reveals that when 50% paper industries waste is used by mixing with 50% (w/w) wheat straw, significant increase (96.38%) in biological efficiency over control of wheat straw was observed. Further, cultivated basidiocarps showed normal morphology of stipe and pileus. Cross section of lamellae did not show any abnormality in the attachment of basidiospores, hymenal trama and basidium. No toxicity was found when fruiting bodies were tested chemically.

  20. Identification and Control of Cladobotryum spp., Causal Agents of Cobeweb Disease of Cultivated Mushroom

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2009-01-01

    Full Text Available Cladobotryum spp. are causal agents of cobweb disease, one of the most serious diseases of cultivated mushroom (Agaricus bisporus (Lange Imbach in Serbia and worldwide, which affects product quality and yield. The disease symptoms are: cottony fluffy white oryellowish to pink colonies on mushroom casing, rapid colonization of casing surface, covering of host basidiomata by mycelia, and their decay. Prochloraz-Mn has been officially recommended for mushroom cultivation in EU countries. However, inefficiency of prochloraz-Mn has been noted at a level of spotting symptoms of cobweb disease. With regard to cases of resistance evolution and a general threat to the environment and human health, special attention should be focused on good programmes of hygiene, and inventing and developing alternative methods of disease control.

  1. Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

    Science.gov (United States)

    This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

  2. Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

    2014-09-03

    Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

  3. Production of exopolysaccharides in submerged cultures of gamma irradiation pleurotus ostreatus

    International Nuclear Information System (INIS)

    Khalaf, M.A.; Atia, A.I.

    2009-01-01

    Mushrooms have become attractive as a functional food and as a source for the development of drugs and nutraceuticals. Pleurotus ostreatus is considered as the best among them. The exopolysaccharides (EPS) of mushrooms demonstrated a strong antitumor and antioxidant action. However, there is little information available in the literature about the optimization of fermentation conditions for production of EPS by P. ostreatus. So, the effect of medium composition and fermentation parameters on mycelial growth and EPS production by gamma irradiated isolate of P. ostreatus were investigated in shake-flask cultures. The economical optimum fermentation parameters for the highest EPS production 5.73 g/l and mycelial growth rate 11.8 g/l were achieved at initial ph 6, cultivation temperature 28 C(degree), 20 g/l sucrose, 4 g/l yeast extract, 50 ml of medium working volume in a 250 ml flask, and 6% (v/v) of inoculum size after 10 and 12 days, respectively. EPS produced, in this study, showed strong antioxidant activity (96.3%) at concentration 10 mg/ml.

  4. Evaluation of 222radon occupational exposure in underground workplaces: tunnels used for mushroom cultivation in Italy

    International Nuclear Information System (INIS)

    Fontana, C.; Vecchiariello, S.; Angeloni, U.; Trevisi, R.; Tonnarini, S.

    2006-01-01

    The mushroom cultivation in tunnels represents a working activity with interesting characteristics from a radiological protection point of view. The practice of using tunnels or caves for the cultivation of mushrooms is diffused in many countries as well as in several Italian regions. These places are characterized by micro climate conditions (temperature, humidity, etc.) particularly adapted for the growth of mushrooms in every period of the year. This practice, like every working activity carried out in underground workplaces, is regulated by the Italian implementation of the European Union Basic Safety Standards (E.U. B.S.S., 1996). With the aim to evaluate the 222 Rn exposure of workers in tunnels used for mushroom cultivation, a study has been undertaken. In particular, hygienic and micro climatic characteristics (depth, temperature, relative humidity, barometric pressure, ventilation, etc.) and radiometric parameters (indoor radon concentration, radon decay products concentration, equilibrium factor F) have been investigated. In the present paper, the results of the two steps of the study are reported. In the first step, an operative protocol has been defined: the protocol was put through a series of measurements in two tuff tunnels in the area of Rome. In the second step, several tunnels used for mushroom cultivation, located in different Italian regions, have been monitored and experimental data have been used to estimate annual effective doses of workers due to radon inhalation.The experimental results have been analyzed in the context of the E.U. B.S.S

  5. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  6. Determination of cesium and selenium in cultivated mushrooms using radionuclide X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Racz, L.; Bumbalova, A.; Harangozo, M.; Toelgyessy, J.; Tomecek, O.

    2000-01-01

    Cesium and selenium intake of cultivated mushrooms (Agaricus bisporus), with these elements previously added to culture medium, has been examined from the viewpoint of health- and environmental protection. The process of measuring has been carried out by the radionuclide X-ray fluorescence technique. Treatments of the elementary substance with Se salt appears to influence the Se content of the mushrooms to a significant extent. Cs intake is of considerable importance, as this element is accumulated by mushrooms. (author)

  7. Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

    Science.gov (United States)

    Jayakumar, T; Ramesh, E; Geraldine, P

    2006-12-01

    This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (pSALP) compared to controls. In the liver, significantly elevated levels (pSALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

  8. Anti-Growth Factors Associated with Pleurotus ostreatus in a Submerged Liquid Fermentation

    Directory of Open Access Journals (Sweden)

    Juliet B. Akinyele

    2012-09-01

    Full Text Available Aims: Previous studies had revealed that cultivation of Pleurotus ostreatus is often met with a lot of challenges ranging from environmental to biological factors which adversely affect the successful cultivation of the mushroom. Hence, a need to determine factors against mycelia colonization of substrate during mushroom’s cultivation.Methodology and Result: Conventional streak method was employed to establish the percentage inhibition as well as intercolony distance between the test organisms obtained from the infected substrate and mycelia of the mushroom during substrate colonization. The test organisms are: a fungus, Kutilakesopsis macalpineae and a bacterium,Pseudomonas tolaasii. The effect of pH and temperature on the mycelia growth of P. ostreatus was also investigated. There was a gradual increase in the percentage inhibition from 33.3 % at 24 h to 75.0 % at 168 h for K. macalpineae and 37.5 % at 24 h to 70.0 at 168 h for P. tolaasii. The inter-colony distance between the antagonists and the mushroom mycelium gradually decreased. Optical density of the mycelium growth was at its optimum at pH 4.5 and temperature of25 °C respectively. In vitro study also showed a significant increase in the optical density from 0.855±0.03 at 24 h to 1.316±0.02 at 168 h in the absence of test antagonist as against 0.812±0.06 and 0.79±0.02 at 24 h to 1.103±0.03 and 0.902±0.03 at 168 h when K. macalpineae and P.tolaasii were used as test antagonistic respectively.Conclusion, significance and impact of study: Sterilization of substrate is essential to avoid contamination during mycelia colonization. Also, slightly acidic medium and temperature control is necessary for high yield of fruit bodies.

  9. Effect of substrate on the growth, nutritional and bioactive ...

    African Journals Online (AJOL)

    rosemary

    2016-07-06

    Jul 6, 2016 ... growth, determining nutritional and bioactive components of two oyster mushroom, Pleurotus ostreatus and. Pleurotus ... and the method of cultivation are of major importance ..... rendered alkaline with a few drops of ammonia solution. 5 ..... production and non-enzymatic antioxidant activity of Pleurotus.

  10. Inhibiting effect of bioactive metabolites produced by mushroom cultivation on bacterial quorum sensing-regulated behaviors.

    Science.gov (United States)

    Zhu, Hu; Wang, Shou-Xian; Zhang, Shuai-Shuai; Cao, Chun-Xu

    2011-01-01

    This study aimed to search for novel quorum sensing (QS) inhibitors from mushroom and to analyze their inhibitory activity, with a view to their possible use in controlling detrimental infections. The bioactive metabolites produced by mushroom cultivation were tested for their abilities to inhibit QS-regulated behavior. All mushroom strains were cultivated in potato-dextrose medium by large-scale submerged fermentation. The culture supernatant was condensed into 0.2 vol by freeze-drying. The condensed supernatant was sterilized by filtration through a 0.22-μm membrane filter and added to Chromobacterium violaceum CV026 cultures, which were used to monitor QS inhibition. Inhibitory activity was measured by quantifying violacein production using a microplate reader. The results have revealed that, of 102 mushroom strains, the bioactive metabolites produced by 14 basidiomycetes were found to inhibit violacein production, a QS-regulated behavior in C. violaceum. Higher fungi can produce QS-inhibitory compounds. Copyright © 2011 S. Karger AG, Basel.

  11. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  12. Evaluation of {sup 222}radon occupational exposure in underground workplaces: tunnels used for mushroom cultivation in Italy

    Energy Technology Data Exchange (ETDEWEB)

    Fontana, C.; Vecchiariello, S.; Angeloni, U. [Laboratory of Environmental Radioactivity - Central Laboratory, ITALIAN RED CROSS, Rome (Italy); Trevisi, R.; Tonnarini, S. [Radon Measurement Laboratory - Department of Occupational Hygiene, ISPESL, Rome (Italy)

    2006-07-01

    The mushroom cultivation in tunnels represents a working activity with interesting characteristics from a radiological protection point of view. The practice of using tunnels or caves for the cultivation of mushrooms is diffused in many countries as well as in several Italian regions. These places are characterized by micro climate conditions (temperature, humidity, etc.) particularly adapted for the growth of mushrooms in every period of the year. This practice, like every working activity carried out in underground workplaces, is regulated by the Italian implementation of the European Union Basic Safety Standards (E.U. B.S.S., 1996). With the aim to evaluate the {sup 222}Rn exposure of workers in tunnels used for mushroom cultivation, a study has been undertaken. In particular, hygienic and micro climatic characteristics (depth, temperature, relative humidity, barometric pressure, ventilation, etc.) and radiometric parameters (indoor radon concentration, radon decay products concentration, equilibrium factor F) have been investigated. In the present paper, the results of the two steps of the study are reported. In the first step, an operative protocol has been defined: the protocol was put through a series of measurements in two tuff tunnels in the area of Rome. In the second step, several tunnels used for mushroom cultivation, located in different Italian regions, have been monitored and experimental data have been used to estimate annual effective doses of workers due to radon inhalation.The experimental results have been analyzed in the context of the E.U. B.S.S.

  13. Antinociceptive effect of Pleurotus ostreatus (Oyster Mushroom ...

    African Journals Online (AJOL)

    PROF HORSFALL

    pattern by comparing it with a standard drug and a control using the hot water based flick tail test. Thirty five ... groups two, three and four were treated with 100, 200 and 400 mg/kg of Pleurotus ostreatus aqueous ... Abnormalities in the nervous system may also cause ... During this period, they were covered with wire gauze,.

  14. SYNTHESIS OF AROMA COMPOUNDS BY Pleurotus ostreatus (Jacq.:Fr. Kumm. CULTURED ON VARIOUS SUBSTRATES E. N. Vlasenko, J. V. Stepnevskaya, O. V.

    Directory of Open Access Journals (Sweden)

    E. N. Vlasenko

    2017-08-01

    Full Text Available The aim of the study was to determine the intensity of synthesis of volatile aroma compounds by Pleurotus ostreatus (oyster mushroom on sunflower husks and barley straw using sensory profile analysis and UV spectroscopy. The main cultural and morphological characteristics of the mycelial growth and development of fruiting bodies are determined: the period of mycelial development on the substrate, the time of primordial formation, the number of mushroom bunches per unit volume of substrate, the morphology of carpophores. Characteristic attributes of the aroma of dried fruiting bodies (mushroom, woody, sweet, herbaceous, fish, meat, floral, earthy, acidic, putrescent are established and their aroma profiles are built. Sensory profile analysis of flavor of dried samples showed that the mushroom flavor of fungi cultivated on the sunflower husk is more pronounced than of those grown on barley straw. The light absorption maxima are recorded in the ranges 204–210 and 250–290 nm according to UV absorption spectra. Optimal conditions for extracting aromatics from dried fungi samples are the extraction time of 20–35 min at the boiling point of the solvent. Analysis of the UV spectra of fungal alcohol and hexane extracts showed that the intensity of the synthesis of volatile compounds is higher for strains cultivated on sunflower husks than for samples obtained on barley straw.

  15. Determination of Cr, Cu, Fe, Ni, Pb and Zn by ICP-OES in mushroom samples from Sakarya, Turkey

    Directory of Open Access Journals (Sweden)

    Esra Altıntığ

    2017-06-01

    Full Text Available Russula cyanoxantha, Russula delica, Lactarius salmonicolor, Lactarius deliciosus, Pleurotus eryngii, Pleurotus ostreatus, Agaricus bisporus, Suillus luteus, Pleurotus spp and Boletus edulis were collected from Sakarya-Turkey respectively. Also canned food in the form of the Pleurotus eryngii, Pleurotus ostreatus, and Lactarius salmonicolor mushrooms were used for the examination. Trace metal concentrations found in these mushrooms were determined inductively using coupled plasma optic emission spectrometry microwave processes. The results were obtained for (Cr 0.3-26.65, (Cu 17.38-132.75, (Fe 26.3-225.40, (Ni 2.57-39.28, (Pb 11.52-185.20, and (Zn 22.86-126.84 mg/kg. The accuracy of the method was checked by the standard reference material; tea leaves (INCY-TL-1 and tomato leaves (1573a.

  16. Effects of Cooking and In Vitro Digestion on Antioxidant Properties and Cytotoxicity of the Culinary-Medicinal Mushroom Pleurotus ostreatoroseus (Agaricomycetes).

    Science.gov (United States)

    Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2018-01-01

    In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.

  17. Application of Hazard Analysis and Critical Control Points (HACCP) to the Cultivation Line of Mushroom and Other Cultivated Edible Fungi.

    Science.gov (United States)

    Pardo, José E; de Figueirêdo, Vinícius Reis; Alvarez-Ortí, Manuel; Zied, Diego C; Peñaranda, Jesús A; Dias, Eustáquio Souza; Pardo-Giménez, Arturo

    2013-09-01

    The Hazard analysis and critical control points (HACCP) is a preventive system which seeks to ensure food safety and security. It allows product protection and correction of errors, improves the costs derived from quality defects and reduces the final overcontrol. In this paper, the system is applied to the line of cultivation of mushrooms and other edible cultivated fungi. From all stages of the process, only the reception of covering materials (stage 1) and compost (stage 3), the pre-fruiting and induction (step 6) and the harvest (stage 7) have been considered as critical control point (CCP). The main hazards found were the presence of unauthorized phytosanitary products or above the permitted dose (stages 6 and 7), and the presence of pathogenic bacteria (stages 1 and 3) and/or heavy metals (stage 3). The implementation of this knowledge will allow the self-control of their productions based on the system HACCP to any plant dedicated to mushroom or other edible fungi cultivation.

  18. Yield and nutritional composition of oyster mushroom strains newly introduced in Bangladesh Produtividade e composição nutricional de linhagens de cogumelo‑ostra recentemente lançadas em Bangladesh

    Directory of Open Access Journals (Sweden)

    Mostak Ahmed

    2013-02-01

    Full Text Available The objective of this work was to evaluate yield and chemical composition of oyster mushroom strains newly introduced in Bangladesh. Strains of Pleurotus high‑king (strain PHK, P. ostreatus (strain PO2, and P. geesteranus (strains PG1 and PG3 were evaluated as to yield components and proximate composition. Pleurotus ostreatus was used as control. Pleurotus high‑king showed fastest growth of primordia, but moderate flush of effective fruiting bodies. Pleurotus geesteranus (PG1 showed higher economic yield and biological performance, and better chemical composition, especially in terms of protein and mineral contents. Pleurotus geesteranus (PG1 shows better performance than P. ostreatus (PO2, the most commercially cultivated edible species in Bangladesh, and, therefore, it should be recommended for commercial cultivation.O objetivo deste trabalho foi avaliar a produtividade e a composição química de linhagens de cogumelo‑ostra introduzidas recentemente em Bangladesh. Linhagens de Pleurotus high‑king (linhagem PHK, P. ostreatus (linhagem PO2 e P. geesteranus (linhagens PG1 e PG3 foram avaliadas quanto aos componentes da produção e à composição proximal. Pleurotus ostreatus foi utilizado como controle. Pleurotus high‑king apresentou rápido crescimento de primórdios, mas fluxo moderado de corpos de frutificação efetivos. Pleurotus geesteranus (PG1 apresentou maior produtividade econômica e desempenho biológico, além de melhor composição química, especialmente em termos de conteúdos de proteína e minerais. Pleurotus geesteranus (PG1 apresenta melhor desempenho que P. ostreatus (linhagem PO2, a espécie comestível mais cultivada comercialmente em Bangladesh, e, portanto, deve ser recomendado para plantio comercial.

  19. Studies on the aroma of different species and strains of Pleurotus measured by GC/MS, sensory analysis and electronic nose

    OpenAIRE

    Renata Zawirska-Wojtasiak; Marek Siwulski; Sylwia Mildner-Szkudlarz; Erwin Wąsowicz

    2009-01-01

    The aroma of several strains of Pleurotus ostreatus, Pleurotus citrinopileatus and Pleurotus djamor was studied by GC/MS. Three main mushrooms aroma constituents: 3-octanol, 3-octanone and 1-octen-3-ol were taken into account for quantitative measurements. The highest amount of 1-octen-3-ol was recorded in P. ostreatus, while considerably lower amounts in P. citrinopileatus. Sensory profile analysis as well as the electronic nose also varied between the three species of Pleurotus. Chiral gas ...

  20. Mutation Induction In White Oyster Mushroom (Pleurotus Ostreatus) Using GAMMA Irradiation And Analyzing Genetic Diversity Of Induced Mutants By RAPD.PCR

    International Nuclear Information System (INIS)

    Mohammed, H.M; Soliman, S.S.A; Shawky, A.S.H; Mahgoub, E.M.I

    2013-01-01

    The present study aimed to understand the effect of gamma rays on three strains of white oyster mushroom Pleurotus ostreatus and induction of new benefit mutants. Five different doses, i.e., 0.25,0.5,0.75, and 1.00 KGy of gamma rays were used. Twelve morphological criteria were measured. The result confirmed the existence of different response of three strains to different doses of radiation. The 21 strain as a control, the first flush was misshapen, but the second flush gave normal fruit, while mutant Po 21-3 gave excellent growth performance for the shape, colour, fruit diameter and stem length, while slightly decrease in wet and dry total matter per bag and flushes numbers were found.The po 21-2 mutant considered as important mutant because slightly increased in wet and dry total matter than the control, and had short stem length. This mutant Po 21 -2 gave spores, while the control was sporeless. Control of strain 22 possessed good performance for fruit characterization but it forms fruits less than its primordial it formed (semi maturation less strain) per bag, While po 22-l and Po 22-2 appeared good performance, in addition high yielding as wet and dry total matter and faster flushing. The control of strain 66 had a good growth performance, and the four mutants for this strain is very good too they had excellent growth performance; Po 66-1 and Po 66-3 mutants had significant and highly significant values for wet matter than the control (21.04, 21.64 and 12.27) for (Po 66-1, Po 66-4, control). As well as more important criteria there were taken as short fruit stem length and fruit number/bag. These results confirmed the important of Po 66-4 followed by po 66-1 in next breeding and production programs for white oyster mushroom (Pleurotus ostreatus).the RAPD PCR results showed the oligonucleotide OPB-10, OPA-05 and OPC-02 presented the highest percentage of RAPD polymorphism (80⁒, 80⁒, 66.6⁒). The pattern obtained with OPB-10 oligonucleotide for strains

  1. Optimization of humidifying procedure in controlled environment for ...

    African Journals Online (AJOL)

    hp

    2016-11-09

    Nov 9, 2016 ... humidifying treatment had influenced the mushroom growth in ..... small water which is heavier than vapour and condense on floor very .... Indoor Mushroom Cultivation of Grey Oyster (Pleurotus pulmonarius) by Different ...

  2. Antioxidant properties of mushroom mycelia obtained by batch cultivation and tocopherol content affected by extraction procedures.

    Science.gov (United States)

    Vamanu, Emanuel

    2014-01-01

    The determination of the antioxidant potential of lyophilized mushroom mycelia from 5 strains of the species Pleurotus ostreatus and Coprinus comatus (obtained by submerged cultivation in batch system) was analyzed as ethanolic extracts by evaluating ABTS and the hydroxyl scavenging activity, FRAP method, the chelating capacity, the inhibition of human erythrocyte hemolysis, and the inhibition of xanthine oxidase activity. The main compounds present in all extracts were determined by HPLC chromatography. Overall, results demonstrated that the biologically active substances content is modulated by the extraction method used. The most beneficial extract, characterized by determining the EC50 value, was that of C. comatus M8102, followed by P. ostreatus PQMZ91109. Significant amount of α-tocopherol (179.51 ± 1.51 mg/100 g extract) was determined as well as flavones such as rutin and apigenin. In the P. ostreatus PQMZ91109 extract, 4.8 ± 0.05 mg/100 g extract of tocopherol acetate known to play a significant role as an antioxidant in skin protection against oxidative stress generated by UV rays was determined. The various correlations (r (2) = 0.7665-0.9426 for tocopherol content) assessed and the composition of extracts in fluidized bed from the mycelia of the tested species depicted a significant pharmacological potential as well as the possibility of usage in the development of new functional products.

  3. Accumulation of Heavy Metals by Wild Mushrooms in Ibadan, Nigeria

    OpenAIRE

    Chinatu Charity Ndimele; Prince Emeka Ndimele; Kanayo Stephen Chukwuka

    2017-01-01

    Background. Many companies in Nigeria generate industrial effluents, including heavy metals. These metals can be accumulated by biota such as mushrooms, which are then eaten by the populace. Objectives. The present study investigates the metal content of wild mushrooms in order to educate the local population on the safety of their consumption. Methods. Seven different species of wild mushrooms (Cortinarius melliolens, Chlorophyllum brunneum, Pleurotus florida, Volvariella speciosa, Can...

  4. Morphological and molecular identification of four Brazilian commercial isolates of Pleurotus spp. and cultivation on corncob

    Directory of Open Access Journals (Sweden)

    Nelson Menolli Junior

    2010-04-01

    Full Text Available The species of Pleurotus have great commercial importance and adaptability for growth and fructification within a wide variety of agro-industrial lignocellulosic wastes. In this study, two substrates prepared from ground corncobs supplemented with rice bran and charcoal were tested for mycelium growth kinetics in test tubes and for the cultivation of four Pleurotus commercial isolates in polypropylene bags. The identification of the isolates was based on the morphology of the basidiomata obtained and on sequencing of the LSU rDNA gene. Three isolates were identified as P. ostreatus, and one was identified as P. djamor. All isolates had better in-depth mycelium development in the charcoal-supplemented substrate. In the cultivation experiment, the isolates reacted differently to the two substrates. One isolate showed particularly high growth on the substrate containing charcoal.Espécies de Pleurotus têm grande importância comercial e adaptabilidade para crescimento e frutificação em uma ampla variedade de resíduos agro-industriais lignocelulósicos. Neste trabalho foram testados dois substratos à base de sabugo de milho triturado, suplementados com farelo de arroz e carvão vegetal, para avaliação da cinética de crescimento micelial em tubos de ensaio e produção em sacos de polipropileno, utilizando quatro isolados comerciais. O estudo taxonômico foi realizado com a análise da morfologia dos basidiomas obtidos em cultivo e pelo seqüenciamento do gene nLSU do DNAr, para certificar a identificação taxonômica. Os isolados tiveram melhor desenvolvimento micelial em profundidade no substrato suplementado com carvão vegetal. Em relação à produção, os isolados reagiram de formas distintas em função dos substratos, sendo significativamente melhor o substrato contendo carvão. Três isolados foram identificados como P. ostreatus e o outro foi identificado como P. djamor.

  5. Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    2012-12-01

    Full Text Available The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse. The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase and hydrolytic enzymes (cellulases, xylanases and tanases. Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6. These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes.

  6. Essential and toxic element determination in edible mushrooms by neutron activation analysis

    International Nuclear Information System (INIS)

    Moura, Patricia Landim da Costa

    2008-01-01

    In this study concentrations of As, Br, Co, Cr, Cs, Fe, K, Na, Rb, Se and Zn were determined in edible mushrooms acquired from commercial establishments in the city of Sao Paulo and directly from Mogi das Cruzes, Suzano, Juquitiba and Mirandopolis producers. The analytical technique used for determining these elements in edible mushrooms was Instrumental Neutron Activation Analysis (INAA). Species of the Agaricus, Lentinus and Pleurotus genera were acquired during the period from November, 2006 to March, 2007. About 150 to 200 mg of freeze-dried mushrooms were irradiated in a neutron flux of 1012 cm -2 s -1 for 8 hours in the IEA-R1 nuclear research reactor at IPEN-CNEN-SP. In order to evaluate the precision and accuracy of the methodology, four reference materials: INCT-MPH-2 Mixed Polish Herbs and INCT-TL-1 Tea Leaves, NIST SRM 1577b Bovine Liver, and the material Mushroom from IAEA were analyzed. Results showed some variation in the element concentrations among the different genera. In some samples, arsenic was found but in low concentrations. Arsenic is probably derived from the contamination from pesticides used in the cultivation, in their the substrates where mushrooms uptake their nutrients. Although there are element concentration variations, mushrooms can still be considered a very rich nutritional source, mainly because of their low concentrations of Na, and due to the good source of K, Fe and Zn. (author)

  7. Unraveling the mystery of commercial cultivation of Agaricus bisporus : plant biomass utilization and its effect on mushroom production

    NARCIS (Netherlands)

    Patyshakuliyeva, A.

    2015-01-01

    Agaricus bisporus, the white button mushroom, is economically the most important mushroom cultivated worldwide. Growth of A. bisporus needs a substrate produced by the composting of animal manure, wheat straw, gypsum, water and different additives. Therefore lignocellulose which is a complex mixture

  8. Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...

    African Journals Online (AJOL)

    2012r

    2014-09-24

    Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.

  9. Failure of the cultivated mushroom (Agaricus bisporus) to induce tumors in the A/J mouse lung tumor model

    DEFF Research Database (Denmark)

    Pilegaard, Kirsten; Kristiansen, E.; Meyer, Otto A.

    1997-01-01

    We studied whether the cultivated mushroom (Agaricus bisporus) or 4-(carboxy)phenylhydrazine (CP) induce lung adenomas in the A/J mouse lung tumor model. For 26 weeks female mice were fed a semisynthetic diet where 11 or 22% of the diet was replaced by freeze-dried mushrooms. The intake...... of the mushroom diets was equivalent to an intake of agaritine, the major phenylhydrazine derivative occurring in the mushroom, of 92 or 166 mg/kg body weight per day. The intake of CP was 106 mg/kg body weight per day. Neither the;freeze-dried mushroom nor CP induced statistically significant increased numbers...

  10. Composição mineral de uma linhagem de Pleurotus ostreatus cultivada em resíduos madeireiros e agroindustriais da região amazônica Mineral composition of Pleurotus ostreatus strain grown in wood and agroindustrial residues from the Amazon region

    Directory of Open Access Journals (Sweden)

    Ceci Sales-Campos

    2009-12-01

    Full Text Available Os cogumelos do gênero Pleurotus são cultivados em diversos substratos lignocelulósicos, dada a atividade decompositora desses organismos proveniente de seu metabolismo enzimático. O presente estudo teve como objetivo analisar a composição mineral de Pleurotus ostreatus e dos substratos de cultivo preparados à base de resíduos madeireiros e agroindustriais da região amazônica. Foram analisados macro (P, K, Ca e Mg e micronutrientes (Fe, Zn, Cu, Mn e Na dos cogumelos e dos substratos. Os substratos foram formulados a partir da serragem de Simarouba amara Aubl. (marupá, Ochroma piramidale Cav. ex. Lam. (pau de balsa e de bagaços de Bactris gasipaes Kunth (pupunheira e de Saccharum officinarum (cana-de-açúcar. As amostras foram solubilizadas mediante digestão ácida (nítrico-peridrol. Os elementos Ca, Mg, Fe, Cu, Zn e Mn foram determinados por espectrometria de absorção atômica; o Na e K, por emissão atômica e o P, por colorimetria. A composição mineral do cogumelo variou com o substrato de cultivo. Os diferentes substratos possibilitaram a produção de um cogumelo rico em K, P, Mg e Fe, essenciais à nutrição e à saúde humana. O potássio foi o mineral de maior teor no cogumelo em todos os substratos testados (36,83-42,18 g.kg-1, seguido de fósforo (6,95-10,60 g.kg-1 e do magnésio (1,57-2,50 g.kg-1.Mushrooms belonging to the Pleurotus gender are grown in several lignocellulosic substrates due to the decomposing activity of these organisms that result from their enzymatic metabolism. The objective of the present study was to analyze the mineral composition of Pleurotus ostreatus and the cultivation substrates prepared with wood and agroindustrial residues from the Amazon region. Macro (P, K, Ca and Mg and micronutrients (Fe, Zn, Cu, Mn and Na of mushroom and substrates were analyzed. Substrates were formulated from Simarouba amara Aubl. and Ochroma piramidale Cav. ex. Lam. sawdust and crushed Bactris gasipaes Kunth

  11. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  12. Optimization of the cultivation conditions for mushroom production with European wild strains of Agaricus subrufescens and Brazilian cultivars.

    Science.gov (United States)

    Llarena-Hernández, Carlos R; Largeteau, Michèle L; Ferrer, Nathalie; Regnault-Roger, Catherine; Savoie, Jean-Michel

    2014-01-15

    The almond mushroom Agaricus subrufescens (formerly Agaricus blazei or Agaricus brasiliensis) is cultivated at commercial level in Brazil and some Asian countries on local substrates and casing mixtures. Despite its tropical origin, A. subrufescens might be a seasonal option for mushroom growers in western countries, where some wild strains have been isolated. For this purpose, cultivation conditions were developed starting from the substrate and casing mixture commonly used for commercial production of the button mushroom Agaricus bisporus in France. The commercial compost, based on wheat straw and horse manure, used for A. bisporus and the casing mixture (peat and limestone) supplemented with fine sand proved efficient to grow A. subrufescens. Increasing the depth of the casing layer improved significantly the yield and time to fruiting. Daily variations in temperature did not markedly modify the yield. Significantly higher mushroom biomass was obtained with three wild European strains compared with three Brazilian cultivars. The very productive wild strain CA438-A gave mushrooms of size and dry matter content comparable to those of a cultivar. Commercial production of A. subrufescens can be developed in western countries on the wheat straw-based substrate commonly used for A. bisporus in these regions, by a simple modification of the casing mixture and maintaining the incubation temperature throughout the crop, which is expected to save energy during summer. Good yields were obtained cultivating European strains under optimised parameters. © 2013 Society of Chemical Industry.

  13. Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

    Science.gov (United States)

    Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

    2016-12-01

    Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

  14. Liberalization of the energy market. Outline of the mushroom cultivation; Liberalisering energiemarkt. Verkenning champignonteelt

    Energy Technology Data Exchange (ETDEWEB)

    Van der Wel, A.J.; Bakker, R.

    2000-07-01

    As a result of a new Dutch Electricity Law and the liberalization of the natural gas market the mushroom cultivation business requires insight in the consequences of those developments for the energy costs. Also attention is paid to the consequences of the abolition of the limited exemption of the Regular Energy Levy (REB, abbreviated in Dutch). Finally, insight is given into the consequences of changes in the government policy on the so-called long-range agreements on energy efficiency (sector edible mushrooms)18 refs.

  15. Lentinula edodes and Pleurotus ostreatus: functional food with antioxidant -antimicrobial activityand an important source of Vitamin D and medicinal compounds

    Directory of Open Access Journals (Sweden)

    Simone Parola

    2017-10-01

    Full Text Available Background: Mushrooms produce a large amount of medicinal compounds, and are also an optimal source of fibres, proteins, vitamins (like groups B and D, and other micronutrients including potassium, magnesium, etc. Consequently, mushrooms are commonly considered to be functional foods. Many works report the high biological potentials of medicinal mushrooms involving their antibacterial, hypoglycaemic, anticholesterolemic, radical scavenging, and anti-inflammatory effects. Context and purpose of this study: First off, this work aimed to find strains of Lentinula edodes and Pleurotus ostreatus from a bank of edible mushrooms bought from international strain banks (Table I that could possess health benefit related properties, such as a radical scavenging activity (antioxidant effect, antibacterial effects against common pathogenic bacteria, and being able to produce interesting nutrients and secondary metabolites. As the fungal bank comprises of 20 strains of L. edodes and 20 strains of P. ostreatus, a first screening was made by the selection of 13 strains for each mushroom able to grow in multiple wood types or that were particularly productive and had proved good growth reproducibility over the last 5 years. This work also studied the correlation between culture conditions and mushroom quality in terms of the previously reported properties. Comparison among the selected strains was operated by the assessment of antioxidant and antimicrobial activities after different sample treatments. Furthermore, an initial optimization of the analytic techniques was produced for the direct estimation of important secondary metabolites and nutrients by means of HPLC-MS/MS technique. Further research will encompass an evaluation of transformation processes (drying, freezing, rehydration, cooking, etc. impact on radical scavenging, antibacterial activity, and possible degradation/loss of nutraceutically important substances such as vitamin D2, ergothioneine

  16. Biogas production from oil palm empty fruit bunches of post mushroom cultivation media

    Science.gov (United States)

    Purnomo, Agus; Suprihatin; Romli, M.; Hasanudin, Udin

    2018-03-01

    The Empty fruit bunches are one of the palm oil industry wastes, which can be used for mushroom cultivation. Post-cultivation of mushroom from former EFB-mushroom media (EFBMM) has the potential to be processed into biogas. The purpose of this research was to examine optimum co-digestion conditions for biogas production of EFBMM.The research was carried out in an anaerobic digester with three different conditions - dry fermentation (Water content (WC)/Total Solid (TS) ratio 1.5 - 3.5), semi-wet fermentation (WC/TS ratio = 4.0 - 5.7) and wet fermentation (WC/TS ratio> 9.0) conditions. Digester of capacity 50L was used. Fermentation was done using 20% cow feces as inoculum which then added with circulation system for 70 days. The results showed that optimum biogas production were produced in semi-wet fermentation conditions (WC/TS ratio = 4). It was produced 37.462 liters (2.420 liters CH4/Kg Volatile Solid (VS)) of biogas with methane contain about 26.231%. Total volume of inoculum during process was 19.6 liters (1: 4 w/v) with absorbed TS inoculum ratio, TS/I = 0.4 (1:2.5 w/v). The result of research also showed that biogas which was produced from control about 2.865 liters (0.041 liters CH4/KgVS), with TS absorbed inoculum ratio, TS/I = 0.5 (1: 5w/v).

  17. Effect of olive mill waste (OMW) supplementation to Oyster mushrooms substrates on the cultivation parameters and fruiting bodies quality

    NARCIS (Netherlands)

    Ruiz-Rodriguez, A.; Soler-Rivas, C.; Polonia, I.; Wichers, H.J.

    2010-01-01

    Seven Oyster mushroom strains were cultivated in wheat straw (WS) bags supplemented with 0 up to 90% olive mill waste (OMW), a solid residue obtained from a two-phases olive oil production system. All mushroom strains could grow but high OMW concentrations resulted in a significant yield, biological

  18. Cadmium determination in Lentinus edodes mushroom species Determinação de cádmio em cogumelos da espécie Lentinus edodes

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.Muitos estudos têm encontrado elementos tóxicos em cogumelos. Sabe-se que algumas espécies de cogumelos comestíveis acumulam elevados níveis de contaminantes inorgânicos, como cádmio, mercúrio e chumbo. Há cerca de duas mil espécies de cogumelos comestíveis, mas apenas 25 espécies são cultivadas e usadas como alimentos. No Brasil, as espécies mais comercializadas e consumidas são Agaricus bisporus, conhecida como Champignon de Paris; Lentinus edodes ou Shitake, e Pleurotus sp, também chamada de Shimeji ou Hiratake. Neste trabalho, o cádmio (Cd foi determinado em amostras de cogumelos da espécie Lentinus edodes cultivadas em diversas cidades do Estado de São Paulo e algumas amostras importadas do Japão e da China. O cádmio foi determinado por espectrometria de absor

  19. Characterization of Species of Cladobotryum which Cause Cobweb Disease in Edible Mushrooms Grown in Korea.

    Science.gov (United States)

    Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young

    2012-09-01

    Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging from 5~32℃. Rapid growth of the isolates to colony diameters of 47~82 mm was observed at conditions of 18~22℃. No growth was observed at 32℃. C. mycophilum produced a yellowish red pigment while C. varium produced a cream colored pigment after cultivation for 25 days on PDA. Phylogenetic analysis of the internal transcribed spacer region and partial 28S rDNA from the four isolates confirmed they were C. mycophilum and C. varium. Cross pathogenicity tests revealed that the two isolates of C. mycophilum were highly pathogenic toward three mushroom types, but not toward H. marmoreus. The two isolates of C. varium were less pathogenic than those of C. mycophilum, but were pathogenic toward all mushroom types evaluated.

  20. Effects of different substrates on the yield and protein content of ...

    African Journals Online (AJOL)

    The effects of seven substrates for the cultivation, yield and protein content of the mushroom, Pleurotus tuberregium (Fries) Singer were investigated. The experimental design used was completely randomized design (CRD) of 7 treatments and 10 replicates. The highest fresh weight yield was obtained from mushrooms ...

  1. Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

    Science.gov (United States)

    Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

    2016-11-01

    Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

  2. Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

    Science.gov (United States)

    Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

    2018-07-25

    The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. The use of sensory analysis in biotechnology of the cultivation of macromycetes

    Directory of Open Access Journals (Sweden)

    K. M. Vlasenko

    2016-08-01

    Full Text Available Sensory analysis is the most ancient and inexpensive method of assessing the quality of food products. Consumer demand for the fruit bodies of mushrooms is due to their unique taste and aroma. Profile methods of sensory analysis are used in quality control, for characterising the differences between food products and for determining the impact of various factors on the quality of the test product. The aim of this research is to study the influence of different types of substrates on the character and intensity of arom     a of the dried fruit bodies of Pleurotus ostreatus (Jacq.: Fr. Kumm. IBK–1535 using the sensory profile method. The substrates for the cultivation of mushrooms were selected from waste from the agricultural and wood processing industries: sunflower husks, wheat straw, waste from the cleaning of seed corn, and sawdust of deciduous trees and oak bark. The preparation and sterilization of substrates was performed according to standard techniques. During the process of cultivation we determined the culture-morphological indices of development of the mycelium: the duration of growth in the substrate, time of appearance of the primordia, the number of formed fruiting bodies of mushrooms, the average biomass of the fruiting bodies. We did not detect any significant differences between substrates in the growth rate of mycelia. The best culture-morphological indices of growth and development of mycelia were identified for the corn waste substrate. This substrate had the greatest number of primordia, while the lowest was for wheat straw. The mycelium of P. ostreatus IBK-1535 was white, fluffy, and denser on substrates of corn waste, sunflower husks and oak bark. The sensory profile analysis was performed according to ISO 6564:1885.1 g of dried fruiting bodies was crushed, placed in glass vials with stoppers and heated to +35…+40 °C for a better emission of volatile compounds. A five person degustation commission was trained to

  4. Current Overview of Mushroom Production in the World

    NARCIS (Netherlands)

    Royse, Daniel J.; Baars, J.J.P.; Tan, Qi

    2017-01-01

    Edible, medicinal, and wild mushrooms are the three major components of the global mushroom industry. World production of cultivated, edible mushrooms has increased more than 30‐fold since 1978. China is the main producer of cultivated, edible mushrooms. Lentinus edodes is now the world's leading

  5. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    Energy Technology Data Exchange (ETDEWEB)

    Bercu, V., E-mail: vbercu@gmail.co [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Negut, C.D., E-mail: dnegut@nipne.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania); Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, 077125 Magurele (Ilfov) (Romania); Duliu, O.G., E-mail: duliu@b.astral.r [University of Bucharest, Department of Atomic and Nuclear Physics, P.O. Box MG-11, 077125 Magurele (Ilfov) (Romania)

    2010-12-15

    The suitability of the EPR spectroscopy for detection of {gamma}-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  6. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    International Nuclear Information System (INIS)

    Bercu, V.; Negut, C.D.; Duliu, O.G.

