Reflooding and boil-off experiments in a VVER-440 like rod bundle and analyses with the CATHARE code

Energy Technology Data Exchange (ETDEWEB)

Korteniemi, V.; Haapalehto, T. [Lappeenranta Univ. of Technology (Finland); Puustinen, M. [VTT Energy, Lappeenranta (Finland)

1995-09-01

Several experiments were performed with the VEERA facility to simulate reflooding and boil-off phenomena in a VVER-440 like rod bundle. The objective of these experiments was to get experience of a full-scale bundle behavior and to create a database for verification of VVER type core models used with modern thermal-hydraulic codes. The VEERA facility used in the experiments is a scaled-down model of the Russian VVER-440 type pressurized water reactors used in Loviisa, Finland. The test section of the facility consists of one full-scale copy of a VVER-440 reactor rod bundle with 126 full-length electrically heated rod simulators. Bottom and top-down reflooding, different modes of emergency core cooling (ECC) injection and the effect of heating power on the heat-up of the rods was studied. In this paper the results of calculations simulating two reflood and one boil-off experiment with the French CATHARE2 thermal-hydraulic code are also presented. Especially the performance of the recently implemented top-down reflood model of the code was studied.

Assessment of computer codes for VVER-440/213-type nuclear power plants

Energy Technology Data Exchange (ETDEWEB)

Szabados, L.; Ezsol, Gy.; Perneczky [Atomic Energy Research Institute, Budapest (Hungary)

1995-09-01

Nuclear power plant of VVER-440/213 designed by the former USSR have a number of special features. As a consequence of these features the transient behaviour of such a reactor system should be different from the PWR system behaviour. To study the transient behaviour of the Hungarian Paks Nuclear Power Plant of VVER-440/213-type both analytical and experimental activities have been performed. The experimental basis of the research in the PMK-2 integral-type test facility , which is a scaled down model of the plant. Experiments performed on this facility have been used to assess thermal-hydraulic system codes. Four tests were selected for {open_quotes}Standard Problem Exercises{close_quotes} of the International Atomic Energy Agency. Results of the 4th Exercise, of high international interest, are presented in the paper, focusing on the essential findings of the assessment of computer codes.

Test facility of the VVER-440 condensation-type pressure suppression system

International Nuclear Information System (INIS)

Wolff, H.; Arndt, S.

2004-01-01

Since the early nineties, GRS has supported regulatory authorities in Central and Eastern Europe in performing safety assessments of nuclear power plants. Especially studies of the condensation-type pressure suppression system of VVER-440/V-213-type plants have been important in this respect. Major steps in demonstrating complete functioning of the condensation-type pressure suppression system under accident conditions by experiments run in the Russian large scale test facility, BC V-213, have been completed in the past two years within the framework of various international experimental programs. The test results were used to validate specifically for power plants with VVER-400/V-213 reactors the COCOSYS GRS computer code, which is used in the safety assessments. The results of recalculations of the C02 EREC test, which simulates a break of a main steam pipe, demonstrate the present state of validation of COCOSYS for VVER condensation-type pressure suppression systems. (orig.) [de

Qualification of UT methods and systems used for in-service inspections of VVER 440 vessels

International Nuclear Information System (INIS)

Skala, Z.; Vit, J.

2003-01-01

SKODA JS has been performing automated in-service inspections VVER reactor pressure vessels for more than twenty years. All of these inspections were performed by ultrasonic pulse echo method, combined from 1996 with eddy current testing. The Time of Flight Diffraction Method (TOFD) is one of modern methods of ultrasonic testing. The accuracy of sizing the through wall extent of a flaw by TOFD is much better than the accuracy achievable by the pulse echo method. A series of laboratory tests were performed by SKODA JS and confirmed the suitability of TOFD method for VVER reactor parts testing. The Czech Atomic law demands the qualification of systems and methods used for the in-service inspections of nuclear reactors. The qualification is done in accordance with ENIQ methodology and consists of preparation of the Technical Justification and practical tests made under the surveillance of Qualification Body. SKODA JS intends to qualify systems and methods used for the automated ultrasonic testing of VVER 440 and VVER 1000 reactor components from the inner as well as from the outer surface. The accuracy of the flaw through wall extent sizing by TOFD was confirmed by the qualification of methods and systems used for the testing of VVER 440 vessel circumferential weld and so the TOFD method shall be used routinely by SKODA JS for the inspection of vessel circumferential welds root area and for sizing of flaws exceeding the acceptance level. (author)

New code for VVER-440 loading pattern design

International Nuclear Information System (INIS)

Bajgl, J.; Lehmann, M.

1999-01-01

This paper describes the main attributes of a new computer program OPTIMAL used for loading pattern design in Dukovany NPP (4 reactors VVER-440). We have been developed this program in Nuclear Research Institute Rez since 1994 on the base of special contract between Dukovany NPP and Nuclear Research Institute Rez. General information about the optimisation methodology is given in the first part. The organisation of the optimisation process is described in part 2. Construction of the optimisation functional is shown in part 3. Procedures used during one-cycle optimisation are described in part 4. (Authors)

Phase and structural transformations in VVER-440 RPV base metal after long-term operation and recovery annealing

Science.gov (United States)

Kuleshova, E. A.; Gurovich, B. A.; Maltsev, D. A.; Frolov, A. S.; Bukina, Z. V.; Fedotova, S. V.; Saltykov, M. A.; Krikun, E. V.; Erak, D. Yu; Zhurko, D. A.; Safonov, D. V.; Zhuchkov, G. M.

2018-04-01

This study was carried out to evaluate the possibility of 1st generation VVER-440 reactors lifetime extension by recovery re-annealing with the respect to base metal (BM). Comprehensive studies of the structure and properties of BM templates (samples cut from the inner surface of the shells in beltline region) of operating VVER-440 reactor (after primary standard recovery annealing 475 °C/150 h and subsequent long-term re-irradiation within reactor pressure vessel (RPV)) were conducted. These templates were also subjected to laboratory re-annealing 475 °C/150 h. TEM, SEM and APT studies of BM after laboratory re-annealing revealed significant recovery of radiation-induced hardening elements (Cu-rich precipitates and dislocation loops). Simultaneously a process of strong phosphorus accumulation at grain boundaries occurs since annealing temperature corresponds to the maximum reversible temper brittleness development. The latter is not observed for VVER-440 weld metal (WM). Comparative assessment of the properties return level for the beltline BM templates after recovery re-annealing 475 °C/150 h showed that it does not reach the one typical for beltline WM after the same annealing.

The status of the Bubbler Condenser Containment System for the Reactors of the VVER-440/213 Type

International Nuclear Information System (INIS)

Karwat, H.; Rosinger, H.E.

1998-01-01

VVER-440/213 Pressurized Water Reactors have a pressure-suppression containment structure called a 'Bubbler Condenser' tower which can reduce the design pressure of the entire containment following a design basis accident (DBA), such as a loss-of-coolant accident (LOCA). The bubbler condenser pressure suppression system provides reduction of the LOCA containment pressure by the condensation of released steam in a water pool. World-wide there are 14 nuclear power plants of the VVER-440/213 type in Eastern Europe and Russia. One of the safety concerns for the VVER-440/213 reactors relates to the ability of the bubbler condenser containment system to function satisfactorily and to maintain its integrity following certain postulated accidents and thus limit the release of radioactive material to the environment. The complicated geometry of the bubbler condenser unit, and the dependence on several moving devices and interlocks are the main doubts expressed by different specialists with regard to the design. General description of the bubbler condenser containment system, the physical processes, concerns and design assessment of the bubbler condenser containment system, presentation of the OECD's Unified Bubbler Condenser Research Project (UBCRP) and the European Commission PHARE/TACIS project. Recent utility investigations are also discussed

Influence of Bypass on Thermo-Hydraulics of VVER 440 Fuel Assembly

Directory of Open Access Journals (Sweden)

Jakubec Jakub

2017-04-01

Full Text Available The paper deals with CFD modelling and simulation of coolant flow within the nuclear reactor VVER 440 fuel assembly. The influence of coolant flow in bypass on the temperature distribution at the outlet of the fuel assembly and pressure drop was investigated. Only steady-state analyses were performed. Boundary conditions are based on operating conditions. ANSYS CFX is chosen as the main CFD software tool, where all analyses are performed.

Floor response spectra for seismic qualification of Kozloduy VVER 440-230 NPP

International Nuclear Information System (INIS)

Kostov, M.K.; Prato, C.A.; Stevenson, J.D.

1993-01-01

In this paper the floor response spectra generation methodology for Kozloduy NPP, Unit 1-2 of VVER 440-230 is presented. The 2D coupled soil-structure interaction models are used combined with a simplified correction of the final results for accounting of torsional effects. Both time history and direct approach for in-structure spectra generation are used and discussion of results is made

Floor response spectra for seismic qualification of Kozloduy VVER 440-230 NPP

Energy Technology Data Exchange (ETDEWEB)

Kostov, M.K. [Bulgarian Academy of Sciences, Sofia (BG). Central Lab. for Seismic Mechanics and Earthquake Engineering; Ma, D.C. [Argonne National Lab., IL (United States); Prato, C.A. [Univ. of Cordoba (AR); Stevenson, J.D. [Stevenson and Associates, Cleveland, OH (US)

1993-08-01

In this paper the floor response spectra generation methodology for Kozloduy NPP, Unit 1-2 of VVER 440-230 is presented. The 2D coupled soil-structure interaction models are used combined with a simplified correction of the final results for accounting of torsional effects. Both time history and direct approach for in-structure spectra generation are used and discussion of results is made.

Accident loads for a VVER-440/213 containment

Energy Technology Data Exchange (ETDEWEB)

Techy, Z. [Institute for Electric Power Research (VEIKI), Budapest (Hungary); Lajtha, G. [Institute for Electric Power Research (VEIKI), Budapest (Hungary); Taubner, R. [Institute for Electric Power Research (VEIKI), Budapest (Hungary)

1995-08-01

Specific features of the VVER-440/213 containment are the subdivided rectangular building and the localization system including the bubbler trays and air traps. Accident loads are calculated for a large break loss of coolant accident (LBLOCA). The maximum pressure and temperature loads are calculated with different codes during the blowdown phase of the LBLOCA. The uncertainty margins of the maximum pressure are given in this case. Sensitivity studies are performed for different leakage rates and hydraulic data of the containment. The effects of the active and passive spray systems on the depressurization are presented in this paper. The maximum pressure loads are also examined in case of degraded conditions of the localization system. (orig.).

Water chemistry regimes for VVER-440 units: water chemistry influence on fuel cladding behaviour

International Nuclear Information System (INIS)

Zmitko, M.

1999-01-01

In this lecture next problems of water chemistry influence on fuel cladding behaviour for VVER-440 units are presented: primary coolant technologies; water chemistry specification and control; fuel integrity considerations; zirconium alloys cladding corrosion (corrosion versus burn-up; water chemistry effect; crud deposition; hydrogen absorption; axial offset anomaly); alternatives for the primary coolant regimes

Experimental study of hydrodynamically induced vibrational processes in VVER-440 fuel assemblies

International Nuclear Information System (INIS)

Solonin, V.I.; Perevezentsev, V.V.; Rekshnya, N.F.; Krapivtsev, V.G.

2000-01-01

Investigations are described of hydrodynamically induced vibrations in a single fuel assembly of a VVER-440 reactor, performed on a full-scale model installed in a closed loop filled with distilled water; the model fuel elements contained simulators of fuel pellets. Data on hydrodynamic loads were obtained by measuring pressure oscillations along the height of the fuel assembly case. Results of the measurements are presented in graphs and are discussed in some detail. (A.K.)

Impact of burnable absorber Gd on nuclide composition for VVER-440 fuel (Gd-2)

International Nuclear Information System (INIS)

Zajac, R.; Chrapciak, V.

2010-01-01

The latest version of Russian fuel VVER-440 includes burnable absorber in 6 pins. In this article is impact of burnable absorber on nuclide composition and criticality analyzed. In part 1 was analyzed whole burnup interval 0-50 MWd/kgU. In present part 2 are detailed analysis only for first cycle (burnup 0-10 MWd/kgU). (Authors)

Hydrodynamics around a spacer of a VVER-440 fuel rod bundle

International Nuclear Information System (INIS)

Mayer, G.; Hazi, G.; Kavran, P.

2004-01-01

Recently, an intensive research has been started in our institute, focusing on the hydrodynamics of fuel rod bundles. Numerical computations have been planed to be carried out in a three level bottom-up hierarchy, using direct numerical simulation, large eddy simulation and Reynolds averaged Navier-Stokes approach. Here, we give a description of the numerical method applied for direct numerical and large eddy simulation. We present some preliminary results obtained by the simulation of the flow around a spacer of a VVER-440 fuel rod bundle. (author)

The FARC fuel archive of VVER

International Nuclear Information System (INIS)

Zizin, M.N.; Parfenova, N.A.; Proselkov, V.N.; Shishkov, L.K.

1998-01-01

The principles of organisation are explained and the structure of the FARC fuel archive for VVER reactors is described. The objective of the archive is accumulation of fuel data, data storage and obtaining the fuel using characteristics. The working version of fuel archive on 01.07.98 is realised, in which the data tables for fuel assemblies for 169 VVER-440 cycles and 35 VVER-1000 cycles are stored. There are two different versions of fuel archive - for VVER-440 (FARC) and for VVER-1000 (FARC1000). A structure of some tables and the texts of programs for them differ. The algorithms and codes for checking integrity, reasonableness and reliability of fuel archive data are developed. (author)

Isothermal and thermal–mechanical fatigue of VVER-440 reactor pressure vessel steels

Energy Technology Data Exchange (ETDEWEB)

Fekete, Balazs, E-mail: fekete.mm.bme@gmail.com [College of Dunaujvaros, Tancsics 1A, Dunaujvaros H-2400 (Hungary); Department of Applied Mechanics, Budapest University of Technology and Economics, Muegyetem 5, Budapest H-1111 (Hungary); Trampus, Peter [College of Dunaujvaros, Tancsics 1A, Dunaujvaros H-2400 (Hungary)

2015-09-15

Highlights: • We aimed to determine the thermomechanical behaviour of VVER reactor steels. • Material tests were developed and performed on GLEEBLE 3800 physical simulator. • Coffin–Manson curves and parameters were derived. • High accuracy of the strain energy based evaluation was found. • The observed dislocation evolution correlates with the mechanical behaviour. - Abstract: The fatigue life of the structural materials 15Ch2MFA (CrMoV-alloyed ferritic steel) and 08Ch18N10T (CrNi-alloyed austenitic steel) of VVER-440 reactor pressure vessel under completely reserved total strain controlled low cycle fatigue tests were investigated. An advanced test facility was developed for GLEEBLE-3800 physical simulator which was able to perform thermomechanical fatigue experiments under in-service conditions of VVER nuclear reactors. The low cycle fatigue results were evaluated with the plastic strain based Coffin–Manson law, and plastic strain energy based model as well. It was shown that both methods are able to predict the fatigue life of reactor pressure vessel steels accurately. Interrupted fatigue tests were also carried out to investigate the kinetic of the fatigue evolution of the materials. On these samples microstructural evaluation by TEM was performed. The investigated low cycle fatigue behavior can provide reference for remaining life assessment and lifetime extension analysis.

Microstructure and embrittlement of VVER 440 reactor pressure vessel steels; Microstructure et fragilisation des aciers de cuve des reacteurs nucleaires VVER 440

Energy Technology Data Exchange (ETDEWEB)

Hennion, A

1999-03-15

27 VVER 440 pressurised water reactors operate in former Soviet Union and in Eastern Europe. The pressure vessel, is made of Cr-Mo-V steel. It contains a circumferential arc weld in front of the nuclear core. This weld undergoes a high neutron flux and contains large amounts of copper and phosphorus, elements well known for their embrittlement potency under irradiation. The embrittlement kinetic of the steel is accelerated, reducing the lifetime of the reactor. In order to get informations on the microstructure and mechanical properties of these steels, base metals, HAZ, and weld metals have been characterized. The high amount of phosphorus in weld metals promotes the reverse temper embrittlement that occurs during post-weld heat treatment. The radiation damage structure has been identified by small angle neutron scattering, atomic probe, and transmission electron microscopy. Nanometer-sized clusters of solute atoms, rich in copper with almost the same characteristics as in western pressure vessels steels, and an evolution of the size distribution of vanadium carbides, which are present on dislocation structure, are observed. These defects disappear during post-irradiation tempering. As in western steels, the embrittlement is due to both hardening and reduction of interphase cohesion. The radiation damage specificity of VVER steels arises from their high amount of phosphorus and from their significant density of fine vanadium carbides. (author)

Isothermal and thermal-mechanical fatigue of VVER-440 reactor pressure vessel steels

Science.gov (United States)

Fekete, Balazs; Trampus, Peter

2015-09-01

The fatigue life of the structural materials 15Ch2MFA (CrMoV-alloyed ferritic steel) and 08Ch18N10T (CrNi-alloyed austenitic steel) of VVER-440 reactor pressure vessel under completely reserved total strain controlled low cycle fatigue tests were investigated. An advanced test facility was developed for GLEEBLE-3800 physical simulator which was able to perform thermomechanical fatigue experiments under in-service conditions of VVER nuclear reactors. The low cycle fatigue results were evaluated with the plastic strain based Coffin-Manson law, and plastic strain energy based model as well. It was shown that both methods are able to predict the fatigue life of reactor pressure vessel steels accurately. Interrupted fatigue tests were also carried out to investigate the kinetic of the fatigue evolution of the materials. On these samples microstructural evaluation by TEM was performed. The investigated low cycle fatigue behavior can provide reference for remaining life assessment and lifetime extension analysis.

Delayed Neutron Fraction (beta-effective) Calculation for VVER 440 Reactor

International Nuclear Information System (INIS)

Hascik, J.; Michalek, S.; Farkas, G.; Slugen, V.

2008-01-01

Effective delayed neutron fraction (β eff ) is the main parameter in reactor dynamics. In the paper, its possible determination methods are summarized and a β eff calculation for a VVER 440 power reactor as well as for training reactor VR1 using stochastic transport Monte Carlo method based code MCNP5 is made. The uncertainties in determination of basic delayed neutron parameters lead to the unwished conservatism in the reactor control system design and operation. Therefore, the exact determination of the β eff value is the main requirement in the field of reactor dynamics. The interest in the delayed neutron data accuracy improvement started to increase at the end of 80-ties and the beginning of 90-ties, after discrepancies among the results of experiments and measurements what do you mean differences between different calculation approaches and experimental results. In consequence of difficulties in β eff experimental measurement, this value in exact state is determined by calculations. Subsequently, its reliability depends on the calculation method and the delayed neutron data used. An accurate estimate of β eff is essential for converting reactivity, as measured in dollars, to an absolute reactivity and/or to an absolute k eff . In the past, k eff has been traditionally calculated by taking the ratio of the adjoint- and spectrum-weighted delayed neutron production rate to the adjoint- and spectrum-weighted total neutron production rate. An alternative method has also been used in which β eff is calculated from simple k-eigenvalue solutions. The summary of the possible β eff determination methods can be found in this work and also a calculation of β eff first for the training reactor VR1 in one operation state and then for VVER 440 power reactor in two different operation states are made using the prompt method, by MCNP5 code.(author)

VVER-440 and VVER-1000 reactor dosimetry benchmark - BUGLE-96 versus ALPAN VII.0

International Nuclear Information System (INIS)

Duo, J. I.

2011-01-01

Document available in abstract form only, full text of document follows: Analytical results of the vodo-vodyanoi energetichesky reactor-(VVER-) 440 and VVER-1000 reactor dosimetry benchmarks developed from engineering mockups at the Nuclear Research Inst. Rez LR-0 reactor are discussed. These benchmarks provide accurate determination of radiation field parameters in the vicinity and over the thickness of the reactor pressure vessel. Measurements are compared to calculated results with two sets of tools: TORT discrete ordinates code and BUGLE-96 cross-section library versus the newly Westinghouse-developed RAPTOR-M3G and ALPAN VII.0. The parallel code RAPTOR-M3G enables detailed neutron distributions in energy and space in reduced computational time. ALPAN VII.0 cross-section library is based on ENDF/B-VII.0 and is designed for reactor dosimetry applications. It uses a unique broad group structure to enhance resolution in thermal-neutron-energy range compared to other analogous libraries. The comparison of fast neutron (E > 0.5 MeV) results shows good agreement (within 10%) between BUGLE-96 and ALPAN VII.O libraries. Furthermore, the results compare well with analogous results of participants of the REDOS program (2005). Finally, the analytical results for fast neutrons agree within 15% with the measurements, for most locations in all three mockups. In general, however, the analytical results underestimate the attenuation through the reactor pressure vessel thickness compared to the measurements. (authors)

Neutron dosimetry in EDF experimental surveillance programme for VVER-440 nuclear power plants

International Nuclear Information System (INIS)

Brumovsky, M.; Erben, O.; Novosad, P.; Zerola, L.; Hogel, J.; Trollat, C.

2001-01-01

Fourteen chains containing experimental surveillance material specimens of the VVER 440/213 nuclear power reactor pressure vessels were irradiated in the surveillance channels of the Nuclear Power Plant Dukovany in the Czech Republic. The irradiation periods were one, two or three cycles. The chains contained different number and types of containers, the omitted ones were replaced by chain elements. All of the containers were instrumented with wire neutron fluence detectors, some of the containers in the chain had spectrometric sets of neutron fluence monitors. For the absolute fluence values evaluation it was taken into account time history of the reactor power and local changes of the neutron flux along the reactor core height, correction factors due to the orientation of monitors with respect to the reactor core centre. Unfolding programs SAND-II or BASA-CF were used. The relative axial fluence distribution was obtained from the O-wire measurements. Neutron fluence values above 0.5 MeV energy and above 1.0 MeV energy in the container axis on the axial positions of the sample centres and fluence values in the geometric centre of the samples was calculated making use the exponential attenuation model of the incident neutron beam. Received fast neutron fluence values can be used as reference values to all VVER-440 type 213 nuclear power plant reactors. (author)

Verification of the enrichment of fresh VVER-440 fuel assemblies at NPP Paks

Energy Technology Data Exchange (ETDEWEB)

Almasia, I.; Hlavathya, Z.; Nguyena, C. T. [Institute of Isotopes, Hungarian Academy of Sciences, Budapest, (Hungary); others, and

2012-06-15

A Non Destructive Analysis (NDA) method was developed for the verification of {sup 235}U enrichment of both homogeneous and profiled VVER-440 reactor fresh fuel assemblies by means of gamma spectrometry. A total of ca. 30 assemblies were tested, five of which were homogeneous, with {sup 235}U enrichment in the range 1,6% to 3,6%, while the others were profiled with pins of 3,3% to 4,4% enrichment. Two types of gamma detectors were used for the test measurements: 2 coaxial HPGe detectors and a miniature CdZnTe (CZT) detector fitting into the central tube of the assemblies. It was therefore possible to obtain information from both the inside and the outside of the assemblies. It was shown that it is possible to distinguish between different types of assemblies within a reasonable measurement time (about 1000 sec). For the HPGe measurements the assemblies had to be lifted out from their storage rack, while for the CZT detector measurements the assemblies could be left at their storage position, as it was shown that the neighbouring assemblies do not affect measurement inside the assemblies' central tube. The measured values were compared to Monte Carlo simulations carried out using the MCNP code, and a recommendation for the optimal approach to verify the {sup 235}U enrichment of fresh VVER-440 reactor fuel assemblies is suggested.

Assessment of In-vessel corium retention for VVER-440/V213

International Nuclear Information System (INIS)

Matejovic, P.; Barnak, M.; Bachraty, M.; Berky, R.

2011-01-01

In-vessel corium retention (IVR) via external reactor vessel cooling (ERVC) has been recognised as a feasible and promising severe accident management strategy for VVER-440/V213 reactors. In general, the avoiding of boiling crisis on outer (cooled) RPV (reactor pressure vessel) surface is sufficient condition for preserving the RPV integrity. The crucial point of the proposed IVR concept for VVER-440/V213 is the narrow gap between elliptical lower head and thermal and biological shield. In the cold conditions the width of this gap is only about 2 cm and would be even lower in hot IVR conditions, when the reactor wall is subjected to large thermal gradients due to temperature difference between the hot inner surface (loaded by corium) and cold outer surface (which is cooled by water in flooded cavity). Sufficient gap should remain free for coolant flow for the success of the proposed IVR concept. Thus, realistic estimation of thermal load and corresponding deformations of reactor wall and their impact on gap width are of primarily importance. Two different approaches were used for the estimation of the thermal load: a conservative approach and a transient approach, both were computed with the ASTEC code. The structural analysis of RPV subjected to IVR load was performed using the finite element method (FEM) code ANSYS release 10.0. From the results obtained it follows, that even when the RPV is subjected to limiting loading conditions during severe accident, there should be sufficient gap width (∼ 1 cm) between RPV wall and thermal/biological shield for the coolant flow in natural circulation regime alongside the outer surface of the RPV wall

Nuclear fuel for VVER reactors. Actual state and trends

International Nuclear Information System (INIS)

Molchanov, V.

2011-01-01

The main tasks concerning development of FA design, development and modernization of structural materials, improvement of technology of structural materials manufacturing and FA fabrication and development of methods and codes are discussed in this paper. The main features and expected benefit of implementation of second generation and third generation fuel assembly for VVER-440 Nuclear Fuel are given. A brief review of VVER-440 and VVER-1000 Nuclear Fuel development before 1997 since 2010 is shown. A summary of VVER-440 and VVER-1000 Nuclear Fuel Today, including details about TVSA-PLUS, TVSA-ALFA, TVSA-12 and NPP-2006 Phase 2 tasks (2010-2012) is presented. In conclusion, as a result of large scope of R and D performed by leading enterprises of nuclear industry modern nuclear fuel for VVER reactors is developed, implemented and successfully operated. Fuel performance (burnup, lifetime, fuel cycles, operating reliability, etc.) meets the level of world's producers of nuclear fuel for commercial reactors

Present status and recent improvements of water chemistry at Russian VVER plants

International Nuclear Information System (INIS)

Mamet, V.; Yurmanov, V.

2001-01-01

Water chemistry is an important contributor to reliable plant operation, safety barrier integrity, plant component lifetime, radiation safety, environmental impact. Primary and secondary water chemistry guidelines of Russian VVER plants have been modified to meet the new safety standards. At present 14 VVER units of different generation are in operation at 5 Russian NPPs. There are eight 4-loop pressurised water reactors VVER-1000 (1000 MWe) and six 6-loop pressurised water reactors VVER-440 (440 MWe). Generally, water chemistry at East European VVER plants (about 40 VVER-440 and VVER-1000 units in Ukraine, Bulgaria, Slovakia, Czech Republic, Hungary, Finland and Armenia) is similar to water chemistry at Russian VVER plants. Due to similar design and structural materials some water chemistry improvements were introduced at East European plants after they has been successfully implemented at Russian plants and vice versa. Some water chemistry improvements will be implemented at modern VVER plants under construction in Ukraine, Slovakia, Czech Republic, Iran, China, India. (R.P.)

Microstructure and embrittlement of VVER 440 reactor pressure vessel steels

International Nuclear Information System (INIS)

Hennion, A.

1999-03-01

27 VVER 440 pressurised water reactors operate in former Soviet Union and in Eastern Europe. The pressure vessel, is made of Cr-Mo-V steel. It contains a circumferential arc weld in front of the nuclear core. This weld undergoes a high neutron flux and contains large amounts of copper and phosphorus, elements well known for their embrittlement potency under irradiation. The embrittlement kinetic of the steel is accelerated, reducing the lifetime of the reactor. In order to get informations on the microstructure and mechanical properties of these steels, base metals, HAZ, and weld metals have been characterized. The high amount of phosphorus in weld metals promotes the reverse temper embrittlement that occurs during post-weld heat treatment. The radiation damage structure has been identified by small angle neutron scattering, atomic probe, and transmission electron microscopy. Nanometer-sized clusters of solute atoms, rich in copper with almost the same characteristics as in western pressure vessels steels, and an evolution of the size distribution of vanadium carbides, which are present on dislocation structure, are observed. These defects disappear during post-irradiation tempering. As in western steels, the embrittlement is due to both hardening and reduction of interphase cohesion. The radiation damage specificity of VVER steels arises from their high amount of phosphorus and from their significant density of fine vanadium carbides. (author)

PMK-2, the First Integral Thermal-Hydraulics Tests for the Safety Evaluation of VVER-440/213 Nuclear Power Plants

Directory of Open Access Journals (Sweden)

Gy. Ézsöl

2012-01-01

Full Text Available The PMK-2 facility is a full-pressure thermal-hydraulic model of the primary and partly the secondary circuit of the VVER-type units of Paks NPP. The facility was the first integral-type facility for VVERs. The PMK-2 was followed later by the PACTEL (for VVER-440, the ISB, and PSB for VVER-1000. Since the startup of the facility in 1985, 55 experiments have been performed primarily in international frameworks with the participation of experts from 29 European and overseas countries forming a scientific school to better understand VVER system behaviour and reach a high level of modelling of accident sequences. The ATHLET, CATHARE, and RELAP5 codes have been validated including both qualitative and quantitative assessments. The former was almost exclusively applied to the early phase of validation by integral experiments, while the quantitative assessments have been performed by the Fast Fourier Transform Based Method. Paper gives comprehensive information on the design features of PMK-2 facility with a special respect to the representativeness of phenomena, the experiments performed, and the results of the validation of ATHLET, CATHARE, and RELAP5 codes. Safety significance of the PMK-2 projects is also discussed.

PMK-2, the First Integral Thermal-Hydraulics Tests for the Safety Evaluation of VVER-440/213 Nuclear Power Plants

International Nuclear Information System (INIS)

Ezsol, G.; Perneczky, L.; Szabados, L.; Toth, I.

2012-01-01

The PMK-2 facility is a full-pressure thermal-hydraulic model of the primary and partly the secondary circuit of the VVER-type units of Paks NPP. The facility was the first integral-type facility for VVERs. The PMK-2 was followed later by the PACTEL (for VVER-440), the ISB, and PSB for VVER-1000. Since the startup of the facility in 1985, 55 experiments have been performed primarily in international frameworks with the participation of experts from 29 European and overseas countries forming a scientific school to better understand VVER system behaviour and reach a high level of modelling of accident sequences. The ATHLET, CATHARE, and RELAP5 codes have been validated including both qualitative and quantitative assessments. The former was almost exclusively applied to the early phase of validation by integral experiments, while the quantitative assessments have been performed by the Fast Fourier Transform Based Method. Paper gives comprehensive information on the design features of PMK-2 facility with a special respect to the representativeness of phenomena, the experiments performed, and the results of the validation of ATHLET, CATHARE, and RELAP5 codes. Safety significance of the PMK-2 projects is also discussed

Application of the thermal-hydraulic codes in VVER-440 steam generators modelling

Energy Technology Data Exchange (ETDEWEB)

Matejovic, P.; Vranca, L.; Vaclav, E. [Nuclear Power Plant Research Inst. VUJE (Slovakia)

1995-12-31

Performances with the CATHARE2 V1.3U and RELAP5/MOD3.0 application to the VVER-440 SG modelling during normal conditions and during transient with secondary water lowering are described. Similar recirculation model was chosen for both codes. In the CATHARE calculation, no special measures were taken with the aim to optimize artificially flow rate distribution coefficients for the junction between SG riser and steam dome. Contrary to RELAP code, the CATHARE code is able to predict reasonable the secondary swell level in nominal conditions. Both codes are able to model properly natural phase separation on the SG water level. 6 refs.

Application of the thermal-hydraulic codes in VVER-440 steam generators modelling

Energy Technology Data Exchange (ETDEWEB)

Matejovic, P; Vranca, L; Vaclav, E [Nuclear Power Plant Research Inst. VUJE (Slovakia)

1996-12-31

Performances with the CATHARE2 V1.3U and RELAP5/MOD3.0 application to the VVER-440 SG modelling during normal conditions and during transient with secondary water lowering are described. Similar recirculation model was chosen for both codes. In the CATHARE calculation, no special measures were taken with the aim to optimize artificially flow rate distribution coefficients for the junction between SG riser and steam dome. Contrary to RELAP code, the CATHARE code is able to predict reasonable the secondary swell level in nominal conditions. Both codes are able to model properly natural phase separation on the SG water level. 6 refs.

Sequence of decommissioning of the main equipment in a central type VVER 440 V-230

International Nuclear Information System (INIS)

Andres, E.; Garcia Ruiz, R.

2014-01-01

IBERDROLA Ingenieria y Construccion S.A.U., leader of consortium with Empresarios Agrupados and INDRA, has developed the Basic Engineering for the decommissioning of contaminated systems and building of a VVER 440 V-230 Nuclear Power Plant, establishing the sequence and methodology for the main equipment fragmentation. For that, it has been designed dry and wet cutting zones to be set up in the area where steam generators, main cooling pumps and pressurizer are located; these components will be dismantled previously. (Author)

Special features of embrittlement of welded joints in shells of VVER-type reactors

International Nuclear Information System (INIS)

Kasatkin, O.G.

1999-01-01

At present, the atomic power engineering of Russia and Ukraine is based on water-water energy reactors of the VVER-440 and VVER-1000 type, with the electric power of 440 and 1000 MW, respectively. The majority of the VVER-440 reactors are installed in Russia, and VVER-1000 reactors operate in Ukraine. The reactors' shell (RS) is produced from cylindrical shells and a dished end welded together by circular joints under a flux. The RS of the VVER-440 reactor is produced from 15Kh3MFA steel, and the VVER-1000 reactors are produced from 15Kh2NMFA steel. The shell of the VVER-1000 reactor has an internal austenite coating. The condition of the RS metal is determined mainly by the critical brittleness temperature T b at which the impact toughness of specimens with a sharp notch reaches 60 J/cm 2 . The energy reactors, working in western countries, are characterised by a service life of 40 years and discussion is being carried out to extend this lifetime to 60 years. The design service life of the domestic reactors varies from 30 (RS VVER-440) to 40 (RS VVER-1000) years. According to investigations, the service life of the shells of these reactors is restricted by the properties of welded joints which are characterised by higher susceptibility to embrittlement than that of the parent metal, especially due to a higher content in the weld of phosphorus (RS VVER-440) or nickel (RS VVER-1000). Therefore, some experts believe that the actual service life of the RS is shorter than the design life. The accurate evaluation of the service life of welded joints in the RS is very important for the safety of service and also in the economic aspects, because the unjustified decrease of the permissible service life and premature shutdown of units of the nuclear power station result in huge losses

SCORPIO-VVER core monitoring and surveillance system with advanced capabilities

International Nuclear Information System (INIS)

Molnar, J.; Vocka, R.

2010-01-01

In this work authors present 12 years of operation experience of core monitoring and surveillance system with advanced capabilities on nuclear power plants on 6 unit of VVER-440 type of reactors at two different NPPs. The original version of the SCORPIO (Surveillance of reactor CORe by PIcture On-line display) system was developed for the western type of PWR reactors. The first version of the SCORPIO-VVER Core Monitoring System for Dukovany NPP (VVER-440 type of reactor, Czech Republic) was developed in 1998. For SCORPIO-VVER implementation at Bohunice NPP in Slovakia (2001) the system was enhanced with startup module KRITEX.

Adoption of in-vessel retention concept for VVER-440/V213 reactors in Central European Countries

Energy Technology Data Exchange (ETDEWEB)

Matejovic, Peter, E-mail: peter.matejovic@ivstt.sk [Inzinierska Vypoctova Spolocnost (IVS), Jana Holleho 5, 91701 Trnava (Slovakia); Barnak, Miroslav; Bachraty, Milan; Vranka, Lubomir [Inzinierska Vypoctova Spolocnost (IVS), Jana Holleho 5, 91701 Trnava (Slovakia); Berky, Robert [Integrita a Bezpecnost Ocelovych Konstrukcii, Rybnicna 40, 831 07 Bratislava (Slovakia)

2017-04-01

Highlights: • Design of in-vessel retention concept for VVER-440/V213 reactors. • Thermal loads acting on the inner reactor surface. • Structural response of reactor pressure vessel. • External reactor vessel cooling. - Abstract: An in-vessel retention (IVR) concept was proposed for standard VVER-440/V213 reactors equipped with confinement made of reinforced concrete and bubbler condenser pressure suppression system. This IVR concept is based on simple modifications of existing plant technology and thus it was attractive for plant operators in Central European Countries. Contrary to the solution that was adopted before at Loviisa NPP in Finland (two units of VVER-440/V213 reactor with steel confinement equipped with ice condenser), the coolant access to the reactor pressure vessel from flooded cavity is enabled via closable hole installed in the centre of thermal shield of the reactor lower head instead of lowering this massive structure in the case of severe accident. As a consequence, the crucial point of this IVR concept is narrow gap between torispherical lower head and thermal and biological shield. Here the highest thermal flux is expected in the case of severe accident. Thus, realistic estimation of thermal load and corresponding deformations of reactor wall and their impact on gap width for coolant flow are of primarily importance. In this contribution the attention is paid especially to the analytical support with emphasis to the following points: 1) {sup ∗}Estimation of thermal loads acting on the inner reactor surface; 2) {sup ∗}Estimation of structural response of reactor pressure vessel (RPV) with emphasis on the deformation of outer reactor surface and its impact on the annular gap between RPV wall and thermal/biological shield; 3) {sup ∗}Analysis of external reactor vessel cooling. For this purpose the ASTEC code was used for performing analysis of core degradation scenarios, the ANSYS code for structural analysis of reactor vessel

Thermal-hydraulic studies on the safety of VVER-440 type nuclear power plants

International Nuclear Information System (INIS)

Tuunanen, J.

1994-01-01

The thesis includes several thermal-hydraulic analyses related to the Loviisa VVER-440 nuclear power plant units. The work consists of experimental studies, analysis of the experiments, analysis of some plant transients and development of a calculational model for calculation of boric concentrations in the reactor. In the first part of thesis, in the case of simulation of boric acid solution behaviour during long-term cooling period of LOCAs, experiments were performed in scaled-down test facilities. The experimental data together with the results of RELAP5/MOD3 simulations were used to develop a model for calculations of boric acid concentrations in the reactor during LOCAs. In the second part, in the case of simulation of horizontal generators, experiments were performed with PACTEL integral test loop to simulate loss of feedwater transients. The PACTEL experiments as well as earlier REWETT-III natural circulation tests, were analyzed with RELAP5/MOD3 Version 5m5 code. The third part of the work consists of simulations of Loviisa VVER reactor pump trip transients with RELAP5/MOD1-Eur, RELAP5/MOD3 and CATHARE codes. (56 refs., 9 figs.)

Analysis of transients for NPP with VVER-440 using the code SiTAP

International Nuclear Information System (INIS)

Kalinenko, V.

1994-06-01

The report contains analysis of transients ''Loop connection'' and ''Steam generator tube rupture'' for nuclear power plants (NPP) with VVER-440. To obtain more detailed information about NPP's dynamic characteristics, various variants of initial and boundary conditions are considerd. Calculation of these transients was performed using the SiTAP code developed at the Nuclear Safety Institute of the Russian Research Centre ''Kurchatov Institute''. SiTAP code is a multifunctional computer tool for fast analysis of transient and accidental processes of VVER type reactors for engineers working in the field of NPP dynamics. SiTAP can be used form comparative analysis of several variants of accident scenarios to find out the conditions leading to most serious consequences from a safety point of view. In such cases, additional analyses using best-estimate codes should be carried out. The results of SiTAP for a faulty loop connection leading to a boron dilution accident are intended to be used as boundary conditions for a more detailed anlaysis with the aid of the three-dimensional reactor core model DYN3D, developed in the Research Centre Rossendorf for the simulation of reactivity initiated accidents. (orig.)

NNSA / IAEA VVER reactor safety workshops. May 2002 - April 2003. Executive summary

International Nuclear Information System (INIS)

Evans, M.; Petri, M. C.

2003-01-01

Over the past year, the U.S. National Nuclear Security Administration (NNSA) has sponsored four workshops to compare the probabilistic risk assessments (PRAs) of Soviet-designed VVER power plants. The ''International Workshop on Safety of First-Generation VVER-440 Nuclear Power Plants'' was held on May 20-25, 2002, in Piestany, Slovakia. A short follow-on workshop was held in Bratislava, Slovakia, on November 5-6, 2002, to complete the work begun in May. Piestany was the location also for the ''International Workshop on Safety of Second-Generation VVER-440 Nuclear Power Plants'' (September 9-14, 2002) and the ''International Workshop on Safety of VVER-1000 Nuclear Power Plants'' (April 7-12, 2003). The four workshops were held in cooperation with the International Atomic Energy Agency (IAEA), the Nuclear Regulatory Authority of Slovakia (UJD), the Center for Nuclear Safety in Central and Eastern Europe (CENS), and Argonne National Laboratory (ANL). The objectives of the workshops were to identify the impact of the improvements on the core damage frequency; the contribution to the PRA results of different assumptions about events that can occur at the plants; and to understand, identify, and prioritize potential improvements in hardware and plant operation of VVER nuclear power plants. These objectives were achieved based on insights gained from recent PRAs completed by the plants and their technical support organizations. Nine first-generation VVER-440 plants (nominally of the VVER-440/230 design) are currently operating in Armenia, Bulgaria, Russia, and Slovakia. Sixteen VVER-440/213 plants are currently operating in the Czech Republic, Hungary, Russia, Slovakia, and Ukraine. Twenty-three VVER-1000 plants are currently operating in Bulgaria, the Czech Republic, Russia, and Ukraine. Eleven addition plants are in the advanced stages of construction in various parts of the world. The workshops reviewed the current configuration and safety status of each plant

Determination of mixing factors for VVER-440 fuel assembly head

Energy Technology Data Exchange (ETDEWEB)

Tóth, S., E-mail: toth@reak.bme.hu [Institute of Nuclear Techniques, Budapest University of Technology and Economics, Műegyetem rkp. 9, H-1111 Budapest (Hungary); Aszódi, A. [Institute of Nuclear Techniques, Budapest University of Technology and Economics, Műegyetem rkp. 9, H-1111 Budapest (Hungary)

2013-11-15

CFD models have been developed for the heads of the old, the present and the new type VVER-440 fuel assemblies using the experience of a former validation process. With these models temperature distributions are investigated in the heads of some typical assemblies and the in-core thermocouple signals are calculated. The analyses show that the coolant mixing is intensive but not-perfect in the assembly heads. The difference between the thermocouple signal and the cross-sectional average temperature at the measurement level depends on the assembly type. Using the results of these CFD calculations the weight factors of the rod bundle regions for the in-core thermocouple have been determined. With these factors the thermocouple signals are estimated and the results are statistically tested using the registered data of the Hungarian nuclear power plant. This test shows that the deviations between the measured and the calculated temperatures can be significantly decreased and consequently monitoring uncertainties can be reduced with using the weight factors.

VVER-440 training simulators upgrades - Experience of CORYS T.E.S.S

International Nuclear Information System (INIS)

Bartak, J.; Fallon, B.

2006-01-01

The paper presents recent projects of upgrading screen operated simulators of VVER-440 nuclear power plants to full scale replica simulators, implemented by CORYS TESS. Control room replica full scope simulators were built for the Bohunice NPP in Slovakia and the Novovoronezh NPP in Russia. The scope of simulation was extended to reflect the current status of the units, which have undergone significant modernization programs over the last few years. The paper describes the software and hardware adaptations and evolutions of the existing simulators, the implementation in the simulator of modern supervision systems as well as of systems and equipment designed in the seventies and still used on the reference units. The training benefits of parallel use of control room replica and screen-operated simulators in the training process are discussed. (author)

Diversification of the VVER fuel market in Eastern Europe and Ukraine

Energy Technology Data Exchange (ETDEWEB)

Kirst, Michael [Westinghouse EMEA, Brussels (Belgium); Benjaminsson, Ulf; Oenneby, Carina [Westinghouse Electric Sweden AB, Vaesteraes (Sweden)

2015-03-15

There are a total of 33 VVER active reactors in the EU and Ukraine, accounting for the largest percentage of the total electricity supply in the countries operating these. The responsible governments and utilities operating these units want too see an increased diversification of the nuclear fuel supply. Westinghouse is the only nuclear fuel producer outside Russia, which has taken the major steps to develop, qualify and manufacture VVER fuel designs - both for VVER-440 and VVER-1000 reactors. The company has delivered reloads of VVER-440 fuel to Loviisa 2 in Finland, VVER-1000 fuel for both the initial core and follow-on regions to Temelin 1-2 in the Czech Republic and more recently reloads of VVER-1000 fuel to South Ukraine 2-3. Technical challenges in form of mechanical interference with the resident fuel have been encountered in Ukraine, but innovative solutions have been developed and successfully implemented and today Ukraine has, for the first time in its history, a viable VVER-1000 fuel design alternative, representing a tremendous lever in energy security for the country.

VVER-specific features regarding core degradation - Status Report

International Nuclear Information System (INIS)

Hozer, Z.; Trambauer, K.; Duspiva, J.

1999-01-01

and metal masses of VVER reactors results for some accident sequences in later core degradation. The unique construction of VVER-440 control assemblies plays a special role during accident progression, having several fuel assemblies below the core and creating a heterogeneous core structure with absorber assemblies. Some events (e.g. B 4 C melting in the VVER-1000) are more similar to processes in BWRs. The early phase of core degradation seems to be similar in VVERs and PWRs, however the role of boron steel absorber assembly melting can change the sequence for the VVER-440. Accident progression during the late phase of core degradation can be influenced by the interaction of molten material with lower plenum structures in VVER-440. The mechanism of vessel failure can show some differences due to the VVER bottom heads being elliptical and without penetrations, compared with those of PWRs which are hemispherical and where penetrations are present. The severe accident phenomena were compared with the help of categories used for PWRs and BWRs. Most of the phenomena were found not to be VVER-specific, which means that the phenomena takes place in a similar way in the reactor types compared. Very few phenomena were found not relevant to VVER (e.g. AIC control rod related ones). When the phenomena was given a VVER-specific character the role of design features was discussed. In some cases there was experimental evidence, however in most of the cases the effect of VVER design could only be estimated. Some phenomena are not known in detail even for Western LWRs, so the comparison can show only some likelihood of differences. The review of related experiments showed, that the VVER experimental database is not as extensive as that for PWRs and BWRs. A number of separate-effect and integral tests indicated that the behaviour of materials used in VVERs is generally similar to that of PWRs. Some specific areas are not covered by experiments at all and their investigation should be

Experimental support of the bleed and feed accident management measures for VVER-440/213 type reactors

International Nuclear Information System (INIS)

Szabados, L.

2002-01-01

In the original design of the VVER-440/213 type nuclear power plants event oriented emergency operating procedures (EOP) were implemented. In the last years, however, new symptom based procedures of Westinghouse-type have been developed and partly implemented for the plants in Central Europe including the Paks Nuclear Power Plant. Paper gives a short review of the experiments performed in the PMK-2 facility to study the effectiveness of the bleed and feed strategies and to get experimental data bases for the validation of thermohydraulic system codes like RELAP5, ATHLET and CATHARE.(author)

Qualification of coupled 3D neutron kinetic/thermal hydraulic code systems by the calculation of a VVER-440 benchmark. Re-connection of an isolated loop

Energy Technology Data Exchange (ETDEWEB)

Kotsarev, Alexander; Lizorkin, Mikhail [National Research Centre ' Kurchatov Institute' , Moscow (Russian Federation); Bencik, Marek; Hadek, Jan [UJV Rez, a.s., Rez (Czech Republic); Kozmenkov, Yaroslav; Kliem, Soeren [Helmholtz-Zentrum Dresden-Rossendorf (HZDR) e.V., Dresden (Germany)

2016-09-15

The 7th AER dynamic benchmark is a continuation of the efforts to validate the codes systematically for the estimation of the transient behavior of VVER type nuclear power plants. The main part of the benchmark is the simulation of the re-connection of an isolated circulation loop with low temperature in a VVER-440 plant. This benchmark was calculated by the National Research Centre ''Kurchatov Institute'' (with the code ATHLET/BIPR-VVER), UJV Rez (with the code RELAP5-3D {sup copyright}) and HZDR (with the code DYN3D/ATHLET). The paper gives an overview of the behavior of the main thermal hydraulic and neutron kinetic parameters in the provided solutions.

Fire protection upgrading of four Russian 440/230 VVER units

International Nuclear Information System (INIS)

Corsini, G.; Yelfimov, S.

1995-01-01

The main goal of TACIS 3.6 a project funded by the Commission of the European Communities (CEC), was the front-end engineering for upgrading the Fire Protection System (FPS) of the safety-related equipment of Novovoronezh, Units 3 and 4, and Kola, Units 1 and 2, VVER 440/230 nuclear power plants. As a first step, all the safety-related equipment had to be identified, evaluation criteria had to be established and the existing FPS reviewed against the criteria. In the second step, the selection of the upgrading measures, depending on feasibility and cost estimate, has been accomplished, room by room. The third step, carried out on schedule and completed end July 95, has been essentially the preparation of the Technical Specifications for procurement of the needed equipment including remaining detail engineering. The Russian sub-contactor Atom Energo Project (AEP), who have been the designers of these older NPP s, have done the work with the Italian Ansaldo as the consultants of their Russian colleagues. Practical aspects of the engineering work are discussed and examples of improvements selected for retrofitting described. (author)

Development of fuel cycles with new fuel with 8.9 mm external diameter for VVER-440. Preliminary assessment of operating efficiency

Energy Technology Data Exchange (ETDEWEB)

Gagarinskiy, Alexey [National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation)

2017-09-15

Since the introduction of VVERs-440, their fuel assemblies are subject to ongoing improvements. Until now, the basic structural parameters of fuel, such as rod diameter of 9.1 mm, have never changed. This paper focuses on computational estimates of basic neutronic parameters of the fuel cycle that involves assemblies consisting of fuel rods with diameter reduced to 8.9 mm.

Effect of uncompensated SPN detector cables on neutron noise signals measured in VVER-440 reactors

Energy Technology Data Exchange (ETDEWEB)

Kiss, S. E-mail: kisss@sunserv.kfki.hu; Lipcsei, S. E-mail: lipcsei@sunserv.kfki.hu; Hazi, G. E-mail: gah@sunserv.kfki.hu

2003-03-01

The Self Powered Neutron Detector (SPND) noise measurements of an operating VVER-440 nuclear reactor are described and characterised. Signal characteristics may be radically influenced by the geometrical properties of the detector and the cable, and by the measuring arrangement. Simulator is used as a means of studying the structure of those phase spectra that show propagating perturbations measured on uncompensated SPN detectors. The paper presents measurements with detectors of very different sizes (i.e. 20 cm length SPNDs and the 200 cm length compensation cables), where the ratios of the global and local component differ significantly for the different detector sizes. This phenomenon is used up for signal compensation.

Experience in modernization of safety I and C in VVER 440 nuclear power plants Bohunice V1 and Paks

International Nuclear Information System (INIS)

Martin, M.

2000-01-01

For nuclear power plants which have been in operation for more than 15 years, backfitting or even complete replacement of the instrumentation and control (I and C) equipment becomes an increasingly attractive option, motivated not only by the objective to reduce the cost of I and C system maintenance and repair but also to prolong or at least to safeguard the plant life-time: optimized spare-part management through use of standard equipment; reduction of number and variety of different items of equipment by implementing functions stepwise in application software; adding new functionality in the application software which was not possible in the old technology due to lack of space; safeguarding of long-term After-Sales-Service. Some years ago Bohunice V1 NPP, Slovak Republic and Paks NPP, Hungary intended to replace parts of their Safety I and C, mainly the Reactor Trip System, the Reactor Limitation System and the Neutron Flux Excore Instrumentation and Monitoring Systems. After a Basic Engineering Phase in Bohunice V1 and a Feasibility Study in Paks both plants decided to use the Siemens' Digital Safety I and C System TELEPERM XS to modernize their plants. Both Bohunice, Unit 2 and Paks, Unit 1 have been back on line for over six months with the new Digital Safety I and C. At the present time Bohunice, Unit 1 and within the next few months Paks, Unit 2 will be replaced. Trouble-free start-ups and no major problems under operation in the first two plants were based on: thorough understanding of the VVER 440 technology; comprehensive planning together with the plant operators and authorities; the possibility to adapt TELEPERM XS to every plant type; the execution of extensive pre-operational tests. Regarding these modernization measures Siemens, as well as the above Operators, have gained considerable experience in the field of I and C Modernization in VVER 440 NPPs. Important aspects of this experience are: how to transfer the VVER technology to TELEPERM XS; how to

TAREG 2.01/00 Project, ''Validation of neutron embrittlement for VVER 1000 and 440/213 RPVs, with emphasis on integrity assessment''

International Nuclear Information System (INIS)

Ahlstrand, R.; Margolin, B.; Kostylev, V.; Yurchenko, E.; Akbashev, I.; Piminov, V.; Nikolaev, Y.; Koshkin, V.; Kharshenko, V.; Chyrko, L.; Bukhanov, V.; Comsa, O.

2012-01-01

The irradiation embrittlement and integrity of the VVER reactors has been an important issue in many EC supported TACIS and PHARE projects since 1990. In the EC annual program 2000 two TACIS projects (TAREG 2.01/00 and 2.01/03) were approved on the issue in order to improve the neutron irradiation embrittlement databases, elaborate new trend curves for the embrittlement and to assess the integrity of the RPVs (Reactor Pressure Vessel) by analysing PTS transients (Pressurized Thermal Shock) for some selected Russian and Ukrainian VVER 1000 and 440/213 NPPs. In this paper the TAREG 2.01/00 project is briefly described with some details from the twin project 2.01/03, which served as a materials testing project, providing inputs for the 1st project. As a result of the project new trend curves for neutron irradiation embrittlement were elaborated, based on upgraded and more reliable surveillance results databases. The PTS study shows that the integrity of the selected VVER RPVs can be ensured to the end of RPV design life. (author)

Technology of repair of selected equipment in the power plant type VVER 440

International Nuclear Information System (INIS)

Barborka, J.; Magula, V.