    2010-01-01

    The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel-Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom-Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle-Cantharellus cibarius Fr., as well as oyster mushroom-Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  7. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation;Aumento da vida util de cogumelos Pleurotus sajor-caju in natura com aplicacao de radiacao gama

    Energy Technology Data Exchange (ETDEWEB)

    Moda, Evelise Moncaio

    2008-07-01

    The production and consumption of edible mushrooms has been increasing in the last years due to its nutritional composition and sensory quality. The irradiation of mushrooms has been used with the purpose of maintaining the fresh product characteristics during shelf-life. The present study evaluated the effect of different radiation doses on the conservation of mushrooms Pleurotus sajor-caju, through by chemical, physical, microbiological and sensorial parameters. The packaging consisted on polystyrene trays with 250 g of sample, wrapped in polyvinyl chloride (PVC). The mushrooms were irradiated with doses of 125, 250, 500 and 750 Gy in a Gamma cell 220 type irradiator, and stored at 4 +- 1 deg C and 90% UR for 10 days. The proximate composition (moisture, crude fibre, total protein, total fat and ash), total soluble solids, pH, texture, color (L, a, b, Chroma and ho), enzymatic activity (polyphenoloxidase and peroxidase), microbiological (total coliform, Escherichia coli and total psychotropic bacteria) and sensory evaluation (color, taste and appearance) were determined in the 1st, 5th and 10th storage days. For the respiratory rate analysis, 30 g of sample were placed in jars and stored at 4 +- 1 deg C and 90% UR for 8 days. CO{sub 2} was analyzed every day using a gaseous chromatograph. The results were submitted to variance analysis and average test using the SAS statistical package. The total protein and total fat values did not differ significantly between treatments or storage periods, while the moisture, crude fibre and ash values differ between treatments and periods. The dose of 750 Gy darkness the mushroom in the last evaluation, and texture was better in control during the storage period. The color (L, a), texture and proximate composition values did not differ significantly between treatments or storage periods. A significant increase was observed for soluble solids, b{sup *} and enzymatic activity values in all treatments at the end of the storage

  8. The use of plant extracts to control the major disease and pest in mushroom cultivation

    NARCIS (Netherlands)

    Baars, J.J.P.; Rutjens, A.J.; Kogel, de W.J.; Baar, J.

    2008-01-01

    Dry bubble disease and its spread by insects represents a major problem in the cultivation of mushrooms. Prevention of dry bubble disease and its vectors usually involves chemical crop protection. However, the use of chemical crop protection is becoming less acceptable. We expect that, within a few

  9. Global collection of mushroom pathogens

    NARCIS (Netherlands)

    Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.; Korsten, L.

    2013-01-01

    In many places in the world, increasingly less chemical crop protection agents are available for use in mushroom cultivation. As a consequence, mushroom cultivation will loose the ability to use crop protection agents. As a consequence, good hygiene management, early detection and monitoring of

  10. Cultivation of three medicinal mushroom species on olive oil press cakes containing substrates

    Directory of Open Access Journals (Sweden)

    Andrej GREGORI

    2015-12-01

    Full Text Available Olive oil press cakes (OOPC represent a waste that has a negative impact on environment. OOPC have little or no use and because of that solutions for their alternative use are sought after. In our experiments we investigated substrate mixtures composed of different proportions of OOPC, wheat bran, crushed corn seeds and beech sawdust for cultivation of Ganoderma lucidum, Lentinula edodes and Grifola frondosa fruiting bodies. The increasing amount of OOPC in fruiting bodies cultivation substrates resulted in decreasing production of fruiting bodies. Results show, that although OOPC in small portion can be successfully used as a medicinal mushroom fruiting bodies cultivating substrate, their use is rational only, if no other substrate composing materials can be found or when OOPC usage solves the problem of its deposition.

  11. Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

    Science.gov (United States)

    Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

    2017-03-01

    Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Biological control of Lycoriella ingenua (Diptera: Sciaridae) in commercial mushroom (Agaricus bisporus) cultivation: a comparison between Hypoaspis miles and Steinernema feltiae.

    Science.gov (United States)

    Jess, Stephen; Schweizer, Heinrich

    2009-11-01

    Mushroom cultivation may be adversely affected by insect pests, including sciarids (Lycoriella spp.), which were previously controlled by application of chemical pesticides. However, owing to food safety and environmental concerns, availability of pesticides for use during mushroom cultivation has diminished. Consequently, it is imperative to investigate alternative control strategies, not reliant on chemical pesticides, which may be used in an integrated pest management system. Application of the predatory mite Hypoaspis miles Berlese to commercial mushroom-growing beds at the beginning of spawn run or just prior to casing (830 mites m(-2)) significantly reduced immature sciarids, Lycoriella ingenua (Dufour), in the growing substrate and also adult activity towards the conclusion of cropping. A trend towards lower sciarid emergence from substrates and reduced adult sciarid activity was observed following the application of Steinernema feltiae (Filipjev) (1.5 x 10(6) nematodes m(-2)) at casing. No significant treatment effects on mushroom yield were observed. However, contamination of the mushroom crop by adult sciarids increased in untreated controls. Application of H. miles required a 12-fold increase in labour when compared with application of S. feltiae. Contingent upon the development of an effective application system, H. miles has potential for the biological control of sciarids in commercial mushroom production. (c) 2009 Society of Chemical Industry.

  13. Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

    Science.gov (United States)

    Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

    2015-10-01

    Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. USE OF ARTIFICIAL LIGHT IN MUSHROOM CULTIVATION

    Directory of Open Access Journals (Sweden)

    N. L. Poyedinok

    2013-12-01

    Full Text Available Artificial light is used in greenhouses to increase productivity and quality of agricultural and ornamental plants. Despite the awareness of the fact that light also plays important role in the life of nonhotosynthetic organisms, such as fungi, its using in their biotechnology cultivation is currently limited. Science has quite a large amount information about the influence of artificial light of different nature on morphogenesis, metabolic processes and productivity of more than 100 species of fungi, many of which are valuable producers of biologically active compounds. Themechanisms of photoreactions of various fungi, which is an integral part of a purposeful photoregulation their activity in biotechnological processes are described. The analysis of the researches and of the experience of their practical application allows predicting potential of using artificial light in mushroom growing industry, as well as in creating highly productive, environmentally clean technologies of targeted synthesis of the final product.

  15. Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus

    International Nuclear Information System (INIS)

    Galanda, D.; Matel, L.

    2007-01-01

    The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)

  16. Biology, cultivation, and medicinal functions of the mushroom Hericium erinaceum

    Directory of Open Access Journals (Sweden)

    Sławomir Sokół

    2016-01-01

    Full Text Available Hericium erinaceum (Bull.: Fr. Pers. is an edible fungus of great significance in medicine. It is rarely found in Europe, in contrast, it is common in Japan and North America. Its fruitbodies have been well-known for hundreds of years in traditional Chinese medicine and cuisine. A cradle of H. erinaceum cultivation is Asia. In Eastern Europe is rare in natural habitats, but can be successfully cultivated. Both fruitbodies and mycelia are rich in active, health promoting substances. Tests of substances extracted from this mushroom carried out on animals and in vitro have given good results. They can be used in the treatment of cancer, hepatic disorders, Alzheimer’s and Parkinson’s diseases, wound healing. They improve cognitive abilities, support the nervous and immune systems. Promising results have been reported in clinical trials and case reports about the human treatment (e.g., recovery from schizophrenia, an improvement of the quality of sleep, alleviation of the menopause symptoms. The subject of this paper is to summarize information about the development of mycelium, the best conditions for cultivation of fruitbodies, bioactive substances and their use in medicine.

  17. Assessment of Genetic Diversity among Pleurotus spp. Isolates from Jordan

    Directory of Open Access Journals (Sweden)

    Hanan Aref Hasan

    2018-04-01

    Full Text Available Pleurotus is considered an important genus that belongs to the family Pleurotaceae and includes the edible King Oyster mushroom (Pleurotus eryngii. In the present study, 19 Pleurotus isolates were collected from two locations in the north of Jordan (Tell ar-Rumman and Um-Qais. The morphological characteristics among collected isolates revealed that there was a morphological similarity among the collected isolates. Nucleotide sequence analysis of the internal transcribed spacer (ITS1–5.8S rDNA–ITS4 region and 28S nuclear large subunit (nLSU in the ribosomal DNA gene of the isolated stains showed that all of them share over 98% sequence similarity with P. eryngii. Genetic diversity among the collected strains was assessed using inter simple sequence repeat (ISSR analysis using 18 different primer pairs. Using this approach, 141 out of 196 bands obtained were considered polymorphic and the highest percentage of polymorphism was observed using primer UBC827 (92.3% with an overall Polymorphism Information Content (PIC value of 70.56%. Cluster analysis showed that the Jordanian Pleurotus isolates fall into two main clades with a coefficient of similarity values ranging from 0.59 to 0.74 with a clear clustering based on collection sites. The results of the present study reveal that molecular techniques of ISSR and rDNA sequencing can greatly aid in classification and identification of Pleurotus spp. in Jordan.

  18. Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

    Science.gov (United States)

    Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

    2016-04-01

    The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

  19. Yield and size of oyster mushroom grown on rice/wheat straw basal substrate supplemented with cotton seed hull.

    Science.gov (United States)

    Yang, Wenjie; Guo, Fengling; Wan, Zhengjie

    2013-10-01

    Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.

  20. Wild growing mushrooms for the Edible City? Cadmium and lead content in edible mushrooms harvested within the urban agglomeration of Berlin, Germany

    International Nuclear Information System (INIS)

    Schlecht, Martin Thomas; Säumel, Ina

    2015-01-01

    Health effects by consuming urban garden products are discussed controversially due to high urban pollution loads. We sampled wild edible mushrooms of different habitats and commercial mushroom cultivars exposed to high traffic areas within Berlin, Germany. We determined the content of cadmium and lead in the fruiting bodies and analysed how the local setting shaped the concentration patterns. EU standards for cultivated mushrooms were exceeded by 86% of the wild mushroom samples for lead and by 54% for cadmium but not by mushroom cultures. We revealed significant differences in trace metal content depending on species, trophic status, habitat and local traffic burden. Higher overall traffic burden increased trace metal content in the biomass of wild mushrooms, whereas cultivated mushrooms exposed to inner city high traffic areas had significantly lower trace metal contents. Based on these we discuss the consequences for the consumption of mushrooms originating from urban areas. - Highlights: • Popular edible mushrooms display large variations in Cd and Pb content. • Low accumulating species are Sparassis crispa, Boletus luridus, or Boletus badius. • High accumulating species are Agaricus ssp., Russula vesca, or Calvatia gigantea. • Cd and Pb content in wild growing edible mushrooms were mostly above EU limits for cultivated mushrooms. • Cd and Pb content in commercial mushrooms cultures were regularly below EU limits for cultivated mushrooms. - Commercial mushroom cultures can be integrated into ‘Edible City’ approaches, but majority of wild growing mushroom samples highly accumulate trace metals

  1. [Biotechnological cultivation of edible macrofungi: an alternative for obtaining nutraceutics].

    Science.gov (United States)

    Suárez Arango, Carolina; Nieto, Ivonne Jeannette

    2013-01-03

    Macromycetes have been part of the human culture for thousand years, and have been reported as food in the most important civilizations in history. Many nutraceutical properties of macromycetes have been described, such as anti-cancer, anti-tumour, cholesterol lowering, antiviral, antibacterial, or immunomodulatory, among others. Given that production of mushrooms by traditional cultivation and extraction of bioactive metabolites is very difficult in some cases, biotechnology is essential for the development of profitable and productive techniques for obtaining these metabolites. It is the development of this technology, and the ease in which it enables the use of its variables that has allowed mycelium to be cultivated in liquid medium of macrofungi, with a significant reduction in time and an increased production of metabolites. This increased production has led to the study of compounds that have medicinal, nutriceutical and quasi-farmaceutical potential, in the exhausted media and the mycelium. The aim of this review is to provide an overview of the use of liquid-state fermentation as a technological tool for obtaining edible fungi, and the study of these and their metabolites, by describing the different cultivation conditions used in recent years, as well as the results obtained. The relevance of Agaricus, Flammulina, Grifola, Pleurotus and Lentinula genera, will also be discussed, with emphasis on the last one, since Shiitake has been always considered as the ultimate medicinal mushroom. Copyright © 2011 Revista Iberoamericana de Micología. Published by Elsevier España, S.L. All rights reserved.

  2. Application of solid waste from anaerobic digestion of poultry litter in Agrocybe aegerita cultivation: mushroom production, lignocellulolytic enzymes activity and substrate utilization.

    Science.gov (United States)

    Isikhuemhen, Omoanghe S; Mikiashvili, Nona A; Kelkar, Vinaya

    2009-06-01

    The degradation and utilization of solid waste (SW) from anaerobic digestion of poultry litter by Agrocybe aegerita was evaluated through mushroom production, loss of organic matter (LOM), lignocellulolytic enzymes activity, lignocellulose degradation and mushroom nutrients content. Among the substrate combinations (SCs) tested, substrates composed of 10-20% SW, 70-80% wheat straw and 10% millet was found to produce the highest mushroom yield (770.5 and 642.9 g per 1.5 kg of substrate). LOM in all SCs tested varied between 8.8 and 48.2%. A. aegerita appears to degrade macromolecule components (0.6-21.8% lignin, 33.1-55.2% cellulose and 14-53.9% hemicellulose) during cultivation on the different SCs. Among the seven extracellular enzymes monitored, laccase, peroxidase and CMCase activities were higher before fruiting; while xylanase showed higher activities after fruiting. A source of carbohydrates (e.g., millet) in the substrate is needed in order to obtain yield and biological efficiency comparable to other commercially cultivated exotic mushrooms.

  3. ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH

    Directory of Open Access Journals (Sweden)

    Paccola Edneia A. de Souza

    2001-01-01

    Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.

  4. Accuracy of sampling during mushroom cultivation

    NARCIS (Netherlands)

    Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.

    2015-01-01

    Experiments described in this report were performed to increase the accuracy of the analysis of the biological efficiency of Agaricus bisporus strains. Biological efficiency is a measure of the efficiency with which the mushroom strains use dry matter in the compost to produce mushrooms (expressed

  5. Microcontroller based automatic temperature control for oyster mushroom plants

    Science.gov (United States)

    Sihombing, P.; Astuti, T. P.; Herriyance; Sitompul, D.

    2018-03-01

    In the cultivation of Oyster Mushrooms need special treatment because oyster mushrooms are susceptible to disease. Mushroom growth will be inhibited if the temperature and humidity are not well controlled because temperature and inertia can affect mold growth. Oyster mushroom growth usually will be optimal at temperatures around 22-28°C and humidity around 70-90%. This problem is often encountered in the cultivation of oyster mushrooms. Therefore it is very important to control the temperature and humidity of the room of oyster mushroom cultivation. In this paper, we developed an automatic temperature monitoring tool in the cultivation of oyster mushroom-based Arduino Uno microcontroller. We have designed a tool that will control the temperature and humidity automatically by Android Smartphone. If the temperature increased more than 28°C in the room of mushroom plants, then this tool will turn on the pump automatically to run water in order to lower the room temperature. And if the room temperature of mushroom plants below of 22°C, then the light will be turned on in order to heat the room. Thus the temperature in the room oyster mushrooms will remain stable so that the growth of oyster mushrooms can grow with good quality.

  6. Economic assessment of mushroom project commercialisation

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Meswan Maskom

    2010-01-01

    The market value of mushroom is worth US $45 billion comprising: US $28-30 billion from food, US $9-10 billion from medicinal products and US $3.5-4 billion from wild mushroom. Malaysian import deficit of mushroom over the year 2001-2007 was 40,933 metric ton that worth of RM 187.7 million. The existing local market is lucrative and the potential world market is very large. Having cultivation technology in placed, understanding key value chains of cultivation technology processes, this paper assesses the case study of project economic of mushroom commercialization. (author)

  7. Efficiency of the application of an increasing hydrogel dose in bispore mushrooms cultivation. Agaricus bisporus (Lange Sing. Imbach

    Directory of Open Access Journals (Sweden)

    Grzegorz Koc

    2011-01-01

    Full Text Available The economical efficiency of the application of an increasing hydrogel dose in bispore mushrooms (Agaricus bisporus (Lange Sing. Imbach SYLVAN 737 has been experimented in controlled weather conditions. It was found that the application of a 50 and 150 g•m-2 hydrogel dose is not economically proved due to the lack of harvest significant increase. In the cultivation of this particular variety of mushrooms, the optimal hydrogel dose should not be 100 g•m-2 of subsoil.

  8. Diversity of edible mushrooms in pakistan

    International Nuclear Information System (INIS)

    Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

    2007-01-01

    Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

  9. Statistics analysis of distribution of Bradysia Ocellaris insect on Oyster mushroom cultivation

    Science.gov (United States)

    Sari, Kurnia Novita; Amelia, Ririn

    2015-12-01

    Bradysia Ocellaris insect is a pest on Oyster mushroom cultivation. The disitribution of Bradysia Ocellaris have a special pattern that can observed every week with several asumption such as independent, normality and homogenity. We can analyze the number of Bradysia Ocellaris for each week through descriptive analysis. Next, the distribution pattern of Bradysia Ocellaris is described through by semivariogram that is diagram of variance from difference value between pair of observation that separeted by d. Semivariogram model that suitable for Bradysia Ocellaris data is spherical isotropic model.

  10. Inhibition of lipid peroxidation induced by γ- radiation and AAPH in rat liver and brain mitochondria by mushrooms

    International Nuclear Information System (INIS)

    Lakshmi, B.; Janardhanan, K.K.; Tilak, J.C.; Devasagayam, T.P.A.; Adhikari, S.

    2005-01-01

    Exposure to radiation or 2.2' Azobis(2-amidopropane) dihydrochloride (AAPH) induces generation of reactive oxygen species (ROS) especially hydroxyl radical ( . OH) and peroxyl radical (ROO . ), which are capable of inducing lipid peroxidation. Our earlier studies have demonstrated that extracts of the medicinal and edible mushrooms Ganoderma lucidum, Pleurotus florida, Pleurotus sajor-caju and Phellinus rimosus possessed significant antioxidant activity, measured as radical scavenging. In the present study, we examined the protective effect of these mushroom extracts against radiation- and AAPH-induced lipid peroxidation using rat liver and brain mitochondria as model systems. The results obtained showed that the investigated mushroom extracts significantly inhibited the formation of lipid hydroperoxide and thiobarbituric acid reactive substances, indicating membrane protective effects. The finding suggests the profound protective effect of the extracts of the fruiting bodies of G. lucidum, P. florida, P. sajor-caju and P. rimosus against lipid peroxidation by two major forms of ROS capable of inducing this type of damage in a major organelle, the mitochondria from both rat liver and brain. This observation can possibly explain the health benefits of these mushrooms. (author)

  11. Chemical Composition and Bioactive Compounds of Some Wild Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    Melinda NAGY

    2017-05-01

    Full Text Available Over the last decades, the consumption of mushrooms has significantly increased due to the scientific evidence of their ability to help the organism in the combat and prevention of several diseases (Kalac, 2009. Fruiting bodies of mushrooms are consumed as a delicacy for their texture and flavour, but also for their nutritional properties that makes them even more attractable (Heleno S. 2015. In this paper data were collected from several scientific studies with the aim to characterize the chemical composition and content of bioactive compounds of various mushrooms species: Agaricus bisporus, Boletus edulis, Cantharellus cibarius, Pleurotus ostreatus, Lactarius piperatus. The chemical composition of 5 wild edible studied mushrooms, including moisture, ash, total carbohydrates, total sugars, crude fat, crude protein and energy were determined according to AOAC procedures.

  12. Antioxidant capacity and mineral contents of edible wild Australian mushrooms.

    Science.gov (United States)

    Zeng, X; Suwandi, J; Fuller, J; Doronila, A; Ng, K

    2012-08-01

    Five selected edible wild Australian mushrooms, Morchella elata, Suillus luteus, Pleurotus eryngii, Cyttaria gunnii, and Flammulina velutipes, were evaluated for their antioxidant capacity and mineral contents. The antioxidant capacities of the methanolic extracts of the dried caps of the mushrooms were determined using a number of different chemical reactions in evaluating multi-mechanistic antioxidant activities. These included the Trolox equivalent antioxidant capacity, ferric ion reducing antioxidant power, and ferrous ion chelating activity. Mineral contents of the dried caps of the mushrooms were also determined by inductively coupled plasma-optical emission spectroscopy. The results indicated that these edible wild mushrooms have a high antioxidant capacity and all, except C. gunnii, have a high level of several essential micro-nutrients such as copper, magnesium, and zinc. It can be concluded that these edible wild mushrooms are good sources of nutritional antioxidants and a number of mineral elements.

  13. Fatty Acid Compositions of Six Wild Edible Mushroom Species

    Science.gov (United States)

    Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent

    2013-01-01

    The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377

  14. Fatty Acid Compositions of Six Wild Edible Mushroom Species

    Directory of Open Access Journals (Sweden)

    Pelin Günç Ergönül

    2013-01-01

    Full Text Available The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2. Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids.

  15. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  16. Performance of oyster mushroom (Pleurotus ostreatus) in different ...

    African Journals Online (AJOL)

    USER

    2012-05-08

    May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.

  17. FUNGI: A REVIEW ON MUSHROOMS

    OpenAIRE

    Abulude, F. Olawale; Ndamitso, M. Muhammed

    2017-01-01

    This paper reviews a fungus – mushrooms. In this paper, identification, cultivation, uses, side effects, nutritional and medicinal values, storage, marketing and other uses of mushrooms were discussed. From the review too it was observed that its usefulness surpasses the side effects. These side effects could be eliminated if proper ‘processing’ could be employed. Due to advances in both basic knowledge and practical technology relevant to mushroom farming, mushroom products and mushroom bior...

  18. Climate Management System for mushroom cultivation (CMMC). First phase. Inventory and functional design; Klimaat Managementsysteem Champignonteelt (KMC). 1e fase. Inventarisatie en functioneel ontwerp

    Energy Technology Data Exchange (ETDEWEB)

    Gielen, J.H. [DLV Plant, Horst (Netherlands)

    2011-03-15

    This report describes the feasibility and the opportunities of developing a Climate Management System for Mushroom Cultivation (CMMC) software package, based on which a decision can be made to proceed with the realization of phase 2 of the project, i.e. the actual construction of the CMMC for mushroom cultivation [Dutch] Deze rapportage beschrijft de haalbaarheid en de mogelijkheden van de ontwikkeling van een KMC software pakket, op basis waarvan besloten kan worden tot de realisatie van fase 2 van het project, de daadwerkelijke bouw van de KMC voor de champignonteelt.

  19. Enrichment of mushrooms: an interesting strategy for the acquisition of lithium.

    Science.gov (United States)

    de Assunção, Laélia Soares; da Luz, José Maria Rodrigues; da Silva, Marliane de Cássia Soares; Vieira, Patrícia Aparecida Fontes; Bazzolli, Denise Mara Soares; Vanetti, Maria Cristina Dantas; Kasuya, Maria Catarina Megumi

    2012-09-15

    The capability of Pleurotus ostreatus mushroom to accumulate lithium (Li) and the accessibility of this Li compared with lithium carbonate (Li(2)CO(3)), often used as psychiatric medicine, were investigated. Mushrooms were produced on a substrate-based on coffee husk, with different added concentrations of lithium chloride (LiCl). Biological efficiency (BE), the crude protein content, the concentration of Li and other elements present in mushrooms were determined. The sequential extraction and in vitro test were used to verify the accessibility and the degree of solubility of this element. Li concentration in mushrooms was directly influenced by increasing LiCl concentration in the substrate (Plithium can be an alternative source of Li, as well as being a food with high nutritional value. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Use of gamma irradiation for wheat sterilization as a media for cultivation of mushrooms' spawn

    International Nuclear Information System (INIS)

    Amidi, R.; Mostafavi, M.

    1997-01-01

    In recent years, respect to mushrooms, nutritious value cultivation and culture of this valuable crop has increased in our country. Since, today the nuclear techniques for preserving and improving the quality of agricultural products and foods are being the core of consideration and these techniques are being vastly utilized, therefore we can use these techniques to eliminate some of the existing problems which appear during processing of mushrooms. In this research the possibility of using 60 Co gamma irradiation to sterilize the wheat as a medium culture of mushroom mycelia was examined and during several experiments we obtained the suitable gamma irradiation dose rate (10000 Gy) and then, we made a comparison between two methods of wheat sterilization i.e. by the means of; l: autoclave and 2: gamma irradiation with respect to the quality and race of 'Pleuroturs Sajor Caju' mushrooms, mycelium growth. According to the results, at the early stage of experiments no noticeable difference between autoclave and irradiated samples was observed but gradually it was noted that on irradiated culture bed the mycelium growth was infinitely better than those on autoclave wheat. Thus in irradiated seeds grain, since the grain wheat was remained sound, the my celia were grown regularly

  1. Hypersensitivity pneumonitis associated with mushroom worker's lung: an update on the clinical significance of the importation of exotic mushroom varieties.

    Science.gov (United States)

    Moore, John E; Convery, Rory P; Millar, B Cherie; Rao, Juluri R; Elborn, J Stuart

    2005-01-01

    Hypersensitivity pneumonitis remains an important industrial disease in mushroom workers. It has a significant morbidity, and early diagnosis and removal from exposure to the antigen are critically important in its management. Recently, several new allergens have been described, particularly those from mushroom species originating in the Far East, which are of clinical significance to workers occupationally exposed to such allergens in cultivation, picking, and packing of commercial mushroom crops. Importing of exotic mushrooms including Shiitake is common in EU countries, and some of the exotic species of mushrooms are cultivated for local markets. This practice may contribute to an increase in clinical cases of mushroom hypersensitivity pneumonitis. This update reviews the recent literature and examines changing trends of mushroom worker's lung, with increased movement of commercial product and labour markets worldwide.

  2. Neuronal health - can culinary and medicinal mushrooms help?

    Science.gov (United States)

    Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela

    2013-01-01

    Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.

  3. Selenium in edible mushrooms.

    Science.gov (United States)

    Falandysz, Jerzy

    2008-01-01

    Selenium is vital to human health. This article is a compendium of virtually all the published data on total selenium concentrations, its distribution in fruitbody, bioconcentration factors, and chemical forms in wild-grown, cultivated, and selenium-enriched mushrooms worldwide. Of the 190 species reviewed (belonging to 21 families and 56 genera), most are considered edible, and a few selected data relate to inedible mushrooms. Most of edible mushroom species examined until now are selenium-poor (cesarea, A. campestris, A. edulis, A. macrosporus, and A. silvaticus. A particularly rich source of selenium could be obtained from selenium-enriched mushrooms that are cultivated on a substrate fortified with selenium (as inorganic salt or selenized-yeast). The Se-enriched Champignon Mushroom could contain up to 30 or 110 microg Se/g dw, while the Varnished Polypore (Ganoderma lucidum) could contain up to 72 microg Se/g dw. An increasingly growing database on chemical forms of selenium of mushrooms indicates that the seleno-compounds identified in carpophore include selenocysteine, selenomethionine, Se-methylselenocysteine, selenite, and several unidentified seleno-compounds; their proportions vary widely. Some aspects of environmental selenium occurrence and human body pharmacokinetics and nutritional needs will also be briefly discussed in this review.

  4. Biological effects and ISSR analysis of 60Co γ-irradiation on edible mushroom mycelia

    International Nuclear Information System (INIS)

    Cai Weiming; Feng Weilin; Jin Qunli; Fan Lijun; Wu Yongzhi

    2009-01-01

    Mycelia of Agaricus bitorquis, Flammulina velutipes and Pleurotus eryngii were irradiated by 60 Co γ-rays at the dose of 0, 200, 500 and 800 Gy. The results showed that irradiation inhibited their mycelia growth positively. Of the three edible mushroom, Agaricus bitorquis was the most sensitive one to irradiation, its mycelia died at the dose of 800 Gy. Germination rate, growth rate and vigor of all mycelia irradiated with un-lethal doses increased along with the times of transfer of culture. Electrical conductivity (EC) analysis showed that irradiation increased EC of leaching solution of mycelia positively. The EC of leaching solution of mycelia of Flammulina velutipes and Pleurotus eryngii irradiated with 500 Gy, Agaricus bitorquis irradiated with 200 Gy, were significantly higher than CK. ISSR analysis revealed that 60 Co γ irradiation effect on DNA variation of Agaricus bitorquis, Flammulina velutipes and pleurotus eryngii mycelia in varying degrees. Number of polymorphic bands changed after irradiation. Flawing bands and increasing bands were observed in amplified bands of 14 selected ISSR primers. The ISSR variation rates of Agaricus bitorquis for 200 Gy and 599 Gy treatments were 33.3% and 50.5%; the ISSR variation rates of Flammulina velutipes for 200 Gy, 500 Gy and 800 Gy treatments were 2.3%, 2.3% and 3.1%, that of Pleurotus eryngii were 8.6%, 13.4% and 20.0%. It is possible to use 60 Co γ irradiation as a mutagen to screen new mushroom varieties. (authors)

  5. Assessment of Gardening Wastes as a Co-Substrate for Diapers Degradation by the Fungus Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Rosa María Espinosa-Valdemar

    2015-05-01

    Full Text Available Waste with high biomass content generated in cities in developing countries is sent to landfills or open dumps. This research aims to degrade biomass content in urban waste through cultivation, at pilot scale, of the edible mushroom Pleurotus ostreatus. First, the number of diapers used by one baby per week was measured with a survey in day care facilities. Then, cellulose content of diapers was assessed. Finally, cultivation of P. ostreatus was carried out using as substrate a mixture of diapers with gardening waste, a co-substrate readily available at urban settings. The factors assessed were strain of P. ostreatus (grey BPR-81, white BPR-5, conditioning of the substrate (diapers with and without plastic and co-substrate (wheat straw, grass, and withered leaves. Results show that diapers are a valuable source of biomass, as generation of diapers with urine is 15.3 kg/child/month and they contain 50.2% by weight of cellulose. The highest reductions in dry weight and volume (>64% of substrates was achieved with the substrate diaper without plastic and co-substrate wheat straw. Although diapers with plastic and grass and leaves showed lower degradation, they achieved efficiencies that make them suitable as a co-substrate (>40%, considering that their biomass is currently confined in landfills.

  6. Commercial Scale Production of Mushroom Liquid Seeds

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Mohd Meswan Maskom; Khairuddin Abdul Rahim

    2015-01-01

    Mushroom liquid seed production technology was developed by Malaysian Nuclear Agency (Nuclear Malaysia) in the late 1990s. Initially, the liquid seeds were used mainly in the solid state fermentation process for converting oil palm empty fruit bunch fibres into ruminant feed. Considering widespread problems encountered by mushroom growers from use of solid seeds, especially in cases of contaminant agents infecting cultivated bags and inconsistencies in yield, we diverted our focus to utilising liquid seeds as alternative inocula for mushroom cultivation. These problems provide us opportunities to look into the issues and address the problems faced by mushroom growers. However, the technology of producing liquid seed at laboratory scale needs to be primed for commercial production. This paper discusses developmental aspects of mushroom liquid seed at commercial scale for the advancement of the country's mushroom industry. (author)

  7. The use of residual geothermal energy in an edible mushroom production plant, Los Humeros geothermal fields (Mexico): Achievements and alternatives; El uso de la energia geotermica residual en la planta productora de hongos comestibles del campo geotermico Los Humeros (Mexico): Logros y alternativas

    Energy Technology Data Exchange (ETDEWEB)

    Rangel Rangel, Maria Elena [Proteccion ambiental, Puebla (Mexico)

    2000-12-01

    A plant for raising edible mushrooms with residual geothermal energy is a project of the Comision Federal de Electricidad (CFE). The results reflect important achievements in the development of technology for the productions of wholesome and available food with geothermal heat instead of conventional energy sources. The installations have an enormous technological and commercial potential- demonstrated by the cultivation of oyster mushrooms (Pleurotus ostreatus), which success has awakened the interest of research institutions. The Instituto of Ecologia, A.C., has begun a joint project with CFE cultivating shiitake mushrooms (Lentinula edodes) with geothermal energy. These achievements mark a clear trend toward the integral use of facilities, the establishment of a crop with greater economic advantages, and the diffusion of this project. [Spanish] La planta productora de hongos comestibles es un proyecto de la Comision Federal de Electricidad (CFE) para dar un uso alterno a la energia geotermica residual. Los resultados obtenidos hasta el momento reflejan logros importantes en la generacion de tecnologia propia para la produccion de un alimento sano y accesible, sustituyendo la energia proveniente de combustibles convencionales por calor geotermico. Las instalaciones creadas cuentan con un enorme potencial tecnologico y comercial demostrando con el cultivo de las setas (Pleurotus ostreatus) con un exito tal que ha despertado el interes de instituciones dedicadas a la investigacion. Tal es el caso de Instituto de Ecologia, A.C que acualmente se encuentra involucrado en un proyecto conjunto sobre el cultivo del hongo Lentinula edodes (shiitake) utilizando energia geotermica en su proceso productivo. Con lo anterior, se esta marcando una clara tendencia hacia el aprovechamiento integral de las instalaciones, el establecimiento de un cultivo con mayores ventajas economicas y la difusion de este proyecto.

  8. A study of mechanisms responsible for incorporation of cesium and radiocesium into fruitbodies of king oyster mushroom (Pleurotus eryngii)

    Energy Technology Data Exchange (ETDEWEB)

    Bystrzejewska-Piotrowska, Grazyna [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)], E-mail: byst@biol.uw.edu.pl; Bazala, Michal A. [Isotope Laboratory, Faculty of Biology, Warsaw University, 02-096 Warsaw, Miecznikowa 1 (Poland)

    2008-07-15

    Ex vitro cultures of Pleurotus eryngii were carried out under controlled conditions using sterile medium composed of barley seeds. The influence of alkali and alkaline earth element salts (CsCl, KCl, NaCl, RbCl, and CaCl{sub 2}) and tetraethylammonium chloride on incorporation of cesium, potassium, sodium, rubidium and calcium, and their distribution within fruitbodies, was examined. The results show that incorporation of cesium into fruitbodies was not suppressed by Na{sup +} and Rb{sup +} or tetraethylammonium chloride. However, it was inhibited by Ca{sup 2+} and stimulated by high concentrations of K{sup +}. The inhibition of cesium incorporation by Ca{sup 2+}, lack of influence of tetraethylammonium chloride and stimulation by high K{sup +} concentrations suggest that there may exist two pathways of passive transport of cesium in mycelium: (i) uptake mediated by a non-specific potassium channel localised in plasmalemma (similar to voltage-insensitive cation channel, VICC) followed by diffusive transport inside hyphae and (ii) extracellular transport from the medium through inter-hyphal cavities into fruitbodies. The results highlight distinctiveness of mechanisms responsible for the uptake and incorporation of cesium in mushrooms and plants.

  9. Macro and trace elements in edible mushrooms, Shiitake, Shimeji and Cardoncello from Petrópolis, Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Jaylei Monteiro Gonçalves

    2014-05-01

    Full Text Available The concentrations of twenty-five elements (Al, As, Ba, Bi, Ca, Cd, Cr, Cu, Fe, Ga, K, Li, Mg, Mn, Mo, Na, Ni, Pb, Rb , Sb, Se, Sn, Sr, V and Zn were determined in three edible mushrooms, Shiitake (Lentinula edodes, Black Shimeji (Pleurotus ostreatusi and Cardoncello (Pleurotus eryngyii from Petrópolis, Rio de Janeiro, Brazil. Samples were collected along the year 2010 and their preparations were made after drying, milling, an acid pre-digestion and a decomposition procedure in a muffle furnace. The analytical techniques employed for the elements determination were Mass Spectrometry with Inductively Coupled Plasma and Flame Atomic Absorption Spectrometry. Two certified reference materials, Apple Leaves and Mussel Tissue, were used for the evaluation of the analytical procedure and recovery values around 98% were obtained. The results showed that the analyzed mushrooms have high levels of Cu, Fe, K, Mg, Mn and Zn containing more than 30% the recommended daily intake for these nutrients according to Brazilian legislation. These mushrooms presented a very low ratio Na/K. Regarding the levels of some contaminants, the mushrooms had concentrations of Cd, Pb and As below the recommended maximum limits allowed by Brazilian legislation.

  10. Neuronal Health – Can Culinary and Medicinal Mushrooms Help?

    Science.gov (United States)

    Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela

    2013-01-01

    Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets. PMID:24716157

  11. Neuronal Health – Can Culinary and Medicinal Mushrooms Help?

    Directory of Open Access Journals (Sweden)

    Vikineswary Sabaratnam

    2013-01-01

    Full Text Available Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.

  12. Effect of β-1.3/1.6-D-glucan derived from oyster mushroom Pleurotus ostreatus on biometrical, haematological, biochemical, and immunological indices in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Dobsikova, Radka; Blahova, Jana; Franc, Ales; Jakubik, Juraj; Mikulikova, Ivana; Modra, Helena; Novotna, Kamila; Svobodova, Zdenka

    2012-01-01

    Effect of long-term oral administration of three different concentrations (0.5, 1.0, and 2.0%) of micronized β-1.3/1.6-D-glucan derived from oyster mushroom (Pleurotus ostreatus, Hiratake) on biometrical, haematological, biochemical, and immunological indices of half-year-old rainbow trout (Oncorhynchus mykiss) was assessed in the study. Rainbow trout were feed commercial feed pellets containing β-1.3/1.6-D-glucan in the concentrations of 0.5, 1.0, and 2.0% for 85 days. Biometrical indices consisted in total and standard length, body and liver weight, from which derived somatic parameters such as Fulton´s condition factor and hepatosomatic index were calculated. Haematological parameters were evaluated according to unified methods for haematological examination in fish. Plasma biochemical profile was analysed using biochemical analyser Konelab 20i and Easy Lyte Analyzer. A phagocyte cells metabolic activity (induced chemiluminescence of phagocytes) was determined as an immunological parameter by a microplate luminometric method on Immunotech LM-01T. No clinical signs of behavioral, respiratory, or neurologic distress were observed in rainbow trout. Fish showed normal feeding behavior. As for biometric parameters, no significant changes in total and standard length, body weight, liver weight, as well as in condition factor and hepatosomatic index of experimental and control fish were found. In the course of the study, weight gains in rainbow trout were similar and continuous. Shifts in PCV (pglucose, lactate, total protein, cholesterol, calcium, natrium, potassium (all p<0.05), albumins and chlorides (both p<0.01), as well as catalytic activities of ALT and AST (both p<0.05) were changed in the course of the study. A phagocyte cells metabolic activity (luminol-induced chemiluminescence) in rainbow trout was not altered by oyster mushroom β-1.3/1.6-D-glucan administration. After long-term oral administration of three concentrations of micronized β-1.3/1.6-D

  13. Edible wild mushrooms of the Western Ghats: Data on the ethnic knowledge

    Directory of Open Access Journals (Sweden)

    Namera C. Karun

    2017-10-01

    Full Text Available The edible wild mushrooms are most important in food security of ethnic groups and tribals throughout the world. Various indigenous strategies are followed to trace wild mushrooms suitable for human consumption. Data presented in this article projects ethnic knowledge on 51 edible wild mushrooms (in 23 genera in the Western Ghats region of India. Information collected with support of ethnic groups/tribals pertains to habitats, substrates, mutualistic association, extent of availability, extent of edibility and method of processing of wild mushrooms. Extensive field visits and interactions with ethnic groups were performed to collect the data on each mushroom. Initially, most of these mushrooms were identified based on the indigenous methods and designated with vernacular names (Are-Gowda, Kodava and Tulu. Based on macromorphology (in field and micromorphology (in laboratory, each mushroom was identified with its systematic name. Among the 51 wild mushrooms irrespective of extent of availability, the most preferred include Astraeus hygrometricus, Clitocybe infundibuliformis, Fistulina hepatica, Lentinus sajor-caju, Pleurotus (5 spp. and Scleroderma citrinum and Termitomyces (18 spp.. This data forecasts the importance of documentation of traditional knowledge, protection of habitats, management of resources (tree species and substrates and sustainable exploitation of wild mushrooms.

  14. Mushroom immunomodulators: unique molecules with unlimited applications.

    Science.gov (United States)

    El Enshasy, Hesham A; Hatti-Kaul, Rajni

    2013-12-01

    For centuries, mushrooms have been used as food and medicine in different cultures. More recently, many bioactive compounds have been isolated from different types of mushrooms. Among these, immunomodulators have gained much interest based on the increasing growth of the immunotherapy sector. Mushroom immunomodulators are classified under four categories based on their chemical nature as: lectins, terpenoids, proteins, and polysaccharides. These compounds are produced naturally in mushrooms cultivated in greenhouses. For effective industrial production, cultivation is carried out in submerged culture to increase the bioactive compound yield, decrease the production time, and reduce the cost of downstream processing. This review provides a comprehensive overview on mushroom immunomodulators in terms of chemistry, industrial production, and applications in medical and nonmedical sectors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Antioxidant activities of extracts from five edible mushrooms using different extractants

    Directory of Open Access Journals (Sweden)

    Suphaphit Boonsong

    2016-03-01

    Full Text Available Extractions were performed of the total phenolic and flavonoid contents and antioxidant properties of five edible mushroom samples—Lentinus edodes, Volvariella volvacea, Pleurotus eous, Pleurotus sajor-caju and Auricularia auricular—using three different extractants. Among the three different extractants, 50% (volume per volume; v/v ethanol was the most suitable for antioxidant extraction from the mushroom samples. The 50% (v/v ethanolic extract of dried L. edodes contained higher total phenolic and flavonoid contents than in the other mushroom extract samples. The antioxidant activities of 50% (v/v ethanolic extract of dried L. edodes showed the strongest 2,2-diphenyl-1-picrylhydrazyl radical-scavenging assay (64.34% compared to butylated hydroxyanisole (BHA and α-tocopherol at 500 μg/mL. The ethanolic extract showed a lower reducing power of 0.10 compared to BHA and α-tocopherol at 500 μg/mL. Moreover, the L. edodes ethanolic extract also had the highest chelating ability (66.28% which was lower than for ethylenediaminetetraacetic acid at 500 μg/mL and showed the strongest superoxide radical-scavenging activity (64.17% compared to BHA and α-tocopherol. Therefore, the 50% (v/v ethanolic extract of L. edodes could be used as a potential natural antioxidative source or as an ingredient in the fish and fishery product industries.

  16. Interactions between Xylotrophic Mushrooms and Mycoparasitic Fungi in Dual-Culture Experiments

    Directory of Open Access Journals (Sweden)

    S.M. Badalyan

    2004-04-01

    Full Text Available Seventeen wood-decaying mushroom species (Coriolus versicolor, Flammulina velutipes, Ganoderma sp., Hypholoma fasciculare, H. sublateritium, Kühneromyces mutabilis, Lentinula edodes, Lentinus tigrinus, Pholiota alnicola, Ph. aurivella, Ph. destruens, Pleurotus cornucopiae, Pl. ostreatus, Polyporus subarcularius, Po. squamosus, Po. varius and Schizophyllum commune were paired with three Trichoderma species (T. harzianum, T. pseudokoningii, and T. viride and Clonostachys rosea in dual-culture experiments on an agar-based medium. Xylotrophic mushrooms and mycoparasitic fungi in general showed similar competitive ability; deadlock, or mutual inhibition after mycelial contact, was observed in 45.6% of pairings, while stable inhibition at a distance occurred in 4.4% of pairings. Replacement, or overgrowth of xylotrophic mushroom by a mycoparasitic fungus was observed in 29.4% of pairings; the opposite, overgrowth of the xylotrophic mushroom on the mycoparasitic fungus in 20.6%. of pairings. Of the xylotrophic mushrooms, Pl. ostreatus, Ganoderma sp., F. velutipes and H. fasciculare, showed the highest competitive ability against mycoparasitic fungi. Of the mycoparasitic fungi, T. harzianum showed the strongest competitive activity against xylotrophic mushrooms.

  17. Essential and toxic element determination in edible mushrooms by neutron activation analysis; Determinacao de elementos essenciais e toxicos em cogumelos comestiveis por analise por ativacao com neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Moura, Patricia Landim da Costa

    2008-07-01

    In this study concentrations of As, Br, Co, Cr, Cs, Fe, K, Na, Rb, Se and Zn were determined in edible mushrooms acquired from commercial establishments in the city of Sao Paulo and directly from Mogi das Cruzes, Suzano, Juquitiba and Mirandopolis producers. The analytical technique used for determining these elements in edible mushrooms was Instrumental Neutron Activation Analysis (INAA). Species of the Agaricus, Lentinus and Pleurotus genera were acquired during the period from November, 2006 to March, 2007. About 150 to 200 mg of freeze-dried mushrooms were irradiated in a neutron flux of 1012 cm{sup -2} s{sup -1} for 8 hours in the IEA-R1 nuclear research reactor at IPEN-CNEN-SP. In order to evaluate the precision and accuracy of the methodology, four reference materials: INCT-MPH-2 Mixed Polish Herbs and INCT-TL-1 Tea Leaves, NIST SRM 1577b Bovine Liver, and the material Mushroom from IAEA were analyzed. Results showed some variation in the element concentrations among the different genera. In some samples, arsenic was found but in low concentrations. Arsenic is probably derived from the contamination from pesticides used in the cultivation, in their the substrates where mushrooms uptake their nutrients. Although there are element concentration variations, mushrooms can still be considered a very rich nutritional source, mainly because of their low concentrations of Na, and due to the good source of K, Fe and Zn. (author)

  18. A comparison of dried shiitake mushroom in log cultivation and mycelial cultivation from different geographical origins using stable carbon and nitrogen isotope analysis

    International Nuclear Information System (INIS)

    Suzuki, Yaeko; Nakashita, Rumiko; Ishikawa, Noemia Kazue; Tabuchi, Akiko; Sakuno, Emi; Tokimoto, Keisuke

    2015-01-01

    We determined carbon and nitrogen isotopic compositions (δ 13 C and δ 15 N) of dried shiitake mushroom (Lentinula edodes) samples from Japan, China, South Korea and Brazil in order to discriminate their geographical origins. In log cultivation, the δ 13 C values of Japanese dried shiitake samples were lower than those of Chinese samples, depending on the δ 13 C values of log and their growth conditions. In mycelial cultivation, the δ 13 C and δ 15 N values of Japanese dried shiitake samples were higher than those of Chinese samples. By using the δ 13 C and δ 15 N values, 87.4% of Japanese dried shiitake samples (n = 95) and 87.9% of Chinese dried shiitake samples (n = 66) in log cultivation, 90.0% of the Japanese dried shiitake samples (n = 50) and 93.9% of Chinese dried shiitake samples (n = 114) in mycelial cultivation, were correctly classified according to the production site. These results suggested that the δ 13 C and δ 15 N values will be potentially useful for tracing their geographical origin of dried shiitake samples. (author)

  19. Wild and domesticated mushroom consumption in Nigeria ...

    African Journals Online (AJOL)

    African Crop Science Journal ... On the other hand, if nutrition analysis reveals different nutrition parameters for both types of mushrooms, 43.3% opted for cultivated mushroom, 42.2%, wild; 12.2% both; while 2.2% would eat ... Keywords: Consumption pattern, Lentinus squarrosulus, nutrition, perception, wild mushroom ...

  20. Cobweb, a serious pathology in mushroom crops: A review

    Directory of Open Access Journals (Sweden)

    Jaime Carrasco

    2017-07-01

    Full Text Available Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

  1. Cobweb, a serious pathology in mushroom crops: A review

    International Nuclear Information System (INIS)

    Carrasco, J.; Navarro, M.J.; Gea, F.

    2017-01-01

    Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

  2. Cobweb, a serious pathology in mushroom crops: A review

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco, J.; Navarro, M.J.; Gea, F.

    2017-07-01

    Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

  3. Investigation of antioxidative, antityrosinase and cytotoxic effects of extract of irradiated oyster mushroom

    Directory of Open Access Journals (Sweden)

    Nutsuda Banlangsawan

    2016-02-01

    Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.

  4. Chemical analysis of fructification bodies of Pleurotus sajor-caju cultivated in several nitrogen concentrations

    OpenAIRE

    Silva, Evânia Geralda; Dias, Eustáquio Souza; Siqueira, Félix Gonçalves; Schwan, Rosane Freitas

    2007-01-01

    Os cogumelos do gênero Pleurotus normalmente crescem bem em substratos mais pobres em nitrogênio, ao contrário dos cogumelos Agaricus que requerem substratos com relação C/N mais estreita. Por outro lado, os valores nutricionais do cogumelo dependem da composição química do substrato utilizado e das condições de cultivo. Este trabalho teve como objetivo avaliar o teor de proteína dos corpos de frutificação do cogumelo Pleurotus sajor-caju cultivado em capim coast-cross, bagaço de cana-de-açúc...

  5. Evaluation of edible mushroom Oudemansiella canarii cultivation on different lignocellulosic substrates.

    Science.gov (United States)

    Xu, Feng; Li, Zhiming; Liu, Yu; Rong, Chengbo; Wang, Shouxian

    2016-09-01

    In this study, the mycelial growth rate, mycelial colonization time, yield, and biological efficiency of the edible mushroom Oudemansiella canarii were determined, and the effects of different substrate combinations on productivity, chemical contents and amino acids were evaluated. Lignocellulosic wastes, such as cottonseed hull, sawdust, corncob, and their combinations supplemented with 18% wheat bran and 2% lime, were used for the cultivation of O. canarii. The biological efficiency (BE) and essential amino acid content of treatment T1, which consisted of 80% cottonseed hull, were the highest among all the tested treatments. Mixtures that included sawdust, such as treatments T2 (80% sawdust), T4 (40% sawdust + 40% cottonseed hull), and T6 (40% sawdust + 40% corncob), exhibited lower yield and BE. Corncob was good for O. canarii production in terms of yield and BE, whereas the mycelial growth rate and colonization time were lower compared to those on other substrates. Comparing the BE, essential amino acids, and other traits of the six treatments, treatment T1 (80% cottonseed hull) was the best formula for O. canarii cultivation and should be extended in the future.

  6. Pengaruh mutasi dengan radiasi sinar gamma (CO₆₀ terhadap produktivitas jamur tiram abu-abu (Pleurotus sajur-caju

    Directory of Open Access Journals (Sweden)

    Ira Djajanegara

    2012-02-01

    Full Text Available Irradiation aplied to living organisms may have positive or negative effects on physiological and morphological properties of the organisms. One way to gain genetic variation with better properties than the parental strain is by Gamma (Co 60 radiation application. During this experiment, Gama (Co 60 rays was applied to the grey oyster (Pleurotus sajur-caju mushroom mycellia during exponential phase. Radiation was applied at 0.75 KGray with dose velocity of 1.149 KGray. Analysis of mushroom productivity performances indicate that diameter of mycellia, fresh weight, dry weight, diameter of fruit body and the amount of fruit body of the mutant and control were not significantly different. However, the isozyme pattern showed a different pattern between the mutant and the control which indicates that mutation process has already occured. These data show that mutation did not affect the productivity of the mushroom. Therefore, mutation may affect the nutritional quality of the mushroom instead. Further experiment to verify this possibility is suggested.

  7. Bioconversion of biomass residue from the cultivation of pea sprouts on spent Pleurotus sajor-caju compost employing Lumbricus rubellus

    Directory of Open Access Journals (Sweden)

    Azizi Abu Bakar

    2012-11-01

    Full Text Available Vermicomposting is a green technology for the purpose of nutrient enrichment from a variety of organic waste products. In this study, saw dust-based spent mushroom compost (SMC, an organic waste and biomass residue, was used as a medium for the cultivation of pea sprouts. After harvesting the pea sprouts, the growth medium was reused to culture earthworms, Lumbricus rubellus. The culturing activity was conducted for 50 days without any pre-composting or thermocomposting. Thus duration of vermicomposting process was shortened as opposed to previous work on vermicomposting of saw dust-based SMC (no amendment for 70 days. The culturing treatments were conducted in triplicate, including one treatment without earthworms as the control. The analysis showed that concentrations of macronutrients in vermicompost were higher compared to controls, in which N = 4.12%, P = 2.07% and K = 1.56%. The C:N ratio was 11.77, which indicates a stabilisation and maturity of the organic waste compost, compared with the C:N ratio for the control, which was 59.34. At the end of the experiment, increment of total biomass and number of earthworms were observed and no mortality was recorded. The results suggested that vermicomposting could be used as an environmentally valuable technology to convert saw dust used for mushroom and pea sprouts cultivation into vermicompost or bio-fertiliser by employing L. rubellus.

  8. Assessing the potential of mushroom cultivation in improving ...

    African Journals Online (AJOL)

    Mo

    Department of Agricultural Extension Education, Faculty of Agriculture, Makerere University, P.O Box ... requires little land space, earns high income, and provides ... mushroom growing is one of the enterprises that would fit .... Children. 2. 3.30. Relative. 3. 5.00. Table 1. Availability of wild mushrooms now and in the past.

  9. Economic feasibility of small scale button mushroom production in pakistan

    International Nuclear Information System (INIS)

    Tahir, A.; Hassan, S.

    2013-01-01

    Abstract:- Mushroom is widely cultivated as a proteineous vegetable in many countries of the world including Pakistan. Its cultivation requires less space, care, equipment and cost compared to many other crops and livestock. The present study was conducted in 2010 to estimate the profitability of small scale button mushroom production at National Agricultural Research Centre (NARC) Islamabad, Pakistan. The cost of production methodology was used for this study. The yield and gross return of mushroom was estimated at 155.6 kg ha and Rs.77,800 ha , respectively. The results indicated the fact that mushroom production is very much remunerative to its producers as it can give maximum net return by reducing their cost of production as its cultivation is dependent on the agricultural raw material which is cheaply available. (author)

  10. Effect of 60Co γ-irradiation on postharvest quality of pleurotus nebrodensis stored at 4 degree C

    International Nuclear Information System (INIS)

    Xiong Qiaoling; Huazhong Agriculture Univ., Wuhan; Xing Zengtao; Feng Zhiyong; Buswell, J.; Bian Yinbing

    2007-01-01

    The effect of γ-rays irradiation on the fresh-keeping of Pleurotus nebrodensis fruit bodies was reported in this paper. Fresh harvested fruit bodies of Pleurotus nebrodensis were irradiate at different doses levels (0.8-2.0 kGy) and stored for 22 days at 4 degree C. The fruit bodies treated with 1.2 kGy irradiation retained the highest soluble protein contents, and exhibited less postharvest softening throughout the storage period. Regression analysis plots of fruit body hardness versus soluble protein content were linear (t>0.05). Increases in mushroom cell permeability observed throughout the storage period were directly related to irradiation dose. Too higher dose(≥2.0 kGy) of irradiation will accelerate the nutrition degradation and rotting of the fruit bodies. (authors)

  11. Perbandingan Pertumbuhan Jamur Tiram Putih di Kumbung Ciseeng dan Universitas Al-Azhar Indonesia

    Directory of Open Access Journals (Sweden)

    Putri Kenanga

    2016-03-01

    Full Text Available White oyster mushroom (Pleurotus ostreatus is one of wood fungi which easy to grow at rotting wood and organic waste. White oyster mushroom is rich in protein, carbohydrates, minerals, and vitamins. Environmental factors affecting the growth of white oyster mushrooms is temperature and humidity. The study aims to compare the growth and production of white oyster mushroom in different location, Ciseeng and University of Al-Azhar Indonesia (UAI. Cultivation in UAI done in a controlled situation using autoclave sterilization, inoculation using enkas and the treatment is watering on gunny sack in the mushroom house regularly. Whereas, cultivation in Ciseeng less controlled by traditional cultivation using steam sterilization and inoculation process at open space. Wet weight, dry weight, and biological efficiency results is higher in UAI than Ciseeng at 7.95%, 14.5%, and 7.34% higher, respectively. Morphological parameter such as number of fruiting body, mushroom cap diameters, and stem lenght also show better in UAI than Ciseeng at 23.67%, 8.75%, 54.96% higher, respectively. Better result of mushroom cultivation at UAI supported by 28.3oC average temperature and 93.95% humidity, meanwhile in Ciseeng average temperature and humidity was 29.25oC and 82.15%.

  12. Heavy metal and proximate composition associated with the ...

    African Journals Online (AJOL)

    Changes in the heavy metal content and proximate composition during the 28 day composting of cassava peels used in the cultivation of the oyster mushrooms Pleurotus ostreatus strain EM-1 was studied. Significant dry weight variations of cellulose, hemicellulose and fat contents were observed from day 0 to 12.

  13. Effects of Some Beneficial Bacteria in Casing Soil on Growth and Yield of Cultivated Mushroom Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Mehmet Çetin

    2016-03-01

    Full Text Available This research was carried out to determine the interaction between some bacteria naturally existing in casing soil and Agaricus bisporus (Sylvan Hauser A15 hypha in laboratory (in vitro and cultivation (in vivo conditions, and to confirm its effects on mushroom yield. Totally 32 bacteria (3 Gram (+ and 29 Fluorescent Pseudomonads was isolated from casing soil and healthy sporophores. As a result of in vitro experiment carried out to determine the effects of bacteria on mycelium growth of A. bisporus, 24 bacterial isolates were found more effective at the rate of 2 to 115% than control treatment. To determine the effects of bacterium, chosen at the end of in vitro experiments, on mushroom yield in cultivation conditions, three experiments were established in March, May and July in 2008. At the end of experiments, bacterial isolates provided 8 – 40 % increase in total yield. Population density and change in population number related to time was observed during growing period, after the inoculation of bacterial isolates into casing soil. According to the results, Pseudomonas fluorescens (T 4/2 and Ş 8, P.putida (Ş 2/1 and Ş 10 and Bacillus mycoides (T 7/2 bacterial isolates were colonized successfully both in casing soil and sporophores.

  14. Optimum Condition of Ecologic Feed Fermentation by Pleurotus ostreatus Using Soybean Curd Residue as Raw Materials

    OpenAIRE

    Shi, Min; Yang, Yingnan; Li, Yiting; Wang, Yuepeng; Zhang, Zhenya

    2011-01-01

    A novel approach by utilizing soybean curd residue, to produce polysaccharide from the edible mushroom Pleurotus ostreatus in solid-state culture, was developed. Firstly, the significant effect of fermented conditions on P. ostreatus polysaccharide production were screened out to be inoculum size, moisture content and C/N ratio by using a single factor experiment. Secondly, the three factors were optimized using central composite design in response surface methodology. As results, a quadratic...

  15. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation.

    Science.gov (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2013-01-01

    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  16. Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

    Science.gov (United States)

    Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez

    2014-01-01

    Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...

  17. Microbial ecology of the Agaricus bisporus mushroom cropping process.

    Science.gov (United States)

    McGee, Conor F

    2018-02-01

    Agaricus bisporus is the most widely cultivated mushroom species in the world. Cultivation is commenced by inoculating beds of semi-pasteurised composted organic substrate with a pure spawn of A. bisporus. The A. bisporus mycelium subsequently colonises the composted substrate by degrading the organic material to release nutrients. A layer of peat, often called "casing soil", is laid upon the surface of the composted substrate to induce the development of the mushroom crop and maintain compost environmental conditions. Extensive research has been conducted investigating the biochemistry and genetics of A. bisporus throughout the cultivation process; however, little is currently known about the wider microbial ecology that co-inhabits the composted substrate and casing layers. The compost and casing microbial communities are known to play important roles in the mushroom production process. Microbial species present in the compost and casing are known for (1) being an important source of nitrogen for the A. bisporus mycelium, (2) releasing sugar residues through the degradation of the wheat straw in the composted substrate, (3) playing a critical role in inducing development of the A. bisporus fruiting bodies and (4) acting as pathogens by parasitising the mushroom mycelium/crop. Despite a long history of research into the mushroom cropping process, an extensive review of the microbial communities present in the compost and casing has not as of yet been undertaken. The aim of this review is to provide a comprehensive summary of the literature investigating the compost and casing microbial communities throughout cultivation of the A. bisporus mushroom crop.

  18. Linhchi mushrooms as biological monitors for 137Cs pollution

    International Nuclear Information System (INIS)

    Tran Van, L.; Le Duy, T.

    1991-01-01

    Radioactivity of Linhchi mushrooms (Ganoderma Lucidum) cultivated in laboratory and production conditions has been measured in the Environmental Laboratory of Nuclear Research Institute (NRI), Dalat, Vietnam. The results showed that Linhchi mushroom has a high radioactive concentration of 137 Cs, which is about 20 Bq kg -1 fresh weight. In addition, the radioactive contents of substrata before and after cultivation were insignificant. This suggested that Linhchi mushroom should only accumulate the 137 Cs radioisotope from the atmosphere, directly. Therefore, it should be considered as a bio-indicator for environmental monitoring. (author) 13 refs.; 3 figs.; 2 tabs

  19. Structural Features and Healthy Properties of Polysaccharides Occurring in Mushrooms

    Directory of Open Access Journals (Sweden)

    Eva Guillamón

    2012-12-01

    Full Text Available Polysaccharides from mushrooms have attracted a great deal of attention due to the many healthy benefits they have demonstrated, such as immunomodulation, anticancer activity, prevention and treatment of cardiovascular diseases, antiviral and antimicrobial effects, among others. Isolation and purification of polysaccharides commonly involve several steps, and different techniques are actually available in order to increase extraction yield and purity. Studies have demonstrated that the molecular structure and arrangement significantly influence the biological activity; therefore, there is a wide range of analytical techniques for the elucidation of chemical structures. Different polysaccharides have been isolated from mushrooms, most of them consisting of β-linked glucans, such as lentinan from Lentinus edodes, pleuran from Pleurotus species, schizophyllan from Schizophyllum commune, calocyban from Calocybe indica, or ganoderan and ganopoly from Ganoderma lucidum. This article reviews the main methods of polysaccharide isolation and structural characterization, as well as some of the most important polysaccharides isolated from mushrooms and the healthy benefits they provide.

  20. Extension of the shelf-life of fresh oyster mushrooms ( Pleurotus ...

    African Journals Online (AJOL)

    The objective of this study was to improve the preservation of fresh oyster mushrooms by modified atmosphere packaging (MAP) and chemical treatments. The MAP effects and treatments on organoleptic quality, weight loss, cell permeability, texture changes and polyphenol oxidase (PPO) activity were studied. In addition ...

  1. Genome Sequence of the Edible Cultivated Mushroom Lentinula edodes (Shiitake Reveals Insights into Lignocellulose Degradation.

    Directory of Open Access Journals (Sweden)

    Lianfu Chen

    Full Text Available Lentinula edodes, one of the most popular, edible mushroom species with a high content of proteins and polysaccharides as well as unique aroma, is widely cultivated in many Asian countries, especially in China, Japan and Korea. As a white rot fungus with lignocellulose degradation ability, L. edodes has the potential for application in the utilization of agriculture straw resources. Here, we report its 41.8-Mb genome, encoding 14,889 predicted genes. Through a phylogenetic analysis with model species of fungi, the evolutionary divergence time of L. edodes and Gymnopus luxurians was estimated to be 39 MYA. The carbohydrate-active enzyme genes in L. edodes were compared with those of the other 25 fungal species, and 101 lignocellulolytic enzymes were identified in L. edodes, similar to other white rot fungi. Transcriptome analysis showed that the expression of genes encoding two cellulases and 16 transcription factor was up-regulated when mycelia were cultivated for 120 minutes in cellulose medium versus glucose medium. Our results will foster a better understanding of the molecular mechanism of lignocellulose degradation and provide the basis for partial replacement of wood sawdust with agricultural wastes in L. edodes cultivation.

  2. Genome Sequence of the Edible Cultivated Mushroom Lentinula edodes (Shiitake) Reveals Insights into Lignocellulose Degradation

    Science.gov (United States)

    Chen, Lianfu; Gong, Yuhua; Cai, Yingli; Liu, Wei; Zhou, Yan; Xiao, Yang; Xu, Zhangyi; Liu, Yin; Lei, Xiaoyu; Wang, Gangzheng; Guo, Mengpei; Ma, Xiaolong; Bian, Yinbing

    2016-01-01

    Lentinula edodes, one of the most popular, edible mushroom species with a high content of proteins and polysaccharides as well as unique aroma, is widely cultivated in many Asian countries, especially in China, Japan and Korea. As a white rot fungus with lignocellulose degradation ability, L. edodes has the potential for application in the utilization of agriculture straw resources. Here, we report its 41.8-Mb genome, encoding 14,889 predicted genes. Through a phylogenetic analysis with model species of fungi, the evolutionary divergence time of L. edodes and Gymnopus luxurians was estimated to be 39 MYA. The carbohydrate-active enzyme genes in L. edodes were compared with those of the other 25 fungal species, and 101 lignocellulolytic enzymes were identified in L. edodes, similar to other white rot fungi. Transcriptome analysis showed that the expression of genes encoding two cellulases and 16 transcription factor was up-regulated when mycelia were cultivated for 120 minutes in cellulose medium versus glucose medium. Our results will foster a better understanding of the molecular mechanism of lignocellulose degradation and provide the basis for partial replacement of wood sawdust with agricultural wastes in L. edodes cultivation. PMID:27500531

  3. Therapeutic potential of culinary-medicinal mushrooms for the management of neurodegenerative diseases: diversity, metabolite, and mechanism.

    Science.gov (United States)

    Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary

    2015-01-01

    Mushrooms have long been used not only as food but also for the treatment of various ailments. Although at its infancy, accumulated evidence suggested that culinary-medicinal mushrooms may play an important role in the prevention of many age-associated neurological dysfunctions, including Alzheimer's and Parkinson's diseases. Therefore, efforts have been devoted to a search for more mushroom species that may improve memory and cognition functions. Such mushrooms include Hericium erinaceus, Ganoderma lucidum, Sarcodon spp., Antrodia camphorata, Pleurotus giganteus, Lignosus rhinocerotis, Grifola frondosa, and many more. Here, we review over 20 different brain-improving culinary-medicinal mushrooms and at least 80 different bioactive secondary metabolites isolated from them. The mushrooms (either extracts from basidiocarps/mycelia or isolated compounds) reduced beta amyloid-induced neurotoxicity and had anti-acetylcholinesterase, neurite outgrowth stimulation, nerve growth factor (NGF) synthesis, neuroprotective, antioxidant, and anti-(neuro)inflammatory effects. The in vitro and in vivo studies on the molecular mechanisms responsible for the bioactive effects of mushrooms are also discussed. Mushrooms can be considered as useful therapeutic agents in the management and/or treatment of neurodegeneration diseases. However, this review focuses on in vitro evidence and clinical trials with humans are needed.

  4. Oyster Mushroom

    African Journals Online (AJOL)

    The pastoralists have been hopelessly trying to get rid of the bush through ... mushroom cultivation the mentioned problems can be solved yielding nutritious ..... Mean values within the same column with no common superscript letter differ at the 95% confidence level and the .... Encroachment in the Borana Low Land.

  5. wild and domesticated mushroom consumption in nigeria abstract

    African Journals Online (AJOL)

    USER

    of awareness, consumption history, wild or ... 15.6% were students and 11.1% business ... 1.1. N/A. 5. 5.6. NA = Not applicable mushrooms for over 10 years; whereas 13.3% ... Consumption history of wild and cultivated mushrooms in Nigeria.

  6. A Low Cost 3D Acquiring System for Mushroom Robot Based on Webcam and Line Laser

    Directory of Open Access Journals (Sweden)

    Gang Sun

    2014-03-01

    Full Text Available This paper presents a low cost 3D acquiring system for mushroom robot based on webcam and line laser. The system comprises Webcam, semiconductor line laser, motion platform and data process unit. The system can get the 3D information of the Pleurotus eryngii in bottle based on structured light scanning theory. Field test shows the accuracy of the height is less than 2mm and it can be use to locate the buds in the bottle correctly. It has the potention to fulfill the requirement of the location of the mushroom for thinning bud robot.

  7. Mushroom refinement endeavor auspicate non green revolution in the offing

    Directory of Open Access Journals (Sweden)

    SHAUKET AHMED PALA

    2014-11-01

    Full Text Available Pala SA, Wani AH, Boda RH, Wani BA. 2014. Mushroom refinement endeavor auspicate non green revolution in the offing. Nusantara Bioscience 6: 173-185. Mushroom can serve as food, tonic, and as medicine thus make people healthier, fitter and happier. They have a cracking potential for generating great socioeconomic impact in human welfare at local, national and international level. With the help of allied mushroom farming we can easily tackle the problem of food for growing world population; reduce environmental pollution by bioconversion of huge organic wastes into mushrooms; recycle huge quantity of organic wastes to mushroom crops, biofertilizers, and biogas; restore damaged environment by mushroom mycelia through mycoforestry, mycoremediation, mycofiltration and mycopesticides in a zero emission fashion. They can be used to degrade radioactive industrial biocide wastes in an eco-friendly fashion. Since mushroom cultivation is an indoor agribusiness, it could have great economic impact by generating employment, income and functional food requirements for rural people especially in developing countries. How far mushroom cultivation can meet the functional food requirements; address the domestic food challenges, rising food prices and crisis vis a vis environmental sustainability will be thrust areas of this communication.

  8. DNA-based taxonomic identification of basidiospores in hallucinogenic mushrooms cultivated in "grow-kits" seized by the police: LC-UV quali-quantitative determination of psilocybin and psilocin.

    Science.gov (United States)

    Gambaro, Veniero; Roda, Gabriella; Visconti, Giacomo Luca; Arnoldi, Sebastiano; Casagni, Eleonora; Dell'Acqua, Lucia; Farè, Fiorenza; Paladino, Eleonora; Rusconi, Chiara; Arioli, Stefania; Mora, Diego

    2016-06-05

    The taxonomic identification of the biological material contained in the hallucinogenic mushrooms culture media, was carried out using a DNA-based approach, thus highlighting the usefulness of this approach in the forensic identification of illegal samples also when they are present as basidiospores mixed in culture media and spore-bearing fruiting body are not present. This approach is very useful as it allows the unequivocal identification of potentially illicit material before the cultivation and it enables to stop the material to the Customs and to destroy it due to its dangerousness without cultivating the "grow-kits" and without instructing a criminal case. In fact, even if psilocin and psilocybin and the whole mushrooms are illegal in many countries, there is no specific indication in the law about the so called "grow-kits", containing the spores. To confirm the data obtained by the taxonomic identification, a simple, reliable, efficient LC-UV method, using tryptamine as internal standard, suitable for the forensic quali-quantitative determination of psilocin and psilocybin in hallucinogenic mushroom was optimized, validated and applied to the mushrooms grown after the cultivation of the grow-kits seized by the judicial authority, with the authorization of the Ministry of Health. A cation exchange column was used in a gradient elution mode (Phase A: 50mMK2HPO4; 100mM NaCl pH=3 Phase B: methanol). The developed method was linear over the calibration range with a R(2)>0.9992 for both the analytes. The detection and quantification limits were respectively 0.01 and 0.1μg/mL for psilocybin and 0.05μg/mL and 0.1μg/mL for psilocin and the intra- and inter-day precision was satisfactory (coefficients of variation psilocybin in the mushrooms grown from the seized "grow-kits" ranged from 1.02 to 7.60mg/g of dry vegetable material, while the content of psilocin from 0.415 to 8.36mg/g. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Comparative nutritional and mycochemical contents, biological activities and LC/MS screening of tuber from new recipe cultivation technique with wild type tuber of tiger's milk mushroom of species Lignosus rhinocerus.

    Science.gov (United States)

    Jamil, Nor Azreen Mohd; Rashid, Noraswati Mohd Nor; Hamid, Mohamad Hasril Abd; Rahmad, Norasfaliza; Al-Obaidi, Jameel R

    2017-12-04

    Tiger's milk mushroom is known for its valuable medicinal properties, especially the tuber part. However, wild tuber is very hard to obtain as it grows underground. This study first aimed to cultivate tiger's milk mushroom tuber through a cultivation technique, and second to compare nutritional and mycochemical contents, antioxidant and cytotoxic activities and compound screening of the cultivated tuber with the wild tuber. Results showed an increase in carbohydrate content by 45.81% and protein content by 123.68% in the cultivated tuber while fat content reduced by 13.04%. Cultivated tuber also showed an increase of up to 64.21% for total flavonoid-like compounds and 62.51% of total β-D-glucan compared to the wild tuber. The antioxidant activity of cultivated tuber and wild tuber was 760 and 840 µg mL -1 , respectively. The cytotoxic activity of boiled water extract of cultivated tuber against a human lung cancer cell line (A549) was 65.50 ± 2.12 µg mL -1 and against a human breast cancer cell line (MCF7) was 19.35 ± 0.11 µg mL -1 . β-D-glucan extract from the purification of boiled water extract of cultivated tuber showed cytotoxic activity at 57.78 ± 2.29 µg mL -1 against A549 and 33.50 ± 1.41 µg mL -1 against MCF7. However, the β-glucan extract from wild tuber did not show a cytotoxic effect against either the A549 or MCF7 cell lines. Also, neither of the extracts from cultivated tuber and wild tuber showed an effect against a normal cell line (MRC5). Compound profiling through by liquid chromatography mass spectrometry (LC/MS) showed the appearance of new compounds in the cultivated tuber. In conclusion, our cultivated tuber of tiger's milk mushroom using a new recipe cultivation technique showed improved nutrient and bioactive compound contents, and antioxidant and cytotoxic activities compared to the wild tuber. Further investigations are required to obtain a better quality of cultivated tuber.

  10. Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

    2013-01-01

    Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

  11. Wild mushrooms in Ethiopia: A review and synthesis for future perspective

    International Nuclear Information System (INIS)

    Dejene, T.; Oria-de-Rueda, J.A.; Martín-Pinto, P.

    2017-01-01

    Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

  12. Wild mushrooms in Ethiopia: A review and synthesis for future perspective

    Energy Technology Data Exchange (ETDEWEB)

    Dejene, T.; Oria-de-Rueda, J.A.; Martín-Pinto, P.

    2017-11-01

    Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

  13. Wild mushrooms in Ethiopia: A review and synthesis for future perspective

    Directory of Open Access Journals (Sweden)

    Tatek Dejene

    2017-05-01

    Full Text Available Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

  14. Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

    Science.gov (United States)

    Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

    2017-02-01

    Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Nutritional Composition of Three Domesticated Culinary-Medicinal Mushrooms: Oudemansiella sudmusida, Lentinus squarrosulus, and Tremella aurantialba.

    Science.gov (United States)

    Zhou, Shuai; Tang, Qing-Jiu; Zhang, Zhong; Li, Chuan-hua; Cao, Hui; Yang, Yan; Zhang, Jing-Song

    2015-01-01

    The nutritional composition of three recently domesticated culinary-medicinal mushroom species (Oudemansiella sudmusida, Lentinus squarrosulus, and Tremella aurantialba) was evaluated for contents of protein, fiber, fat, total sugar content, amino acid, carbohydrate, and nucleotide components. The data indicated that fruiting bodies of these three mushroom species contained abundant nutritional substances. The protein contents of L. squarrosulus and O. submucida were 26.32% and 14.70%, which could be comparable to other commercially cultivated species. T. aurantialba contained 74.11% of carbohydrate, of which soluble polysaccharide was 40.55%. Oudemansiella sudmusida contained 15.95% of arabitol as the highest sugar alcohol in three mushrooms. These mushrooms also possessed distinct taste by their flavor component composition. Among them, L. squarrosulus contained 10.68% and 9.25% of monosodium glutamate-like and sweet amino acids, which were higher than the other two mushrooms. However, the nucleotide amounts of the three mushrooms were all lower than those of other commercially cultivated mushrooms. Among them, L. squarrosulus contained the highest amount of flavor nucleotides, which was 1.01‰. Results revealed that these three mushroom species are potentially suitable resources for commercial cultivation and healthy food.

  16. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  17. First Collection and Identification of Wild Mushrooms in Western Iraq

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2014-04-01

    Full Text Available Fungi are found everywhere and affect our lives every day from mushroom to industrially important product, plant helpers, plant pathogens and to human diseases. Therefore, we concentrated our attention on fungi that can be grown in our environment, while maintaining an interest in their performance in nature. About fifteen different species were collected and identified from different villages of Heet district, Anbar province, Iraq. Out of the fifteen, two species, naming Armillaria mellea and Coprinus disseminates were identified as species level and others: Pleurotus spp., Agaricus spp., Calvatia sp., Telephora sp., Fomes sp., Lepiota sp. and Morchella sp. as genus level only. This study was aimed to collect and identify wild mushrooms that grow naturally in different orchards and gardens on 2009-2013 in Heet city. A total of 15 species in 9 genera, 9 families and 5 orders belong to woody and fleshy species were identified for the first time in Anbar province. The collected mushrooms were appearing from November to February of each year.

  18. Biosorption of cadmium (II) and lead (II) from aqueous solutions using mushrooms: A comparative study

    Energy Technology Data Exchange (ETDEWEB)

    Vimala, R., E-mail: vimararagu@yahoo.co.in [School of Biotechnology, Chemical and Biomedical Engineering, VIT University, Vellore 632014, Tamil Nadu (India); Das, Nilanjana [School of Biotechnology, Chemical and Biomedical Engineering, VIT University, Vellore 632014, Tamil Nadu (India)

    2009-08-30

    Sorption capacity of oyster mushroom (Pleurotus platypus), button mushroom (Agaricus bisporus) and milky mushroom (Calocybe indica) were evaluated on biosorption of heavy metals, viz. cadmium (II) and lead (II) from aqueous solutions. The optimum sorption conditions were studied for each metal separately. The desired pH of the aqueous solution was found to be 6.0 for the removal of cadmium (II) and 5.0 for removal of lead (II) for all the mushrooms. The percent removal of both the metals was found to increase with the increase in biosorbent dosage and contact time. The fitness of the biosorption data for Langmuir and Freundlich adsorption models was investigated. It was found that biosorption of cadmium (II) and lead (II) ions onto the biomass of the three mushrooms were better suitable to Langmuir than Freundlich adsorption model. P. platypus showed the highest metal uptake potential for cadmium (q{sub max} 34.96 mg/g) whereas A. bisporus exhibited maximum potential for lead (q{sub max} 33.78 mg/g). Milky mushroom showed the lowest metal uptake capacity for both the metals. The present data confirms that mushrooms may be used as efficient biosorbent for the removal of cadmium (II) and lead (II) ions from aqueous solution.