1998-01-01

This article is divided in two parts: The first part is studying the effect of individual parameters by the usual and pulsed welding of 15CH2MFA steel. It can be concluded that by use of mechanized or automatic TIG process in PC position with addition of a cold wire with high nickel content the desired quality of repair welded joints of a pressure vessel of VVER 440 reactor can be achieved. Based on the results of the second laboratory study of the renovation technology applied for the rotary surfaces of pressure-tight cover and spindle of the main closing armature type DN 500 it can be concluded, that the developed technology for surfacing the sealing surfaces by TIG process with addition of a high-nickel cold wire the functional capability of the mentioned parts can be fully restored

Technology of repair of selected equipment in the power plant type VVER 440

Energy Technology Data Exchange (ETDEWEB)

Barborka, J.; Magula, V. [Welding Research Inst. (WRI), Bratislava (Slovakia)

1998-11-01

This article is divided in two parts: The first part is studying the effect of individual parameters by the usual and pulsed welding of 15CH2MFA steel. It can be concluded that by use of mechanized or automatic TIG process in PC position with addition of a cold wire with high nickel content the desired quality of repair welded joints of a pressure vessel of VVER 440 reactor can be achieved. Based on the results of the second laboratory study of the renovation technology applied for the rotary surfaces of pressure-tight cover and spindle of the main closing armature type DN 500 it can be concluded, that the developed technology for surfacing the sealing surfaces by TIG process with addition of a high-nickel cold wire the functional capability of the mentioned parts can be fully restored.

FP 6 EU - COVERS. Coordination action - VVER safety research

International Nuclear Information System (INIS)

Vasa, I.

2008-01-01

In this work research program of the European Union FP 6 - COVERS coordinated by the NRI Rez is presented. COVERS is designed to improve professional and communication environment in the specific area covering all aspects of safe and reliable operation of nuclear power plants with VVER-440 and VVER-1000 reactors. Project Consortium is composed of 26 research and development, engineering and technical support organisations of European VVER-operating and other EU and non-EU countries.

The further development of WWER-440 fuel design performance

International Nuclear Information System (INIS)

Lushin, V.; Vasilchenko, I.; Ananjev, J.; Abashina, G.

2011-01-01

The most distinguished stages in VVER-440 fuel development of the latest ten years are: designing of second generation FA complex; and designing of sheathless working fuel assembly of the third generation (RK-3) which are presented in this report. Designing of fuel assemblies of the second generation and RK-3 is characterized by the tendency to power increase of VVER-440 operating units with V-213-type reactor, that, in turn, has given a stimulus to further design enhancement of fuel assemblies specified. The further development of the second generation fuel assembly design and the change-over to the third generation working assemblies will allow for fuel utilization to be considerably increased under the conditions of application the more long-term fuel cycles for VVER-440 reactors and operation of the Units at the increased power

VVER fuel cycle development at Slovakia

International Nuclear Information System (INIS)

Darilek, P.; Chrapiak, V.; Majerik, J.

1995-01-01

Four VVER-440 units are now under exploitation at Bohunice-site in Slovakia. Fuel cycle development of Unit No.3 and No.4 (type 213) is discussed and compared with equilibrium cycles in this paper. (author)

Improving nuclear safety of VVER-440 units

International Nuclear Information System (INIS)

Nochev, T.; Sabinov, S.

2001-01-01

In this paper authors deals with improvement of nuclear safety of WWER-440 units in Kozloduy NPP. Main directions for improving nuclear safety of WWER-440 units were: - to expand number of the design accident; - to increase reliability of equipment important for the safety; - to decrease the probability of initiating events; - improvements the integrity of the primary circuit (application LBB concept, qualification of the pressure safety valves to avoid pressurized thermal shock); - improvement of the fire protection; - improvement of the operation including upgrading and improvement of operational documents, implementation of new system for training the operators and etc.; - reassessment of the seismic response of the plant. Main actions were made at NPP Kozloduy to increase nuclear safety of VVER-440 units. 1. Modernization of Emergency High Pressure Safety Injection System. The modernization includes dividing of independent channels with reservation of active elements. Pumps were exchanged with more effective and reliable ones. HPSIS was increased reliability in general through decrease number of active elements and exchanged with passive. 2. For the purpose of avoiding fast cooling at the primary circuit and obtaining thermal shock of reactor vessel, Main Safety Insulation Valves are installed at NPP Kozloduy. 3. Modernization of Emergency power supplies AC. Oil breakers VMP-10 are exchanged with gas FS-4. 4. Generator breakers are installed to decrease probability of loss power supply and blackout. They provide reliable power supply to the system important for the safety in case of failure on generator. 5. I and C system has been qualified and optimized. 6. Reassessments of Limiting Conditions of Operation and new scram signals have been introduced. 7. An operators-oriented Informational System has been developed. It includes ensuring and updating of equipment data, new informational support of operator and etc. 8. A new auxiliary independent system for

Living PSA program for VVER 440/213 in the Czech Republic

International Nuclear Information System (INIS)

Husak, S.; Patrik, M.

2000-01-01

The paper presents an overview of a Living PSA concept in the Czech Republic for the VVER 440/213 NPP Dukovany unit. The first step of PSA program was a Level 1 basic study for Unit No. 1 which was completed in 1995. The main objective of the study was to determine the risk level of full power operation and its contributors as well as to reveal the weak points of the plant. Living PSA program for a Level 1 study has been afterwards established as a framework for all activities related to risk assessment and risk based decision-making support in NPP Dukovany. The basic parts of the project are: a management of PSA models and studies to implement design and procedures, modifications or new data inputs from data collection; continuous improvement based of new analyses, experiments or more detailed models; an extensions of the scope (external events, all plant operating modes, other sources of radioactive releases). The Living PSA program in NPP Dukovany provides basis for three kinds of PSA activities: risk assessment applications, risk monitoring and risk assessment of operational. (author)

From Wolves to Dogs, and Back: Genetic Composition of the Czechoslovakian Wolfdog.

Science.gov (United States)

Smetanová, Milena; Černá Bolfíková, Barbora; Randi, Ettore; Caniglia, Romolo; Fabbri, Elena; Galaverni, Marco; Kutal, Miroslav; Hulva, Pavel

2015-01-01

The Czechoslovakian Wolfdog is a unique dog breed that originated from hybridization between German Shepherds and wild Carpathian wolves in the 1950s as a military experiment. This breed was used for guarding the Czechoslovakian borders during the cold war and is currently kept by civilian breeders all round the world. The aim of our study was to characterize, for the first time, the genetic composition of this breed in relation to its known source populations. We sequenced the hypervariable part of the mtDNA control region and genotyped the Amelogenin gene, four sex-linked microsatellites and 39 autosomal microsatellites in 79 Czechoslovakian Wolfdogs, 20 German Shepherds and 28 Carpathian wolves. We performed a range of population genetic analyses based on both empirical and simulated data. Only two mtDNA and two Y-linked haplotypes were found in Czechoslovakian Wolfdogs. Both mtDNA haplotypes were of domestic origin, while only one of the Y-haplotypes was shared with German Shepherds and the other was unique to Czechoslovakian Wolfdogs. The observed inbreeding coefficient was low despite the small effective population size of the breed, possibly due to heterozygote advantages determined by introgression of wolf alleles. Moreover, Czechoslovakian Wolfdog genotypes were distinct from both parental populations, indicating the role of founder effect, drift and/or genetic hitchhiking. The results revealed the peculiar genetic composition of the Czechoslovakian Wolfdog, showing a limited introgression of wolf alleles within a higher proportion of the dog genome, consistent with the reiterated backcrossing used in the pedigree. Artificial selection aiming to keep wolf-like phenotypes but dog-like behavior resulted in a distinctive genetic composition of Czechoslovakian Wolfdogs, which provides a unique example to study the interactions between dog and wolf genomes.

ANDREA 2.2 and 2.3. Advances in modelling of VVER cores

Energy Technology Data Exchange (ETDEWEB)

Havluj, Frantisek; Hejzlar, Jonatan; Vocka, Radim; Vysoudil, Jiri [UJV Rez, Husinec-Rez (Czech Republic)

2017-09-15

In 2016 a new version of code ANDREA for core design and reload safety analysis of VVER reactors has been released. The new code version includes several major improvements. The first of them is a seamless incorporation of short time kinetics calculations (without temperature feedback) into the code. This new feature accompanied by the possibility of excore detector signal predictions enables precise interpretation of dynamic measurements of control assembly weight during the reactor startup. Second important enhancement resides in new flexible format of cross section libraries and in new fuel temperature model based on results of TRANSURANUS fuel performance code. The new code version has been thoroughly tested and validated for both VVER440 and VVER-1000 reactors. Furthermore for the new version 2.3 which is to be released shortly we have implemented the possibility of fluent control assemblies' motion and of non-equidistant axial nodalization schemes in VVER-440 calculations.

Inspection qualification as a tool to risk based ET ISI of VVER type SG tubes

International Nuclear Information System (INIS)

Horacek, L.

2002-01-01

A Pilot study on Eddy current inspection qualification of VVER 440 steam generator tubes, discussed in this paper, followed the ENIQ methodology principles and covered briefly the assumed scope of ET qualification, relevant elaborated qualification documents, known ISI limitations and a review of input information on component and defects determined for Eddy current inspection qualification of VVER 440 steam generator tubes. The information includes the fabrication of the test blocks with SG tube segments provided by intended defect simulations of realistic SCC type and basic data on the realistic SCC type defects manufacturing technology. Lessons learned from the development of manufacturing technology of SSC type of defects, regional blind tests, elaboration of the preliminary technical justification for Eddy current automated inspections, potential optimisation of inspection procedures, laboratory and practical open trials are summarised in the paper. The results of the Pilot study also especially in relation to POD curve being determined seem to be useful for practical operational ISI programme and Risk informed ISI decisions and the establishment of plugging criteria of VVER 440 and VVER 1000 type steam generator tubes. (orig.)

Validation of containment thermal hydraulic computer codes for VVER reactor

Energy Technology Data Exchange (ETDEWEB)

Jiri Macek; Lubomir Denk [Nuclear Research Institute Rez plc Thermal-Hydraulic Analyses Department CZ 250 68 Husinec-Rez (Czech Republic)

2005-07-01

Full text of publication follows: The Czech Republic operates 4 VVER-440 units, two VVER-1000 units are being finalized (one of them is undergoing commissioning). Thermal-hydraulics Department of the Nuclear Research Institute Rez performs accident analyses for these plants using a number of computer codes. To model the primary and secondary circuits behaviour the system codes ATHLET, CATHARE, RELAP, TRAC are applied. Containment and pressure-suppression system are modelled with COCOSYS and MELCOR codes, the reactor power calculations (point and space-neutron kinetics) are made with DYN3D, NESTLE and CDF codes (FLUENT, TRIO) are used for some specific problems.An integral part of the current Czech project 'New Energy Sources' is selection of a new nuclear source. Within this and the preceding projects financed by the Czech Ministry of Industry and Trade and the EU PHARE, the Department carries and has carried out the systematic validation of thermal-hydraulic and reactor physics computer codes applying data obtained on several experimental facilities as well as the real operational data. One of the important components of the VVER 440/213 NPP is its containment with pressure suppression system (bubble condenser). For safety analyses of this system, computer codes of the type MELCOR and COCOSYS are used in the Czech Republic. These codes were developed for containments of classic PWRs or BWRs. In order to apply these codes for VVER 440 systems, their validation on experimental facilities must be performed.The paper provides concise information on these activities of the NRI and its Thermal-hydraulics Department. The containment system of the VVER 440/213, its functions and approaches to solution of its safety is described with definition of acceptance criteria. A detailed example of the containment code validation on EREC Test facility (LOCA and MSLB) and the consequent utilisation of the results for a real NPP purposes is included. An approach to

Tightening unit EZ 250 for VVER 1000 type reactor pressure vessel head flange joints

International Nuclear Information System (INIS)

Ruchar, Miloslav; Nadenik, Tomas; Kroj, Ludek

2010-01-01

The programme of flange joints tightening by seals made of expanded graphite for VVER 440 and VVER 1000 reactor head flange joints is highlighted, and tightening units of row EZ 650 and EZ 650 TK and KNI for VVER 440 reactor head flange joints and EZ 250 tightening unit for VVER 1000 reactor head flange joints are described in detail. The main advantages of electronically controlled tightening units include: Precise and uniform compression of the gasket during the tightening procedure; Automated solution to the graphite relaxing problem during tightening; Possibility of diagnosis of the thread status of the joints being tightened; Alleviation of operator's tough work; Shorter time of tensioning associated with a lower collective doses; Quick preparation of tightening procedure report from the data measured; Calibration renewal is possible in advance at time of unit storage without the need to place it on a real joint. (P.A.)

Analysis of core damage frequency: Nuclear power plant Dukovany, VVER/440 V-213 Unit 1, internal events. Volume 1: Main report

International Nuclear Information System (INIS)

Pugila, W.J.

1994-01-01

This report presents the final results from the Level 1 probabilistic safety assessment (PSA) for the Dukovany VVER/440 V-213 nuclear power plant, Unit 1. Section 1.1 describes the objectives of this study. Section 1.2 discusses the approach that was used for completing the Dukovany PSA. Section 1.3 summarizes the results of the PSA. Section 1.4 provides a comparison of the results of the Dukovany PSA with the results of other PSAs for different types of reactors worldwide. Section 1.5 summarizes the conclusions of the Dukovany PSA

Pituitary dwarfism in Saarloos and Czechoslovakian wolfdogs is associated with a mutation in LHX3.

Science.gov (United States)

Voorbij, A M W Y; Leegwater, P A; Kooistra, H S

2014-01-01

Pituitary dwarfism in German Shepherd Dogs is associated with autosomal recessive inheritance and a mutation in LHX3, resulting in combined pituitary hormone deficiency. Congenital dwarfism also is encountered in breeds related to German Shepherd Dogs, such as Saarloos and Czechoslovakian wolfdogs. To investigate whether Saarloos and Czechoslovakian wolfdog dwarfs have the same LHX3 mutation as do Germans Shepherd Dog dwarfs. A specific aim was to determine the carrier frequency among Saarloos and Czechoslovakian wolfdogs used for breeding. Two client-owned Saarloos wolfdogs and 4 client-owned Czechoslovakian wolfdogs with pituitary dwarfism, 239 clinically healthy client-owned Saarloos wolfdogs, and 200 client-owned clinically healthy Czechoslovakian wolfdogs. Genomic DNA was amplified using polymerase chain reaction (PCR). In the Saarloos and Czechoslovakian wolfdog dwarfs, PCR products were analyzed by sequencing. DNA fragment length analysis was performed on the samples from the clinically healthy dogs. Saarloos and Czechoslovakian wolfdog dwarfs have the same 7 bp deletion in intron 5 of LHX3 as do German Shepherd Dog dwarfs. The frequency of carriers of this mutation among clinically healthy Saarloos and Czechoslovakian wolfdogs used for breeding was 31% and 21%, respectively. An LHX3 mutation is associated with pituitary dwarfism in Saarloos and Czechoslovakian wolfdogs. The rather high frequency of carriers of the mutated gene in the 2 breeds emphasizes the need for screening before breeding. If all breeding animals were genetically tested for the presence of the LHX3 mutation and a correct breeding policy would be implemented, this disease could be eradicated completely. Copyright © 2014 by the American College of Veterinary Internal Medicine.

Feasibility and usefulness of reconstructing obsolete power blocks of VVER-440 reactors

International Nuclear Information System (INIS)

Kirichenko, A.M.; Krushenik, S.D.; Sigal, M.V.; Kustov, V.P.

1993-01-01

At the present time, in Russia and in the East European countries there are atomic power stations with first-generation VVER-440 reactors built according to specification which no longer satisfy the more rigorous modern safety standards. Among these power stations are, in particular, the Novovoronezh and the Armenian Atomic Power Station and two blocks of the Kola Atomic Power Station. The search for technical solutions for modernizing these power blocks is complicated because two conditions which are hard to reconcile must be fulfilled: an acceptable safety level must be obtained and the rebuilding must be economically justifiable (particularly since the time of operation of a power block until its standard service life is over is short). Research work undertaken in the All-Union Scientific Research Institute of Atomic Power Stations has shown that one way of overcoming these difficulties may involve changing the operating conditions of the reactor assembly to a less demanding mode of operation. This solution implies an economically justified minimum of structural improvements, provides the required safety level, and prolongs the service life of the power block. The reduction of the thermal power, and consequently, the necessary transfer of a power block to another option

Typical design/qualification acceptance criteria for newly installed pipelines and equipment components of VVER-type NPPs

International Nuclear Information System (INIS)

Masopust, R.

2003-01-01

This paper describes in general the typical design/qualification acceptance criteria and seismic acceptance criteria in particular that are applicable for important to safety newly installed pipelines and equipment components of VVER-type already existing NPPs, specifically during the design verification phase of this newly installed equipment. These criteria are currently used for VVER 440-213 and VVER 1000 NPPs in Czech Republic and in Slovakia. The similar criteria are also used in Hungary. (author)

Containment leak-tightness enhancement at VVER 440 NPPs

International Nuclear Information System (INIS)

Prandorfy, M.

2000-01-01

The hermetic compartments of WWER 440 NPPs fulfil the function of the containment used at NPPs all over the world. The purpose of the containment is to protect the NPP personnel against radioactive impact as well as to prevent radioactive leakage to the. environ ent during a lost of coolant accident. Leak-tightness enhancement in NPPs with WWER 440/213 and WWER 440/230 reactors is an important safety issue. New procedures, measures and methods were adopted at NPPs in Mochovce, Jaslovske Bohunice, Dukovany and PAKS for leak identification and sealing works performed by VUEZ Levice. (authors)

Hydrogen mixing analyses for a VVER containment.

Energy Technology Data Exchange (ETDEWEB)

Sienicki, J.J.; Kostka, P.; Techy, Z.

2002-02-25

Hydrogen combustion may represent a threat to containment integrity in a VVER-440/213 plant owing to the combination of high pressure and high temperature. A study has been carried out using the GASFLOW 2.1 three-dimensional CFD code to evaluate the hydrogen distribution in the containment during a beyond design basis accident. The VVER-440/213 containment input model consists of two 3D blocks connected via one-dimensional (1D) ducts. One 3D block contains the reactor building and the accident localization tower with the suppression pools. Another 3D block models the air traps. 1D ducts represent the check valves connecting the accident localization tower with the air traps. The VVER pressure suppression system, called ''bubbler condenser,'' was modeled as a distributed heat sink with water thermodynamic properties. This model accounts for the energy balance. However, it is not currently possible to model dynamic phenomena associated with the water pools (e.g., vent clearing, level change). The GASFLOW 2.1 calculation gave detailed results for the spatial distribution of thermal-hydraulic parameters and gas concentrations. The range and trend of the parameters are reasonable and valuable. There are particularly interesting circulation patterns around the steam generators, in the bubbler tower and other primary system compartments. In case of the bubbler tower, concentration and temperature contour plots show an inhomogeneous distribution along the height and width, changing during the accident. Hydrogen concentrations also vary within primary system compartments displaying lower as well as higher (up to 13-20% and higher) values in some nodes. Prediction of such concentration distributions was not previously possible with lumped parameter codes. GASFLOW 2.1 calculations were compared with CONTAIN 1.2 (lumped parameter code) results. Apart from the qualitatively similar trends, there are, for the time being, quantitative differences between the

Automatic loading pattern optimization tool for Loviisa VVER-440 reactors

Energy Technology Data Exchange (ETDEWEB)

Kuopanportti, Jaakko [Fortum Power and Heat, Fortum (Finland). Nuclear Competence Center

2013-09-15

An automatic loading pattern optimization tool called ALPOT has been developed for Loviisa VVER-440 reactors. The ALPOT code utilizes combination of three different optimization methods. The first method is the imitation of the equilibrium pattern that is the optimized pattern in case the cycle length and the operation conditions are constant and the same shuffling pattern is repeated from cycle to cycle. In practice, the algorithm imitates assemblies' operation year distribution of the equilibrium pattern stochastically. The function of the imitation algorithm is to provide initial patterns quickly for the next optimization phase, which is performed either with the stochastic guided binary search algorithm or the deterministic burnup kernel method depending on the choice of the user. The former is a modified version of the standard binary search. The standard version goes through all possible swaps of the assemblies and chooses the best swap at each iteration round. The guided version chooses one assembly, tries to swap it with every other possible assembly and performs the best swap at each iteration round. The search is guided so that the algorithm chooses the assemblies at or near the most restrictive fuel assembly first. The kernel method creates burnup kernel functions to estimate burnup variations that are required to achieve desired changes in the power distribution of the reactor. The idea of the kernel method is first determine the optimal burnup distribution that minimizes the maximum relative assembly power using the created kernel functions and a common solver routine. Then, the burnups of the available fuel assemblies are matched with the obtained burnup distribution. (orig.)

Automatic loading pattern optimization tool for Loviisa VVER-440 reactors

International Nuclear Information System (INIS)

Kuopanportti, Jaakko

2013-01-01

An automatic loading pattern optimization tool called ALPOT has been developed for Loviisa VVER-440 reactors. The ALPOT code utilizes combination of three different optimization methods. The first method is the imitation of the equilibrium pattern that is the optimized pattern in case the cycle length and the operation conditions are constant and the same shuffling pattern is repeated from cycle to cycle. In practice, the algorithm imitates assemblies' operation year distribution of the equilibrium pattern stochastically. The function of the imitation algorithm is to provide initial patterns quickly for the next optimization phase, which is performed either with the stochastic guided binary search algorithm or the deterministic burnup kernel method depending on the choice of the user. The former is a modified version of the standard binary search. The standard version goes through all possible swaps of the assemblies and chooses the best swap at each iteration round. The guided version chooses one assembly, tries to swap it with every other possible assembly and performs the best swap at each iteration round. The search is guided so that the algorithm chooses the assemblies at or near the most restrictive fuel assembly first. The kernel method creates burnup kernel functions to estimate burnup variations that are required to achieve desired changes in the power distribution of the reactor. The idea of the kernel method is first determine the optimal burnup distribution that minimizes the maximum relative assembly power using the created kernel functions and a common solver routine. Then, the burnups of the available fuel assemblies are matched with the obtained burnup distribution. (orig.)

The threat to Austria from Czechoslovakian nuclear power plants not yet headed off

International Nuclear Information System (INIS)

Tollmann, A.

1990-01-01

The author is dissapointed that the recent political changes in the neighbouring Czechoslovakia did not result in a construction stop of Temelin. The Czechoslovakian nuclear lobby fought back. With one exception all members of the present Czechoslovakian government are nuclear proponents. The way to success will be stonier than in Austria because in Czechoslovakia - in contrast to Austria - the public is unenlightened

Calculation of spatial weighting functions for ex-core detectors of VVER-440 reactors by Monte Carlo method

International Nuclear Information System (INIS)

Berki, T.

2003-01-01

The signal of ex-core detectors depends not only on the total power of a reactor but also on the power distribution. The spatial weighting function establishes correspondence between the power distribution and the detector signal. The weighting function is independent of the power distribution. The weighting function is used for detector-response analyses, for example in the case of rod-drop experiments. (1) The paper describes the calculation and analysis of the weighting function of a VVER-440. The three-dimensional Monte Carlo code MCNP is used for the evaluation. Results from forward and adjoint calculations are compared. The effect of the change in the concentration of boric acid is also investigated. The evaluation of the spatial weighting function is a fixed-source neutron transport problem, which can be solved much faster by adjoint calculation, however forward calculations provide more detailed results. It is showed that the effect of boric acid upon the weighting function is negligible. (author)

Technical-economic evaluation of uranium reserves in the DIAMO company, Straz pod Ralskem (Czech Republic)

International Nuclear Information System (INIS)

Hradek, J.

1998-01-01

Changing economic conditions in the Czechoslovakian (CSFR) economy (in 1992) made it necessary to realign exploitation of uranium in the country, taking into consideration economical, and environmental factors. This was done partly through mathematical-geological modelling. This analysis, which take into account mining practice and costs, involved reevaluating the uranium resources. The report describes how this was accomplished. It also describes how the uranium classification system used in the CSFR, which is based on the categories A,B,C1,C2,PI and P2, compares to the IAEA system. (author)

Completion of the VVER 440/213 NPP Mochovce incorporation enhanced safety features

International Nuclear Information System (INIS)

Charbonneau, S.; Eckert, G.

1996-01-01

The cooperation between the western countries and the countries of ex-eastern block in the field of nuclear safety is recent and still limited. The main reasons for this situation are limited or non existent capabilities of these countries for financing as well as non acceptable legal conditions concerning the third party nuclear liability in this part of Europe. Nevertheless, Framatome and Siemens associated in the consortium named EUCOM, have signed in April 1996 the contract of about 100 million US dollars with Slovak electricity company (SLOVENSKE ELEKTRARNE-SE) for upgrading the Units 1 and 2 of Mochovce Nuclear Power Plant according to the western safety standards. This is the first important project involving west-european companies in the modernisation of Russian type of pressurized water reactor (VVER 440/213). The consortium will cooperate with other partners involved in the project: Slovak, Czech and Russian. The financing of the project will be provided mainly form Slovak and Czech sources. The safety upgrading will be financed through French and German buyer credits. French company Electricite de France (EDF) will be the consultant for SE. The safety upgrading measures have been elaborated taking into account the recommendation of Vienna International Atomic Energy Agency (IAEA) and the evaluation of the safety realised by RISKAUDIT, the common organization of German and French safety authorities (GSR and IPSN). Hence all guaranties have been taken to fulfil the western safety criteria for Nuclear Power Plant Mochovce. (author)

SCORPIO-VVER core monitoring and surveillance system with advanced capabilities

International Nuclear Information System (INIS)

Molnar, J.; Vocka, R.

2009-01-01

The SCORPIO-VVER system includes following features: 1) Validation of plant measurements and identification of sensor failures. 2) Optimum combination of measurements and calculations to obtain precise values of important parameters. 3) On-line 3D power distribution calculation with pin power reconstruction. 4) Limit checking and thermal margin calculation allowing for surveillance of VVER core limits such as DNBR, Sub-cooling margin, FdH and FQ peeking factors. 5) Integrated modules for monitoring fuel performance and coolant activity for identification of fuel failures. 6) Predictive capabilities and strategy planning, offering the possibility to check the consequences of operational manoeuvres in advance, prediction of critical parameters, etc. 7) Convenient monitoring of approach to criticality during reactor start-up. 8) Automated transition between cycles (fuel reload). The SCORPIO-VVER core monitoring system with its flexible and modular framework successfully responses to the plant operating needs and advances in nuclear fuel cycle strategies and fuel design. Modular framework allows for easy modifications of the system and implementation of new methods in physical modules. Even if the system is installed only on VVER-440 reactors, it could be adapted for VVER-1000 needs

Investigation of circulating temperature fluctuations of the primary coolant in order to develop an enhanced MTC estimator for VVER-440 reactors

Energy Technology Data Exchange (ETDEWEB)

Kiss, Sandor; Lipcsei, Sandor [Hungarian Academy of Sciences, Budapest (Hungary). Centre for Energy Research - MTA

2017-09-15

Our aim was to develop a method based on noise diagnostics for the estimation of the moderator temperature coefficient of reactivity (MTC) for the Paks VVER-440 units in normal operation. The method requires determining core average neutron flux and temperature fluctuations. The circulation period of the primary coolant, transfer properties of the steam generators, as well as the source and the propagation of the temperature perturbations and the proportions of the perturbation components were investigated in order to estimate the feedback caused by the circulation of the primary coolant. Finally, after developing the new MTC estimator, determining its frequency range and optimal parameters, trends were produced based on an overall evaluation of measurements made with standard instrumentation during a one-year-long period at Paks NPP.

Possibility of implementation of 6-year fuel cycle at NPP with VVER-440 reactor

Energy Technology Data Exchange (ETDEWEB)

Heraltova, L., E-mail: lenka.heraltova@fjfi.cvut.cz [UJV Rez a.s., Hlavni 130, 250 68 Husinec-Rez (Czech Republic); Faculty of Nuclear Sciences and Physical Engineering, Czech Technical University in Prague, Brehova 7, 115 19 Praha 1 (Czech Republic)

2015-12-15

Highlights: • Possibility of extension of fuel cycle. • Increase of enrichment above 5% {sup 235}U. • Core properties calculated by diffusion code ANDREA. • Back end fuel cycle characteristic. - Abstract: This paper discusses possibility of an extension of a fuel cycle at a VVER-440 reactor for up to 6 years. The prolongation of a fuel cycle was realized by optimization of a fuel design and increasing of a fuel enrichment. The modified design of the fuel assembly covers change of pellet geometry, decreasing of parasitic absorption in construction materials, improved moderation of fuel pins and also increase of enrichment. Fuel assemblies with enrichment up to 7% {sup 235}U are considered for prolonged fuel batches. Three different batch lengths were considered for evaluation of core properties – 12, 18 and 24 months, and two types of burnable absorbers were included – Gd{sub 2}O{sub 3} and Er{sub 2}O{sub 3}. Comparison of proposed fuel assemblies was realized by length of a batch, average burnup, maximal power of fuel assembly or fuel pin, control fuel assembly worth, reactivity coefficients, and effective delayed neutrons fraction. Comparison of characteristics of a burned fuel discharged from a reactor core is discussed in the last part of the paper.

VVER fuel. Results of post irradiation examination

International Nuclear Information System (INIS)

Smirnov, V.P.; Markov, D.V.; Smirnov, A.V.; Polenok, V.S.; Perepelkin, S.O.; Ivashchenko, A.A.

2005-01-01

The present paper presents the main results of post-irradiation examination of more than 40 different fuel assemblies (FA) operated in the cores of VVER-1000 and VVER-440-type power reactors in a wide range of fuel burnup. The condition of fuel assembly components from the viewpoint of deformation, corrosion resistance and mechanical properties is described here. A serviceability of the FA design as a whole and interaction between individual FA components under vibration condition and mechanical load received primary emphasis. The reasons of FA damage fuel element failure in a wide range of fuel burnup are also analyzed. A possibility and ways of fuel burnup increase have been proved experimentally for the case of high-level serviceability maintenance of fuel elements to provide for advanced fuel cycles. (author)

Innovated feed water distributing system of VVER steam generators

International Nuclear Information System (INIS)

Matal, O.; Sousek, P.; Simo, T.; Lehota, M.; Lipka, J.; Slugen, V.

2000-01-01

Defects in feed water distributing system due to corrosion-erosion effects have been observed at many VVER 440 steam generators (SG). Therefore analysis of defects origin and consequently design development and testing of a new feed water distributing system were performed. System tests in-situ supported by calculations and comparison of measured and calculated data were focused on demonstration of long term reliable operation, definition of water flow and water chemical characteristics at the SG secondary side and their measurements and study of dynamic characteristics needed for the innovated feed water distributing system seismic features approval. The innovated feed water distributing system was installed in the SGs of two VVER units already. (author)

Time versus frequency domain calculation of the main building complex of the VVER 440/213 NPP PAKS

International Nuclear Information System (INIS)

Katona, T.; Ratkai, S.; Halbritter, A.; Krutzik, N.J.; Schuetz, W.

1995-01-01

Various dynamic analyses were conducted for the main building complex of the VVER 440/213 PAKS in order to determine the dynamic response and assess the aseismic capacity of this nuclear power plant. Different types of mathematical models for idealizing the soil and the building structures were used. The main goal of the study presented here was to demonstrate the effects of different procedures for consideration of soil-structure interaction on the dynamic response of the structures mentioned above. The analyses were based on appropriate mathematical models of the coupled vibration structures (reactor building, turbine hall, intermediate building structures) and the layered soil. On the basis of this study, it can be concluded that substructure models using frequency-independent impedances and cut-off of modal damping usually provide conservative results. Complex models which allow the soil-soil and the structure or by frequency-dependent impedances) provide more accurate results. The latter approach results in more efficient designs which are not only safe but also economical. (author). 7 refs., 15 figs

Recent results of three-dimensional CFD simulations of coolant mixing in VVER-440/213 reactor pressure vessel

International Nuclear Information System (INIS)

Kiss, B.; Boros, I.; Aszodi, A.

2008-01-01

The Budapest University of Technology and Economics, Institute of Nuclear Techniques has been working since 2001 on the three-dimensional CFD model of the reactor pressure vessel of the VVER-440 type reactor. During this time period - due to the development of the available computational capacity - a very complex and detailed model of the RPV has been developed. The aim of the construction of the new model is to describe further internal structures of the RPV (e.g. correct modeling of brake tubes, or internals in the upper mixing chamber) and to perform an extensive sensitivity analysis on the different modeling and calculation parameters (e.g. porous region models vs. detailed modeling, or n different turbulence models). The new model can be applied for steady state calculation during normal operational condition and for different transient analyses as well. One interesting application is the participation in a planned benchmark exercise on the start-up of the sixth main coolant pump, which is aimed to compare the capabilities of mixing models of one-dimensional system codes with the results of CFD simulation. (authors)

The experimental definition of the acoustic standing wave series shapes, formed in the coolant of the primary circuit of VVER-440 type reactor

International Nuclear Information System (INIS)

Bulavin, V.V.; Pavelko, V.I.

1995-01-01

On the basis of pressure fluctuation measurements in some primary circuit loops at 2 nd Unit of Kola NPP with VVER-440 type reactors, the shapes of acoustic standing waves (ASW) were determined at frequencies corresponding to four minimal oscillation eigenfrequencies in the primary circuit coolant. On identification of the ASW modes and properties, experimental results based on six circulating loops in symmetric arrangement allowed determination of the three-dimensional space structure of the wave nodes and antinodes inside and outside of the reactor vessel (RV). As part of this analysis, the geometric features of the primary circuit that caused the formation of these standing waves were identified. Differences in each ASW shape were shown to cause different individual effects on the neutron field in the reactor core and on fuel assembly vibration. This has been partially confirmed by ex-core neutron ionization chamber noise analysis. One type of ASW, possessing an antinode inside the RV, can be used for measurement of the pressure coefficient of reactivity. However, this must be done with care to avoid the potential for incorrect results in some cases. The results presented in this paper can be readily extended to other VVER type reactors with both odd and even number of loops. (author)

Control of selected VVER components life time SKODA JS a.s. experience

International Nuclear Information System (INIS)

Zdebor, J.; Pribulla, E.

2005-01-01

Experience from the operation of nuclear power plants with type VVER reactors has shown that the life time management of a number of nuclear reactor components is technically as well as with respect to safety substantiated even at the time which exceeds their originally designed life time. To accept such solution it was necessary to develop and implement a number of programs based on which it was possible to evaluate the actual condition of monitored equipment. It is a condition allowing to adopt solution concerning the possibility of their further operation. Experience from the manufacture of 21 sets of reactor equipment for VVER 440 and 3 sets VVER 1000 has been gathered in SKODA JS a.s. which have been completed by experience from service activities performed at operated nuclear power plants. Analyses of manufacturing data and in-service inspection results completed by a lot of laboratory tests have become the basis for the development of selected VVER components life time management programs. The paper focuses on the life time management of those VVER components which SKODA JS a.s. has most experience with. (authors)

Application of the coupled code system KIKO3D/ATHLET to the boron dilution transients in VVER-440 Type NPP

International Nuclear Information System (INIS)

Hegyi, G.; Kereszturi, A.; Trosztel, I.

2003-01-01

The transient caused by a perturbation of boron concentration and coolant temperature at the inlet of a Russian developed reactor (VVER-440) is reanalysed as a part of the modernisation (introduction of a new type profiled fuel) and power upgrading (up to 108 %) project. This task is one of the basis cases to be investigated in the safety analysis of the pressurized water reactor (PWR) and the criteria of Anticipated Operational Occurrences (AOO) have to be fulfilled for it. First detailed planning calculations were performed with the thermal hydraulic system code ATHLET and neutron physical code system KARATE-440 to find out the appropriate initial parameter set taking into account the active safety system of the NPP. Finally the most reactive case is analysed by the KIKO3D/ATHLET coupled system code. Whereas the investigation is done for safety analysis, conservative assumptions are imposed on reactivity characteristics. Moreover at the core inlet no-mixing is supposed from the unaffected loops. The presented calculations show, how the coupled code system with a detailed description of plant functions and core behaviour can help to understand better the local phenomena in the study of a potential risk of dilution accident, as it offers the possibility to evaluate the plant safety in a more realistic and versatile manner. (author)

The System of Higher Education in CSFR

OpenAIRE

Kopp, Botho von

1991-01-01

By dividing his article in two chapters ("1. From the founding of Charles University to the modern higher education system" and "2. The higher education system 1948-1989") the author gives an historical overview over the sytem of higher education in CSFR, whereas he covers the following aspects in the second chapter: "Basic data on higher education", "Organization and structure of the course of studies" and "Developments after 1989 and future trends". (DIPF/ ssch.)

CFD evaluation of hydrogen risk mitigation measures in a VVER-440/213 containment

Energy Technology Data Exchange (ETDEWEB)

Heitsch, Matthias, E-mail: Matthias.Heitsch@ec.europa.e [Institute for Energy, Joint Research Centre, PO Box 2, 1755 ZG Petten (Netherlands); Huhtanen, Risto [VTT Technical Research Centre of Finland, PO Box 1000, FI-02044 VTT (Finland); Techy, Zsolt [VEIKI Institute for Electric Power Research Co., PO Box 80, H-1251 Budapest (Hungary); Fry, Chris [Serco, Winfrith Technology Centre, Dorchester, Dorset DT2 8DH (United Kingdom); Kostka, Pal [VEIKI Institute for Electric Power Research Co., PO Box 80, H-1251 Budapest (Hungary); Niemi, Jarto [VTT Technical Research Centre of Finland, PO Box 1000, FI-02044 VTT (Finland); Schramm, Berthold [Gesellschaft fuer Anlagen- und Reaktorsicherheit, GRS mbH, Schwertnergasse 1, 50667 Koeln (Germany)

2010-02-15

In the PHARE project 'Hydrogen Management for the VVER440/213' (HU2002/000-632-04-01), CFD (Computational Fluid Dynamics) calculations using GASFLOW, FLUENT and CFX were performed for the Paks NPP (Nuclear Power Plant), modelling a defined severe accident scenario which involves the release of hydrogen. The purpose of this work is to demonstrate that CFD codes can be used to model gas movement inside a containment during a severe accident. With growing experience in performing such analyses, the results encourage the use of CFD in assessing the risk of losing containment integrity as a result of hydrogen deflagrations. As an effective mitigation measure in such a situation, the implementation of catalytic recombiners is planned in the Paks NPP. In order to support these plans both unmitigated and recombiner-mitigated simulations were performed. These are described and selected results are compared. The codes CFX and FLUENT needed refinement to their models of wall and bulk steam condensation in order to be able to fully simulate the severe accident under consideration. Several CFD codes were used in parallel to model the same accident scenario in order to reduce uncertainties in the results. Previously it was considered impractical to use CFD codes to simulate a full containment subject to a severe accident extending over many hours. This was because of the expected prohibitive computing times and missing physical capabilities of the codes. This work demonstrates that, because of developments in the capabilities of CFD codes and improvements in computer power, these calculations have now become feasible.

Analysis of noncondensable effect during small break transient in VVER-440 geometry with CATHARE V1.3L. Preliminary results

International Nuclear Information System (INIS)

Sarrette, C.

1996-11-01

The report presents a study of the transport and dissolution-release of non-condensable gas into the fluid of the primary loop for the VVER-440 geometry. The analysis has been done using a new model developed for the CATHARE thermal hydraulic code. Results are presented, obtained from calculations of small break loss-of-coolant (SBLOCA) accidents for the Loviisa nuclear power plant (NPP) geometry. The influence of nitrogen dissolved in the water of the accumulators of the emergency core coolant system (ECCS) on natural circulation is discussed. Possibilities of formation of nitrogen bubbles in the main vessels upper plenum, top of the downcomer, steam generators collectors, and upper structures of RCP's are investigated. First results show that there is potentiality for interruption, mainly due to the presence of nitrogen in the top of the downcomer and the upper parts of the RCP's. These preliminary results should be confirmed by carrying out calculations now prematurely stopped for numerical reasons. (8 refs.)

Results of 15 years experiments in the PMK-2 integral-type facility for VVERs

Energy Technology Data Exchange (ETDEWEB)

Szabados, L.; Ezsoel, G.; Perneczky, L. [KFKI Atomic Energy Research Institute, Budapest (Hungary)

2001-07-01

Due to the specific features of the VVER-440/213-type reactors the transient behaviour of such a reactor system is different from the usual PWR system behaviour. To provide an experimental database for the transient behaviour of VVER systems the PMK integral-type facility, the scaled down model of the Paks NPP was designed and constructed in the early 1980's. Since the start-up of the facility 48 experiments have been performed. It was confirmed through the experiments that the facility is a suitable tool for the computer code validation experiments and to the identification of basic thermal-hydraulic phenomena occurring during plant accidents. High international interest was shown by the four Standard Problem Exercises of the IAEA and by the projects financed by the EU-PHARE. A wide range of small- and medium-size LOCA sequences have been studied to know the performance and effectiveness of ECC systems and to evaluate the thermal-hydraulic safety of the core. Extensive studies have been performed to investigate the one- and two-phase natural circulation, the effect of disturbances coming from the secondary circuit and to validate the effectiveness of accident management measures like bleed and feed. The VVER-specific case, the opening of the SG collector cover was also extensively investigated. Examples given in the report show a few results of experiments and the results of calculation analyses performed for validation purposes of codes like RELAP5, ATHLET and CATHARE. There are some other white spots in Cross Reference Matrices for VVER reactors and, therefore, further experiments are planned to perform tests primarily in further support of accident management measures at low power states of plants to facilitate the improved safety management of VVER-440-type reactors. (authors)

Results of 15 years experiments in the PMK-2 integral-type facility for VVERs

International Nuclear Information System (INIS)

Szabados, L.; Ezsoel, G.; Perneczky, L.

2001-01-01

Due to the specific features of the VVER-440/213-type reactors the transient behaviour of such a reactor system is different from the usual PWR system behaviour. To provide an experimental database for the transient behaviour of VVER systems the PMK integral-type facility, the scaled down model of the Paks NPP was designed and constructed in the early 1980's. Since the start-up of the facility 48 experiments have been performed. It was confirmed through the experiments that the facility is a suitable tool for the computer code validation experiments and to the identification of basic thermal-hydraulic phenomena occurring during plant accidents. High international interest was shown by the four Standard Problem Exercises of the IAEA and by the projects financed by the EU-PHARE. A wide range of small- and medium-size LOCA sequences have been studied to know the performance and effectiveness of ECC systems and to evaluate the thermal-hydraulic safety of the core. Extensive studies have been performed to investigate the one- and two-phase natural circulation, the effect of disturbances coming from the secondary circuit and to validate the effectiveness of accident management measures like bleed and feed. The VVER-specific case, the opening of the SG collector cover was also extensively investigated. Examples given in the report show a few results of experiments and the results of calculation analyses performed for validation purposes of codes like RELAP5, ATHLET and CATHARE. There are some other white spots in Cross Reference Matrices for VVER reactors and, therefore, further experiments are planned to perform tests primarily in further support of accident management measures at low power states of plants to facilitate the improved safety management of VVER-440-type reactors. (authors)

Pressure loadings of Soviet-designed VVER [Water-Cooled, Water-Moderated Energy Reactor] reactor release mitigation structures from large-break LOCAs

International Nuclear Information System (INIS)

Sienicki, J.J.; Horak, W.C.

1989-01-01

Analyses have been carried out of the pressurization of the accident release mitigation structures of Soviet-designed VVER (Water-Cooled, Water-Moderated Energy Reactor) pressurized water reactors following large-break loss-of-coolant accidents. Specific VVER systems for which calculations were performed are the VVER-440 model V230, VVER-440 model V213, and VVER-1000 model V320. Descriptions of the designs of these and other VVER models are contained in the report DOE/NE-0084. The principal objective of the current analyses is to calculate the time dependent pressure loadings inside the accident localization or containment structures immediately following the double-ended guillotine rupture of a primary coolant pipe. In addition, the pressures are compared with the results of calculations of the response of the structures to overpressure. Primary coolant system thermal hydraulic conditions and the fluid conditions at the break location were calculated with the RETRAN-02 Mod2 computer code (Agee, 1984). Pressures and temperatures inside the building accident release mitigation structures were obtained from the PACER (Pressurization Accompanying Coolant Escape from Ruptures) multicompartment containment analysis code developed at Argonne National Laboratory. The analyses were carried out using best estimate models and conditions rather than conservative, bounding-type assumptions. In particular, condensation upon structure and equipment was calculated using correlations based upon analyses of the HDR, Marviken, and Battelle Frankfurt containment loading experiments. The intercompartment flow rates incorporate an effective discharge coefficient and liquid droplet carryover fraction given by expressions of Schwan determined from analyses of the Battelle Frankfurt and Marviken tests. 5 refs., 4 figs

Main results on pilot operation during 5 years of the 3rd generation fuel in VVER-440 reactors of Kola NPP

International Nuclear Information System (INIS)

Saprykin, V.; Sumarokov, M.; Gagarinskiy, A.; Sumarokova, A.; Adeev, V.

2015-01-01

In the report the results of comparison of main neutron-physical data of exploitation of nuclear fuel are presented for the average enrichment (on U - 235) of 4.87 for the 2nd and 3rd (12 piece) generations with the results of calculations by the complex of the programs KASKAD for 5 fuel loadings of Kola NPP Unit 4 with the reactor VVER- 440. The basic feature of fuel of the 3rd generation as compared with the 2nd is a presence of ribs of inflexibility at corners instead of cover of the fuel assembly and also the increased amount of uranium. The arrangement of fuel rods with different enrichment in fuel assemblies of the 2nd and 3rd generations is chosen identical for the convenient comparison of neutronic and thermohydraulic characteristics of the fuel of different generations. The fuel of 3rd generation was situated in the core symmetrically to the fuel of 2nd one

The corrosion and corrosion mechanical properties evaluation for the LBB concept in VVERs

Energy Technology Data Exchange (ETDEWEB)

Ruscak, M.; Chvatal, P.; Karnik, D.

1997-04-01

One of the conditions required for Leak Before Break application is the verification that the influence of corrosion environment on the material of the component can be neglected. Both the general corrosion and/or the initiation and, growth of corrosion-mechanical cracks must not cause the degradation. The primary piping in the VVER nuclear power plant is made from austenitic steels (VVER 440) and low alloy steels protected with the austenitic cladding (VVER 1000). Inspection of the base metal and heterogeneous weldments from the VVER 440 showed that the crack growth rates are below 10 m/s if a low oxygen level is kept in the primary environment. No intergranular cracking was observed in low and high oxygen water after any type of testing, with constant or periodic loading. In the framework of the LBB assessment of the VVER 1000, the corrosion and corrosion mechanical properties were also evaluated. The corrosion and corrosion mechanical testing was oriented predominantly to three types of tests: stress corrosion cracking tests corrosion fatigue tests evaluation of the resistance against corrosion damage. In this paper, the methods used for these tests are described and the materials are compared from the point of view of response on static and periodic mechanical stress on the low alloyed steel 10GN2WA and weld metal exposed in the primary circuit environment. The slow strain rate tests and static loading of both C-rings and CT specimens were performed in order to assess the stress corrosion cracking characteristics. Cyclic loading of CT specimens was done to evaluate the kinetics of the crack growth under periodical loading. Results are shown to illustrate the approaches used. The data obtained were evaluated also from the point of view of comparison of the influence of different structure on the stress corrosion cracking appearance. The results obtained for the base metal and weld metal of the piping are presented here.

The most extensive reconstruction of nuclear power plant with VVER 440/V230 reactor

International Nuclear Information System (INIS)

Ferenc, M.

2000-01-01

The nuclear power plant V-1 Bohunice consists of two VVER-440 units with V-230 reactors. Unit 1 was commissioned in 1978 and Unit 2 in 1980. Large experience and knowledge from the operation of previous units with V-230 reactors were incorporated into the V-1 design, which resulted in a higher level of safety and operational reliability of these units. The Siemens company which won an international bidding process developed these basic goals for the Gradual Upgrading into the so called Basic Engineering (BE). For the implementation of the Gradual Upgrading in line with the BE, Rekon consortium was established consisting of Siemens and VUJE. The implementation of the Gradual Upgrading is scheduled for the time period of 1996 - 2000. Siemens was responsible for the upgrading strategy - based on the approved results of the basic engineering phase and the PSAR, the engineering and realization of all I and C improvements, and also for the seismic upgrade. VUJE's responsibility covered the detailed engineering and implementation of mechanical, electrical and civil part of upgrading measures as well as overall organisation and evaluation of verification tests. The consortium awarded contracts for final planning and design, installation services and commissioning to other Slovakian subcontractors in order to ensure the largest possible local content. The gradual reconstruction of the V-1 Bohunice with V230 reactors represents a comprehensive reconstruction of safety-related systems and equipment. Following its completion, the units will be operated with a safety level accepted internationally. (author)

Start-up of a cold loop in a VVER-440, the 7th AER benchmark calculation with HEXTRAN-SMABRE-PORFLO

International Nuclear Information System (INIS)

Hovi, Ville; Taivassalo, Veikko; Haemaelaeinen, Anitta; Raety, Hanna; Syrjaelahti, Elina

2017-01-01

The 7 th dynamic AER benchmark is the first in which three-dimensional thermal hydraulics codes are supposed to be applied. The aim is to get a more precise core inlet temperature profile than the sector temperatures available typically with system codes. The benchmark consists of a start-up of the sixth, isolated loop in a VVER-440 plant. The isolated loop initially contains cold water without boric acid and the start-up leads to a somewhat asymmetrical core power increase due to feedbacks in the core. In this study, the 7 th AER benchmark is calculated with the three-dimensional nodal reactor dynamics code HEXTRAN-SMABRE coupled with the porous computational fluid dynamics code PORFLO. These three codes are developed at VTT. A novel two-way coupled simulation of the 7 th AER benchmark was performed successfully demonstrating the feasibility and advantages of the new reactor analysis framework. The modelling issues for this benchmark are reported and some evaluation against the previously reported comparisons between the system codes is provided.

Assessment of the recovery annealing efficiency for VVER-1000 materials' structure reset and lifetime extension

International Nuclear Information System (INIS)

Gurovich, B.; Kuleshova, E.; Prikhodko, K.; Fedotova, S.

2011-01-01

The results of the VVER-1000 reactor pressure vessels welds studies based on the surveillance specimens sets have revealed a high embrittlement rate of steel with high nickel content compared with predicted embrittlement determined from the Russian Guide. For these critical vessels further safe operation (even during design service life) is not allowed without additional measures (recovery annealing of the VVER-1000 welds as earlier for VVER- 440). The reason is that the rate of high nickel VVER-1000 welds embrittlement is significantly higher than that is for base metal. In order to solve a problem of VVER-1000 lifetime extension recovery annealing validation and accelerated reirradiation of specimens for prolonged operation period estimation after annealing were necessary. In this work comparison of electron-microscopy fine structure studies and fractographic studies of Charpy specimens fracture surface of the VVER-1000 high nickel welds in different states were carried out. It allows estimation of the recovery annealing effect on steels structure and its behavior at further operation. It is shown that both secondary and primary irradiation causes alike radiation-induced fine structure changes: dislocation loops and nano-size precipitates. Recovery annealing leads to full dislocation loops dissolution and significant nano-size precipitates solution but not to the initial values. The rate of radiation defects and radiation-induced precipitates accumulation at reirradiation weld after recovery annealing is lower than at primary irradiation and determine the lower secondary embrittlement rate of VVER-1000 weld. (authors)

Inspection qualification programme for VVER reactors and review of round robin test results

International Nuclear Information System (INIS)

Horacek, L.; Zdarek, J.

1998-01-01

Experience obtained, especially from in-service inspections of VVER 440-type reactor pressure vessels and from the Czech round test trials with international participation of ultrasonic teams, has highlighted the need for an in-service inspection qualification programme in the Czech Republic focused on NDT procedures, equipment and personnel. Recently, several national and international regional projects included in the PHARE programme (projects 4.1.2/93 and 1.02/94), briefly described, have been initiated. These projects are to cover step by step the programme of the in-service inspection qualification in view of technical justification as well as of practical assessment-performance demonstration-for all the main VVER-type primary circuit components. (orig.)

Evaluation of an experiment modelling heat transfer from the melt pool for use in VVER 440/213 reactors

International Nuclear Information System (INIS)

Skop, J.

2003-12-01

The strategy of confining core melt within the reactor vessel is among promising strategies to mitigate severe accidents of VVER 440/213 reactors. This strategy consists in residual heat removal from the melt by external vessel cooling from the outside, using water from the flooded reactor downcomer. This approach can only be successful if the critical heat flux on the external vessel surface is not exceeded. This can be assessed based on the parameters of heat transfer from the core melt pool in the conditions of natural circulation within the pool. Those parameters are the subject of the report. A basic description of the terms and physical basis of the strategy of confining core melt inside the vessel is given in Chapter 2, which also briefly explains similarity theory, based on which the results obtained on experimental facilities, using simulation materials, can be related to the actual situation inside a real reactor. Chapter 3 presents an overview of experimental work addressing the characteristics of heat transfer from the core melt pool in natural circulation conditions and a description of the experimental facilities. An overview of the results emerging from the experiments and their evaluation with respect to their applicability to reactors in Czech nuclear power plants are given in Chapter 4

Results of VVER fuel rods tests in the MIR.M1 reactor under power cycling conditions

International Nuclear Information System (INIS)

Burukin, A.; Izhutov, A.; Ovchinnikov, V.; Kalygin, V.; Markov, D.; Pimenov, Y.; Novikov, V.; Medvedev, A.; Nesterov, B.