  19. Zeolites as possible biofortifiers in Maitake cultivation

    Directory of Open Access Journals (Sweden)

    Vunduk Jovana

    2014-01-01

    Full Text Available The levels of Ni, Cu and Mg in Grifola frondosa (also known as Maitake mushroom fruit body produced on zeolite Minazel Plus (MG-supplemented substrate were measured with inductively coupled plasma optical emission spectrometry (ICP-OES. Two different concentrations of MG were added to the substrate for mushroom cultivation. Levels of selected metals were measured in cultivated dry carpophores. The content of Ni increased in fruit bodies produced on supplemented substrate, while in case of Cu, a pronounced decrease was observed. When two different concentrations of MG were implemented, the Mg level showed both positive and negative trend, depending on the applied concentration of zeolite. MG in a concentration of 1% showed the strongest influence on the observed elements in the cultivated fruiting body of Maitake mushroom. [Projekat Ministarstva nauke Republike Srbije, br. 46010

  20. Effect of water extract from spent mushroom substrate after Ganoderma balabacense cultivation by using JUNCAO technique on production performance and hematology parameters of dairy cows.

    Science.gov (United States)

    Liu, Yanling; Zhao, Chao; Lin, Dongmei; Lin, Hui; Lin, Zhanxi

    2015-09-01

    The spent mushroom substrate of Ganoderma balabacense cultivation (SMSGB) contains a large amount of bioactive substances. However, the potentials of SMSGB for improving milk production in dairy cows have not been thoroughly studied. In this study, the effects of hot water extract (HWE) from spent mushroom substrate after G. balabacense cultivated with JUNCAO, the herbaceous plants long-known to be suitable for cultivating edible and medicinal fungi, on production performance and hematology parameters of dairy cows, were determined. Holstein dairy cows were fed different doses of HWE. After a 60-day administration period with 100 g/day of HWE, milk yield, milk protein and triglyceride (TG) levels increased by 4.02% (P < 0.01), 4.49% (P < 0.05) and 32.65% (P < 0.05), respectively; somatic cell count (SCC) and alanine aminotransferase (ALT) were significantly decreased (P < 0.05). The production performance of dairy cows suggests that HWE with SMSGB treatment is effective in improving milk yield (P < 0.01) and hematology parameters of dairy cows, and may be useful as a functional feed additive. © 2015 Japanese Society of Animal Science.

  1. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  2. Identification of molecular species of acylglycerols of Philippine wild edible mushroom, Ganoderma lucidum

    Science.gov (United States)

    Wild edible mushrooms are widely consumed in many countries. We successfully cultivated four edible, medicinal Philippine mushrooms in liquid culture. Recently, we identified the molecular species of acylglycerols in the lipid extract of mushroom G. lucidum NRRL66208. One hundred and three molecular...

  3. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  4. Characterization of Species of Cladobotryum which Cause Cobweb Disease in Edible Mushrooms Grown in Korea

    OpenAIRE

    Back, Chang-Gi; Lee, Chang-Yun; Seo, Geon-Sik; Jung, Hee-Young

    2012-01-01

    Four Cladobotryum isolates were collected from four different commercially grown mushroom types infected with cobweb disease in Cheongdo-gun and Chilgok-gun of Gyeongbuk Province, Korea in 2010. The isolates were identified as C. mycophilum from Agaricus bisporus and Pleurotus eryngii, C. varium from Flammulina velutipes and Hypsizygus marmoreus. The cultural characteristics of the four isolates were investigated using potato dextrose agar (PDA) media under nine different temperatures ranging...

  5. Yield response of mushroom (Agaricus bisporus) on wheat straw ...

    African Journals Online (AJOL)

    SERVER

    2008-01-18

    Jan 18, 2008 ... 1Mugla University, Faculty of Technical Education, Kotekli, 48000, Mugla, Turkey. 2Mugla University, Mushroom ..... Hayes WA, Shandilya TR (1977). Casing soil and compost substrates used in the artifical culture of Agaricus bisporus, the cultivated mushroom. Indian J. Mycol. Plant Pathol. 7: 5-10. Lambert ...

  6. Temperature Control System for Mushroom Dryer

    Science.gov (United States)

    Wibowo, I. A.; Indah, Nur; Sebayang, D.; Adam, N. H.

    2018-03-01

    The main problem in mushroom cultivation is the handling after the harvest. Drying is one technique to preserve the mushrooms. Traditionally, mushrooms are dried by sunshine which depends on the weather. This affects the quality of the dried mushrooms. Therefore, this paper proposes a system to provide an artificial drying for mushrooms in order to maintain their quality. The objective of the system is to control the mushroom drying process to be faster compared to the natural drying at an accurate and right temperature. A model of the mushroom dryer has been designed, built, and tested. The system comprises a chamber, heater, blower, temperature sensor and electronic control circuit. A microcontroller is used as the controller which is programmed to implement a bang-bang control that regulates the temperature of the chamber. A desired temperature is inputted as a set point of the control system. Temperature of 45 °C is chosen as the operational drying temperature. Several tests have been carried out to examine the performance of the system including drying speed, the effects of ambient conditions, and the effects of mushroom size. The results show that the system can satisfy the objective.

  7. The Removal of Turbidity and TSS of the Domestic Wastewater by Coagulation-Flocculation Process Involving Oyster Mushroom as Biocoagulant

    Science.gov (United States)

    Pardede, Astrid; Budihardjo, Mochamad Arief; Purwono

    2018-02-01

    Oyster mushroom (Pleurotus ostreatus) can be utilized as biocoagulant since it has chitin cell wall. Chitin has characteristics of bioactivity, biodegradability, absorption and could bind the metal ions. In this study, Oyster Mushroom is micronized and mixed with wastewater to treat turbidity and Total Suspended Solid (TSS) using coagulation-flocculation process employed jartest method. Various doses of Oyster mushroom, 600 mg/l, 1000 mg/l, and 2000 mg/l were tested in several rapid mixing rates which were 100 rpm, 125 rpm, and 150 rpm for 3 minutes followed by 12 minutes of slow mixing at 45 rpm. The mixture then was settled for 60 minutes with pH level maintained at 6-8. The result showed that the Oyster mushroom biocoagulant was able to remove 84% of turbidity and 90% of TSS. These reductions were achieved with biocoagulant dose of 600 mg/ L at 150 rpm mixing rate.

  8. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  9. Antioxidants of Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    Maja Kozarski

    2015-10-01

    Full Text Available Oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS lead to a range of health disorders in humans. Our endogenous antioxidant defense mechanisms and our dietary intake of antioxidants potentially regulate our oxidative homeostasis. Numerous synthetic antioxidants can effectively improve defense mechanisms, but because of their adverse toxic effects under certain conditions, preference is given to natural compounds. Consequently, the requirements for natural, alternative sources of antioxidant foods identified in edible mushrooms, as well as the mechanistic action involved in their antioxidant properties, have increased rapidly. Chemical composition and antioxidant potential of mushrooms have been intensively studied. Edible mushrooms might be used directly in enhancement of antioxidant defenses through dietary supplementation to reduce the level of oxidative stress. Wild or cultivated, they have been related to significant antioxidant properties due to their bioactive compounds, such as polyphenols, polysaccharides, vitamins, carotenoids and minerals. Antioxidant and health benefits, observed in edible mushrooms, seem an additional reason for their traditional use as a popular delicacy food. This review discusses the consumption of edible mushrooms as a powerful instrument in maintaining health, longevity and life quality.

  10. The genome sequence of the commercially cultivated mushroom Agrocybe aegerita reveals a conserved repertoire of fruiting-related genes and a versatile suite of biopolymer-degrading enzymes.

    Science.gov (United States)

    Gupta, Deepak K; Rühl, Martin; Mishra, Bagdevi; Kleofas, Vanessa; Hofrichter, Martin; Herzog, Robert; Pecyna, Marek J; Sharma, Rahul; Kellner, Harald; Hennicke, Florian; Thines, Marco

    2018-01-15

    Agrocybe aegerita is an agaricomycete fungus with typical mushroom features, which is commercially cultivated for its culinary use. In nature, it is a saprotrophic or facultative pathogenic fungus causing a white-rot of hardwood in forests of warm and mild climate. The ease of cultivation and fructification on solidified media as well as its archetypal mushroom fruit body morphology render A. aegerita a well-suited model for investigating mushroom developmental biology. Here, the genome of the species is reported and analysed with respect to carbohydrate active genes and genes known to play a role during fruit body formation. In terms of fruit body development, our analyses revealed a conserved repertoire of fruiting-related genes, which corresponds well to the archetypal fruit body morphology of this mushroom. For some genes involved in fruit body formation, paralogisation was observed, but not all fruit body maturation-associated genes known from other agaricomycetes seem to be conserved in the genome sequence of A. aegerita. In terms of lytic enzymes, our analyses suggest a versatile arsenal of biopolymer-degrading enzymes that likely account for the flexible life style of this species. Regarding the amount of genes encoding CAZymes relevant for lignin degradation, A. aegerita shows more similarity to white-rot fungi than to litter decomposers, including 18 genes coding for unspecific peroxygenases and three dye-decolourising peroxidase genes expanding its lignocellulolytic machinery. The genome resource will be useful for developing strategies towards genetic manipulation of A. aegerita, which will subsequently allow functional genetics approaches to elucidate fundamentals of fruiting and vegetative growth including lignocellulolysis.

  11. EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

    Science.gov (United States)

    Bercu, V.; Negut, C. D.; Duliu, O. G.

    2010-12-01

    The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

  12. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  13. Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

    Directory of Open Access Journals (Sweden)

    José Maria Rodrigues da Luz

    Full Text Available Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

  14. Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

    Science.gov (United States)

    da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

    2013-01-01

    Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

  15. Cultivation of mushroom (Volvariella volvacea) on banana leaves

    African Journals Online (AJOL)

    SERVER

    percentage of the fibre components being degraded. The crude protein ... incubation of the mushroom due probably to the addition of microbial protein. The acid ... a plastic or tent-like construction or bamboo frame stretched with plastic film ...

  16. Utilização do composto exaurido de Pleurotus sajor caju em rações de frangos de corte e seus efeitos no desempenho dessas aves - DOI: 10.4025/actascianimsci.v31i2.4811 Utilization of the spent substrate of Pleurotus sajor caju mushroom in broiler chicks ration and the effect on broiler chicken performance - DOI: 10.4025/actascianimsci.v31i2.4811

    Directory of Open Access Journals (Sweden)

    Antônio Gilberto Bertechini

    2009-08-01

    Full Text Available Avaliou-se a adição dietética de um composto exaurido da produção do cogumelo Pleurotus sajor caju sobre o desempenho de frangos de corte nos períodos de um a 21, 22 a 38 e um a 38 dias de idade. Foram utilizados 500 pintos de um dia Ross-308, machos, em delineamento inteiramente casualizado, com cinco tratamentos, obtidos pelos níveis do composto na ração (0; 0,5; 1,0; 1,5 e 2,0% com quatro repetições de 20 aves cada. Foram avaliados ganho de peso, consumo de ração, conversão alimentar, rendimento de carcaça, gordura abdominal e altura das microvilosidades do intestino. A adição do composto não influenciou no consumo da ração e na conversão alimentar. Para o ganho de peso houve efeito positivo somente na fase inicial (um a 21 dias, sendo o valor máximo obtido com a adição de 0,67% do composto. A adição do composto não alterou o rendimento de carcaça e gordura abdominal, porém, alterou a altura das microvilosidades do intestino. A adição de composto exaurido da produção do fungo Pleurotus sajor caju, na concentração de 0,67%, melhora o ganho de peso dos frangos nos primeiros 21 dias de idadeThis research evaluated the effect of the addition of a spent mushroom substrate (SMS Pleurotus sajor caju at different levels on the performance of broiler chicks from 1 to 21, 22 to 38 and 1 to 38 days of age. Five hundred one-day-old Ross-308 chicks were utilized, allocated in a completely randomized design, with five treatments obtained by increased levels of compost on ration (0; 0.5; 1.0; 1.5 and 2.0%, with four replicates of 20 birds per experimental unit. The intake, weight gain, feed conversion, carcass yield, abdominal fat and villus height were evaluated. No effect was observed on intake and feed conversion when the compost was included in the feeding. A positive effect was observed for weight gain from 1 to 21 days of age, with maximum value of 0.67% of SMS, but its addition did not modify the carcass yield and

  17. Modification of growth conditions by mm-waves of wood-decaying mushrooms cultures

    International Nuclear Information System (INIS)

    Avagyan, I.A.

    2016-01-01

    Basidial macromycetes are not only value food, but can be used as source of such biological active compounds as the genistein, β -glucans, glioxal-oxidase et al. In this work we used different frequencies of extremely high frequency of electromagnetic irradiation (EHF EMI) with the aim of obtaining mushroom cultures with increased fermentative activity by the modulation of its growth conditions during growth on the peptone media. We investigated the influence of the non-thermal extremely high frequency electromagnetic waves in the interval of 45-53 GHz on β-glucosidase activities of two species of wood-decaying mushroom. In this study we examined the most popular edible wood-decaying mushroom Pleurotus ostreatus, which is wide-spread in the forests and commercial mushroom Lentinula edodes, under influence of such an abiotic factor as the extremely high frequency waves in the interval of 45 GHz - 53 GHz during 20 and 40 min on the 7th day of mycelial culture's growth. After the treatment of cultures we continued their growth and on the 3th day we examined the influence of these waves on fermentative activity of mycelial extracts. The some conditions of such treatment led to significant rising of β-glucosidase activities in the extracts of mycelial cultures

  18. Serum immunoglobulin E and immunoglobulin G reactivity to Agaricus bisporus proteins in mushroom cultivation workers.

    Science.gov (United States)

    Khakzad, Z; Hedayati, M T; Mahdian, S; Mayahi, S

    2015-06-01

    Although molds are regarded as the main fungal allergen sources, evidence indicates that spores of Basidiomycota including Agaricus bisporus ( A. bisporus ) can be also found at high concentrations in the environment and may cause as many respiratory allergies as molds. The aim of the present study was to evaluate specific immunoglobulin E (IgE) and immunoglobulin G (IgG) antibodies against A. bisporus via immunoblotting technique in individuals working at mushroom cultivation centers. In this study, 72 workers involved in the cultivation and harvest of button mushrooms were enrolled. For the analysis of serum IgE and IgG, A. bisporus grown in Sabouraud dextrose broth was harvested and ruptured by liquid nitrogen and glass beads. The obtained sample was centrifuged and the supernatant was collected as "crude extract" (CE). CE was separated via Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE). The separated proteins were transferred to a nitrocellulose filter and the bands responsive to IgE and IgG were identified by anti-human conjugated antibodies. All participants were screened in terms of total IgE level. Among 72 workers, 18 (25%) had a total IgE level higher than 188 IU/mL. In SDS-PAGE, the CE of A. bisporus showed 23 different protein bands with a molecular weight range of 13-80 kDa. The sera of 23.6% and 55.5% of participants showed positive response, with specific IgE and IgG antibodies against A. bisporus in the blot, respectively. The bands with molecular weights of 62 and 68 kDa were the most reactive protein components of A. bisporus to specific IgE antibodies. Moreover, bands with molecular weights of 57 and 62 kDa showed the highest reactivity to IgG, respectively. Also, 62 and 68 kDa components were the most reactive bands with both specific IgG and IgE antibodies. The obtained findings revealed that A. bisporus has different allergens and antigens, which contribute to its potential as an aeroallergen in hypersensitivity

  19. CE-MS-based metabolomics reveals the metabolic profile of maitake mushroom (Grifola frondosa) strains with different cultivation characteristics.

    Science.gov (United States)

    Sato, Mayumi; Miyagi, Atsuko; Yoneyama, Shozo; Gisusi, Seiki; Tokuji, Yoshihiko; Kawai-Yamada, Maki

    2017-12-01

    Maitake mushroom (Grifola frondosa [Dicks.] Gray) is generally cultured using the sawdust of broadleaf trees. The maitake strain Gf433 has high production efficiency, with high-quality of fruiting bodies even when 30% of the birch sawdust on the basal substrate is replaced with conifer sawdust. We performed metabolome analysis to investigate the effect of different cultivation components on the metabolism of Gf433 and Mori52 by performing CE-MS on their fruiting bodies in different cultivation conditions to quantify the levels of amino acids, organic acids, and phosphorylated organic acids. We found that amino acid and organic acid content in Gf433 were not affected by the kind of sawdust. However, Gf433 contained more organic acids and less amino acids than Mori52, and Gf433 also contained more chitin compared with Mori52. We believe that these differences in the metabolome contents of the two strains are related to the high production efficiency of Gf433.

  20. Investigations on Mushroom Storage and Quality Parameters

    Directory of Open Access Journals (Sweden)

    Ömür Dündar

    2016-03-01

    Full Text Available In this study, researchers on storage and quality properties of mushrooms cultivated in the world and Turkey have been investigated. Mushrooms contain some important minerals and vitamins such as iron, calcium, phosphorus, potassium, copper and folate, thiamine, riboflavin, niacin, vitamin B, C, D and also they are a good source of carbohydrate and protein. After harvest, to extend the shelf life of mushrooms, some applications such as pre-cooling, storage in appropriate temperature, use of different types of polyethylene packaging, modified atmosphere packaging, nitric oxide and UV light applications were done on mushrooms. The effects of these applications on physical and chemical features such as like weight loss, firmness, cap opening rate, cap diameter, stem diameter, browning, colour, respiration rate, enzymatic reactions, total phenols, total sugars, aminoacid content were investigated.

  1. Arsenic and Other Elemental Concentrations in Mushrooms from Bangladesh: Health Risks

    Directory of Open Access Journals (Sweden)

    Md Harunur Rashid

    2018-05-01

    Full Text Available Mushroom cultivation has been increasing rapidly in Bangladesh. Arsenic (As toxicity is widespread in the world and Bangladesh faces the greatest havoc due to this calamity. Rice is the staple food in Bangladesh and among all the crops grown, it is considered to be the main cause of As poisoning to its population after drinking water. Consequently, rice straw, an important growing medium of mushrooms in Bangladesh, is known to have high As content. The objective of this study was, therefore, to determine the concentrations of As in mushrooms cultivated in Bangladesh and to assess the health risk as well. It also considered other elements, including Cd, Cr, Co, Cu, Pb, Mn, Hg, Ni, and Zn concentrations in mushrooms from Bangladesh. The mean concentrations (mg/kg of As, Cd, Cr, Co, Cu, Pb, Mn, Hg, Ni, and Zn in mushrooms were 0.51, 0.38, 0.28, 0.01, 13.7, 0.31, 11.7, 0.12, 0.28, and 53.5, respectively. Based on the dietary intake of mushrooms, the weekly intakes of As, Cd, Cr, Co, Cu, Pb, Mn, Hg, Ni, and Zn from mushrooms for adults were 0.0042, 0.0030, 0.0024, 0.0001, 0.1125, 0.0019, 0.1116, 0.0011, 0.0023, and 0.4734 mg, respectively. Due to the low concentrations of As and other trace elements observed in mushrooms from Bangladesh, as well as relatively lower consumption of this food in people’s diet, it can be inferred that consumption of the species of mushrooms analysed will cause no toxicological risk.

  2. Cultivation and bromatological analysis of the medicinal mushroom ...

    African Journals Online (AJOL)

    User

    2015-02-04

    Feb 4, 2015 ... African Journal of Biotechnology. Full Length Research Paper ... Both treatments were carried out in 10 repetitions, totaling 200 packages. ... The mushrooms showed high levels of ethereal extract, fibers and ... Nowadays, they have a guaranteed market in many ... Residues processing ..... Effect of different.

  3. Effect of Lignin-Containing Media on Growth of Medicinal Mushroom Lentinula Edodes

    Directory of Open Access Journals (Sweden)

    Matjuškova Nataļja

    2017-04-01

    Full Text Available The effect of lignocellulose and lignin on growth of mycelium of mushroom Lentinula edodes and laccase activity in cultivation medium was studied. It was shown that cultivation of L. edodes mycelium in liquid nutrient medium with addition of 0.25-0.5% of kraft lignin increased mycelium biomass yield approximately two times compared with reference conditions without addition of lignin. Similar results were obtained in experiments in which 0.5% lignocellulose that remained after obtaining furfural, and 0.5% lignin that remained after obtaining furfural and glucose from wheat straw, were added to the nutrient medium. This effect was greater in the conditions of cultivation with good aeration, compared with static culture. Laccase activity in medium increased after addition of wheat straw lignocellulose or lignin only in the case of mycelium cultivation with aeration. In the case of mushroom cultivation on solid nutrient medium, addition of wheat straw lignocellulose and lignin promoted growth of mycelium only during the first 7 days of cultivation.

  4. [Effect of substrate of edible mushroom on continuously cropping obstacle of Rehmannia glutinosa].

    Science.gov (United States)

    Ru, Rui-Hong; Li, Xuan-Zhen; Hunag, Xiao-Shu; Gao, Feng; Wang, Jian-Ming; Li, Ben-Yin; Zhang, Zhong-Yi

    2014-08-01

    The continuous cultivation of Rehmannia glutinosa causes the accumulation of phenolic acids in soil. It is supposed to be the reason of the so called "continuously cropping obstacle". In this study, phenolic acids (hydroxybenzoic acid, vanillic acid, eugenol, vanillin and ferulic acid) were degraded by the extracta of all the tested spent mushroom substrate (SMS) and the maximal degradation rate was 75.3%, contributed by extraction of SMS of Pleurotus eryngii. Pot experiment indicated that hydroxybenzoic acid and vanillin in soil were also degraded effectively by SMS of P. eryngii. The employment of SMS enhanced ecophysiology index to near the normal levels, such as crown width, leaves number, leaf length, leaf width and height. At the same time, the fresh and dry weight and total catalpol concentration of tuberous root weight of R. glutinosa was increased to 2.70, 3.66, 2.25 times by employment of SMS, respectively. The increase of bacteria, fungi and actinomycetes numbers in rhizosphere soil were observed after the employment of SMS by microbial counts. The employment of SMS also enhanced the enzyme activity in soils, such as sucrase, cellulase, phosphalase, urease and catelase. These results indicated that the employment of SMS alleviated the continuously cropping obstacle of R. glutinosa in some extent.

  5. Discrimination Method of the Volatiles from Fresh Mushrooms by an Electronic Nose Using a Trapping System and Statistical Standardization to Reduce Sensor Value Variation

    Directory of Open Access Journals (Sweden)

    Kouki Fujioka

    2013-11-01

    Full Text Available Electronic noses have the benefit of obtaining smell information in a simple and objective manner, therefore, many applications have been developed for broad analysis areas such as food, drinks, cosmetics, medicine, and agriculture. However, measurement values from electronic noses have a tendency to vary under humidity or alcohol exposure conditions, since several types of sensors in the devices are affected by such variables. Consequently, we show three techniques for reducing the variation of sensor values: (1 using a trapping system to reduce the infering components; (2 performing statistical standardization (calculation of z-score; and (3 selecting suitable sensors. With these techniques, we discriminated the volatiles of four types of fresh mushrooms: golden needle (Flammulina velutipes, white mushroom (Agaricus bisporus, shiitake (Lentinus edodes, and eryngii (Pleurotus eryngii among six fresh mushrooms (hen of the woods (Grifola frondosa, shimeji (Hypsizygus marmoreus plus the above mushrooms. Additionally, we succeeded in discrimination of white mushroom, only comparing with artificial mushroom flavors, such as champignon flavor and truffle flavor. In conclusion, our techniques will expand the options to reduce variations in sensor values.

  6. INFLUENCE OF TEMPERATURE AND RELATIVE HUMIDITY ON THE STUDDED AGARICUS BLAZEI MURRILL MUSHROOM COMPOST

    Directory of Open Access Journals (Sweden)

    Sándor Rózsa

    2017-12-01

    Full Text Available Almond mushroom, Agaricus blazei Murrill, is the so-called secondary saprophyte, developing on partially processed substrate, in which microorganisms reduced complex ligno-cellulose compounds. Numerous authors have shown that due to the similar life cycle in the cultivation of almond mushroom technologies developed for white button mushroom may be applied. However, almond mushroom requires high temperature and high humidity as well as access to light to form fruiting bodies. In Brazil, due to the advantageous climatic conditions this species is frequently grown outdoors; however, in other countries - mainly due to its high temperature requirements - such cultivation system is risky and may only be successful during very warm summers. In this study, we analyzed four kind of compost studded by Agaricus blazei Murrill mushroom mycelium. We recorded every hour the air and compost temperature and the air relative humidity. The best studded compost was the classical, followed by synthetic and then by the mixt compost.

  7. Volatile Composition of Some Cultivated and Wild Culinary-Medicinal Mushrooms from Hungary.

    Science.gov (United States)

    Csóka, Mariann; Geosel, Andras; Amtmann, Maria; Korany, Kornel

    2017-01-01

    The volatile constituents of the fruiting bodies of 4 culinary-medicinal mushroom species (Agaricus bisporus, Boletus edulis, Cantharellus cibarius, and Hericium erinaceus) from Hungary were examined to review their aroma composition. Simultaneous distillation/extraction was applied to extract volatile compounds from fungi, and the values were measured with gas chromatography--mass spectrometry. Although the fragrances of fungi are not as characteristic as those of spices, several groups of volatile compounds have been found in mushrooms. The number of identified components ranged between 61 and 100, with a high ratio of 8-carbon volatiles generally occurring in fungi. Beyond common properties, individual attributes have been identified as well: an outstanding ratio of benzene compounds in champignons, numerous N-containing volatiles in boletes, carotenoid degradation products in chanterelles, and esters and fatty acids with a high carbon number in the lion's mane mushroom. The identification of these characteristic fragrance constituents can be very important in differentiating between species and confirming their presence in mushroom products.

  8. Antihyperlipidemic activities of Pleurotus ferulae on biochemical and histological function in hypercholesterolemic rats

    Directory of Open Access Journals (Sweden)

    Nuhu Alam

    2011-01-01

    Full Text Available Background: Pleurotus ferulae is an edible mushroom has been widely used for nutritional and medicinal purposes. Irrespective of the medicinal importance or therapeutic potentials of P. ferulae, there have not been studies on anti-hyperlipidemic properties. Therefore, the present study investigates the effects of dietary P. ferulae fruiting bodies on plasma and feces biochemical and on the liver histological status in hypercholesterolemic rats. Methods: Six weeks old female Sprague-Dawley albino rats were divided into three groups of 10 rats each. Then biochemical and histological examinations were performed. Results: Feeding of a diet containing 5% P. ferulae fruiting bodies to hypercholesterolemic rat reduced plasma total cholesterol, triglyceride, low-density lipoprotein (LDL, total lipid, phospholipids, and LDL/high-density lipoprotein ratio by 30.02, 49.31, 71.15, 30.23, 21.93, and 65.31%, respectively. Mushroom also significantly reduced body weight in hypercholesterolemic rats. However, it had no adverse effects on plasma albumin, total bilirubin, direct bilirubin, creatinin, blood urea nitrogen, uric acid, glucose, total protein, calcium, sodium, potassium, chloride, inorganic phosphate, magnesium, and enzyme profiles. Feeding mushroom increased total lipid and cholesterol excretion in feces. The plasma lipoprotein fraction, separated by agarose gel electrophoresis, indicated that P. ferulae significantly reduced plasma β and pre-β-lipoprotein, while increased the α-lipoprotein. A histological study of hepatic cells by conventional hematoxylin-eosin and oil red O staining showed normal findings for mushroom-fed hypercholesterolemic rats. Conclusions: The present study suggests that 5% P. ferulae diet supplement provides health benefits, at least partially, by acting on the atherogenic lipid profile in hypercholesterolemic rats.

  9. Edible mushroom Pleurotus sajor-caju production on washed and supplemented sugarcane bagasse Produção do cogumelo comestível Pleurotus sajor-caju em bagaço de cana-de-açúcar lavado e suplementado

    Directory of Open Access Journals (Sweden)

    Evelise Moncaio Moda

    2005-04-01

    Full Text Available Traditionally, the cultivation of Pleurotus sajor-caju is performed on different composted and pasteurized agricultural residues. The objective of this study was to investigate whether traditional composting and pasteurization processes could be replaced by washed and supplemented (mineral or organic sugarcane bagasse. In one experiment, fresh sugarcane bagasse was immersed in hot water at 80°C for two hours (control or washed in fresh water for one hour using an adapted machine for residue treatment. In another experiment, fresh sugarcane bagasse was washed in fresh water (control, and supplemented with corn grits (organic supplementation, or supplemented with nutrient solution (mineral supplementation. In the first experiment, the washed bagasse presented a average biological efficiency (ABE of 19.16% with 44% contamination, and the pasteurized bagasse presented a ABE of 13.86% with 70% contamination. In the second experiment, corn grits presented the poorest performance, with a ABE of 15.66% and 60% contamination, while supplementation with the nutrient solution presented a ABE of 30.03%, whereas the control of 26.62%. Washing fresh sugarcane bagasse could suppress the pasteurized substrate in Pleurotus sajor-caju production, compensating a reduced ABE with a faster process.Tradicionalmente, o cultivo do Pleurotus sajor-caju é realizado utilizando-se diversos resíduos agrícolas, precedido dos processos de compostagem e pasteurização. O presente trabalho teve por objetivo comparar o processo de pasteurização com a lavagem do bagaço de cana-de-açúcar e avaliar formas de suplementação do bagaço, visando aumento na produtividade. No primeiro experimento, os colmos da cana-de-açúcar passaram por moenda para a extração do caldo, sendo em seguida desfibrados. No tratamento controle, o bagaço fresco foi pasteurizado em água a 80°C durante 2 horas e o outro tratamento consistiu na lavagem do bagaço fresco em centrífuga com

  10. Bacillus niabensis sp. nov., isolated from cotton-waste composts for mushroom cultivation.

    Science.gov (United States)

    Kwon, Soon-Wo; Lee, Seon-Young; Kim, Byung-Yong; Weon, Hang-Yeon; Kim, Jung-Bong; Go, Seung-Joo; Lee, Gil-Bok

    2007-08-01

    A group of five bacilli, designated strains 4T12, 4T19(T), 5M45, 5M53 and 5T52, isolated from cotton-waste composts for mushroom cultivation, were examined. These strains were Gram-positive, aerobic, motile, spore-forming rods. 16S rRNA gene sequence analyses revealed that the isolates belonged to the genus Bacillus, showing the highest levels of similarity (approx. 96.6-96.9 %) with respect to Bacillus herbersteinensis DSM 16534(T). The values for DNA-DNA hybridization (approx. 85-96 %) among these five strains revealed that they belong to the same species. The major menaquinone present was MK-7 and the predominant cellular fatty acids were anteiso-C(15 : 0) (approx. 24.5-33.9 %) and C(16 : 0) (approx. 15.1-34.1 %). The DNA G+C contents were 37.7-40.9 mol%. On the basis of physiological, biochemical, chemotaxonomic and comparative genomic analyses, the five isolates represent a novel species of the genus Bacillus, for which the name Bacillus niabensis sp. nov. is proposed. The type strain is 4T19(T) (=KACC 11279(T) =DSM 17723(T)).

  11. In Vitro Antioxidant and In Vivo Hypolipidemic Effects of the King Oyster Culinary-Medicinal Mushroom, Pleurotus eryngii var. ferulae DDL01 (Agaricomycetes), in Rats with High-Fat Diet-Induced Fatty Liver and Hyperlipidemia.

    Science.gov (United States)

    Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun

    2017-01-01

    We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.

  12. Influence of 50 Hz magnetic field on growth of mushroom species: Shitake (Lentinus edodes) and Oyster (Pleurotus astreatus)

    Energy Technology Data Exchange (ETDEWEB)

    Bambang Anggoro; Pakpahan, P.M.; Fajar Dwi Kusnoaji; Sirait, K.T. [Bandung Institute of Technology (Indonesia). Faculty of Industrial Technology

    1999-07-01

    Investigation on effects of electromagnetic fields on different aspects of biological systems has been done by much research. Our present study, which has been carried out under the joint research between the laboratory of High voltage and High current Engineering and the Laboratory of Microbiology of Institut Teknologi Bandung, investigates the influence of 50 Hz magnetic field on the growth of several species of mushroom. In this study, we observed growth of mushroom, from spora up to fully ripped stages, under magnetic field exposure of different intensity from 0,1 mT to 1,7 mT. During exposure the room condition was held constant at a temperature of 20{sup o}C and 95% humidity. We noted that some parameters such as: mushroom growth velocity, shape, dimension, quantity, color and period of mushroom ovary are significantly influenced by magnetic energy absorbed. (author)

  13. A Proinflammatory Effect of the β-Glucan from Pleurotus cornucopiae Mushroom on Macrophage Action

    Directory of Open Access Journals (Sweden)

    Ken-ichiro Minato

    2017-01-01

    Full Text Available PCPS from P. citrinopileatus mushroom extract is a β-1,6-glucan possessing a proinflammatory effect on innate immune cells. The PCPS stimulated THP-1 macrophages to secrete significant levels of TNF. Moreover, the mRNA expressions of TNF and IL-1β were significantly enhanced by PCPS treatment. However, the PCPS did not induce to express both IL-12 and IL-10 mRNA in the macrophages. Next, the P. cornucopiae extract (containing mainly PCPS treatment against mice showed significant increases in TNF and IL-1β mRNA expressions in the peritoneal macrophages of them. In this study, the expression levels of IFNγ mRNA in the spleen were almost the same between the extract- (PCPS- treated group and control group. However, the expression of IL-4 mRNA showed a lower level in the extract-treated group than that in the control. Our results suggested that the PCPS could induce proinflammatory action in the immune response. In addition, the proinflammatory effect of the PCPS on THP-1 was enhanced by 5′-GMP-Na, while it was reduced by vitamin D2. These two compounds are majorly contained in the P. citrinopileatus mushroom. Therefore, these results suggested that the P. citrinopileatus mushroom might contain other immune regulative compounds, such as vitamin D2, as well as PCPS.

  14. Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

    Science.gov (United States)

    Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

    2017-06-01

    Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

  15. Evaluation of cellulosic wastes for the cultivation of Pleurotus eryngii ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-16

    May 16, 2008 ... of plant residues, and they have been found to be nutritionally and ... In most countries, there is a well-established consumer accep- tance for cultivated ... temperature, dampness, CO2, cultivation methods and tecniques etc.

  16. Evaluation of casing materials made from spent mushroom substrate and coconut fibre pith for use in production of Agaricus bisporus (Lange) Imbach

    Energy Technology Data Exchange (ETDEWEB)

    Pardo-Gimenez, A.; Pardo-Gonzalez, J. E.

    2008-07-01

    The agronomic performance of different proportions of mixtures of coconut fibre (CF) pith and spent mushroom substrate (SMS) was studied for their use as casing material in mushroom cultivation. After chemical and biological characterisation of the casing substrates qualitative and quantitative production parameters were evaluated in a cycle of Agaricus production. An increase in the proportion of SMS reduced the number of carpophores and overall yield; while the first flush was delayed, mushroom size tended to increase and the mushrooms had a higher dry matter content and a better texture, although their colour was worse. Combinations of CF pith and SMS of 4:1 and 3:2 (v/v) gave biological efficiencies of 92.9 and 82.6 kg 100 kg-1 compost, respectively. These values compare well with that obtained from the commercial casings used as a control. The high electrical conductivity of the mixture containing the highest proportion of SMS would limit its use. However, the results indicate the viability of reusing SMS as an ingredient of casing material for mushroom cultivation. This alternative could be considered to partially replace the organic substrates normally used for mushroom cultivation, with the double advantage of decreasing cost and reducing the environmental impact of waste disposal. Additional key words: alternative casing, compost reuse, mushroom cultivation. (Author) 31 refs.

  17. Antimelanogenesis and Anti-Inflammatory Activity of Selected Culinary-Medicinal Mushrooms.

    Science.gov (United States)

    Saad, Hazwani Mat; Sim, Kae Shin; Tan, Yee Shin

    2018-01-01

    Five culinary-medicinal mushrooms are commonly available in the Malaysian market: Agaricus bisporus (white and brown), Ganoderma lucidum, Hypsizygus marmoreus, Pleurotus floridanus, and P. pulmonarius. These species were selected for use in the current study, the aim of which was to investigate the antimelanogenesis and anti-inflammatory activity of these mushrooms in an attempt to evaluate their potential use in cosmeceuticals. Mushroom fruiting bodies were extracted with hot water, and the extracts were freeze-dried before testing. The antimelanogenesis activity of the extracts was determined by cell viability assay, measurement of intracellular melanin content, and cellular tyrosinase assay with B16F10 melanoma cells. The anti-inflammatory activity of the mushroom extracts was tested by measuring the levels of nitric oxide (NO), tumor necrosis factor (TNF)-α, and interleukin-10 excreted by RAW264.7 macrophages. Brown A. bisporus reduced intracellular melanin content to the largest extent-up to 57.05 ± 3.90%-without a cytotoxic effect on B16F10 melanoma cells. This extract also reduced cellular tyrosinase activity to 17.93 ± 2.65%, performing better than kojic acid, the positive control. In parallel, the extract from brown A. bisporus, at the highest concentration tested, has appreciable anti-inflammatory activity through reductions of NO and TNF-α levels. The other 5 extracts showed moderate antimelanogenesis and anti-inflammatory activities. In summary, our findings show that A. bisporus (brown) extract has the potential to be used as an ingredient in whitening skincare products and to sooth the inflammatory response on the skin.

  18. EFEKTIVITAS PEMBERIAN AIR LERI TERHADAP PERTUMBUHAN DAN HASIL JAMUR TIRAM PUTIH (Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Ummu Kalsum

    2011-09-01

    Full Text Available White oyster mushroom is kind of consumed mushroom that has delicious taste and efficacious drug. Mushroom need nutrition addition to increase growth and development so that better production, like nutrition from rice washing water. The contain are carbon element, nitrogen, mineral and vitamin B. This experiment aim to determine addition of rice washing water effect, optimal volume and time interval on growth and yield of white oyster mushroom (Pleurotus ostreatus. This experiment is carried out at mushroom’s house Maduraya Agro Kamal. The research design used was factorial completely randomized design with two factors. First factor is addition rice washing water volume with 4 level, that is without addition rice washing water (A0, addition rice washing water as much as 20 ml/1000 g substrat (A1, 40 ml/1000 g substrat (A2 and 60 ml/1000 g substrat (A3. Second factor is addition time interval that consists of 2 level, that is 2 days (B1 and 4 days (B2. Experiment result shows that interaction between volume treatment and addition time interval give effect on fruit body total. Addition rice washing water volume treatment give real effect on maximal pileus fruit width. While addition time interval treatment does not give significant difference on all parameters but it can increase pileus fruit width, total weight and biological efficiency. Interaction of volume treatment and addition time interval is the best combination is volume treatment 40 ml/1000 g substrat with time interval 2 days (A2B1, this matter is showed in lot fruit body total as big as 8,871 fruit. Addition rice washing water volume 40 ml/1000 g substrat is the best volume that indicated from first bud appear, first harvest time, total weight and biological efficiency.

  19. Convergent coevolution in the domestication of coral mushrooms by fungus-growing ants

    DEFF Research Database (Denmark)

    Munkacsi, A B; Pan, J J; Villesen, Palle

    2004-01-01

    -mushroom family Pterulaceae using phylogenetic reconstructions based on broad taxon sampling, including the first mushroom collected from the garden of an ant species in the A. pilosum group. The domestication of the pterulaceous cultivar is independent from the domestication of the gilled mushrooms cultivated......Comparisons of phylogenetic patterns between coevolving symbionts can reveal rich details about the evolutionary history of symbioses. The ancient symbiosis between fungus-growing ants, their fungal cultivars, antibiotic-producing bacteria and cultivar-infecting parasites is dominated by a pattern...

  20. Pengaruh jamur tiram putih (pleurotus ostreatus terhadap kadar glukosa darah, profil lipid dan kadar MDA pada tikus (rattus norvegicus diabetes melitus

    Directory of Open Access Journals (Sweden)

    Purbowati Purbowati

    2016-06-01

    Full Text Available Background : Diabetes mellitus is a chronic disease caused by acquired deficiency in insulin production by the pancreas, or by the ineffectiveness of using the produced insulin. Oyster mushroom (Pleurotus ostreatus can help lower blood glucose levels, improve lipid profile and reduce levels of MDA. Objective : to analyze the effect of oyster mushroom on blood glucose levels, lipid profile and MDA levels in STZ induced rats as type 1 DM model. Methods : thirty Sprague Dawley rats were randomly divided into 3 groups: one positive group (1 and two treated group which received 100 mg/kgBB (2 and 200 mg/kgBB (3 oyster mushroom extract, respectively. The interventions were carried out for 30 days. The examination of blood glucose levels, lipid profile and MDA levels was before and after the intervention. The differences inthe datapre-post interventions were analyzed by paired t-test, whereas the differences between the groups were analyzed by one-way ANOVA and kruskal wallis followed by post hoc analysis. Results : the treatment group experienced a decrease in blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and an increase in HDL cholesterol levels post-intervention (p < 0,001. Oyster mushroom extract with the dose of 200 mg/kg was more effective in lowering blood glucose levels, MDA levels and improving lipid profiles (p < 0,001. Conclusion : Oyster mushrooms administration lowers blood glucose levels, total cholesterol, LDL cholesterol, triglycerides, MDA and increases HDL cholesterol levels.

  1. Ear Mushroom (Auricularia sp.) Cultivation On Irradiated Palm Oil Empty Fruit Bunch And Saw Dust

    International Nuclear Information System (INIS)

    Endrawanto; Suwadji, E.

    2000-01-01

    The experiments were conducted under laboratory condition. Ear mushroom (Auricularia sp.) were grown on palm oil empty fruit bunch (EFB), sludge of oil residue, and saw dust as growth medium after (heating) autoclaved and irradiated by gamma rays at the dose of 30 kGy. EFB fiber as well as saw dust were mixed with sludge in composition of (1:0), (0;1), (1;1), (2;5), (1;5), (1;10) and (1;20). The mixture was then composted within 2 weeks by the addition of CaO 2%, CaSO 4 (gypsum) 2 %, rice bran 12%, P fertilizer 0,5% and urea 0,25%. A plastic bag volume 1000 ml was filled by 400 grams of composted material as mushrooms medium or bag log. Sterilized bag logs were then inoculated with mushroom spawns. After inoculation, bag logs were incubated during 1.5 months waiting for mycelium growing. Parameters of the experiments were following weight of mushrooms after harvesting, biological efficiency, rendement, and total fiber on bag log after mushrooms harvesting. Results of experiments showed that utilization of sludge as mixture with EFB produced weight mushrooms yield more than without sludge addition. Saw dust treatment produced more mushrooms weight compared to EFB treatments I.e. 90 g and 75 g. Weight of mushrooms produced and 76.6 g respectively. Rendement obtained between saw dust palm oil empty fruit bunch treatments were not significant at P<0.05 I.e. 91-92%

  2. Induction and evaluation of beneficial mutations in Volvariella volvacea mushroom

    International Nuclear Information System (INIS)

    Borromeo, J.D.

    1976-03-01

    The present strains of Volvariella volvacea are difficult to grow, hence the need for developing a wild-type mushroom that can be grown without the stringent cultural requirements. This would be suitable for backyard or small-scale production. A vigorous white mushroom that responds to the controlled conditions in mushroom houses is appropriate for large-scale or commercial production. The percentages success in getting the ''first flushes'' has been no more than 30%. There was a certain amount of difficulty in recognizing mutants based on their morphological features in laboratory culture. The first irradiation series utilizing 200 and 400 kR and using the box-type method of cultivation in growing the mushroom have given us the needed information in planning the next irradiation series

  3. Ethnomedicinal uses, pharmacological activities, and cultivation of Lignosus spp. (tiger׳s milk mushrooms) in Malaysia - A review.

    Science.gov (United States)

    Lau, Beng Fye; Abdullah, Noorlidah; Aminudin, Norhaniza; Lee, Hong Boon; Tan, Pei Jean

    2015-07-01

    Several members of the genus Lignosus, which are collectively known as cendawan susu rimau (in Malay) or tiger׳s milk mushrooms (TMM), are regarded as important local medicine particularly by the indigenous communities in Malaysia. The mushroom sclerotia are purportedly effective in treating cancer, coughs, asthma, fever, and other ailments. The most commonly encountered Lignosus spp. in Malaysia was authenticated as Lignosus rhinocerotis (Cooke) Ryvarden (synonym: Polyporus rhinocerus), which is also known as hurulingzhi in China and has been used by Chinese physicians to treat liver cancer, gastric ulcers, and chronic hepatitis. In spite of growing interest in the therapeutic potential of TMM, there is no compilation of scientific evidence that supports the ethnomedicinal uses of these mushrooms. Therefore, the present review is intended (i) to provide a comprehensive, up-to-date overview of the ethnomedicinal uses, pharmacological activities, and cultivation of TMM in general and L. rhinocerotis in particular, (ii) to demonstrate how recent scientific findings have validated some of their traditional uses, and (iii) to identify opportunities for future research and areas to prioritize for TMM bioprospecting. A detailed literature search was conducted via library search (books, theses, reports, newspapers, magazines, and conference proceedings) and electronic search (Web of Science, PubMed, and Google Scholar) for articles published in peer-reviewed journals. These sources were scrutinized for information on TMM and specifically for L. rhinocerotis. Ethnomycological knowledge about TMM, with an emphasis on cultural associations and use as local medicine, has been comprehensively and systematically compiled for the first time. Some of the reported medicinal properties of TMM have been validated by scientific studies. The anti-tumor, immuno-modulatory, anti-inflammatory, anti-oxidative, anti-microbial, neurite outgrowth stimulation, and other pharmacological

  4. Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

    Science.gov (United States)

    Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

    2011-10-01

    Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Evaluation of umami taste in mushroom extracts by chemical analysis, sensory evaluation, and an electronic tongue system.

    Science.gov (United States)

    Phat, Chanvorleak; Moon, BoKyung; Lee, Chan

    2016-02-01

    Seventeen edible mushrooms commercially available in Korea were analysed for their umami taste compounds (5'-nucleotides: AMP, GMP, IMP, UMP, XMP; free amino acids: aspartic, glutamic acid) and subjected to human sensory evaluation and electronic tongue measurements. Amanita virgineoides featured the highest total 5'-nucleotide content (36.9 ± 1.50 mg/g), while monosodium glutamate-like components (42.4 ± 6.90 mg/g) were highest in Agaricus bisporus. The equivalent umami concentration (EUC) ranged from 1.51 ± 0.42 to 3890 ± 833 mg MSG/g dry weight; most mushrooms exhibited a high umami taste. Pleurotus ostreatus scored the highest in the human sensory evaluation, while Flammulina velutipes obtained the maximum score in the electronic tongue measurement. The EUC and the sensory score from the electronic tongue test were highly correlated, and also showed significant correlation with the human sensory evaluation score. These results suggest that the electronic tongue is suitable to determine the characteristic umami taste of mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Dietary fibers from mushroom sclerotia. 4. In vivo mineral absorption using ovariectomized rat model.

    Science.gov (United States)

    Wong, Ka-Hing; Katsumata, Shin-Ichi; Masuyama, Ritsuko; Uehara, Mariko; Suzuki, Kazuharu; Cheung, Peter C K

    2006-03-08

    The effect of three novel dietary fibers (DFs) prepared from mushroom sclerotia, namely, Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos, on calcium and magnesium absorption was evaluated in ovariectomized (OVX) rats fed with sclerotial DF based and low Ca (0.3%) diets for 14 days. The animals in the W. cocos DF diet group possessed significantly (p cocos DF group were also significantly (p cocos DF could improve the overall Ca and Mg absorptions of the OVX rats fed a low Ca diet. The potential use of sclerotial DFs as a functional food ingredient for enhancing mineral absorption is also discussed.

  7. Nutriceutical potential of Pleurotus tuber-regium sclerotium

    Directory of Open Access Journals (Sweden)

    R. C. Ohiri

    2018-04-01

    Full Text Available The aim of the study was to determine the composition of the sclerotium of Pleurotus tuber-regium and to analyze its nutritional potential. Major minerals and micronutrients content of the P. tuber-regium sclerotium were determined. The study has shown fairly high concentrations of potassium and magnesium as major minerals with values of 60.66 ± 4.13 and 41.79 ± 3.14 mg/kg, while manganese and zinc were micronutrients with the highest values of 1.20 ± 0.10 and 0.95 ± 0.07 mg/kg. Glutamic acid and aspartic acid were also observed in high concentrations with values of 11.51 ± 1.01 and 5.52 ± 0.86 mg/kg. The mushroom powder of P. tuber-regium was a source for production of oil, which was analyzed by GC-MS method. Benzenedicarboxylic acid mono-(2-ethylhexyl ester and benzenedicarboxylic acid butyl-cyclohexyl ester were volatile constituents predominating with percentage total of 78.7 and 5.2, respectively. It is concluded that the presence of mineral elements, amino acids and volatile components observed in this fungus indicated the presence of the nutritional potential in the sclerotia of P. tuber-regium.

  8. Folk taxonomy and use of mushrooms in communities around Ngorongoro and Serengeti National Park, Tanzania.

    Science.gov (United States)

    Tibuhwa, Donatha Damian

    2012-09-21

    Maasai and Kurya form two main communities around the Serengeti National Park in Tanzania which are mainly pastoralists. Changing climate to excessive drought, have recently forced them to start practicing subsistence farming which is severely affected by wild animals. This study explored status of the folk taxonomy and uses of mushrooms in the two communities as a pave way for possibilities of introducing mushroom cultivation, an alternative crop which is hardly affected by wild animals. Folk taxonomy and use mushrooms by the Kurya and Maasai communities were investigated. Information was collected by face to face interviews with 150 individuals in 6 selected villages. Using descriptive statistics by Statistic Package for the Social Science (SPSS) version 17.0, the demographic characteristics of informants were evaluated and cross relationships with the recorded data were analysed. Kurya are mycophilic with 94% of the informants recognizing utilization of the wild mushroom either as foodstuff or as tonics while the Maasai are mycophobic with 99% being unaware of the edibility of mushroom although 28% recognized mushrooms as tonic. For both communities, the knowledge of mushroom utilization and folk taxonomy increased with age of the informants, while it decreases with formal education level of the informants which imply that the basis of knowledge is mainly traditional. Comparing the two communities, the Maasai use mushrooms only for medicinal purposes and never sought them for food while the Kurya were well knowledgeable on the edibility and folk classification especially the Termitomyces species. Characters used in folkal taxonomy included color and size of the basidiomata, shape and size of the pseudorrhiza, habitats and edibility information. A new use of ascospores whereby they anaesthaesia bees during honey harvesting was discovered, and mushroom cultivation was widely welcomed (94.7%) as an alternative crop which is rarely affected by wild animals. In order

  9. Folk taxonomy and use of mushrooms in communities around Ngorongoro and Serengeti National Park, Tanzania

    Directory of Open Access Journals (Sweden)

    Tibuhwa Donatha

    2012-09-01

    Full Text Available Abstract Background Maasai and Kurya form two main communities around the Serengeti National Park in Tanzania which are mainly pastoralists. Changing climate to excessive drought, have recently forced them to start practicing subsistence farming which is severely affected by wild animals. This study explored status of the folk taxonomy and uses of mushrooms in the two communities as a pave way for possibilities of introducing mushroom cultivation, an alternative crop which is hardly affected by wild animals. Methods Folk taxonomy and use mushrooms by the Kurya and Maasai communities were investigated. Information was collected by face to face interviews with 150 individuals in 6 selected villages. Using descriptive statistics by Statistic Package for the Social Science (SPSS version 17.0, the demographic characteristics of informants were evaluated and cross relationships with the recorded data were analysed. Results Kurya are mycophilic with 94% of the informants recognizing utilization of the wild mushroom either as foodstuff or as tonics while the Maasai are mycophobic with 99% being unaware of the edibility of mushroom although 28% recognized mushrooms as tonic. For both communities, the knowledge of mushroom utilization and folk taxonomy increased with age of the informants, while it decreases with formal education level of the informants which imply that the basis of knowledge is mainly traditional. Comparing the two communities, the Maasai use mushrooms only for medicinal purposes and never sought them for food while the Kurya were well knowledgeable on the edibility and folk classification especially the Termitomyces species. Characters used in folkal taxonomy included color and size of the basidiomata, shape and size of the pseudorrhiza, habitats and edibility information. A new use of ascospores whereby they anaesthaesia bees during honey harvesting was discovered, and mushroom cultivation was widely welcomed (94.7% as an alternative

  10. Convergent coevolution in the domestication of coral mushrooms by fungus-growing ants

    DEFF Research Database (Denmark)

    Munkacsi, A.B.; Pan, J.J.; Villesen, P.

    2004-01-01

    family Pterulaceae using phylogenetic reconstructions based on broad taxon sampling, including the first mushroom collected from the garden of an ant species in the A. pilosum group. The domestication of the pterulaceous cultivar is independent from the domestication of the gilled mushrooms cultivated...... of parallel coevolution, where the symbionts of each functional group are members of monophyletic groups. However, there is one outstanding exception in the fungus-growing ant system, the unidentified cultivar grown only by ants in the Apterostigma pilosum group. We classify this cultivar in the coral-mushroom...

  11. Effect of some heavy metals on the growth and development of Pleurotus tuber-regium.

    Directory of Open Access Journals (Sweden)

    Akpaja EO

    2012-02-01

    Full Text Available The effects of five heavy metals (cadmium, copper, mercury, lead and zinc on the growth and fruit body production in Pleurotus tuber-regium was investigated. Lead sulphate, zinc sulphate, copper sulphate, cadmium nitrate and mercury chloride were added to garden soil at concentrations of 0, 0.125, 0.25, 0.5, 1.0, and 2.0 mmol per 3 kg of soil. Sclerotia of the test mushroom were used to inoculate the artificially contaminated soil. Mercury prevented growth and fruit body production in P. tuber-regium. Fungal morphometry was greatly affected by lead. The heavy metal content in the fungal biomass complex increased with increase of heavy metal concentration in the soil. The highest concentration (183.06 mg/kg was found in zinc at 2 mmol/L.

  12. Content of Chemical Elements in Wood-Destroying Fungi

    Directory of Open Access Journals (Sweden)

    Strapáč I.

    2016-12-01

    Full Text Available The aim of this study was to examine the content of chemical elements in the dried fruiting bodies of edible wood decaying fungi such as Honey mushrooms (Armillaria mellea, Shiitakes (Lentinus edodes and Oyster mushrooms (Pleurotus ostreatus. Powdered samples of fungi were mineralized in a microwave digestion. Twenty-one (21 chemical elements were detected in the plasma of the device ICP-MS AGILENT 7500c by accredited methods with the aid of calibration curves. The content of individual elements varied within a considerable range. The highest contents of K, Mn, Cu and Cd were found in the fruiting bodies of Honey mushrooms (Armillaria mellea. Shiitakes (Lentinus edodes had the highest content of B and Mo. Significant differences were found in the content of elements in the Oyster mushrooms (Pleurotus ostreatus from Slovakia, Hungary and China. The highest content of Al was found in the Oyster mushrooms (Pleurotus ostreatus from Hungary. The Chinese oysters had a maximum contents of Ca, Mg, Co, Pb, As and U. The Oyster mushrooms (Pleurotus ostreatus from Lemešany (Slovakia had the highest contents of Na, Zn, Fe, Se, Ag, Hg and Cr. The difference of chemical element content could be influenced by the genotype of the fungus and by the composition of substrate on which mushroom grow up.

  13. Dietary fibers from mushroom sclerotia: 1. Preparation and physicochemical and functional properties.

    Science.gov (United States)

    Wong, Ka-Hing; Cheung, Peter C K

    2005-11-30

    Preparation of three novel dietary fibers (DFs) from mushroom sclerotia, namely, Pleurotus tuberregium, Polyporous rhinocerus, and Wolfiporia cocos, by a scale-up modified AOAC procedure using industrial enzymes was investigated. A remarkably high level of total dietary fiber (TDF) ranging from 81.7 to 96.3% sample dry matter (DM), in which a content of nonstarch polysaccharide (NSP) ranging from 86.6 to 94.3% sclerotial TDF DM, was obtained from the three sclerotia. All sclerotial DFs were rich in beta-glucan (the glucose residue ranged from 89.7 to 94.5% NSP DM) with a very low level of resistant glycogen (ranged from 3.77 to 3.94% sclerotial TDF DM). All three novel sclerotial DFs also exhibited similar, if not better, physicochemical and functional properties (pH, color, water binding capacity, oil holding capacity, and emulsifying properties) as those of barely DF control and commercial DF-rich ingredients. The potential use of the three mushroom sclerotial DFs as a new beta-glucan type DF-rich ingredient in the food industry was discussed.

  14. Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

    Directory of Open Access Journals (Sweden)

    Ricardo Sposina S. Teixeira

    2010-01-01

    Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

  15. The potential of Pleurotus-treated olive mill solid waste as cattle feed.

    Science.gov (United States)

    Shabtay, Ariel; Hadar, Yitzhak; Eitam, Harel; Brosh, Arieh; Orlov, Alla; Tadmor, Yaakov; Izhaki, Ido; Kerem, Zohar

    2009-12-01

    The aims of the current study were to follow: (1) the capability of the edible mushroom Pleurotus ostreatus to degrade cell wall components and soluble phenols of the olive mill solid waste (OMSW), and improve it for ruminant nutrition (2) the fate of oil and the lipid-soluble compounds tocopherols, squalene and beta-sitosterol in the fermented OMSW. A significant decrease in oil and lipid-soluble compounds with a concomitant shift in the fatty acid profile and degradation of soluble phenols took place already after 14 d. The utilization of lipids by the fungus shifted the degradation of the structural carbohydrates to a later stage, and significantly reduced the metabolizable energy of the OMSW. We propose that edible fungi with reduced lipase activity would preserve the energy and health promoting ingredients of the oil, and force the fungus to degrade structural carbohydrates, thus improving its digestibility.

  16. An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and oyster (Pleurotus ostreatus) mushrooms.

    Science.gov (United States)

    Hearst, Rachel; Nelson, David; McCollum, Graham; Millar, B Cherie; Maeda, Yasunori; Goldsmith, Colin E; Rooney, Paul J; Loughrey, Anne; Rao, J R; Moore, John E

    2009-02-01

    Antibiotic agents have been in widespread and largely effective therapeutic use since their discovery in the 20th century. However, the emergence of multi-drug resistant pathogens now presents an increasing global challenge to both human and veterinary medicine. It is now widely acknowledged that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance. With this in mind, a study was undertaken to examine the antimicrobial properties of aqueous extracts of 'exotic' Shiitake and Oyster mushrooms on a range of environmental and clinically important microorganisms. Several batches of Shiitake and oyster mushrooms were purchased fresh from a local supermarket and underwent aqueous extraction of potential antimicrobial components. After reconstitution, aqueous extracts were tested qualitatively against a panel of 29 bacterial and 10 fungal pathogens, for the demonstration of microbial inhibition. Our data quantitatively showed that Shiitake mushroom extract had extensive antimicrobial activity against 85% of the organisms it was tested on, including 50% of the yeast and mould species in the trial. This compared favourably with the results from both the Positive control (Ciprofloxacin) and Oyster mushroom, in terms of the number of species inhibited by the activity of the metabolite(s) inherent to the Shiitake mushroom. This small scale study shows the potential antimicrobial effects of Shitake extracts, however further work to isolate and identify the active compound(s) now requires to be undertaken. Once these have been identified, suitable pharmaceutical delivery systems should be explored to allow concentrated extracts to be prepared and delivered optimally, rather than crude ingestion of raw material, which could promote further bacterial resistance.

  17. Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

    Directory of Open Access Journals (Sweden)

    Marian Petre

    2009-11-01

    Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts.The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum asthe longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for theirvalorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

  18. Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

    Directory of Open Access Journals (Sweden)

    Marian Petre

    2009-12-01

    Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts. The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum as the longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for their valorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

  19. Concentrations of 137Cs and 40K in mushrooms consumed in Japan and radiation dose as a result of their dietary intake

    International Nuclear Information System (INIS)

    Ban-nai, Tadaaki; Muramatsu, Yasuyuki; Yoshida, Satoshi

    2004-01-01

    Mushrooms are known to accumulate radiocesium. To estimate the intake of radiocesium through the eating of mushrooms, about 30 samples belonging to 4 commonly consumed species (Lentinula edodes, Hypsizigus marmoreus, Grifola frondosa, and Tricholoma matsutake), were analyzed for 137 Cs and 40 K. The concentration ranges were 0.060-29 Bq kg -1 (wet wt) for 137 Cs and 38-300 Bq kg -1 (wet wt) for 40 K. The geometric mean concentration for 137 Cs was 0.56 Bq kg -1 (wet wt), and the mean concentration for 40 K was 92 Bq kg -1 (wet wt). The 137 Cs concentrations in L. edodes cultivated in mushroom beds (sawdust-rice bran media) were lower than those cultivated on bed logs (natural wood with bark). The annual intake of 137 Cs per person through mushrooms was calculated, by using the current analytical results and food consumption data in Japan, to be 3.1 Bq for 137 Cs, which is about 28% of the total dietary intake of this nuclide. The effective dose equivalent of 137 Cs through mushrooms was estimated to be 4.0 x 10 -8 Sv, which is about the half the value obtained in our previous study. The decrease of the 137 Cs intake through mushrooms is probably related to changes in cultivation methods in recent years, from the use of bed logs to mushroom beds. (author)

  20. Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii.

    Science.gov (United States)

    Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

    2014-01-01

    Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.

  1. Contents of trace elements in meadow mushrooms as results of PIXE, NAA and AAS measurements

    International Nuclear Information System (INIS)

    Urban, J.; Sieniawski, J.

    1992-01-01

    Contents of heavy elements in mushrooms from the Dresden area and from some parts of Poland, by use of three methods of measurement (PIXE, AAS and NAA) were determined, with the special interest focused on wild growing and cultivated meadow mushrooms. The ability for accumulation of Se, Cu, Ag and Cu was established. In some wild growing mushrooms the values of Cd, Hg, As and Pb exceeded allowed limits for human nutrition. (author). 16 refs, 1 fig., 5 tabs

  2. New Germplasms of the Culinary-Medicinal Button Mushroom, Agaricus bisporus (Agaricomycetes): Two Wild Strains from the Tibetan Plateau (China).

    Science.gov (United States)

    Li, Bin-Bin; Jiang, Si-Ping; Xu, Ai-Guo; Dorji, Phurbu; Wang, Wen-Jing; Wang, Xiao-Liang; Wei, Tie-Zheng; Zhang, Zu-Tang; Yao, Yi-Jian

    2017-01-01

    Agaricus bisporus is one of the most important commercially cultivated culinary-medicinal mushrooms worldwide. In China, most of the cultivated strains of the fungus were introduced from other countries and cultivated in the eastern provinces. In this study, 2 wild strains of A. bisporus, 2091 and 2094, isolated from fresh specimens collected from the Tibetan Plateau, were domesticated and cultivated alongside a commercial hybrid strain, As2796, in Lhasa, China, for comparison in order to provide new germplasms for cultivation. Basic characteristics, mushroom yield, dry weight, polysaccharide contents, and antioxidant activities of the tested strains were analyzed. Compared with strain As2796, the 2 wild strains displayed good values for mycelial growth, time to fruiting, mushroom yield, dry weight, and polysaccharide contents, and their basidiomata had distinct morphological characteristics (e.g., brown or pale brown caps with some white scales). In addition, the antioxidant activities (reducing power and DPPH radical scavenging effect) of strain 2094 were significantly higher than those of the other 2 strains. Domestication of the 2 wild strains would add more genetic variation into the germplasm of A. bisporus for cultivation, especially in China, and might help to address the problem inherent to the nearly monoculture crop lacking genetic diversity in China.

  3. Characterization of Biochemical Composition for Different Types of Spent Mushroom Substrate in Malaysia

    International Nuclear Information System (INIS)

    Nur Aziera Abd Rasib; Zarina Zakaria; Mohammad Fahrurrazi Tompang; Ridzwan Abdul Rahman; Hakimah Othman

    2015-01-01

    A preliminary study was conducted to identify the amount and changes of biochemical composition of different types of Malaysian spent mushroom substrate (SMS) before and after several cycle of mushroom cultivation. The characterization of SMS involved the analysis of crude protein, carbohydrate, fat, lignin and ash for selected mushrooms namely as white oyster (Pleuratos oestrous), grey oyster (Pleuratos sajor-caju), abalone (Pleuratos cystidiosus), ganoderma (Ganoderma lucidium) and black jelly (Auricularia polytricha). Overall trend showed that there were increment for crude protein and fat, whereas carbohydrate and lignin showed reduction in the content. Significant results were showed on protein increment where ganoderma attained the highest value, 36.6 g, followed by black jelly, white oyster, grey oyster and abalone. Contradictory, lowest carbohydrate reduction was observed in ganoderma at 70.42 g and the most was in black jelly. Increment in fat and reduction in lignin was almost similar for each SMS. There was an increment in the ash percentage resulted from sterilization process. Clearly cultivation by mushroom had changed biochemical value especially in increasing the protein content that might be useful in protein required industry such as animal feeding. (author)

  4. Effects of Eryngii mushroom (Pleurotus eryngii) and Lactobacillus plantarum on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880).

    Science.gov (United States)

    Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa

    2016-10-01

    This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.

  5. Measurements of trace contaminants in closed-type plant cultivation chambers

    Science.gov (United States)

    Tani, A.; Kiyota, M.; Aiga, I.; Nitta, K.; Tako, Y.; Ashida, A.; Otsubo, K.; Saito, T.

    Trace contaminants generated in closed facilities can cause abnormal plant growth. We present measurement data of trace contaminants released from soils, plants, and construction materials. We mainly used two closed chambers, a Closed-type Plant and Mushroom Cultivation Chamber (PMCC) and Closed-type Plant Cultivation Equipment (CPCE). Although trace gas budgets from soils obtained in this experiment are only one example, the results indicate that the budgets of trace gases, as well as CO_2 and O_2, change greatly with the degree of soil maturation and are dependent on the kind of substances in the soil. Both in the PMCC and in the CPCE, trace gases such as dioctyl phthalate (DOP), dibutyl phthalate (DBP), toluene and xylene were detected. These gases seemed to be released from various materials used in the construction of these chambers. The degree of increase in these trace gas levels was dependent on the relationship between chamber capacity and plant quantity. Results of trace gas measurement in the PMCC, in which lettuce and shiitake mushroom were cultivated, showed that ethylene was released both from lettuce and from the mushroom culture bed. The release rates were about 90 ng bed^-1 h^-1 for the shiitake mushroom culture bed (volume is 1700 cm^3) and 4.1 ~ 17.3 ng dm^-2h^-1 (leaf area basis) for lettuce. Higher ethylene release rates per plant and per unit leaf area were observed in mature plants than in young plants.

  6. Polluting macrophytes Colombian lake Fúquene used as substrate by edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Martínez-Nieto, Patricia; García-Gómez, Gustavo; Mora-Ortiz, Laura; Robles-Camargo, George

    2014-01-01

    Invasive aquatic plants from Lake Fúquene (Cundinamarca, Colombia), water hyacinth (Eichhornia crassipes C. Mart.) and Brazilian elodea (Egeria densa Planch.) have been removed mechanically from the lake and can be used for edible mushrooms production. The growth of the oyster mushroom (Pleurotus ostreatus) on these aquatic macrophytes was investigated in order to evaluate the possible use of fruiting bodies and spent biomass in food production for human and animal nutrition, respectively. Treatments included: water hyacinth, Brazilian elodea, sawdust, rice hulls and their combinations, inoculated with P. ostreatus at 3%. Water hyacinth mixed with sawdust stimulated significantly fruiting bodies production (P = 3.3 × 10(-7)) with 71% biological efficacy, followed by water hyacinth with rice husk (55%) and elodea with rice husk (48%), all of these have protein contents between 26 and 47%. Loss of lignin (0.9-21.6%), cellulose (3.7-58.3%) and hemicellulose (1.9-53.8%) and increment in vitro digestibility (16.7-139.3%) and reducing sugars (73.4-838.4%) were observed in most treatments. Treatments spent biomass presented Relative Forage Values (RFV) from 46.1 to 232.4%. The results demonstrated the fungus degrading ability and its potential use in aquatic macrophytes conversion biomass into digestible ruminant feed as added value to the fruiting bodies production for human nutrition.

  7. Sustainable energy supply for mushroom cultivation. Application of underground energy storage. Application of a heat pump for heat production. Feasibility study; Duurzame energievoorziening paddestoelen kwekerij. toepassing van energieopslag in de bodem. Toepassing van warmtepomp voor warmteopwekking. Een haalbaarheidsstudie

    Energy Technology Data Exchange (ETDEWEB)

    Koel, J.J. [EBS-Adviseurs, Veenendaal (Netherlands)

    2001-02-26

    The results of a feasibility study on the use of heat and cold storage and the use of an electric heat pump for the energy supply of a mushroom cultivation business (Verbruggen paddestoelen in Erp, Netherlands) are presented.

  8. Determination of transfer coefficient between oyster mushrooms and cultivating medium using 242Pu and 241Am tracers

    International Nuclear Information System (INIS)

    Galanda, D.; Matel, L.

    2003-01-01

    The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of Am-241 and Pu-242. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by α-spectrometry. The results of activity Am-241 and Pu-242 in the mushrooms body and residual activity in the support were detected and calculated. (authors)

  9. Biological resources and breeding for improvements in the production of the button mushroom in small-scale farming

    OpenAIRE

    Savoie, Jean-Michel

    2013-01-01

    Gourmet mushrooms may contribute to the development of a new agriculture by addressing the consumer demand and some of the non-nutritional uses of agricultural productions. The value of recycling with gourmet and medicinal mushrooms is clearly understood and wastes can be viewed as positive products, at least in term of providing new economic opportunities and positive environmental consequences. Important cultivated edible and medicinal mushrooms are members of the Agaricus genus. They are s...

  10. Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus

    International Nuclear Information System (INIS)

    Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook

    2003-01-01

    A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group

  11. Characteristics of radiocesium concentration by mushrooms and microorganisms

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Kuwahara, Chikako; Shibata, Hisashi; Maeda, Yoko; Kato, Fumio

    2000-01-01

    The 137 Cs values in cultured edible fruiting bodies of Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus) were 2-3 orders of magnitude higher than those in the wild mushrooms. The concentration ratio (CR, 137 Cs or Cs concentration in the dried cultured fruiting bodies or mycelia/ 137 Cs or Cs concentration in the fresh medium) suggested that 137 Cs in the medium actively migrated into the mushroom. The 137 Cs and stable Cs uptake by the cultured fruiting bodies of P. ostreatus were affected by the presence of K the same as the mycelia. Streptomyces lividans TK24 (S.lividans) and Streptomyces sp. TOHO-2 (Streptomyces sp.), one of the soil microorganisms, grown in the presence of Cs showed high accumulation of Cs in the mycelia. Elementary analysis of P. ostreatus and S. lividans were performed using a scanning electron microscopy-energy dispersive X-ray microanalyzer. The ratio of Cs in the stationary phase to that in the proliferation phase at the mycelial root of P. ostreatus formed in the early stage was about five times that at the mycelial tip. S. lividans and Streptomyces sp. grown on the YM agar plate containing CsCl showed white spots locating at a similar intervals. Concentrations of Cs, P, O and Mg in the white spots were higher than those in other regions. (author)

  12. Sequencing and Comparative Analysis of the Straw Mushroom (Volvariella volvacea) Genome

    Science.gov (United States)

    Bao, Dapeng; Gong, Ming; Zheng, Huajun; Chen, Mingjie; Zhang, Liang; Wang, Hong; Jiang, Jianping; Wu, Lin; Zhu, Yongqiang; Zhu, Gang; Zhou, Yan; Li, Chuanhua; Wang, Shengyue; Zhao, Yan; Zhao, Guoping; Tan, Qi

    2013-01-01

    Volvariella volvacea, the edible straw mushroom, is a highly nutritious food source that is widely cultivated on a commercial scale in many parts of Asia using agricultural wastes (rice straw, cotton wastes) as growth substrates. However, developments in V. volvacea cultivation have been limited due to a low biological efficiency (i.e. conversion of growth substrate to mushroom fruit bodies), sensitivity to low temperatures, and an unclear sexuality pattern that has restricted the breeding of improved strains. We have now sequenced the genome of V. volvacea and assembled it into 62 scaffolds with a total genome size of 35.7 megabases (Mb), containing 11,084 predicted gene models. Comparative analyses were performed with the model species in basidiomycete on mating type system, carbohydrate active enzymes, and fungal oxidative lignin enzymes. We also studied transcriptional regulation of the response to low temperature (4°C). We found that the genome of V. volvacea has many genes that code for enzymes, which are involved in the degradation of cellulose, hemicellulose, and pectin. The molecular genetics of the mating type system in V. volvacea was also found to be similar to the bipolar system in basidiomycetes, suggesting that it is secondary homothallism. Sensitivity to low temperatures could be due to the lack of the initiation of the biosynthesis of unsaturated fatty acids, trehalose and glycogen biosyntheses in this mushroom. Genome sequencing of V. volvacea has improved our understanding of the biological characteristics related to the degradation of the cultivating compost consisting of agricultural waste, the sexual reproduction mechanism, and the sensitivity to low temperatures at the molecular level which in turn will enable us to increase the industrial production of this mushroom. PMID:23526973

  13. Sequencing and comparative analysis of the straw mushroom (Volvariella volvacea genome.

    Directory of Open Access Journals (Sweden)

    Dapeng Bao

    Full Text Available Volvariella volvacea, the edible straw mushroom, is a highly nutritious food source that is widely cultivated on a commercial scale in many parts of Asia using agricultural wastes (rice straw, cotton wastes as growth substrates. However, developments in V. volvacea cultivation have been limited due to a low biological efficiency (i.e. conversion of growth substrate to mushroom fruit bodies, sensitivity to low temperatures, and an unclear sexuality pattern that has restricted the breeding of improved strains. We have now sequenced the genome of V. volvacea and assembled it into 62 scaffolds with a total genome size of 35.7 megabases (Mb, containing 11,084 predicted gene models. Comparative analyses were performed with the model species in basidiomycete on mating type system, carbohydrate active enzymes, and fungal oxidative lignin enzymes. We also studied transcriptional regulation of the response to low temperature (4°C. We found that the genome of V. volvacea has many genes that code for enzymes, which are involved in the degradation of cellulose, hemicellulose, and pectin. The molecular genetics of the mating type system in V. volvacea was also found to be similar to the bipolar system in basidiomycetes, suggesting that it is secondary homothallism. Sensitivity to low temperatures could be due to the lack of the initiation of the biosynthesis of unsaturated fatty acids, trehalose and glycogen biosyntheses in this mushroom. Genome sequencing of V. volvacea has improved our understanding of the biological characteristics related to the degradation of the cultivating compost consisting of agricultural waste, the sexual reproduction mechanism, and the sensitivity to low temperatures at the molecular level which in turn will enable us to increase the industrial production of this mushroom.

  14. Accumulation of radiocesium and trace elements in mushrooms collected from Japanese forests

    International Nuclear Information System (INIS)

    Yoshida, S.; Muramatsu, Y.; Ban-Nai, T.

    1996-01-01

    Concentrations of 137 Cs, 134 Cs and 40 K for 124 mushroom species (284 samples) collected from Japanese forests during 1989 to 1991 were studied. The levels of 137 Cs m mushrooms varied very widely ranging from 40 K were relatively constant. The median concentrations of 137 Cs and 40 K were 53 and 1180 Bq/kg (dry wt), respectively. The 134 Cs discharged through the Chernobyl accident was detected only in 33 mushroom samples. The proportions of 137 Cs originating from the Chernobyl accident m these mushrooms were in the range 137 Cs concentrations in mycorrhizal fungi tended to be higher than those in saprophytes. The concentrations in many mushrooms reflected the layers m which their mycelia were growing. In addition to the radionuclides, many stable elements including stable Cs in mushroom and soil samples were determined. A good correlation between 137 Cs and stable Cs was observed for 33 mushrooms collected from a pine forest on sandy soil near coast in Tokai-mura, Ibaraki, indicating that mushroom available Cs is recycling in the pine forest with the constant 137 Cs/stable Cs ratio. Accumulations from soil to mushrooms were observed for Cd, Rb, Zn, Cu. Cs, K, Mg, Mn, Ni and Tl. Through cultivation experiments in flasks using radiotracers, 137 Cs, 65 Zn and 54 Mn were observed to be accumulated in mushrooms. (author)

  15. Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde: Nutritional value and in vitro neurite outgrowth activity in rat pheochromocytoma cells.

    Science.gov (United States)

    Phan, Chia-Wei; Wong, Wei-Lun; David, Pamela; Naidu, Murali; Sabaratnam, Vikineswary

    2012-07-19

    Drugs dedicated to alleviate neurodegenerative diseases like Parkinson's and Alzheimer's have always been associated with debilitating side effects. Medicinal mushrooms which harness neuropharmacological compounds offer a potential possibility for protection against such diseases. Pleurotus giganteus (formerly known as Panus giganteus) has been consumed by the indigenous people in Peninsular Malaysia for many years. Domestication of this wild mushroom is gaining popularity but to our knowledge, medicinal properties reported for this culinary mushroom are minimal. The fruiting bodies P. giganteus were analysed for its nutritional values. Cytotoxicity of the mushroom's aqueous and ethanolic extracts towards PC12, a rat pheochromocytoma cell line was assessed by using 3-[4,5-dimethythiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) assay. Neurite outgrowth stimulation assay was carried out with nerve growth factor (NGF) as control. To elucidate signaling mechanisms involved by mushroom extract-induced neurite outgrowth, treatment of specific inhibitor for MEK/ERK and PI3K signalling pathway was carried out. The fruiting bodies of P. giganteus were found to have high carbohydrate, dietary fibre, potassium, phenolic compounds and triterpenoids. Both aqueous and ethanolic extracts induced neurite outgrowth of PC12 cells in a dose- and time-dependant manner with no detectable cytotoxic effect. At day 3, 25 μg/ml of aqueous extract and 15 μg/ml of ethanolic extract showed the highest percentage of neurite-bearing cells, i.e. 31.7 ± 1.1% and 33.3 ± 0.9%; respectively. Inhibition treatment results suggested that MEK/ERK and PI3K/Akt are responsible for neurite outgrowth of PC12 cells stimulated by P. giganteus extract. The high potassium content (1345.7 mg/100 g) may be responsible for promoting neurite extension, too. P. giganteus contains bioactive compounds that mimic NGF and are responsible for neurite stimulation. Hence, this mushroom may be

  16. ALTERNATIVE NOURISHMENT BESIDE VEGETABLE AND FRUIT IN OUR COUNTRY SOURCE: WILD MUSHROOM (Pleurotus eryngii var. ferulae

    Directory of Open Access Journals (Sweden)

    Mehmet Akyüz

    2007-04-01

    Full Text Available P. eryngii var. ferulae which is known very well in Eastern Anatolia Region and picked up from the nature in spring months is sold by the side of the roads and in neighbour markets with the name of ‘’ çaşır, çakşır, çaşur, heliz, kırkor, göbek, göbelek and mendik’’ mushroom. As a member of Apiaceae family; Ferulae sp. that preads at the slope of the mountains, grows up naturally on the roots of its species that remained from the previous year especially at the altitude of 1000-2500 meters on high mountains. It is known that local people has benefited from the natural products special to periodic times. It is seen that it is not benefited from alternative natural nourishment resources like cultuıre vegetables and fruit with their important features and effective nutritive value. In our opinion, this article will be useful for mentioning the importance of the mushroom beside the vegetables and fruits which are vital for our life. It will be useful to expose the medical features, nourishment content and effective nutritive valu and effective nutritious features of mushroom. Furthermore, It is determined that it is necessary to describe P. eryngii and its similarities with the identification of scientific facts as species, subspecies, variety, taxa or synonym in our country.