2011-01-01

The paper presents the main results of the 50 ... 60 MWd/kgU burnup VVER fuel rods tests performed in the MIR.M1 reactor loop facilities under power cycling. The non-destructive PIE results are presented as well. A series of experiments was performed, including overall measurement of fuel rod parameters test, in one of which 300 cycles were done. Irradiation under power cycling conditions and PIE of high-burnup VVER fuel rods showed the following: 1) all fuel rods claddings preserved their integrity under irradiation at linear heat rate (LHR) higher than the NPP operating one; 2) experimental data were obtained on the axial and radial cladding strain and fission gas release (FGR) from 50 ... 60 MWd/kgU burnup VVER-440 and VVER-1000 fuel rods as well as on the kinetics of the change in these parameters and fuel temperature under the power cycling; 3) non-destructive PIE results are in a satisfactory correlation with the data obtained by means of in-pile measurement gages during irradiation. (authors)

Start-up of a cold loop in a VVER-440, the 7{sup th} AER benchmark calculation with HEXTRAN-SMABRE-PORFLO

Energy Technology Data Exchange (ETDEWEB)

Hovi, Ville; Taivassalo, Veikko; Haemaelaeinen, Anitta; Raety, Hanna; Syrjaelahti, Elina [VTT Technical Research Centre of Finland Ltd, VTT (Finland)

2017-09-15

The 7{sup th} dynamic AER benchmark is the first in which three-dimensional thermal hydraulics codes are supposed to be applied. The aim is to get a more precise core inlet temperature profile than the sector temperatures available typically with system codes. The benchmark consists of a start-up of the sixth, isolated loop in a VVER-440 plant. The isolated loop initially contains cold water without boric acid and the start-up leads to a somewhat asymmetrical core power increase due to feedbacks in the core. In this study, the 7{sup th} AER benchmark is calculated with the three-dimensional nodal reactor dynamics code HEXTRAN-SMABRE coupled with the porous computational fluid dynamics code PORFLO. These three codes are developed at VTT. A novel two-way coupled simulation of the 7{sup th} AER benchmark was performed successfully demonstrating the feasibility and advantages of the new reactor analysis framework. The modelling issues for this benchmark are reported and some evaluation against the previously reported comparisons between the system codes is provided.

Highly Expressed Granulocyte Colony-Stimulating Factor (G-CSF) and Granulocyte Colony-Stimulating Factor Receptor (G-CSFR) in Human Gastric Cancer Leads to Poor Survival.

Science.gov (United States)

Fan, Zhisong; Li, Yong; Zhao, Qun; Fan, Liqiao; Tan, Bibo; Zuo, Jing; Hua, Kelei; Ji, Qiang

2018-03-23

BACKGROUND Chemotherapy for advanced gastric cancer (GC) patients has been the mainstay of therapy for many years. Although adding anti-angiogenic drugs to chemotherapy improves patient survival slightly, identifying anti-angiogenic therapy-sensitive patients remains challenging for oncologists. Granulocyte colony-stimulating factor (G-CSF) promotes tumor growth and angiogenesis, which can be minimized with the anti-G-CSF antibody. Thus, G-CSF might be a potential tumor marker. However, the effects of G-CSF and G-CSFR expression on GC patient survival remain unclear. MATERIAL AND METHODS Seventy GC tissue samples were collected for G-CSF and G-CSFR detection by immunohistochemistry. A total of 40 paired GC tissues and matched adjacent mucosa were used to measure the G-CSF and G-CSFR levels by ELISA. Correlations between G-CSF/G-CSFR and clinical characteristics, VEGF-A levels and overall survival were analyzed. Biological function and underlying mechanistic investigations were carried out using SGC7901 cell lines, and the effects of G-CSF on tumor proliferation, migration, and tube formation were examined. RESULTS The levels of G-CSFR were upregulated in GC tissues compared to normal mucosa tissues. Higher G-CSF expression was associated with later tumor stages and higher tumor VEGF-A and serum CA724 levels, whereas higher G-CSFR expression was associated with lymph node metastasis. Patients with higher G-CSF expression had shorter overall survival times. In vitro, G-CSF stimulated SGC7901 proliferation and migration through the JAK2/STAT3 pathway and accelerated HUVEC tube formation. CONCLUSIONS These data suggest that increased G-CSF and G-CSFR in tumors leads to unfavorable outcomes for GC patients by stimulating tumor proliferation, migration, and angiogenesis, indicating that these factors are potential tumor targets for cancer treatment.

Implementation of New Reactivity Measurement System and New Reactor Noise Analysis Equipment in a VVER-440 Nuclear Power Plant

Science.gov (United States)

Vegh, János; Kiss, Sándor; Lipcsei, Sándor; Horvath, Csaba; Pos, István; Kiss, Gábor

2010-10-01

The paper deals with two recently developed, high-precision nuclear measurement systems installed at the VVER-440 units of the Hungarian Paks NPP. Both developments were motivated by the reactor power increase to 108%, and by the planned plant service time extension. The first part describes the RMR start-up reactivity measurement system with advanced services. High-precision picoampere meters were installed at each reactor unit and measured ionization chamber current signals are handled by a portable computer providing data acquisition and online reactivity calculation service. Detailed offline evaluation and analysis of reactor start-up measurements can be performed on the portable unit, too. The second part of the paper describes a new reactor noise diagnostics system using state-of-the-art data acquisition hardware and signal processing methods. Details of the new reactor noise measurement evaluation software are also outlined. Noise diagnostics at Paks NPP is a standard tool for core anomaly detection and for long-term noise trend monitoring. Regular application of these systems is illustrated by real plant data, e.g., results of standard reactivity measurements during a reactor startup session are given. Noise applications are also illustrated by real plant measurements; results of core anomaly detection are presented.

Evaluation of containment peak pressure and structural response for a large-break loss-of-coolant accident in a VVER-440/213 NPP

Energy Technology Data Exchange (ETDEWEB)

Spencer, B.W.; Sienicki, J.J.; Kulak, R.F.; Pfeiffer, P.A. [Argonne National Lab., IL (United States); Voeroess, L.; Techy, Z. [VEIKI Inst. for Electric Power Research, Budapest (Hungary); Katona, T. [Paks Nuclear Power Plant (Hungary)

1998-07-01

A collaborative effort between US and Hungarian specialists was undertaken to investigate the response of a VVER-440/213-type NPP to a maximum design-basis accident, defined as a guillotine rupture with double-ended flow from the largest pipe (500 mm) in the reactor coolant system. Analyses were performed to evaluate the magnitude of the peak containment pressure and temperature for this event; additional analyses were performed to evaluate the ultimate strength capability of the containment. Separate cases were evaluated assuming 100% effectiveness of the bubbler-condenser pressure suppression system as well as zero effectiveness. The pipe break energy release conditions were evaluated from three sources: (1) FSAR release rate based on Soviet safety calculations, (2) RETRAN-03 analysis and (3) ATHLET analysis. The findings indicated that for 100% bubbler-condenser effectiveness the peak containment pressures were less than the containment design pressure of 0.25 MPa. For the BDBA case of zero effectiveness of the bubbler-condenser system, the peak pressures were less than the calculated containment failure pressure of 0.40 MPa absolute.

Greifswald and Rheinsberg: East European VVERs with a new mission

International Nuclear Information System (INIS)

Sterner, H.; Leushacke, D.; Rittscher, D.

1995-01-01

Plans for the decommissioning of the VVER reactors at Greifswald and Rheinsberg in the former German Democratic Republic are described. The decision to decommission the eight VVER-440s (two of which are still under construction) at Greifswald and the Russian prototype PWR, VVER-2, at Rheinsberg, was taken because of a lack of public acceptance and financial considerations. Three main phases are scheduled for the project. The first, the post-operation phase, has already commenced at both sites. It involves: the operation of all systems needed safely to store fuel elements, to remove them and to condition operational waste; dismantling of mainly inactive, systems not needed for fuel handling; and system decontamination. The second phase comprises the dismantling of contaminated systems, remote dismantling and conditioning of the dismantled material. Finally, in the site restoration phase, following the dismantling of remaining systems and building decontamination and demolition, the site will be adapted for other uses. Three projects for new site use at Greifswald being pursued. As a first step, an international Technology Centre is to be created to collect and evaluate information on decommissioning experience. The centre will require international financial support and co-ordination. New facilities are already being constructed to deal with decontamination of dismantled materials and the interim storage of radioactive waste and reactor fuel. (UK)

CFD investigations of natural circulation between the RPV and the cooling pond of VVER-440 type reactors in incidental conditions during maintenance performed with the code CFX-4.3

International Nuclear Information System (INIS)

Legradi, G.; Aszodi, A.

2002-01-01

During the annual maintenance of the VVER-440 type reactors, the RPV, the cooling pond and the transfer pond form a connected flow domain. The reactor is cooled by the natural circulation, which develops in one or two main loops. The cooling pond has its own cooling loops. CFD calculations have been performed with the CFX-4.3 code to investigate whether it is possible to cool the reactor core in case the main loops are lost and other emergency systems are not available. The results point out that the cooling system of the cooling pond is not capable of cooling the reactor core with the present connection. Therefore, modifications of the cooling system are investigated which would make it suitable for removing the remanent heat from the core.(author)

Plasma, a plant safety monitoring and assessment system for VVER-440 reactors

Energy Technology Data Exchange (ETDEWEB)

Hornaes, A.; Hulsund, J. E. [Institutt for energiteknikk (IFE), OECD Halden Reactor Project, Halden (Norway); Lipcsei, S.; Major, Cs.; Racz, A.; Vegh, J. [KFKI, Atomic Energy Research Institute, Budapest (Hungary); Eiler, J. [Paks, Nuclear Power Plant Ltd, Paks (Hungary)

1999-05-15

The objective with the Plant Safety Monitoring and Assessment System (PLASMA) is to develop an operator support system to support the execution of new symptom-based Emergency Operating Procedures for application in VVER reactors, with the Paks NPP in Hungary as the target plant. Many of the VVER reactors are rewriting their EOPs to comply more with Western standards of symptom-based EOPs. In this connection it is desirable to improve the data validation, information integration and presentation for operators when executing the EOPs. The entry-point to a symptom-oriented procedure is defined by the occurrence of a well-defined reactor operation status, with all its symptoms. However, the application of the EOF benefits from an operator support system, which performs plant status and symptom identification reliably and accurately. The development of the PLASMA system is a joint venture between Institutt for energiteknikk (IFE) and KFKI with the NPP Paks as the target plant. The project has been initiated and partly funded by the Science and Technology Agency (STA), Japan through the OECD NEA assistance program. In Hungary, considerable effort has concentrated on the safety reassessment of the Paks NPP and new EOPs are being written, but no comprehensive Operator Support System (OSS) for plant safety assessment is installed. Some safety parameter display functions are incorporated into diverse operator support systems, but an online 'plant safety monitoring and assessment system' is still missing. The present project comprises designing, constructing, testing and installing such an OSS, which to a great extent could support plant operators in their safety assessment work (author) (ml)

On detection of the possible use of VVERs for unreported production of plutonium. Final report for the period July 1988 - December 1989

International Nuclear Information System (INIS)

Simov, R.; Nelov, N.; Stoyanova, I.; Kovachev, N.; Yonchev, P.

1989-01-01

The study includes an analysis of the feasibility of unreported production of plutonium-239 in VVER-440 reactors. It is shown that for VVER-440 reactors 36 natural uranium oxide fuel assemblies in the peripheral region of the core need to be loaded to produce 8 kg of extra plutonium in one cycle. Substituting the peripheral fuel assemblies with natural uranium oxide fuel assemblies, the changes in the power peaking are negligible and do not affect reactor safety. Unreported production outside the core is not practical due to physical and mechanical constraints, low flux level, etc. The feasibility of unreported removal of irradiated material in spent fuel cask has been also assessed. After about a month cooling time, still within the refueling period, the irradiated natural uranium fuel assemblies could be removed off-site without significant health hazard to the workers. To improve the effectiveness of the safeguards objectives, additional inspection activities are suggested. 10 figs

Front against the Temelin nuclear power station

International Nuclear Information System (INIS)

Anon.

1990-01-01

Though the main concern of the author is the Czechoslovakian Temelin power station, the main target of his attacks are the Austrian proponents of nuclear energy i.e. the Reactor Safty Commission and the Austrian Chancellor. The newly opened possibility of anti-nuclear propaganda in the CSFR, by Greenpeace and the author's organisation is welcomed. The number of signatures collected against Temelin is given as 350.000. 815 signatures come from Japan: a facsimile of some Japanese signatures is presented

Regulatory use the classification security systems of I and C in VVER type reactors

International Nuclear Information System (INIS)

Ilizastegui Perez, F.

1998-01-01

Presently work the author proposes a classification to the system I and C to the VVER 440 type reactor in categories the regulatory control with a view to establishing the degree to the attention that the regulator should pay to these systems, leaving the importance that have the same ones for the security the installation, during the execution the works that are carried out with this equipment in the stages construction, setting in service and exploitation

Pituitary dwarfism in Saarloos and Czechoslovakian wolfdogs is associated with a mutation in LHX3

NARCIS (Netherlands)

Voorbij, AMWY; Leegwater, Peter; Kooistra, Hans

2014-01-01

Background Pituitary dwarfism in German Shepherd Dogs is associated with autosomal recessive inheritance and a mutation in LHX3, resulting in combined pituitary hormone deficiency. Congenital dwarfism also is encountered in breeds related to German Shepherd Dogs, such as Saarloos and Czechoslovakian

The in-core fuel management code system for VVER reactors

International Nuclear Information System (INIS)

Cada, R.; Krysl, V.; Mikolas, P.; Sustek, J.; Svarny, J.

2004-01-01

The structure and methodology of a fuel management system for NPP VVER 1000 (NPP Temelin) and VVER 440 (NPP Dukovany) is described. It is under development in SKODA JS a.s. and is followed by practical applications. The general objectives of the system are maximization of end of cycle reactivity, the minimization of fresh fuel inventory for the minimization of fed enrichment and minimization of burnable poisons (BPs) inventory. They are also safety related constraints in witch minimization of power peaking plays a dominant role. General structure of the system consists in preparation of input data for macrocode calculation, algorithms (codes) for optimization of fuel loading, calculation of fuel enrichment and BPs assignment. At present core loading can be calculated (optimized) by Tabu search algorithm (code ATHENA), genetic algorithm (code Gen1) and hybrid algorithm - simplex procedure with application of Tabu search algorithm on binary shuffling (code OPAL B ). Enrichment search is realized by the application of simplex algorithm (OPAL B code) and BPs assignment by module BPASS and simplex algorithm in OPAL B code. Calculations of the real core loadings are presented and a comparison of different optimization methods is provided. (author)

The Plinius/Colima CA-U3 test on fission-product aerosol release over a VVER-type corium pool

International Nuclear Information System (INIS)

Journeau, Ch.; Piluso, P.; Correggio, P.; Godin-Jacqmin, L.

2007-01-01

In a hypothetical case of severe accident in a PWR type VVER-440, a complex corium pool could be formed and fission products could be released. In order to study aerosols release in terms of mechanisms, kinetics, nature or quantity, and to better precise the source term of VVER-440, a series of experiments have been performed in the Colima facility and the test Colima CA-U3 has been successfully performed thanks to technological modifications to melt a prototypical corium at 2760 C degrees. Specific instrumentation has allowed us to follow the evolution of the corium melt and the release, transport and deposition of the fission products. The main conclusions are: -) there is a large release of Cr, Te, Sr, Pr and Rh (>95%w), -) there is a significant release of Fe (50%w), -) there is a small release of Ba, Ce, La, Nb, Nd and Y (<90%w), -) there is a very small release of U in proportion (<5%w) but it is one of the major released species in mass, and -) there is no release of Zr. The Colima experimental results are consistent with previous experiments on irradiated fuels except for Ba, Fe and U releases. (A.C.)

Advanced designs of VVER reactor plant

International Nuclear Information System (INIS)

Mokhov, V.A.

2010-01-01

The history of VVER reactors, current challenges and approaches to the challenges are highlighted. The VVER-1200 reactor of 3+ generation for AES-2006 units are under construction at the Leningrad 2 nuclear power plant (LNPP-2). The main parameters are listed and details are presented of the vessel, steam generator, and improved fuel. The issue of the NPP safety is discussed. Additional topics include the MIR-1200 reactor unit, VVER-600, and VVER-SCP (Generation 4). (P.A.)

The review of the reactor physics experiments carried out on the LR-0 research reactor NRI Rez plc for reactors of the VVER type

International Nuclear Information System (INIS)

Hudec, Frantisek; Jansky, Bohumil; Juricek, Vlastimil; Mikus, Jan; Novak, Evzen; Osmera, Bohumil; Posta, Severin; Rypar, Vojtech; Svadlenkova, Marie

2010-01-01

LR-0 is an experimental zero power reactor mainly used for the determination of the neutron-physical characteristics of WWER and PWR type reactor lattices and shielding with UO2 or MOX fuel. Its major assets include capability to design and operate multizone cores, i.e. substituted cores, with an inner inserted part in hexagonal or square geometry (driven by LR-0 standard assemblies); Standard and special supporting plates for mock-up experiments; special supporting plates, which enables the triangular symmetrical assembly arrangement with an arbitrary pitch; Modeling neutron field parameters of power reactors; Wide range benchmarking possibilities, with high reproducibility of the benchmark design parameters; Wide range of measurement techniques including equipment and experienced personal; Flexible rearrangements of the core. The main experiments included: Pin wise flux distribution measurements; VVER-440 and VVER-1000 mock-ups; compact spent fuel storage; space kinetics experiment; core parameters experimental determination; experiment with new design fuel assembly; WWER-440 control assembly influence; and burnable absorber study. International research projects are also described. (P.A.)

The Plinius/Colima CA-U3 test on fission-product aerosol release over a VVER-type corium pool; L'essai Plinius/Colima CA-U3 sur le relachement des aerosols de produits de fission au-dessus d'un bain de corium de type VVER

Energy Technology Data Exchange (ETDEWEB)

Journeau, Ch.; Piluso, P.; Correggio, P.; Godin-Jacqmin, L

2007-07-01

In a hypothetical case of severe accident in a PWR type VVER-440, a complex corium pool could be formed and fission products could be released. In order to study aerosols release in terms of mechanisms, kinetics, nature or quantity, and to better precise the source term of VVER-440, a series of experiments have been performed in the Colima facility and the test Colima CA-U3 has been successfully performed thanks to technological modifications to melt a prototypical corium at 2760 C degrees. Specific instrumentation has allowed us to follow the evolution of the corium melt and the release, transport and deposition of the fission products. The main conclusions are: -) there is a large release of Cr, Te, Sr, Pr and Rh (>95%w), -) there is a significant release of Fe (50%w), -) there is a small release of Ba, Ce, La, Nb, Nd and Y (<90%w), -) there is a very small release of U in proportion (<5%w) but it is one of the major released species in mass, and -) there is no release of Zr. The Colima experimental results are consistent with previous experiments on irradiated fuels except for Ba, Fe and U releases. (A.C.)

Enhancement of Training Capabilities in VVER Technology Through Establishment of VVER Training Academy

International Nuclear Information System (INIS)

Ilieva, M.; Miteva, R.

2015-01-01

Education and training (E&T) have always been key factor to the sustainability of the nuclear industry. With regard to E&T it is still the challenge to raise the interest of qualified young people of studies and professions related to nuclear technologies. CORONA Project is established to provide a special purpose structure for training and for gathering the existing and generating new knowledge in the VVER area as well as to contribute to transnational mobility and lifelong learning amongst VVER operating countries. CORONA Project consists of two parts: CORONA I (2011–2014) “Establishment of a regional centre of competence for VVER technology and Nuclear Applications”, co-financed by the EC Framework Programme 7 and CORONA II “Enhancement of training capabilities in VVER technology through establishment of VVER training academy”, co-financed by the EURATOM 2014-2015 Working programme of HORIZON 2020. The project is focused on development of training schemes for VVER nuclear professionals, subcontractors, students and for non-nuclear specialists working in support of nuclear applications as civil engineers, physical protection employees, government employees, secondary school teachers, journalists. Safety culture and soft skills training are incorporated as an integral part of all training schemes because they require continuous consideration. It is vital for the acceptance of nuclear energy by the public and for the safe performance of the nuclear installations. CORONA II project is to proceed with the development of state-of-the-art virtual training centre — CORONA Academy. This objective will be realised through networking between universities, research organizations, regulatory bodies, industry and any other organizations involved in the application of nuclear science, ionising radiation and nuclear safety. It will bring together the most experienced trainers and will allow trainees from different locations to access the needed knowledge on demand

Implementation of safety parameter display system at VVER-440 NPPs

International Nuclear Information System (INIS)

Manninen, T.

1997-01-01

Furnishing WWER-440 nuclear power plant units with a safety parameter display system (SPDS) fulfilling the requirements of internationally recognized standards and guidelines has been ranked high on the lists of proposed safety improvement projects. Technically such an SPDS system can be implemented either as a separate stand-alone system or as a more or less closely integrated part of a process information system of the plant unit. In the paper examples of these approaches are presented. Functionally all these examples include the well proven SPDS concept developed by IVO Power Engineering Ltd, Finland. The functional design basis, the general requirements for the system platform, experience with implementation and expansion possibilities of the systems are discussed. (author)

Validation of Advanced Computer Codes for VVER Technology: LB-LOCA Transient in PSB-VVER Facility

Directory of Open Access Journals (Sweden)

A. Del Nevo

2012-01-01

Full Text Available The OECD/NEA PSB-VVER project provided unique and useful experimental data for code validation from PSB-VVER test facility. This facility represents the scaled-down layout of the Russian-designed pressurized water reactor, namely, VVER-1000. Five experiments were executed, dealing with loss of coolant scenarios (small, intermediate, and large break loss of coolant accidents, a primary-to-secondary leak, and a parametric study (natural circulation test aimed at characterizing the VVER system at reduced mass inventory conditions. The comparative analysis, presented in the paper, regards the large break loss of coolant accident experiment. Four participants from three different institutions were involved in the benchmark and applied their own models and set up for four different thermal-hydraulic system codes. The benchmark demonstrated the performances of such codes in predicting phenomena relevant for safety on the basis of fixed criteria.

Upper plenum break LOCA investigation in the ISB-VVER and PSB-VVER facilities

Energy Technology Data Exchange (ETDEWEB)

Blinkov, V. N.; Melikhov, O. I.; Lipatov, I. A.; Nikonov, S. M.; Dremin, G. I.; Galchanskaya, S. A.; Gashenko, M. P.; Rovnov, A. A.; Kapustin, A. V.; Elkin, I. V. [EREC, Moscow (Russian Federation)

2003-07-01

The capability to define the actual NPP transient/accident scenario depends to a great extent on facilities' scaling and reliability of the system thermalhydraulic codes which, in turn, are assessed against the experimental data taken in the same facilities. At the present time, it is received fact that the rigorous modeling of the cumulative set of all thermalhydraulic processes in the plant primary and secondary sides during accident is unfeasible. Therefore, the extrapolation of the facilities loops behavior to the actual systems constitutes a fundamental problem in this area. In the paper, some aspects for the problem have been discussed in the course of comparative analysis of the data derived from the 11 % upper plenum break LOCA tests performed in the PSB-VVER and ISB-VVER integral test facilities under the close scenarios. Both facilities, PSB-VVER and ISB-VVER, are modeled the same VVER-1000 reactor in different scales. The thermalhydraulic behavior of the primary systems in both facilities has been discussed in the paper, and shown to be similar. Also, the attention has been focused upon the discrepancies in the significant variables trends. The discrepancies are shown to be caused by influence of peculiarities of the facilities hardware and due to the scale factor. The scaling study is an important aspect of the thermalhydraulic codes verification procedure. Being qualified against the experimentally simulated accident sequence in two test facilities of different scales, the thermalhydraulic codes will be capable of evaluation of the prototype behavior to greater accuracy.

Validation of coupled neutronic / thermal-hydraulic codes for VVER reactors. Final report

Energy Technology Data Exchange (ETDEWEB)

Mittag, S.; Grundmann, U.; Kliem, S.; Kozmenkov, Y.; Rindelhardt, U.; Rohde, U.; Weiss, F.-P.; Langenbuch, S.; Krzykacz-Hausmann, B.; Schmidt, K.-D.; Vanttola, T.; Haemaelaeinen, A.; Kaloinen, E.; Kereszturi, A.; Hegyi, G.; Panka, I.; Hadek, J.; Strmensky, C.; Darilek, P.; Petkov, P.; Stefanova, S.; Kuchin, A.; Khalimonchuk, V.; Hlbocky, P.; Sico, D.; Danilin, S.; Ionov, V.; Nikonov, S.; Powney, D.

2004-08-01

In recent years, the simulation methods for the safety analysis of nuclear power plants have been continuously improved to perform realistic calculations. Therefore in VALCO work package 2 (WP 2), the usual application of coupled neutron-kinetic / thermal-hydraulic codes to VVER has been supplemented by systematic uncertainty and sensitivity analyses. A comprehensive uncertainty analysis has been carried out. The GRS uncertainty and sensitivity method based on the statistical code package SUSA was applied to the two transients studied earlier in SRR-1/95: A load drop of one turbo-generator in Loviisa-1 (VVER-440), and a switch-off of one feed water pump in Balakovo-4 (VVER-1000). The main steps of these analyses and the results obtained by applying different coupled code systems (SMABRE - HEXTRAN, ATHLET - DYN3D, ATHLET - KIKO3D, ATHLET - BIPR-8) are described in this report. The application of this method is only based on variations of input parameter values. No internal code adjustments are needed. An essential result of the analysis using the GRS SUSA methodology is the identification of the input parameters, such as the secondary-circuit pressure, the control-assembly position (as a function of time), and the control-assembly efficiency, that most sensitively affect safety-relevant output parameters, like reactor power, coolant heat-up, and primary pressure. Uncertainty bands for these output parameters have been derived. The variation of potentially uncertain input parameter values as a consequence of uncertain knowledge can activate system actions causing quite different transient evolutions. This gives indications about possible plant conditions that might be reached from the initiating event assuming only small disturbances. In this way, the uncertainty and sensitivity analysis reveals the spectrum of possible transient evolutions. Deviations of SRR-1/95 coupled code calculations from measurements also led to the objective to separate neutron kinetics from

CORONA project -contribution to VVER nuclear education and training

International Nuclear Information System (INIS)

Ilieva, M.; Miteva, R.; Takov, T.

2016-01-01

CORONA Project is established to stimulate the transnational mobility and lifelong learning amongst VVER end users. The project aims to provide a special purpose structure for training of specialists and to maintain the nuclear expertise by gathering the existing and generating new knowledge in the VVER area. CORONA Project consists of two parts: CORONA I (2011-2014) ''Establishment of a regional center of competence for VVER technology and Nuclear Applications'', co-financed by the Framework Program 7 of the European Union (EU) and CORONA II (2015-2018) ''Enhancement of training capabilities in VVER technology through establishment of VVER training academy'', co-financed by HORIZON 2020, EURATOM 2014-2015. The selected form of the CORONA Academy, together with the online availability of the training opportunities will allow trainees from different locations to access the needed knowledge on demand. The project will target also new-comers in VVER community like Vietnam, Turkey, Belarus, etc. (authors)

Overview of VVER water chemistry

International Nuclear Information System (INIS)

Ganesh, S.; Selvaraj, S.; Balasubramanian, M.R.; Selvavinayagam, P.; Sundar, R.S.

2007-01-01

Kudankulam Nuclear Power project is having twin units of 1000MWe of VVER type. This paper highlights the different analytical techniques that are followed to maintain the system chemistry within the technical specifications. This paper also briefs the different chemicals that are added to the systems and how they are monitored. Basic differences with respect to chemistry between a PHWR and VVER are also highlighted in this paper. (author)

Core design experience of WWER-440 reactors when they working on increased power level

International Nuclear Information System (INIS)

Adeev, V.; Panov, A.; Melenchuk, I.

2015-01-01

The Kola NPP continues commercial operation of 2nd generation fuel (FA-2) and trial operation of 3rd generation fuel (FA-3), which has a number of design features providing the best operational characteristics. This report gives the results of VVER-440 core operation with FA-2 and FA-3 with enrichment increased up to 4.87%, and at the power level uprated to 107% of nominal power level. Brief analysis of obtained data is carried out. Peculiarities and techniques of developing loading patterns with new types of nuclear fuel for operation at the uprated power level are reviewed. (authors)

Informational system to assist decision making at spent nuclear fuel transportation from VVER-440, VVER-1000 and RBMK-1000 nuclear power plants

International Nuclear Information System (INIS)

Kuryndin, A.V.; Kirkin, A.M.; Stroganov, A.A.

2012-01-01

The developed informational system provides an automated estimations of nuclear and radiation safety parameters during spent nuclear fuel transportation from WWER-440 and WWER-1000 and RBMK-1000 nuclear power plants to the nuclear fuel cycle facilities, and allows us to determine the optimum cask loading from the dose rates distribution outside of protection point of view [ru

Information about AER WG A on improvement, extension and validation of parametrized few-group libraries for VVER 440 and VVER 1000

International Nuclear Information System (INIS)

Mikolas, P.

2010-01-01

Joint AER Working Group A on 'Improvement, extension and validation of parameterized few-group libraries for WWER-440 and WWER-1000' and AER Working Group B on 'Core design' nineteenth meeting was hosted by VUJE a. s. in Modra - Harmonia (Slovakia) during the period of 20. to 22. April 2010. There were present altogether 12 participants from 8 member organizations and 9 papers were presented (8 of them in written form). Objectives of the meeting of WG A are: Issues connected with spectral calculations and few-groups libraries preparation, their accuracy and validation. Presentations were devoted to some aspects of transport and diffusion calculations and to the benchmark dealing with WWER-1000 core periphery power tilt. Tamas Parko (co-authors Istvan Pos and Sandor Patai Szabo) described in his presentation 'Application of Discontinuity factors in C-PORCA 7 code', Radoslav Zajac (co-authors Petr Darilek and Vladimir Necas) spoke about 'Fast Reactor Nodalisation in HELIOS Code', Gabriel Farkas presented 'Calculation of Spatial Weighting Functions of Ex-Core Neutron Detectors for WWER-440 Using Monte Carlo Approach' and Daniel Sprinzl (co-authors Vaclav Krysl, Pavel Mikolas and Jiri Svarny) provided a definition of a benchmark in ' 'MIDICORE' WWER-1000 core periphery power tilt benchmark proposal'. (Author)

Component vibration of VVER-reactors - diagnostics and modelling

International Nuclear Information System (INIS)

Altstadt, E.; Scheffler, M.; Weiss, F.-P.

1995-01-01

Flow induced vibrations of reactor pressure vessel (RPV) internals (control element and core barrel motions) at VVER-440 reactors have led to the development of dedicated methods for on-line monitoring. These methods need a certain developed stage of the faults to be detected. To achieve a real sensitive early detection of mechanical faults of RPV internals, a theoretical vibration model was developed based on finite elements. The model comprises the whole primary circuit including the steam generators (SG). By means of that model all eigenfrequencies up to 30 Hz and the corresponding mode shapes were calculated for the normal vibration behaviour. Moreover the shift of eigenfrequencies and of amplitudes due to the degradation or to the failure of internal clamping and spring elements could be investigated, showing that a recognition of such degradations even inside the RPV is possible by pure excore vibration measurements. A true diagnostic, that is the identification of the failed component, might become possible because different faults influence different and well separated eigenfrequencies. (author)

Estimation of material degradation of VVER-1000 baffle

Science.gov (United States)

Harutyunyan, Davit; Koš'ál, Michal; Vandlík, Stanislav; Hojná, Anna; Schulc, Martin; Flibor, Stanislav

2017-09-01

The planned lifetime of the first commercial VVER-1000 units were designed for 30 to 35 years. Most of the early VVER plants are now reaching and/or passing the 35-year mark. Service life extension for another 10 to 30 years is now under investigation. Life extension requires the evaluation of pressure vessel internals degradation under long-term irradiation. One of the possible limiting factors for the service life of VVERs is a void swelling of the Russian type titanium stabilized stainless 08Ch18N10T steel used to construct the baffle surrounding the core. This article aims to show first steps towards deeper analysis of the baffle degradation process and to demonstrate the possibilities of precise calculation and measurements on the VVER-1000 mock-up in LR-0 reactor.

Compact simulators for WWER-440 type nuclear power plants

International Nuclear Information System (INIS)

Vegh, E.; Janosy, J.S.

1991-09-01

This paper describes a compact simulator for VVER-440 type plants. Up till now three simulators have been delivered: to Paks Nuclear Power Plant (Hungary), and to Kola and Rovno NPPs (Soviet Union). In this compact simulator the modelling complexity of the plant is almost similar to that of a full-scope one apart from the Control Room being replaced by a Control Desk and four colour graphic display units. The simulation of the plant covers the whole operating range: from cold shut-down state to nominal power level. The simulator contains up to 32 different initial conditions. Moreover, every 5 minutes the simulator produces so called 'snapshots', i.e. disc images of the Data Base. Using these snapshots the instructor can go back in time (called backtracking) in order to repeat some previously passed events

Measures for ensuring hydrogen fire and explosion safety for VVER-440/230

International Nuclear Information System (INIS)

Bezlepkin, V.; Semashko, S.; Svetlov, S.; Sidorov, V.; Ivkov, I.; Krylov, Yu.; Kukhtevich, V.

2004-01-01

This paper deals with the findings of calculation analysis as regards the release of mass, energy and hydrogen during beyond-design-basis accident (BDBA) at Kola NPP equipped with VVER-440 reactor (B-230 design) and in respect of distribution of hydrogen throughout NPP tight compartments. The analysis figures out the number and locations of passive catalytic hydrogen recombiners and of the sensors of the hydrogen concentration monitoring system. In order to prove the hydrogen safety of the design, it has been necessary to review accidents accompanied by maximum emissions (both peak and integral ones) of hydrogen into the tight area. During design-basis accident (DBA), no steam/zirconium reactions occur in the reactor core. Out of BDBA, the severe accidents with damage to the core accompanied oxidative reactions between zirconium and steel with emission of hydrogen are regarded as the most dangerous ones. Assessment of additional hydrogen sources shows that the contribution of such sources to the total amount of hydrogen that may emit during a severe accident is insignificant. Calculations have been made for the following scenarios of severe accidents, which seem to be the most important in terms of hydrogen safety analysis: - 20 mm leak from the primary circuit in combination with a failure of the emergency makeup system; - 500 mm PCP rupture in the vicinity of reactor inlet branch with bi-lateral leakage of coolant. Releases of mass and energy during the aforesaid scenarios, changes of medium parameters within the tight compartments and analysis of possible fire conditions have been analyzed by means of Russian computer codes RATEG/SVECHA/HEFEST, KUPOL-M and LIMITS. The said analysis shows that the large break accident (500 mm), i.e. PCP rupture in the vicinity of the reactor branch with bi-lateral leakage of coolant is of the keen interest in terms of hydrogen safety. This accident typifies powerful short-term release of hydrogen at a significantly lesser

Uncertainty and sensitivity analysis applied to coupled code calculations for a VVER plant transient

International Nuclear Information System (INIS)

Langenbuch, S.; Krzykacz-Hausmann, B.; Schmidt, K. D.

2004-01-01

The development of coupled codes, combining thermal-hydraulic system codes and 3D neutron kinetics, is an important step to perform best-estimate plant transient calculations. It is generally agreed that the application of best-estimate methods should be supplemented by an uncertainty and sensitivity analysis to quantify the uncertainty of the results. The paper presents results from the application of the GRS uncertainty and sensitivity method for a VVER-440 plant transient, which was already studied earlier for the validation of coupled codes. For this application, the main steps of the uncertainty method are described. Typical results of the method applied to the analysis of the plant transient by several working groups using different coupled codes are presented and discussed The results demonstrate the capability of an uncertainty and sensitivity analysis. (authors)

SCORPIO - VVER core surveillance system

International Nuclear Information System (INIS)

Hornaes, A.; Bodal, T.; Sunde, S.

1998-01-01

The Institutt for energiteknikk has developed the core surveillance system SCORPIO, which has two parallel modes of operation: the Core Follow Mode and the Predictive Mode. The main motivation behind the development of SCORPIO is to make a practical tool for reactor operators, which can increase the quality and quantity of information presented on core status and dynamic behavior. This can first of all improve plant safety, as undesired core conditions are detected and prevented. Secondly, more flexible and efficient plant operation is made possible. The system has been implemented on western PWRs, but the basic concept is applicable to a wide range of reactors including VVERs. The main differences between VVERs and typical western PWRs with respect to core surveillance requirements are outlined. The development of a VVER version of SCORPIO has been done in co-operation with the Nuclear Research Institute Rez, and industry partners in the Czech Republic. The first system is installed at Dukovany NPP, where the Site Acceptance Test was completed 6. March 1998.(author)

The integration of fast reactor to the fuel cycle in Slovakia

International Nuclear Information System (INIS)

Zajac, R.; Darilek, P.; Necas, V.

2009-01-01

A very topical problem of nuclear power is the fuel cycle back-end. One of the options is a LWR spent fuel reprocessing and a fissile nuclides re-use in the fast reactor. A large amount of spent fuel has been stored in the power plant intermediate storage during the operation of VVER-440 reactors in Slovakia. This paper is based on an analysis of Pu and minor actinides content in actual VVER-440 spent fuel stored in Slovakia. The next part presents the possibilities of reprocessing and Pu re-use in fast reactor under Slovak conditions. The fuel cycle consisting of the VVER-440 reactor, PUREX reprocessing plant and a sodium fast reactor was designed. The last section compares two parts of this fuel cycle: one is UOX cycle in VVER-440 reactor and the other is cycle in the fast reactor - SUPER PHENIX loaded with MOX fuel (Pu + Minor Actinides). The starting point is a single recycling of Pu from VVER-440 in the FR. The next step is multirecycling of Pu in the FR to obtain equilibrium cycle. This article is dealing with the solution of power production and fuel cycle indicators. All kinds of calculations were performed by computer code HELIOS 1.10. (authors)

In core-fuel management in approach to equilibrium of WWER-440 reactor; Prelazni rezim iskoriscenja goriva u nuklearnom reaktoru tipa VVER-440

Energy Technology Data Exchange (ETDEWEB)

Marinkovic, N [Boris Kidric Institute of nuclear sciences, Vinca, Belgrade (Yugoslavia)

1978-07-01

For the need of in core fuel management and prediction of fuel cycle costs as well as operating of a nuclear power plant behaviour of main physical parameters and refueling scheme during approach to equilibrium operation are indispensable. An estimation of a refueling scheme during forst six years of exploitation for a commercially proven PWR reactor of WWER-440 type is shown in this paper. (author)

Rolls-Royce successful modernization of safety-critical Instrumentation and Control (I and C) equipment at the Dukovany VVER 440/213 Nuclear Power Plant, based on SPINLINE 3 platform

International Nuclear Information System (INIS)

Rebreyend, P.; Burel, J.P.; Spoc, J.; Karasek, A.

2010-01-01

Rolls-Royce has provided on-time delivery of a substantial safety-critical I and C overhaul for four Nuclear reactors operated by Czech Republic utility, CEZ a.s. This nine-year project is considered to be one of the largest I and C modernization projects in the world. The Dukovany VVER 440 I and C modernization project and its key success factors are profiled in this paper. The project is in the final stages with the last unit to be completed in 2009. Beginning in September 2000, the project is in compliance with the initial schedule. Rolls-Royce has been designing and manufacturing I and C solutions dedicated to the implementation of safety and safety-related functions in nuclear power plants (NPPs) for more than 30 years. Though the early solutions were non-software-based, since 1984 software-based solutions for safety I and C functions have been deployed in operating NPPs across France and 15 other countries. The Rolls-Royce platform is suitable for implementation of safety I and C functions in new NPPs, as well as in the modernization of safety equipment in existing plants. CEZ a.s. is a major electricity supplier for the national grid. At Dukovany, CEZ a.s. operates four units of VVER-440/213-type reactors producing one quarter of CEZ a.s. electricity production. The first of these units was connected to the grid in 1985. Since the year 2000, the nine-year modernization program has been underway at Dukovany, at a cost of more than 200 million Euros. The equipment replacement was implemented during regular, planned outages of the original equipment and systems. After an international bidding phase, CEZ a.s. awarded a contract to Skoda JS for general engineering and project management. Individual subcontracts were then signed between Skoda JS and a consortium between Rolls-Royce and Areva for modernization of the safety systems, including the Reactor Protection System (RPS), the Reactor Control System (RCS), and the Post-Accident Monitoring System (PAMS). Two

Improvement of MSLB transient analysis for VVER by the coupled code system KIKO3D/ATHLET

International Nuclear Information System (INIS)

Hegyi, Gy.; Kereszturi, A.; Trosztel, I.

2001-01-01

An overview is given on the investigations of the Main Steam Line Break transient in a VVER- 440 NPP by using the KIKO3D/ATHLET 1.2.A coupled code system. Special attention was paid for the influence of modeling the outcore detector signals and the malfunctioning of the emergency control system (scram with stuck rod). The conservatism of the calculations was assured even in the case of application of the 3D best estimate KIKO3D code. The consequence of MSLB accident is investigated at the end of cycle (EOC), at full power (FP) and shut down initial conditions. Even if very strong conservative assumptions were applied, dangerous hot spots were not found in the supposed scenarios.(author)

Innovative instrumentation for VVERs based in non-invasive techniques

International Nuclear Information System (INIS)

Jeanneau, H.; Favennec, J.M.; Tournu, E.; Germain, J.L.

2000-01-01

Nuclear power plants such as VVERs can greatly benefit from innovative instrumentation to improve plant safety and efficiency. In recent years innovative instrumentation has been developed for PWRs with the aim of providing additional measurements of physical parameters on the primary and secondary circuits: the addition of new instrumentation is made possible by using non-invasive techniques such as ultrasonics and radiation detection. These innovations can be adapted for upgrading VVERs presently in operation and also in future VVERs. The following innovative instrumentation for the control, monitoring or testing at VVERs is described: 1. instrumentation for more accurate primary side direct measurements (for a better monitoring of the primary circuit); 2. instrumentation to monitor radioactivity leaks (for a safer plant); 3. instrumentation-related systems to improve the plant efficiency (for a cheaper kWh)

Stress corrosion cracking (Standard Astm G 30-90) in stainless steel 08X18H10T of swimming-pool that contain nuclear fuel in reactors V.V.E.R.-440

International Nuclear Information System (INIS)

Zamora R, L.; Herrera, V.

1998-01-01

The standard recommended practice for making and using 'U' bend stress corrosion test specimens; Designation G30-90 has been used as a laboratory tool to study the susceptibility of austenitic stainless steels and the other materials of test of intergranular stress corrosion cracking (IGSCC). The experiment has been development in a similar conditions of the chemical regime, the swimming-pool that containing nuclear fuel in borated water reactors VVER-440 in general this cladding by two films, one of carbon steel (04T26) and other with austenitic stainless steel 08X18HT (similar type 321) stabilized with titanium, the thickness of filler metals was to 4 to 8 mm. The specimens was prepare one plate with this characteristics, the welding was put in the part central with the following measurements of 160x15x5 mm. The specimens strips bent approximately 180 degrees around radius of curvature of R=14.5 mm and ε 1 = 17.2% and maintained in this plastically deformed condition during the test. And then preparing metallographically and exposure in environment of 12 and 40 gr./l of H 3 BO 3 70 Centigrade with or noting contaminants of NaCl. The results showed the initial cracks. (Author)

PSB-VVER counterpart experiment simulating a small cold leg break LOCA

International Nuclear Information System (INIS)

Blinkov, V.N.; Melikhov, O.I.; Kapustin, A.V.; Lipatov, I.A.; Dremin, G.I.; Nikonov, S.M.; Rovnov, A.A.; Elkin, I.V.; Pylev, S.S.

2005-01-01

Full text of publication follows: An experiment simulating a small break LOCA has been performed in PSB-VVER facility, under PSB-VVER OECD Project. The test is intended to be a counterpart one to an experiment performed in the LOBI integral test facility. The objectives of the PSB-VVER small cold leg break test are: to study VVER-1000 thermal hydraulic response following a small break in the cold leg, to provide data for code assessment regarding phenomena indicated in the VVER-1000 code validation matrix and to study the scaling effect. The scenario for the PSB-VVER experiment has been designed taking the LOBI BL-34 test as reference. The ratio of primary system volumes (without volume of the pressurizer and the surge line) has been chosen to scale the reference experiment conditions and to generate the conditions of PSB-VVER cold leg break experiment. The resulting conditions are compared with the LOBI cold leg break test conditions by means of different counterpart test criteria. Comparing the two experiments in terms of the criteria shows that basic requirements to the counterpart test are fulfilled. A pretest analysis with RELAP5/MOD3.2 code has shown that the PSBVVER small break experiment is expected to show the same relevant phenomena and main events as the LOBI BL-34 test. The predicted PSB-VVER primary pressure is very close to that measured in the LOBI facility. The measured pressure in the PSB-VVER primary system has turned out to be very close to that registered in LOBI BL-34 test. This verifies the approach used for developing the conditions of the PSB-VVER counterpart test. The experiment results and the RELAP5/MOD3.2 pretest calculation are in good agreement. A posttest calculation of the experiment with RELAP5/MOD3.2 code has been performed in order to assess the codes capability to simulate the phenomena relevant to the test. The code has shown a reasonable prediction of the phenomena measured in the experiment. (authors)

PSB-VVER counterpart experiment simulating a small cold leg break LOCA

Energy Technology Data Exchange (ETDEWEB)

Blinkov, V.N.; Melikhov, O.I.; Kapustin, A.V.; Lipatov, I.A.; Dremin, G.I.; Nikonov, S.M.; Rovnov, A.A. [Elektrogorsk Research and Engineering Center, EREC, Bezymiannaja Street, 6, Elektrogorsk, Moscow Region, 142530 (Russian Federation); Elkin, I.V.; Pylev, S.S. [NSI RRC ' Kurchatov Institute' , Kurchatov Sq., 1, Moscow, 123182 (Russian Federation)

2005-07-01

Full text of publication follows: An experiment simulating a small break LOCA has been performed in PSB-VVER facility, under PSB-VVER OECD Project. The test is intended to be a counterpart one to an experiment performed in the LOBI integral test facility. The objectives of the PSB-VVER small cold leg break test are: to study VVER-1000 thermal hydraulic response following a small break in the cold leg, to provide data for code assessment regarding phenomena indicated in the VVER-1000 code validation matrix and to study the scaling effect. The scenario for the PSB-VVER experiment has been designed taking the LOBI BL-34 test as reference. The ratio of primary system volumes (without volume of the pressurizer and the surge line) has been chosen to scale the reference experiment conditions and to generate the conditions of PSB-VVER cold leg break experiment. The resulting conditions are compared with the LOBI cold leg break test conditions by means of different counterpart test criteria. Comparing the two experiments in terms of the criteria shows that basic requirements to the counterpart test are fulfilled. A pretest analysis with RELAP5/MOD3.2 code has shown that the PSBVVER small break experiment is expected to show the same relevant phenomena and main events as the LOBI BL-34 test. The predicted PSB-VVER primary pressure is very close to that measured in the LOBI facility. The measured pressure in the PSB-VVER primary system has turned out to be very close to that registered in LOBI BL-34 test. This verifies the approach used for developing the conditions of the PSB-VVER counterpart test. The experiment results and the RELAP5/MOD3.2 pretest calculation are in good agreement. A posttest calculation of the experiment with RELAP5/MOD3.2 code has been performed in order to assess the codes capability to simulate the phenomena relevant to the test. The code has shown a reasonable prediction of the phenomena measured in the experiment. (authors)

An experimental investigation of 1% SBLOCA on PSB-VVER test facility

Energy Technology Data Exchange (ETDEWEB)

Lipatov, I.A.; Dremin, G.I.; Galtchanskaia, S.A.; Gorbunov, Yu.S. [Electrogorsk Research and Engineering Center, EREC, Electrogorsk (Russian Federation); Elkin, I.V. [Russian Research Centre Kurchatov Inst., Moscow (Russian Federation)

2001-07-01

The paper presents the results of the three tests carried out in the PSB-VVER large-scale integral test facility. The PSB-VVER test facility is a four loop, full pressure scaled down model bearing structural similarities to the primary system of the NRP with VVER-1000 Russian design reactor. Volume-power scale is 1/300 while elevation scale is 1/1. (orig.)

A study of different cases of VVER reactor core flooding in a large break loss of coolant accident

International Nuclear Information System (INIS)

Bezrukov, Y.A.; Schekoldin, V.I.; Zaitsev, S.I.; Churkin, A.N.; Lisenkov, E.A.

2016-01-01

The paper covers a brief review of reflooding studies performed in different countries and the relevant tests performed in OKB GIDROPRESS (Russia) are discussed in more detail. The OKB GIDROPRESS test facility simulates the primary circuit of the VVER-440 reactor, with a full-scale fuel assembly (FA) mockup as the core simulator. The VVER core reflooding was studied in a FA mockup containing 126 fuel rod simulators with axial power peaking. The experiments were performed for two types of flooding. The first type is top flooding of the empty (steamed) FA mockup. The second type is bottom flooding of the FA mockup with level of boiling water. The test parameters are as follows: the range of the supplied power to the bundle is from 40 to 320 kW, the cooling water flow rate is from 0.04 to 1.1 kg/s, the maximum temperature of the fuel rod simulator is 800 C. degrees and the linear heat flux is from 0.1 to 1.0 kW/m. The test results were used for computer code validation, especially for the TRAP package code. The experiments show that as the transverse dimension of the FA mockup increases, the flow choking of the water supplied from the top by the steam flow significantly decreases

A 25% double-ended LOCA in the PSB-VVER facility

International Nuclear Information System (INIS)

Blinkov, V.N.; Lipatov, I.A.; Dremin, G.I.

2003-01-01

The paper presents the results of the experimental investigation in the PSB-VVER facility and post-test analysis with RELAP5/MOD3.3 of the thermal-hydraulic response of the PSB-VVER to a 25% double-ended Hot Leg Break (HLB). The test scenario included loss of off-site power concurrently with the scram-signal and the safety system operation as described in the reference VVER-1000 operational manual in the case of this type of accident assuming one diesel-generator failure. The key transient parameter trends as well as sequence of events and phenomena are given in the paper. RELAP5/MOD3.3 a post-test analysis has been performed using the experimental data gained as a base. The reasonable qualitative agreement between the key calculated and measured variables has been shown. The quantitative code accuracy evaluation has shown that the total average amplitude of the main parameters' deviations AA tot tot < 0.28 that corresponds to satisfactory quality of the VVER-1000 hot leg guillotine break LOCA modeling in the PSB-VVER. (author)

Innovation of blow-down system in steam generators of a VVER 440 unit

International Nuclear Information System (INIS)

Matal, O.; Simo, T.; Mancev, M.D.

1997-01-01

The impurities getting into the steam generator with the feedwater are continually removed by the blowdown and unit sludge system. The mostly non-symmetrical type of pipe branches under steam generators at WWER-440 units causes nonuniform blowdown flow rates at the halves of the steam generator; this often leads to a blocking of the pipe with the lower flow rate. The most simple way of hydraulically equalizing the blowdown pipes is to implement symmetric blowdown pipes and to install efficient throttling elements in the pipe. The proposed innovation will make it possible to re-distribute the blowdown flow rates and to reduce more effectively the concentrations of impurities in steam generators. (M.D.)

Fuel designs for VVER reactors

International Nuclear Information System (INIS)

Simonov, K.V.; Carbon, P.; Silberstein, A.

1995-01-01

That progresses in efficiency and safety through progresses in technology and better prediction with fully benchmarked upgraded computer codes is a common goal for on the one hand the original designer of the VVER reactors and their respective fuels and on the other hand for EVF a western company resulting from a combined force with highly diversified and complementary talents in reactor and fuel design and manufacturing. It can be expected that this new challenge and dialogue between the two Russian and European industrial ventures will be mutually beneficial and yield innovative and high quality products and as a consequence strong return will be produced for the best interest of utilities operating VVER reactors. (orig./HP)

Corrosion products behaviour under VVER primary coolant conditions

International Nuclear Information System (INIS)

Grygar, T.; Zmitko, M.

2002-01-01

The aim of this work was to collect data on thermodynamic stability of Cr, Fe, and Ni oxides, mechanisms of hydrothermal corrosion of stainless steels and to compare the real observation with the theory. We found that the electrochemical potential and pH in PWR and VVER are close to the thermodynamic boundary between two fields of stable spinel type oxides. The ways of degradation of the passivating layers due to changes in water chemistry were considered and PWR and VVER systems were found to be potentially endangered by reductive attack. In certain VVER systems the characteristics of the passivating layer on steels and also concentration of soluble corrosion products seem to be in contradiction with the theoretical expectations. (author)

Detailed modeling of KALININ-3 NPP VVER-1000 reactor pressure vessel by the coupled system code ATHLET/BIPR-VVER

International Nuclear Information System (INIS)

Nikonov, S.P.; Velkov, K.; Pautz, A.

2011-01-01

The paper gives an overview of the recent developments of a new reactor pressure vessel (RPV) model of VVER-1000 for the coupled system code ATHLET/BIPR-VVER. Based on the previous experience a methodology is worked out for modeling the RPV in a pseudo-3D way with the help of a multiple parallel thermal-hydraulic channel scheme that follows the hexagonal fuel assembly structure from the bottom to the top of the reactor. The results of the first application of the new modeling are discussed on the base of the OECD/NEA coupled code benchmark for Kalinin-3 NPP transient. Coolant mass flow distributions in reactor volume of VVER 1000 reactor are presented and discussed. It is shown that along the core height a mass flow re-distribution of the coolant takes place starting approximately at an axial layer located 1 meter below the core outlet. (author)

Application of the SCANAIR code for VVER RIA conditions - Boron dilution accident

International Nuclear Information System (INIS)

Arffman, A.; Cazalis, B.