  17. Neurite outgrowth stimulatory effects of culinary-medicinal mushrooms and their toxicity assessment using differentiating Neuro-2a and embryonic fibroblast BALB/3T3.

    Science.gov (United States)

    Phan, Chia-Wei; David, Pamela; Naidu, Murali; Wong, Kah-Hui; Sabaratnam, Vikineswary

    2013-10-11

    Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health.

  18. Carbon And Nitrogen Requirements For The Cultivation Of Oyster ...

    African Journals Online (AJOL)

    Carbon And Nitrogen Requirements For The Cultivation Of Oyster Mushroom ... It was found that under these experimental conditions, the carbon compounds supported growth except ribose, starch and dextrin. ... HOW TO USE AJOL.

  19. Levels of platinum group elements and rare-earth elements in wild mushroom species growing in Poland.

    Science.gov (United States)

    Mleczek, Mirosław; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Gąsecka, Monika

    2016-01-01

    Due to limited data-describing abilities of mushrooms to accumulate platinum group elements (PGEs) and rare-earth elements (REEs), the aim of this study was to determine, by inductively coupled plasma optical emission spectrometry followed by microwave-assisted sample digestion by nitric acid, the content of these elements in 20 mushroom species (10 above ground and 10 growing on wood), mostly edible, collected near a busy trunk road. The highest content of PGEs in above-ground mushroom species was observed in Lepista gilva and Suillus bovinus fruit bodies (0.38 ± 0.05 and 0.37 ± 0.03 mg kg(-1) DW, respectively), while in mushrooms growing on wood, the highest content was observed in Pleurotus ostreatus (0.35 ± 0.04 mg kg(-1) DW). The mean content of PGEs for both these groups was 0.23 ± 0.08 and 0.26 ± 0.07 mg kg(-1) DW, respectively. The highest content of REEs in Suillus luteus and Tricholoma equestra was 5.03 ± 0.50 and 2.18 ± 0.56 mg kg(-1) DW, respectively, but within mushrooms growing on wood in Ganoderma applanatum fruiting bodies it was 4.19 ± 0.78 mg kg(-1) DW. Mean contents of REEs were 1.39 ± 1.21 and 1.61 ± 0.97 mg kg(-1) DW in above-ground species and species growing on wood, respectively. Generally, the group of mushroom species growing on wood was capable of slightly higher accumulation of both REEs and PGEs. No limits have been established for both the groups until now.

  20. Increase of vitamin D2 by UV-B exposure during the growth phase of white button mushroom (Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Hanne L. Kristensen

    2012-04-01

    Full Text Available Background: Mushrooms are the only non-animal food source of vitamin D. Wild mushrooms have naturally high vitamin D2 content, and cultivated mushrooms produce vitamin D2 from ergosterol when exposed to supplementary UV-B during the post-harvest phase.Objectives: This study investigated the effects of providing supplementary UV-B during the growth phase on vitamin D2 formation and the interactions with growth of mushrooms, as compared to supplementary UV-B during the post-harvest phase or exposure to sunlight for both cultivated and wild mushrooms.Methods: Experiments were carried out with exposure to supplementary UV-B just prior to harvest in the range of 0–2,400 mJ cm−2. Mushrooms grew for 2 days with or without repeated UV-B exposure each day. Vitamin D2 and growth rate were determined. In addition, some mushrooms were post-harvest treated by exposure at 200 mJ cm−2 supplementary UV-B or natural sunlight, prior to vitamin D2 determination.Results: The content of vitamin D2 was 0.2–164 µg 100 g−1 fresh weight, and there was a linear relationship between UV-dose up to 1,000 mJ cm−2 and vitamin D2 content. The fast growth rate of the mushrooms diluted the vitamin D2 from 24 to 3 µg 100 g−1 within 2 days of exposure at 200 mJ cm−2. Following repeated UV-B exposure, vitamin D2 increased to 33 µg vitamin D2 100 g−1. Growth was unaffected by UV-B. Post-harvest exposure to supplementary UV-B resulted in a higher vitamin D2 content of 32 µg 100 g−1 compared to the 24 µg 100 g−1 obtained from exposure to UV-B during the growth phase. In contrast, wild and cultivated mushrooms with and without exposure to sunlight had vitamin D2 content in the range of 0.2–1.5 µg vitamin D2 100 g−1.Conclusions: This study showed that mushrooms with a well-defined content of vitamin D2 can be obtained by exposure to supplementary UV-B just prior to harvest.

  1. Pleurotus sajor caju

    African Journals Online (AJOL)

    Administrator

    The influence of fungus treatment on the biochemical composition and degradation patter of sawdust and cotton plant by-products (cotton burns and cotton gin trash) by Pleurotus sajor caju were evaluated. Lignin degradation increased as the incubation period progressed while the highest loss of hemicellulose, cellulose ...

  2. Pleurotus pulmonarius cultivation on amended palm press fibre waste

    African Journals Online (AJOL)

    In the last few decades, rapid global demand for edible oils has resulted in a significant increase in the land area of oil crop cultivation. In the process of extraction of palm oil from oil palm fruit, biomass materials such as palm pressed fibre (PPF) are generated as waste products. This research was undertaken to evaluate ...

  3. Entomopathogenic nematodes for the control of phorid and sciarid flies in mushroom crops

    OpenAIRE

    Navarro, María Jesús; Gea, Francisco José

    2014-01-01

    The objective of this work was to evaluate the efficacy of two nematodes, Steinernema feltiae and S. carpocapsae, to control mushroom flies and to evaluate the effect of these treatments on Agaricus bisporus production. Two mushroom cultivation trials were carried out in controlled conditions, in substrate previously infested with the diptera Megaselia halterata and Lycoriella auripila, with two treatments: 106infective juveniles (IJ) per square meter of S. feltiae and 0.5x106IJ m-2S. feltiae...

  4. Improvement in the productivity of xylooligosaccharides from waste medium after mushroom cultivation by hydrothermal treatment with suitable pretreatment.

    Science.gov (United States)

    Sato, Nobuaki; Shinji, Kazunori; Mizuno, Masahiro; Nozaki, Kouichi; Suzuki, Masayuki; Makishima, Satoshi; Shiroishi, Masahiro; Onoda, Takeru; Takahashi, Fumihiro; Kanda, Takahisa; Amano, Yoshihiko

    2010-08-01

    The effective xylooligosaccharides (XOs) production from the waste medium after mushroom cultivation (WM) was investigated. The WM contains rich nutrients (protein, etc.) which induce Maillard reaction with reducing sugars under hydrothermal conditions. To improve the productivity of XOs, the suitable pretreatment combined with washing and grinding was investigated, and subsequently hydrothermal treatment was demonstrated with batch type and continuous flow type reactor. The washing pretreatment with hot water of 60 degrees C was effective to remove nutrients from the WM, and it led to prevent brownish discoloration on the hydrothermal treatment. On the basis of experimental data, industrial XOs production processes consisting of the pretreatment, hydrothermal treatment and purification step was designed. During the designed process, 2.3 kg-dry of the purified XOs was produced from 30 kg-wet of the WM (15% yield as dry basis weight). Theoretical yield of XOs attained to 48% as xylan weight in the WM. (c) 2010 Elsevier Ltd. All rights reserved.

  5. Biodegradation and detoxification of olive mill wastewater by selected strains of the mushroom genera Ganoderma and Pleurotus

    Czech Academy of Sciences Publication Activity Database

    Ntougias, S.; Baldrian, Petr; Ehaliotis, C.; Nerud, František; Antoniou, T.; Merhautová, Věra; Zervakis, G.

    2012-01-01

    Roč. 88, č. 5 (2012), s. 620-626 ISSN 0045-6535 Institutional research plan: CEZ:AV0Z50200510 Keywords : White-rot fungi * Mushroom * Toxicity Subject RIV: EE - Microbiology, Virology Impact factor: 3.137, year: 2012

  6. EVALUACIÓN DE LOS PARÁMETROS PRODUCTIVOS DE LA SEMILLA DE Pleurotus ostreatus PROPAGADA EN DIFERENTES MEDIOS DE CULTIVO AVALIAÇÃO DOS PARÂMETROS DE PRODUÇÃO DA SEMENTÉ DE Pleurotus ostreatus DISSEMINADAS EM DIFERENTES MEIOS DE CULTURA EVALUATION OF PARAMETERS PRODUCTION OF THE SEED Pleurotus ostreatus SPREED IN DIFFERENT CULTURE MEDIA

    Directory of Open Access Journals (Sweden)

    MARÍA DEL PILAR RÍOS

    2010-12-01

    3 inteiramente casualizado. Na terceira seção avaliada, se avaliou a colonização e frutificação do fungo em bagaço de cana utilizando parâmetros biológicos, tais como desempenho, eficiência e taxa de produção de sementes, com o inteiramente casualizado 3x3. 0 meio alternativo em pH 5,0 foi o mais adequado para o crescimento de Pleurotus ostreatus, demonstrando sua adaptabilidade a meios com alto conteúdo de carboidrato, cujos níveis de renda foram adequados para a produção competitiva e fruticultura diminuindo o tempo de incubação e colheita.Alternative media were evaluated for the propagation of Pleurotus ostreatus and its behavior was compared with that of a commercial media. The response to these media was measured through the adaptation of the fungus in barley for obtaining the commercial seed and this one in its turn in the response to a substratum based on cane bagasse for obtaining oyster mushrooms. In the first phase the fungus was obtained and planted in a solid media of potato extract at two concentrations and three pH values using a factorial design 2x3 (pH vs. concentration of potato extract. In the second phase was measured the growth of Pleurotus ostreatus inoculated in sterilized hydrated barley through a completely random design 3x3. In the third phase was evaluated the colonization and fructification of the fungus in cane bagasse using parameters as biológical efficiency performance and seed production rate, with a completely random design 3x3. The alternative media with pH 5,0 was the most adequate for the growth of Pleurotus ostreatus, displaying its adaptability to media with high carbohydrates content which performances were appropiate to obtain competitive production levels in growth and fructification, diminishing thus the incubation and harvesting time.

  7. Concentration and behavior of radioactive cesium in several kinds of mushrooms in Hokkaido, (2)

    International Nuclear Information System (INIS)

    Okui, Toyo; Kobayashi, Satoshi; Takizawa, Namio.

    1991-01-01

    Concentrations of 137 Cs, 134 Cs and potassium were measured in cultivated and wild mushrooms and their matrixes (soils or woods) collected from Hokkaido in 1990. The 137 Cs concentrations in mushrooms were in the range of 0.07-188.9Bq/kg fresh weight. The highest 137 Cs concentration was observed in Clitocybe clavipes. The 137 Cs concentration ratios of the wood rotting fungi and the actomycorrhizal fungi were 0.8-5.0 and 0.3-1.1, respectively. Both values of mushrooms were remarkably higher than that of leafvegetables (10 -2 ∼10 -3 ). The potassium concentrations in mushrooms were in the range of 0.08-0.63 %. 134 Cs released from the Chernobyl atomic power plant stationin 1986 was observed in only Clitocybe clavipes. (author)

  8. Lithium biofortification of medicinal mushrooms Agrocybe cylindracea and Hericium erinaceus.

    Science.gov (United States)

    Rzymski, Piotr; Niedzielski, Przemysław; Siwulski, Marek; Mleczek, Mirosław; Budzyńska, Sylwia; Gąsecka, Monika; Poniedziałek, Barbara

    2017-07-01

    Although an increase in dietary lithium (Li) has been suggested as a possible method for mood stabilization and for decreasing violence and suicidal rates, no Li-enriched food has entered the market. Here we continue to explore the feasibility of mushrooms in this respect and have investigated the growth, accumulation and mineral content (Ca, K, Mg and Na) of Agrocybe cylidracea and Hericium erinaceus cultivated on substrates supplemented with 0.25-1.0 mM of Li as acetate or chloride. As demonstrated, supplementation with LiCl yielded more satisfactory results, did not alter mushroom biomass, appearance, shape or size regardless of Li concentration. It also had no significant effect on mineral composition and resulted in a concentration-dependent uptake of Li and its accumulation in fruiting bodies. More promising results were found for H. erinaceus . As calculated, consumption of 100 g dw of its fruiting bodies obtained from cultivation with 1.0 mM of Li (as acetate or chloride) would constitute 69% of the provisional recommended dietary daily intake of Li set at 1.0 mg. The study highlights that H. erinaceus could be selected for further studies on Li-enriched food that concern the bioavailability of Li from mushrooms, their safety and activity in animal experimental models and eventually, human studies.

  9. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  10. Anaerobic hydrogen production from unhydrolyzed mushroom farm waste by indigenous microbiota.

    Science.gov (United States)

    Lin, Chiu-Yue; Lay, Chyi-How; Sung, I-Yuan; Sen, Biswarup; Chen, Chin-Chao

    2017-10-01

    The cultivation of mushrooms generates large amounts of waste polypropylene bags stuffed with wood flour and bacterial nutrients that makes the mushroom waste (MW) a potential feedstock for anaerobic bioH 2 fermentation. MW indigenous bacteria were enriched using thermophilic temperature (55°C) for use as the seed inoculum without any external seeding. The peak hydrogen production rate (6.84 mmol H 2 /L-d) was obtained with cultivation pH 8 and substrate concentration of 60 g MW/L in batch fermentation. Hydrogen production yield (HY) is pH and substrate concentration dependent with an HY decline occurring at pH and substrate concentration increasing from pH 8 to 10 and 60 to 80 g MW/L, respectively. The fermentation bioH 2 production from MW is in an acetate-type metabolic path. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. Influence of environmental factors on the carbon dioxide production of mushroom substrate

    NARCIS (Netherlands)

    Loeffen, H.; Bakker, J.C.

    1998-01-01

    An important characteristic of the mushroom cultivation is the "activity" of substrate. The correlations were determined between climate factors and CO2 production per phase of seven crops. The CO2 production was used as a measure for substrate activity. During the vegetative phases high

  12. Assessment of factors influencing trace element content of mushrooms from European part of Russia

    International Nuclear Information System (INIS)

    Gorbunov, A.V.; Lyapunov, S.M.; Okina, O.I.; Frontas'eva, M.V.; Pavlov, S.S.

    2009-01-01

    The results on trace element content in 12 species of basidial mushrooms from the European part of Russia are presented. Difference in the elemental content of wild and cultivated mushrooms is demonstrated. Assessment of technogenic contamination impact on trace element content of champignons is given. It was revealed that in the described conditions the accumulation of Ni, Cu, Zn, Cd, and Pb in Boletus edulis is not observed. High content of the mentioned elements in these mushrooms is caused by high content of their mobile forms in soil. It was shown that the high concentration of mobile forms of metals in soil establishes in the process of natural many years' accumulation of organic matter followed by its decomposition

  13. Phylogenetic placement of an unusual coral mushroom challenges the classic hypothesis of strict coevolution in the apterostigma pilosum group ant-fungus mutualism.

    Science.gov (United States)

    Dentinger, Bryn T M; Lodge, D Jean; Munkacsi, Andrew B; Desjardin, Dennis E; McLaughlin, David J

    2009-08-01

    The approximately 50 million-year-old fungus-farming ant mutualism is a classic example of coevolution, involving ants that subsist on asexual, fungal biomass, in turn propagating the fungus clonally through nest-to-nest transmission. Most mutualistic ants cultivate two closely related groups of gilled mushrooms, whereas one small group of ants in the genus Apterostigma cultivates a distantly related lineage comprised of the G2 and G4 groups. The G2 and G4 fungi were previously shown to form a monophyletic group sister to the thread-like coral mushroom family Pterulaceae. Here, we identify an enigmatic coral mushroom that produces both fertile and sterile fruiting structures as the closest free-living relative of the G4 fungi, challenging the monophyly of the Apterostigma-cultivated fungi for the first time. Both nonparametric bootstrap and Bayesian posterior probability support the node leading to the G4 cultivars and a free-living Pterula mushroom. These data suggest three scenarios that contradict the hypothesis of strict coevolution: (1) multiple domestications, (2) escape from domestication, (3) selection of single cultivar lineages from an ancestral mixed-fungus garden. These results illustrate how incomplete phylogenies for coevolved symbionts impede our understanding of the patterns and processes of coevolution.

  14. New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-06-01

    Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

  15. Natural radionuclides and 137Cs in commercialized edible mushrooms in Sao Paulo-Brazil

    International Nuclear Information System (INIS)

    Castro, Lilian Pavanelli de

    2008-01-01

    Artificial and natural radionuclides are commonly found in several compartments of the earth's crust. Some mushroom species have a high capacity to absorb radionuclides and toxic elements from the soil. Diet is considered as one of the main routes of radioactive contamination. Therefore, radioactivity measurements in the environment and in food are extremely important to monitor the radiation levels that human can be exposed to either directly or indirectly. Environmental bio monitoring has demonstrated that diverse organisms such as crustaceans, fish and mushrooms are useful when evaluating both the contamination and the quality of the ecosystems. There are actually several radionuclides that can be accumulated in mushrooms, including 40 K, 137 Cs, 232 Th and 238 U. There are few studies in the Southern hemisphere countries, on the natural and artificial radioactivity levels in mushrooms. The present study evaluated 40 K, 137 Cs, 232 Th and 238 U in commercialized edible mushrooms in the state of Sao Paulo, Brazil. The edible mushroom samples were acquired in different commercial establishments in the Sao Paulo metropolitan region, specifically in Municipal Markets. Some samples were acquired directly from producers located in the cities of Mogi das Cruzes, Mirandopolis, Suzano and Juquitiba. About 400g were collected for each edible mushroom species, which included Agaricus sp, Pleurotus sp and Lentinula sp species. All the samples were prepared and stored in polyethylene bottles for approximately 35 days, so that secular equilibrium could be established before counting. The 40 K, 137 Cs, 232 Th and 238 U gamma activities were measured by gamma spectrometry. The equipment consisted of a Hyper pure Germanium detector connected to an electronic system. The detector efficiency was obtained from measurements of reference materials: IAEA-300, IAEA-327 and IAEA-375. The results for the specific activities in edible mushrooms samples ranged fi-om 461 to 1535 Bq kg -1

  16. Natural products and biological activity of the pharmacologically active cauliflower mushroom Sparassis crispa.

    Science.gov (United States)

    Kimura, Takashi

    2013-01-01

    Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.

  17. Natural Products and Biological Activity of the Pharmacologically Active Cauliflower Mushroom Sparassis crispa

    Directory of Open Access Journals (Sweden)

    Takashi Kimura

    2013-01-01

    Full Text Available Sparassis crispa, also known as cauliflower mushroom, is an edible mushroom with medicinal properties. Its cultivation became popular in Japan about 10 years ago, a phenomenon that has been attributed not only to the quality of its taste, but also to its potential for therapeutic applications. Herein, I present a comprehensive summary of the pharmacological activities and mechanisms of action of its bioactive components, such as beta-glucan, and other physiologically active substances. In particular, the immunomodulatory mechanisms of the beta-glucan components are presented herein in detail.

  18. Establishment of an efficient transformation system for Pleurotus ostreatus.

    Science.gov (United States)

    Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

    2017-11-21

    Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

  19. Isolation and characterization of differentially expressed genes in ...

    African Journals Online (AJOL)

    USER

    Through reverse transcriptase-polymerase chain reaction analysis, priA homologue and AP-1 like transcription factor ... The oyster mushroom, Pleurotus ostreatus, and white button mushroom ..... differential display of RAPD. FEMS Microbiol.

  20. Cultivation of shear stress sensitive microorganisms in disposable bag reactor systems.

    Science.gov (United States)

    Jonczyk, Patrick; Takenberg, Meike; Hartwig, Steffen; Beutel, Sascha; Berger, Ralf G; Scheper, Thomas

    2013-09-20

    Technical scale (≥5l) cultivations of shear stress sensitive microorganisms are often difficult to perform, as common bioreactors are usually designed to maximize the oxygen input into the culture medium. This is achieved by mechanical stirrers, causing high shear stress. Examples for shear stress sensitive microorganisms, for which no specific cultivation systems exist, are many anaerobic bacteria and fungi, such as basidiomycetes. In this work a disposable bag bioreactor developed for cultivation of mammalian cells was investigated to evaluate its potential to cultivate shear stress sensitive anaerobic Eubacterium ramulus and shear stress sensitive basidiomycetes Flammulina velutipes and Pleurotus sapidus. All cultivations were compared with conventional stainless steel stirred tank reactors (STR) cultivations. Good growth of all investigated microorganisms cultivated in the bag reactor was found. E. ramulus showed growth rates of μ=0.56 h⁻¹ (bag) and μ=0.53 h⁻¹ (STR). Differences concerning morphology, enzymatic activities and growth in fungal cultivations were observed. In the bag reactor growth in form of small, independent pellets was observed while STR cultivations showed intense aggregation. F. velutipes reached higher biomass concentrations (21.2 g l⁻¹ DCW vs. 16.8 g l⁻¹ DCW) and up to 2-fold higher peptidolytic activities in comparison to cell cultivation in stirred tank reactors. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Entomopathogenic nematodes for the control of phorid and sciarid flies in mushroom crops

    Directory of Open Access Journals (Sweden)

    María Jesús Navarro

    2014-01-01

    Full Text Available The objective of this work was to evaluate the efficacy of two nematodes, Steinernema feltiae and S. carpocapsae, to control mushroom flies and to evaluate the effect of these treatments on Agaricus bisporus production. Two mushroom cultivation trials were carried out in controlled conditions, in substrate previously infested with the diptera Megaselia halterata and Lycoriella auripila, with two treatments: 106infective juveniles (IJ per square meter of S. feltiae and 0.5x106IJ m-2S. feltiae + 0.5x106IJ m-2S. carpocapsae. Another experiment was carried out using the same treatments to evaluate the possible nematode effect on mushroom yield. The number of adults emerging from the substrate was evaluated for each fly species. No decrease in the population of M. halterata was detected with nematode application, whereas the number of L. auripila was reduced in both treatments, particularly in the individual treatment with S. feltiae. The application of entomopathogenic nematodes has no adverse effect on mushroom production.

  2. Effect of gamma irradiation on the nutritional quality of Agaricus bisporus strains cultivated in different composts

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Meire Cristina Nogueira, E-mail: mcnandrade@hotmail.com [Universidade do Sagrado Coracao (USC), Bauru, SP (Brazil). Centro de Ciencias Exatas e Sociais Aplicadas; Jesus, Joao P.F.; Vieira, Fabricio R.; Viana, Sthefany R.F.; Minhoni, Marli T.A. [Universidade Estadual Paulista Julio de Mesquita Filho (FCA/UNESP), Botucatu, SP (Brazil). Fac. de Ciencias Agronomicas. Dept. de Producao Vegetal/Defesa Fitossanitaria, Modulo de Cogumelos; Spoto, Marta H.F. [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Departamento de Agroindustria, Alimentos e Nutricao

    2014-05-15

    The effect of irradiation doses (0, 125, 250 and 500 Gy) on the nutritional quality of A. bisporus mushrooms (strains ABI-07/06, ABI-05/03 and PB-1) cultivated in composts based on oat straw (Avena sativa) and brachiaria (Brachiaria sp.) was evaluated. The experimental design was 4 x 3 x 2 factorial scheme (irradiation doses x strains x composts), with 24 treatments, consisting of two repetitions each, totaling 48 experimental units (samples of mushrooms). The samples were irradiated in Cobalt-60 irradiator, model Gammacell 220 kGy, with dose rate of 0.740 kGy h{sup -1}, according to the treatments proposed. Subsequently, the control (unirradiated) and the other treatments were maintained at 4±1°C and 90% RH in a climatic chamber for carrying out the chemical analysis of the mushrooms on the 1st and 14th day of storage. It was found that all A. bisporus strains evaluated were food with excellent nutritional value, because they presented high protein and fiber contents and low ethereal extract content; the chemical characterization of the mushrooms was influenced by the compost type in which they were cultivated; gamma irradiation influenced the chemical composition of mushrooms. (author)

  3. Effect of gamma irradiation on the nutritional quality of Agaricus bisporus strains cultivated in different composts

    International Nuclear Information System (INIS)

    Andrade, Meire Cristina Nogueira; Jesus, Joao P.F.; Vieira, Fabricio R.; Viana, Sthefany R.F.; Minhoni, Marli T.A.; Spoto, Marta H.F.

    2014-01-01

    The effect of irradiation doses (0, 125, 250 and 500 Gy) on the nutritional quality of A. bisporus mushrooms (strains ABI-07/06, ABI-05/03 and PB-1) cultivated in composts based on oat straw (Avena sativa) and brachiaria (Brachiaria sp.) was evaluated. The experimental design was 4 x 3 x 2 factorial scheme (irradiation doses x strains x composts), with 24 treatments, consisting of two repetitions each, totaling 48 experimental units (samples of mushrooms). The samples were irradiated in Cobalt-60 irradiator, model Gammacell 220 kGy, with dose rate of 0.740 kGy h -1 , according to the treatments proposed. Subsequently, the control (unirradiated) and the other treatments were maintained at 4±1°C and 90% RH in a climatic chamber for carrying out the chemical analysis of the mushrooms on the 1st and 14th day of storage. It was found that all A. bisporus strains evaluated were food with excellent nutritional value, because they presented high protein and fiber contents and low ethereal extract content; the chemical characterization of the mushrooms was influenced by the compost type in which they were cultivated; gamma irradiation influenced the chemical composition of mushrooms. (author)

  4. Impact of a native Streptomyces flavovirens from mushroom compost on green mold control and yield of Agaricus bisporus.

    Science.gov (United States)

    Šantrić, Ljiljana; Potočnik, Ivana; Radivojević, Ljiljana; Umiljendić, Jelena Gajić; Rekanović, Emil; Duduk, Bojan; Milijašević-Marčić, Svetlana

    2018-05-18

    Thirty-five actinobacterial isolates, obtained from button mushroom (Agaricus bisporus) substrates (i.e., compost in different phases of composting, black peat or casing layer) in Serbia in 2014-2016 were tested in vitro against the causal agents of green mold in cultivated mushroom. Out of six most promising isolates, A06 induced 42.4% in vitro growth inhibition of Trichoderma harzianum T54, and 27.6% inhibition of T. aggressivum f. europaeum T77. The novel strain A06 was identified as Streptomyces flavovirens based on macroscopic and cultural characteristics and 16S rDNA sequence and used in mushroom growing room experiments. Actinobacteria had no negative influence on mycelial growth of the cultivated mushroom in compost in situ. Isolate S. flavovirens A06 enhanced mushroom yield significantly, up to 31.5%. The A06 isolate was more efficient in enhancing yield after inoculation with the compost mold T. aggressivum (26.1%), compared to casing mold T. harzianum (8%). Considering disease incidence, actinobacteria significantly prevented green mold in compost caused by T. aggressivum (6.8%). However, fungicide prochloraz-Mn had a more significant role in reducing symptoms of casing mold, T. harzianum, in comparison with actinobacteria (24.2 and 11.8%, respectively). No significant differences between efficacies of S. flavovirens A06 and the fungicide prochloraz-Mn against T. aggressivum were revealed. These results imply that S. flavovirens A06 can be used to increase mushroom yield and contribute to disease control against the aggressive compost green mold disease caused by Trichoderma aggressivum.

  5. Mushroom tumor: a new disease on Flammulina velutipes caused by Ochrobactrum pseudogrignonense.

    Science.gov (United States)

    Wu, Zhipeng; Peng, Weihong; He, Xiaolan; Wang, Bo; Gan, Bingcheng; Zhang, Xiaoping

    2016-01-01

    Mushroom tumor on Flammulina velutipes has become the main disease during the off-season cultivation of F. velutipes while the causal organism has remained unknown. The present study was aimed at identifying the pathogen confirming its pathogenisity following Koch's Postulates, characterizing it using morphological, physiological, biochemical and molecular features, and studying its current distribution. We determined that mushroom tumor is a new bacterial infection disease caused by Ochrobactrum pseudogrignonense. It produces tumor-like structures on the surface of the substrate, and inhibits the formation of primordia and fruiting of F. velutipes. The molecular studies showed that this new pathogen is closely related to Ochrobactrum based on 16S rRNA sequences. This is the first time that Ochrobactrum has been shown to be a pathogen of a mushroom. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Mushroom acidic glycosphingolipid induction of cytokine secretion from murine T cells and proliferation of NK1.1 α/β TCR-double positive cells in vitro

    International Nuclear Information System (INIS)

    Nozaki, Hirofumi; Itonori, Saki; Sugita, Mutsumi; Nakamura, Kimihide; Ohba, Kiyoshi; Suzuki, Akemi; Kushi, Yasunori

    2008-01-01

    Interferon (IFN)-γ and interleukin (IL)-4 regulate many types of immune responses. Here we report that acidic glycosphingolipids (AGLs) of Hypsizigus marmoreus and Pleurotus eryngii induced secretion of IFN- γ and IL-4 from T cells in a CD11c-positive cell-dependent manner similar to that of α-galactosylceramide (α-GalCer) and isoglobotriaosylceramide (iGb3), although activated T cells by AGLs showed less secretion of cytokine than those activated by α-GalCer. In addition, stimulation of these mushroom AGLs induced proliferation of NK1.1 α/β TCR-double positive cells in splenocytes. Administration of a mixture of α-GalCer and AGLs affected the stimulation of α-GalCer and generally induced a subtle Th1 bias for splenocytes but induced an extreme Th2 bias for thymocytes. These results suggested that edible mushroom AGLs contribute to immunomodulation

  7. Extracellular Enzymes Produced by the Cultivated Mushroom Lentinus edodes during Degradation of a Lignocellulosic Medium

    Science.gov (United States)

    Leatham, Gary F.

    1985-01-01

    Although the commercially important mushroom Lentinus (= Lentinula) edodes (Berk.) Sing. can be rapidly cultivated on supplemented wood particles, fruiting is not reliable. This study addressed the problem by developing more information about growth and development on a practical oakwood-oatmeal medium. The study determined (i) the components degraded during a 150-day incubation at 22°C, (ii) the apparent vegetative growth pattern, (iii) the likely growth-limiting nutrient, and (iv) assays that can be used to study key extracellular enzymes. All major components of the medium were degraded, lignin selectively so. The vegetative growth rate was most rapid during the initial 90 days, during which weight loss correlated with glucosamine accumulation (assayed after acid hydrolysis). The rate then slowed; in apparent preparation for fruiting, the cultures rapidly accumulated glucosamine (or its oligomer or polymer). Nitrogen was growth limiting. Certain enzyme activities were associated with the pattern of medium degradation, with growth, or with development. They included cellulolytic system enzymes, hemicellulases, the ligninolytic system, (gluco-)amylase, pectinase, acid protease, cell wall lytic enzymes (laminarinase, 1,4-β-d-glucosidase, β-N-acetyl-d-glucosaminidase, α-d-galactosidase, β-d-mannosidase), acid phosphatase, and laccase. Enzyme activities over the 150-day incubation period with and without a fruiting stimulus are reported. These results provide a basis for future investigations into the physiology and biochemistry of growth and fruiting. PMID:16346918

  8. Water-Soluble Polysaccharide Extracts from the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Agaricomycetes) with HMGCR Inhibitory Activity.

    Science.gov (United States)

    Gil-Ramirez, Alicia; Smiderle, Fhernanda R; Morales, Diego; Govers, Coen; Synytsya, Andriy; Wichers, Harry J; Iacomini, Marcello; Soler-Rivas, Cristina

    2017-01-01

    Water extracts from Pleurotus ostreatus containing no statins showed 3-hydroxy-3-methyl-glutaryl CoA reductase (HMGCR) inhibitory activity (in vitro) that might be due to specific water-soluble polysaccharides (WSPs); when isolated and deproteinized, increasing concentrations of the WSP extract induced higher inhibition. The WSP extract contained mainly β-glucans, mannogalactans, and glycogen (e.g., α-glucans), although derivatives or fragments with lower molecular weights (between 14 and 3.5 kDa) were present and were able to induce the inhibitory activity. The extract contained more β-(1→3)-glucans than β-(11→3),(11→6)-glucans, and they partially survived digestion and managed to pass through Caco2 cell monolayers to the lower compartment after in vitro digestion and transport experiments. The WSP might also modulate Caco2 membrane integrity.

  9. Bioconcentration of artificial radionuclides in edible mushrooms: in situ and in vitro studies

    Energy Technology Data Exchange (ETDEWEB)

    Dementyev, Dmitry V.; Manukovsky, Nikolai S.; Bolsunovsky, Alexander Ya.; Alexandrova, Yuliyana V. [Institute of Biophysics, Siberian Branch of the Russian Academy of Sciences, 660036, Krasnoyarsk (Russian Federation)

    2014-07-01

    grown on the soil-like substrate showed that accumulation of Am-241 from solution by mycelium of Pleurotus ostreatus and Neonothopanus nimbi reached 97%. Hence, these mushroom species can be used for bioremediation of solutions contaminated by radionuclides. The substrates prepared from Yenisei flood plain soils and bottom sediments, which contained Co-60, Cs-137, and Eu-152 and were also supplemented with Am-241, were used to grow fruiting bodies of P. ostreatus. The analysis showed that the fruiting bodies accumulated only Cs-137 and Am-241. The highest CF of Cs-137 by P. ostreatus grown on the sediment-based substrate was an order of magnitude higher than the CF of Cs-137 by the mushrooms grown on the soil-based substrate (0.1 vs. 0.008), due to differences in Cs-137 bioavailability in soil and sediment. Also, the CF of Am-241 was twice higher in the fruiting bodies grown on the sediment-based substrate than in those grown on the soil-based substrate (0.005 vs. 0.0026). Analysis of the CFs showed that under natural conditions, accumulation rates of Cs-137 by mushrooms were an order of magnitude higher than those of U-238. Under laboratory conditions, accumulation of Cs-137 in fruiting bodies was an order of magnitude greater than accumulation of Am-241, a transuranium radionuclide. The ability of mushrooms to accumulate artificial radionuclides makes them good candidates for bioremediation of contaminated solutions and soils. (authors)

  10. [Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

    Science.gov (United States)

    Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

    Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  12. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  13. Forest farming of shiitake mushrooms: an integrated evaluation of management practices.

    Science.gov (United States)

    Bruhn, J N; Mihail, J D; Pickens, J B

    2009-12-01

    Two outdoor shiitake (Lentinula edodes) cultivation experiments, established in Missouri USA in 1999 and 2000, produced mushrooms in 2000-2005. We examined shiitake production in response to substrate species, inoculum form, inoculum strain, and inoculation timing, using total mushroom weight per log as the primary response variable with log characteristics as covariates. The significantly greater mushroom weight produced by sugar maple logs compared with white or northern red oak was attributable to the higher proportion of undiscolored wood volume in the maple logs, rather than to bark thickness or log diameter. The "wide temperature range" shiitake strain produced significantly greater yield compared with the "warm" or "cold" weather strains. Both the wide-range and warm-weather strains were stimulated to fruit by significant rain events, while the cold-weather strain was responsive to temperature. Inoculation with sawdust spawn gave significantly greater yield than colonized wooden dowels or pre-packaged "thimble" plug inoculum. The second and third full years following inoculation were the most productive.

  14. Effects of Crude Oil and Oil Products on Growth of Some Edible ...

    African Journals Online (AJOL)

    The vegetative growth response of three local edible mushrooms: Pleurotus pulmonarius (Pp), Pleurotus tuber-regium (Pt) and Lentinus squarrosulus (Ls) on different concentrations of Crude oil (COIL), Automotive Gasoline Oil (AGO), Fresh Engine Oil (ENGOIL) and Spent Engine Oil (SENGOIL) was investigated. The result ...

  15. Elucidation of the regio- and chemoselectivity of enzymatic allylic oxidations with Pleurotus sapidus – conversion of selected spirocyclic terpenoids and computational analysis

    Directory of Open Access Journals (Sweden)

    Verena Weidmann

    2013-10-01

    Full Text Available Allylic oxidations of olefins to enones allow the efficient synthesis of value-added products from simple olefinic precursors like terpenes or terpenoids. Biocatalytic variants have a large potential for industrial applications, particularly in the pharmaceutical and food industry. Herein we report efficient biocatalytic allylic oxidations of spirocyclic terpenoids by a lyophilisate of the edible fungus Pleurotus sapidus. This ‘’mushroom catalysis’’ is operationally simple and allows the conversion of various unsaturated spirocyclic terpenoids. A number of new spirocyclic enones have thus been obtained with good regio- and chemoselectivity and chiral separation protocols for enantiomeric mixtures have been developed. The oxidations follow a radical mechanism and the regioselectivity of the reaction is mainly determined by bond-dissociation energies of the available allylic CH-bonds and steric accessibility of the oxidation site.

  16. Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

    Science.gov (United States)

    Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

    2016-05-01

    One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

  17. Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

    Directory of Open Access Journals (Sweden)

    Simon James

    2011-05-01

    Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

  18. Study on energy efficient mushroom business in 2010. Highest feasible level of energy conservation and energy efficiency; Onderzoek naar het energiezuinig paddenstoelenbedrijf anno 2010. Hoogst haalbare niveau van energiereductie en energie-efficiency

    Energy Technology Data Exchange (ETDEWEB)

    Suurmeijer, J.M.; Mikkers, E. [Grontmij, Amersfoort (Netherlands); Hilkens, J. [AdVisie, Herkenbosch (Netherlands)

    2010-06-15

    Targets of Dutch mushroom cultivation businesses include an energy efficiency improvement of 2.5% annually, implementation of sustainable energy options, and climate-neutral and economically viable cultivation by new mushroom cultivation businesses that are to be built in 2020. This report describes the measures that could be implemented in support of these targets [Dutch] De doelstellingen voor paddestoelenbedrijven zijn een energie-efficientie verbetering van 2,5% per jaar, implementatie van duurzame energieopties, en klimaatneutrale en economisch rendabele teelt van de in 2020 nieuw te bouwen paddenstoelenbedrijven. In dit rapport staan de maatregelen beschreven die genomen kunnen worden ter ondersteuning van de doelstellingen.

  19. Forest farming of shiitake mushrooms: aspects of forced fruiting.

    Science.gov (United States)

    Bruhn, J N; Mihail, J D

    2009-12-01

    Three outdoor shiitake (Lentinula edodes (Berk.) Pegler) cultivation experiments were established during 2002-2004 at the University of Missouri Horticulture and Agroforestry Research Center, in central Missouri. Over three complete years following a year of spawn run, we examined shiitake mushroom production in response to the temperature of forcing water, inoculum strain, substrate host species and physical orientation of the log during fruiting. Forcing compressed the period of most productive fruiting to the two years following spawn run. Further, chilled forcing water, 10-12 degrees C, significantly enhanced yield, particularly when ambient air temperatures were favorable for the selected mushroom strain. The temperature of water available for force-fruiting shiitake logs depends on geographic location (latitude) and source (i.e., farm pond vs. spring or well water). Prospective growers should be aware of this effect when designing their management and business plans.

  20. Microbiological decomposition of bagasse after radiation pasteurization

    International Nuclear Information System (INIS)

    Ito, Hitoshi; Ishigaki, Isao

    1987-01-01

    Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms. (author)

  1. Microbiological decomposition of bagasse after radiation pasteurization

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Hitoshi; Ishigaki, Isao

    1987-11-01

    Microbiological decomposition of bagasse was studied for upgrading to animal feeds after radiation pasteurization. Solid-state culture media of bagasse were prepared with addition of some amount of inorganic salts for nitrogen source, and after irradiation, fungi were infected for cultivation. In this study, many kind of cellulosic fungi such as Pleurotus ostreatus, P. flavellatus, Verticillium sp., Coprinus cinereus, Lentinus edodes, Aspergillus niger, Trichoderma koningi, T. viride were used for comparison of decomposition of crude fibers. In alkali nontreated bagasse, P. ostreatus, P. flavellatus, C. cinereus and Verticillium sp. could decompose crude fibers from 25 to 34 % after one month of cultivation, whereas other fungi such as A. niger, T. koningi, T. viride, L. edodes decomposed below 10 %. On the contrary, alkali treatment enhanced the decomposition of crude fiber by A. niger, T. koningi and T. viride to be 29 to 47 % as well as Pleurotus species or C. cinereus. Other species of mushrooms such as L. edodes had a little ability of decomposition even after alkali treatment. Radiation treatment with 10 kGy could not enhance the decomposition of bagasse compared with steam treatment, whereas higher doses of radiation treatment enhanced a little of decomposition of crude fibers by microorganisms.

  2. Biodegradation of remazol brilliant blue R by ligninolytic enzymatic complex produced by Pleurotus ostreatus Biodegradação do azul brilhante de remazol R pelo complexo enzimático ligninolítico produzido por Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Kátia Maria Gomes Machado

    2006-12-01

    Full Text Available Pleurotus ostreatus ("shimeji" is produced in Brazil on a commercial scale using various lignocellulosic residues. Efforts have been made to reuse the culture residue to obtain products of greater aggregate value such as enzymes or in processes of bioremediation. We evaluated the Remazol brilliant blue R (RBBR degradation potential of extracts from solid substrate colonized by P. ostreatus and extracts from residue of the "shimeji" mushroom yield. Colonized substrates and residue were provided by Toyobo do Brasil Ltda. Extraction was performed with sodium acetate buffer (50 mM, pH 4.6. RBBR decolorization was monitored at 592 nm and peroxidase and laccase activities were measured by monitoring the oxidation of ABTS. Horseradish peroxidase was used as reference. The time of growth of P. ostreatus influenced RBBR degradation and peroxidase and laccase activities. Concentration of 1 mM H2O2 and pH 4.0 were the best for RBBR decolorization. Complete RBBR decolorization was obtained with the addition of only one aliquot of 50 µL of 1 mM H2O2. The stability of the extracts was higher when they were kept under refrigeration than when stored frozen. The potential application of the ligninolytic complex derived from P. ostreatus and mushroom residue for xenobiotic degradation was demonstrated.Pleurotus ostreatus ("shimeji" é produzido no Brasil em escala comercial empregando-se vários resíduos lignocelulósicos. Esforços têm sido feitos para reaproveitamento do resíduo do cultivo em produtos de maior valor agregado, como enzimas ou sua aplicação em processos de biorremediação. Foi feita avaliação do potencial de degradação do azul brilhante de remazol (RBBR por extratos obtidos de substratos sólidos colonizados por P. ostreatus e por extratos do resíduo da produção do cogumelo "shimeji". Substratos colonizados e o resíduo foram fornecidos pela Toyobo do Brasil Ltda. Extração foi feita com tampão acetato de sódio (50 mM, pH 4

  3. Risk evaluation of radioactive contamination in some species of edible mushrooms

    International Nuclear Information System (INIS)

    Droujinina, I.; Schinner, F.; Dromp, W.

    1998-01-01

    Full text of publication follows: edible mushrooms play an important role even in modern society - far beyond their value as food supply. The search for and gathering of edible mushrooms is one of the last possibilities of urbanized man to satisfy his drive as a hunter and collector in nature and thus an important part of the cultural heritage. Deprivation of this recreational activity due to radioactive contamination is considered simply a certain loss of quality of life and thus may have a strong emotional and sociological impact. The accident at the Chernobyl reactor on 26 April 1986 led to considerable amounts of radioactive material being distributed over a large area of Europe with Austria as one of the highest contaminated western countries. 13 years after the accident at Chernobyl, the long-lived isotopes such as cesium 137 (physical half-life of 30.2 years) and others are still of concern. Several publications suggest that the consumption of wild growing mushrooms has to be regarded as risky. The aim of our study is to provide some new investigations on the process of accumulation of radioactive Cs in ecosystems with the focus of attention on fungi, Therefore factors and processes limiting isotope accumulation of edible mushrooms are being determined, using standard microbiological and physical methods. Through a series of experiments and evaluations some factors limiting the accumulation of radionuclides in mycelia and in fruit bodies of selected mushrooms with a main emphasis placed on taxonomic position of each species and type of metabolism are being defined. On this basis careful extrapolation to the industrially cultivated species and to the most popular objects amongst mushroom-collectors is to be achieved. Our approach of assessing the risk of radioactive contamination of edible mushrooms, which is applicable for any assumed scenario, will be discussed. (authors)

  4. [Hallucinogenic mushrooms].

    Science.gov (United States)

    Reingardiene, Dagmara; Vilcinskaite, Jolita; Lazauskas, Robertas

    2005-01-01

    The group of hallucinogenic mushrooms (species of the genera Conocybe, Gymnopilus, Panaeolus, Pluteus, Psilocybe, and Stropharia) is psilocybin-containing mushrooms. These "magic", psychoactive fungi have the serotonergic hallucinogen psilocybin. Toxicity of these mushrooms is substantial because of the popularity of hallucinogens. Psilocybin and its active metabolite psilocin are similar to lysergic acid diethylamide. These hallucinogens affect the central nervous system rapidly (within 0.5-1 hour after ingestion), producing ataxia, hyperkinesis, and hallucinations. In this review article there are discussed about history of use of hallucinogenic mushrooms and epidemiology; pharmacology, pharmacodynamics, somatic effects and pharmacokinetics of psilocybin, the clinical effects of psilocybin and psilocin, signs and symptoms of ingestion of hallucinogenic mushrooms, treatment and prognosis.

  5. A Comprehensive and Comparative Study of Wolfiporia extensa Cultivation Regions by Fourier Transform Infrared Spectroscopy and Ultra-Fast Liquid Chromatography.

    Directory of Open Access Journals (Sweden)

    Yan Li

    Full Text Available Nowadays, Wolfiporia extensa as a popular raw material in food and medicine industry has received increasing interests. Due to supply shortage, this species of edible and medicinal mushroom has been cultivated in some provinces of China. In the present study, cultivated W. extensa collected from six regions in Yunnan Province of China were analyzed by an integrated method based on Fourier transform infrared (FT-IR spectroscopy and ultra-fast liquid chromatography (UFLC coupled with multivariate analysis including partial least squares discriminant analysis (PLS-DA and hierarchical cluster analysis (HCA in order to investigate the differences and similarities in different origins and parts. In the tested mushroom samples, characteristic FT-IR spectra were obtained for acquiring comprehensive fuzz chemical information and pachymic acid was determinated as a biomarker in the meantime. From the results, the comparison of samples was achieved successfully according to their geographical regions and different parts. All the samples displayed regional dependence and the inner parts showed better quality consistency. In addition, the chemical constituents of cultivated W. extensa could be also affected by the cultivation methods. Meanwhile, there was an interesting finding that the soil properties of cultivation regions may have a relationship with the chemical constituents of the epidermis of soil-cultured W. extensa, rather than the inner parts. Collectively, it demonstrated that the present study could provide comprehensive chemical evidence for the critical complement of quality evaluation on the cultivated W. extensa. Moreover, it may be available for the further researches of complicated mushrooms in practice.

  6. A Comprehensive and Comparative Study of Wolfiporia extensa Cultivation Regions by Fourier Transform Infrared Spectroscopy and Ultra-Fast Liquid Chromatography

    Science.gov (United States)

    Li, Yan; Zhang, Ji; Li, Tao; Liu, Honggao

    2016-01-01

    Nowadays, Wolfiporia extensa as a popular raw material in food and medicine industry has received increasing interests. Due to supply shortage, this species of edible and medicinal mushroom has been cultivated in some provinces of China. In the present study, cultivated W. extensa collected from six regions in Yunnan Province of China were analyzed by an integrated method based on Fourier transform infrared (FT-IR) spectroscopy and ultra-fast liquid chromatography (UFLC) coupled with multivariate analysis including partial least squares discriminant analysis (PLS-DA) and hierarchical cluster analysis (HCA) in order to investigate the differences and similarities in different origins and parts. In the tested mushroom samples, characteristic FT-IR spectra were obtained for acquiring comprehensive fuzz chemical information and pachymic acid was determinated as a biomarker in the meantime. From the results, the comparison of samples was achieved successfully according to their geographical regions and different parts. All the samples displayed regional dependence and the inner parts showed better quality consistency. In addition, the chemical constituents of cultivated W. extensa could be also affected by the cultivation methods. Meanwhile, there was an interesting finding that the soil properties of cultivation regions may have a relationship with the chemical constituents of the epidermis of soil-cultured W. extensa, rather than the inner parts. Collectively, it demonstrated that the present study could provide comprehensive chemical evidence for the critical complement of quality evaluation on the cultivated W. extensa. Moreover, it may be available for the further researches of complicated mushrooms in practice. PMID:28036354

  7. Increase of vitamin D2 by UV-B exposure during the growth phase of white button mushroom (Agaricus bisporus)

    DEFF Research Database (Denmark)

    Kristensen, Hanne; Rosenqvist, Eva S. K.; Jakobsen, Jette

    2012-01-01

    Background: Mushrooms are the only non-animal food source of vitamin D. Wild mushrooms have naturally high vitamin D2 content, and cultivated mushrooms produce vitamin D2 from ergosterol when exposed to supplementary UV-B during the post-harvest phase. Objectives: This study investigated...... with exposure to supplementary UV-B just prior to harvest in the range of 0-2,400 mJ cm-2. Mushrooms grew for 2 days with or without repeated UV-B exposure each day. Vitamin D2 and growth rate were determined. Some mushrooms were post-harvest treated by exposure at 200 mJ cm-2 supplementary UV-B or natural...... sunlight, prior to vitamin D2 determination. Results: The content of vitamin D2 was 0.2-164 µg 100 g-1 fresh weight (FW), and there was a linear relationship between UV-dose up to 1,000 mJ cm-2 and vitamin D2 content. The fast growth rate of the mushrooms diluted the vitamin D2 from 24 to 3 µg 100 g-1...

  8. Mushrooms

    Science.gov (United States)

    ... these mushrooms have effects similar to the drug LSD . Sometimes Called: shrooms, magic mushrooms How It's Used: ... this topic for: Teens Drugs: What to Know LSD Dealing With Addiction Marijuana Bath Salts Depressants GHB ...

  9. High protein complementation with high fiber substrates for oyster ...

    African Journals Online (AJOL)

    Agricultural residues have been world widely accepted for oyster mushroom culture. In this study, we used wheat straw, barley straw, maize stem residue, and lawn residue as substrates coupled with wheat bran, rice bran and soybean powder as complements for the growth of Pleurotus florida and Pleurotus ostreatus as ...

  10. Enhancing Growth and Yield of Grey Oyster Mushroom (Plearotussajorcaju Using Different Acoustic Sound Treatments

    Directory of Open Access Journals (Sweden)

    Ibrahim Roshita

    2017-01-01

    Full Text Available Mushroom, as believed by many people, grows on specific time and condition as in the wild it grows after a heavy rain falls. The effects of lightning and thunderstorm may suppress the mychorrizal structure to grow and eventually forming fruiting body. This study was conducted to determine the effect of different acoustic sound treatments on the growth and yield of grey oyster mushroom (Pleurotussajor-caju. Five different acoustic sound treatments had been applied during spawning period which were thunder storm, hardcore music, soothing instrumental, Quranic recital and without any sound treatment applied which served as control. The parameters studied were mycelium growth rate, days of mycelium filled up the bags, days of pinhead emergence, days of fruiting body formation, total weight, percentage biological efficiency, pileus color and texture. There were significant differences (P0.05 observed in other parameters, such as pinhead emergence, fruiting bodies formation, pileus color and texture. In summary, treatments using different acoustic sound at 75 dB could be considered as better treatment to enhance the mycelium growth thus accelerate the mushroom cultivation process as well as increasing the mushroom productivity. This research could help farmers to grow and harvest their mushroom at specific time frame and fulfill customer’s demand.

  11. Nutrient Management in Aquaponics: Comparison of Three Approaches for Cultivating Lettuce, Mint and Mushroom Herb

    Directory of Open Access Journals (Sweden)

    Valentina Nozzi

    2018-03-01

    Full Text Available Nutrients that are contained in aquaculture effluent may not supply sufficient levels of nutrients for proper plant development and growth in hydroponics; therefore, they need to be supplemented. To determine the required level of supplementation, three identical aquaponic systems (A, B, and C and one hydroponic system (D were stocked with lettuce, mint, and mushroom herbs. The aquaponic systems were stocked with Nile tilapia. System A only received nutrients derived from fish feed; system B received nutrients from fish feed as well as weekly supplements of micronutrients and Fe; system C received the same nutrients as B, with weekly supplements of the macronutrients, P and K; in system D, a hydroponic inorganic solution containing N, Ca, and the same nutrients as system C was added weekly. Lettuce achieved the highest yields in system C, mint in system B, and mushroom herb in systems A and B. The present study demonstrated that the nutritional requirements of the mint and mushroom herb make them suitable for aquaponic farming because they require low levels of supplement addition, and hence little management effort, resulting in minimal cost increases. While the addition of supplements accelerated the lettuce growth (Systems B, C, and even surpassed the growth in hydroponic (System C vs. D, the nutritional quality (polyphenols, nitrate content was better without supplementation.

  12. The Edible Mushroom Book

    DEFF Research Database (Denmark)

    Conte, Anna Del; Læssøe, Thomas

    A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats.......A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats....

  13. Growth performance of commercial temperate mushrooms Agaricus bisporus and Hypsizygus sp. under local environment

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Mat Rasol Awang; Hassan Hamdani Hassan Mutaat; Mohd Meswan Maskom

    2010-01-01

    To date, the Malaysian mushroom industry focuses on only seven species of mushroom for commercial purpose. To expand and further develop the mushroom industry, new mushroom species should be introduced into our local market. Temperate mushrooms are possible to be cultivated commercially in Malaysia but the optimisation of growth performance for high quality spawn and high mushroom yield need to be studied. In the present study the growth performance of mycelia of Agaricus bisporus and Hypsizygus sp. on culture media and substrates were investigated. Four types of culture media, viz. Potato Dextrose Agar (PDA), Nutrient Agar (NA), Malt Yeast Extract (MYE) and Complete Yeast Media (CYM) were used to determine the suitable culturing media for mycelial growth. The mycelia were inoculated on oil palm empty fruit bunch (EFB) and sawdust substrate and incubated at room temperature and in a low temperature in incubation room (10 - 12 degree Celsius). From the observation, Agaricus bisporus grew better on Malt Yeast Extract (MYE) medium with a growth rate of 0.306 cm/ day. Complete Yeast Media (CYM) was found more suitable for Hypsizygus sp. with a growth rate of 1.049 cm/ day. The linear growth rate of mycelium as measured on the surface of mushroom bag of Agaricus bisporus on EFB incubated at room temperature was 0.4364 cm/ day and cool temperature was 0.055 cm/ day. For Hypsizygus sp. the linear growth rate of the mycelium was 2.11 cm/ day. The linear growth of Hypsizygus sp. on sawdust substrate incubated in cool temperature was 1.4 cm/ day. (author)

  14. Fate of lignin and substituted xylan during commercial cultivation of Agaricus bisporus

    NARCIS (Netherlands)

    Kabel, Mirjam; Jurak, Edita; Patyshakuliyeva, Aleksandrina; de Vries, Ronald; Gruppen, Harry; Baars, Johan; Sonnenberg, Anton

    2016-01-01

    Wheat straw based compost is the substrate for commercial growth of Agaricus bisporus mushrooms, but it is unknown to which extent the carbohydrate-lignin matrix changes and how much is metabolized during commercial cultivation. In this paper we report yields and remaining structures of the major

  15. Evaluation of indigenous potent mushroom growth promoting bacteria (MGPB) on Agaricus bisporus production.

    Science.gov (United States)

    Zarenejad, F; Yakhchali, B; Rasooli, I

    2012-01-01

    Mushrooms such as Agaricus bisporus, are cultivated for food worldwide. Fruit body initiation in Agaricus bisporus is a phase change from the vegetative to the reproductive stage which depends on the presence of a casing layer with particular physical, chemical and microbiological properties. The phase change is achieved practically by environmental manipulation and the presence of naturally occurring bacteria such as Pseuodomonas putida. In this study, 274 individual bacterial isolates were collected by screening the casing layer of 14 edible mushroom farms. The isolates were analysed with respect to biochemical properties, organic and inorganic phosphate solubilization, production of siderophore and growth in the presence of volatile compound of 1-octen-3-ol. It was found that approximately 97% of the strains were able to grow in the presence of 1-octen-3-ol and 36% were able to solubilize phosphorus. Among the isolates, 23 strains were selected as potent mushroom growth promoting bacteria (MGPB) for inoculation of the casing layer. Field experiments using these strains showed various promoting effects on production of mushroom. Finally, 2 strains (strains Bt4 and Ps7) showing the highest increase in A. bisporus production, were characterized as Pseuodomonas putida by molecular methods and identified as the best suited growth promoting inoculants for application in production farms for increasing the mushroom yield.

  16. Mycophilic or mycophobic? Legislation and guidelines on wild mushroom commerce reveal different consumption behaviour in European countries.

    Directory of Open Access Journals (Sweden)

    Ursula Peintner

    Full Text Available Mycophiles forage for and pick vast quantities of a wide variety of wild mushroom species. As a result, mushroom intoxications are comparatively frequent in such countries with mycophiles. Thus, national governments are forced to release guidelines or enact legislation in order to ensure the safe commerce of wild mushrooms due to food safety concerns. It is in these guidelines and laws that one can observe whether a country is indeed mycophobic or mycophilic. Furthermore, these laws and guidelines provide valuable information on mushroom preferences and on the consumption habits of each country. As such we were interested in the questions as to whether mushroom consumption behaviour was different within Europe, and if it was possible to discover the typical or distinctive culinary preferences of Slavic or Romanic speaking people, people from special geographical regions or from different zones. This work is based on the analysis of edible mushroom lists available in specific guidelines or legislation related to the consumption and commerce of mushrooms in 27 European countries. The overall diversity of edible mushrooms authorised to be commercialised in Europe is very high. However, only 60 out of a total 268 fungal species can be cultivated. This highlights the importance of guidelines or legislation for the safe commerce of wild mushrooms. The species richness and composition of the mushrooms listed for commerce is very heterogeneous within Europe. The consumption behaviour is not only language-family-related, but is strongly influenced by geographical location and neighbouring countries. Indicator species were detected for different European regions; most of them are widespread fungi, and thus prove culture-specific preferences for these mushrooms. Our results highlight tradition and external input such as trade and cultural exchange as strong factors shaping mushroom consumption behaviour.

  17. Gamma radiation in increasing productivity of Agaricus bisporus and Pleurotus sajor-caju and enhancing storage life of P. sajor-caju

    International Nuclear Information System (INIS)

    Roy, M.K.; Chatterjee, S.R.; Bahukhandi, D.; Sharma, R.; Philips, A.S.

    2000-01-01

    Gamma radiation of spawn of Agaricus bisporus and pleurotus sajor-caju at doses of 0.1 to 0.3 kGy and 0.1 to 0.25 kGy respectively, reduced the mycelial spawn run time and exerted a stimulatory effect on the growth of these two mushrooms. Irradiation also increased yield of these mushrooms. In all cases of the former, the highest yield of 2.57g was recorded from spawn irradiated at 0.3 kGy, while with the latter, best yield of 1119 g was recorded from spawn treated with 0.25 kGy. The control (non-irradiated) spawns of A. bisporus and P. sajor-caju gave yields of 2.03 g and 565 g respectively. Thus, a major boost in yields could be achieved using this technology. The shelf life of P. sajor-caju could be extended up to 9 days by 0.5 kGy of radiation, when the treated fruit bodies were held at 15 deg C as against the un-irradiated ones which had a shelf-life of 6 days. This dose neither adversely affected the browning of the fruit bodies at 45 deg C, nor lowered their protein (protein + free amino acids) and carbohydrate contents. Irradiation, however, at all the doses from 0.1 to 0.75 kGy enhanced the rehydration ratio and total free amino acid contents. The rehydration ratio of 0.62 was the maximum, reached with a dose of 0.25 kGy as against the control, which showed a value of 5.0. Dehydration along with gamma radiation treatment could play an important role for long term storage of mushrooms. Weight loss of un-dehydrated fruit bodies also decreased as a result of irradiation. (author)

  18. Radiotracer experiments on the uptake of radionuclides by mushrooms and vegetables

    International Nuclear Information System (INIS)

    Ban-Nai, Tadaaki; Muramatsu, Yasuyuki; Yoshida, Satoshi; Yanagisawa, Kei

    1996-01-01

    Radiotracer experiments were performed to study radionuclide uptake by mushrooms and plants. Four mushroom species, Hebeloma vinosophyllum, Flammulina velutipes, Agrocybe cylindracea and Coprinus phlyctidosporus were cultivated in a flask containing medium with the radiotracers 137 Cs, 85 Sr, 54 Mn, 60 Co and 65 Zn. Mushrooms tended to accumulate Cs, Mn and Zn. The concentration ratio of Cs between mushroom and medium ranged from 2.6 to 21. The highest was observed in H. vinospohyllum. The concentration ratio of Mn was about 10, while the ratio of Zn ranged from 15 to 30. No noticeable accumulations were found for Sr or Co. Transfer factors (TFs) of radionuclides from soil to leaf vegetables (cabbage, Chinese cabbage, komatsuna, spinach and lettuce) were also studied using Andosol (a representative Japanese soil). The TFs of 137 Cs, 85 Sr, 54 Mn, 60 Co and 65 Zn for edible parts of these vegetables were (mean value) 0.11, 0.24, 0.61, 0.05 and 0.52, respectively. The TFs of Mn, Co and Zn for spinach were higher than those for the other vegetables. The distributions of Cs in different organs of the leaf vegetables were rather uniform. The TFs of Sr and Mn were higher for older (outer) leaves than younger (inner) ones. In contrast to Sr and Mn, TFs of Zn for younger leaves were higher than those for older ones

  19. A dioxygenase of Pleurotus sapidus transforms (+)-valencene regio-specifically to (+)-nootkatone via a stereo-specific allylic hydroperoxidation.

    Science.gov (United States)

    Krügener, Sven; Krings, Ulrich; Zorn, Holger; Berger, Ralf G

    2010-01-01

    A selective and highly efficient allylic oxidation of the sesquiterpene (+)-valencene to the grapefruit flavour compound (+)-nootkatone was achieved with lyophilisate of the edible mushroom Pleurotus sapidus. The catalytic reaction sequence was elucidated through the identification of intermediate, (+)-valencene derived hydroperoxides. A specific staining of hydroperoxides allowed the semi-preparative isolation of two secondary (+)-valencene hydroperoxides, 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-4(S)-yl-hydroperoxide and 6(R)-Isopropenyl-4(R),4a(S)-dimethyl-2,3,4,4a,5,6,7,8-octahydro-naphthalen-2(R)-yl-hydroperoxide. Chemical reduction of the biotransformation products yielded a tertiary alcohol identified as 2(R)-Isopropenyl-8(R),8a(S)-dimethyl-1,3,4,7,8,8a-hexahydro-2H-naphthalen-4a(R)-ol. This suggested a lipoxygenase-type oxidation of (+)-valencene via secondary and tertiary hydroperoxides and confirmed homology data of the key enzyme obtained previously from amino acid sequencing.

  20. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  1. Neurite outgrowth stimulatory effects of culinary-medicinal mushrooms and their toxicity assessment using differentiating Neuro-2a and embryonic fibroblast BALB/3T3

    Science.gov (United States)

    2013-01-01

    Background Mushrooms are not only regarded as gourmet cuisine but also as therapeutic agent to promote cognition health. However, little toxicological information is available regarding their safety. Therefore, the aim of this study was to screen selected ethno-pharmacologically important mushrooms for stimulatory effects on neurite outgrowth and to test for any cytotoxicity. Methods The stimulatory effect of mushrooms on neurite outgrowth was assessed in differentiating mouse neuroblastoma (N2a) cells. Neurite length was measured using Image-Pro Insight processor system. Neuritogenesis activity was further validated by fluorescence immunocytochemical staining of neurofilaments. In vitro cytotoxicity was investigated by using mouse embryonic fibroblast (BALB/3T3) and N2a cells for any embryo- and neuro-toxic effects; respectively. Results Aqueous extracts of Ganoderma lucidum, Lignosus rhinocerotis, Pleurotus giganteus and Grifola frondosa; as well as an ethanol extract of Cordyceps militaris significantly (p < 0.05) promoted the neurite outgrowth in N2a cells by 38.4 ± 4.2%, 38.1 ± 2.6%, 33.4 ± 4.6%, 33.7 ± 1.5%, and 35.8 ± 3.4%; respectively. The IC50 values obtained from tetrazolium (MTT), neutral red uptake (NRU) and lactate dehydrogenase (LDH) release assays showed no toxic effects following 24 h exposure of N2a and 3T3 cells to mushroom extracts. Conclusion Our results indicate that G. lucidum, L. rhinocerotis, P. giganteus, G. frondosa and C. militaris may be developed as safe and healthy dietary supplements for brain and cognitive health. PMID:24119256

  2. Crosses between monokaryons of Pleurotus sapidus or Pleurotus florida show an improved biotransformation of (+)-valencene to (+)-nootkatone.

    Science.gov (United States)

    Omarini, Alejandra B; Plagemann, Ina; Schimanski, Silke; Krings, Ulrich; Berger, Ralf G

    2014-11-01

    Several hundred monokaryotic and new dikaryotic strains derived thereof were established from (+)-valencene tolerant Pleurotus species. When grouped according to their growth rate on agar plates and compared to the parental of Pleurotus sapidus 69, the slowly growing monokaryons converted (+)-valencene more efficiently to the grapefruit flavour compound (+)-nootkatone. The fast growing monokaryons and the slow×slow and the fast×fast dikaryotic crosses showed similar or inferior yields. Some slow×fast dikaryons, however, exceeded the biotransformation capability of the parental dikaryon significantly. The activity of the responsible enzyme, lipoxygenase, showed a weak correlation with the yields of (+)-nootkatone indicating that the determination of enzyme activity using the primary substrate linoleic acid may be misleading in predicting the biotransformation efficiency. This exploratory study indicated that a classical genetics approach resulted in altered and partly improved terpene transformation capability (plus 60%) and lipoxygenase activity of the strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Surfactant-assisted pretreatment and enzymatic hydrolysis of spent mushroom compost for the production of sugars.

    Science.gov (United States)

    Kapu, N U S; Manning, M; Hurley, T B; Voigt, J; Cosgrove, D J; Romaine, C P

    2012-06-01

    Spent mushroom compost (SMC), a byproduct of commercial mushroom cultivation, poses serious environmental problems that have hampered the growth of this important agro-industry. In an effort to develop new applications for SMC, we explored its use as a feedstock for bioethanol production. SMC constitutes approximately 30%w/w polysaccharides, 66% of which is glucan. Following dilute-acid pretreatment and enzymatic hydrolysis, both in the presence of PEG 6000, 97% of glucan and 44% of xylan in SMC were converted into the corresponding monosaccharides. Incorporation of PEG 6000 reduced the cellulase requirement by 77%. Zwittergent 3-12 and 3-14 also significantly increased the efficacy of acid pretreatment and enzymatic hydrolysis. The use of SMC in bioethanol production represents a potential mitigation solution for the critical environmental issues associated with the stockpiling of the major byproduct of the mushroom industry. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

    Science.gov (United States)

    Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

    2014-01-01

    The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

  5. Pleurotus ostreatus

    African Journals Online (AJOL)

    badr

    2011-11-07

    Nov 7, 2011 ... Evaluation of nutritional substrate and physical stress. (gamma ... cows. Lavi et al. (2010) stated that mushroom poly- saccharides are potent substances that exhibit anti-tumor ...... A brief history of heat, chemical and radiation.

  6. Genetic and Morphological Characterization of Cladobotryum Species Causing Cobweb Disease of Mushrooms

    OpenAIRE

    McKay, Gareth J.; Egan, Damian; Morris, Elizabeth; Scott, Carol; Brown, Averil E.

    1999-01-01

    Cladobotryum dendroides (= Dactylium dendroides) has hitherto been regarded as the major causal agent of cobweb disease of the cultivated mushroom, Agaricus bisporus. Nucleotide sequence data for the internal transcribed spacer (ITS) regions of four Cladobotryum/Hypomyces species reported to be associated with cobweb disease, however, indicate that the most common pathogen is now C. mycophilum. This cobweb pathogen varies somewhat in conidial septation from published descriptions of C. mycoph...

  7. Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

    Science.gov (United States)

    Suseem, S R; Saral, Mary

    2015-07-01

    To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

  8. Cytotoxic Effect on Human Myeloma Cells and Leukemic Cells by the Agaricus blazei Murill Based Mushroom Extract, Andosan™

    Directory of Open Access Journals (Sweden)

    Jon-Magnus Tangen

    2017-01-01

    Full Text Available Agaricus blazei Murill is an edible mushroom of the Basidiomycetes family, which has been found to contain a number of compounds with antitumor properties, such as proteoglycans and ergosterol. In the present investigation, we show that the commercial mushroom product Andosan, which contains 82.4% Agaricus blazei Murill, together with medicinal mushrooms Hericium erinaceus (14.7% and Grifola frondosa (2.9%, has a cytotoxic effect on primary myeloma cells, other myeloma cell lines, and leukemia cell lines in vitro. Although the exact content and hence the mechanisms of action of the Andosan extract are unknown, we have found in this investigation indications of cell cycle arrest when myeloma cell lines are cultivated with Andosan. This may be one of the possible explanations for the cytotoxic effects of Andosan.

  9. Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

    Science.gov (United States)

    Akpinar, Merve; Urek, Raziye Ozturk

    2012-01-01

    Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

  10. Pleurotus giganteus (Berk. Karun & Hyde), the giant oyster mushroom inhibits NO production in LPS/H2O2 stimulated RAW 264.7 cells via STAT 3 and COX-2 pathways.

    Science.gov (United States)

    Baskaran, Asweni; Chua, Kek Heng; Sabaratnam, Vikineswary; Ravishankar Ram, Mani; Kuppusamy, Umah Rani

    2017-01-13

    Pleurotus giganteus (Berk. Karunarathna and K.D. Hyde), has been used as a culinary mushroom and is known to have medicinal properties but its potential as an anti-inflammatory agent to mitigate inflammation triggered diseases is untapped. In this study, the molecular mechanism underlying the protective effect of ethanol extract of P. giganteus (EPG) against lipopolysaccharide (LPS) and combination of LPS and hydrogen peroxide (H 2 O 2 )-induced inflammation on RAW 264.7 macrophages was investigated. The effect of EPG on nitric oxide (NO) production as an indicator of inflammation in RAW 264.7 macrophages was estimated based on Griess reaction that measures nitrite level. The expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), NF-kB activating protein (NKAP), signal transducer and activator of transcription 3 protein (STAT 3) and glutathione peroxidase (GPx) genes were assessed using real time reverse transcription polymerase chain reaction (RT-PCR) approach. EPG (10 μg/ml) showed the highest reduction in the LPS-induced NO production in RAW 264.7 macrophages and significantly suppressed (p < 0.05) the expression iNOS, STAT 3 and COX-2. There was a significant increase (p < 0.05) in combination of LPS and H 2 O 2 - induced iNOS production when compared to the LPS-induced iNOS production in RAW 264.7 macrophages and this concurred with the NO production which was attenuated by EPG at 10 μg/ml. A significant (p < 0.05) down regulation was observed in the combination of LPS and H 2 O 2 -induced iNOS and GPx expression by EPG. Our data suggest that the anti-inflammatory activity of EPG is mediated via the suppression of the STAT 3 and COX-2 pathways and can serve as potential endogenous antioxidant stimulant.

  11. A Sustainable Technology Contribuiting to the Food Security

    Directory of Open Access Journals (Sweden)

    Dra. Rosa Catalina Bermúdez-Savòn

    2015-11-01

    Full Text Available A sustainable way for food and energetic security in rural and the city regions, is presented with the application of the solid state fermentation for the biotransformation of lignocellulosic by-products and agro-industrial wastes with white-rot fungi. Inamush as advantages of this technology, is showed the cultivation of mushroom Pleurotus spp.on coffee pulp, cedar chip , coconut and cocoa shells, and the influence of it´s mixture (1:1, trough examination of their growth rates and conversion efficacy to fruiting bodies, which cause contamination of soil and water, because of large volumes and difficult management. The use of residues for these cultive was consolidate such as alternative viable for food production, capable to satisfy the protein and nutritive necessity of population in the non-developing countries, besides low cost production, high protein content and obtention in large quantity in short time. In addition to produce complements for animal feet, such as the spent oyster mushroom substrate postcosecha is detoxified, has proteic content and better digestibility than original substrates,and can be used as animal feed or fertilizer, at the same time, was eradicated the problem of environmental contamination of these residues provoking and further contribution at sustainable development of the communities.

  12. Rapid evaluation technique to differentiate mushroom disease-related moulds by detecting microbial volatile organic compounds using HS-SPME-GC-MS.

    Science.gov (United States)

    Radványi, Dalma; Gere, Attila; Jókai, Zsuzsa; Fodor, Péter

    2015-01-01

    Headspace solid-phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS) was used to analyse microbial volatile organic compounds (MVOCs) of mushroom disease-related microorganisms. Mycogone perniciosa, Lecanicillum fungicola var. fungicola, and Trichoderma aggressivum f. europaeum species, which are typically harmful in mushroom cultivation, were examined, and Agaricus bisporus (bisporic button mushroom) was also examined as a control. For internal standard, a mixture of alkanes was used; these were introduced as the memory effect of primed septa in the vial seal. Several different marker compounds were found in each sample, which enabled us to distinguish the different moulds and the mushroom mycelium from each other. Monitoring of marker compounds enabled us to investigate the behaviour of moulds. The records of the temporal pattern changes were used to produce partial least squares regression (PLS-R) models that enabled determination of the exact time of contamination (the infection time of the media). Using these evaluation techniques, the presence of mushroom disease-related fungi can be easily detected and monitored via their emitted MVOCs.

  13. Use of lignocellulosic wastes of pecan (Carya illinoinensis) in the cultivation of Ganoderma lucidum.

    Science.gov (United States)

    Ozcariz-Fermoselle, María Virginia; Fraile-Fabero, Raúl; Girbés-Juan, Tomás; Arce-Cervantes, Oscar; Oria de Rueda-Salgueiro, Juan Andrés; Azul, Anabela Marisa

    The wastes of pecan nut (Carya illinoinensis (Wangenh.) K. Koch) production are increasing worldwide and have high concentrations of tannins and phenols. To study the biodegradation of lignocellulosic wastes of pecan used as solid substrate for the cultivation of the white-rot fungus Ganoderma lucidum (Curtis) P. Karst. Six formulations of pecan wastes were used as solid substrate: pecan shells (PS100), pecan pericarp (PP100), pecan wood-chips (PB100), and the combinations PS50+PP50, PB50+PS50 and PB50+PP50. The substrates were inoculated with a wild strain of G. lucidum collected in the Iberian Peninsula. The biodegradation capability of G. lucidum was estimated by using the mycelial growth rate, the biological efficiency, the production and the dry biological efficiency. Notably, all solid substrates were suitable for G. lucidum growth and mushroom yield. The best performance in mushroom yield was obtained with PB100 (55.4% BE), followed by PB50+PP50 (31.7% BE) and PB50+PS50 (25.4% BE). The mushroom yield in the substrates containing pecan wood-chips (PB) was significantly higher. Our study is leading the way in attempting the cultivation of G. lucidum on lignocellulosic pecan waste. These results show an environmentally friendly alternative that increases the benefits for the global pecan industry, especially in rural areas, and transforms biomass into mushrooms with nutraceutical properties and biotechnological applications. Copyright © 2018 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. First report of Syzygites megalocarpus (Mucorales) web mold on the commercial portabella button mushroom Agaricus bisporus in North America

    Science.gov (United States)

    Agaricus bisporus (Lange) Imbach mushrooms are cultivated commercially under environmentally controlled conditions in several states within the US. They are the most important crop in Pennsylvania and an important high value crop in many other states. In August 2011 we first observed a mucoraceous m...

  15. Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

    Science.gov (United States)

    Yun, Yeo Hong; Koo, Ja Sun

    2015-01-01

    Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

  16. Analysis of Taiwan patents for the medicinal mushroom "Niu-Chang- Chih".

    Science.gov (United States)

    Chen, Yu-Fen; Lu, Wen-Ling; Wu, Ming-Der; Yuan, Gwo-Fang

    2013-04-01

    "Niu-Chang-Chih" (Antrodia cinnanomea) is a medicinal mushroom that has only been collected from the aromatic tree, Cinnamomum kanehirai, which is native to Taiwan. A total of 105 Taiwan patent applications and patents for "Niu-Chang-Chih" were collected and analyzed. Patent applications and granted patents claiming newly identified functional components from "Niu-Chang-Chih," biologically pure cultures of the mushroom strain, and cultivation of "Niu-Chang-Chih" were examined. Several applications and patents claim identified active compounds from "Niu-Chang- Chih," which provide better patent protection. These newly identified functional compounds include cyclohexanones, maleic and succinic acid derivatives, labdane diterpenoids, and benzenoids. Newly identified functional proteins include a glutathione-dependent formaldehyde dehydrogenase (GFD), a glycoprotein named ACA1, and a laccase. Newly identified functional polysaccharides include ACP1, ACP2, and ACP3. The number of patents for newly identified compounds and their uses are expected to continue growing.