2010-01-01

This paper consists of two parts. In part A, RIA pulse tests conducted at the Russian BIGR reactor are being analysed at IRSN with SCANAIR V6 fuel performance code as a part of the code validation for VVER fuel. Recently a new version of the SCANAIR code was made available to VTT Technical Research Centre of Finland, and part B of the paper covers the introduction of the code version at VTT by a calculation of a hypothetical boron dilution accident in a VVER-440 power reactor. Concerning part A, it appears that the SCANAIR V6 version, including a BIGR/NSRR heat transfer model, validated by Japanese NSRR experiments, and a Norton viscoplastic clad mechanical behaviour, is able to simulate the rod thermal behaviour in BIGR tests. Concerning the clad mechanics, it has been seen that a pellet swelling model is able to simulate the average rod deformation. Nonetheless, the current clad creep model associated with the free volume equilibrium assumption is not suited to predict the maximum clad deformation and the possible post DNB rod failure because they do not simulate local balloons. Furthermore, it has been shown that the clad deformation is strongly dependent on transient gas transfer. Concerning part B, a boron dilution accident previously calculated with SCANAIR V2 was recalculated with SCANAIR V6. A limited amount of result parameters were compared with the results of VTT's neutronics code TRAB. Divergence problems encountered previously when reaching the DNB limit were not present anymore. Fuel and cladding temperatures produced by SCANAIR were in good agreement with those calculated with TRAB

Refurbishing the reactor protection systems of VVER-440/230 and VVER-1000/320 nuclear power plants with exclusively digital IandC systems

International Nuclear Information System (INIS)

Martin, M.

1997-01-01

The refurbishment of reactor protection systems of nuclear power plants is based on two sets of requirements: engineering aspects such as performance, qualification and licensing, as well as interfaces to other systems; and cost-benefit relationships, ease of service and maintenance as well as installation during scheduled outages. A number of WWER-440 and WWER-1000 nuclear plants have announced their intention to refurbish their protection systems. Since 1994, these plants have been placing orders with Siemens for new protection systems, including the neutron flux monitoring system utilizing the advanced system TELEPERM XS. This exclusively digital IandC system provides an excellent foundation for the remaining plant service life

Definition of the seventh dynamic AER benchmark-WWER-440 pressure vessel coolant mixing by re-connection of an isolated loop

International Nuclear Information System (INIS)

Kotsarev, A.; Lizorkin, M.; Petrin, R.

2010-01-01

The seventh dynamic benchmark is a continuation of the efforts to validate systematically codes for the estimation of the transient behavior of VVER type nuclear power plants. This benchmark is a continuation of the work in the sixth dynamic benchmark. It is proposed to be simulated the transient - re-connection of an isolated circulating loop with low temperature or low boron concentration in a VVER-440 plant. It is supposed to expand the benchmark to other cases when a different number of loops are in operation leading to different symmetric and asymmetric core boundary conditions. The purposes of the proposed benchmark are: 1) Best-estimate simulations of an transient with a coolant flow mixing in the Reactor Pressure Vessel of WWER-440 plant by re-connection of one coolant loop to the several ones on operation, 2) Performing of code-to-code comparisons. The core is at the end of its first cycle with a power of 1196.25 MWt. The basic additional difference of the 7-seventh benchmark is in the detailed description of the downcomer and bottom part of the reactor vessel that allow describing the effects of coolant mixing in the Reactor Pressure Vessel without any additional conservative assumptions. The burn-up and the power distributions at this reactor state have to be calculated by the participants. The thermohydraulic conditions of the core in the beginning of the transient are specified. Participants self-generated best estimate nuclear data is to be used. The main geometrical parameters of the plant and the characteristics of the control and safety systems are also specified. Use generated input data decks developed for a WWER-440 plant and for the applied codes should be used. The behaviour of the plant should be studied applying coupled system codes, which combine a three-dimensional neutron kinetics description of the core with a pseudo or real 3D thermohydraulics system code. (Authors)

PSB-VVER experimental and analytical investigation of station blackout accident in VVER-1000

Energy Technology Data Exchange (ETDEWEB)

Lipatov, I.A.; Kapustin, A.V.; Nikonov, S.M.; Rovnov, A.A.; Basov, A.V. [Electrogorsk Research and Engineering Centre (EREC), Moscow Region (Russian Federation); Elkin, I.V. [NSI RRC, Kurchatov Institute, Moscow (Russian Federation)

2007-07-01

In November 2003, an experiment simulating station blackout accident was carried out in the PSB-VVER integral test facility at the Electrogorsk Research and Engineering Centre (Russia). The purpose of the experiment was to provide missing data for code validation as well as to investigate the VVER thermohydraulics in the blackout conditions. The experiment covers a wide range of phenomena relating not only to transients but also to small break loss-of-coolant accidents. The data gained in the test has been used to assess the RELAP5/MOD3.3 code. In this paper, a special attention has been paid to the code assessment regarding the mixture level and entrainment in steam generator secondary side. The analysis of the recorded transient has shown that the calculation of the heat transfer on the secondary side of steam generators is very sensitive to the steam generator nodalization. (authors)

VVER-1000 backfitting programs

International Nuclear Information System (INIS)

Zabka, H.; Milhem, J.L.

1998-01-01

Russia, Ukraine, and Bulgaria have nineteen nuclear generating units of the VVER-1000/V-320 (1000 MWe PWR) type in operation. Most of these plants were built in the eighties. Their design is based on Soviet standards of the seventies. In the early eighties and, in particular, after the Chernobyl accident, new safety principles and supplementary specific standards were introduced. However, they were taken into account only to a limited extent in the design and construction of the VVER-1000/V-320 plants. A number of nuclear power plants, whose construction was stopped after the political changes in the countries of the former USSR, now are to be completed with the financial assistance of the Commission of the European Union and other Western organizations, respectively. This Western support is dependent on the condition that these plants attain a level of engineered safeguards comparable to that of PWR plants currently in operation in Western Europe. (orig.) [de

Primary water chemistry for NPP with VVER-TOI

International Nuclear Information System (INIS)

Susakin, S.N.; Brykov, S.I.; Zadonsky, N.V.; Bystrova, O.S.

2012-09-01

Nowadays within the framework of development of the nuclear power industry in Russia the VVER-TOI reactor is under designing (Standard optimized design). The given design provides for improvement of operation safety level, of technical-economic, operational and load-follow characteristics, and for the raise of competitive capacity of reactor plant and NPP as a whole. In VVER-TOI reactor plant design the primary water chemistry has been improved considering operation experience of VVER reactor plants and a possibility of RP operation under load-follow modes from the viewpoint of meeting the following requirements: - suppression of generation of oxidizing radiolytic products under power operation; - assurance of corrosion resistance of structural materials of equipment and pipelines throughout the NPP design service life; - minimization of deposits on surfaces of the reactor core fuel rods and on heat exchange surface of steam generators; - minimization of accumulation of activated corrosion products; - minimization of the amount of radioactive processing waste. In meeting these requirements an important role is devoted to suppression of generation of oxidizing radiolytic products owing to accumulation of hydrogen in the primary coolant. At NPP with VVER-1000 reactor the ammonia-potassium water chemistry is used wherein the hydrogen accumulation is provided at the expense of ammonia proportioning. Usage of ammonia leads to generation of additional amount of radioactive processing waste and to increased irregularity of maintaining the water chemistry under the daily load-follow modes. In VVER TOI design the primary water chemistry is improved by replacing the proportioning of ammonia with the proportioning of gaseous hydrogen. Different process schemes were considered that provide for a possibility of hydrogen accumulation and maintaining owing to direct proportioning of gaseous hydrogen. The obtained results showed that transition to the potassium water chemistry

Severe accident experiments on PLINIUS platform. Results of first experiments on COLIMA facility related to VVER-440. Presentation of planned VULCANO and KROTOS tests

International Nuclear Information System (INIS)

Piluso, P.; Boccaccio, E.; Bonnet, J.-M.; Journeau, C.; Fouquart, P.; Magallon, D.; Ivanov, I.; Mladenov, I.; Kalchev, S.; Grudev, P.; Alsmeyer, H.; Fluhrer, B.; Leskovar, M.

2005-01-01

In the hypothetical case of a nuclear reactor severe accident, the reactor core could melt and form a mixture of nuclear fuel (UO 2 + Fission Products), metallic or oxidized cladding + steel, called c orium , of highly refractory oxides (UO 2 , ZrO 2 ) and metallic or oxidized steel, that could eventually flow out of the vessel and mix with the substrate decomposition products (generally oxides such as SiO 2 , Al 2 O 3 , CaO, Fe 2 O 3 ). The French Atomic Energy Commission (CEA) has launched a R and D programme aimed at providing the tools for improving the mastering of severe accidents. It encompasses the development of models and codes, performance of experiments in simulant and prototypic materials and the analysis of international experiments. The experiments with prototypic corium (i.e. material containing depleted UO 2 ) are performed in the PLINIUS experimental platform at CEA Cadarache. It comprises the VULCANO facility for 50-100 kg tests (corium-material interactions, corium solidification etc.), the COLIMA facility for smaller scale (∼1 kg) experiments, the VITI facility for corium properties measurement and the KROTOS facility for corium-water interaction (a few kg). In the framework of the 5 th European Framework Programme, free trans-national access to these facilities has been offered to EU and Associated States researchers. For the first PLINIUS access, COLIMA experiments have been conducted with a Bulgarian Team (TU/SOFIA, BAS/INRNE and NPP/KOZLODUY). This series of tests was devoted to experimental studies on fission products release and corium behaviour in the late phase in a hypothetic case of severe accident in a PWR type VVER-440. The COLIMA experimental results are consistent with previous experiments on irradiated fuels (VERCORS, PHEBUS) with small differences for some fission products and show new results for the remaining corium. For the second visit, scientific users from FZK in Germany were selected to validate the COMET core

Research on loading pattern optimization for VVER reactor

International Nuclear Information System (INIS)

Tran Viet Phu; Nguyen Thi Mai Huong; Nguyen Huu Tiep; Ta Duy Long; Tran Vinh Thanh; Tran Hoai Nam

2017-01-01

A study on fuel loading pattern optimization of a VVER reactor was performed. In this study, a core physics simulator was developed based on a multi-group diffusion theory for the use in the problem of fuel loading optimization of VVER reactors. The core simulator could handle the triangular meshes of the core and the computational speed is fast. Verification of the core simulator was confirmed against a benchmark problem of a VVER-1000 reactor. Several optimization methods such as DS, SA, TS and a combination of them were investigated and implemented in coupling with the core simulator. Calculations was performed for optimizing the fuel loading pattern of the core using these methods based on a benchmark core model in comparison with the reference core. Comparison among these methods have shown that a combination of SA+TS is the most effective for the problem of fuel loading pattern optimization. Advanced methods are being researched continuously. (author)

VVER-440 control rod follower induced local power peaking computational benchmark: MCNP and KARATE solutions

International Nuclear Information System (INIS)

Hegyi, G.; Hordosy, G.; Kereszturi, A.; Maraczy, C.; Temesvari, E.

2009-01-01

In this paper the linear pin power calculation in the KARATE-440 code system are presented. The calculation results show that: 1) The coupler mathematical benchmark was solved by the KARATE code system using the same methods and approximations as in case of NPP applications. 2) Without Hf plate in the fuel pin row next to the problematic coupler section pronounced local power peak arises. 4) Though the underprediction of the peak by KARATE-SADR is 4%, it is in accordance with the applied uncertainty of KARATE-SADR. 5) The application of Hf plate solves the problem.

Vver-1000 Mox core computational benchmark

International Nuclear Information System (INIS)

2006-01-01

The NEA Nuclear Science Committee has established an Expert Group that deals with the status and trends of reactor physics, fuel performance and fuel cycle issues related to disposing of weapons-grade plutonium in mixed-oxide fuel. The objectives of the group are to provide NEA member countries with up-to-date information on, and to develop consensus regarding, core and fuel cycle issues associated with burning weapons-grade plutonium in thermal water reactors (PWR, BWR, VVER-1000, CANDU) and fast reactors (BN-600). These issues concern core physics, fuel performance and reliability, and the capability and flexibility of thermal water reactors and fast reactors to dispose of weapons-grade plutonium in standard fuel cycles. The activities of the NEA Expert Group on Reactor-based Plutonium Disposition are carried out in close co-operation (jointly, in most cases) with the NEA Working Party on Scientific Issues in Reactor Systems (WPRS). A prominent part of these activities include benchmark studies. At the time of preparation of this report, the following benchmarks were completed or in progress: VENUS-2 MOX Core Benchmarks: carried out jointly with the WPRS (formerly the WPPR) (completed); VVER-1000 LEU and MOX Benchmark (completed); KRITZ-2 Benchmarks: carried out jointly with the WPRS (formerly the WPPR) (completed); Hollow and Solid MOX Fuel Behaviour Benchmark (completed); PRIMO MOX Fuel Performance Benchmark (ongoing); VENUS-2 MOX-fuelled Reactor Dosimetry Calculation (ongoing); VVER-1000 In-core Self-powered Neutron Detector Calculational Benchmark (started); MOX Fuel Rod Behaviour in Fast Power Pulse Conditions (started); Benchmark on the VENUS Plutonium Recycling Experiments Configuration 7 (started). This report describes the detailed results of the benchmark investigating the physics of a whole VVER-1000 reactor core using two-thirds low-enriched uranium (LEU) and one-third MOX fuel. It contributes to the computer code certification process and to the

Experimental and numerical investigation of the coolant mixing during fast deboration transients

International Nuclear Information System (INIS)

Hoehne, T.; Rohde, U.; Weiss, F.P.

1999-01-01

For the analysis of boron dilution transients and main steam line break scenarios the modeling of the coolant mixing inside the reactor vessel is important, because the reactivity insertion strongly depends on boron acid concentration or the coolant temperature distribution. Calculations for steady state flow conditions for the VVER-440 were performed with a CFD code (CFX-4). The comparison with experimental data and an analytical mixing model which is implemented in the neutron-kinetic code DYN3D showed a good agreement for near-nominal conditions. First experiments at the Rossendorf Mixing Test Facility ROCOM were performed simulating the start-up of the first main coolant pump. The reference reactor for the geometrically 1:5 scaled Plexiglas model is the German Konvoi type PWR. After demonstrating the capability of the CFD code to simulate these complicated flow transients, calculations were performed for the start-up of the first pump in a VVER-440 type reactor. These calculations are a first step of understanding the coolant mixing in the RPV of a VVER-440 type reactor under transient conditions. The results of the calculation show a very complex flow in the downcomer. A high downcomer of VVER-440 and the existence of the lower control rod chamber support coolant mixing is concluded. (author)

Nuclear safety at the Paks Plant

International Nuclear Information System (INIS)

Bajsz, Jozsef; Vamos, Gabor

1991-01-01

The Paks Nuclear Power Plant is located on the Danube river 114 km south of Budapest. It consists of four PWR units of the Soviet VVER-440 design. These are of the second generation design VVER 440 (model 213) with safety features as of 1975. It should be emphasized that these are two different generations of VVER 440 units. This is not always clear, not only to the general public, but sometimes even to people working in the nuclear industry. The widespread criticism of the first generation type 230 reactors is often extended to model 213 reactors, as the differences between the two models are often not sufficiently emphasized. In this situation it is very important to provide balanced information about the advantages and disadvantages of this reactor type. This paper attempts to do that. (author)

Three-dimensional reactor dynamics code for VVER type nuclear reactors

Energy Technology Data Exchange (ETDEWEB)

Kyrki-Rajamaeki, R. [VTT Energy, Espoo (Finland)

1995-10-01

A three-dimensional reactor dynamics computer code has been developed, validated and applied for transient and accident analyses of VVER type nuclear reactors. This code, HEXTRAN, is a part of the reactor physics and dynamics calculation system of the Technical Research Centre of Finland, VTT. HEXTRAN models accurately the VVER core with hexagonal fuel assemblies. The code uses advanced mathematical methods in spatial and time discretization of neutronics, heat transfer and the two-phase flow equations of hydraulics. It includes all the experience of VTT from 20 years on the accurate three-dimensional static reactor physics as well as on the one-dimensional reactor dynamics. The dynamic coupling with the thermal hydraulic system code SMABRE also allows the VVER circuit-modelling experience to be included in the analyses. (79 refs.).

Three-dimensional reactor dynamics code for VVER type nuclear reactors

International Nuclear Information System (INIS)

Kyrki-Rajamaeki, R.

1995-10-01

A three-dimensional reactor dynamics computer code has been developed, validated and applied for transient and accident analyses of VVER type nuclear reactors. This code, HEXTRAN, is a part of the reactor physics and dynamics calculation system of the Technical Research Centre of Finland, VTT. HEXTRAN models accurately the VVER core with hexagonal fuel assemblies. The code uses advanced mathematical methods in spatial and time discretization of neutronics, heat transfer and the two-phase flow equations of hydraulics. It includes all the experience of VTT from 20 years on the accurate three-dimensional static reactor physics as well as on the one-dimensional reactor dynamics. The dynamic coupling with the thermal hydraulic system code SMABRE also allows the VVER circuit-modelling experience to be included in the analyses. (79 refs.)

Stresses in transition region of VVER-1000 reactor vessels

International Nuclear Information System (INIS)

Namgung, I.; Nguye, T.L.

2014-01-01

Most of the western PWR reactor's bottom head is hemi-spherical shape, however for Russian designed VVER family of reactor it is ellipsoidal shape. The transition region from shell side to ellipsoidal head and transition top flange to cylindrical shell develop higher stress concentration than western PWR reactor vessel. This region can be modeled as conical shell with varying thickness. The theoretical derivation of stress in the thick-walled conical cylinder with varying thickness was developed and shown in detail. The results is applied to VVER-1000 reactor vessel of which shell to bottom ellipsoidal shell and shell to upper flange were investigated for stress field. The theoretical calculations were also compared with FEM solutions. An axisymmetric 3D model of VVER-1000 reactor vessel (without closure head) FEM model was created and internal hydrostatic pressure boundary condition was applied. The stress results from FEM and theoretical calculation were compared, and the discrepancies and accuracies of the theoretical results were discussed. (author)

Stresses in transition region of VVER-1000 reactor vessels

Energy Technology Data Exchange (ETDEWEB)

Namgung, I. [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of); Nguye, T.L. [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of); National Research Inst. of Mechanical Engineering, Hanoi City, Vietnam (China)

2014-07-01

Most of the western PWR reactor's bottom head is hemi-spherical shape, however for Russian designed VVER family of reactor it is ellipsoidal shape. The transition region from shell side to ellipsoidal head and transition top flange to cylindrical shell develop higher stress concentration than western PWR reactor vessel. This region can be modeled as conical shell with varying thickness. The theoretical derivation of stress in the thick-walled conical cylinder with varying thickness was developed and shown in detail. The results is applied to VVER-1000 reactor vessel of which shell to bottom ellipsoidal shell and shell to upper flange were investigated for stress field. The theoretical calculations were also compared with FEM solutions. An axisymmetric 3D model of VVER-1000 reactor vessel (without closure head) FEM model was created and internal hydrostatic pressure boundary condition was applied. The stress results from FEM and theoretical calculation were compared, and the discrepancies and accuracies of the theoretical results were discussed. (author)

Seismic verification methods for structures and equipment of VVER-type and RBMK-type NPPs (summary of experiences)

International Nuclear Information System (INIS)

Masopust, R.

2003-01-01

The main verification methods for structures and equipment of already existing VVER-type and RBMK-type NPPs are briefly described. The following aspects are discussed: fundamental seismic safety assessment principles for VVER/RBMK-type NPPs (seismic safety assessment procedure, typical work plan for seismic safety assessment of existing NPPs, SMA (HCLPF) calculations, modified GIP (GIP-VVER) procedure, similarity of VVER/RBMK equipment to that included in the SQUG databases and seismic interactions

Safety enhancement concept for NPP of new generation with VVER reactors

International Nuclear Information System (INIS)

Bezlepkin, V.; Kukhtevich, I.; Semashko, S.; Svetlov, S.; Solodovnikov, A.

2004-01-01

With the present day conditions, in order to successfully promote new NPP designs in the electric power markets, it is necessary to ensure enhanced technical/economic performances provided that international safety requirements are properly adhered to. When compared with high-powered nuclear power plants, NPP VVER-640 design (medium powered) possesses a number of advantages for the regions with undeveloped energy systems. Reduced specific energy intensity of the core adopted in this type of reactor allows to ensure the emergency cooldown of the reactor plant by passive means and to minimize the 'human factor' risk and external effects and provide sound substantiations as to how to retain corium inside RPV in case of severe accidents. At the same time, high-powered NPPs seem to be promising for regions with developed energy systems. Among such designs, NPP VVER-1000 and VVER-1500 designs are the most desirable. Configuration of new generation NPP with VVER-1500 is to be selected based on the gained experience in designing NPPs of previous generations considering the latest safety requirements and situation in the domestic and global energy markets for the time being and in the short run. Recent IAEA publications and latest EUR requirements insist that the following key safety indices should be established for new NPP designs: - aggregated frequency of core melting is 10 -6 (1/year); - frequency of maximum accident release is 10 -7 (1/year). To meet the aforementioned criteria, it is necessary to implement some safety assurance principles recommended by IAEA (in-depth defence, single failure, redundancy, diversity, etc.), application of deterministic and probabilistic methods for selection of safety assurance activities and means and use of reasonable combination of active and passive systems. Application of VVER-640 concept to high-powered NPPs seems to be a formidable task due to a number of reasons, namely, it is quite difficult to carry out cooldown process

Fuel leak testing performance at NPP Jaslovske Bohunice

International Nuclear Information System (INIS)

Slugen, V.; Krnac, S.; Smiesko, I.

1995-01-01

The NPP Bohunice VVER-440 fuel leak testing experience are relatively extensive in comparison with other VVER-440 users. As the first Europe NPP was adapted Siemens (KWU) in core-sipping equipment to VVER-440 units and since this time were have done these tests also for NPP Paks (Hungary) and NPP Dukovany (Czech Republic). The occurrence of leaking fuel assemblies in NPP is in the last 5 years relatively stabilised and low. A significant difference can be observed between type V-230 (31 leaks) and type V-213 (1 leak). None of of the indicated leaking fuel assemblies has been investigated in the hot cell. Therefore cannot be confirm the effective causes of leak occurrence. Nevertheless, the fuel failure rate and the performance of leak testing in NPP Bohunice are comparable to the world standard at PWR's. 1 tab., 2 figs., 3 refs

Fuel leak testing performance at NPP Jaslovske Bohunice

Energy Technology Data Exchange (ETDEWEB)

Slugen, V; Krnac, S [Slovak Technical Univ., Bratislava (Slovakia); Smiesko, I [Nuclear Powr Plant EBO, Jaslovske Bohuce (Slovakia)

1996-12-31

The NPP Bohunice VVER-440 fuel leak testing experience are relatively extensive in comparison with other VVER-440 users. As the first Europe NPP was adapted Siemens (KWU) in core-sipping equipment to VVER-440 units and since this time were have done these tests also for NPP Paks (Hungary) and NPP Dukovany (Czech Republic). The occurrence of leaking fuel assemblies in NPP is in the last 5 years relatively stabilised and low. A significant difference can be observed between type V-230 (31 leaks) and type V-213 (1 leak). None of of the indicated leaking fuel assemblies has been investigated in the hot cell. Therefore cannot be confirm the effective causes of leak occurrence. Nevertheless, the fuel failure rate and the performance of leak testing in NPP Bohunice are comparable to the world standard at PWR`s. 1 tab., 2 figs., 3 refs.

Structural seismic upgrading of NPPs in Czech and Slovak republics

Energy Technology Data Exchange (ETDEWEB)

David, M [DAVID Consulting, Engineering and Design Office, Prague (Czech Republic)

1997-03-01

Several Nuclear Power Plants of the VVER type has been constructed during the past years in former Czechoslovak Republic. Some of them has been already put in operation and some of them are under construction. Nuclear Power Plants V1(2 units of VVER 440/230), V2(2 units of VVER 440/213) in Slovak and NPP Dukovany (4 units of VVER 440/213) in Czech republic are in operation. NPP Mochovce (4 units of VVER 440/213) in Slovak and NPP Temelin (4 units reduced now to 2 units VVER 1000) have been already almost completed, but still under construction. All above cited NPPs have not been either explicitly designed against earthquake or the design against earthquake or its input data must be upgraded to be compatible with present requirements. The upgrading of seismic input as well the seismic upgrading of all structures and technological equipments for so many NPPs has involved a lot of comprehensive work in Czech as well as in Slovak republics. The upgrading cannot be completed in a short time and as a rule the seismic upgrading has been usually performed in several steps, beginning with the most important arrangements against seismic hazard. The basic principles and requirements for seismic upgrading has been defined in accordance with the international and particularly with the IAEA recommendations. About the requirements for seismic upgrading of NPPs in Czech and Slovak republics will be reported in other contribution. This contribution is dealing with the problems of seismic upgrading of NNPs civil engineering structures. The aim of this contribution is to point out some specific problems connected firstly with very complicated concept of Versa structures and secondly with the difficult task to increase the structural capacity to the required seismic level. (J.P.N.)

Structural seismic upgrading of NPPs in Czech and Slovak republics

International Nuclear Information System (INIS)

David, M.

1997-01-01

Several Nuclear Power Plants of the VVER type has been constructed during the past years in former Czechoslovak Republic. Some of them has been already put in operation and some of them are under construction. Nuclear Power Plants V1(2 units of VVER 440/230), V2(2 units of VVER 440/213) in Slovak and NPP Dukovany (4 units of VVER 440/213) in Czech republic are in operation. NPP Mochovce (4 units of VVER 440/213) in Slovak and NPP Temelin (4 units reduced now to 2 units VVER 1000) have been already almost completed, but still under construction. All above cited NPPs have not been either explicitly designed against earthquake or the design against earthquake or its input data must be upgraded to be compatible with present requirements. The upgrading of seismic input as well the seismic upgrading of all structures and technological equipments for so many NPPs has involved a lot of comprehensive work in Czech as well as in Slovak republics. The upgrading cannot be completed in a short time and as a rule the seismic upgrading has been usually performed in several steps, beginning with the most important arrangements against seismic hazard. The basic principles and requirements for seismic upgrading has been defined in accordance with the international and particularly with the IAEA recommendations. About the requirements for seismic upgrading of NPPs in Czech and Slovak republics will be reported in other contribution. This contribution is dealing with the problems of seismic upgrading of NNPs civil engineering structures. The aim of this contribution is to point out some specific problems connected firstly with very complicated concept of Versa structures and secondly with the difficult task to increase the structural capacity to the required seismic level. (J.P.N.)

Developing the European Center of Competence on VVER-Type Nuclear Power Reactors

Science.gov (United States)

Geraskin, Nikolay; Pironkov, Lyubomir; Kulikov, Evgeny; Glebov, Vasily

2017-01-01

This paper presents the results of the European educational projects CORONA and CORONA-II which are dedicated to preserving and further developing nuclear knowledge and competencies in the area of VVER-type nuclear power reactors technologies (Water-Water Energetic Reactor, WWER or VVER). The development of the European Center of Competence for…

Water chemistry experiences with VVERs at Kudankulam

International Nuclear Information System (INIS)

Rout, D.; Upadhyaya, T.C.; Ravindranath; Selvinayagam, P.; Sundar, R.S.

2015-01-01

Kudankulam Nuclear Power Project - 1 and 2 (Kudankulam NPP - 1 and 2) are pressurised water cooled VVERs of 1000 MWe each. Kudankulam NPP Unit - 1 is presently on its first cycle of operation and Kudankulam NPP Unit - 2 is on the advanced stage of commissioning with the successful completion of hot run related Functional tests. Water Chemistry aspects during various phases of commissioning of Kudankulam NPP Unit - 1 such as Hot Run, Boric acid flushing, initial fuel Loading (IFL), First approach to Criticality (FAC) are discussed. The main objectives of the use of controlled primary water chemistry programme during the hot functional tests are reviewed. The importance of the relevant water chemistry parameters were ensured to have the quality of the passive layer formed on the primary coolant system surfaces. The operational experiences during the 1 st cycle of operation of primary water chemistry, radioactivity transport and build-up are presented. The operational experience of some VVER units in the field of the primary water chemistry, radioactivity transport and build-up are presented as a comparison to VVER at Kudankulam NPP. The effects of the initial passivated layer formed on metal surfaces during hot run, activated corrosion products levels in the primary coolant under controlled water chemistry regime and the contamination/radiation situation are discussed. This report also includes the water chemistry related issues of secondary water systems. (author)

Expert evaluation in NPP safety important systems licensing process

International Nuclear Information System (INIS)

Mikhail, A Yastrebenetsky; Vasilchenko, V.N.

2001-01-01

Expert evaluation of nuclear power plant safety important systems modernization is an integral part of these systems licensing process. The paper contains some aspects of this evaluation which are based on Ukrainian experience of VVER-1000 and VVER-440 modernization. (authors)

Expert evaluation in NPP safety important systems licensing process

Energy Technology Data Exchange (ETDEWEB)

Mikhail, A Yastrebenetsky; Vasilchenko, V.N. [Ukrainian State Scientific Technical Center of Nuclear and Radiation Safety (Ukraine)

2001-07-01

Expert evaluation of nuclear power plant safety important systems modernization is an integral part of these systems licensing process. The paper contains some aspects of this evaluation which are based on Ukrainian experience of VVER-1000 and VVER-440 modernization. (authors)

Analysis of VVER-1000 large and small break LOCA experiments with RELAP5/MOD3.2

International Nuclear Information System (INIS)

Rychkov, M.; Chikkanagoudar, U.; Sehgal, B.R.

2004-01-01

A RELAP5 model for the analysis of the PSB-VVER test facility was developed by EREC in Russia. The PSB-VVER is a large-scale integral test facility to model the VVER-1000 type NPP. The volume and power scale in this test facility is 1:300 and the elevation scale is 1:1, which corresponds to the elevation mark of the reactor prototype. At the Division of Nuclear Safety, we have modified the PSB-VVER facility's RELAP5 model in order to analyze two of the transient tests performed on the PSB-VVER facility, which serve as the validation matrix described by NEA/CSNI. The objective of the work conducted was to validate the results obtained from RELAP5's calculation with the supplied experimental data from the PSB-VVER test facility. Two accident scenarios have been calculated and analyzed. After being verified against the '11% UP LOCA' test data, the RELAP5/MOD3.2 model was used for a so-called 'blind' transient calculation of the test '2*25% HL LOCA' and the results obtained were compared with the experimental data provided after the calculation. From the results of the qualitative and quantitative comparison of the 2 test calculations and the experimental data, we can state that the RELAP5/MOD3.2 code gives a satisfactory modeling of the PSB-VVER facility' thermal hydraulic phenomena

Application of a Russian nuclear reactor simulator VVER-1000; Aplicacion de un simulador de reactor nuclear ruso VVER-1000

Energy Technology Data Exchange (ETDEWEB)

Lopez-Peniche S, A. [UNAM, Facultad de Ingenieria, Circuito Interior, Ciudad Universitaria, 04360 Mexico D. F. (Mexico); Salazar S, E., E-mail: alpsordo@hotmail.com [UNAM, Facultad de Ingenieria, Departamento de Sistemas Energeticos, Laboratorio de Analisis en Ingenieria de Reactores Nucleares, 62250 Jiutepec, Morelos (Mexico)

2012-10-15

The objective of the present work is to give to know the most important characteristics in the Russian nuclear reactor of pressurized light water VVER-1000, doing emphasis in the differences that has with the western equivalent the reactor PWR in the design and the safety systems. Therefore, a description of the computerized simulation of the reactor VVER-1000 developed by the company Eniko TSO that the International Atomic of Energy Agency distributes to the states members with academic purposes will take place. The simulator includes mathematical models that represent to the essential systems in the real nuclear power plant, for what is possible to reproduce common faults and transitory characteristic of the nuclear industry with a behavior sufficiently attached to the reality. In this work is analyzed the response of the system before a turbine shot. After the accident in the nuclear power plant of Three Mile Island (US) they have been carried out improvements in the design of the reactor PWR and their safety systems. To know the reach and the limitations of the program, the events that gave place to this accident will be reproduced in the simulator VVER-1000. With base to the results of the simulation we will conclude that so reliable is the response of the safety system of this reactor. (Author)

Validation experience with the core calculation program karate

International Nuclear Information System (INIS)

Hegyi, Gy.; Hordosy, G.; Kereszturi, A.; Makai, M.; Maraczy, Cs.

1995-01-01

A relatively fast and easy-to-handle modular code system named KARATE-440 has been elaborated for steady-state operational calculations of VVER-440 type reactors. It is built up from cell, assembly and global calculations. In the frame of the program neutron physical and thermohydraulic process of the core at normal startup, steady and slow transient can be simulated. The verification and validation of the global code have been prepared recently. The test cases include mathematical benchmark and measurements on operating VVER-440 units. Summary of the results, such as startup parameters, boron letdown curves, radial and axial power distributions of some cycles of Paks NPP is presented. (author)

Structural mechanisms of the flux effect for VVER-1000 reactor pressure vessel materials

International Nuclear Information System (INIS)

Gurovich, B.; Kuleshova, E.; Fedotova, S.; Maltsev, D.; Zabusov, O.; Frolov, A.; Erak, D.; Zhurko, D.

2015-01-01

To justify the lifetime extension of VVER-1000 reactor pressure vessels (RPV) up to 60 years and more it is necessary to expand the existing surveillance samples database to beyond design fluence by means of accelerated irradiation in a research reactor. Herewith since the changes in mechanical properties of materials under irradiation are due to occurring structural changes, correct analysis of the data obtained at accelerated irradiation of VVER-1000 RPV materials requires a clear understanding of the structural mechanisms that are responsible for the flux effect in VVER-1000 RPV steels. Two mechanisms are responsible for radiation embrittlement of VVER-1000 RPV steels: the hardening one (radiation hardening due to formation of radiation-induced Ni-based precipitates and radiation defects) and non-hardening one (due to formation of impurities segregations at grain boundaries - reversible temper brittleness). In this context for an adequate interpretation of the mechanical tests results when justifying the lifetime extension of existing units a complex of comparative structural studies (TEM, SEM and AES) of VVER-1000 RPV materials irradiated in different conditions (in research reactor IR-8 and within surveillance samples) was performed. It is shown that the flux effect is observed for materials with high nickel content (weld metals with Ni content > 1.35%) and it is mostly due to the contribution of non-hardening mechanism of radiation embrittlement (the difference in the accumulation kinetics of grain boundary phosphorus segregation) and somewhat contribution of the hardening mechanism (the difference in density of radiation-induced precipitates). Therefore when analyzing the results obtained from the accelerated irradiation of VVER-1000 WM the correction for the flux effect should be made. (authors)

Core designs of modern VVER projects

International Nuclear Information System (INIS)

Vasilchenko, I.; Kushmanov, S.; Vjalitsyn, V.; Vasilchenko, R.

2015-01-01

The presented operational experience of TVS - 2M (pilot-commercial operation started in 2006 at Balakovo NPP -1) enables to use it as reference for new projects because of similarity in designs and operational conditions. In the paper main parameters of fuel cycles, stability to impact of damaging factors, pilot operation of MG, new alloys, ADF and NTMC, upgrade of FA - 2M for the further power uprating, profiling of Gd-fuel rods for 18-month Fuel Cycle (FC) and perfection of absorber element design are the discussed issues. At the end author concluded that: 1) Core designs of new projects AES-2006 and VVER-TOI are based on extensive successful operational experience of the close prototype of TVS - 2M. 2) All improvements both of technical and economic parameters of fuel are subjected to representative examination by pilot operation at the power units with VVER-1000 being close prototypes of new designs

Comparison of physiological load tolerances between the Siberian husky and the Czechoslovakian wolfdog, during sport training

Directory of Open Access Journals (Sweden)

Dominika Gulda

2018-03-01

Full Text Available The purpose of the study was to determine the physiological load tolerances of two breeds of dogs used for sports, namely the Siberian husky and the Czechoslovakian wolfdog, on the basis of measurements of surface temperature and blood lactic acid levels.Two breeds - Czechoslovakian wolfdog (10 individuals and Siberian husky (10 individuals, 20 dogs - male, 4-6 years old, were selected for the study. All the qualified animals were previously examined by a veterinarian and considered to be healthy. The dogs tested were used in dogtrekking sport competitions. For both breeds, an attempt was made to test the dogtrekking harness for 5 km of non-stop track running. The animals trotted while being led by a guide. Three attempts were made for each dog at 48 hour intervals. All dogs were tested for two parameters, first before and then after the exercise – measuring surface temperature at selected points of the body as well as lactic acid concentration. A higher and statistically significant level of lactic acid was recorded in the case of Siberian husky. Before the run, the level of lactic acid was comparable in both breeds. The second parameter was the surface temperature measured at the selected measuring points. Significant statistical differences were noted for the wolfdog breed at P≤0.05 before the exercise and 10 minutes after resting, at the neck, rump and abdominal points. In addition, the same level of statistical significance was measured by surface thermography at the abdominal point, both before and immediately after the run. The high statistically significant increase (P≤0.01 in surface temperature was noted for muscles of the so-called rump, both before and after the exertion. There was no statistically significant difference in the back thermography in the wolfdog breed. In the Siberian husky breed, statistically significant differences (P≤0.05 were observed at the neck, rump and chest points, in confrontation with the

Hextran-Smabre calculation of the VVER-1000 coolant transient benchmark

Energy Technology Data Exchange (ETDEWEB)

Elina Syrjaelahti; Anitta Haemaelaeinen [VTT Processes, P.O.Box 1604, FIN-02044 VTT (Finland)

2005-07-01

Full text of publication follows: The VVER-1000 Coolant Transient benchmark is intended for validation of couplings of the thermal hydraulic codes and three dimensional neutron kinetic core models. It concerns a switching on a main coolant pump when the other three main coolant pumps are in operation. Problem is based on experiment performed in Kozloduy NPP in Bulgaria. In addition to the real plant transient, two extreme scenarios concerning control rod ejection after switching on a main coolant pump were calculated. In VTT the three-dimensional advanced nodal code HEXTRAN is used for the core kinetics and dynamics, and thermohydraulic system code SMABRE as a thermal hydraulic model for the primary and secondary loop. Parallelly coupled HEXTRAN-SMABRE code has been in production use since early 90's, and it has been extensively used for analysis of VVER NPPs. The SMABRE input model is based on the standard VVER-1000 input used in VTT. Last plant specific modifications to the input model have been made in EU projects. The whole core calculation is performed in the core with HEXTRAN. Also the core model is based on earlier VVER-1000 models. Nuclear data for the calculation was specified in the benchmark. The paper outlines the input models used for both codes. Calculated results are introduced both for the coupled core system with inlet and outlet boundary conditions and for the whole plant model. Sensitivity studies have been performed for selected parameters. (authors)

Hextran-Smabre calculation of the VVER-1000 coolant transient benchmark

International Nuclear Information System (INIS)

Elina Syrjaelahti; Anitta Haemaelaeinen

2005-01-01

Full text of publication follows: The VVER-1000 Coolant Transient benchmark is intended for validation of couplings of the thermal hydraulic codes and three dimensional neutron kinetic core models. It concerns a switching on a main coolant pump when the other three main coolant pumps are in operation. Problem is based on experiment performed in Kozloduy NPP in Bulgaria. In addition to the real plant transient, two extreme scenarios concerning control rod ejection after switching on a main coolant pump were calculated. In VTT the three-dimensional advanced nodal code HEXTRAN is used for the core kinetics and dynamics, and thermohydraulic system code SMABRE as a thermal hydraulic model for the primary and secondary loop. Parallelly coupled HEXTRAN-SMABRE code has been in production use since early 90's, and it has been extensively used for analysis of VVER NPPs. The SMABRE input model is based on the standard VVER-1000 input used in VTT. Last plant specific modifications to the input model have been made in EU projects. The whole core calculation is performed in the core with HEXTRAN. Also the core model is based on earlier VVER-1000 models. Nuclear data for the calculation was specified in the benchmark. The paper outlines the input models used for both codes. Calculated results are introduced both for the coupled core system with inlet and outlet boundary conditions and for the whole plant model. Sensitivity studies have been performed for selected parameters. (authors)

Dosimetry of VVER-1000 Reactor Pressure Vessel and Surveillance Specimens as a part of PLiM at Ukrainian NPPs

International Nuclear Information System (INIS)

Bukanov, V.N.; Diemokhin, V.L.; Grytsenko, O.V.; Ilkovych, V.V.; Pugach, A.M.; Pugach, S.M.; Vasylieva, O.G.; Vyshnevskyi, I.M.; Kasatkin, O.G.

2012-01-01

A regular surveillance program for VVER-1000 and its shortages are described. The Methodology for determination of neutron flux functionals on surveillance specimens of VVER-1000 pressure vessel is presented. The radiation exposure monitoring system for VVER-1000 pressure vessel is described. The main principles of an additional surveillance program for VVER-1000 are presented. The Dosimetry Experiment, which is already carrying out at Unit 3 of Rivne NPP, is described. (author)

VVER-1000: considering its strengths and weaknesses

International Nuclear Information System (INIS)

Laaksonen, J.

1994-01-01

The safety of currently operating VVER-1000 reactors is examined. The factors considered are deviations in operation, inherent safety, safety system design, protection against internal and external hazards, equipment quality, the approach to plant operations and the safety culture. On the basis of this evaluation it is concluded that the overall safety of a VVER-1000 cannot be at the level of a modern Western PWR though there is no sound basis to make a quantitative comparison. Many of the concerns raised are being adequately addressed in the Czech Temelin which is currently under construction and in new designs which are still at the drawing board stage. Extensive back fitting programmes are planned or underway in operating plants. The creation of independent responsible operating organizations, powerful regulation and an improved economic situation are advanced as necessary criteria for real improvements in safety. (UK)

Natural circulation in a VVER reactor geometry: Experiments with the PACTEL facility and Cathare simulations

Energy Technology Data Exchange (ETDEWEB)

Raussi, P.; Kainulainen, S. [Lappeenranta Univ. of Technology, Lappeenranta (Finland); Kouhia, J. [VTT Energy, Lappeenranta (Finland)

1995-09-01

There are some 40 reactors based on the VVER design in use. Database available for computer code assessment for VVER reactors is rather limited. Experiments were conducted to study natural circulation behaviour in the PACTEL facility, a medium-scale integral test loop patterned after VVER pressurized water reactors. Flow behaviour over a range of coolant inventories was studied with a small-break experiment. In the small-break experiments, flow stagnation and system repressurization were observed when the water level in the upper plenum fell below the entrances to the hot legs. The cause was attributed to the hot leg loop seals, which are a unique feature of the VVER geometry. At low primary inventories, core cooling was achieved through the boiler-condenser mode. The experiment was simulated using French thermalhydraulic system code CATHARE.

Secular Trends and Latitude Gradients in Sex Ratios at Birth in Czechoslovakia and the Post-Czechoslovakian States

Directory of Open Access Journals (Sweden)

Victor Grech

2012-01-01

Full Text Available Latitude gradients and secular trends in Europe and North America have been found in the male-female ratio at birth (M/F: male births divided by total births which is expected to be 0.515. Annual national data for Czechoslovakia and the post-Czechoslovakian (Czech Republic and Slovakia countries for male and female live births were obtained from the World Health Organisation and analysed with contingency tables. This study analysed 13,123,538 live births. An overall decreasing trend in M/F was found (p < 00001. No latitude gradient was noted. There was an overall deficit of 15,232 male births based on an M/F of 0.515. M/F is declining in this region, despite well developing economies that have resisted the worldwide slowdown. An interplay of several poorly understood factors is likely.

Advanced nondestructive examination of the reactor vessel head penetration tube welds

International Nuclear Information System (INIS)

Cvitanovic, M.; Zado, V.

1996-01-01

Beside a referent code examination requirements, appearance of the service induced flaws on the Reactor Vessel Head (RVH) penetration tube welds forced development of remotely operated examination tools and techniques. Several systems were developed for examination of RVH PWR type while only one system for examination of VVER - 440 type RVH has been developed by Inetec. In this article the most advanced RVH VVER - 440 type examination techniques such as ultrasonic, eddy current and visual testing techniques as well as remotely operated tool are described. (author)

Qualification of the nuclear reactor core model DYN3D coupled to the thermohydraulic system code ATHLET, applied as an advanced tool for accident analysis of VVER-type reactors. Final report

International Nuclear Information System (INIS)

Grundmann, U.; Kliem, S.; Krepper, E.; Mittag, S; Rohde, U.; Schaefer, F.; Seidel, A.

1998-03-01

The nuclear reactor core model DYN3D with 3D neutron kinetics has been coupled to the thermohydraulic system code ATHLET. In the report, activities on qualification of the coupled code complex ATHLET-DYN3D as a validated tool for the accident analysis of russian VVER type reactors are described. That includes: - Contributions to the validation of the single codes ATHLET and DYN3D by the analysis of experiments on natural circulation behaviour in thermohydraulic test facilities and solution of benchmark tasks on reactivity initiated transients, - the acquisition and evaluation of measurement data on transients in nuclear power plants, the validation of ATHLET-DYN3D by calculating an accident with delayed scram and a pump trip in VVER plants, - the complementary improvement of the code DYN3D by extension of the neutron physical data base, implementation of an improved coolant mixing model, consideration of decay heat release and xenon transients, - the analysis of steam leak scenarios for VVER-440 type reactors with failure of different safety systems, investigation of different model options. The analyses showed, that with realistic coolant mixing modelling in the downcomer and the lower plenum, recriticality of the scramed reactor due to overcooling can be reached. The application of the code complex ATHLET-DYN3D in Czech Republic, Bulgaria and the Ukraine has been started. Future work comprises the verification of ATHLET-DYN3D with a DYN3D version for the square fuel element geometry of western PWR. (orig.) [de

Verification of the Korsar code on results of experiments executed on the PSB-VVER facility

International Nuclear Information System (INIS)

Roginskaya, V.L.; Pylev, S.S.; Elkin, I.V.

2005-01-01

Full text of publication follows: Paper represents some results of computational research executed within the framework of verification of the KORSAR thermal hydraulic code. This code was designed in the NITI by A.P. Aleksandrov (Russia). The general purpose of the work was development of a nodding scheme of the PSB-VVER integral facility, scheme testing and computational modelling of the experiment 'The PSB-VVER Natural Circulation Test With Stepwise Reduction of the Primary Inventory'. The NC test has been performed within the framework of the OECD PSB-VVER Project (task no. 3). This Project is focused upon the provision of experimental data for codes assessment with regard to VVER analysis. Paper presents a nodding scheme of the PSB-VVER facility and results of pre- and post-test calculations of the specified experiment, obtained with the KORSAR code. The experiment data and the KORSAR pre-test calculation results are in good agreement. A post-test calculation of the experiment with KORSAR code has been performed in order to assess the code capability to simulate the phenomena relevant to the test. The code showed a reasonable prediction of the phenomena measured in the experiment. (authors)

Verification of the Korsar code on results of experiments executed on the PSB-VVER facility

Energy Technology Data Exchange (ETDEWEB)

Roginskaya, V.L.; Pylev, S.S.; Elkin, I.V. [NSI RRC ' Kurchatov Institute' , Kurchatov Sq., 1, Moscow, 123182 (Russian Federation)

2005-07-01

Full text of publication follows: Paper represents some results of computational research executed within the framework of verification of the KORSAR thermal hydraulic code. This code was designed in the NITI by A.P. Aleksandrov (Russia). The general purpose of the work was development of a nodding scheme of the PSB-VVER integral facility, scheme testing and computational modelling of the experiment 'The PSB-VVER Natural Circulation Test With Stepwise Reduction of the Primary Inventory'. The NC test has been performed within the framework of the OECD PSB-VVER Project (task no. 3). This Project is focused upon the provision of experimental data for codes assessment with regard to VVER analysis. Paper presents a nodding scheme of the PSB-VVER facility and results of pre- and post-test calculations of the specified experiment, obtained with the KORSAR code. The experiment data and the KORSAR pre-test calculation results are in good agreement. A post-test calculation of the experiment with KORSAR code has been performed in order to assess the code capability to simulate the phenomena relevant to the test. The code showed a reasonable prediction of the phenomena measured in the experiment. (authors)

Assessment of Automated Data Analysis Application on VVER Steam Generator Tubing

International Nuclear Information System (INIS)

Picek, E.; Barilar, D.

2006-01-01

INETEC - Institute for Nuclear Technology has developed software package named EddyOne having an option of automated analysis of bobbin coil eddy current data. During its development and site use some features were noticed preventing the wide use automatic analysis on VVER SG data. This article discuss these specific problems as well evaluates possible solutions. With regards to current state of automated analysis technology an overview of advantaged and disadvantages of automated analysis on VVER SG is summarized as well.(author)

Relap5/Mod3.1 analysis of main steam header rupture in VVER- 440/213 NPP

Energy Technology Data Exchange (ETDEWEB)

Kral, P. [Nuclear Research Inst. Rez (Switzerland)

1995-12-31

The presentation is focused on two main topics. First the applied modelling of PGV-4 steam generator for RELAP5 code are described. The results of steady-state calculation under reference conditions are compared against measured data. The problem of longitudinal subdivision of SG tubes is analysed and evaluated. Secondly, a best-estimate analysis of main steam header (MSH) rupture accident in WWER-440/213 NPP is presented. The low reliability of initiation of ESFAS signal `MSH Rupture` leads in this accident to big loss of secondary coolant, full depressurization of main steam system, extremely fast cool-down of both secondary and primary system, opening of PRZ SV-bypass valve with later liquid outflow, potential reaching of secondary criticality by failure of HPIS. 7 refs.

Relap5/Mod3.1 analysis of main steam header rupture in VVER- 440/213 NPP

Energy Technology Data Exchange (ETDEWEB)

Kral, P [Nuclear Research Inst. Rez (Switzerland)

1996-12-31

The presentation is focused on two main topics. First the applied modelling of PGV-4 steam generator for RELAP5 code are described. The results of steady-state calculation under reference conditions are compared against measured data. The problem of longitudinal subdivision of SG tubes is analysed and evaluated. Secondly, a best-estimate analysis of main steam header (MSH) rupture accident in WWER-440/213 NPP is presented. The low reliability of initiation of ESFAS signal `MSH Rupture` leads in this accident to big loss of secondary coolant, full depressurization of main steam system, extremely fast cool-down of both secondary and primary system, opening of PRZ SV-bypass valve with later liquid outflow, potential reaching of secondary criticality by failure of HPIS. 7 refs.

Relap5/Mod3.1 analysis of main steam header rupture in VVER- 440/213 NPP

International Nuclear Information System (INIS)

Kral, P.

1995-01-01

The presentation is focused on two main topics. First the applied modelling of PGV-4 steam generator for RELAP5 code are described. The results of steady-state calculation under reference conditions are compared against measured data. The problem of longitudinal subdivision of SG tubes is analysed and evaluated. Secondly, a best-estimate analysis of main steam header (MSH) rupture accident in WWER-440/213 NPP is presented. The low reliability of initiation of ESFAS signal 'MSH Rupture' leads in this accident to big loss of secondary coolant, full depressurization of main steam system, extremely fast cool-down of both secondary and primary system, opening of PRZ SV-bypass valve with later liquid outflow, potential reaching of secondary criticality by failure of HPIS

Validation matrix for the assessment of thermal-hydraulic codes for VVER LOCA and transients. A report by the OECD support group on the VVER thermal-hydraulic code validation matrix

International Nuclear Information System (INIS)

2001-06-01

This report deals with an internationally agreed experimental test facility matrix for the validation of best estimate thermal-hydraulic computer codes applied for the analysis of VVER reactor primary systems in accident and transient conditions. Firstly, the main physical phenomena that occur during the considered accidents are identified, test types are specified, and test facilities that supplement the CSNI CCVMs and are suitable for reproducing these aspects are selected. Secondly, a list of selected experiments carried out in these facilities has been set down. The criteria to achieve the objectives are outlined. The construction of VVER Thermal-Hydraulic Code Validation Matrix follows the logic of the CSNI Code Validation Matrices (CCVM). Similar to the CCVM it is an attempt to collect together in a systematic way the best sets of available test data for VVER specific code validation, assessment and improvement, including quantitative assessment of uncertainties in the modelling of phenomena by the codes. In addition to this objective, it is an attempt to record information which has been generated in countries operating VVER reactors over the last 20 years so that it is more accessible to present and future workers in that field than would otherwise be the case. (authors)

Fatigue flaw growth assessment and inclusion of stratification to the LBB assessment

Energy Technology Data Exchange (ETDEWEB)

Samohyl, P.

1997-04-01

The application of the LBB requires also fatigue flaw growth assessment. This analysis was performed for PWR nuclear power plants types VVER 440/230, VVER 440/213c, VVER 1000/320. Respecting that these NPP`s were designed according to Russian codes that differ from US codes it was needed to compare these approaches. Comparison with our experimental data was accomplished, too. Margins of applicability of the US methods and their modifications for the materials used for construction of Czech and Slovak NPP`s are shown. Computer code accomplishing the analysis according to described method is presented. Some measurement and calculations show that thermal stratifications in horizontal pipelines can lead to additive loads that are not negligible and can be dangerous. An attempt to include these loads induced by steady-state stratification was made.

VVER-1000 RPV Head Examination Control System

International Nuclear Information System (INIS)

Erak, Z.; Gortan, K.

2006-01-01

This article presents the electronic system used for automated NDT examination of VVER-1000 Reactor Pressure Vessel Head (RPVH). The control system drives the inspection tool with end-effectors to needed position. When the final position is reached, the eddy current and ultra sound acquisition system performs the data acquisition. The system is composed of 3 layers. The first layer is the hardware layer consisting of motors driving the tool and end-effectors along with sensors needed to obtain the positioning data. The second layer is the MAC-8 control system performing basic monitoring and control routines as an interconnection between first and third layer. The third layer is the control software, running on PC, which is used as a human-machine-interface. Presentation contains details of examination techniques with focus on eddy current examination as well as details on manipulator and end effectors developed by Inetec for VVER-1000 RPVH examination.(author)

Investigation of primary-to-secondary leakage accident on the PSB-VVER integral test facility

International Nuclear Information System (INIS)

Lipatov, I.A.; Dremin, G.I.; Galtchanskaya, S.A.; Chmal, I.I.; Moloshnikov, A.S.; Gorbunov, Y.S.; Antonova, A.I.; Elkin, I.V.

2001-01-01

The full text follows. The paper presents the main results from the test on primary-to-secondary leakage of 100 mm in equivalent diameter. The test was performed on the PSB-VVER integral test facility. PSB-VVER is a 4-loops scaled down model of primary system of NPP with VVER-1000 Russian type reactor. Volume - power scale is about 1/300 while elevation scale is 1/1. All components of the primary system of the reference NPP are modeled on PSB-VVER. Both passive (accumulators) and active (high and low pressure) ECCSs, pressurizer spray and relief circuits, feed water system and atmospheric dumping system (ADS) as well as the primary circuit gas remove emergency system are also simulated. The primary-to-secondary leakage was simulated using an external break line which connects the upper part of the hot header to SG water volume. The break line included a break nozzle (a cylindrical channel d = 5.8 mm, l/d = 10 with sharp inlet edge), quick-acting valve and two-phase mass flow rate measurement system. In addition loss of off-site power at the moment when a scram-signal is generated was assumed in the experiment. Thus the accident is to be considered as a beyond-design-basic one. The loss of off-site power results in the following: -main circulation pump shutdown; -pressurizer heaters switching off; -HPIS water cooling flow rate and number of points of water injection are reduced The study focuses on the adequacy of the associated accident management (AM) procedure developed by EDO ''GIDROPRESS'' as a General Designer of VVER-type reactors. The AM-procedure was adopted to the PSB-VVER test facility conditions using CATHARE (France) and DINAMIKA (Russia) codes analysis. The AM-procedure in PSB-VVER is as follows: after about 30 min of the onset of the accident, when the accident type and the localization of the SG affected become evident for the operator, he closes all the main steam isolation valves, inhibits the ADS actuation in the affected SG and begins to remove

VIPRE modeling of VVER-1000 reactor core for DNB analyses

Energy Technology Data Exchange (ETDEWEB)

Sung, Y.; Nguyen, Q. [Westinghouse Electric Corporation, Pittsburgh, PA (United States); Cizek, J. [Nuclear Research Institute, Prague, (Czech Republic)

1995-09-01

Based on the one-pass modeling approach, the hot channels and the VVER-1000 reactor core can be modeled in 30 channels for DNB analyses using the VIPRE-01/MOD02 (VIPRE) code (VIPRE is owned by Electric Power Research Institute, Palo Alto, California). The VIPRE one-pass model does not compromise any accuracy in the hot channel local fluid conditions. Extensive qualifications include sensitivity studies of radial noding and crossflow parameters and comparisons with the results from THINC and CALOPEA subchannel codes. The qualifications confirm that the VIPRE code with the Westinghouse modeling method provides good computational performance and accuracy for VVER-1000 DNB analyses.

VVANTAGE 6 - an advanced fuel assembly design for VVER reactors

International Nuclear Information System (INIS)

Doshi, P.K.; DeMario, E.E.; Knott, R.P.

1993-01-01

Over the last 25 years, Westinghouse fuel assemblies for pressurized water reactors (PWR's) have undergone significant changes to the current VANTAGE 5. VANTAGE 5 PWR fuel includes features such as removable top nozzles, debris filter bottom nozzles, low-pressure-drop zircaloy grids, zircaloy intermediate flow mixing grids, optimized fuel rods, in-fuel burnable absorbers, and increased burnup capability to region average values of 48000 MWD/MTU. These features have now been adopted to the VVER reactors. Westinghouse has completed conceptual designs for an advanced fuel assembly and other core components for VVER-1000 reactors known as VANTAGE 6. This report describes the VVANTAGE 6 fuel assembly design

CORONA ACADEMY, Opportunities for Enhancement of Training Capabilities in VVER Technology

International Nuclear Information System (INIS)

Ilieva, M.; Dieguez Porras, P.; Klepakova, A.

2016-01-01

Full text: The general objective of the project CORONA II is to enhance the safety of nuclear installations through further improvement of the training capabilities for providing the necessary personnel competencies in VVER area. More specific objective of the project is to continue the development of a state-of-the-art regional training network for VVER competence called CORONA Academia. The project aims at continuation of the European cooperation and support in this area for preservation and further development of expertise in the nuclear field by improvement of higher education and training. The consortium is focusing its effort on using the most advanced ways of providing training to the trainees, saving cost and time–distance learning and e-learning approaches which will be tested in CORONA II Project. The knowledge management portal will integrate the information on VVER web into a single communication system and develop and implement a semantic web structure to achieve mutual recognition of authentication information with other databases. That will enable the partners to share the materials available in each specific training center. (author

Thermal aging effects of VVER-1000 weld metal under operation temperature

International Nuclear Information System (INIS)

Chernobaeva, A.A.; Kuleshova, E.A.; Gurovich, B.A.; Erak, D.Y.; Zabusov, O.O.; Maltsev, D.A.; Zhurko, D.A.; Papina, V.B.; Skundin, M.A.

2015-01-01

The VVER-1000 thermal aging surveillance specimen sets are located in the reactor pressure vessel (RPV) under real operation conditions. Thermal aging surveillance specimens data are the most reliable source of the information about changing of VVER-1000 RPV materials properties because of long-term (hundred thousand hours) exposure at operation temperature. A revision of database of VVER-1000 weld metal thermal aging surveillance specimens has been done. The reassessment of transition temperature (T t ) for all tested groups of specimens has been performed. The duration of thermal exposure and phosphorus contents have been defined more precisely. The analysis of thermal aging effects has been done. The yield strength data, study of carbides evolution show absence of hardening effects due to thermal aging under 310-320 C degrees. Measurements of phosphorus content in grain boundaries segregation in different states have been performed. The correlation between intergranular fracture mode in Charpy specimens and transition temperature shift under thermal aging at temperature 310-320 C degrees has been revealed. All these data allow developing the model of thermal aging. (authors)

Application of a Russian nuclear reactor simulator VVER-1000

International Nuclear Information System (INIS)

Lopez-Peniche S, A.; Salazar S, E.

2012-10-01

The objective of the present work is to give to know the most important characteristics in the Russian nuclear reactor of pressurized light water VVER-1000, doing emphasis in the differences that has with the western equivalent the reactor PWR in the design and the safety systems. Therefore, a description of the computerized simulation of the reactor VVER-1000 developed by the company Eniko TSO that the International Atomic of Energy Agency distributes to the states members with academic purposes will take place. The simulator includes mathematical models that represent to the essential systems in the real nuclear power plant, for what is possible to reproduce common faults and transitory characteristic of the nuclear industry with a behavior sufficiently attached to the reality. In this work is analyzed the response of the system before a turbine shot. After the accident in the nuclear power plant of Three Mile Island (US) they have been carried out improvements in the design of the reactor PWR and their safety systems. To know the reach and the limitations of the program, the events that gave place to this accident will be reproduced in the simulator VVER-1000. With base to the results of the simulation we will conclude that so reliable is the response of the safety system of this reactor. (Author)

Safety improvements made at the Loviisa nuclear power plant to reduce fire risks originating from the turbine generators

International Nuclear Information System (INIS)

Virolainen, T.; Marttila, J.; Aulamo, H.

1998-01-01

Comprehensive upgrading measures have been completed for the Loviisa Nuclear Power Plant (modified VVER440/V213). These were carried out from the start of the design phase and during operation to ensure safe plant shutdown in the event of a large turbine generator oil fire. These modifications were made mainly on a deterministic basis according to specific risk studies and fire analyses. As part of the probabilistic safety assessment, a fire risk analysis was made that confirmed the importance of these upgrading measures. In fact, they should be considered as design basis modifications for all VVER440 plants. (author)

Results of operation of VVER-1000 FAs manufactured at PJSC NCCP

International Nuclear Information System (INIS)

Davidov, D.; Brovkin, O.; Bezborodov, Y.

2015-01-01

Fuel Assemblies manufactured at PJSC NCCP are in operation at 27 VVER-1000 power units at 11 NPPs in Russia, Ukraine, Bulgaria, China, Iran and India. Basic results of operation of PJSC NCCP VVER-1000 FAs during 2007-2014 are presented. The operation results confirm the design characteristics of fuel, i.e.: average fuel burnup up to 55 MW*day/kgU in FAs; safe and reliable FA operation, with low leaking rate (in the order of 10-6). The achieved operation characteristics of TVSA and TVS-2M Fuel Assemblies prove the quality, reliability and competitiveness of FAs manufactured at PJSC NCCP

Development of TVSA VVER-1000 fuel

International Nuclear Information System (INIS)

Samoilov, O.; Kaydalov, V.; Romanov, A.; Falkov, A.; Morozkin, O.; Sholin, E.

2013-01-01

The TVSA fuel assemblies with a rigid angle-piece skeleton operate at 21 VVER-1000 units of Kalinin NPP, and Ukrainian, and Czech and Bulgarian NPPs. The total of more than 6,000 TVSA fuel assemblies have been fabricated. High lifetime performance has been achieved, namely, the maximum FA burnup is 65 MW∙day/kgU; maximum fuel rod burnup is 72 MW∙day/kgU; the lifetime is 50,000 EFPH. The TVSA fuel assembly is being improved to enhance its technical and economic performance and competitiveness of the Russian fuel for the VVER-1000 reactor: 1) Reliability and safety are being enhanced; repairability is being ensured. 2) High burnup levels in fuel are being ensured. 3) The uranium content in FAs is being increased. 4) The operational life is being extended. 5) Thermal-technical characteristics of FAs are being improved. The basic TVSA fuel assembly design evolved into the TVSA-PLUS with the fuel column elongated by 150 mm. The TVSA-PLUS fuel assembly has been in operation since 2010 at Kalinin NPP power units; an eighteen-month cycle is implemented at the uprated power of 104%. The TVSA-12PLUS fuel assembly has been developed with an elongated fuel column, optimized spacer grid positions (the spacer grid pitch is 340 mm) and with ensuring higher rigidity for the skeleton. It is provided for that fuel rods with the elevated uranium content and mixing intensifier grids will be used. The TVSA-T is developed for VVER-1000 reactor cores at the Temelin NPP. The TVSA-T is characterized by a load-carrying skeleton formed with angle-pieces and combined spacer grids that incorporate mixer grids. The TVSA-T design won the international tender to supply fuel to the Temelin NPP in the Czech Republic, and currently Temelin NPP Unit 1 and 2 are operating with the cores fully loaded with TVSA-Ts

Experimental studies of resistance fretting-wear of fuel rods for VVER-1000 and TVS-KVADRAT fuel assemblies

International Nuclear Information System (INIS)

Makarov, V.; Afanasiev, A.; Egorov, Yu.; Matvienko, I.

2015-01-01

The paper covers the results of the studies performed to justify the wear resistance of fuel rods in contact with the spacer grids of TVS VVER-1000 fuel assembly and TVS-KVADRAT square fuel assembly of Russian design for PWR-900 reactor. The presented results of three testing stages comprise: Testing of mockup fuel rods of VVER TVS fuel assembly for fretting wear under the conditions of the water chemistry of VVER reactor; Testing models of different design embodiments of the fuel rods for VVER TVS fuel assembly for fretting wear in still cold water; Testing mockup fuel rods of TVS-KVADRAT square fuel assembly for PWR reactor for frettingwear under the conditions of PWR water chemistry. The effect of structural and operational factors was determined (amplitudes, fuel rod vibration frequencies, values of cladding-to-spacer grid cell gap for the depth of fuel rod cladding wear etc.), an assessment was made of the threshold values of fuel rod vibration parameters, which, if not exceeded, provide the absence of the fuel rod cladding fretting wear in the fuel rod-to spacer grid contact area. Key words: fretting wear, fuel rod, spacer grid, VVER, PWR (author)

Nuclear plant analyzer program for Bulgaria

International Nuclear Information System (INIS)

Shier, W.; Kennett, R.

1993-01-01

An interactive nuclear plant analyzer(NPA) has been developed for use by the Bulgarian technical community in the training of plant personnel, the development and verification of plant operating procedures, and in the analysis of various anticipated operational occurrences and accident scenarios. The current NPA includes models for a VVER-440 Model 230 and a VVER-1000 Model 320 and is operational on an IBM RISC6000 workstation. The RELAP5/MOD2 computer code has been used for the calculation of the reactor responses to the interactive commands initiated by the NPA operator. The interactive capabilities of the NPA have been developed to provide considerable flexibility in the plant actions that can be initiated by the operator. The current capabilities for both the VVER-440 and VVER-1000 models include: (1) scram initiation; (2) reactor coolant pump trip; (3) high pressure safety injection system initiation; (4) low pressure safety injection system initiation; (5) pressurizer safety valve opening; (6) steam generator relief/safety valve opening; (7) feedwater system initiation and trip; (8) turbine trip; and (9) emergency feedwater initiation. The NPA has the capability to display the results of the simulations in various forms that are determined by the model developer. Results displayed on the reactor mask are shown through the user defined, digital display of various plant parameters and through color changes that reflect changes in primary system fluid temperatures, fuel and clad temperatures, and the temperature of other metal structures. In addition, changes in the status of various components and systems can be initiated and/or displayed both numerically and graphically on the mask. This paper provides a description of the structure of the NPA, a discussion of the simulation models used for the VVER-440 and the VVER-1000, and an overview of the NPA capabilities. Typical results obtained using both simulation models will be discussed

MEASUREMENTS OF THE CONFINEMENT LEAKTIGHTNESS AT THE KOLA NUCLEAR POWER STATION (UNIT 2) IN RUSSIA

International Nuclear Information System (INIS)

GREENE, G.A.; GUPPY, J.G.

1998-01-01

This is the final report on the INSP project entitled, ''Kola Confinement Leaktightness'' conducted by BNL under the authorization of Project Work Plan WBS 1.2.2.1. This project was initiated in February 1993 to assist the Russians to reduce risks associated with the continued operation of older Soviet-designed nuclear power plants, specifically the Kola VVER-440/230 Units 1 and 2, through upgrades in the confinement performance to reduce the uncontrolled leakage rate. The major technical objective of this-project was to improve the leaktightness of the Kola NPP VVER confinement boundaries, through the application of a variety of sealants to penetrations, doors and hatches, seams and surfaces, to the extent that current technology permitted. A related objective was the transfer, through training of Russian staff, of the materials application procedures to the staff of the Kola NPP. This project was part of an overall approach to minimizing uncontrolled releases from the Kola NPP VVER440/230s in the event of a serious accident, and to thereby significantly mitigate the consequences of such an accident. The US provided materials, application technology, and applications equipment for application of sealant materials, surface coatings, potting materials and gaskets, to improve the confinement leaktightness of the Kola VVER-440/23Os. The US provided for training of Russian personnel in the applications technology

Implementation of the neutronics model of HEXTRAN/HEXBU-3D into APROS for WWER calculations

International Nuclear Information System (INIS)

Rintala, J.

2008-01-01

A new three-dimensional nodal model for neutronics calculation is currently under implementation into APROS - Advanced PROcess Simulation environment - to conform the increasing accuracy requirements. The new model is based on an advanced nodal code HEXTRAN and its static version HEXBU-3D by VTT, Technical Research Centre of Finland. Currently the new APROS is under a testing programme. Later a systematic validation will be performed. In the first phase, a goal is to obtain a fully validated model for VVER-440 calculations. Thus, all the current test calculations are performed by using Loviisa NPP's VVER-440 model of APROS. In future, the model is planned to be applied for the calculations of VVER-1000 type reactors as well as in rectangular fuel geometry. The paper outlines first the general aspects of the method, and then the current situation of the implementation. Because of the identical model with the models of HEXTRAN and HEXBU-3D, the results in the test calculations are compared to the results of those. In the paper, results of two static test calculations are shown. Currently the model works well already in static analyses. Only minor problems with the control assemblies of VVER-440 type reactor still exist but the reasons are known and will be corrected in near future. Dynamical characteristics of the model are up to now tested only by some empirical tests. (author)

MEASUREMENTS OF THE CONFINEMENT LEAKTIGHTNESS AT THE KOLA NUCLEAR POWER STATION (UNIT 2) IN RUSSIA

Energy Technology Data Exchange (ETDEWEB)

GREENE,G.A.; GUPPY,J.G.

1998-08-01

This is the final report on the INSP project entitled, ``Kola Confinement Leaktightness'' conducted by BNL under the authorization of Project Work Plan WBS 1.2.2.1. This project was initiated in February 1993 to assist the Russians to reduce risks associated with the continued operation of older Soviet-designed nuclear power plants, specifically the Kola VVER-440/230 Units 1 and 2, through upgrades in the confinement performance to reduce the uncontrolled leakage rate. The major technical objective of this-project was to improve the leaktightness of the Kola NPP VVER confinement boundaries, through the application of a variety of sealants to penetrations, doors and hatches, seams and surfaces, to the extent that current technology permitted. A related objective was the transfer, through training of Russian staff, of the materials application procedures to the staff of the Kola NPP. This project was part of an overall approach to minimizing uncontrolled releases from the Kola NPP VVER440/230s in the event of a serious accident, and to thereby significantly mitigate the consequences of such an accident. The US provided materials, application technology, and applications equipment for application of sealant materials, surface coatings, potting materials and gaskets, to improve the confinement leaktightness of the Kola VVER-440/23Os. The US provided for training of Russian personnel in the applications technology.

Investigation of primary-to-secondary leakage accident on the PSB-VVER integral test facility

Energy Technology Data Exchange (ETDEWEB)

Lipatov, I.A.; Dremin, G.I.; Galtchanskaya, S.A.; Chmal, I.I.; Moloshnikov, A.S.; Gorbunov, Y.S.; Antonova, A.I. [Electrogorsk Research and Engineering Center, EREC, Moscow (Russian Federation); Elkin, I.V. [RRC ' ' Kurchatov Institute, Moscow (Russian Federation)

2001-07-01

The full text follows. The paper presents the main results from the test on primary-to-secondary leakage of 100 mm in equivalent diameter. The test was performed on the PSB-VVER integral test facility. PSB-VVER is a 4-loops scaled down model of primary system of NPP with VVER-1000 Russian type reactor. Volume - power scale is about 1/300 while elevation scale is 1/1. All components of the primary system of the reference NPP are modeled on PSB-VVER. Both passive (accumulators) and active (high and low pressure) ECCSs, pressurizer spray and relief circuits, feed water system and atmospheric dumping system (ADS) as well as the primary circuit gas remove emergency system are also simulated. The primary-to-secondary leakage was simulated using an external break line which connects the upper part of the hot header to SG water volume. The break line included a break nozzle (a cylindrical channel d = 5.8 mm, l/d = 10 with sharp inlet edge), quick-acting valve and two-phase mass flow rate measurement system. In addition loss of off-site power at the moment when a scram-signal is generated was assumed in the experiment. Thus the accident is to be considered as a beyond-design-basic one. The loss of off-site power results in the following: -main circulation pump shutdown; -pressurizer heaters switching off; -HPIS water cooling flow rate and number of points of water injection are reduced The study focuses on the adequacy of the associated accident management (AM) procedure developed by EDO ''GIDROPRESS'' as a General Designer of VVER-type reactors. The AM-procedure was adopted to the PSB-VVER test facility conditions using CATHARE (France) and DINAMIKA (Russia) codes analysis. The AM-procedure in PSB-VVER is as follows: after about 30 min of the onset of the accident, when the accident type and the localization of the SG affected become evident for the operator, he closes all the main steam isolation valves, inhibits the ADS actuation in the affected SG

Transient thermal-hydraulic/neutronic analysis in a VVER-1000 reactor core

International Nuclear Information System (INIS)

Seyed khalil Mousavian; Mohammad Mohsen Ertejaei; Majid Shahabfar

2005-01-01

Full text of publication follows: Nowadays, coupled thermal-hydraulic and three-dimensional neutronic codes in order to consider different feedback effects is state of the art subject in nuclear engineering researches. In this study, RELAP5/COBRA and WIMS/CITATION codes are implemented to investigate the VVER-1000 reactor core parameters during Large Break Loss of Coolant Accident (LB-LOCA). In a LB-LOCA, the primary side pressure, coolant density and fuel temperature strongly decrease but the cladding temperature experiences a strong peak. For this purpose, the RELAP5 Best Estimate (BE) system code is used to simulate the LB-LOCA analysis in VVER-1000 nuclear thermal-hydraulic loops. Also, the modified COBRA-IIIc software as a sub-channel analysis code is applied for modeling of VVER-1000 reactor core. Moreover, WIMS and CITATION as a cross section and 3-D neutron flux codes are coupled with thermal-hydraulic codes with the aim of consider the spatial effects through the reactor core. For this reason, suitable software is developed to link and speed up the coupled thermalhydraulic and three-dimensional neutronic calculations. This software utilizes of external coupling concept in order to integrate thermal-hydraulic and neutronic calculations. (authors)

VVER operational safety improvements: lessons learnt from European co-operation and future research needs

International Nuclear Information System (INIS)

Pazdera, F.; Vasa, I.; Zd'arek, J.

2003-01-01

The paper summarises involvement of Nuclear Research Institute Rez (NRI) in the areas which are directly related to Reactor Operational Safety and Plant Life Management, it also gives an idea how results of the research projects can be used to enhance safety of VVER reactors. These issues are for many years subject of a wide international co-operation effort, covered by such programmes as PHARE, OECD/NEA TACIS, 5th Framework Programme. Nuclear Research Institute participated in the majority of these programmes and projects, which allowed us to evaluate benefits (especially for VVER reactors) of the projects already finalised or running, as well as to formulate so-called 'future research needs', which possibly may be pursued within 6th Framework Programme. The paper highlights the main features of some projects our Institute was and is involved in, emphasising the most important results, expectations and future needs. It also very briefly, deals with some general and particular lessons learnt within these projects and their application to VVER reactors, especially as to their safety improvement. The paper also mentions VVER-focused projects and activities, co-ordinated by the OECD, which should enable to extend multilateral contacts already existing between organisations of the EU countries to include organisations from Russia, USA, Japan and possibly some other countries

Multiple recycle of REMIX fuel at VVER-1000 operation in closed fuel cycle

Energy Technology Data Exchange (ETDEWEB)

Alekseev, P. N.; Bobrov, E. A., E-mail: evgeniybobrov89@rambler.ru; Chibinyaev, A. V.; Teplov, P. S.; Dudnikov, A. A. [National Research Center Kurchatov Institute (Russian Federation)

2015-12-15

The basic features of loading the VVER-1000 core with a new variant of REMIX fuel (REgenerated MIXture of U–Pu oxides) are considered during its multiple recycle in a closed nuclear fuel cycle. The fuel composition is produced on the basis of the uranium–plutonium regenerate extracted at processing the spent nuclear fuel (SNF) from a VVER-1000, depleted uranium, and the fissionable material: {sup 235}U as a part of highly enriched uranium (HEU) from warheads superfluous for defense purposes or {sup 233}U accumulated in thorium blankets of fusion (electronuclear) neutron sources or fast reactors. Production of such a fuel assumes no use of natural uranium in addition. When converting a part of the VVER-1000 reactors to the closed fuel cycle based on the REMIX technology, the consumption of natural uranium decreases considerably, and there is no substantial degradation of the isotopic composition of plutonium or change in the reactor-safety characteristics at the passage from recycle to recycle.

Safety upgrading of the PAKS Nuclear Plant

International Nuclear Information System (INIS)

Vamos, G.; Vigassy, J.

1993-01-01

In the last several years the net electricity from the Paks NPP represents almost half of the Hungarian total. The 4 units of Paks belong to the latest generation of the VVER-440 units, the small-sized Russian designed PWRs. Reviewing the main design features of them, the safety merits and safety concerns are summarized. Due to the conservative design and the extensive operating experience the safety merits appear to be more significant than generally believed. The VVER-440 type has two models, the 230 and 213, which have a large number of distinctive safety features. These are highlighted in the section comparisons. A quality assurance program was initiated in Paks very early. A long-term safety upgrading program was also initiated, originating from vendor recommendations, regulatory decisions, in-house operating experience and safety concerns, and independent reviews. The main areas and some examples of the measures are described. This program, like all other activities related to nuclear safety, has been under regulatory control. The specific features of the Hungarian regulatory system are described. For advanced, general and new evaluation of the safety of the units in Paks in accordance with the internationally recommended criteria of the 90's, the project AGNES has been launched with international participation. The scope of this project is summarized. International efforts as the IAEA Regional Project on safety assessment of VVER-440/213 and VVER-440/230 units are underway. Since safety is not only a question of design, but it can be significantly influenced by operations and maintenance practices, the Paks NPP has invited LAEA's OSART and ASSET missions, WANO's Pilot Peer Review

Numerical Boron mixing studies for Loviisa Nuclear Power Plant

Energy Technology Data Exchange (ETDEWEB)

Gango, P. [IVO International Ltd. (Finland)

1995-09-01

A program has been started for studying numerically boron mixing in the downcomer of Loviisa NPP (VVER-440). Mixing during the transport of a diluted slug from the loop to the core might serve as an inherent protection mechanism against severe reactivity accidents in inhomogenous boron dilution scenarios for PWRs. The commercial general purpose Computational Fluid Dynamics (CFD) core PHOENICS is used for solving the governing fluid flow equations in the downcomer geometry of VVER-440. So far numerical analyses have been performed for steady state operation conditions and two different pump driven transients. The steady state analyses focused on model development and validation against existing experimental data. The two pump driven transient scenarios reported are based on slug transport during the start of the sixth and first loop respectively. The results from the two transients show that mixing is case and plant specific; the high and open downcomer geometry of VVER-440 seems to be advantageous from mixing point of view. In addition the analyzing work for the {open_quotes}first pump start{close_quotes} scenario brought up some considerations about flow distribution in the existing experimental facilities.

Simulation of a nuclear accident by an academic simulator of a VVER-1000 reactor; Simulacion de un accidente nuclear, mediante un simulador academico de un reactor VVER-1000

Energy Technology Data Exchange (ETDEWEB)

Hernandez G, L. [UNAM, Facultad de Ingenieria, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Salazar S, E., E-mail: laurahg42@gmail.com [UNAM, Facultad de Ingenieria, Laboratorio de Analisis en Ingenieria de Reactores Nucleares, 62250 Jiutepec, Morelos (Mexico)

2014-10-15

This work is planned to simulate a scenario in which the same conditions that caused the accident at the Fukushima Daichi nuclear power plant are present, using a simulator of a nuclear power plant with VVER-1000 reactor, a different type of technology to the NPP where the accident occurred, which used BWR reactors. The software where it will take place the simulation was created and distributed by the IAEA for academic purposes, which contains the essential systems that characterize this type of NPP. The simulator has tools for the analysis of the characteristic phenomena of a VVER-1000 reactor in the different systems together and planned training tasks. This makes possible to identify the function of each component and how connects to other systems, thus facilitating the visualization of possible failures and the consequences that they have on the general behavior of the reactor. To program the conditions in the simulator, is necessary to know and synthesize a series of events occurred in Fukushima in 2011 and the realized maneuvers to reduce the effects of the system failures. Being different technologies interpretation of the changes that would suffer the VVER systems in the scenario in question will be developed. The Fukushima accident was characterized by the power loss of regular supply and emergency of the cooling systems which resulted in an increase in reactor temperature and subsequent fusion of their nuclei. Is interesting to reproduce this type of failure in a VVER, and extrapolate the lack of power supply in the systems that comprise, as well as pumping systems for cooling, has a pressure regulating system which involves more variables in the balance of the system. (Author)

Evaluation of reliability of EC inspection of VVER SG tubes

International Nuclear Information System (INIS)

Stanic, D.

2001-01-01

Evaluation of eddy current data collected during inspection of VVER steam generators is very complex task because of numerous parameters which have affect on eddy current signals. That was the reason that recently ago INETEC has started related scientific project in order to evaluate the reliability of eddy current (EC) inspection of VVER steam generator (SG) tubing. In the scope of project the following objectives will be investigated: 1. Determination of POD (Probability of detection) of various types degradation cracks, where their basic parameters are variables (basic parameters are depth, length, width, orientation, number) on three different sets of tubes (clean ideal tubes, tubes with pilgering, tubes electroplated with copper) 2. Sizing quality (accuracy, repeatability) (same data sets as defined in 1.) 3. Effect of fill factor on POD and sizing quality. 4. Effect of tube bends on POD and sizing quality. 5. Effect of other tube geometry variations on POD and sizing quality (tube ovality, transition zone region, expanded (rolled) part of tube, dents, dings). Investigation will start with bobbin probe technique which is the most used technique for general purpose VVER tube examination. Since INETEC is the only world company which successfully developed and applied rotating probe technique for VVER SG tubes, scope of the project will be extended on rotating probe technique utilizing 'pancake' and 'point' coil. Method reliability will be investigated first on the huge set of EDM notches representing various defect morphologies and simulating different factors, and the second part will be investigated on sets of degradation defects obtained by artificial corrosion. In the scope of the project the measures for enhancing the method reliability have to be determined. This considers the proper definition of parameters of examination system, as well as establishment of the suitable analysis procedures. This article presents the temporary results of the first part of

Dicty_cDB: SLC440 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC440 (Link to dictyBase) - G22407 DDB0231506 Contig-U13322-1 | Contig-U16512-1 SLC4...40P (Link to Original site) SLC440F 491 SLC440Z 449 SLC440P 940 - - Show SLC440 Libra...ry SL (Link to library) Clone ID SLC440 (Link to dictyBase) Atlas ID - NBRP ID G22407 dictyBase ID DDB023150...cdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC440Q.Seq.d/ Representative seq. ID SLC440P (Link to Original site) R...epresentative DNA sequence >SLC440 (SLC440Q) /CSM/SL/SLC4-B/SLC440Q.Seq.d/ GGAGATTTCACCACCACCAACAGAACAACACCA

Solution of safety problems for nuclear power plants with WWER-440 reactors

International Nuclear Information System (INIS)

Krett, V.; Pernitsa, R.; Pfann, Ya.; Zbeglik, J.

1982-01-01

Institute of nuclear research (INR) of Czechoslovakian Atomic Energy Commission isto fulfil the supervision functions within the field of nuclear power research and development. The problems of safe operation ensurance for the nuclear power plants (NPP) with WWER-440 reactors are studied within the frame of sever major issues: code standardization and devolopment of guiding materials for the state supervision; neutronic and thermohydrolic data processing for the accident analysis; operation reliability studies of the safety systems and estimates of separate component failure importance; assessment of the accidents resulting from the equipment misfunctioning and component failures; development of a controlled reliability program; evaluation of the atomic installationsimpact on the environment; ensurence of the reactor vessel reliability and durability under irradiation. The NPP safety analysis incorporates the calculations of transient and accidental regimes for the core, the primary loop and the entire plant. A number of codes has been produced which allow to determine the state of fuel elements during operation just before the accidents assessed, thermohydrolic conditions in the coolant and the temperature distribution within the fuel both for the stationary reactor conditions and for transient regimes. A mathematical model has been deveoloped, including the description of all the primary loop major components. The Soviet code DYNAMIKA has been adopted and adjusted for EC-1040 computer, there by the accident analysis for the entire NPP has been made possible. On the basis of american SAFTE code a faster SAFEDO-2 code has been developed employing the Monte Carlo method for the accident analysis of a complex system described by means of a failure tree. The discussed codes are used at the data assessment for the accident analysis part of the safety reports as well as for the reliability evaluation of the emergency core cooling system [ru

PSB-VVER simulation of Kozloduy NPP 'loss of feed water transient'

Energy Technology Data Exchange (ETDEWEB)

Groudev, P.P. [Institute for Nuclear Research and Nuclear Energy, Tzarigradsko Shaussee 72, Sofia 1784 (Bulgaria)]. E-mail: pavlinpg@inrne.bas.bg; Stefanova, A.E. [Institute for Nuclear Research and Nuclear Energy, Tzarigradsko Shaussee 72, Sofia 1784 (Bulgaria)]. E-mail: antoanet@inrne.bas.bg; Gencheva, R.V. [Institute for Nuclear Research and Nuclear Energy, Tzarigradsko Shaussee 72, Sofia 1784 (Bulgaria)]. E-mail: roseh@inrne.bas.bg; Pavlova, M.P. [Institute for Nuclear Research and Nuclear Energy, Tzarigradsko Shaussee 72, Sofia 1784 (Bulgaria)]. E-mail: pavlova@inrne.bas.bg

2005-04-01

This paper provides a comparison between the PSB test facility experimental results obtained during the simulation of loss of feed water transient (LOFW) and the calculation results received by INRNE computer model of the same test facility. Integral thermal-hydraulic PSB-VVER test facility located at Electrogorsk Research and Engineering Center on NPPs Safety (EREC) was put in operation in 1998. The structure of the test facility allows experimental studies under steady state, transient and accident conditions. RELAP5/MOD3.2 computer code has been used to simulate the loss of feed water transient in a PSB-VVER model. This model was developed at the Institute for Nuclear Research and Nuclear Energy for simulation of loss of feed water transient. The objective of the experiment 'loss of feed water', which has been performed at PSB-VVER test facility is simulation of Kozloduy NPP LOFW transient. One of the main requirements to the experiment scenario has been to reproduce all main events and phenomena that occurred in Kozloduy NPP during the LOFW transient. Analyzing the PSB-VVER test with a RELAP5/MOD3.2 computer code as a standard problem allows investigating the phenomena included in the VVER code validation matrix as 'integral system effects' and 'natural circulation'. For assessment of the RELAP5 capability to predict the 'Integral system effect' phenomenon the following RELAP5 quantities are compared with external trends: the primary pressure and the hot and cold leg temperatures. In order to assess the RELAP5 capability to predict the 'Natural circulation' phenomenon the hot and cold leg temperatures behavior have been investigated. This report was possible through the participation of leading specialists from Kozloduy NPP and with the support of Argonne National Laboratory (ANL), under the International Nuclear Safety Program (INSP) of the United States Department of Energy.

10 CFR 440.19 - Labor.

Science.gov (United States)

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Labor. 440.19 Section 440.19 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION WEATHERIZATION ASSISTANCE FOR LOW-INCOME PERSONS § 440.19 Labor. Payments for labor... supplement wages paid to training participants, public service employment workers, or other Federal or State...

Investigation of accident management procedures related to loss of feedwater and station blackout in PSB-VVER integral test facility

Energy Technology Data Exchange (ETDEWEB)

Bucalossi, A. [EC JRC, (JRC F.5) PO Box 2, 1755 ZG Petten (Netherlands); Del Nevo, A., E-mail: alessandro.delnevo@enea.it [ENEA, C.R. Brasimone, 40032 Camugnano (Italy); Moretti, F.; D' Auria, F. [GRNSPG, Universita di Pisa, via Diotisalvi 2, 56100 Pisa (Italy); Elkin, I.V.; Melikhov, O.I. [Electrogorsk Research and Engineering Centre, Electrogorsk, Moscow Region (Russian Federation)

2012-09-15

Highlights: Black-Right-Pointing-Pointer Four integral test facility experiments related to VVER-1000 reactor. Black-Right-Pointing-Pointer TH response of the VVER-1000 primary system following total loss of feedwater and station blackout scenarios. Black-Right-Pointing-Pointer Accident management procedures in case of total loss of feedwater and station blackout. Black-Right-Pointing-Pointer Experimental data represent an improvement of existing database for TH code validation. - Abstract: VVER 1000 reactors have some unique and specific features (e.g. large primary and secondary side fluid inventory, horizontal steam generators, core design) that require dedicated experimental and analytical analyses in order to assess the performance of safety systems and the effectiveness of possible accident management strategies. The European Commission funded project 'TACIS 2.03/97', Part A, provided valuable experimental data from the large-scale (1:300) PSB-VVER test facility, investigating accident management procedures in VVER-1000 reactor. A test matrix was developed at University of Pisa (responsible of the project) with the objective of obtaining the experimental data not covered by the OECD VVER validation matrix and with main focus on accident management procedures. Scenarios related to total loss of feed water and station blackout are investigated by means of four experiments accounting for different countermeasures, based on secondary cooling strategies and primary feed and bleed procedures. The transients are analyzed thoroughly focusing on the identification of phenomena that will challenge the code models during the simulations.

Modelling of thermal mechanical behaviour of high burn-Up VVER fuel at power transients with special emphasis on the impact of fission gas induced swelling of fuel pellets

International Nuclear Information System (INIS)

Novikov, V.; Medvedev, A.; Khvostov, G.; Bogatyr, S.; Kuzetsov, V.; Korystin, L.

2005-01-01

This paper is devoted to the modelling of unsteady state mechanical and thermo-physical behaviour of high burn-up VVER fuel at a power ramp. The contribution of the processes related to the kinetics of fission gas to the consequences of pellet-clad mechanical interaction is analysed by the example of integral VVER-440 rod 9 from the R7 experimental series, with a pellet burn-up in the active part at around 60 MWd/kgU. This fuel rod incurred ramp testing with a ramp value ΔW 1 ∼ 250 W/cm in the MIR research reactor. The experimentally revealed residual deformation of the clad by 30-40 microns in the 'hottest' portion of the rod, reaching a maximum linear power of up to 430 W/cm, is numerically justified on the basis of accounting for the unsteady state swelling and additional degradation of fuel thermal conductivity due to temperature-induced formation and development of gaseous porosity within the grains and on the grain boundaries. The good prediction capability of the START-3 code, coupled with the advanced model of fission gas related processes, with regard to the important mechanical (residual deformation of clad, pellet-clad gap size, central hole filling), thermal physical (fission gas release) and micro-structural (profiles of intra-granular concentration of the retained fission gas and fuel porosity across a pellet) consequences of the R7 test is shown. (authors)

The estimation of the control rods absorber burn-up during the VVER-1000 operation

Energy Technology Data Exchange (ETDEWEB)

Bolshagin, Sergey N.; Gorodkov, Sergey S.; Sukhino-Khomenko, Evgeniya A. [National Research Centre ' Kurchatov Institute' , Moscow (Russian Federation)

2013-09-15

The isotopic composition of the control rods absorber changes under the neutron flux influence, so the control rods efficiency can decrease. In the VVER-1000 control rods boron carbide and dysprosium titanate are used as absorbing materials. In boric part the efficiency decreases due to the {sup 10}B isotope burn-up. Dysprosium isotopes turn into other absorbing isotopes, so the absorbing properties of dysprosium part decrease to a lesser degree. Also the control rod's shells may be deformed as a consequence of boron carbide radiation swelling. This fact should be considered in substantiation of control rods durability. For the estimation of the control rods absorber burn-up two models are developed: VVER-1000 3-D fuel assembly with control rods partially immersed (imitation of the control rods operation in the working group) and VVER-1000 3-D fuel assembly with control rods, located at the upper limit switch (imitation of the control rods operation in groups of the emergency shutdown system). (orig.)

Operational benchmark for VVER-1000, unit 6, Kozloduy NPP

International Nuclear Information System (INIS)

Apostolov, T.; Petrov, B.

1999-01-01

Benchmark calculations have been carried out using the 3D nodal code TRAPEZ. Global neutron-physics characteristics of the VVER-1000 core, Kozloduy NPP Unit 6, have been determined taking into account the real loading patterns and operational history of the first three cycles. The code TRLOAD has been used to perform the fuel reloading between any two cycles. The reactor and components descriptions as well as material compositions are given. The results presented include the critical boric acid concentration, the radial power distribution, the axial power distribution for the maximum overload assembly, and the burnup distribution at three different moments during each cycle. Calculated values have been compared with measured data. It is shown that the results obtained by the TRAPEZ code are in good agreement with the experimental data. The information presented could serve as a test case for validation of code packages designed for analyzing the steady-state operation of VVERs. (author)

Simulation of VVER MCCI reactor test case with ASTEC V2/MEDICIS computer code

International Nuclear Information System (INIS)

Stefanova, A.; Grudev, P.; Gencheva, R.

2011-01-01

This paper presents an application of the ASTEC v2, module MEDICIS for simulation of VVER Molten core concrete interaction test (MCCI) case without water injection. The main purpose of performed calculation is verification and improvement of module MEDICIS/ASTECv2 for better simulation of core concrete interaction processes. The VVER-1000 reference nuclear power plant was chosen as SARNET2 benchmark MCCI test-case. The initial conditions for MCCI test are taken after SBO scenario calculated with ASTEC version 1.3R2 by INRNE. (authors)

Comparative study WWER-440/230 reactors and the Juragua-based WWER-440/318 project

International Nuclear Information System (INIS)

1994-01-01

The work consists in a comparative analysis between WWER-440/230 and WWER-440/318 type reactors on the basis of the major findings and recommendations given in the extra budgetary Programme of the International Atomic Energy Agency on the safety of these reactors and summarized in the document 'The safety of WWER-440 model 230 nuclear power plant'. The fundamental emphasis was done in the design concept of these reactors

Primary LOCA in VVER-1000 by pressurizer PORV failure

International Nuclear Information System (INIS)

Sabotinov, L.; Lutsanych, S.; Kadenko, I.

2013-01-01

The paper presents the calculations and analysis of the design basis accident of a standard VVER-1000/V320 reactor with inadvertent opening and stuck in open position of the pressurizer pilot operated relief valve (PORV). The objective is the independent assessment of this accident applying the French best estimate thermal-hydraulic computer code CATHARE 2 and verification to meet the safety criteria for such kind of the accident. The 'Inadvertent opening and stuck in open position of PORV' is a design basis accident classified as Medium Break Loss of Coolant Accident (MB LOCA) with the equivalent diameter of the break D- 68 mm. This accident is particularly interesting to be calculated and analyzed, because it took place at operating NPP with VVER-1000 reactors (Rovno NPP) in 2009. The calculations have been carried out with conservative conditions as usual for DBA analysis. The NPP model corresponds to a real VVER-1000/V320 configuration and comprises all safety systems, adopted for one of the latest CATHARE 2 versions. The results of CATHARE 2 calculations are compared with available results of RELAP5 calculations. There is similarity of the thermal-hydraulic parameters behavior, but also some differences can be observed basically due to the break flow prediction, which causes differences in primary pressure evaluation. Both calculations show that there is no boiling crisis in the reactor core and reliable cooldown is achieved. The calculations performed with CATHARE2 code demonstrate the ability of the code to predict reasonably the break flow, pressures, temperatures etc. for considered LOCA scenario and to be applied for safety studies

Safety provisions for steam generator in Mochovce nuclear power plant. BO CI 04 Integrity of primary collectors of VVER 440 steam generators

International Nuclear Information System (INIS)

Cikryt, F.; Bednarek, L.; Matocha, K.; Vejvoda, S.

1997-01-01

This paper dealt with the identification of possible damaging mechanism of the collector of the WWER 440 steam generator, cracking of primary collectors, corrosion damage of the protective coat of the primary collector circumferential weld, cracking of breathing space in the region of blinding effect by corrosion and strain, leaking of disassembling joint of the primary collector lid and with the integrity of heat exchanging tubes

OECD/DOE/CEA VVER-1000 coolant transient (V1000CT) benchmark for assessing coupled neutronics/thermal-hydraulics system codes for VVER-1000 RIA analysis

International Nuclear Information System (INIS)

Ivanov, B.; Ivanov, K.; Aniel, S.; Royer, E.; Kolev, N.; Groudev, P.

2004-01-01

The present paper describes the two phases of the OECD/DOE/CEA VVER-1000 coolant transient benchmark labeled as V1000CT. This benchmark is based on a data from the Bulgarian Kozloduy NPP Unit 6. The first phase of the benchmark was designed for the purpose of assessing neutron kinetics and thermal-hydraulic modeling for a VVER-1000 reactor, and specifically for their use in analyzing reactivity transients in a VVER-1000 reactor. Most of the results of Phase 1 will be compared against experimental data and the rest of the results will be used for code-to-code comparison. The second phase of the benchmark is planned for evaluation and improvement of the mixing computational models. Code-to-code and code-to-data comparisons will be done based on data of a mixing experiment conducted at Kozloduy-6. Main steam line break will be also analyzed in the second phase of the V1000CT benchmark. The results from it will be used for code-to-code comparison. The benchmark team has been involved in analyzing different aspects and performing sensitivity studies of the different benchmark exercises. The paper presents a comparison of selected results, obtained with two different system thermal-hydraulics codes, with the plant data for the Exercise 1 of Phase 1 of the benchmark as well as some results for Exercises 2 and 3. Overall, this benchmark has been well accepted internationally, with many organizations representing 11 countries participating in the first phase of the benchmark. (authors)

Primary water chemistry of VVERs-operating experience

International Nuclear Information System (INIS)

Kysela, Jan; Zmitko, Milan; Petrecky, Igor

1998-01-01

VVER units are operated in mixed boron-potassium-ammonia water chemistry. Several modifications of the water chemistry, differing in boron-potassium co-ordination and in the way how hydrogen concentration is produced and maintain in the coolant, is used. From the operational experience point of view VVER units do not show any significant problems connected with the primary coolant chemistry. The latest results indicate that dose rate levels are slowly returning to the former ones. An improvement of the radiation situation observed last two years is supported by the surface activity measurements. However, the final conclusion on the radiation situation can be made only after evaluation of the several following cycles. Further investigation is also needed to clarify a possible effect of modified water chemistry and shut-down chemistry on radioactivity build-up and dose rate level at Dukovany units. Structure materials composition has a significant effect on radiation situation in the units. It concerns mainly of cobalt content in SG material. There is no clear evidence of possible effect of the SG shut-down regimes on the radiation situation in the units even if the dose rate and surface activity data show wide spread for the individual reactor loops. (S.Y.)

Experience on KKNPP VVER 1000 MWe water chemistry

International Nuclear Information System (INIS)

Ganesh, S.; Selvaraj, S.; Balasubramanian, M.R.; Selvavinayagam, P.; Pillai, Suresh Kumar

2015-01-01

Kudankulam Nuclear Power Project consists of pressurized water reactor (VVER) 2 x 1000 MWe constructed in collaboration with Russian Federation at Kudankulam in Tirunelveli District, Tamilnadu. Unit - 1 attained criticality on July 13 th 2013 and the unit was synchronized to grid on 22 nd October 2013. This paper highlights experience gained on water chemistry regime for primary and secondary circuit. (author)

Modernization of Cross Section Library for VVER-1000 Type Reactors Internals and Pressure Vessel Dosimetry

Directory of Open Access Journals (Sweden)

Voloschenko Andrey

2016-01-01

Full Text Available The broad-group library BGL1000_B7 for neutron and gamma transport calculations in VVER-1000 internals, RPV and shielding was carried out on a base of fine-group library v7-200n47g from SCALE-6 system. The comparison of the library BGL1000_B7 with the library v7-200n47g and the library BGL1000 (the latter is using for VVER-1000 calculations is demonstrated on several calculation and experimental tests.

Multi codes and multi-scale analysis for void fraction prediction in hot channel for VVER-1000/V392

International Nuclear Information System (INIS)

Hoang Minh Giang; Hoang Tan Hung; Nguyen Huu Tiep

2015-01-01

Recently, an approach of multi codes and multi-scale analysis is widely applied to study core thermal hydraulic behavior such as void fraction prediction. Better results are achieved by using multi codes or coupling codes such as PARCS and RELAP5. The advantage of multi-scale analysis is zooming of the interested part in the simulated domain for detail investigation. Therefore, in this study, the multi codes between MCNP5, RELAP5, CTF and also the multi-scale analysis based RELAP5 and CTF are applied to investigate void fraction in hot channel of VVER-1000/V392 reactor. Since VVER-1000/V392 reactor is a typical advanced reactor that can be considered as the base to develop later VVER-1200 reactor, then understanding core behavior in transient conditions is necessary in order to investigate VVER technology. It is shown that the item of near wall boiling, Γ w in RELAP5 proposed by Lahey mechanistic method may not give enough accuracy of void fraction prediction as smaller scale code as CTF. (author)

Implementation of the SCDAP/RELAP5 Mod. 3.3 and MAAP/VVER codes

International Nuclear Information System (INIS)

Duspiva, J.; Vokac, P.; Dienstbier, J.

2001-05-01

The SR5 code was installed on a Hewlett/Packard workstation, and test problems, supplied with the software, were solved. Finally, the tool for graphical processing of the calculation results was prepared and tested. The MAAP/VVER code was installed on a HP J210 workstation and, in particular, on PC. The code was tested on two problems, supplied with the software. The transformation of the output from MAAP/VVER to the graphical format was carried out by using the support tools obtained as well as by using tools that have been in use at the Institute for other codes to analyze severe accidents. (P.A.)

Mochovce NPP safety improvement and completion

International Nuclear Information System (INIS)

1997-01-01

6th Nuclear society information meeting dealt with the completion of the Mochovce NPP with regard to implementation of safety measures. It was aimed to next problems: I. 'Survey' presentation on the situation of the nuclear power industry in partner countries; II. Basic technical presentations; III. Presentations of operators of the other VVER 440/213 NPPs on their activities in the field of safety improvement in relation to IAEA recommendations; IV. Technical solutions of safety improvements ranked with IAEA degree 3 (Report SC 108 VVER); V: Technical solutions of selected Safety Measures ranked with IAEA degree 2 and 1 (Report SC 108 VVER)

46 CFR 130.440 - Communications system.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Communications system. 130.440 Section 130.440 Shipping... MISCELLANEOUS EQUIPMENT AND SYSTEMS Automation of Unattended Machinery Spaces § 130.440 Communications system. (a) Each OSV must have a communications system to immediately summon a crew member to the machinery...

Conservative ground of qualification BRU-A VVER-1000 in modes of instability of diphasic environment

International Nuclear Information System (INIS)

Skalozubov, V.I.; Klyuchnikov, A.A.; Haj Farajallah Dabbach

2010-01-01

The article first presents grounds and conditions of origin of hydraulic shocks in the VVER system of safety relief valves, caused interchannel heat hydrodynamic instability of biphasic medium. It is supposed conservatively that origin of hydraulic shocks caused instability of biphasic stream determines the unavailability to close of safety relief valves. It is established that the modes of hydraulic shocks in safety relief valves of VVER 1000 (B-320) at the fully opened valves are not typical for the conditions of accidents with intercontour leakages.

21 CFR 573.440 - Ethylene dichloride.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Ethylene dichloride. 573.440 Section 573.440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additive Listing § 573.440 Ethylene dichloride. The food additive ethylene dichloride may be safely used in...

Core designs for new VVER reactors and operational experience of immediate prototypes

International Nuclear Information System (INIS)

Vasilchenko, I.; Mokhov, V.; Ryzhov, S.

2011-01-01

The paper covers the recent improvements analyzed in order to implement the enhanced core performances. AES-2006 reactor core design is considered from the point of view of its application and improvement in the planned VVER-TOI project and of the possibilities of using the basic engineering solutions for the cores with spectral control. The discussion of several types of mixing grids considered in the paper involves a preliminary assessment of their efficiency and the information on their introduction into pilot operation at the VVER-1000 Units. Special attention is given to the results of the operation of immediate prototypes (TVS-2 and TVS-2M) that corroborate the reliability of the design both with regard for the core geometrical stability and fuel cladding tightness

Status and prospects of the core surveillance system SCORPIO-VVER in Czech Republic and Slovakia

International Nuclear Information System (INIS)

Molnar, J.; Vocka, R.

2011-01-01

The SCORPIO-VVER core monitoring system has proved since the first installation at Dukovany NPP in 1999 to be a valuable tool for the reactor operators and reactor physicists. It is now installed on four units of Dukovany NPP (Czech Republic) and two units of Bohunice NPP (Slovak Republic) replacing the original Russian VK3 system. By both Czech and Slovak nuclear regulatory bodies it was licensed as a Technical Specification Surveillance tool. Since it's first installation, the development of SCORPIO-VVER system continues along with the changes in WWER reactors operation. The system is being adapted according the utility needs and several notable improvements in physical modules of the system were introduced. The latest most significant changes were done in connection with implementation of a new digital I and C system, loading of the optimized gadolinium bearing Gd2 fuel assemblies, improvements in the area of core design (neutron physics, core thermal hydraulics and fuel thermal mechanics), adaptation of the system to up-rated unit conditions, in design and methodology of the limit and technical specifications checking (implementation of the on-line shutdown margin calculation to the system) and improvements in the predictive part of the system (Strategy Generator). After the currently finished upgrades (Upgrade 2 at EBO Slovakia in 2009, Upgrade 5 at EDU Czech Republic in 2010) the SCORPIO-VVER is still in focus of Central European nuclear power plants with the road map of modification and implementation up to 2015. In April 2011 the Upgrade 3 at EBO Slovakia has been contracted to support the changed reactor technical specification and for support of the new type of fuel planned to load in 2012. During the summer of 2011 the discussions started with EDU NPP in Czech Republic regarding to the future development of the SCORPIO-VVER system up to 2015. Parallel with the support of current installations at NPPs the project of new installations is ongoing. During

Application of the Defense-in-Depth Concept in the Projects of New-Generation NPPs Equipped with VVER Reactors

Energy Technology Data Exchange (ETDEWEB)

Shvyryaev, Yu. V.; Morozov, V. B.; Kuchumov, A.Yu., E-mail: morozov@aep.ru [JSC Atomenergoproekt, Moscow (Russian Federation)

2014-10-15

The projects of new-generation NPPs equipped with VVER reactors are developed as projects the safety level of which is superior to that of NPPs that are currently in operation. The main design solutions adopted for implementing the defence-in-depth (DiD) concept in the projects of new-generation NPPs equipped with VVER reactors are briefly characterized in the paper. (author)

Fusion of eastern and western technology in VVER 1000 NPP upgrade

International Nuclear Information System (INIS)

Ubra, O.; Fleischhans, J.; Kveton, M.

1997-01-01

An extensive modernization program upgrading two units of VVER 1000 type of the Czech nuclear power plant (NPP) Temelin to meet the latest international standards is presented. The program is based primarily on combination of eastern and western technology and it has been implemented during plant construction. The NPP Temelin was originally designed according to the standards of the former Soviet Union. After a series of reviews in the 1990s, a decision was made by the Temelin management of upgrade the design of the plant, including the supply of fuel and instrumentation and control system by a western company. The adoption of western technology and practices has helped to solve a large number of IAEA safety issues related to design and operation of VVER 1000 NPP. Details on the current Temelin design and other related safety matters are presented

Radioactive sludge and wastewater analysis and treatment in the Hungarian VVER-440/213-type NPP

International Nuclear Information System (INIS)

Patzay, G.; Weiser, L.; Feil, F.; Schunk, J.; Patek, G.; Pinter, T.