  17. Decontamination of Fumonisin B1 in maize grain by Pleurotus eryngii and antioxidant enzymes

    Directory of Open Access Journals (Sweden)

    Miriam HAIDUKOWSKI

    2017-05-01

    Full Text Available Fumonisin B1 (FB1 is among the most common mycotoxins found in maize kernels and maize products worldwide. The microbiological process of detoxification and transformation of toxic organic pollutants is a promising method for foodstuffs decontamination. Some basidiomycetes, such as the Pleurotus eryngii species complex, include several important commercial edible varieties that can detoxify polycyclic organic compounds and a range of wastes and pollutants. We investigated the potential role of P. eryngii, one of the most consumed mushrooms, in the decontamination of FB1 in maize. In addition, selected antioxidant enzymes, (soluble peroxidase (POD, catalase (CAT and ascorbate peroxidase, primarily involved in control of cell hydrogen peroxide levels, and lignin degradation, were analyzed, to evaluate their contributions to the molecular mechanisms of FB1 by P. eryngii. FB1 decontamination by P. eryngii and involvement of CAT and POD enzymes in the control of toxic decontamination levels of H2O2 were demonstrated. A consistent reduction of FB1 was observed at different incubation times. The average decrease levels of FB1, with respect to the control cultures, ranged from 45 to 61% (RSD < 15%. This study is a possible eco-friendly approach to reducing this mycotoxin in the feed supply chains.

  18. Distribution of radionuclides in different parts of a mushroom: Influence of the degree of maturity

    Energy Technology Data Exchange (ETDEWEB)

    Baeza, Antonio [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain)]. E-mail: ymiralle@unex.es; Guillen, Fco. Javier [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Salas, Alejandro [Department of Physics, Veterinary Faculty, University of Extremadura, Avda de la Universidad s/n, 10071 Caceres (Spain); Manjon, Jose Luis [Department of Plant Biology, Faculty of Sciences, University of Alcala, 28871 Alcala de Henares, Madrid (Spain)

    2006-04-15

    Mushrooms are known to be bioaccumulators of radionuclides, but little is known about their distribution within the fruiting bodies or the influence of the degree of maturity on uptake. We carried out a series of cultures of the species Pleurotus eryngii under controlled laboratory conditions to analyze these variables. The maximal uptake of {sup 134}Cs and {sup 85}Sr was found to occur in mature fruiting bodies, and with the growth of the mushroom the distribution of radionuclides within the fruiting bodies became inhomogeneous. In particular, there was an exponential increase in the percentage of the total activity of {sup 134}Cs, {sup 85}Sr, and {sup 6}Co in the cap + gills as the fruiting bodies matured, accompanied by a complementary decrease in the stem. Radiocaesium, potassium, calcium, {sup 239+24}Pu, {sup 234,238}U, {sup 228,230,232}Th, and {sup 226}Ra were assayed in the cap, gills, and stem of fruiting bodies of Tricholoma equestre collected in a natural ecosystem and cultured P. eryngii. Potassium and radiocaesium were mainly located in the cap + gills, and {sup 226}Ra in the gills. There was a disequilibrium between {sup 230,232}Th and {sup 228}Th in the different parts of the fungi, probably due to uptake of {sup 228}Ra and subsequent decay to {sup 228}Th. Finally, the distribution pattern of{sup 239+24}Pu, {sup 234,238}U, and {sup 230,232}Th seemed to be species dependent.

  19. Genome sequence of the button mushroom Agaricus bisporus reveals mechanisms governing adaptation to a humic-rich ecological niche

    Science.gov (United States)

    Emmanuelle Morin; Annegret Kohler; Adam R. Baker; Marie Foulongne-Oriol; Vincent Lombard; Laszlo G. Nagy; Robin A. Ohm; Aleksandrina Patyshakuliyeva; Annick Brun; Andrea L. Aerts; Andrew M. Bailey; Christophe Billette; Pedro M. Coutinho; Greg Deakin; Harshavardhan Doddapaneni; Dimitrios Floudas; Jane Grimwood; Kristiina Hild& #233; n; Ursula K& #252; es; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Claude Murat; Robert W. Riley; Asaf A. Salamov; Jeremy Schmutz; Venkataramanan Subrananian; Han A.B. W& #246; sten; Jianping Xu; Daniel C. Eastwood; Gary D. Foster; Anton S.M. Sonnenberg; Daniel Cullen; Ronald P. de Vries; Taina Lundell; David S. Hibbett; Bernard Henrissat; Kerry S. Burton; Richard W. Kerrigan; Michael P. Challen; Igor V. Grigoriev; Francis Martin

    2012-01-01

    Agaricus bisporus is the model fungus for the adaptation, persistence,and growth in the humic-rich leaf-litter environment. Aside from its ecological role, A. bisporus has been an important component of the human diet for over 200 y and worldwide cultivation of the "button mushroom" forms a multibillion dollar...

  20. Bioremediation of recalcitrant chemical pollutant-contaminated soil. Applying edible mushroom cultivation waste to bioremediation; Kinoko kinsho ni yoru nanbunkaisei busshitsu osendo no bioremidiation. Kinoko kinsho no rigunin bunkai koso kassei to takan hokozoku tanka suiso no bunkaino

    Energy Technology Data Exchange (ETDEWEB)

    Okada, S.; Oide, E.; Oshima, Y.; Tsuji, H. [Obayashi Corp., Tokyo (Japan)

    2000-01-10

    Bioremediation is a viable and cost effective method for soil contaminated with a variety of chemical pollutants. White-rot fungi, with emitted extracellular free radicals, are known to be able to decompose lignin, which is usually nonbiodegradable by most bacteria. The decomposition mechanism has been shown to be attributed, at least in part, to lignolytic peroxidases. We examined a method that utilizes edible mushroom cultivation waste as the microbial source, and found that these waste materials have high lignolytic peroxidase activity and degradated polyaromatic hydrocarbons in sands. (author)

  1. Production of spent mushroom substrate hydrolysates useful for cultivation of Lactococcus lactis by dilute sulfuric acid, cellulase and xylanase treatment.

    Science.gov (United States)

    Qiao, Jian-Jun; Zhang, Yan-Fei; Sun, Li-Fan; Liu, Wei-Wei; Zhu, Hong-Ji; Zhang, Zhijun

    2011-09-01

    Spent mushroom substrate (SMS) was treated with dilute sulfuric acid followed by cellulase and xylanase treatment to produce hydrolysates that could be used as the basis for media for the production of value added products. A L9 (3(4)) orthogonal experiment was performed to optimize the acid treatment process. Pretreatment with 6% (w/w) dilute sulfuric acid at 120°C for 120 min provided the highest reducing sugar yield of 267.57 g/kg SMS. No furfural was detected in the hydrolysates. Exposure to 20PFU of cellulase and 200 XU of xylanase per gram of pretreated SMS at 40°C resulted in the release of 79.85 g/kg or reducing sugars per kg acid pretreated SMS. The dilute sulfuric acid could be recycled to process fresh SMS four times. SMS hydrolysates neutralized with ammonium hydroxide, sodium hydroxide, or calcium hydroxide could be used as the carbon source for cultivation of Lactococcus lactis subsp. lactis W28 and a cell density of 2.9×10(11)CFU/mL could be obtained. The results provide a foundation for the development of value-added products based on SMS. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Applied modern biotechnology for cultivation of Ganoderma and development of their products.

    Science.gov (United States)

    Zhou, Xuan-Wei; Su, Kai-Qi; Zhang, Yong-Ming

    2012-02-01

    A white-rot basidiomycete Ganoderma spp. has long been used as a medicinal mushroom in Asia, and it has an array of pharmacological properties for immunomodulatory activity. There have been many reports about the bioactive components and their pharmacological properties. In order to analyze the current status of Ganoderma products, the detailed process of cultivation of Ganoderma spp. and development of their products are restated in this review article. These include the breeding, cultivating, extracting bioactive component, and processing Ganoderma products, etc. This article will expand people's common knowledge on Ganoderma, and provide a beneficial reference for research and industrial production.

  3. Radioactive cesium in Finnish mushrooms

    International Nuclear Information System (INIS)

    Kostiainen, E.; Ylipieti, J.

    2010-02-01

    Surveillance of radioactive cesium in Finnish mushrooms was started in 1986 at STUK. Results of the surveillance programs carried out in Lapland and other parts of Finland are given in this report. More than 2000 samples of edible mushrooms have been analysed during 1986-2008. The 137 Cs detected in the mushrooms mainly originates from the 137 Cs deposition due to the accident at the Chernobyl nuclear power plant in 1986. The 137 Cs concentrations of mushrooms in the end of 1970s and in the beginning of 1980s varied from some ten to two hundred becquerels per kilogram originating from the nuclear weapon test period. The uneven division of the Chernobyl fallout is seen in the areal variation of 137 Cs concentrations of mushrooms, the 137 Cs concentrations being about tenfold in the areas with the highest deposition compared to those where the deposition was lowest. After the Chernobyl accident the maximum values in the 137 Cs concentrations were reached during 1987-88 among most species of mushrooms. The 137 Cs concentrations have decreased slowly, being in 2008 about 40 per cent of the maximum values. The 137 Cs concentrations may be tenfold in the mushroom species with high uptake of cesium (Rozites caperatus, Hygrophorus camarophyllus, Lactarius trivialis) compared to the species with low uptake (Albatrellus ovinus, Leccinum sp.) picked in the same area. The 137 Cs contents in certain species of commercial mushrooms in Finland still exceed the maximum permitted level, 600 Bq/kg, recommended to be respected when placing wild game, wild berries, wild mushrooms and lake fish on the market (Commission recommendation 2003/274/Euratom). Therefore, the 137 Cs concentrations of mushrooms should be measured before placing them on the market in the areas of the highest 137 Cs deposition, except for Albatrellus ovinus, Boletus sp. and Cantharellus cibarius. The 137 Cs concentrations of common commercial mushroom species, Cantharellus tubaeformis and Craterellus

  4. Hepatoprotective Effects of Mushrooms

    Directory of Open Access Journals (Sweden)

    Rosane Marina Peralta

    2013-07-01

    Full Text Available The particular characteristics of growth and development of mushrooms in nature result in the accumulation of a variety of secondary metabolites such as phenolic compounds, terpenes and steroids and essential cell wall components such as polysaccharides, b-glucans and proteins, several of them with biological activities. The present article outlines and discusses the available information about the protective effects of mushroom extracts against liver damage induced by exogenous compounds. Among mushrooms, Ganoderma lucidum is indubitably the most widely studied species. In this review, however, emphasis was given to studies using other mushrooms, especially those presenting efforts of attributing hepatoprotective activities to specific chemical components usually present in the mushroom extracts.

  5. The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

    Science.gov (United States)

    Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

    2015-12-01

    Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

  6. The role of culinary-medicinal mushrooms on human welfare with a pyramid model for human health.

    Science.gov (United States)

    Chang, Shu Ting; Wasser, Solomon P

    2012-01-01

    ) (tonics). The advantages of using mushroom-based DSs as a matter of safety (as opposed to herbal preparations) are: (1) The overwhelming majority of mushrooms used for production of DSs are cultivated commercially (and not gathered in the wild). (2) Mushrooms are easily propagated vegetatively and thus keep to one clone. The mycelium can be stored for a long time, and the genetic and biochemical consistency can be checked after a considerable time. (3) The main advantage, in our opinion, is that many mushrooms are capable of growing in the form of mycelial biomass in submerged cultures. In this review, we discuss legal and regulatory issues introducing and controlling DSs from MMs in different countries, including the United States, the European Community, Australia, New Zealand, Japan, and P.R. China, and guidelines of the World Health Organization. One of the targets of the present review is also to draw attention to many critically important unsolved problems in the future development of medicinal mushroom science in the 21st century.

  7. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  8. Comparative study of mycelial growth and basidiomata formation in seven different species of the edible mushroom genus Hericium.

    Science.gov (United States)

    Ko, Han Gyu; Park, Hyuk Gu; Park, Sang Ho; Choi, Chang Won; Kim, Seong Hwan; Park, Won Mok

    2005-09-01

    The potential of using several agricultural by-products as supplements of sawdust substrate for the production of edible mushroom Hericium was evaluated using seven Hericium species. All the tested supplements (rice bran, wheat bran, barley bran, Chinese cabbage, egg shell, and soybean powder) were found to be suitable for the mycelial growth of all the tested species. In mycelial growth, soybean powder was the best supplement for Hericium americanum, Hericium coralloides, and Hericium erinaceum while barley bran was the best for Hericium alpestre, Hericium laciniatum, and Hericium erinaceus. For Hericium abietis, rice bran and Chinese cabbage was the best. The possibility of mushroom production on oak sawdust substrate with 20% rice bran supplement was demonstrated with H. coralloides, H. americanum, H. erinaceus, and H. erinaceum which showed 26-70% biological efficiency. Our results also showed that strain selection is important to improve biological efficiency and mushroom yield in Hericium cultivation.

  9. Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

    Science.gov (United States)

    Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

    2016-11-01

    This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Functional foods from mushroom

    Science.gov (United States)

    Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

  11. Effects of mushroom cultivation on nutritional value and dynamics of goat ruminal degradability of cottonseed hull%食用菌栽培对棉籽壳营养价值及山羊瘤胃动态降解率的影响

    Institute of Scientific and Technical Information of China (English)

    潘军; 曹玉凤; 吕超; 高腾云; 王笑笑; 孙凯佳; 张丽

    2012-01-01

    evaluate the nutritional value and in situ dry mater (DM),organic matter (OM),crude protein (CP),acid detergent fiber (ADF) and neutral detergent fiber (NDF) degradation characteristics of SMS of Pleurotus ostreatus,Auricularia polytricha,Flammulina velutipes and P.Ferulae and cottonseed hulls.Thestudy analyzed the effects of mushroom cultivation on nutritional value and dynamics of rumen degradability of cottonseed hull and four SMS.Compared with cottonseed hull,the results showed that DM and OM of the 4 SMSs dropped by 13.09%~19.67% (P < 0.01) and 14.13%~39.52% (P < 0.01),respectively.CP of the 4 SMSs increased by 40.20%~34.29% (P < 0.01),while NDF and ADF declined by 3.07%~39.72% (P< 0.01) and 17.80%~45.91% (p< 0.01),respectively.Effective rumen degradability of DM andOM,and a+b value of A.Polytricha,F.Velutipes and P.Ferulae SMSs were significantly (P < 0.01) higher than those of cottonseed hull.Also effective rumen degradability of DM and OM,and a+b value off.Ostreatus SMSs were higher (P < 0.05) than those of cottonseed hull.Then effective rumen degradability of CP and a+b value of P.Ostreatus,F.Velutipes and P.Ferulae SMSs were significantly (P < 0.01) higher than those of cottonseed hull.Effective rumen degradability of NDF and ADF of 4 SMSs increased by 76.72%~702.63% (P < 0.01) and 137.41%~575.31% (P < 0.01),respectively.In conclusion,nutritional value and effective rumen degradability of the 4 SMSs improved by mushroom cultivation on cottonseed hulls,which were also fit for use as feed for ruminants.

  12. Characterization of the rcsA Gene from Pantoea sp. Strain PPE7 and Its Influence on Extracellular Polysaccharide Production and Virulence on Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Min Keun Kim

    2017-06-01

    Full Text Available RcsA is a positive activator of extracellular polysaccharide (EPS synthesis in the Enterobacteriaceae. The rcsA gene of the soft rot pathogen Pantoea sp. strain PPE7 in Pleurotus eryngii was cloned by PCR amplification, and its role in EPS synthesis and virulence was investigated. The RcsA protein contains 3 highly conserved domains, and the C-terminal end of the open reading frame shared significant amino acid homology to the helix-turn-helix DNA binding motif of bacterial activator proteins. The inactivation of rcsA by insertional mutagenesis created mutants that had decreased production of EPS compared to the wild-type strain and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. The Pantoea sp. strain PPE7 rcsA gene was shown to strongly affect the formation of the disease symptoms of a mushroom pathogen and to act as the virulence factor to cause soft rot disease in P. eryngii.

  13. Are mushrooms radioactive?

    International Nuclear Information System (INIS)

    Randa, Z.; Benada, J.; Singert, M.; Horyna, J.

    1988-01-01

    Tabulated is the content of 137 Cs in dry matter of higher mushrooms collected in the years 1986 to 1987. The radioactive level of mushrooms collected in Czechoslovakia such as Boletus badius and B. chrysenteron reached 20 to 50 kBq/kg of dry matter. The individual dose at mean consumption of these mushrooms was estimated at 0.2 to 0.3 mSv/year which amounted to 20 to 30% of the dose from the natural background. (J.B.). 1 tab

  14. In Vitro and In Vivo Antidiabetic Evaluation of Selected Culinary-Medicinal Mushrooms (Agaricomycetes).

    Science.gov (United States)

    Singh, Varinder; Bedi, Gurleen Kaur; Shri, Richa

    2017-01-01

    Management of type 2 diabetes by delaying or preventing glucose absorption using natural products is gaining significant attention. Edible mushrooms are well documented for their nutritional and medicinal properties. This investigation was designed to evaluate the antidiabetic activity of aqueous extracts of selected culinary-medicinal mushrooms, namely, Pleurotus ostreatus, Calocybe indica, and Volvariella volvacea, using in vitro models (α-amylase inhibition assay, glucose uptake by yeast cells, and glucose adsorption capacity). The most active extract was subsequently examined in vivo using the oral starch tolerance test in mice. All prepared extracts showed dose-dependent inhibition of α-amylase and an increase in glucose transport across yeast cells. C. indica extract was the most active α-amylase inhibitor (half-maximal inhibitory concentration, 18.07 ± 0.75 mg/mL) and exhibited maximum glucose uptake by yeast cells (77.53 ± 0.97% at 35 mg/mL). All extracts demonstrated weak glucose adsorption ability. The positive in vitro tests for C. indica paved the way for in vivo studies. C. indica extract (200 and 400 mg/kg) significantly (P < 0.05) reduced postprandial blood glucose peaks in mice challenged with starch. The extract (400 mg/kg) and acarbose normalized blood glucose levels at 180 minutes, when they were statistically similar to values in normal mice. Thus, it may be concluded that the antidiabetic effect of C. indica is mediated by inhibition of starch metabolism (α-amylase inhibition), increased glucose uptake by peripheral cells (promotion of glucose uptake by yeast cells), and mild entrapment (adsorption) of glucose. Hence, C. indica can be developed as antidiabetic drug after detailed pharmacological studies.

  15. Gamma irradiation and heat treatment for sterilization of Mushroom Spent Compost (MSC)

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Hassan Hamdani Mutaat; Foziah Ali; Zainab Harun; Hoe, P.C.K.; Mohd Meswan Maskom; Khairuddin Abdul Rahim

    2016-01-01

    Mushroom spent compost (MSC) refers to substrate residue from mushroom cultivation. MSC can be used as a material to improve soil properties for farming. MSC is also suitable as a carrier or substrate to hold beneficial microorganisms in bio fertilizer products. The carrier for bio fertilizer products must be sterilized completely before inoculating with bacteria inoculum. In this study, the effects of gamma irradiation and heat on sterilization of MSC were evaluated by microbial enumeration technique. The MSC was packed into polyethylene bags. The packed MSC were irradiated at different doses of 0 (control), 10, 20, 30, 40, 50 kGy, and heat sterilized at different autoclaving time of 0 (control), 15, 30, 45 and 60 minutes, separately. The irradiated and autoclaved samples were enumerated for viable colonies. The results showed that MSC was completely sterilized by gamma irradiation at the dose of 30 kGy whilst sterilization by heat required 30 minute autoclaving time. (author)

  16. nutrient composition of pleurotus tuberregium (fr) sing's sclerotia

    African Journals Online (AJOL)

    DJFLEX

    The amino acid and mineral profile of Pleurotus tuberregium sclerotia, was investigated. Every 100g ... sample was dried to a constant weight, defatted (by placing a ... (67%), millet, soy bean (74%), peanuts (65%), African ... sodium content to cashew nut (5-13.02mg/100g) [Nandi, .... sclerotia Flour and Protein Concentrate.

  17. The physiology of Agaricus bisporus in semi-commercial compost cultivation appears to be highly conserved among unrelated isolates

    NARCIS (Netherlands)

    Pontes, María Victoria Aguilar; Patyshakuliyeva, Aleksandrina; Post, Harm; Jurak, Edita; Hildén, Kristiina; Altelaar, Maarten; Heck, Albert; Kabel, Mirjam A; de Vries, Ronald P; Mäkelä, Miia R

    2017-01-01

    The white button mushroom Agaricus bisporus is one of the most widely produced edible fungus with a great economical value. Its commercial cultivation process is often performed on wheat straw and animal manure based compost that mainly contains lignocellulosic material as a source of carbon and

  18. The physiology of Agaricus bisporus in semi-commercial compost cultivation appears to be highly conserved among unrelated isolates

    NARCIS (Netherlands)

    Pontes, María Victoria Aguilar; Patyshakuliyeva, Aleksandrina; Post, Harm; Jurak, Edita; Hildén, Kristiina; Altelaar, Maarten; Heck, Albert; Kabel, Mirjam A.; Vries, de Ronald P.; Mäkelä, Miia R.

    2018-01-01

    The white button mushroom Agaricus bisporus is one of the most widely produced edible fungus with a great economical value. Its commercial cultivation process is often performed on wheat straw and animal manure based compost that mainly contains lignocellulosic material as a source of carbon and

  19. Imaging mass spectrometry and genome mining reveal highly antifungal virulence factor of mushroom soft rot pathogen.

    Science.gov (United States)

    Graupner, Katharina; Scherlach, Kirstin; Bretschneider, Tom; Lackner, Gerald; Roth, Martin; Gross, Harald; Hertweck, Christian

    2012-12-21

    Caught in the act: imaging mass spectrometry of a button mushroom infected with the soft rot pathogen Janthinobacterium agaricidamnosum in conjunction with genome mining revealed jagaricin as a highly antifungal virulence factor that is not produced under standard cultivation conditions. The structure of jagaricin was rigorously elucidated by a combination of physicochemical analyses, chemical derivatization, and bioinformatics. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Enzymatic, Antioxidant, Antimicrobial, and Insecticidal Activities of Pleurotus pulmonarius and Pycnoporus cinnabarinus Grown Separately in an Airlift Reactor

    Directory of Open Access Journals (Sweden)

    Maura Téllez-Téllez

    2016-03-01

    Full Text Available Crude extract samples of Pleurotus pulmonarius and Pycnoporus cinnabarinus were taken during growth in liquid broth in an airlift reactor. Growth was monitored indirectly by sugar consumption and pH profile. During growth Pleurotus pulmonarius consumed glucose more slowly than Pycnoporus cinnabarinus, reaching a final pH of 8.0. In contrast, Pycnoporus cinnabarinus started consuming glucose faster from the beginning to the end with a pH of 3.6, suggesting the production of different metabolites while they grow in the same culture broth. Additionally, antioxidant activity, polyphenol and flavonoid contents, as well as laccase and hydrolase activities were quantified in the culture extracts during the fermentation. Pleurotus pulmonarius showed higher antioxidant activity than Pycnoporus cinnabarinus. Both fungi have a very low polyphenol and flavonoid content. Values of amylase and pectinase activities were similar in crude extracts of both fungi; however, cellulase, xylanase, invertase, and laccase activities showed higher levels in crude extract of Pleurotus pulmonarius. Antimicrobial and insecticidal activities were also evaluated in each crude extract. In fact, Pycnoporus cinnabarinus presented a very strong bacteriostatic and bactericidal effect against Escherichia coli and Staphylococcus aureus and reliably killed Diatraea magnifactella larvae, while Pleurotus pulmonarius did not showed any negative effect on the growth of these bacteria or larvae.

  1. A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

    Science.gov (United States)

    Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

    2015-03-01

    In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

  2. Amylolytic studies of pleurotus tuber-regium | Monago | Global ...

    African Journals Online (AJOL)

    The alpha amylase of the sclerotium of Pleurotus tuber-regium was studied. The enzyme was purified from the fresh sclerotium through dialysis, ammonium sulphate fractionation and column chromatography of CM sephadex. The enzyme showed 70% of it's optimal activity between p.H 4.0 to 8.0. Acid and thermal stability ...

  3. Nutrient Management in Aquaponics: Comparison of Three Approaches for Cultivating Lettuce, Mint and Mushroom Herb

    OpenAIRE

    Valentina Nozzi; Andreas Graber; Zala Schmautz; Alex Mathis; Ranka Junge

    2018-01-01

    Nutrients that are contained in aquaculture effluent may not supply sufficient levels of nutrients for proper plant development and growth in hydroponics; therefore, they need to be supplemented. To determine the required level of supplementation, three identical aquaponic systems (A, B, and C) and one hydroponic system (D) were stocked with lettuce, mint, and mushroom herbs. The aquaponic systems were stocked with Nile tilapia. System A only received nutrients derived from fish feed; system ...

  4. Centesimal composition and physical-chemistry analysis of the edible mushroom Lentinus strigosus occurring in the Brazilian Amazon.

    Science.gov (United States)

    Sales-Campos, Ceci; Araujo, Lidia M; Minhoni, Marli T A; Andrade, Meire C N

    2013-01-01

    The centesimal composition and the physical and chemical analyses of Lentinus strigosus, an edible mushroom occurring in the Brazilian Amazon and produced in alternative substrates based on wood and agroindustrial residues, were evaluated. For this purpose, the C, N, pH, soluble solids, water activity, protein, lipids, total fiber, ash, carbohydrate, and energy levels were determined. The substrates were formulated from Simarouba amara Aubl. ("marupá"), Ochroma piramidale Cav. Ex. Lam. ("pau-de-balsa") and Anacardium giganteum ("cajuí") sawdust and Bactris gasipaes Kunth ("pupunheira") stipe and Saccharum officinarum (sugar cane bagasse). The results indicated that the nutritional composition of L. strigosus varied with the substrate of cultivation; the protein levels found in mushrooms grown in the different substrates (18-21.5%) varied with the substrate and was considered high; the soluble solids present in the mushrooms could have a relation with complex B hydrosoluble vitamins. L. strigosus could be considered as important food owing to its nutritional characteristics such as high protein content, metabolizable carbohydrates and fibers, and low lipids and calories content.

  5. Attraction, Oviposition and Larval Survival of the Fungus Gnat, Lycoriella ingenua, on Fungal Species Isolated from Adults, Larvae, and Mushroom Compost

    Science.gov (United States)

    Cloonan, Kevin R.; Andreadis, Stefanos S.; Chen, Haibin; Jenkins, Nina E.; Baker, Thomas C.

    2016-01-01

    We previously showed that the females of the mushroom sciarid, Lycoriella ingenua (Dufour, 1839) (Diptera: Sciaridae), one of the most severe pests of the cultivated white button mushroom, Agaricus bisporus (J.E. Lange) Emil J. Imbach (Agaricales: Agaricaceae), are attracted to the mushroom compost that mushrooms are grown on and not to the mushrooms themselves. We also showed that females are attracted to the parasitic green mold, Trichoderma aggressivum. In an attempt to identify what is in the mushroom compost that attracts female L. ingenua, we isolated several species of fungi from adult males and females, third instar larvae, and mushroom compost itself. We then analyzed the attraction of females to these substrates using a static-flow two choice olfactometer, as well as their oviposition tendencies in another type of assay under choice and no-choice conditions. We also assessed the survival of larvae to adulthood when first instar larvae were placed on each of the isolated fungal species. We found that female flies were attracted most to the mycoparasitic green mold, T. aggressivum, to Penicilium citrinum isolated from adult female bodies, and to Scatylidium thermophilium isolated from the mushroom compost. Gravid female flies laid the most eggs on T. aggressivum, Aspergillus flavus isolated from third instar larval frass, Aspergillus fumigatus isolated from adult male bodies, and on P. citrinum. This egg-laying trend remained consistent under no-choice conditions as females aged. First instar larvae developed to adulthood only on S. thermophilium and Chaetomium sp. isolated from mushroom compost, and on P. citrinum. Our results indicate that the volatiles from a suite of different fungal species act in tandem in the natural setting of mushroom compost, with some first attracting gravid female flies and then others causing them to oviposit. The ecological context of these findings is important for creating an optimal strategy for using possible

  6. [Effects of mushroom residue compost on growth and nutrient accumulation of Larix principis-rupprechtii containerized transplants].

    Science.gov (United States)

    Teng, Fei; Liu, Yong; Lou, Jun Shan; Sun, Qiao Yu; Wan, Fang Fang; Yang, Chen; Zhang, Jin

    2016-12-01

    Excessive use of peat may cause some environmental problems. To alleviate the negative effect, an experiment was conducted with the mushroom residue compost to replace peat in Larix principis-rupprechtii containerized transplant production, and the proportion of mushroom residue compost was 0% (T 0 , control), 15% (T 1 ), 18.75% (T 2 ), 25% (T 3 ), 37.50% (T 4 ), 50% (T 5 ), 56.25% (T 6 ) and 60% (T 7 ), respectively. The physical and chemical features of the substrates and its effect on the vegetative growth and nutrient accumulation of L. principis-rupprechtii containerized transplants were studied. The results showed when the proportion of mushroom residue compost in the substrate accounted for 50% or less, there was no significant difference in the transplant height, diameter, and biomass compared with the control, and the nutrient concentration in T 2 , T 4 , T 5 treatments was significantly higher than in T 0 . The pH value was sub-acidic to neutral which was suitable to the transplant growth. When the compost proportion accounted for more than 50%, the pH value was altered to alkali and was not suitable to the transplant growth. When the proportion of mushroom residue compost accounted for 15%, the plant grew best, and the height, diameter, and total biomass got the highest. Therefore, using mushroom residue compost to replace peat in L. principis-rupprechtii containerized transplants cultivation was feasible and the maximum replacement ratio could reach 50%. The high quality transplants could be obtained when the compost replacement ratio was 15%.

  7. Mushrooms, trees, and money: value estimates of commercial mushrooms and timber in the pacific northwest.

    Science.gov (United States)

    Alexander, Susan J; Pilz, David; Weber, Nancy S; Brown, Ed; Rockwell, Victoria A

    2002-07-01

    Wild edible mushrooms are harvested in the forests of the Pacific Northwest, where both trees and mushrooms grow in the same landscape. Although there has been some discussion about the value of trees and mushrooms individually, little information exists about the joint production of, and value for, these two forest products. Through four case studies, the information needed to determine production and value for three wild mushroom species in different forests of the Pacific Northwest is described, and present values for several different forest management scenarios are presented. The values for timber and for mushrooms are site- and species-specific. On the Olympic Peninsula in Washington, timber is highly valued and chanterelles are a low-value product by weight; timber has a soil expectation value (SEV) 12 to 200 times higher than chanterelles. In south-central Oregon, timber and American matsutake mushrooms have the potential to have about the same SEV. In eastern Oregon, timber is worth 20 to 110 times as much as the morels that grow in the forest. Production economics is concerned with choices about how much and what to produce with what resources. The choices are influenced by changes in technical and economic circumstances. Through our description and analysis of the necessary definitions and assumptions to assess value in joint production of timber and wild mushrooms, we found that values are sensitive to assumptions about changes in forest management, yields for mushrooms and trees, and costs.

  8. Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

    Science.gov (United States)

    Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

    2018-03-01

    As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

  9. Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

    Science.gov (United States)

    Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

    2016-03-01

    Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

  10. BIODEGRADATION OF SUGARCANE VINASSES BY THE WHITE-ROT FUNGI Pleurotus ostreatus IN A PACKED BED REACTOR

    Directory of Open Access Journals (Sweden)

    W.A. Tapie

    2016-08-01

    Full Text Available Sugarcane vinasses are considered a complex effluent because of its organic load, low pH, high temperature, and by the presence of recalcitrant substances such as melanoidins and phenolic compounds. The aim of this work was to evaluate the potential of the fungus Pleurotus ostreatus to carry out the biodegradation of sugarcane vinasses in a fixed-bed bioreactor. The experiments evidence the potential of the fungus Pleurotus ostreatus to carry out the decolorization (83%, the removal of the Chemical Oxygen Demand (COD=87% and the Biochemical Oxygen Demand (BOD5=92%, the reduction of total suspended solids (83% and volatile suspended solids (72% of vinasses. The technical simplicity of the proposed alternative as well as process performance reveals the potential of the fungus Pleurotus ostreatus for the treatment of sugarcane mill effluents.

  11. Browse Title Index - AJOL

    African Journals Online (AJOL)

    Items 7451 - 7500 of 11090 ... ... Listeria monocytogenes- A high risk food pathogen by multiplex PCR, Abstract PDF ... and molecular characterization of Oyster mushroom (Pleurotus spp.) ... Vol 14, No 15 (2015), Morphological and RAPD-marker ...

  12. (Pleurotus pulmonarius) grown on cotton waste and cassava peel

    African Journals Online (AJOL)

    This work evaluated the yield of Pleurotus pulmonarius on different mixtures of cotton waste and cassava peel. P. pulmonarius demonstrated significantly higher colonization rate on cotton waste substrate (100 g cotton waste) 3 weeks after inoculation of spawn than any other substrate mixtures. Cotton waste had the ...

  13. Detoxification of Olive Mill Wastewater and Bioconversion of Olive Crop Residues into High-Value-Added Biomass by the Choice Edible Mushroom Hericium erinaceus.

    Science.gov (United States)

    Koutrotsios, Georgios; Larou, Evangelia; Mountzouris, Konstantinos C; Zervakis, Georgios I

    2016-09-01

    Environmentally acceptable disposal of olive cultivation residues (e.g., olive prunings; olive pruning residues (OLPR)) and olive mill wastes is of paramount importance since they are generated in huge quantities within a short time. Moreover, olive mill wastewater (OMW) or sludge-like effluents ("alperujo"; two-phase olive mill waste (TPOMW)) are highly biotoxic. Hericium erinaceus is a white-rot fungus which produces choice edible mushrooms on substrates rich in lignocellulosics, and its suitability for the treatment of olive by-products was examined for the first time. Fungal growth resulted in a notable reduction of OMW's pollution parameters (i.e., 65 % decolorization, 47 % total phenolic reduction, and 52 % phytotoxicity decrease) and correlated with laccase and manganese peroxidase activities. Solid-state fermentation of various mixtures of OLPR, TPOMW, and beech sawdust (control) by H. erinaceus qualified OLPR in subsequent cultivation experiments, where it exhibited high mushroom yields and biological efficiency (31 %). Analyses of proximate composition and bioactive compound content revealed that mushrooms deriving from OLPR substrates showed significantly higher crude fat, total glucan, β-glucan, total phenolics, and ferric-reducing antioxidant potential values than the control. H. erinaceus demonstrated the potential to detoxify OMW and bioconvert OLPR into high-quality biomass, and hence, this fungus could be successfully exploited for the treatment of such by-products.

  14. Anticancer potential evoked by Pleurotus florida and Calocybe ...

    African Journals Online (AJOL)

    Jane

    2011-07-20

    Jul 20, 2011 ... Actually, world trade in mushrooms is as big as the trade in coffee. Mushroom polysaccharides support some or all of the major systems of the body, including nervous, hormonal and immune systems as well as regulatory functions. ..... mechanistic description of dead and dying eukaryotic cells. Infection.

  15. Review on Natural Enemies and Diseases in the Artificial Cultivation of Chinese Caterpillar Mushroom, Ophiocordyceps sinensis (Ascomycetes).

    Science.gov (United States)

    Lu, Zenghui; Shi, Ping; He, Yuanchuan; Zhang, Deli; He, Zongyi; Chen, Shijiang; Tu, Yongqin; Li, Li; Liu, Fei; Zeng, Wei

    2015-01-01

    Ophiocordyceps sinensis (syn. Cordyceps sinensis), well known as DongChongXiaCao (DCXC), is one of the most valuable traditional Chinese medicinal species. In this article, we provide a systematic review of natural enemies and diseases encountered in artificial cultivation of DCXC. Unfortunately, DCXC has been endangered over the past decades due to overharvesting and a worsening ecological environment. Therefore, the artificial cultivation of DCXC has been extensively investigated in recent years. Complete indoor artificial cultivation and semi-field cultivation are the two most common strategies used to cultivate DCXC. However, cultured DCXCs are often attacked by various natural enemies and diseases, which have resulted in substantial loss of the valuable medicinal resource. In this study, we have summarized the species of natural enemies and types of diseases confronted by DCXC. Twenty reported natural enemy species are categorized into four classes, one of which is reported for the first time in this study. Moreover, six microbial pathogens are also discussed. The recapitulation of the natural enemies and diseases in DCXC artificial cultivation not only promote the development of integrated pest management of DCXC cultivation but also provide important information to help preserve and develop this valuable resource.

  16. Improving the feeding value of straws with Pleurotus ostreatus

    NARCIS (Netherlands)

    Khan, N.A.; Hussain, S.; Ahmad, N.; Alam, S.; Bezabhi, M.; Hendriks, W.H.; Yu, P.; Cone, J.W.

    2015-01-01

    The high content of lignin in cell walls is the major limiting factor in the digestion and utilisation of cereal crop residues by ruminants. The aim of this study was to evaluate the effectiveness of the white rot fungus, Pleurotus ostreatus (P. ostreatus), to degrade lignin and to enhance the rumen

  17. Additive effects of CuSO4 and aromatic compounds on laccase production by Pleurotus sajor-caju PS-2001 using sucrose as a carbon source

    Directory of Open Access Journals (Sweden)

    F. Bettin

    2014-06-01

    Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.

  18. Nutritional composition of bioproducts generated from semi-solid ...

    African Journals Online (AJOL)

    sunny t

    2016-03-23

    Mar 23, 2016 ... Culturas DPUA –UFAM. Av. General Rodrigo ... in the pineapple peel and in the bioproducts generated from pineapple peel and mycelium of Pleurotus albidus ..... mushrooms consumed by the ethnic tribes of India. Detailed ...

  19. Preliminary investigation into the use of Pleurotus tuber-regium ...

    African Journals Online (AJOL)

    The swelling capacity was three times that of maize starch BP Tablets prepared with P. tuber-regium powder disintegrated faster than those prepared with maize starch BP at concentrations below 10% w/w. At the disintegrant concentration of 10% w/w paracetamol tablets made from both Pleurotus powder and maize starch ...

  20. Dissipation and Migration of Pyrethroids in Auricularia polytricha Mont. from Cultivation to Postharvest Processing and Dietary Risk

    Directory of Open Access Journals (Sweden)

    Jin-Jing Xiao

    2018-03-01

    Full Text Available In order to ensure raw consumption safety the dissipation behavior, migration, postharvest processing, and dietary risk assessment of five pyrethroids in mushroom (Auricularia polytricha Mont. cultivated under Chinese greenhouse-field conditions. Half-lives (t1/2 of pyrethroids in fruiting body and substrate samples were 3.10–5.26 and 17.46–40.06 d, respectively. Fenpropathrin dissipated rapidly in fruiting bodies (t1/2 3.10 d; bifenthrin had the longest t1/2. At harvest, pyrethroid residues in A. polytricha (except fenpropathrin were above the respective maximum residue limits (MRLs. Some migration of lambda-cyhalothrin was observed in the substrate-fruit body system. In postharvest-processing, sun-drying and soaking reduced pyrethroid residues by 25–83%. We therefore recommend that consumers soak these mushrooms in 0.5% NaHCO3 at 50 °C for 90 min. Pyrethroids exhibit a particularly low PF value of 0.08–0.13%, resulting in a negligible exposure risk upon mushroom consumption. This study provides guidance for the safe application of pyrethroids to edible fungi, and for the establishment of MRLs in mushrooms to reduce pesticide exposure in humans.