2010-01-01

It is well known that in the Hungarian VVER-type nuclear power plant Paks the radioactive waste waters are collected in common tanks. These water streams contain radioactive isotopes in ultra-low concentration and inactive compounds as major components (borate 1.7 g/dm 3 , sodium-nitrate 0.4 g/dm 3 , sodium-hydroxide 0.16 g/dm 3 , and oxalate 0.25 g/dm 3 ). These low salinity solutions were evaporated by adding sodium-hydroxide, until 400 g/dm 3 salt content is reached. There is about 6000 m 3 concentrated evaporator bottom residues in the tanks of the reactor. There are some tanks at the power plant containing sludge type radioactive waste containing more or less liquid phase too. The general physical and chemical characteristics (density, pH, total solid, dissolved solid etc.) and chemical and radiochemical composition are important information for volume reduction and solidification treatment of these wastes. We have investigated and constructed a complex analysis system for the radioactive sludge and supernatant analysis, including the physical, as well as the chemical and radiochemical analysis methods. Using well known analysis techniques as ion chromatography, ICP-MS, AAS, gamma-and alpha-spectrometry and chemical alkaline fusion digestion and acidic dissolution methods we could analyze the main inorganic, organic and radioactive components of the sludges and supernatants. Determination of the mass and charge balance for the sludge samples were more difficult then for the supernatant samples. Not only are there assumptions required about the chemical form and the oxidation state of the species present in the sludge, but many of the compounds in the sludge are mixed oxides which are not directly measured. Also, the sludge is actually a slurry with a high water content. The interstitial liquid is in close contact with the sludge, and there are many ionic solubility equilibriums. The anion data for the sludge samples are based on the water soluble anions that

46 CFR 154.440 - Allowable stress.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.440 Section 154.440 Shipping COAST... Tank Type A § 154.440 Allowable stress. (a) The allowable stresses for an independent tank type A must... Commandant (CG-522). (b) A greater allowable stress than required in paragraph (a)(1) of this section may be...

Simulation of a nuclear accident by an academic simulator of a VVER-1000 reactor

International Nuclear Information System (INIS)

Hernandez G, L.; Salazar S, E.

2014-10-01

This work is planned to simulate a scenario in which the same conditions that caused the accident at the Fukushima Daichi nuclear power plant are present, using a simulator of a nuclear power plant with VVER-1000 reactor, a different type of technology to the NPP where the accident occurred, which used BWR reactors. The software where it will take place the simulation was created and distributed by the IAEA for academic purposes, which contains the essential systems that characterize this type of NPP. The simulator has tools for the analysis of the characteristic phenomena of a VVER-1000 reactor in the different systems together and planned training tasks. This makes possible to identify the function of each component and how connects to other systems, thus facilitating the visualization of possible failures and the consequences that they have on the general behavior of the reactor. To program the conditions in the simulator, is necessary to know and synthesize a series of events occurred in Fukushima in 2011 and the realized maneuvers to reduce the effects of the system failures. Being different technologies interpretation of the changes that would suffer the VVER systems in the scenario in question will be developed. The Fukushima accident was characterized by the power loss of regular supply and emergency of the cooling systems which resulted in an increase in reactor temperature and subsequent fusion of their nuclei. Is interesting to reproduce this type of failure in a VVER, and extrapolate the lack of power supply in the systems that comprise, as well as pumping systems for cooling, has a pressure regulating system which involves more variables in the balance of the system. (Author)

Assessment of financial expenditure for Rivne NPP power units decommissioning

International Nuclear Information System (INIS)

Nosovskij, A.V.; Salij, L.M.

2007-01-01

The article covers some financial aspects of developing a decommissioning concept for Rivne NPP power units with reactor VVER-440 and VVER-1000. Possible methodological approaches to costs estimate have been analyzed. Preliminary results of cost estimation are presented for two decommissioning options: deferred and immediate dismantling. Principally possible options for accumulating assets have been analyzed to finance measures related to Rivne NPP decommissioning. A mathematical model has been proposed for creating decommissioning financial reserve

VVER operational experience - effect of preconditioning and primary water chemistry on radioactivity build-up

International Nuclear Information System (INIS)

Zmitko, M.; Kysela, J.; Dudjakova, K.; Martykan, M.; Janesik, J.; Hanus, V.; Marcinsky, P.

2004-01-01

The primary coolant technology approaches currently used in VVER units are reviewed and compared with those used in PWR units. Standard and modified water chemistries differing in boron-potassium control are discussed. Preparation of the VVER Primary Water Chemistry Guidelines in the Czech Republic is noted. Operational experience of some VVER units, operated in the Czech Republic and Slovakia, in the field of the primary water chemistry, and radioactivity transport and build-up are presented. In Mochovce and Temelin units, a surface preconditioning (passivation) procedure has been applied during hot functional tests. The main principles of the controlled primary water chemistry applied during the hot functional tests are reviewed and importance of the water chemistry, technological and other relevant parameters is stressed regarding to the quality of the passive layer formed on the primary system surfaces. The first operational experience obtained in the course of beginning of these units operation is presented mainly with respect to the corrosion products coolant and surface activities. Effect of the initial passivation performed during hot functional tests and the primary water chemistry on corrosion products radioactivity level and radiation situation is discussed. (author)

Shallow crack effect on brittle fracture of RPV during pressurised thermal shock

International Nuclear Information System (INIS)

Ikonen, K.

1995-12-01

This report describes the study on behaviour of postulated shallow surface cracks in embrittled reactor pressure vessel subjected to pressurised thermal shock loading in an emergency core cooling. The study is related to the pressure vessel of a VVER-440 type reactor. Instead of a conventional fracture parameter like stress intensity factor or J integral the maximum principal stress distribution on a crack tip area is used as a fracture criteria. The postulated cracks locate circumferentially at the inner surface of the reactor pressure wall and they penetrate the cladding layer and open to the inner surface. Axisymmetric and semielliptical crack shapes were studied. Load is formed of an internal pressure acting also on crack faces and of a thermal gradient in the pressure vessel wall. Physical properties of material and loading data correspond real conditions in VVER-440 RPV. The study was carried out by making lot of 2D- and 3D- finite element calculations. Analysing principles and computer programs are explained. Except of studying the shallow crack effect, one objective of the study has also been to develop further expertise and the in-house developed computing system to make effectively elastic-plastic fracture mechanical analyses for real structures under complicated loads. Though the study concerns VVER-440 RPV, the results are of more general interest especially related to thermal loads. (orig.) (11 refs.)

45 CFR 2541.440 - Termination for convenience.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 4 2010-10-01 2010-10-01 false Termination for convenience. 2541.440 Section 2541.440 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND... LOCAL GOVERNMENTS Reports, Records, Retention and Enforcement § 2541.440 Termination for convenience...

Shut-down margin study for the next generation VVER-1000 reactor including 13 x 13 hexagonal annular assemblies

International Nuclear Information System (INIS)

Faghihi, Farshad; Mirvakili, S. Mohammad

2011-01-01

Highlights: → Shut-Down Margin (SDM) for the next generation annular fuel core of typical VVER-1000, 13 x 13 assemblies are calculated. → The MCNP-5 code is run for many cases with different core burn up at various core temperatures. → There is a substantial drop in SDM in the case of annular fuel for the same power level. → SDM for our proposed VVER-1000 annular pins is calculated for specific average fuel burn up values at the BOC, MOC, and EOC. - Abstract: Shut-Down Margin (SDM) for the next generation annular fuel core of typical VVER-1000, 13 x 13 assemblies are calculated as the main aim of the present research. We have applied the MCNP-5 code for many cases with different values of core burn up at various core temperatures, and therefore their corresponding coolant densities and boric acid concentrations. There is a substantial drop in SDM in the case of annular fuel for the same power level. Specifically, SDM for our proposed VVER-1000 annular pins is calculated when the average fuel burn up values at the BOC, MOC, and EOC are 0.531, 11.5, and 43 MW-days/kg-U, respectively.

Nuclear safety in eastern countries. Background of IPSN's actions

International Nuclear Information System (INIS)

1999-01-01

In this document, IPSN presents its opinion about the safety level that might be reached by the nuclear power plants situated in the former-USSR countries. In these countries 2 types of fission reactors are operating: VVER and RBMK with respectively 46 units and 14 units. 3 generations of VVER-type reactors are coexisting: 440 MWe-230, 440 MWe-213 and 1000 MWe-320. The first generation (440 MWe-230) which involves 11 operating units are the least safe and by no means is it possible to make them reach the western standard of safety. The second generation (440 MWe-213) require technical modifications to near western safety standards. The last generation (1000 MWe-320) has safety levels very similar to PWR's if operating procedures are modified and adapted. RBMK-type reactors have been designed in the years 60-70, they suffer from generic defects due to their design, the poor quality of materials and their low reliability. IPSN fears that any incident in such reactors might turn into a major accident. In order to improve nuclear safety in eastern countries, the European Union has launched an international cooperation, the programmes PHARE and TACIS are presented. (A.C.)

42 CFR 440.390 - Assurance of transportation.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Assurance of transportation. 440.390 Section 440...-Equivalent Coverage § 440.390 Assurance of transportation. If a benchmark or benchmark-equivalent plan does not include transportation to and from medically necessary covered Medicaid services, the State must...

46 CFR 153.440 - Cargo temperature sensors.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo temperature sensors. 153.440 Section 153.440 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS... Temperature Control Systems § 153.440 Cargo temperature sensors. (a) Except as prescribed in paragraph (c) of...

42 CFR 440.70 - Home health services.

Science.gov (United States)

2010-10-01

... an acute illness to avoid the recipient's transfer to a nursing facility. (d) “Home health agency... 42 Public Health 4 2010-10-01 2010-10-01 false Home health services. 440.70 Section 440.70 Public...) MEDICAL ASSISTANCE PROGRAMS SERVICES: GENERAL PROVISIONS Definitions § 440.70 Home health services. (a...

42 CFR 440.370 - Economy and efficiency.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Economy and efficiency. 440.370 Section 440.370...-Equivalent Coverage § 440.370 Economy and efficiency. Benchmark and benchmark-equivalent coverage and any... requirements and other economy and efficiency principles that would otherwise be applicable to the services or...

Condensation driven water hammer studies for feedwater distribution pipe

Energy Technology Data Exchange (ETDEWEB)

Savolainen, S.; Katajala, S.; Elsing, B.; Nurkkala, P.; Hoikkanen, J. [Imatran Voima Oy, Vantaa (Finland); Pullinen, J. [IVO Power Engineering Ltd., Vantaa (Finland); Logvinov, S.A.; Trunov, N.B.; Sitnik, J.K. [EDO Gidropress (Russian Federation)

1997-12-31

Imatran Voima Oy, IVO, operates two VVER 440 reactors. Unit 1 has been operating since 1977 and unit 2 since 1981. First damages of the feed water distribution (FWD) pipes were observed in 1989. In closer examinations FWD-pipe T-connection turned out to suffer from severe erosion corrosion damages. Similar damages have been found also in other VVER 440 type NPPs. In 1994 the first new FWD-pipe was replaced and in 1996 extensive water hammer experiments were carried out together with EDO Gidropress in Podolsk. After the first phase of the experiments some fundamental changes were made to the construction of the FWD-pipe. The object of this paper is to give short insight to the design of the new FWD-pipe concentrating on water hammer experiments. (orig.).

Condensation driven water hammer studies for feedwater distribution pipe

International Nuclear Information System (INIS)

Savolainen, S.; Katajala, S.; Elsing, B.; Nurkkala, P.; Hoikkanen, J.; Pullinen, J.; Logvinov, S.A.; Trunov, N.B.; Sitnik, J.K.

1997-01-01

Imatran Voima Oy, IVO, operates two VVER 440 reactors. Unit 1 has been operating since 1977 and unit 2 since 1981. First damages of the feed water distribution (FWD) pipes were observed in 1989. In closer examinations FWD-pipe T-connection turned out to suffer from severe erosion corrosion damages. Similar damages have been found also in other VVER 440 type NPPs. In 1994 the first new FWD-pipe was replaced and in 1996 extensive water hammer experiments were carried out together with EDO Gidropress in Podolsk. After the first phase of the experiments some fundamental changes were made to the construction of the FWD-pipe. The object of this paper is to give short insight to the design of the new FWD-pipe concentrating on water hammer experiments. (orig.)

Condensation driven water hammer studies for feedwater distribution pipe

Energy Technology Data Exchange (ETDEWEB)

Savolainen, S; Katajala, S; Elsing, B; Nurkkala, P; Hoikkanen, J [Imatran Voima Oy, Vantaa (Finland); Pullinen, J [IVO Power Engineering Ltd., Vantaa (Finland); Logvinov, S A; Trunov, N B; Sitnik, J K [EDO Gidropress (Russian Federation)

1998-12-31

Imatran Voima Oy, IVO, operates two VVER 440 reactors. Unit 1 has been operating since 1977 and unit 2 since 1981. First damages of the feed water distribution (FWD) pipes were observed in 1989. In closer examinations FWD-pipe T-connection turned out to suffer from severe erosion corrosion damages. Similar damages have been found also in other VVER 440 type NPPs. In 1994 the first new FWD-pipe was replaced and in 1996 extensive water hammer experiments were carried out together with EDO Gidropress in Podolsk. After the first phase of the experiments some fundamental changes were made to the construction of the FWD-pipe. The object of this paper is to give short insight to the design of the new FWD-pipe concentrating on water hammer experiments. (orig.).

Surveillance of WWER-440 fuel performance

International Nuclear Information System (INIS)

Simko, J.; Urban, P.

1999-01-01

In this lecture next problems of surveillance of WWER-440 fuel performance are presented: surveillance of WWER-440 fuel performance at Mochovce NPP; basic data of WWER-440 reactor; in-core reactor measuring system 'SVRK'; basic level of SVRK; information output of basic level of SVRK; surveillance of fuel performance; table of permissible operation conditions of the reactor; limitation of the unit 1 power at the beginning of the operation; cyclic changes of power; future perspectives

Development and qualification of a thermal-hydraulic nodalization for modeling station blackout accident in PSB-VVER test facility

Energy Technology Data Exchange (ETDEWEB)

Saghafi, Mahdi [Department of Energy Engineering, Sharif University of Technology, Azadi Avenue, Tehran (Iran, Islamic Republic of); Ghofrani, Mohammad Bagher, E-mail: ghofrani@sharif.edu [Department of Energy Engineering, Sharif University of Technology, Azadi Avenue, Tehran (Iran, Islamic Republic of); D’Auria, Francesco [San Piero a Grado Nuclear Research Group (GRNSPG), University of Pisa, Via Livornese 1291, San Piero a Grado, Pisa (Italy)

2016-07-15

Highlights: • A thermal-hydraulic nodalization for PSB-VVER test facility has been developed. • Station blackout accident is modeled with the developed nodalization in MELCOR code. • The developed nodalization is qualified at both steady state and transient levels. • MELCOR predictions are qualitatively and quantitatively in acceptable range. • Fast Fourier Transform Base Method is used to quantify accuracy of code predictions. - Abstract: This paper deals with the development of a qualified thermal-hydraulic nodalization for modeling Station Black-Out (SBO) accident in PSB-VVER Integral Test Facility (ITF). This study has been performed in the framework of a research project, aiming to develop an appropriate accident management support tool for Bushehr nuclear power plant. In this regard, a nodalization has been developed for thermal-hydraulic modeling of the PSB-VVER ITF by MELCOR integrated code. The nodalization is qualitatively and quantitatively qualified at both steady-state and transient levels. The accuracy of the MELCOR predictions is quantified in the transient level using the Fast Fourier Transform Base Method (FFTBM). FFTBM provides an integral representation for quantification of the code accuracy in the frequency domain. It was observed that MELCOR predictions are qualitatively and quantitatively in the acceptable range. In addition, the influence of different nodalizations on MELCOR predictions was evaluated and quantified using FFTBM by developing 8 sensitivity cases with different numbers of control volumes and heat structures in the core region and steam generator U-tubes. The most appropriate case, which provided results with minimum deviations from the experimental data, was then considered as the qualified nodalization for analysis of SBO accident in the PSB-VVER ITF. This qualified nodalization can be used for modeling of VVER-1000 nuclear power plants when performing SBO accident analysis by MELCOR code.

VVER-1000 small-medium break LOCAs predictions by ASTEC

International Nuclear Information System (INIS)

Georgieva, J.; Stefanova, A.; Atanasova, B.; Groudev, P.; Tusheva, P.; Mladenov, I.; Dimov, D.; Passalacqua, R.

2005-01-01

This paper deals with an assessment of ASTEC1.1v0 code in the simulation of small and medium break LOCAs (ranging from 30mm up to 70mm equivalent diameter). The reference power plant for this analysis is a VVER-1000/V320 (e.g. Units 5 and 6 at Kozloduy NPP). A preliminary comparison with MELCOR and RELAP-SCDAP severe accident codes will be discussed. This investigation has been performed in the framework of the SARNET project (under the Euratom 6 th framework program) by the FoBAUs group (Forum of Bulgarian ASTEC users). The FoBAUs group aims at the validation of the ASTEC code in the field of severe accidents. Future activities will target the ASTEC capability (as a PSA-level 2 tool) to simulate a large range of reactor accident scenarios with intervention of safety systems (either passive systems or operated by operators). The final target is to assess Severe Accident Management (SAM) procedures for VVER-1000 reactors. The ASTEC1.1v0 code version here used is the one released in June 2004 by the French IRSN (Institut de Radioprotection et de Surete Nucleaire) and the German GRS (Gesellschaft ReactorSicherheit mbH). (author)

CATHARE Assessment of PACTEL LOCA Experiments with Accident Management

Directory of Open Access Journals (Sweden)

Luben Sabotinov

2010-01-01

Full Text Available This paper summarizes the analysis results of three PACTEL experiments, carried out with the advanced thermal-hydraulic system computer CATHARE 2 code as a part of the second work package WP2 (analytical work of the EC project “Improved Accident Management of VVER nuclear power plants” (IMPAM-VVER. The three LOCA experiments, conducted on the Finnish test facility PACTEL (VVER-440 model, represent 7.4% cold leg breaks with combination of secondary bleed and primary bleed and feed and different actuation modes of the passive safety injection. The code was used for both defining and analyzing the experiments, and to assess its capabilities in predicting the associated complex VVER-related phenomena. The code results are in reasonable agreement with the measurements, and the important physical phenomena are well predicted, although still further improvement and validation might be necessary.

The choice of the fuel assembly for VVER-1000 in a closed fuel cycle based on REMIX-technology

International Nuclear Information System (INIS)

Bobrov, E.; Alekseev, P.; Chibinyaev, A.; Teplov, P.; Dudnikov, A.

2016-01-01

REMIX (Regenerated Mixture) fuel is produced directly from a non-separated mix of recycled uranium and plutonium from reprocessed used fuel and the fabrication technology of such fuel is called REMIX-technology. This paper shows basic features of different fuel assembly (FA) application for VVER-1000 in a closed fuel cycle based on REMIX-technology. This investigation shows how the change in the water-fuel ratio in the VVER FA affects the fuel characteristics produced by REMIX technology during multiple recycling. It is shown that for for the traditional REMIX-fuel it does not make sense to change anything in the design of VVER FA, because there are no advantages in the fuel feed consumption. The natural uranium economy by the fifth cycle reached about 29%. In the case of the REMIX fuel based on uranium-plutonium from SNF MOX fuel, it would be appropriate to use fuel assemblies with a water-fuel ratio of 1.5

Study of the flux effect nature for VVER-1000 RPV welds with high nickel content

Energy Technology Data Exchange (ETDEWEB)

Kuleshova, E.A., E-mail: evgenia-orm@yandex.ru [National Research Center “Kurchatov Institute”, Kurchatov Sq.1, 123182, Moscow (Russian Federation); National Research Nuclear University, “MEPhI” (Moscow Engineering Physics Institute), Kashirskoe Highway 31, 115409, Moscow (Russian Federation); Gurovich, B.A.; Lavrukhina, Z.V.; Maltsev, D.A.; Fedotova, S.V.; Frolov, A.S.; Zhuchkov, G.M. [National Research Center “Kurchatov Institute”, Kurchatov Sq.1, 123182, Moscow (Russian Federation)

2017-01-15

This work extends the research of the basic regularities of segregation processes in the grain boundaries (GB) of VVER-1000 reactor pressure vessel (RPV) steels. The paper considers the influence of irradiation with different fast neutron fluxes on the structure, yield strength and ductile-to-brittle transition temperature (T{sub K}) changes as well as on changes of the share of brittle intergranular fracture and development of segregation processes in the VVER-1000 RPV weld metal (WM). The obtained experimental results allow to separate the contribution of the hardening and non-hardening mechanisms to mechanical properties degradation of material irradiated at the operating temperature. It is shown that the difference in T{sub K} shift in WM irradiated to the same fluence with different fast neutron fluxes is mainly due to the difference in the GB accumulation kinetics of impurities and only to a small extent due to the material hardening. Phosphorus bulk diffusion coefficients were evaluated for the temperature exposure, accelerated irradiation and irradiation within surveillance specimens (SS) using a kinetic model of phosphorus GB accumulation in low-alloyed low-carbon steels under the influence of operational factors. The correlation between the GB segregation level of phosphorus and nickel, and the T{sub K} shift - in WM SS was obtained experimentally and indicates the non-hardening mechanism contribution to the total radiation embrittlement of VVER-1000 RPV steels throughout its extended lifetime. - Highlights: • Structural elements in high Ni welds are studied at different irradiation fluxes. • AES study demonstrated different P GB kinetics at different irradiation fluxes. • Hardening and non-hardening mechanism contributions to the flux effect are assessed. • Correlation between ΔT{sub K} and P and Ni GB content is shown for VVER-1000 RPV welds.

VVER Reactor Safety in Eastern Europe and Former Soviet Union

Science.gov (United States)

Papadopoulou, Demetra

2012-02-01

VVER Soviet-designed reactors that operate in Eastern Europe and former Soviet republics have heightened international concern for years due to major safety deficiencies. The governments of countries with VVER reactors have invested millions of dollars toward improving the safety of their nuclear power plants. Most of these reactors will continue to operate for the foreseeable future since they provide urgently-needed electrical power. Given this situation, this paper assesses the radiological consequences of a major nuclear accident in Eastern Europe. The paper also chronicles the efforts launched by the international nuclear community to improve the safety of the reactors and notes the progress made so far through extensive collaborative efforts in Armenia, Bulgaria, the Czech Republic, Hungary, Kazakhstan, Lithuania, Russia, Slovakia, and Ukraine to reduce the risks of nuclear accidents. Western scientific and technical staff collaborated with these countries to improve the safety of their reactor operations by strengthening the ability of the regulator to perform its oversight function, installing safety equipment and technologies, investing time in safety training, and working diligently to establish an enduring safety culture. Still, continued safety improvement efforts are necessary to ensure safe operating practices and achieve timely phase-out of older plants.

Proposal of a benchmark for core burnup calculations for a VVER-1000 reactor core

International Nuclear Information System (INIS)

Loetsch, T.; Khalimonchuk, V.; Kuchin, A.

2009-01-01

In the framework of a project supported by the German BMU the code DYN3D should be further validated and verified. During the work a lack of a benchmark on core burnup calculations for VVER-1000 reactors was noticed. Such a benchmark is useful for validating and verifying the whole package of codes and data libraries for reactor physics calculations including fuel assembly modelling, fuel assembly data preparation, few group data parametrisation and reactor core modelling. The benchmark proposed specifies the core loading patterns of burnup cycles for a VVER-1000 reactor core as well as a set of operational data such as load follow, boron concentration in the coolant, cycle length, measured reactivity coefficients and power density distributions. The reactor core characteristics chosen for comparison and the first results obtained during the work with the reactor physics code DYN3D are presented. This work presents the continuation of efforts of the projects mentioned to estimate the accuracy of calculated characteristics of VVER-1000 reactor cores. In addition, the codes used for reactor physics calculations of safety related reactor core characteristics should be validated and verified for the cases in which they are to be used. This is significant for safety related evaluations and assessments carried out in the framework of licensing and supervision procedures in the field of reactor physics. (authors)

Optimizing a gap conductance model applicable to VVER-1000 thermal–hydraulic model

International Nuclear Information System (INIS)

Rahgoshay, M.; Hashemi-Tilehnoee, M.

2012-01-01

Highlights: ► Two known conductance models for application in VVER-1000 thermal–hydraulic code are examined. ► An optimized gap conductance model is developed which can predict the gap conductance in good agreement with FSAR data. ► The licensed thermal–hydraulic code is coupled with the gap conductance model predictor externally. -- Abstract: The modeling of gap conductance for application in VVER-1000 thermal–hydraulic codes is addressed. Two known models, namely CALZA-BINI and RELAP5 gap conductance models, are examined. By externally linking of gap conductance models and COBRA-EN thermal hydraulic code, the acceptable range of each model is specified. The result of each gap conductance model versus linear heat rate has been compared with FSAR data. A linear heat rate of about 9 kW/m is the boundary for optimization process. Since each gap conductance model has its advantages and limitation, the optimized gap conductance model can predict the gap conductance better than each of the two other models individually.

Large eddy simulation of a fuel rod subchannel

International Nuclear Information System (INIS)

Mayer, Gusztav

2007-01-01

In a VVER-440 reactor the measured outlet temperature is related to fuel limit parameters and the power upgrading plans of VVER-440 reactors motivated us to obtain more information on the mixing process of the fuel assemblies. In a VVER-440 rod bundle the fuel rods are arranged in triangular array. Measurement shows (Krauss and Meyer, 1998) that the classical engineering approach, which tries to trace the characterization of such systems back to equivalent (hydraulic diameter) pipe flows, does not give reasonable results. Due to the different turbulence characteristics, the mixing is more intensive in rod bundles than it would be expected based on equivalent pipe flow correlations. As a possible explanation of the high mixing, secondary flow was deduced from measurements by several experimentalists (Trupp and Azad, 1975). Another candidate to explain the high mixing is the so-called flow pulsation phenomenon (Krauss and Meyer, 1998). In this paper we present subchannel simulations (Mayer et al. 2007) using large eddy simulation (LES) methodology and the lattice Boltzmann method (LBM) without the spacers at Reynolds number 21000. The simulation results are compared with the measurements of Trupp and Azad (1975). The mean axial velocity profile shows good agreement with the measurement data. Secondary flow has been observed directly in the simulation results. Reasonable agreement has been achieved for most Reynolds stresses. Nevertheless, the calculated normal stresses show small, but systematic deviation from the measurement data. (author)

Minimum throttling feedwater control in VVER-1000 and PWR NPPs

International Nuclear Information System (INIS)

Symkin, B.E.; Thaulez, F.

2004-01-01

This paper presents an approach for the design and implementation of advanced digital control systems that use a minimum-throttling algorithm for the feedwater control. The minimum-throttling algorithm for the feedwater control, i.e. for the control of steam generators level and of the feedwater pumps speed, is applicable for NPPs with variable speed feedwater pumps. It operates in such a way that the feedwater control valve in the most loaded loop is wide open, steam generator level in this loop being controlled by the feedwater pumps speed, while the feedwater control valves in the other loops are slightly throttling under the action of their control system, to accommodate the slight loop imbalances. This has the advantage of minimizing the valve pressure losses hence minimizing the feedwater pumps power consumption and increasing the net MWe. The benefit has been evaluated for specific plants as being roughly 0.7 and 2.4 MW. The minimum throttling mode has the further advantages of lowering the actuator efforts with potential positive impact in actuator life and of minimizing the feedwater pipelines vibrations. The minimum throttling mode of operation has been developed by the Ukrainian company LvivORGRES. It has been applied with great deal of success on several VVER-1000 NPPs, six units of Zaporizhzha in Ukraine plus, with participation of Westinghouse, Kozloduy 5 and 6 in Bulgaria and South Ukraine 1 to 3 in Ukraine. The concept operates with both ON-OFF valves and true control valves. A study, jointly conducted by Westinghouse and LvivORGRES, is ongoing to demonstrate the applicability of the concept to PWRs having variable speed feedwater pumps and having, or installing, digital feedwater control, standalone or as part of a global digital control system. The implementation of the algorithm at VVER-1000 plants provided both safety improvement and direct commercial benefits. The minimum-throttling algorithm will similarly increase the performance of PWRs. The

OECD/DOE/CEA VVER-1000 Coolant Transient Benchmark. Summary Record of the First Workshop (V1000-CT1)

International Nuclear Information System (INIS)

2003-01-01

The first workshop for the VVER-1000 Coolant Transient Benchmark TT Benchmark was hosted by the Commissariat a l'Energie Atomique, Centre d'Etudes de Saclay, France. The V1000CT benchmark defines standard problems for validation of coupled three-dimensional (3-D) neutron-kinetics/system thermal-hydraulics codes for application to Soviet-designed VVER-1000 reactors using actual plant data without any scaling. The overall objective is to access computer codes used in the safety analysis of VVER power plants, specifically for their use in reactivity transient simulations in a VVER-1000. The V1000CT benchmark consists of two phases: V1000CT-1 - simulation of the switching on of one main coolant pump (MCP) while the other three MCP are in operation, and V1000CT- 2 - calculation of coolant mixing tests and Main Steam Line Break (MSLB) scenario. Further background information on this benchmark can be found at the OECD/NEA benchmark web site . The purpose of the first workshop was to review the benchmark activities after the Starter Meeting held last year in Dresden, Germany: to discuss the participants' feedback and modifications introduced in the Benchmark Specifications on Phase 1; to present and to discuss modelling issues and preliminary results from the three exercises of Phase 1; to discuss the modelling issues of Exercise 1 of Phase 2; and to define work plan and schedule in order to complete the two phases

Experimental investigation of am measures and effect of hydro-accumulator initial pressure for VVER-440 plants

International Nuclear Information System (INIS)

Ivan Toth; Gyorgy Ezsol; Attila Guba; Laszlo Perneczky

2005-01-01

Full text of publication follows: A series of experiments were performed at the PMK-2 test facility within the IMPAM-VVER project of the EU 5. Framework Programme. The PMK-2 integral-type facility is a scaled down model of the Paks NPP with a volume and power scaling of 1:2070. Transients can be started from nominal operating conditions. The ratio of elevations is 1:1 except for the lower plenum and pressurizer. The six loops of the plant are modelled by a single active loop. The main objective of the project was to address different problems encountered during the development of EOPs for the Paks NPP in Hungary. Two of the six PMK tests addressed the investigation of starting criteria for primary and secondary bleed during a small break LOCA without HPIS: - a 'base case', with bleed actions following the plant procedures; - a run with secondary and primary bleed started as early as possible. Further two tests investigated the effect of nominal and reduced initial hydro-accumulator pressures on the process, the main question being, whether the starting pressure of the LPIS can be reached without significant overheating of the fuel. These latter were run from lowered initial system pressure in order to be compared to similar tests performed in the project at the PACTEL facility. The two first tests confirmed tendencies shown by earlier plant calculations that neither the secondary nor the primary bleed is effective enough to reduce the pressure, even if their earliest possible actuation is envisaged. As a consequence, low pressure injection could not be started in time to avoid severe fuel rod heat-up and the core power had to be cut in both tests. Comparing the results of tests 3 and 4 the beneficial effect of lowered HA pressure could be analysed. Although heater rod temperatures started to rise also in this test after hydro-accumulators were empty, the secondary and primary bleed actions resulted in the primary pressure dropping to 0.7 MPa and LPIS injection

10 CFR 440.18 - Allowable expenditures.

Science.gov (United States)

2010-01-01

... part for labor, weatherization materials, and related matters for a renewable energy system, shall not... beginning in calendar year 2010 and the $3,000 average for renewable energy systems will be adjusted... 10 Energy 3 2010-01-01 2010-01-01 false Allowable expenditures. 440.18 Section 440.18 Energy...

Experimental Investigation of Operation of VVER Steam Generator in Condensation Mode in the Event of the Severe Accident

Energy Technology Data Exchange (ETDEWEB)

Morozov, Andrey [Institute for Physics and Power Engineering by A.I. Leypunsky, 1 Bondarenko sq. Obninsk, 249033 (Russian Federation)

2008-07-01

For new Russian nuclear power plants with VVER-1200 reactor in the event of a beyond design basis accident, provision is made for the use of passive safety systems for necessary core cooling. These safety systems include the passive heat removal system (PHRS). In the case of leakage in the primary circuit this system assures the transition of steam generators (SG) to operation in the mode of condensation of the primary circuit steam. As a result, the condensate from SG arrives at the core providing its additional cooling. To investigate the condensation mode of VVER SG operation, a large scale HA2M-SG test facility was constructed. The rig incorporates: buffer tank, SG model with scale is 1:46, PHRS heat exchanger. Experiments at the test facility have been performed to investigate condensation mode of operation of SG model at the pressure 0.4 MPa, correspond to VVER reactor pressure at the last stage of the beyond design basis accident. The report presents the test procedure and the basic obtained test results. (authors)

ISP33 standard problem on the PACTEL facility

Energy Technology Data Exchange (ETDEWEB)

Purhonen, H.; Kouhia, J. [VTT Energy, Lappeenranta (Finland); Kalli, H. [Lappeenranta Univ. of Technology (Finland)

1995-09-01

ISP33 is the first OECD/NEA/CSNI standard problem related to VVER type of pressurized water reactors. The reference reactor of the PACTEL test facility, which was used to carry out the ISP33 experiment, is the VVER-440 reactor, two of which are located near the Finnish city of Loviisa. The objective of the ISP33 test was to study the natural circulation behaviour of VVER-440 reactors at different coolant inventories. Natural circulation was considered as a suitable phenomenon to focus on by the first VVER related ISP due to its importance in most accidents and transients. The behaviour of the natural circulation was expected to be different compared to Western type of PWRs as a result of the effect of horizontal steam generators and the hot leg loop seals. This ISP was conducted as a blind problem. The experiment was started at full coolant inventory. Single-phase natural circulation transported the energy from the core to the steam generators. The inventory was then reduced stepwise at about 900 s intervals draining 60 kg each time from the bottom of the downcomer. the core power was about 3.7% of the nominal value. The test was terminated after the cladding temperatures began to rise. ATHLET, CATHARE, RELAP5 (MODs 3, 2.5 and 2), RELAP4/MOD6, DINAMIKA and TECH-M4 codes were used in 21 pre- and 20 posttest calculations submitted for the ISP33.

40 CFR 440.132 - General definitions.

Science.gov (United States)

2010-07-01

... evaporation data. (c) “Appropriate treatment of the recycle water” in subpart J, § 440.104 includes, but is...) “Groundwater infiltration” in § 440.131 means that water which enters the treatment facility as a result of the... mining, cleaning, or concentration of metal ores. (h) “Mine drainage” means any water drained, pumped, or...

33 CFR 183.440 - Secondary circuits of ignition systems.

Science.gov (United States)

2010-07-01

... systems. 183.440 Section 183.440 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY BOATS AND ASSOCIATED EQUIPMENT Electrical Systems Manufacturer Requirements § 183.440 Secondary circuits of ignition systems. (a) Each conductor in a secondary circuit of an...

Radionuclide inventory calculation in VVER and BWR reactor

International Nuclear Information System (INIS)

Bouhaddane, A.; Farkas, F.; Slugen, V.; Ackermann, L.; Schienbein, M.

2014-01-01

The paper shows different aspects in the radionuclide inventory determination. Precise determination of the neutron flux distribution, presented for a BRW reactor, is vital for the activation calculations. The precision can be improved utilizing variance reduction methods as importance treatment, weight windows etc. Direct calculation of the radionuclide inventory via Monte Carlo code is presented for a VVER reactor. Burn-up option utilized in this calculation appears to be proper for reactor internal components. However, it will not be probably effective outside the reactor core. Further calculations in this area are required to support the forth-set findings. (authors)

Engineering Margin Factors Used in the Design of the VVER Fuel Cycles

Science.gov (United States)

Lizorkin, M. P.; Shishkov, L. K.

2017-12-01

The article describes methods for determination of the engineering margin factors currently used to estimate the uncertainties of the VVER reactor design parameters calculated via the KASKAD software package developed at the National Research Center Kurchatov Institute. These margin factors ensure the meeting of the operating (design) limits and a number of other restrictions under normal operating conditions.

Validation cases of CATHARE 2 for VVER-1000 main steam line break analysis

International Nuclear Information System (INIS)

Kolev, Nikolay P.; Petrov, Nikolay; Donov, Jordan; Sabotinov, Luben; Nikonov, Sergey

2008-01-01

Recent coupled code benchmarks identified coolant mixing in the reactor vessel as an unresolved issue in the analysis of complex plan transients with reactivity insertion. Thus, Phase 2 of the OECD VVER-1000 Coolant Transient Benchmark (V1000CT-2) was defined. The benchmark includes calculation of vessel mixing tests and main steam line break (MSLB) analysis. The reference plant is Kozloduy-6 in Bulgaria. The general objective is the assessment of system codes for VVER safety analysis and specifically for their use in the analysis of reactivity transients. A specific objective is the testing of different scale mixing models (mixing matrix, multi-1D, coarse-3D and CFD), and analysis of MSLB transients with improved vessel thermal hydraulic models. The benchmark is sponsored by CEA-France and OECD and is jointly prepared by CEA and INRNE, in collaboration with the Kozloduy NPP, IRSN and PSU. This paper summarizes CATHARE2 code assessment calculations using multi-1D vessel thermal hydraulics with cross flow. Test cases are the OECD V1000CT-1 pump start-up benchmark and the V1000CT-2 benchmarks. Emphasis is put on vessel mixing aspects. Separate effects in the lower plenum as well as component and integral system tests are considered. The comparison shows that a six-sector vessel mixing model informed by plant data or validated CFD calculations in the initial state was able to correctly reproduce the channel average temperatures at the core inlet as well as the vessel outlet temperatures. Testing at system level including code-to-experiment and CATHARE-ATHLET comparison shows that the considered CATHARE VVER-1000 system model is capable of MSLB simulation. (author)

Comparison of radioactive doses after the last protection layer insight the reactor structure for Russian VVER-1000 and German PWR-1300 reactors

International Nuclear Information System (INIS)

Rahimi, A.; Mansourshaiflu, N.; Alizadeh, M. R.

2004-01-01

In pressurized reactors (VVER and PWR), various protections layers are used for reducing the output core doses. At any protection layer, some amount of neutron and gamma doses is reduced. In this project the axial flux of neutron and gamma beams have been evaluated at various protection layers in the operation state the German PWR-1300 and Russian VVER-1000 reactors by the MCNP computer code. For the purpose of effective use of the MCNP code and assuring its correct performance about of fluxed beams common and series of scientific answers and bench marks should be considered and the results obtained by the MCNP code, be compared with this answers. Then by using appropriate method, for reducing the flux variants of neutron and gamma beams at various protection layers of German PWR-1300 and Russian VVER-1000 reactors of the operation state of both reactors have been accelerated. In this projects, bench marks are computations and numbers existing in PSAR's present at Bushehr nuclear power plant. At the end, by using the results obtained and the standard doses, the time which a person can have work activity at the reactor wall (after the last protection layer), was compared for the operation status of the German PWR-1300 and Russian VVER-1000 reactors

Main results of post-irradiation examinations of new-generation fuel assemblies VVER-1000

International Nuclear Information System (INIS)

Zvir, E.; Markov, D.; Polenok, V.; Zhitelev, V.; Kobylyansky, G.

2009-01-01

To increase the competitiveness of Russian nuclear fuel at the foreign market and to improve its technical and economic performance in order to provide a necessary level of safety, it is necessary to solve certain important tasks: Increase of fuel burn-up; Extension of operational lifetime of fuel assemblies and operational reliability of nuclear fuel; Introduction of cost-beneficial and flexible fuel cycles. Alternative fuel assemblies TVSA VVER-1000 and TVS-2 are used as a basis to optimize the nuclear fuel and develop advanced fuel cycles for nuclear power plants with VVER-1000 reactor types. Four fuel assemblies TVSA operated during 1 and up to 6 reactor cycles, reference fuel assembly TVS-2 operated during three reactor cycles and achieved an average fuel burnup of 48MW·day/kgU as well as failed fuel assembly TVS-2 operated during one cycle were examined at RIAR in recent years. The main objectives of these examinations were to obtain experimental data in support of operational integrity of products or to find out reasons of their failure. The performed post-irradiation examinations confirmed the operational integrity of alternative fuel assemblies TVSA including their geometrical stability up to the average fuel burnup of 55 MW·day/kgU over the fuel assembly (FA) (up to the maximal fuel burnup of ∼73 MW·day/kgU in fuel rods) and of TVS-2 up to the average fuel burnup of 48 MW·day/kgU over the fuel assembly. The changes introduced in the design of VVER-1000 fuel assembly during the development of alternative fuel assembly TVSA and TVS-2 did not make any negative effect on fuel rods. It was proved that causes of fuel rod failure were not related to design features of fuel assemblies. The design features and operating conditions of fuel assemblies under examinations are briefly described. Post-irradiation examinations proved the geometrical stability of fuel assemblies TVSA and TVS-2 under operation up to the fuel burnup of ∼50 MW day/kgU, as for the

Development of a VVER-1000 core loading pattern optimization program based on perturbation theory

International Nuclear Information System (INIS)

Hosseini, Mohammad; Vosoughi, Naser

2012-01-01

Highlights: ► We use perturbation theory to find an optimum fuel loading pattern in a VVER-1000. ► We provide a software for in-core fuel management optimization. ► We consider two objectives for our method (perturbation theory). ► We show that perturbation theory method is very fast and accurate for optimization. - Abstract: In-core nuclear fuel management is one of the most important concerns in the design of nuclear reactors. Two main goals in core fuel loading pattern design optimization are maximizing the core effective multiplication factor in order to extract the maximum energy, and keeping the local power peaking factor lower than a predetermined value to maintain the fuel integrity. Because of the numerous possible patterns of fuel assemblies in the reactor core, finding the best configuration is so important and challenging. Different techniques for optimization of fuel loading pattern in the reactor core have been introduced by now. In this study, a software is programmed in C language to find an order of the fuel loading pattern of a VVER-1000 reactor core using the perturbation theory. Our optimization method is based on minimizing the radial power peaking factor. The optimization process launches by considering an initial loading pattern and the specifications of the fuel assemblies which are given as the input of the software. The results on a typical VVER-1000 reactor reveal that the method could reach to a pattern with an allowed radial power peaking factor and increases the cycle length 1.1 days, as well.

Management of primary-to-secondary leaks at Loviisa nuclear power plant

Energy Technology Data Exchange (ETDEWEB)

Mohnsen, B.; Jaenkaelae, K. [IVO International Ltd, Vantaa (Finland)

1995-12-31

The Loviisa Nuclear power plant consisting of two VVER-440 type press water reactor units has been in commercial operation since the late 1970`s. Specific features for VVER-440 reactors are six primary loops with horizontal steam generators and main gate valves. The structure of the horizontal steam generators construction may cause a large primary to secondary leak in case of a break in the cover of the primary collector. An accident where two primary collector covers opened totally and two covers opened partly took place in Rovno, Ukraine January 1982. Primary to secondary leaks are one of the main contributors to the core melt frequency in VVER reactors according to the Loviisa 1 Probabilistic Safety Assessment. The high core damage contribution has set requirements for the development of effective means to cope with all sizes of primary to secondary leaks in the steam generator. A concept for all leak sizes has been developed for Loviisa 1 and 2. The solution includes four main areas which are a new steam generator leakage monitoring system based on nitrogen-16 measurement, an upgraded pressurizer spray system, an increased emergency cooling water reserve and an automated isolation of the defected steam generator.

Management of primary-to-secondary leaks at Loviisa nuclear power plant

International Nuclear Information System (INIS)

Mohnsen, B.; Jaenkaelae, K.

1995-01-01

The Loviisa Nuclear power plant consisting of two VVER-440 type press water reactor units has been in commercial operation since the late 1970's. Specific features for VVER-440 reactors are six primary loops with horizontal steam generators and main gate valves. The structure of the horizontal steam generators construction may cause a large primary to secondary leak in case of a break in the cover of the primary collector. An accident where two primary collector covers opened totally and two covers opened partly took place in Rovno, Ukraine January 1982. Primary to secondary leaks are one of the main contributors to the core melt frequency in VVER reactors according to the Loviisa 1 Probabilistic Safety Assessment. The high core damage contribution has set requirements for the development of effective means to cope with all sizes of primary to secondary leaks in the steam generator. A concept for all leak sizes has been developed for Loviisa 1 and 2. The solution includes four main areas which are a new steam generator leakage monitoring system based on nitrogen-16 measurement, an upgraded pressurizer spray system, an increased emergency cooling water reserve and an automated isolation of the defected steam generator

Management of primary-to-secondary leaks at Loviisa nuclear power plant

Energy Technology Data Exchange (ETDEWEB)

Mohnsen, B; Jaenkaelae, K [IVO International Ltd, Vantaa (Finland)

1996-12-31

The Loviisa Nuclear power plant consisting of two VVER-440 type press water reactor units has been in commercial operation since the late 1970`s. Specific features for VVER-440 reactors are six primary loops with horizontal steam generators and main gate valves. The structure of the horizontal steam generators construction may cause a large primary to secondary leak in case of a break in the cover of the primary collector. An accident where two primary collector covers opened totally and two covers opened partly took place in Rovno, Ukraine January 1982. Primary to secondary leaks are one of the main contributors to the core melt frequency in VVER reactors according to the Loviisa 1 Probabilistic Safety Assessment. The high core damage contribution has set requirements for the development of effective means to cope with all sizes of primary to secondary leaks in the steam generator. A concept for all leak sizes has been developed for Loviisa 1 and 2. The solution includes four main areas which are a new steam generator leakage monitoring system based on nitrogen-16 measurement, an upgraded pressurizer spray system, an increased emergency cooling water reserve and an automated isolation of the defected steam generator.

The results of postirradiation examinations of VVER-1000 and VVER-440 fuel rods

Science.gov (United States)

Dubrovin, K. P.; Ivanov, E. G.; Strijov, P. N.; Yakovlev, V. V.

1991-02-01

The paper presents the results of postirradiation examination of the fuel rods having different fuel-cladding gaps, pellet densities, pellet inner diameters and so on. The fuel rods were irradiated in the material science reactor (MR) of the Kurchatov Institute of Atomic Energy and at 4 unit of the Novo-Voronezh nuclear powerplant. Some data on fission gas release and rod geometry and compared with computer code predictions.

Physical startup tests for VVER-1200 of Novovoronezh NPP. Advanced technique and some results

Energy Technology Data Exchange (ETDEWEB)

Afanasiev, Dmitry A.; Kraynov, Yury A.; Pinegin, Anatoly A.; Tsyganov, Sergey V. [National Research Centre, Moscow (Russian Federation). Kurchatov Inst.

2017-09-15

The intention of the startup physics tests was to confirm design characteristics of the core loading and their compliance with safety analysis preconditions. The program of startup tests for the leading unit is usually composed in such a way that is is possible to study as much neutron-physical characteristics as possible in the safest condition of zero power. State-of-the-art safety analysis is including computer codes that use three dimensional neutron kinetics and thermohydraulics models. For the substantiation of such models, for its validation and verification there is a need in reactor experiments that implementing spatially distributed transients. We based on such statements when composing hot zero power physical startup program for the new VVER-1200 unit of Novovoronezh NPP. Several tests unconventional for VVER were developed for that program. It includes measuring the worth for each of control rod groups and measuring of single rod worth from the inserted groups - test that models rod ejection event in some sense.

10 CFR 440.1 - Purpose and scope.

Science.gov (United States)

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Purpose and scope. 440.1 Section 440.1 Energy DEPARTMENT... scope. This part implements a weatherization assistance program to increase the energy efficiency of... with children, high residential energy users, and households with high energy burden. [65 FR 77217, Dec...

42 CFR 440.130 - Diagnostic, screening, preventive, and rehabilitative services.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Diagnostic, screening, preventive, and rehabilitative services. 440.130 Section 440.130 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES... Definitions § 440.130 Diagnostic, screening, preventive, and rehabilitative services. (a) “Diagnostic services...

Numerical investigation of passive heat removal system via steam generator in VVER 1200

International Nuclear Information System (INIS)

Dinh Anh Tuan; Duong Thanh Tung; Tran Chi Thanh; Nguyen Van Thai

2015-01-01

Passive heat removal system (PHRS) via Steam Generator is an important part in VVER design. In case of Design Basic Accidents such as blackout, failure of feed water supply to steam generator or coolant leakage with failure of emergency core cooling at high pressure. PHRS is designed to remove the residual heat from reactor core through steam generator to heat exchanger which is placed outside reactor vessel. In order to evaluate the passive system, a numerical investigation using a CFD code is performed. However, PHRS has complex geometry for using CFD simulation. Thus, RELAP5 is applied to provide the wall heat flux of tube in the heat exchanger tank. The natural convection in the heat exchanger tank is investigated in this report. Numerical results show temperature and velocity distribution in the heat exchanger tank are calculated with different wall heat flux corresponding to various transient conditions. The calculated results contribute to the capacity analysis of passive heat removal system and giving valuable information for safe operation of VVER 1200. (author)

Perspectives for practical application of the combined fuel kernels in VVER-type reactors

International Nuclear Information System (INIS)

Baranov, V.; Ternovykh, M.; Tikhomirov, G.; Khlunov, A.; Tenishev, A.; Kurina, I.

2011-01-01

The paper considers the main physical processes that take place in fuel kernels under real operation conditions of VVER-type reactors. Main attention is given to the effects induced by combinations of layers with different physical properties inside of fuel kernels on these physical processes. Basic neutron-physical characteristics were calculated for some combined fuel kernels in fuel rods of VVER-type reactors. There are many goals in development of the combined fuel kernels, and these goals define selecting the combinations and compositions of radial layers inside of the kernels. For example, the slower formation of the rim-layer on outer surface of the kernels made of enriched uranium dioxide can be achieved by introduction of inner layer made of natural or depleted uranium dioxide. Other potential goals (lower temperature in the kernel center, better conditions for burn-up of neutron poisons, better retention of toxic materials) could be reached by other combinations of fuel compositions in central and peripheral zones of the fuel kernels. Also, the paper presents the results obtained in experimental manufacturing of the combined fuel pellets. (authors)

Shaping of the axial power density distribution in the core to minimize the vapor volume fraction at the outlet of the VVER-1200 fuel assemblies

Energy Technology Data Exchange (ETDEWEB)

Savander, V. I.; Shumskiy, B. E., E-mail: borisshumskij@yandex.ru [National Research Nuclear University MEPhI (Russian Federation); Pinegin, A. A. [National Research Center Kurchatov Institute (Russian Federation)

2016-12-15

The possibility of decreasing the vapor fraction at the VVER-1200 fuel assembly outlet by shaping the axial power density field is considered. The power density field was shaped by axial redistribution of the concentration of the burnable gadolinium poison in the Gd-containing fuel rods. The mathematical modeling of the VVER-1200 core was performed using the NOSTRA computer code.

The effect of the volumetric heat source distribution of the fuel pellet on the minimum DNBR ratio

International Nuclear Information System (INIS)

Hordosy, G.; Kereszturi, A.; Maroti, L.; Trosztel, I.

1995-01-01

The radial power distribution in a VVER-440 type fuel assembly is strongly non-uniform as a result of the water-gap between the shrouds and the moderator filled central tube. Consequently, it can be expected that the power density inside a single fuel rod is inhomogeneous, as well. In the paper the methodology and the results of coupled thermohydraulic and neutronic calculations are presented. The objective of the analysis was the investigation of the heat source distribution and the determination of the possible extent of the power non-uniformity in a corner rod which has always the highest peaking factor in a VVER-440 type assembly. The results of the analysis revealed that there can be a strong non-uniformity of power distribution inside a fuel pellet, and the effect depends first of all on the general assembly conditions, while the local subchannel parameters have only a slight influence on the pellet heat source distribution. (author)

Study on safety analysis of VVER-1200/V491 in scenario of Loss of Coolant Accidents along with partly failure of ECCS using RELAP5 code

International Nuclear Information System (INIS)

Hoang Minh Giang; Ha Thi Anh Dao; Hoang Tan Hung; Bui Thi Hoa; Nguyen Thi Tu Oanh; Dinh Anh Tuan; Pham Tuan Nam

2017-01-01

The advanced VVER-1200/V491 reactor designed with passive safety systems to deal with design extension conditions is primarily selected as priority candidate for Ninh Thuan 1 nuclear power plant project. So that, in order to enhance competence of nuclear safety and toward participation on review Safety Analysis Report (SAR) of Ninh Thuan nuclear Power project the study on safety analysis of VVER-1200/V491 in scenario of Loss of Coolant Accidents along with partly failure of ECCS is implemented. As requirement of the study, the input deck file of VVER-1200/V491 for RELAP5 and analysis report for some special case of LOCAs along with partly failure of ECCS are issued. (author)

The RELAP5-Based NPA of the VVER Type Paks NPP

International Nuclear Information System (INIS)

Guba, A.; Toth, I.; Mandy, C.; Stubbe, E.

1999-01-01

NPA is a data driven interactive graphical tool for visualisation of different plant conditions. Data generated by the analysis code RELAP5/MOD3.2 are processed and displayed on a computer monitor. The NPA model of Paks NPP Unit 3 was developed with the aim to demonstrate the phenomena occurring in different transient/accident scenarios. This VVER-specific NPA development is a result of a cooperation between BELGATOM and KFKI-AEKI. (author)

Radiolysis of the VVER-1000 reactor coolant: An experimental study and mathematical modeling

International Nuclear Information System (INIS)

Arkhipov, O.P.; Bugaenko, V.L.; Kabakchi, S.A.

1995-01-01

Variations in the composition of the coolant for the primary circuit of a VVER-1000 reactor of the Kalinin nuclear power plant upon transition from power-level operation to shutdown was studied experimentally. The data obtained were used for verification of the MORAVA-H2 program developed earlier for simulation of the coolant state in pressurized-water power reactors

SKODA JS in Central and Eastern European markets

International Nuclear Information System (INIS)

Luptacik, P.

2006-01-01

During the past decade, SKODA JS a.s. gained a leading position in the manufacture of equipment for the nuclear power sector in Central and Eastern Europe. The company benefited from its experience accumulated during the construction of VVER 440 and VVER 1000 NPPs at a time that saw a global decrease in popularity of the nuclear power sector. The company is building its success on a comprehensive understanding of the function of the primary coolant circuit and efforts to upgrade the equipment and processes so as to reflect new requirements in terms of safety and reactor unit service life. (orig.)

CATHARE-2 prediction of large primary to secondary leakage (PRISE) at PSB-VVER experimental facility

Energy Technology Data Exchange (ETDEWEB)

Sabotinov, L.; Chevrier, P. [Institut de Radioprotection et de Surete Nucleaire, 92 - Fontenay aux Roses (France)

2007-07-01

The large primary to secondary leakage (PRISE) is a specific loss-of-coolant accident in VVER reactors, related to the break of the steam generator collector cover, leading to loss of primary mass inventory and possible direct radioactive release to atmosphere. The best estimate thermal-hydraulic computer code CATHARE-2 Version 2.5-1 was used for post-test analysis of a PRISE experiment, conducted at the large scale test facility PSB-VVER in Russia. The PSB rig is 1:300 scaled model of VVER-1000 NPP. The accident is calculated with a 1.4% break size, which corresponds to 100 mm leak from primary to secondary side in the real NPP. A computer model has been developed for CATHARE-2 V2.5-1, taking into account all important components of the PSB facility: reactor model (lower plenum, core, bypass, upper plenum, downcomer), 4 separate loops, pressurizer, horizontal multi-tube steam generators, break section. The secondary side is presented by recirculation model. A large number of sensitivity calculations has been performed regarding break modeling, reactor pressure vessel modeling, counter current flow modeling, hydraulic losses, heat losses, steam generator level regulation. Comparison between calculated and experimental results shows good prediction of the basic thermal-hydraulic phenomena and parameters such as primary and secondary pressures, temperatures, loop flows, etc. Some discrepancies were observed in the calculations of primary mass inventory and loop seal clearance. Nevertheless the final core heat up, which is one of the most important safety criteria, was correctly predicted. (authors)

Fuel for new Russian reactor VVER-1200

Energy Technology Data Exchange (ETDEWEB)

Vasilchenko, Ivan Nikitovich [GRPress, 21, Ordzhonikidze Street, 142103 Podolsk, Moscow region (Russian Federation)

2009-06-15

A great program is accepted in Russia on increasing the nuclear power capacities. The basis of the program is commissioning of VVER-1200 Units of AES-2006 design. This is largely an evolutionary project of VVER-1000 reactor plant. It is referred also to reactor core. The plant electric power is increased due to increase in the reactor thermal power and forcing the main parameters and the efficiency increase. With this, reactor pressure increases from 15,7 to 16,2 MPa. The reactor inlet temperature increases from 290 deg. C to 298 deg. C, and outlet temperature from 319 deg. C to 329 deg. C. In a set of the design for four Units (2 Units at Novovoronezh NPP and 2 Units at Leningrad NPP) two base fuel cycles are developed: 5 year and 3 year. To provide such fuel cycles the fuel loading is increased by 8 tons, as compared to VVER-1000 base design, due to fuel column increase by 200 mm and change of fuel pellet sizes. In the mentioned fuel cycles the average burnup in the unloaded batch will be {approx}57 MW.day/kg U and 52 MW.day/kg U (maximum burnup over FAs is 64,5 MW.day/kg U and 60,3 MW.day/kg U), respectively. Specific consumption of natural uranium will be reduced by 5% as compared to that reached at VVER-1000 reactor. In spite of increase in Unit power the limiting permissible fuel rod linear heat rate is decreased from 448 W/cm to 420 W/cm. Refueling pattern is used with small neutron escape. The safety criteria are used that were established for VVER-1000, except for those that did not comply with EUR. For instance, the number of leaky fuel rods under accident is limited. The more stringent requirements are stated on efficiency margin of CPS rods for reactor shutdown that is ensured by the increased number of CPS rods. The well-proved design of fuel assembly TVS-2 and its close modification TVS-2M, operated at Balakovo NPP and Rostov NPP, is laid down in the basis of the core design. The load-carrying component of this structure is a rigid skeleton formed by

Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

Directory of Open Access Journals (Sweden)

Košťál Michal

2016-01-01

Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

Burnup Estimation of Rhodium Self-Powered Neutron Detector Emitter in VVER Reactor Core Using Monte Carlo Simulations

OpenAIRE

Khrutchinsky, А. А.; Kuten, S. A.; Babichev, L. F.

2011-01-01

Estimation of burn-up in a rhodium-103 emitter of self-powered neutron detector in VVER-1000 reactor core has been performed using Monte Carlo simulations within approximation of a constant neutron flux.

Analytical validation of operator actions in case of primary to secondary leakage for VVER-1000/V320

Energy Technology Data Exchange (ETDEWEB)

Andreeva, M., E-mail: m_andreeva@inrne.bas.bg; Groudev, P., E-mail: pavlinpg@inrne.bas.bg; Pavlova, M., E-mail: pavlova@inrne.bas.bg

2015-12-15

Highlights: • We validate operator actions in case of primary to secondary leakage. • We perform four scenarios related to SGTR accident for VVER-1000/V320. • The reference power plant for the analyses is Unit 6 at Kozloduy NPP. • The RELAP5/MOD 3.2 computer code is used in performing the analyses. • The analyses confirm the effectiveness of operator actions during PRISE. - Abstract: This paper presents the results of analytical validation of operator actions in case of “Steam Generator Tube Rupture” (SGTR) for VVER-1000/V320 units at Kozloduy Nuclear Power Plant (KNPP), done during the development of Symptom Based Emergency Operating Procedures (SB EOPs) for this plant. The purpose of the analyses is to demonstrate the ability to terminate primary to secondary leakage and to indicate an effective strategy for preventing secondary leakage to the environment and in this way to prevent radiological release to the environment. Following depressurization and cooldown of reactor coolant system (RCS) with isolation of the affected steam generator (SG), in these analyses are validated options for post-SGTR cooldown by: • back up filling the ruptured SG; • using letdown system in the affected SG and • by opening Fast Acting Isolation Valve (FAIV) and using Steam Dump Facility to the Condenser (BRU-K). The results of the thermal-hydraulic analyses have been used to assist KNPP specialists in analytical validation of EOPs. The RELAP5/MOD3.2 computer code has been used for the analyses in a VVER-1000 Nuclear Power Plant (NPP) model. A model of VVER-1000 based on Unit 6 of Kozloduy NPP has been developed for the thermal-hydraulics code RELAP5/MOD3.2 at the Institute for Nuclear Research and Nuclear Energy – Bulgarian Academy of Sciences (INRNE-BAS). This paper is possible through the participation of leading specialists from KNPP.

3D analysis of the reactivity insertion accident in VVER-1000

Energy Technology Data Exchange (ETDEWEB)

Abdullayev, A. M.; Zhukov, A. I.; Slyeptsov, S. M. [NSC Kharkov Inst. for Physics and Technology, 1, Akademicheskaya Str., Kharkov 61108 (Ukraine)

2012-07-01

Fuel parameters such as peak enthalpy and temperature during rod ejection accident are calculated. The calculations are performed by 3D neutron kinetics code NESTLE and 3D thermal-hydraulic code VIPRE-W. Both hot zero power and hot full power cases were studied for an equilibrium cycle with Westinghouse hex fuel in VVER-1000. It is shown that the use of 3D methodology can significantly increase safety margins for current criteria and met future criteria. (authors)

Conducting water chemistry of the secondary coolant circuit of VVER-based nuclear power plant units constructed without using copper containing alloys

Science.gov (United States)

Tyapkov, V. F.

2014-07-01

The secondary coolant circuit water chemistry with metering amines began to be put in use in Russia in 2005, and all nuclear power plant units equipped with VVER-1000 reactors have been shifted to operate with this water chemistry for the past seven years. Owing to the use of water chemistry with metering amines, the amount of products from corrosion of structural materials entering into the volume of steam generators has been reduced, and the flow-accelerated corrosion rate of pipelines and equipment has been slowed down. The article presents data on conducting water chemistry in nuclear power plant units with VVER-1000 reactors for the secondary coolant system equipment made without using copper-containing alloys. Statistical data are presented on conducting ammonia-morpholine and ammonia-ethanolamine water chemistries in new-generation operating power units with VVER-1000 reactors with an increased level of pH. The values of cooling water leaks in turbine condensers the tube system of which is made of stainless steel or titanium alloy are given.

Upgrading the safety of VVER-440/V-230

International Nuclear Information System (INIS)

Kelm, P.; Wenk, W.

1995-01-01

Besides measures seeking to restore the status as laid down in the project design, especially backfitting measures must be mentioned which serve to ensure component and pipe integrity. Ensuring component integrity is a problem not only of RPV embrittlement, but also of failure prevention. This aspect was not always taken into account properly. Further activities in the field of component integrity will focus on backing the brittle fracture evaluation of the RPV; qualifying the leak-before-breack criterion for the main pipes and in areas with screwed connections; qualifying the program of in-service inspections. Several operators are currently in the process of drafting backfitting programs. The upgrading measures envisaged must be checked as to their balanced nature. In certain plants, the integrity of the RPV coud turn out to be the weak spot in upgrading measures. As a consquence, concepts seeking to achieve upgrading for long periods of time may differ from one location to the next and even between units. Extensive modifications in systems engineering and building structures generally must be evaluated against the expected improvement in safety of the whole plant. (orig.) [de

VVER-440 loading patterns optimization using ATHENA code

International Nuclear Information System (INIS)

Katovsky, K.; Sustek, J.; Bajgl, J.; Cada, R.

2009-01-01

In this paper the Czech optimization state-of-the-art, new code system development goals and OPAL optimization system are briefly mentioned. The algorithms, maths, present status and future developments of the ATHENA code are described. A calculation exercise of the Dukovany NPP cycles, on increased power using ATHENA, starting with on-coming 24th cycle (303 FPD) continuing with 25th (322 FPD), and 26th (336 FPD); for all cycles K R ≤1.54 is presented

42 CFR 440.210 - Required services for the categorically needy.

Science.gov (United States)

2010-10-01

... services: (1) The services defined in §§ 440.10 through 440.50, 440.70, and (to the extent nurse-midwives and nurse practitioners are authorized to practice under State law or regulation) the services defined... necessary for the health of the pregnant woman and fetus, or that have become necessary as a result of the...

Kinetics Parameters of VVER-1000 Core with 3 MOX Lead Test Assemblies To Be Used for Accident Analysis Codes

International Nuclear Information System (INIS)

Pavlovitchev, A.M.

2000-01-01

The present work is a part of Joint U.S./Russian Project with Weapons-Grade Plutonium Disposition in VVER Reactor and presents the neutronics calculations of kinetics parameters of VVER-1000 core with 3 introduced MOX LTAs. MOX LTA design has been studied in [1] for two options of MOX LTA: 100% plutonium and of ''island'' type. As a result, zoning i.e. fissile plutonium enrichments in different plutonium zones, has been defined. VVER-1000 core with 3 introduced MOX LTAs of chosen design has been calculated in [2]. In present work, the neutronics data for transient analysis codes (RELAP [3]) has been obtained using the codes chain of RRC ''Kurchatov Institute'' [5] that is to be used for exploitation neutronics calculations of VVER. Nowadays the 3D assembly-by-assembly code BIPR-7A and 2D pin-by-pin code PERMAK-A, both with the neutronics constants prepared by the cell code TVS-M, are the base elements of this chain. It should be reminded that in [6] TVS-M was used only for the constants calculations of MOX FAs. In current calculations the code TVS-M has been used both for UOX and MOX fuel constants. Besides, the volume of presented information has been increased and additional explications have been included. The results for the reference uranium core [4] are presented in Chapter 2. The results for the core with 3 MOX LTAs are presented in Chapter 3. The conservatism that is connected with neutronics parameters and that must be taken into account during transient analysis calculations, is discussed in Chapter 4. The conservative parameters values are considered to be used in 1-point core kinetics models of accident analysis codes

EBO feed water distribution system, experience gained from operation

Energy Technology Data Exchange (ETDEWEB)

Matal, O. [Energovyzkum, Brno (Switzerland); Schmidt, S.; Mihalik, M. [Atomove Elektrarne Bohunice, Jaslovske Bohunice (Switzerland)

1997-12-31

Advanced feed water distribution systems of the EBO design have been installed into steam generators at Units 3 and 4 of the NPP Jaslovske Bohunice (VVER 440). Experiences gained from the operation of steam generators with the advanced feed water distribution systems are discussed in the paper. (orig.). 4 refs.

Third international seminar on horizontal steam generators

Energy Technology Data Exchange (ETDEWEB)

NONE

1995-12-31

The Third International Seminar on Horizontal Steam Generators held on October 18-20, 1994 in Lappeenranta, consisted of six sessions dealing with the topics: thermal hydraulic experiments and analyses, primary collector integrity, management of primary-to-secondary leakage accidents, feedwater collector replacement and discussion of VVER-440 steam generator safety issues.

Third international seminar on horizontal steam generators

International Nuclear Information System (INIS)

1995-01-01

The Third International Seminar on Horizontal Steam Generators held on October 18-20, 1994 in Lappeenranta, consisted of six sessions dealing with the topics: thermal hydraulic experiments and analyses, primary collector integrity, management of primary-to-secondary leakage accidents, feedwater collector replacement and discussion of VVER-440 steam generator safety issues

Third international seminar on horizontal steam generators

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-12-31

The Third International Seminar on Horizontal Steam Generators held on October 18-20, 1994 in Lappeenranta, consisted of six sessions dealing with the topics: thermal hydraulic experiments and analyses, primary collector integrity, management of primary-to-secondary leakage accidents, feedwater collector replacement and discussion of VVER-440 steam generator safety issues.

EBO feed water distribution system, experience gained from operation

Energy Technology Data Exchange (ETDEWEB)

Matal, O [Energovyzkum, Brno (Switzerland); Schmidt, S; Mihalik, M [Atomove Elektrarne Bohunice, Jaslovske Bohunice (Switzerland)

1998-12-31

Advanced feed water distribution systems of the EBO design have been installed into steam generators at Units 3 and 4 of the NPP Jaslovske Bohunice (VVER 440). Experiences gained from the operation of steam generators with the advanced feed water distribution systems are discussed in the paper. (orig.). 4 refs.

Appraisal of the implementation status of appendix general design criteria, of the 10CFR50 in the design of the Juragua NPP

International Nuclear Information System (INIS)

Rodriguez Aleman, Carlos; Mitjans Sanchez, Guillermo

1996-01-01

The work intends to reflect in a general manner the state of accomplishment of the general design requirements for NPP in the US and other parts of the world contained in 10CFR50 appendix A in the design solutions adopted for the Juragua plant with reactors VVER-440 V-318

Evaluation of the applicability of cladding deformation model in RELAP5/MOD3.2 code for VVER-1000 fuel

International Nuclear Information System (INIS)

Vorob'ev, Yu.; Zhabin, O.

2015-01-01

Applicability of cladding deformation model in RELAP5/MOD3.2 code is analyzed for VVER-1000 fuel cladding from Zr+1%Nb alloy. Experimental data and calculation model of fuel assembly channel of the core are used for this purpose. The model applicability is tested for the cladding temperature range from 600 to 1200 deg C and pressure range from 1 to 12 MPa. Evaluation results demonstrate limited applicability of built-in RELAP5/MOD3.2 cladding deformation model to the estimation of Zr+1%Nb cladding rupture conditions. The limitations found shall be considered in application of RELAP5/MOD3.2 cladding deformation model in the design-basis accident analysis of VVER reactors

Analysis of the VVER Standard Problem INSC-PSBV1 '11% Coolant Leak from Upper Plenum' with RELAP5/MOD3.2

International Nuclear Information System (INIS)

Melikhov, O.; Melikhov, V.; Parfenov, Yu.; Gavritenkova, O.; Lipatov, I.; Elkin, I.; Bayless, P.

2004-01-01

Analyses of a loss-of-coolant experiment carried out at the PSB-VVER test facility with the RELAP5/MOD3.2 code have been performed independently by analysts at the Electrogorsk Research and Engineering Center (EREC) and the Idaho National Engineering and Environmental Laboratory (INEEL). The PSB-VVER facility is a full-height scale model of a VVER 1000 reactor that is approximately 1/300 scale in volume and power. VVER Standard Problem INSC-PSBV1 represents an 11% leak from the upper plenum of the PSB-VVER facility, simulating the rupture of one of the accumulator injection lines. The safety-significant thermalhydraulic phenomena occurring in VVER type reactors addressed by this experiment were identified in the test validation matrix. Most of the phenomena of the validation matrix were reasonably simulated by RELAP5/MOD3.2 in both calculations. The major differences between the test and the calculations were the timing of the core heatup, and the thermal response to the accumulator injection cycles in both calculations. The INEEL calculation had a more extensive axial heatup, with most of the core experiencing small heat-ups. The accumulator injection was more effective in quenching the core in the test than in the INEEL calculation. This difference is attributed to the liquid distribution in the core, rather than to the heat transfer models in the code. The code calculation had a more uniform axial distribution of the liquid in the core, and the accumulator injection did not have much impact on the core liquid inventory. In the EREC calculation, only one heatup of the cladding temperature was observed for upper and middle section of the fuel rods before the final heatup. The small heat-ups were not reproduced in EREC calculation. The difference could be attributed to differences in liquid distribution, namely the core region in the EREC calculation contains more liquid over most of the transient than in the experiment. The distribution of liquid in the core in

Generation of multigroup cross-sections from micro-group ones in code system SUHAM-U used for VVER-1000 reactor core calculations with MOX loading

Energy Technology Data Exchange (ETDEWEB)

Boyarinov, V.F.; Davidenko, V.D.; Polismakov, A.A.; Tsybulsky, V.F. [RRC Kurchatov Institute, Moscow (Russian Federation)

2005-07-01

At the present time, the new code system SUHAM-U for calculation of the neutron-physical processes in nuclear reactor core with triangular and square lattices based both on the modern micro-group (about 7000 groups) cross-sections library of code system UNK and on solving the multigroup (up to 89 groups) neutron transport equation by Surface Harmonics Method is elaborated. In this paper the procedure for generation of multigroup cross-sections from micro-group ones for calculation of VVER-1000 reactor core with MOX loading is described. The validation has consisted in computing VVER-1000 fuel assemblies with uranium and MOX fuel and has shown enough high accuracy under corresponding selection of the number and boundaries of the energy groups. This work has been fulfilled in the frame of ISTC project 'System Analyses of Nuclear Safety for VVER Reactors with MOX Fuels'.

Analysing The Thermalhydraulic Parameters Of VVER-1000 Reactor For The Accident Of Steam Generator Tube Rupture

International Nuclear Information System (INIS)

Luu Nam Hai; Truong Cong Thang

2011-01-01

To ensure the safety operation of nuclear power plant (NPP), a lot of postulated accident scenarios were considered and analysed. This research chose and analysed the accident of steam generator tube rupture (SGTR) under the actual plant conditions by using the simulation program PCTRAN. The SGTR accident is happen when the NPP is under operation with the steady state condition (power of 3000 MWth, primary pressure of 157 bar and secondary pressure of 63 bar). The accident is initiated by creating a break with equivalent diameter of 100 mm in the area of lower row heat exchanging tubes. The result of analysis is compared with the calculation of the Shariz University, Iran using the thermal hydraulics code RELAP5/mod3.2 and the report in the PSAR data of VVER-1000. This comparison shows that it is possible for using PCTRAN to analyse accidents of VVER-1000 reactor. (author)

The virtual digital nuclear power plant: A modern tool for supporting the lifecycle of VVER-based nuclear power units

Science.gov (United States)

Arkadov, G. V.; Zhukavin, A. P.; Kroshilin, A. E.; Parshikov, I. A.; Solov'ev, S. L.; Shishov, A. V.

2014-10-01

The article describes the "Virtual Digital VVER-Based Nuclear Power Plant" computerized system comprising a totality of verified initial data (sets of input data for a model intended for describing the behavior of nuclear power plant (NPP) systems in design and emergency modes of their operation) and a unified system of new-generation computation codes intended for carrying out coordinated computation of the variety of physical processes in the reactor core and NPP equipment. Experiments with the demonstration version of the "Virtual Digital VVER-Based NPP" computerized system has shown that it is in principle possible to set up a unified system of computation codes in a common software environment for carrying out interconnected calculations of various physical phenomena at NPPs constructed according to the standard AES-2006 project. With the full-scale version of the "Virtual Digital VVER-Based NPP" computerized system put in operation, the concerned engineering, design, construction, and operating organizations will have access to all necessary information relating to the NPP power unit project throughout its entire lifecycle. The domestically developed commercial-grade software product set to operate as an independently operating application to the project will bring about additional competitive advantages in the modern market of nuclear power technologies.

40 CFR 440.40 - Applicability; description of the mercury ore subcategory.

Science.gov (United States)

2010-07-01

... mercury ore subcategory. 440.40 Section 440.40 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS ORE MINING AND DRESSING POINT SOURCE CATEGORY Mercury Ore Subcategory § 440.40 Applicability; description of the mercury ore subcategory. The provisions of subpart D...

Accounting for the inertia of the thermocouples' measurements by modelling of a NPP Kalinin-3 transient with the coupled system code ATHLET-BIPR-VVER

International Nuclear Information System (INIS)

Nikonov, S.; Velkov, K.

2008-01-01

The ATHLET-BIPR-VVER coupled system code is applied for performing of safety analysis for different WWER reactors. During the last years its validation matrix is continuously being enlarged. The measurements performed during the commissioning phase of NPP Kalinin Unit 3 for the transient 'Switching-off of one Main Circulation Pump at nominal power' are very well documented and have a variety of recorded integral and local thermo-hydraulic and neutron-physic parameters including the measurements' errors. This data is being used for further validation of the coupled code system ATHLET-BIPR-VVER. In the paper are discussed the problems and our solutions by the correct interpretation of the measured thermocouples' records at NPP Kalinin-3 and the comparison with the predicted results by the coupled thermal-hydraulic/neutron-kinetic code ATHLET-BIPR-VVER. Of primary importance by such comparisons is the correct accounting of the fluid mixing process that take place in the surrounding of the measuring sensors and also the consideration of the time delay (inertia term) of the measuring devices. On the bases of previous experience and many simulations of the defined transient a method is discussed and proposed to consider correctly the inertia term of the thermocouples' measurements. The new modelling is implemented in the coupled system code ATHLET-BIPR-VVER for further validation. (Author)

20 CFR 663.440 - What are the requirements for consumer choice?

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What are the requirements for consumer choice? 663.440 Section 663.440 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF... Training Accounts § 663.440 What are the requirements for consumer choice? (a) Training services, whether...

Regulation of granulocyte colony-stimulating factor receptor-mediated granulocytic differentiation by C-mannosylation.

Science.gov (United States)

Otani, Kei; Niwa, Yuki; Suzuki, Takehiro; Sato, Natsumi; Sasazawa, Yukiko; Dohmae, Naoshi; Simizu, Siro

2018-04-06

Granulocyte colony-stimulating factor (G-CSF) receptor (G-CSFR) is a type I cytokine receptor which is involved in hematopoietic cell maturation. G-CSFR has three putative C-mannosylation sites at W253, W318, and W446; however, it is not elucidated whether G-CSFR is C-mannosylated or not. In this study, we first demonstrated that G-CSFR was C-mannosylated at only W318. We also revealed that C-mannosylation of G-CSFR affects G-CSF-dependent downstream signaling through changing ligand binding capability but not cell surface localization. Moreover, C-mannosylation of G-CSFR was functional and regulated granulocytic differentiation in myeloid 32D cells. In conclusion, we found that G-CSFR is C-mannosylated at W318 and that this C-mannosylation has role(s) for myeloid cell differentiation through regulating downstream signaling. Copyright © 2018 Elsevier Inc. All rights reserved.

40 CFR 440.90 - Applicability; description of the antimony ore subcategory.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Applicability; description of the antimony ore subcategory. 440.90 Section 440.90 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS ORE MINING AND DRESSING POINT SOURCE CATEGORY Antimony Ore Subcategory § 440.90 Applicability;...

Development of a qualified nodalization for small-break LOCA transient analysis in PSB-VVER integral test facility by RELAP5 system code

Energy Technology Data Exchange (ETDEWEB)

Shahedi, S. [Department of Energy Engineering, Sharif University of Technology, Azadi Street, Tehran (Iran, Islamic Republic of); Jafari, J., E-mail: jalil_jafari@yahoo.co [Reactors and Accelerators R and D School, Nuclear Science and Technology Research Institute, North Kargar Street, Tehran (Iran, Islamic Republic of); Boroushaki, M. [Department of Energy Engineering, Sharif University of Technology, Azadi Street, Tehran (Iran, Islamic Republic of); D' Auria, F. [DIMNP, University of Pisa, Via Diotisalvi 2, 56126 Pisa (Italy)

2010-10-15

This paper deals with development and qualification of a nodalization for modeling of the PSB-VVER integral test facility (ITF) by RELAP5/MOD3.2 code and prediction of its primary and secondary systems behaviors at steady state and transient conditions. The PSB-VVER is a full-height, 1/300 volume and power scale representation of a VVER-1000 NPP. A RELAP5 nodalization has been developed for PSB-VVER modeling and a nodalization qualification process has been applied for the developed nodalization at steady state and transient levels and a qualified nodalization has been proposed for modeling of the PSB ITF. The 11% small-break loss-of-coolant-accident (SBLOCA), i.e. rupture of one of the hydroaccumulators (HA) injection lines in the upper plenum (UP) region of reactor pressure vessel (RPV) below the hot legs (HL), inlets has been considered for nodalization qualification process. The influence of the different steam generator (SG) nodalizations on the RELAP5 results and on the nodalization qualification process has been examined. The 'steady state' qualification level includes checking the correctness of the initial and boundary conditions and geometrical fidelity. In the 'transient' qualification level, the time dependent results of the code calculation are compared with the experimental time trends from both the qualitative and quantitative point of view. For quantitative assessment of the results, a Fast Fourier Transform Based Method (FFTBM) has been used. The FFTBM was used to establish a range in which the steam generators nodalizations can vary.

Temperature and boron dependencies of buckling and radial reflector saving for VVER lattices

International Nuclear Information System (INIS)

Alvarez, C.

1990-01-01

The temperature and boron dependencies of buckling and radial reflectors savings are analyzed in this paper on the basis of the results from the calculations ZR-6M critical assembly. These dependencies are related to the physical behavior of temperature and boron reactivity coefficients for the cores of VVER-type critical facilities. As a byproduct, the parameter was also investigated and its dependence on water density was determined

Expression of granulocyte colony-stimulating factor receptor correlates with prognosis in oral and mesopharyngeal carcinoma.

Science.gov (United States)

Tsuzuki, H; Fujieda, S; Sunaga, H; Noda, I; Saito, H

1998-02-15

Granulocyte colony-stimulating factor receptors (G-CSFRs) have been observed on the surface of not only hematopoietic cells but also several cancer cells. The stimulation of G-CSF has been demonstrated to induce proliferation and activation of G-CSFR-positive cells. In this study, we investigated the expression of G-CSFR on the surface of tumor cells and G-CSF production in oral and mesopharyngeal squamous cell carcinoma (SCC) by an immunohistochemical approach. Of 58 oral and mesopharyngeal SCCs, 31 cases (53.4%) and 36 cases (62.1%) were positive for G-CSFR and G-CSF, respectively. There was no association between G-CSFR expression and G-CSF staining. In the group positive for G-CSFR expression, relapse was significantly more likely after primary treatment (P = 0.0069), whereas there was no association between G-CSFR expression and age, sex, tumor size, lymph node metastasis, and clinical stage. Also, the G-CSFR-positive groups had a significantly lower disease-free and overall survival rate than the G-CSFR-negative groups (P = 0.0172 and 0.0188, respectively). However, none of the clinical markers correlated significantly with G-CSF staining, nor did the status of G-CSF production influence the overall survival. The results imply that assessment of G-CSFR may prove valuable in selecting patients with oral and mesopharyngeal SCC for aggressive therapy.

Extension and Verification of the Cross-Section Library for the VVER-1000 Surveillance Specimen Region

International Nuclear Information System (INIS)

Kirilova, D.; Belousov, S.; Ilieva, K.

2011-01-01

The objective of this work is a generation of new version of the BGL multigroup cross-section to extend the region of its applicability. The existing library version is problem oriented for VVER-1000 type of reactors and was generated by collapsing of the VITAMIN-B6 problem independent cross-section fine-group library applying the VVER-1000 reactor middle plane spectrum in cylindrical geometry. The new version BGLex additionally contains cross-sections averaged on the corresponding spectra of the surveillance specimen's (SS) region for VVER-1000 type of reactors. Comparative analysis of the neutron spectra for different one-dimensional geometry models that could be applied for the cross-section collapsing using the software package SCALE, showed a high sensitivity of the results to the geometry model. That is why a neutron importance assessment was done for the SS region using the adjoint solution calculated by the two-dimensional code DORT and problem-independent library VITAMIN-B6. The one-dimensional geometry model applied to the cross-section collapsing were determined by the material limits above the reactor core in axial direction z as for every material a homogenization in radial direction was done. The material homogenization in radial direction was done by material weighing taking into account the adjoint solution as well as the neutron source. The one-dimensional geometry model comprising the homogenized weighed materials was applied for the cross-section generation of the fine-group library VITAMIN-B6 to the broad-group structure of BGL library. The new version BGLex was extended with cross-sections for the SS region. Verification and validation of the new version BGLex is forthcoming. It includes comparison between the calculated results with the new version BGLex and the libraries BGL and VITAMIN-B6 and comparison with experimental results. (author)

Extension and Verification of the Cross-Section Library for the VVER- 1000 Surveillance Specimen Region

International Nuclear Information System (INIS)

Kirilova, D.; Belousov, S.; Ilieva, K.

2011-01-01

The objective of this work is a generation of new version of the BGL multigroup cross-section to extend the region of its applicability. The existing library version is problem oriented for VVER-1000 type of reactors and was generated by collapsing of the VITAMIN-B6 problem independent cross-section fine-group library applying the VVER-1000 reactor middle plane spectrum in cylindrical geometry. The new version BGLex additionally contains cross-sections averaged on the corresponding spectra of the surveillance specimen's (SS) region for VVER-1000 type of reactors. Comparative analysis of the neutron spectra for different one-dimensional geometry models that could be applied for the cross-section collapsing using the software package SCALE, showed a high sensitivity of the results to the geometry model. That is why a neutron importance assessment was done for the SS region using the adjoint solution calculated by the two-dimensional code DORT and problem-independent library VITAMIN-B6. The one-dimensional geometry model applied to the cross-section collapsing were determined by the material limits above the reactor core in axial direction z as for every material a homogenization in radial direction was done. The material homogenization in radial direction was done by material weighing taking into account the adjoint solution as well as the neutron source. The one-dimensional geometry model comprising the homogenized weighed materials was applied for the cross-section generation of the fine-group library VITAMIN-B6 to the broad-group structure of BGL library. The new version BGLex was extended with cross-sections for the SS region. Verification and validation of the new version BGLex is forthcoming. It includes comparison between the calculated results with the new version BGLex and the libraries BGL and VITAMIN-B6 and comparison with experimental results. (author)

Experimental study of asymmetric boron dilution at VVER-1000 of Kudankulam NPP and its simulation

Energy Technology Data Exchange (ETDEWEB)

Tsyganov, Sergey V.; Kotsarev, Alexander V.; Baykov, Alexander V. [National Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation)

2017-09-15

The Kudankulam NPP units contain additional and unique for VVER Quick Boron Injection System (QBIS) for beyond-design-basis accident management without scram. During the physical start-up stage at hot zero power of both Kudankulam units, special tests were performed to assess the efficiency of the system. In the course of test three out of four QBIS tanks had been promptly opened and it led to the asymmetrical injection of boric acid into the core. The scenario of the tests may address to the inhomogeneous boron dilution process that is now an essential part of safety analysis of pressurised water reactors. The simulation of the process, including ex-core ion chambers readings, has been accomplished using ATHLET/BIPR-VVER code. Behaviour of some reactor parameters in the course of the test and some results of the simulation are discussing in the paper. Authors believe the process of the asymmetrical injection of boric acid may be useful for verification and validation of coupled neutronic and thermo-hydraulic codes widely used for safety analysis, including analysis of boron dilution accident.

Acoustic leak detection at complicated topologies using neural netwoks

International Nuclear Information System (INIS)

Hessel, G.; Schmitt, W.; Weiss, F.P.

1994-01-01

Considering the shortcomings of all the existing leak detecting principles, a new method again based on the measurement of the leak induced sound but also applying pattern recognition is being developed. The capability of neural networks to localize leaks at the reactor pressure vessel (RPV) head of VVER-440 reactors is discussed. (orig./DG)

The Procedure for Determination of Special Margin Factors to Account for a Bow of the VVER-1000 Fuel Assemblies

International Nuclear Information System (INIS)

Tsyganov, Sergey V.; Marin, Stanislav V.; Shishkov, Lev K.

2008-01-01

Starting from 1980's, the problem of bow of the VVER-1000 reactor FAs and the effect of that on the operational safety is being discussed. At the initial period of time, the extension of time for dropping control rods of the control and protection system associated with this bow posed the highest threat. Later on, new more rigid structures were developed for FAs that eliminated the problems of control rods. However, bow of the VVER-1000 reactor FAs is observed up to now. The scale of this bow reduced significantly but it still effects safety. Even a minor bow available may lead to the noticeable increase of power of individual fuel pins associated with the local variation of the coolant amount. This effect must be taken into account on designing fuel loadings to eliminate the exceeding of set limitations. The introduction of additional special margins is the standard method for taking this effect into account. The present paper describes the conservative technique for the assessment of additional margins for bow of FAs of state-of-the-art designs. This technique is employed in the VVER-1000 reactor designing. The chosen conservatism degree is discussed as well as the method for its assurance and acceptable ways for its slackening. The example of the margin evaluation for the up-to-date fuel loading is given. (authors)

The Procedure for Determination of Special Margin Factors to Account for a Bow of the VVER-1000 Fuel Assemblies

Energy Technology Data Exchange (ETDEWEB)

Tsyganov, Sergey V.; Marin, Stanislav V.; Shishkov, Lev K. [Russian Research Center ' Kurchatov Institute' , 1., Kurchatov sq., 123182 Moscow (Russian Federation)

2008-07-01

Starting from 1980's, the problem of bow of the VVER-1000 reactor FAs and the effect of that on the operational safety is being discussed. At the initial period of time, the extension of time for dropping control rods of the control and protection system associated with this bow posed the highest threat. Later on, new more rigid structures were developed for FAs that eliminated the problems of control rods. However, bow of the VVER-1000 reactor FAs is observed up to now. The scale of this bow reduced significantly but it still effects safety. Even a minor bow available may lead to the noticeable increase of power of individual fuel pins associated with the local variation of the coolant amount. This effect must be taken into account on designing fuel loadings to eliminate the exceeding of set limitations. The introduction of additional special margins is the standard method for taking this effect into account. The present paper describes the conservative technique for the assessment of additional margins for bow of FAs of state-of-the-art designs. This technique is employed in the VVER-1000 reactor designing. The chosen conservatism degree is discussed as well as the method for its assurance and acceptable ways for its slackening. The example of the margin evaluation for the up-to-date fuel loading is given. (authors)

System analysis of nuclear safety of VVER reactor with MOX fuel

Energy Technology Data Exchange (ETDEWEB)

Klimov, A.D.; Zharkov, V.P.; Suslov, I.R. [Russia, Moscow Malaya Krasnoselskaya St. (Russian Federation); Boyarinov, V.F.; Kevrolev, V.V.; Tchibinyaev, A.V.; Tsibulskiy, V.F. [RRC KI, Russia, Moscow (Russian Federation); Kochurov, B.P. [ITEP, Russia, Moscow (Russian Federation); Giovanni, B. [NFPSC, FRAMATOME (France)

2005-07-01

The report presents a short summary of the results achieved in the ISTC (International Science and Technology Center) project 'System analysis of nuclear safety of VVER reactor with MOX fuel' (April 2005). The studies within the project are of a systematic character and include the solutions of 15 tasks. The report gives an overview of the major blocks of these tasks: neutron transport equation solution; calculations of isotopic vectors, analysis of the impact of uncertainties on predicted reactor functionals. The calculation methods, the verification results and the corresponding codes are briefly described. (authors)

Level 1 shutdown and low power operation of Mochovce NPP, Unit 1, Slovakia

International Nuclear Information System (INIS)

Halada, P.; Cillik, I.; Stojka, T.; Kuzma, M.; Prochaska, J.; Vrtik, L.

2004-01-01

The paper presents general approach, used methods and form of documentation of the results that have been applied within the shutdown and low power PSA (SPSA) study for Mochovce NPP, Unit 1, Slovakia. The SPSA project was realized by VUJE Trnava Inc., Slovakia in 2001-2002 years. The Level 1 SPSA study for Mochovce NPP Unit 1 covers internal events as well as internal (fires, floods and heavy load drop) and external (aircraft crash, extreme meteorological conditions, seismic event and influence of surrounding industry) hazards. Mochovce NPP consists of two operating units equipped with VVER 440/V213 reactors safety upgraded before construction finishing and operation start. 87 safety measures based on VVER 440 operational experience and international mission insights were implemented to enhance its operational and nuclear safety. The SPSA relates to full power PSA (FPSA) as a continuation of the effort to create a harmonized level 1 PSA model for all operational modes of the plant with the goal to use it for further purposes as follows: Real Time Risk Monitor, Maintenance Optimization, Technical Specifications Optimization, Living PSA. (author)

10 CFR 440.23 - Oversight, training, and technical assistance.

Science.gov (United States)

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Oversight, training, and technical assistance. 440.23... PERSONS § 440.23 Oversight, training, and technical assistance. (a) The Secretary and the appropriate..., directly or indirectly, training and technical assistance to any grantee or subgrantee. Such training and...

DRAGON analysis of MOX fueled VVER cell benchmarks

International Nuclear Information System (INIS)

Marleau, G.; Foissac, F.

2002-01-01

The computational unit-cell benchmarks problems for LEU and MOX fueled VVER-1000 ('water-water energetic reactor') have been analyzed using the code DRAGON with ENDF/B-V and ENDF/B-VI based WIMS-AECL cross section libraries. The results obtained were compared with those generated using the SAS2H module of the SCALE-4.3 computational code system and with the code HELIOS. Good agreements between DRAGON and HELIOS were obtained when the ENDF/B-VI based library was considered while the ENDF/B-V DRAGON results were generally closer to those obtained using SAS2H. This study was useful for the verification of the DRAGON code and confirms that HELIOS and DRAGON have a similar behavior when compatible cross sections library are used. (author)

Temperature and boron dependencies of buckling and radial reflector savings for VVER lattices

International Nuclear Information System (INIS)

Alvarez, C.

1990-01-01

The temperature and boron dependencies of buckling and radial reflector savings are analyzed in this paper on the basis of the results from the calculations for the ZR-6M critical assembly. These dependencies are related to he physical behaviour of temperature and boron reactivity coefficients for the cores of VVER-type critical facilities. As a byproduct, the dp/dBg 2 parameter was also investigated and its dependence on water density was determined

Issues in the use of Weapons-Grade MOX Fuel in VVER-1000 Nuclear Reactors: Comparison of UO2 and MOX Fuels

Energy Technology Data Exchange (ETDEWEB)

Carbajo, J.J.

2005-05-27

The purpose of this report is to quantify the differences between mixed oxide (MOX) and low-enriched uranium (LEU) fuels and to assess in reasonable detail the potential impacts of MOX fuel use in VVER-1000 nuclear power plants in Russia. This report is a generic tool to assist in the identification of plant modifications that may be required to accommodate receiving, storing, handling, irradiating, and disposing of MOX fuel in VVER-1000 reactors. The report is based on information from work performed by Russian and U.S. institutions. The report quantifies each issue, and the differences between LEU and MOX fuels are described as accurately as possible, given the current sources of data.

42 CFR 440.260 - Methods and standards to assure quality of services.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Methods and standards to assure quality of services. 440.260 Section 440.260 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH... and Limits Applicable to All Services § 440.260 Methods and standards to assure quality of services...

Qualification of the nuclear reactor core model DYN3D coupled to the thermohydraulic system code ATHLET, applied as an advanced tool for accident analysis of VVER-type reactors. Final report; Qualifizierung des Kernmodells DYN3D im Komplex mit dem Stoerfallcode ATHLET als fortgeschrittenes Werkzeug fuer die Stoerfallanalyse von WWER-Reaktoren. T. 1. Abschlussbericht

Energy Technology Data Exchange (ETDEWEB)

Grundmann, U.; Kliem, S.; Krepper, E.; Mittag, S; Rohde, U.; Schaefer, F.; Seidel, A.

1998-03-01

The nuclear reactor core model DYN3D with 3D neutron kinetics has been coupled to the thermohydraulic system code ATHLET. In the report, activities on qualification of the coupled code complex ATHLET-DYN3D as a validated tool for the accident analysis of russian VVER type reactors are described. That includes: - Contributions to the validation of the single codes ATHLET and DYN3D by the analysis of experiments on natural circulation behaviour in thermohydraulic test facilities and solution of benchmark tasks on reactivity initiated transients, - the acquisition and evaluation of measurement data on transients in nuclear power plants, the validation of ATHLET-DYN3D by calculating an accident with delayed scram and a pump trip in VVER plants, - the complementary improvement of the code DYN3D by extension of the neutron physical data base, implementation of an improved coolant mixing model, consideration of decay heat release and xenon transients, - the analysis of steam leak scenarios for VVER-440 type reactors with failure of different safety systems, investigation of different model options. The analyses showed, that with realistic coolant mixing modelling in the downcomer and the lower plenum, recriticality of the scramed reactor due to overcooling can be reached. The application of the code complex ATHLET-DYN3D in Czech Republic, Bulgaria and the Ukraine has been started. Future work comprises the verification of ATHLET-DYN3D with a DYN3D version for the square fuel element geometry of western PWR. (orig.) [Deutsch] Das Reaktorkernmodell DYN3D mit 3D Neutronenkinetik wurde an den Thermohydraulik-Systemcode ATHLET angekoppelt. Im vorliegenden Bericht werden Arbeiten zur Qualifizierung des gekoppelten Codekomplexes zu einem validierten Hilfsmittel fuer Stoerfallablaufanalysen zu Reaktoren des russischen Typs WWER dargestellt. Diese umfassten im einzelnen: - Beitraege zur Validierung der Einzelcodes ATHLET und DYN3D anhand der Nachrechnung von Experimenten zum

Comparison of problems and experience of core operation with distorted fuel element assemblies in VVER-1000 and PWR reactors

International Nuclear Information System (INIS)

Afanas'ev, A.

1999-01-01

The main reactors leading to distortion of fuel element assemblies during reactor operation were studied. A series of actions which compensate this effect was proposed. Criteria of operation limitation in VVER-1000 and PWR reactors are described

Structural strength during severe reactor accidents of the VVER- 91 nuclear power plant

International Nuclear Information System (INIS)

Varpasuo, P.

1999-12-01

The report summarises the studies carried out in Fortum Engineering (formerly IVO Power Engineering) between the years of 1992 and 1997 concerning ultimate strength of structures designed to mitigate and contain the consequences of various core melt accident scenarios. The report begins with the description of containment loading situations arising from core melt accidents. These situations are divided to fast and slow loads. Fast loads include ex-vessel steam explosions, steam spikes, hydrogen burns, direct containment heating and missiles. Slow loads are connected with pressure rise inside the containment in case when the containment heat removal system is not functioning. First part of report describes the analyses of reactor cavity based on axi-symmetric load assumptions. These studies are performed with various models like one degree of freedom idealisation, axi-symmetric modelling of geometry and full three-dimensional modelling of geometry. Second part of report describes the analyses of cavity based on non-axi-symmetric load assumptions. Here full 3D- geometry model is used combined with various physical models for the behaviour of reinforced concrete. Third part of report gives short account of the analysis of containment ultimate pressure capacity. The containment model in this case includes pre-stressing tendons and mild steel reinforcing bars. The load is assumed to axi-symmetric internal static pressure. The capacity of the reactor cavity against the ex-vessel steam explosion scenarios for VVER-91 plant concept is established for both axi-symmetric and non-axi-symmetric load models using ANACAP structural analysis code. The validation of the cavity response to ex-vessel steam explosion load using different commercially available codes gave mixed results for both axisymmetric and non-axi-symmetric load presentations.The ultimate static overpressure capacity of the VVER-91 reactor cavity structure was established to be of the order of 10 MPa. This result

Steam oxidation of Zr 1% Nb clads of VVER fuels in high temperature

International Nuclear Information System (INIS)

Solyanyj, V.I.; Bibilashvili, Yu.K.; Dranenko, V.V.; Levin, A.Ya.; Izrajlevskij, L.B.; Morozov, A.M.

1984-01-01

In a wide range of accident conditions processes of clad corrosion effected by steam are rather intensive and in many respects influence the safety of NPP and the after-accident dismantling of a reactor core. This paper discusses the results of comprehensive studies into corrosion behaviour of Zr 1%Nb clads of VVER-type fuels at high temperatures. These studies are a continuation of previous work and the base for the design modelling of corrosion processes

Simulation of the SPE-4 small-break loss-of-coolant accident

International Nuclear Information System (INIS)

Cebull, P.; Hassan, Y.A.

1993-01-01

A small-break loss of coolant accident (SBLOCA) conducted at the PMK-2 integral test facility was analyzed using RELAP5/MOD3. 1. The experiment simulated a 7.4% break in the cold leg of a VVER-440/213-type nuclear power plant as part of the International Atomic Energy Agency's Fourth Standard Problem Exercise (SPE-4). The VVER design differs from pressurized water reactors (PWRS) of western origin, primarily in its use of horizontal steam generators, hot- and cold-leg loop seals, and safety injection tanks. Because of these differences, it will exhibit somewhat different transient behavior than most PWRS. The PMK-2 test facility, located at the KFKI Atomic Energy Research Institute (AEKI), is a scale model of the Paks nuclear power plant in Hungary with scaling factors of 1:2070 in power and volume and 1:1 in elevation. Primarily used to study SBLOCAs and natural circulation behavior of VVER reactors, it has been used in three previous SPEs

Calculations of 3D full-scale VVER fuel assembly and core models using MCU and BIPR-7A codes

Energy Technology Data Exchange (ETDEWEB)

Aleshin, Sergey S.; Bikeev, Artem S.; Bolshagin, Sergey N.; Kalugin, Mikhail A.; Kosourov, Evgeniy K.; Pavlovichev, Aleksandr M.; Pryanichnikov, Aleksandr V.; Sukhino-Khomenko, Evgenia A.; Shcherenko, Anna I.; Shcherenko, Anastasia I.; Shkarovskiy, Denis A. [Nuclear Research Centre ' ' Kurchatov Institute' ' , Moscow (Russian Federation)

2015-09-15

Two types of calculations were made to compare BIPR-7A and MCU results for 3D full-scale models. First EPS (emergency protection system) efficiency and in-core power distributions were analyzed for an equilibrium fuel load of VVER-1000 assuming its operation within an 18-month cycle. Computations were performed without feedbacks and with fuel burnup distributed over the core. After 3D infinite lattices of full-scale VVER-1000 fuel assemblies (A's) with uranium fuel 4.4% enrichment and uranium-erbium fuel 4.4% enrichment and Er{sub 2}O{sub 3} 1 % wt were considered. Computations were performed with feedbacks and fuel burnup at the constant power level. For different time moments effective multiplication factor and power distribution were obtained. EPS efficiency and reactivity effects at chosen time moments were analyzed.

Post-Test Analysis of 11% Break at PSB-VVER Experimental Facility using Cathare 2 Code

Science.gov (United States)

Sabotinov, Luben; Chevrier, Patrick

The best estimate French thermal-hydraulic computer code CATHARE 2 Version 2.5_1 was used for post-test analysis of the experiment “11% upper plenum break”, conducted at the large-scale test facility PSB-VVER in Russia. The PSB rig is 1:300 scaled model of VVER-1000 NPP. A computer model has been developed for CATHARE 2 V2.5_1, taking into account all important components of the PSB facility: reactor model (lower plenum, core, bypass, upper plenum, downcomer), 4 separated loops, pressurizer, horizontal multitube steam generators, break section. The secondary side is represented by recirculation model. A large number of sensitivity calculations has been performed regarding break modeling, reactor pressure vessel modeling, counter current flow modeling, hydraulic losses, heat losses. The comparison between calculated and experimental results shows good prediction of the basic thermal-hydraulic phenomena and parameters such as pressures, temperatures, void fractions, loop seal clearance, etc. The experimental and calculation results are very sensitive regarding the fuel cladding temperature, which show a periodical nature. With the applied CATHARE 1D modeling, the global thermal-hydraulic parameters and the core heat up have been reasonably predicted.

A successful approach for the implementation of symptom-based emergency operating procedures for VVER reactors

International Nuclear Information System (INIS)

Lhoest, V.; Prior, R.; Pascal, G.

2000-01-01

The paper provides an overview of the organization, the progress and the results of the various Emergence Operating Procedure (EOP) development programs for VVER type reactors conducted by Westinghouse so far. The detailed working process is presented through the solutions to some major plant issues. The EOPs have been developed for the Temelin, Dukovany, Bohunice, Mochovce and Paks VVER nuclear power plants. The procedures are developed in working teams of experts from the utility and Westinghouse. The completion of the programs constitute an indication of the overall success of this approach. This is further reinforced by the general acceptance of the new procedures by the plant personnel, together with the good results obtained so far from procedure testing. This is also confirmed by a new PSA-level 1 analysis for Dukovany plant, which shows a significant improvement in the overall plant safety. This means a 20% reduction in the Core Damage Frequency due to the introduction of the new EOPs. The fact that some modifications have been implemented to the plants to solve design weaknesses identified in the course of this programs also constitute a positive result

Study of Fast Transient Pressure Drop in VVER-1000 Nuclear Reactor Using Acoustic Phenomenon

Directory of Open Access Journals (Sweden)

Soroush Heidari Sangestani

2018-01-01

Full Text Available This article aims to simulate the sudden and fast pressure drop of VVER-1000 reactor core coolant, regarding acoustic phenomenon. It is used to acquire a more accurate method in order to simulate the various accidents of reactor core. Neutronic equations should be solved concurrently by means of DRAGON 4 and DONJON 4 coupling codes. The results of the developed package are compared with WIMS/CITATION and final safety analysis report of Bushehr VVER-1000 reactor (FSAR. Afterwards, time dependent thermal-hydraulic equations are answered by employing Single Heated Channel by Sectionalized Compressible Fluid method. Then, the obtained results were validated by the same transient simulation in a pressurized water reactor core. Then, thermal-hydraulic and neutronic modules are coupled concurrently by use of producing group constants regarding the thermal feedback effect. Results were compared to the mentioned transient simulation in RELAP5 computer code, which show that mass flux drop is sensed at the end of channel in several milliseconds which causes heat flux drop too. The thermal feedback resulted in production of some perturbations in the changes of these parameters. The achieved results for this very fast pressure drop represent accurate calculations of thermoneutronic parameters fast changes.

Calculation with MCNP of capture photon flux in VVER-1000 experimental reactor.

Science.gov (United States)

Töre, Candan; Ortego, Pedro

2005-01-01

The aim of this study is to obtain by Monte Carlo method the high energy photon flux due to neutron capture in the internals and vessel layers of the experimental reactor LR-0 located in REZ, Czech Republic, and loaded with VVER-1000 fuel. The calclated neutron, photon and photon to neutron flux ratio are compared with experimental measurements performed with a multi-parameter stilbene detector. The results show clear underestimation of photon flux in downcomer and some overestimation at vessel surface and 1/4 thickness but a good fitting for deeper points in vessel.

Radioactive release from VVER-1000 reactors after a terror attack

International Nuclear Information System (INIS)

Sdouz, G.

2005-01-01

Full text: One of the terror scenarios for nuclear power plants is a severe damage of the reactor containment caused by a plane crash or a missile. Due to the loss of electric power the cooling of the core is not maintained leading to a core melt accident. Normally in the course of severe accidents an intact containment has the ability to retain a large part of the radioactive inventory. The goal of this work is the investigation of the behavior of the radioactive release from a VVER-1000-type reactor during a severe accident with a large containment leak from the beginning of the accident. The results are compared with the release in a severe accident via a very small leakage due to the untightness of the containment. This work supplements a series of studies investigating the behavior of a VVER-1000-type reactor during severe accidents under different accident management strategies. The focus in this study is on the 'station blackout'-sequence (or TMLB' in the WASH-1400 nomenclature). The calculations were performed using the Source Term Code Package (STCP), hydrogen explosions are not considered. Up to the melt-through of the cavity bottom the thermal-hydraulics phenomena are almost identical to the TMLB'-case with an intact containment from the beginning. The phenomena occur slightly delayed due to the large containment leak. When the core-concrete-interaction begins the resulting gases leave the containment through the large leak and do not cause a pressure increase. The containment pressure remains at ambient pressure. Due to the different behavior and to the different release times of the nuclides the deviations to the scenario with an intact containment show a great variety. From this comparison it can be shown that the intact containment retains the nuclides up to a factor of 6000. (author)

SCORPIO-VVER core monitoring and surveillance system with advanced capabilities

International Nuclear Information System (INIS)

Molnar, Jozef; Vocka, Radim

2010-01-01

The SCORPIO (SCORPIO-VVER) core monitoring system, its basic features and history of implementation at Czech NPPs are described. The most important improvements in the area of neutron physics, core thermal analysis and operation support are as follows: Moving to the 42 axial nodes across the whole system (2004); Implementation of new cross section library to support mixed reactor core with differences in axial geometry of used fuel types and enhancement of Core Simulator boundary conditions model, to properly address the 'wild' geometry in axial direction; Adjusting the thermohydraulic and neutron-physical models regarding to the Gd2 fuel needs; Support up to 5 types of FAs and 2 types of SPND (Posit, IST); Extension of form functions for pin-wise reconstruction to improve pin-power prediction in control rod coupler region; System adaptation to the new upgraded digital I and C unit system; Integration of the SCORPIO-VVER system and its workstation into the plant redundant in-core system; Implementation of new On-Line form function generation to module RECON; New design of the Strategy Generator with advanced predictions; Adaptation of the system to support the new up-rated reactor thermal power; Adding new online SDM calculation function into to system; Implementation of the new 3D power reconstruction with SPND interpretation; Extending the limit checking to the 'full core' checking. The control of margins to the technical specification: Extended to full core - all FA is controlled individually in core; The limits are definable up to 59 FA (1/6 symmetry); 4 limited parameters are controlled - Kr, qlin, Tout-fa, dTfa; 2 additional parameters are monitored - dTsat, DNBR; New MMI are developed to present the limited and controlled parameters in core. Upgrade 3 is planned for the Slovak Bohunice NPP in 2011-2012. (P.A.)

Nuclear safety evaluation of the VVER 440, Type 213

International Nuclear Information System (INIS)

Urbancik, L.

1997-01-01

The supervisory activities of the State Office for Nuclear Safety at the Dukovany nuclear power plant are described. No event resulting in an inpermissible radioactivity leak into the environment occurred at the plant in 1996. From among the 76 failures and events having occurred, only 4 were classified as level 1 on the International Nuclear Event Scale. Changes in the technology of radioactive waste bituminization were proposed. The Interim Spent Fuel Storage Facility at the Dukovany site was in test operation in 1996. Selected physical parameters of this facility were monitored. Seven international transports of spent fuel were accomplished in 1996. The dose rates in the surroundings of the Dukovany plant are monitored constantly by a teledosimetric system operated by the nuclear power plant. Periodical sampling and radionuclide activity measurements in the environment are also performed. (M.D.)

VVER-440 fuel cycles possibilities using modified FA design

International Nuclear Information System (INIS)

Mikolas, P.; Svarny, J.; Razym, V.; Dostal, M.; Jenik, J.; Krupar, P.

2009-01-01

A nearly equilibrium five-year cycle has been achieved at Dukovany NPP over the last years. This means that working fuel assemblies (WFA) with an average enrichment of 4.25 w% (control assemblies (CA) with an average enrichment of 3.82 w%) are normally loaded and reloaded for five years. Operation at uprated thermal power (105% of the original one, increase from 1375 MW t to 1444 MW t ) is being prepared by use of WFA with an average enrichment of 4.38 w% (CA with an average enrichment of 4.25 w%). With the aim of fuel cycle economy improvement, the fuel residence time in the core has to be prolonged up to six years with one cycle duration time up to 18 months and preserving loadings with very low leakage. In order to achieve this goal, at least neutron-physical characteristics of FA must be improved and such changes should be evaluated from other viewpoints. Some particular changes have already been analyzed earlier. Designs of new fuel assemblies with higher (and in the central part of a FA the highest possible, i.e. 4.95 w%) enrichment with preserving low pin power non-uniformity are described in the presented paper. An FA with an average enrichment of 4.66 w% (lower than originally evaluated) containing six fuel pins with 3.35 w% Gd 2 O 3 content was selected in the end. Fuel pins have bigger pellet diameter, bigger pin pitch and thinner FA shroud. A newly designed FA was evaluated from the viewpoint of physics (pin power non-uniformity, criticality of fuel at transport and storage and determination of basic quantities for spent fuel storage purposes by ORIGEN code), thermo-hydraulics (comparison of subchannel output temperatures and the departure from nucleate boiling ratio - DNBR) and mechanical properties. The purpose of this study was to simulate an FA subject to the loads during its six- year lifetime whereas normal working conditions were taken into account. There are presented two models with different shroud thickness undergoing these analyses. Both models also undergo buckling shroud analyses. Next the maximum inner excessive pressure limits (as a consequence of accident conditions) were determined. Furthermore, the low shroud thickness limit for loads representing normal working conditions was assessed. The model, whose shroud thickness was reduced down to 1.0 mm, was subjected to a low cycle fatigue analysis. Possibilities of fuel cycles are evaluated on model loadings with the newly designed FA, where the base are loadings for 27 th - 34 th cycles of the third unit of Dukovany NPP for uprated power. These cycles were prolonged (from approx 330 FPD to 370 FPD) using FA with higher enrichment. Moreover, newly optimized loadings of a length of up to 500 FPD (18 months) were considered. The transient process started from the last of the set of loadings (27 th - 34 th ) for uprated power. Newly designed fuel assemblies were loaded regularly in 18-month cycles. Average enrichment of CA was 4.38 w%. Transient loadings are formed by cycles 35-37 and the equilibrium cycle is created by cycles 38 and 39. Each cycle was optimized individually and fuel assemblies intended for unloading were determined for each cycle separately. The 'equilibrium' cycle is realized by three consecutive loadings with 16 fresh WFA and 2 fresh CA. Basic characteristics of a reference cycle and an 18-month cycle were compared. Optimization was performed by the OPAL - B code on the basis of 3D n-ph calculations of the MOBY-DICK code with the target function F dh < 1.51. Consecutive thermo-hydraulic calculations were executed following the core neutron-physical analysis that had been carried out by the MOBY-DICK code in the 1/6 core symmetry. These thermo-hydraulic calculations were executed for loadings of both existing and newly designed fuel assemblies. Fast neutron fluences (calculated by TORT transport code based on neutron sources calculated by MOBY-DICK code) onto the reactor pressure vessel for proposed the 12-month and 18-month cycles were also calculated and compared. The analyses performed confirmed that fuel cycles using newly designed FA and fulfilling basic safety criteria can be designed together with fuel cycle economy improvement. (authors)

Microstructure alterations in the base material, heat affected zone and weld metal of a 440-VVER-reactor pressure vessel caused by high fluence irradiation during long term operation: material: 15 Ch2MFA {approx} 0, 15 C-2,5 Cr-0, 7Mo-0,3 V; Veraenderungen der Mikrostruktur in Grundwerkstoff, WEZ und Schweissgut eines 440-VVER-Reaktordruckbehaelters, verursacht durch Neutronenbestrahlung im langzeitigen Betrieb; Werkstoff: 15 Ch2MFA {approx} 0,15 C-2,5 Cr-0, 7Mo-0,3 V

Energy Technology Data Exchange (ETDEWEB)

Maussner, G; Scharf, L; Langer, R [Siemens AG Energieerzeugung KWU, Erlangen (Germany); Gurovich, B [Russian Research Centre Kurchatov Inst., Moscow (Russian Federation)

1998-11-01

Within the scope of the Tacis `91/1.1 project of the European Community, ``Reactor Vessel Embrittlement``, specimens were taken from the heavily irradiated circumferential welds of a VVER pressure vessel. The cumulated fast neutron fluence in the specimens amounts to up to 6.5 x 10{sup 19} cm{sup -}2 (E > 0.5 MeV). For the multi-laboratory, coordinated study, the specimens were cutted for mechanical testing as well as analytical, microstructural and microanalytical examinations in the base metal, HAZ and weld metal with respect to the effects of reactor operatio and post-irradiation annealing as well as thermal treatment (475 C, 560 C). The analytical transmission electron microscopy (200 kV) revealed the alterations found in the mechanical properties to be due to the formation of black dots and irradiation-induced segregations and accumulations of copper and carbides. These effects, caused by operation, (neutron radiation, temperature), are much more significant in the HAZ than in the base metal. (orig./CB) [Deutsch] Im Rahmen des von der Europaeischen Union beauftragten Tacis `91/1.1 Programms `Reactor Vessel Embrittlement` wurden Bohrkerne aus dem hochbestrahlten Rundnahtbereich eines VVER-Reaktordruckbehaelters entnommen. Die kumulierte schnelle Neutronenfluenz in diesen Proben betraegt bis zu 6,5 x 10{sup 19} cm{sup -2} (E>0,5 MeV). In einer gemeinschaftlichen Untersuchung wurden mechanisch-technologische, chemische sowie mirkostrukturelle Untersuchungen an Grundwerkstoff-, WEZ- und Schweissgutproben im vergleichbaren Ausgangs-, bestrahlten und anschliessend waermebehandelten (475 C, 560 C) Werkstoffzustand durchgefuehrt. Die analytische Durchstrahlelektronenmikroskopie (200 kV) laesst als Ursache fuer die festgestellten Veraenderungen der mechanischen Eigenschaften die Bildung von Versetzungsringen (black dots) sowie von bestrahlungsinduzierten Ausscheidungen und Anreicherungen von Kupfer in den Karbiden erkennen. Diese Effekte, als Folge der betrieblichen

Press travel to the Mochovce power plant in Slovakia

International Nuclear Information System (INIS)

1998-07-01

This press dossier gives, first, a general presentation of the Mochovce power plant of the republic of Slovakia (history, technical characteristics, safety aspects, technical particularities of VVER 440/213 reactors (safety analysis, recent improvements), financing of the modernization project). Then, the activities of the Framatome group in central and eastern Europe are presented (partnerships, cooperation agreements and contracts). (J.S.)

10 CFR 1042.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-01-01

... 10 Energy 4 2010-01-01 2010-01-01 false Health and insurance benefits and services. 1042.440... in Education Programs or Activities Prohibited § 1042.440 Health and insurance benefits and services. Subject to § 1042.235(d), in providing a medical, hospital, accident, or life insurance benefit, service...

In vessel retention for VVER 1000 - Experimental work

International Nuclear Information System (INIS)

Batek, D.

2015-01-01

After Fukushima accident, the nuclear community realized that it is necessary to have strategy and solution for severe accident management. In Vessel Retention (IVR) of corium is an important strategy to mitigate the consequences of a severe accident. In this poster the author reviews the present status of experimental works made by UJV (Czech Republic) from 2012 until now, on the IVR strategy specifically applied for the VVER 1000 unit. The BESTH 1 experiment was prepared to test the behavior of the RPV (Reactor Pressure Vessel) surface under 2 configurations: clean and corroded. BESTH 2 experiment is a modification of BESTH 1 experiment in order to get greater thermal fluxes. The BESTH 3 facility is a large scale experiment that is under extensive design (2016-2017) whose main objective will be to investigate the results of vast analytical works made by experts with specialization of severe accident phenomenology

Department of Energy's team's analyses of Soviet designed VVERs (water-cooled water-moderated atomic energy reactors)

Energy Technology Data Exchange (ETDEWEB)

1989-09-01

This document contains apprendices A through P of this report. Topics discussed are: a cronyms and technical terms, accident analyses reactivity control; Soviet safety regulations; radionuclide inventory; decay heat; operations and maintenance; steam supply system; concrete and concrete structures; seismicity; site information; neutronic parameters; loss of electric power; diesel generator reliability; Soviet codes and standards; and comparisons of PWR and VVER features. (FI)

10 CFR 5.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Health and insurance benefits and services. 5.440 Section... Education Programs or Activities Prohibited § 5.440 Health and insurance benefits and services. Subject to § 5.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or...

49 CFR 25.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-10-01

... 49 Transportation 1 2010-10-01 2010-10-01 false Health and insurance benefits and services. 25.440... Basis of Sex in Education Programs or Activities Prohibited § 25.440 Health and insurance benefits and services. Subject to § 25.235(d), in providing a medical, hospital, accident, or life insurance benefit...

29 CFR 36.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Health and insurance benefits and services. 36.440 Section... Education Programs or Activities Prohibited § 36.440 Health and insurance benefits and services. Subject to § 36.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or...

42 CFR 440.255 - Limited services available to certain aliens.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Limited services available to certain aliens. 440... Limits Applicable to All Services § 440.255 Limited services available to certain aliens. (a) FFP for services. FFP is available for services provided to aliens described in this section which are necessary to...

Transmutation potential of reactor WWER-440

International Nuclear Information System (INIS)

Darilek, P.; Sebian, V.; Necas, V.

2001-01-01

Theoretical evaluation of WWER-440 transmutation potential by HELIOS - code is presented. Transmutation method proposal comprising special transmutation pins, combined FA and simple reprocessing is described. Transmutation efficiency of the method is characterized (Authors)

OECD/DOE/CEA VVER-1000 Coolant Transient Benchmark. Summary Record of the Third Workshop (V1000-CT3)

International Nuclear Information System (INIS)

2005-01-01

The overall objective of the VVER-1000 coolant transient (V1000CT) benchmark is to assess computer codes used in the safety analysis of VVER power plants, specifically for their use in analysis of reactivity transients in a VVER-1000. The V1000CT benchmark consists of two phases: V1000CT-1 is a simulation of the switching on of one main coolant pump (MCP) when the other three MCPs are in operation, and V1000CT-2 concerns calculation of coolant mixing tests and main steam line break (MSLB) scenarios. Each of the two phases contains three exercises. The reference problem chosen for simulation in Phase 1 is a MCP switching on when the other three main coolant pumps are in operation in a VVER-1000. This event is characterized by rapid increase in the flow through the core resulting in a coolant temperature decrease, which is spatially dependent. This leads to insertion of spatially distributed positive reactivity due to the modelled feedback mechanisms and non-symmetric power distribution. Simulation of the transient requires evaluation of core response from a multi-dimensional perspective (coupled three-dimensional neutronics/core thermal-hydraulics) supplemented by a one-dimensional simulation of the remainder of the reactor coolant system. Three exercises are defined in the framework of Phase 1: a) Exercise 1 - Point kinetics plant simulation; b) Exercise 2 - Coupled 3-D neutronics/core thermal-hydraulics response evaluation; c) Exercise 3 - Best-estimate coupled 3-D core/plant system transient modelling. In addition to the measured (experiment) scenario, extreme calculation scenarios were defined in the frame of Exercise 3 for better testing 3-D neutronics/thermal-hydraulics techniques. The proposals concerned: rod ejection simulations with scram set points at two different power levels. The technical topics presented at this workshop were: Review of the benchmark activities after the 2. Workshop; - Discussion of participant's feedback and introduced modifications

Safety related investigations of the VVER-1000 reactor type by the coupled code system TRACE/PARCS

International Nuclear Information System (INIS)

Jaeger, Wadim; Lischke, Wolfgang; Sanchez Espinoza, Victor Hugo

2007-01-01

This study was performed at the Institute of Reactor Safety at the Research Center Karlsruhe. It is embedded in the ongoing investigations of the international code application and maintenance program (CAMP) for qualification and validation of system codes like TRACE [1] and PARCS [2]. The predestinated reactor type for the validation of these two codes was the Russian designed VVER-1000 because the OECD/NEA VVER-1000 Coolant Transient Benchmark Phase 2 [3] includes detailed information of the Bulgarian nuclear power plant (NPP) Kozloduy unit 6. The posttest-investigations of a coolant mixing experiment have shown that the predicted parameters (coolant temperature, pressure drop, etc.) are in good agreement to the measured data. The coolant mixing pattern especially in the downcomer has been also reproduced quiet well by TRACE. The coupled code system TRACE/PARCS which was applied on a postulated main steam line break (MSLB) provides good results compared to reference values and the ones of other participants of the benchmark. It can be pointed out that the developed three-dimensional nodalisation of the reactor pressure vessel (RPV) is appropriate for the description of transients where the thermal-hydraulics and the neutronics are strongly linked. (author)

Fuel reliability experience in Finland

International Nuclear Information System (INIS)

Kekkonen, L.

2015-01-01

Four nuclear reactors have operated in Finland now for 35-38 years. The two VVER-440 units at Loviisa Nuclear Power Plant are operated by Fortum and two BWR’s in Olkiluoto are operated by Teollisuuden Voima Oyj (TVO). The fuel reliability experience of the four reactors operating currently in Finland has been very good and the fuel failure rates have been very low. Systematic inspection of spent fuel assemblies, and especially all failed assemblies, is a good practice that is employed in Finland in order to improve fuel reliability and operational safety. Investigation of the root cause of fuel failures is important in developing ways to prevent similar failures in the future. The operational and fuel reliability experience at the Loviisa Nuclear Power Plant has been reported also earlier in the international seminars on WWER Fuel Performance, Modelling and Experimental Support. In this paper the information on fuel reliability experience at Loviisa NPP is updated and also a short summary of the fuel reliability experience at Olkiluoto NPP is given. Keywords: VVER-440, fuel reliability, operational experience, poolside inspections, fuel failure identification. (author)

Investigation of reliability of EC method for inspection of VVER steam generator tubes

International Nuclear Information System (INIS)

Corak, Z.

2004-01-01

Complete and accurate non-destructive examinations (NDE) data provides the basis for performing mitigating actions and corrective repairs. It is important that detection and characterization of flaws are done properly at an early stage. EPRI Document PWR Steam Generator Examination Guidelines recommends an approach that is intended to provide the following: Ensure accurate assessment of steam generator tube integrity; Extend the reliable, cost effective, operating life of the steam generators, and Maximize the availability of the unit. Steam Generator Eddy Current Data Analysis Performance Demonstration represents the culmination of the intense two-year industry effort in the development of a performance demonstration program for eddy current testing (ECT) of steam generator tubing. It is referred to as the Industry Database (IDB) and provides a capability for individual organizations to implement SG ECT performance demonstration programs in accordance with the requirements specified in Appendices G and H of the ISI Guidelines. The Appendix G of EPRI Document PWR Steam Generator Examination Guidelines specifies personnel training and qualification requirements for NDE personnel who analyze NDE data for PWR steam generator tubing. Its purpose is to insure a continuing uniform knowledge base and skill level for data analysis. The European methodology document is intended to provide a general framework for development of qualifications for the inspection of specific components to ensure they are developed in a consistent way throughout Europe while still allowing qualification to be tailored in detail to meet different nation requirements. In the European methodology document one will not find a detailed description of how the inspection of a specific component should be qualified. A recommended practice is a document produced by ENIQ to support the production of detailed qualification procedures by individual countries. VVER SG tubes are inspected by EC method but a

17 CFR 201.440 - Appeal of determinations by the Public Company Accounting Oversight Board.

Science.gov (United States)

2010-04-01

... and Commission Review § 201.440 Appeal of determinations by the Public Company Accounting Oversight... for registration of a public accounting firm, may file an application for review. (b) Procedure. An... the Public Company Accounting Oversight Board. 201.440 Section 201.440 Commodity and Securities...

42 CFR 440.155 - Nursing facility services, other than in institutions for mental diseases.

Science.gov (United States)

2010-10-01

... institutions for mental diseases. 440.155 Section 440.155 Public Health CENTERS FOR MEDICARE & MEDICAID... PROVISIONS Definitions § 440.155 Nursing facility services, other than in institutions for mental diseases. (a) “Nursing facility services, other than in an institution for mental diseases” means services...

CFD Analysis of a Slug Mixing Experiment Conducted on a VVER-1000 Model

Directory of Open Access Journals (Sweden)

F. Moretti

2009-01-01

Full Text Available A commercial CFD code was applied, for validation purposes, to the simulation of a slug mixing experiment carried out at OKB “Gidropress” scaled facility in the framework of EC TACIS project R2.02/02: “Development of safety analysis capabilities for VVER-1000 transients involving spatial variations of coolant properties (temperature or boron concentration at core inlet.” Such experimental model reproduces a VVER-1000 nuclear reactor and is aimed at investigating the in-vessel mixing phenomena. The addressed experiment involves the start-up of one of the four reactor coolant pumps (the other three remaining idle, and the presence of a tracer slug on the starting loop, which is thus transported to the reactor pressure vessel where it mixes with the clear water. Such conditions may occur in a boron dilution scenario, hence the relevance of the addressed phenomena for nuclear reactor safety. Both a pretest and a posttest CFD simulations of the mentioned experiment were performed, which differ in the definition of the boundary conditions (based either on nominal quantities or on measured quantities, resp.. The numerical results are qualitatively and quantitatively analyzed and compared against the measured data in terms of space and time tracer distribution at the core inlet. The improvement of the results due to the optimization of the boundary conditions is evidenced, and a quantification of the simulation accuracy is proposed.

The LA-10 Project for complex testing of nuclear incineration systems

International Nuclear Information System (INIS)

Hron, M.; Chochlovsky, I.; Lelek, V.; Peka, I.; Valenta, V.

1997-01-01

The current proposals for high-active long-lived (more then 10''4 years) waste from spent nuclear fuel disposal call forth an increasing mistrust of society towards nuclear power at all. These problems are highly topical even in the Czech Republic. In 1993, the Czech Republic and the Slovak Republic were constituted instead of the former Czechoslovakia. The first of two operated Czechoslovakian NNPs, the NNP Bohunice together with the only one in that time intermediate storage of spent fuel, remains on the territory of Slovakia and the NPP Dukovany as well as the NPP Temelian (designed with totally 4 x VVER-1000, 2 x VVER-1000 of which are ready for start up in the next few years) are located in the Czech Republic. As a consequence of this political step, the decision was accepted to build up an intermediate storage in the Czech Republic (to put it into operation in 2005) and to store all Dukovany's fuel in transport casks (84 complete fuel assemblies per one cask) on the Dukovany's site territory up to the 600 tons of heavy metal and the move it into the new intermediate storage, which should be designed for the lifetime of about 50-60 years. At about 2030 as a main variant, the final disposal of all spent fuel should be prepared. There is an opinion of a rational part of the Czech nuclear community that the final disposal of spent fuel is only something like fairy-tale for public and that a real technical solution should be found definitely. (Author) 13 refs

Knowledge Management Aspects of Decommissioning. Case Study

International Nuclear Information System (INIS)

Pironkov, Lyubomir

2017-01-01

Kozloduy NPP: Units 5&6, type VVER-1000 - in operation. SE RAW SD “Decommissioning of units 1-4” (type VVER-440); SD “Radioactive Waste – Kozloduy”; SD “National Repository for Radioactive Waste“; SD “Permanent Repository for Radioactive Waste – Novi Han”. Decommissioning Strategy: Strategy Target: “Brown Field”. Initial Version: Safe enclosure – completing by 2050. Updated Version: Continuous dismantling of equipment; Completing the process of Decommissioning of Units 1-4 by 2030. Major Phases: 1.Pre-decommissioning activities; 2.Facility shutdown activities; 3.Procurement of equipment; 4.Dismantling activities; 5.Treatment of RAM and RAW and delivery for disposal; 6.Site management and support; 7.Project management and engineering; 8.Management of SNF and activated materials

Heat transfer characteristics of horizontal steam generators under natural circulation conditions

International Nuclear Information System (INIS)

Hyvaerinen, J.

1996-01-01

This paper deals with the heat transfer characteristics of horizontal steam generators, particularly under natural circulation (decay heat removal) conditions on the primary side. Special emphasis is on the inherent features of horizontal steam generator behaviour. A mathematical model of the horizontal steam generator primary side is developed and qualitative results are obtained analytically. A computer code, called HSG, is developed to solve the model numerically, and its predictions are compared with experimental data. The code is employed to obtain for VVER 440 steam generators quantitative results concerning the dependence of primary-to-secondary heat transfer efficiency on the primary side flow rate, temperature and secondary level. It turns out that the depletion of the secondary inventory leads to an inherent limitation of the decay energy removal in VVER steam generators. The limitation arises as a consequence of the steam generator tube bundle geometry. As an example, it is shown that the grace period associated with pressurizer safety valve opening during a station black-out is 2 1/2-3 hours instead of the 5-6 hours reported in several earlier studies. (However, the change in core heat-up timing is much less-about 1 h at most.) The heat transfer limitation explains the fact that, in the Greifswald VVER 440 station black-out accident in 1975, the steam generators never boiled dry. In addition, the stability of single-phase natural circulation is discussed and insights on the modelling of horizontal steam generators with general-purpose thermal-hydraulic system codes are also presented. (orig.)

The AMES network in the 6th Framework Programme

International Nuclear Information System (INIS)

Sevini, F.; Debarberis, L.; Taylor, N.; Gerard, R.; English, C.; Brumovsky, M.

2003-01-01

The AMES (Ageing Materials European Strategy) European network started its activity in 1993 with the aim of studying ageing mechanisms and remedial procedures for structural materials used for nuclear reactor components. Operated by JRC-IE, it has been supporting the co-ordination of the project cluster throughout the 4th and 5th EURATOM Framework Programs, carrying out projects on with plant life management implications. Among them we can list the development of non-destructive techniques applied to thermal ageing and neutron embrittlement monitoring (AMES-NDT and GRETE), improved surveillance for VVER 440 reactors (COBRA), dosimetry (AMESDOSIMETRY, MADAM and REDOS), chemical composition effects on neutron embrittlement (PISA) and advanced fracture mechanics for integrity assessment (FRAME). Main frame of the network in the 5th Framework Programme is the ATHENA project, which is aimed at summarizing the obtained achievements and edit guidelines on important issues like the Master Curve, Effect of chemical composition on embrittlement rate in RPV steels, Re-embrittlement models validation after VVER-440 annealing and open issues in embrittlement of VVER type reactors. In the 6th EURATOM Framework Programme started in 2003 the network will be part of a broader initiative on PLIM including in a more integrated way NESC, ENIQ, NET and AMALIA networks. This paper shows an overview of the concluded projects, achievements of the running ones and open issues tackled in the 6th EURATOM FWP and a summary of the plans for a new broader network on NPP Plant Life management (SAFELIFE). (author)

Ukrainian Nuclear Society International Conference 'Modernization of the NPP with VVER reactor' (abstracts)

International Nuclear Information System (INIS)

Bar'yakhtar, V.G.

1999-01-01

Abstracts of the papers presented at International conference of the Ukrainian Nuclear Society 'Modernization of the NPP with VVER reactor'. The following problems are considered: improving the NPP's safety and reliability; reactor modernization, the lifetime prolongation; increasing of the reactor operating characteristics; methods of capacity factor increasing: refueling control, maintenance control; technical and economical aspects of NPP modernization; modernization of the automated control system of the fuel process at the NPP's; technical features and methods for the continued radiation and technology control at the NPP's; training, increasing the staff qualification and NPP modernization

Neutronic study of nanofluids application to VVER-1000

Energy Technology Data Exchange (ETDEWEB)

Hadad, K., E-mail: hadad@email.arizona.ed [School of Engineering, Shiraz University, Shiraz 7134554115 (Iran, Islamic Republic of); Aerospace and Mechanical Engineering, University of Arizona, Tucson, AZ 85721 (United States); Hajizadeh, A.; Jafarpour, K. [School of Engineering, Shiraz University, Shiraz 7134554115 (Iran, Islamic Republic of); Ganapol, B.D. [Aerospace and Mechanical Engineering, University of Arizona, Tucson, AZ 85721 (United States)

2010-11-15

The change in neutronic parameters of the VVER-1000 nuclear reactor core attributable to the use of nanoparticle/water (nanofluid) as coolant is presented in this paper. Optimization of type and volume fraction of nanoparticles in water that affect the safety enhancement of core primary parameters is intended in this study. Reactivity change, radial and axial local peaking factors (LPPF), and the consequence of nanoparticle deposition on fuel clad are investigated. We considered five nanoparticles which have been studied extensively for their heat transfer properties including Alumina, Aluminum, Copper oxide, Copper and Zirconia. The results of our study show that at low concentration (0.001 volume fraction) Alumina is optimum nanoparticle for normal operation. The maximum radial and axial LPPF were found to be invariant to the type of nanofluid at low volume fractions. With an increase in nanoparticle deposition thickness on fuel clad, a flux and K{sub eff} depression occurs and Al{sub 2}O{sub 3} has the lowest rate of drop off.

Model of nuclear reactor type VVER-1000/V-320 built by computer code ATHLET-CD

International Nuclear Information System (INIS)

Georgiev, Yoto; Filipov, Kalin; Velev, Vladimir

2014-01-01

A model of nuclear reactor type VVER-1000 V-320 developed for computer code ATHLET-CD2.1A is presented. Validation of the has been made, in the analysis of the station blackout scenario with LOCA on fourth cold leg is shown. As the calculation has been completed, the results are checked through comparison with the results from the computer codes ATHLET-2.1A, ASTEC-2.1 and RELAP5mod3.2

Formulae for thermal feedback of group constants in digital reactor simulation

International Nuclear Information System (INIS)

Perneczky, L.; Toth, I.; Vigassy, J.

1976-01-01

The problem, how the feedback of the thermohydraulic field to the neutron density in a reactor can be calculated is analysed. After a brief survey of the digital models in reactor simulation the applied model based on the time-dependent two-group diffusion equations is described. Using the reactor physical code system THERESA numerical results for the VVER-440 reactor are presented. (Sz.Z.)

Determination of the Effectiveness of Control Rods in the VVER Reactor Fuel Assemblies; Determination de l'Efficacite des Barres de Reglage dans les Ensembles Combustibles du reacteur VVER; Opredelenie ehffektivnosti reguliruyushchikh sterzhnej v sborkakh reaktora VVEHR; Determinacion de la Eficacia de las Barras de Control en los Conjuntos de Elementos Combustibles del Reactor VVER

Energy Technology Data Exchange (ETDEWEB)

Semenov, V. N.; Lunin, G. L.; Komissarov, L. V.; Kamyshan, A. N.; Halizev, V. I.; Andrianov, G. Ja.; Voznesenskij, V. A.; Kuz' micheva, V. A.; Lebedev, V. I. [Ordena Lenina Institut Atomnoj Energii Im. I.V. Kurchatova, Moskva, SSSR (Russian Federation)

1964-06-15

The paper describes experiments done in homogeneous mock-ups of the fuel assemblies from the VVER Reactor (at one level of enrichment) to determine the effectiveness of absorbing systems comprising shim fuel assemblies or water cavities and of absorbing rods clad in jackets made of differing materials. The paper also gives data on some experiments that have been done in mock-ups of assemblies with differing levels of enrichment. These experiments make it possible to verify the methods used in calculation and to evaluate the prospects of using them for heterogeneous reactors. (author) [French] Le memoire decrit les experiences qui ont ete faites pour determiner l 'efficacite des absorbants contenus dans les barres de compensation, l'effet cavitaire et l 'efficacite des absorbants gaines de materiaux divers, au moyen d'assemblages homogenes de cartouches de combustible du reacteur VVER (reacteur de puissance ralenti et refroidi a l 'eau ayant le meme taux d'enrichissement. On y trouve en outre des donnees sur certaines experiences executees a l 'aide d'assemblages de cartouches de combustible taux d'enrichissement differents. Ces travaux permettent de verifier la methode de calcul et d'evaluer ses possibilites d'application aux reacteurs non homogenes. (author) [Spanish] Se describen en la memoria experimentos para determinar la eficacia de los materiales absorbentes contenidos en las barras de compensacion, el efecto de cavitacion y la eficacia de los materiales absorbentes revestidos de diversos materiales, realizados con ayuda de los conjuntos homogeneos de elementos combustibles del reactor VVER (reactor de potencia moderado y refrigerado por agua) con un solo grado de enriquecimiento. Ademas, se exponen datos sobre los experimentos efectuados con ayuda de conjuntos de grados de enriquecimientos; variados. Tales experimentos permiten verificar el metodo de calculo teorico, utilizad o y evaluar la posibilidad de aplicarlo a los reactores no homogeneos. (author

High energy pipe line break postulations and their mitigation - examples for VVER nuclear power plants

Energy Technology Data Exchange (ETDEWEB)

Zdarek, J.; Pecinka, L.; Kadecka, P.; Dotrel, J. [Nuclear Res. Inst., Rez (Czech Republic)

1998-11-01

The concept and the proposals for the protection and reinforcement of equipment against the effects of postulated rupture of the high-energy piping, in VVER Plant, are presented. The most recent version of the US NRC Guidelines has been used. The development of the legislation, the basic approach and selection of criteria for the assessment of the rupture of high energy piping, provide the basis for the application of the separation concept in the overall safety philosophy. (orig.)

High energy pipe line break postulations and their mitigation - examples for VVER nuclear power plants

International Nuclear Information System (INIS)

Zdarek, J.; Pecinka, L.; Kadecka, P.; Dotrel, J.

1998-01-01

The concept and the proposals for the protection and reinforcement of equipment against the effects of postulated rupture of the high-energy piping, in VVER Plant, are presented. The most recent version of the US NRC Guidelines has been used. The development of the legislation, the basic approach and selection of criteria for the assessment of the rupture of high energy piping, provide the basis for the application of the separation concept in the overall safety philosophy. (orig.)

Experiments with the HORUS-II test facility

Energy Technology Data Exchange (ETDEWEB)

Alt, S.; Lischke, W. [Univ. for Applied Sciences Zittau/Goerlitz, Zittau (Germany). Dept. of Nuclear Engineering

1997-12-31

Within the scope of the German reactor safety research the thermohydraulic computer code ATHLET which was developed for accident analyses of western nuclear power plants is more and more used for the accident analysis of VVER-plants particularly for VVER-440,V-213. The experiments with the HORUS-facilities and the analyses with the ATHLET-code have been realized at the Technical University Zittau/Goerlitz since 1991. The aim of the investigations was to improve and verify the condensation model particularly the correlations for the calculation of the heat transfer coefficients in the ATHLET-code for pure steam and steam-noncondensing gas mixtures in horizontal tubes. About 130 condensation experiments have been performed at the HORUS-II facility. The experiments have been carried out with pure steam as well as with noncondensing gas injections into the steam mass flow. The experimental simulations are characterized as accident simulation tests for SBLOCA for VVER-conditions. The simulation conditions had been adjusted correspondingly to the parameters of a postulated SBLOCA`s fourth phase at the original plant. 4 refs.

Experiments with the HORUS-II test facility

Energy Technology Data Exchange (ETDEWEB)

Alt, S; Lischke, W [Univ. for Applied Sciences Zittau/Goerlitz, Zittau (Germany). Dept. of Nuclear Engineering

1998-12-31

Within the scope of the German reactor safety research the thermohydraulic computer code ATHLET which was developed for accident analyses of western nuclear power plants is more and more used for the accident analysis of VVER-plants particularly for VVER-440,V-213. The experiments with the HORUS-facilities and the analyses with the ATHLET-code have been realized at the Technical University Zittau/Goerlitz since 1991. The aim of the investigations was to improve and verify the condensation model particularly the correlations for the calculation of the heat transfer coefficients in the ATHLET-code for pure steam and steam-noncondensing gas mixtures in horizontal tubes. About 130 condensation experiments have been performed at the HORUS-II facility. The experiments have been carried out with pure steam as well as with noncondensing gas injections into the steam mass flow. The experimental simulations are characterized as accident simulation tests for SBLOCA for VVER-conditions. The simulation conditions had been adjusted correspondingly to the parameters of a postulated SBLOCA`s fourth phase at the original plant. 4 refs.

Nuclear power in the Ukraine: Problems and prospects

International Nuclear Information System (INIS)

Nigmatullin, N.R.

1995-01-01

Nuclear power production in the Ukraine started in 1977 with the startup of the first 1000-MW power-generating unit at the Chernobyl nuclear power plant. During the period from 1977 to 1989 sixteen power-generating units with a total electric capacity of 14,880 MW were put into operation at five nuclear power plants: ten VVER-1000, two VVER-440, and four RBMK-1000. As a result of the accident in 1986 in the fourth power-generating unit and the fire in 1991 in the second power-generating unit of the Chernobyl nuclear power plant, these units are no longer operating. Therefore the total installed nuclear power plant capacity is 12,880 MW. Moreover, the construction of three more power-generating units with VVER-1000 reactors is almost completed at three nuclear power plants - Zaporozh'e, Roven, and Khmel'nitsk. These units are not in operation because of the moratorium announced by the Supreme Council of Ukraine. In connection with the Council's decision, the Chernobyl nuclear power plant should have been shut down in 1993

Experiments with the HORUS-II test facility

International Nuclear Information System (INIS)

Alt, S.; Lischke, W.

1997-01-01

Within the scope of the German reactor safety research the thermohydraulic computer code ATHLET which was developed for accident analyses of western nuclear power plants is more and more used for the accident analysis of VVER-plants particularly for VVER-440,V-213. The experiments with the HORUS-facilities and the analyses with the ATHLET-code have been realized at the Technical University Zittau/Goerlitz since 1991. The aim of the investigations was to improve and verify the condensation model particularly the correlations for the calculation of the heat transfer coefficients in the ATHLET-code for pure steam and steam-noncondensing gas mixtures in horizontal tubes. About 130 condensation experiments have been performed at the HORUS-II facility. The experiments have been carried out with pure steam as well as with noncondensing gas injections into the steam mass flow. The experimental simulations are characterized as accident simulation tests for SBLOCA for VVER-conditions. The simulation conditions had been adjusted correspondingly to the parameters of a postulated SBLOCA's fourth phase at the original plant

Review of operational requirements with respect to PCMI in a VVER and the corresponding developments in the trans uranus code

International Nuclear Information System (INIS)

Van Uffelen, P.; Lassman, K.; Schubert, A.; Van der Laar, J.; Gyori, C.; Elenkov, D.; Hatala, B.

2005-01-01

Since the mid-90's, a version of the TRANSURANUS code has been under development for the analysis of the fuel rod performance in Russian-type VVER reactors. This required, among other things, the implementation of specific thermal and mechanical properties for Nb-containing cladding. The first part of the paper summarises the present status of the models for normal operating conditions. Further refinements will include the correlation between the effective creep strain rate and the effective stress. In the second part of the paper we consider accident conditions for which new correlations have been developed, including plastic deformation, high-temperature oxidation and burst of the cladding. These conditions have been implemented in TRANSURANUS and verified by means of burst tests for as-received, oxidised and irradiated cladding specimens. Finally, an outlook of the planned activities for code development and validation, including experiments regarding PCMI-related safety criteria for VVER reactors, is presented. (author)

15 CFR 8a.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-01-01

... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Health and insurance benefits and services. 8a.440 Section 8a.440 Commerce and Foreign Trade Office of the Secretary of Commerce... benefits and services. Subject to § 8a.235(d), in providing a medical, hospital, accident, or life...

Proposal of criteria for evaluation of engineering safety factors of VVER core parameters

International Nuclear Information System (INIS)

Shishkov, L.; Tsyganov, S.; Dementiev, V.

2009-01-01

The paper states that the regulatory documentation, as a rule, do not give explicit recommendations on formation techniques of engineering safety factors for design limited parameters of normal operation (K eng ). The AER countries use different approaches to K eng evaluation (sometimes even one country in relation of various power units). The paper suggests the development of uniform rules to be used in calculation of engineering safety factor for all VVER reactors. The paper presents principal problems that must be solved in the course of the discussion, and in the form of an exercise suggests the way of their solution. (authors)

Developing a computational tool for predicting physical parameters of a typical VVER-1000 core based on artificial neural network

International Nuclear Information System (INIS)

Mirvakili, S.M.; Faghihi, F.; Khalafi, H.

2012-01-01

Highlights: ► Thermal–hydraulics parameters of a VVER-1000 core based on neural network (ANN), are carried out. ► Required data for ANN training are found based on modified COBRA-EN code and then linked each other using MATLAB software. ► Based on ANN method, average and maximum temperature of fuel and clad as well as MDNBR of each FA are predicted. -- Abstract: The main goal of the present article is to design a computational tool to predict physical parameters of the VVER-1000 nuclear reactor core based on artificial neural network (ANN), taking into account a detailed physical model of the fuel rods and coolant channels in a fuel assembly. Predictions of thermal characteristics of fuel, clad and coolant are performed using cascade feed forward ANN based on linear fission power distribution and power peaking factors of FAs and hot channels factors (which are found based on our previous neutronic calculations). A software package has been developed to prepare the required data for ANN training which applies a modified COBRA-EN code for sub-channel analysis and links the codes using the MATLAB software. Based on the current estimation system, five main core TH parameters are predicted, which include the average and maximum temperatures of fuel and clad as well as the minimum departure from nucleate boiling ratio (MDNBR) for each FA. To get the best conditions for the considered ANNs training, a comprehensive sensitivity study has been performed to examine the effects of variation of hidden neurons, hidden layers, transfer functions, and the learning algorithms on the training and simulation results. Performance evaluation results show that the developed ANN can be trained to estimate the core TH parameters of a typical VVER-1000 reactor quickly without loss of accuracy.

Evaluation gives the activity inventory the nuclear fuel irradiated and its radioactive waste

International Nuclear Information System (INIS)

Rodriguez Gual, Maritza

1998-01-01

The present work has as objectives to give a quantitative evaluation to the activity that possesses the nuclear fuel for 3,6% enrichment with a burnt one the 33 000 NWd/Tu proposed for the Juragua Nuclear Power Plant . In this work the method is used I calculate ORIGEN2. Obtained results are presented and they are compared with other calculations carried out in reactors type VVER-440

Assessment of the event at Rovno NPP owing to the unexpected opening and obstruction of the safety valve lock mechanism of the pressure compensator

International Nuclear Information System (INIS)

Alonso, C.

1993-01-01

The main objective of this analysis is to be able to identify the sequence of the accident and evaluate the real frequency observed in similar nuclear power plants, according to the experience registered in the data bases of the NPP accident information system (ISI-AES) as well as the quality assurance information system (ISKO). This work describes how the analysis of events in a VVER-440 reactor NPP was performed

The next 20 years operation of the 36 years old Hungarian training reactor

International Nuclear Information System (INIS)

Aszodi, A.

2007-01-01

Hungary prepares for extending the design lifetime of the four VVER-440/213 type units; in that case they will finish operation between 2032 and 2037. Discussion on possible new nuclear units in Hungary was recently commenced. The paper describes actions in human resource management and knowledge management, and also the new safety analysis methods which were applied during the recent Periodic Safety Review of the Hungarian Training Reactor

Influence of geometrical parameters of the VVER-1000 reactor construction elements to internals irradiation conditions

Directory of Open Access Journals (Sweden)

О. M. Pugach

2015-07-01

Full Text Available Investigations to determine the influences of geometrical parameters of the calculational VVER-1000 reactor model to the results of internal irradiation condition determination are carried out. It is shown that the values of appropriate sensitivity matrix elements are not dependent on a height coordinate for any core level, but there is their azimuthal dependence. Maximum possible relative biases of neutron fluence due to inexact knowledge of internal geometrical parameters are obtained for the baffle and the barrel.

Power peak in vicinity of WWER-440 control assembly

International Nuclear Information System (INIS)

Mikus, J.

2002-01-01

This paper presents information concerning the WWER-440 local power peaking problem induced by a control assembly and corresponding investigation possibilities on the light-water zero-power reactor LR-O at the Nuclear Research Institute Rez plc. Brief description of the disposable CA model, experimental arrangement and conditions on the LR-O reactor, preparation of the relevant measurements in the WWER-440 type cores with CA model, as well as some preliminary results of the fission density distribution obtained in a core without boron and with fuel assemblies having profiled enrichment are mentioned too (Author)

State of the VVER-1000 spent U-Gd fuel rods based on the results of post-irradiation examinations

International Nuclear Information System (INIS)

Shevlyakov, G.; Zvir, E.; Strozhuk, A.; Polenok, V.; Sidorenko, O.; Volkova, I.; Nikitin, O.

2015-01-01

The present paper is devoted to post-irradiation examinations (PIE) of U-Gd fuel rods with different geometry of the fuel pellets irradiated as part of the VVER-1000 fuel assembly. As evidenced by their PIE data, they did not exhaust their service life based on the main parameters (geometrical dimensions, corrosion state, and release of fission product gases). (author)

A Roadmap and Discussion of Issues for Physics Analyses Required to Support Plutonium Disposition in VVER-1000 Reactors

International Nuclear Information System (INIS)

Primm, R.T.; Drischler, J.D.; Pavlovichev, A.M.; Styrine, Y.A.

2000-01-01

The purpose of this report is to document the physics analyses that must be performed to successfully disposition weapons-usable plutonium in VVER-1000 reactors in the Russian Federation. The report is a document to support programmatic and financial planning. It does not include documentation of the technical procedures by which physics analyses are performed, nor are the results of any analyses included

A Roadmap and Discussion of Issues for Physics Analyses Required to Support Plutonium Disposition in VVER-1000 Reactors

Energy Technology Data Exchange (ETDEWEB)

Primm, R.T.; Drischler, J.D.; Pavlovichev, A.M. Styrine, Y.A.

2000-06-01

The purpose of this report is to document the physics analyses that must be performed to successfully disposition weapons-usable plutonium in VVER-1000 reactors in the Russian Federation. The report is a document to support programmatic and financial planning. It does not include documentation of the technical procedures by which physics analyses are performed, nor are the results of any analyses included.

Application of Integral Ex-Core and Differential In-Core Neutron Measurements for Adjustment of Fuel Burn-Up Distributions in VVER-1000

Science.gov (United States)

Borodkin, Pavel G.; Borodkin, Gennady I.; Khrennikov, Nikolay N.

2010-10-01

The paper deals with calculational and semi-analytical evaluations of VVER-1000 reactor core neutron source distributions and their influence on measurements and calculations of the integral through-vessel neutron leakage. Time-integrated neutron source distributions used for DORT calculations were prepared by two different approaches based on a) calculated fuel burn-up (standard routine procedure) and b) in-core measurements by means of SPD & TC (new approach). Taking into account that fuel burn-up distributions in operating VVER may be evaluated now by analytical methods (calculations) only it is needed to develop new approaches for testing and correction of calculational evaluations. Results presented in this paper allow to consider a reverse task of alternative estimation of fuel burn-up distributions. The approach proposed is based on adjustment (fitting) of time-integrated neutron source distributions, and hence fuel burn-up patterns in some part of reactor core, on the base of ex-core neutron leakage measurement, neutron-physical calculation and in-core SPD & TC measurement data.

Development of a new chemical technology for cleanup of VVER steam generators

International Nuclear Information System (INIS)

Smykov, V.B.; Yermolaev, N.P.; Ivanov, V.N.

2002-01-01

As shows the maintenance experience of SG's, the long-time maintenance them without chemical cleanup on secondary-side results in accumulation of considerable amounts of depositions of oxides of iron with a high content of copper on outside of tubes. The deposit accumulation creates conditions for concentrating of salts which promote corrosion and, then, the loosing of inter-contour tightness. Therefore the experts do not have any doubts in necessity of chemical cleanups and the chemical cleanups were carried out at some NPP's with VVER during last years. However it is possible to say, that these cleanups were carried out not by the best mode - the same main reagents had been used in order to dissolve the copper and iron oxides. For example, all cleanups at Balakovo NPP in 1996-1997 years had the common deficiency - even during 5. final stage of process the copper prolongs to be washed. By our opinion, the reasons of it are the poor scientific and technical justification of this process. Therefore at various NPP's with VVER cleanups realize by various techniques. The process of chemical cleanup, close to offered in the present work, was repeated many times utilized at BN-600 Belojarsk NPP and at BN-350 Shevtchenko NPP. The purposes of the present work are: 1. Research the behaviours of physicochemical processes during dissolution of components of depositions and their mixtures with use of the various formulas; 2. Analysis of the carried out chemical cleanups of PGV-1000M at an example of Balakovo NPP; 3. Development of a new process of SG's cleanup on the base of experimental researches and analysis; 4. Check of this process on the samples of full-scale depositions from SG Balakovo NPP. (authors)

Some benchmark calculations for VVER-1000 assemblies by WIMS-7B code

International Nuclear Information System (INIS)

Sultanov, N.V.

2001-01-01

Our aim in this report is to compare of calculation results, obtained with the use of different libraries, which are in the variant of the WIMS7B code. We had the three libraries: the 1986 library is based on the UKNDL files, the two 1996 libraries are based on the JEF-2.2 files, the one having the 69 group approximation, the other having the 172 group approximation. We wanted also to have some acquaintance with the new option of WIMS-7B - CACTUS. The variant of WIMS-7B was placed at our disposal by the code authors for a temporal use for 9 months. It was natural to make at comparisons with analogous values of TVS-M, MCU, Apollo-2, Casmo-4, Conkemo, MCNP, HELIOS codes, where the other different libraries were used. In accordance with our aims the calculations of unprofiled and profiled assemblies of the VVER-1000 reactor have been carried out by the option CACTUS. This option provides calculations by the characteristics method. The calculation results have been compared with the K ∞ values obtained by other codes in work. The conclusion from this analysis is such: the methodical parts of errors of these codes have nearly the same values. Spacing for K eff values can be explained of the library microsections differences mainly. Nevertheless, the more detailed analysis of the results obtained is required. In conclusion the calculation of a depletion of VVER-1000 cell has been carried out. The comparison of the dependency of the multiply factor from the depletion obtained by WIMS-7B with different libraries and by the TVS-M, MCU, HELIOS and WIMS-ABBN codes in work has been performed. (orig.)

45 CFR 170.440 - ONC-ATCB status.

Science.gov (United States)

2010-10-01

... Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATIONS, AND CERTIFICATION CRITERIA AND CERTIFICATION PROGRAMS FOR HEALTH INFORMATION TECHNOLOGY Temporary Certification Program for HIT § 170.440 ONC-ATCB status...

46 CFR 129.440 - Emergency lighting.

Science.gov (United States)

2010-10-01

... INSTALLATIONS Lighting Systems § 129.440 Emergency lighting. (a) A vessel of less than 100 gross tons must have... working (machinery) spaces below the main deck. (b) The emergency lighting required by paragraph (a) of... to an automatic battery-charger; and (4) Of enough capacity for 6 hours of continuous operation. ...

Fuel Cycle of VVER-1000: technical and economic aspects

International Nuclear Information System (INIS)

Kosourov, E.; Pavlov, V.; Pavlovichev, A.

2009-01-01

The paper contains estimations of dependences of technical and economic characteristics of VVER-1000 fuel cycle on number of charged FAs and their enrichment. In the study following restrictions were used: minimum quantity of loaded fresh FAs is equal 36 FAs, a maximum one - 78 (79) FAs and fuel enrichment is limited by value 4,95 %. The following technical and economic characteristics are discussed: cycle length, average burnup of spent fuel, specific consumption of natural uranium, specific quantity of separative work, annual production of thermal energy, fuel component of electrical energy cost, electricity generation cost. Results of estimations are presented as dependences of researched characteristics on cycle length, quantity of loaded FAs and their enrichments. The presented information allows to show tendencies and ranges of technical and economic characteristics at change of fuel cycle parameters. This information can be useful for definition of the fuel cycle parameters which satisfy the requirements of power system and exploiting organizations. (authors)

Modernization of the WWER 440/230 nuclear power plant environmental protection system

Energy Technology Data Exchange (ETDEWEB)

Mikheev, N.V.; Kamenskaya, A.N.; Kulyukhin, S.A.; Novichenko, V.L.; Rumer, I.A. [Russian Academy of Sciences, Institute of Physical Chemistry, Moscow (Russian Federation); Antonov, B.V.; Kornienko, A.G.; Meshkov, V.M.; Rogov, M.F. [Rosenergoatom Concern, Moscow (Russian Federation)

2001-07-01

The papers reports a new approach to the problem of increasing environmental protection during severe accidents at WWER 440/230 nuclear power plants. The environmental protection system that we propose has three, not two protection levels, and can be introduced with minor modernization of the equipment available at WWER 440/230 nuclear power plants: 1. a jet-vortex condenser; 2. the sprinkler system; 3. a sorption module. The proposed modernization not only makes it possible to avoid emergency discharge of radioactive air and steam mix into the environment under any accident scenario, but also would substantially contribute to the safety of WWER 440/230 nuclear power plants. (author)

Axial stability of VVER-1000 reactor with control with minimum standard deviation

International Nuclear Information System (INIS)

Afanas'ev, A.M.; Torlin, B.Z.

1980-01-01

Results are given of investigations on the stability of a reactor which has, in addition to an automatic controller, a height distribution regulator (HDR) based on an auxiliary control rod (CR) or a special shortened absorption rod (SAR). The HDR was controlled by using either a special ionization chamber (IC), generating an imbalance signal which sets the CR in motion, or two ionization chambers whose difference signal causes a displacement of the SAR. Since data from numerous pickups can be used to control the height field of the VVER-1000, it is of interest to analyze how this would affect the stability of the reactor. The analysis was carried out with the improved IRINA programs. 11 refs

Corrosion particles in the primary coolant of VVER-440 reactors

International Nuclear Information System (INIS)

Vajda, N.; Molnar, Z.; Macsik, Z.; Szeles, E.; Hargittai, P.; Csordas, A.; Pinter, T.; Pinter, T.

2010-01-01

Corrosion and activity build-up processes are of major concern in ageing and life-extension of nuclear power reactors. Researches to study the migration of radioactive corrosion particles have been initiated at Paks Nuclear Power Plant (NPP), Hungary in order to better understand the corrosion of the primary circuit surfaces, the transport and activation of the particles of corrosion origin and their deposition on in-core and out-of-core surfaces. Radioactive corrosion particles were collected from the primary coolant and the steam generator surfaces of the 4 reactor units and subjected to detailed microanalytical and radioanalytical investigations. Scanning electron microscopy and energy dispersive X-ray microanalysis (SEM-EDX) were used to study the morphology and the composition of the matrix elements in the particles and the deposited corrosion layers. Particles identified by SEM-EDX were re-located under optical microscope by means of a coordinate transformation algorithm and were separated with a micromanipulator for further studies. Activities of γ emitting radionuclides were determined by high resolution γ spectrometry, and those of β decaying isotopes were measured by liquid scintillation (LS) spectrometry after radiochemical processing. High sensitivity of the nuclear measuring techniques allowed us to determine the low activity concentrations of the long-lived radionuclides, i.e. 60 Co, 54 Mn, 63 Ni, 55 Fe in the individual particles. Finally, high resolution sector-field inductively coupled plasma mass spectrometry (SF-ICP-MS) was applied to determine the ultralow concentrations of Co, Fe, Ni in the same particles. Specific activities of 60 Co/Co, 54 Mn/Fe, 55 Fe/Fe and 63 Ni/Ni were derived from the measured activity and concentration data. Specific activities of the radioactive corrosion products reveal the history of activity buildup processes in the particle. Typically, Fe-Cr-Ni oxide particles formed as a result of corrosion of the steel surfaces are released into the coolant and activated during the residence time (τ) in the reactor core that varies in a wide range. Smallest τ values are obtained if the particle circulates without deposition in the core and high values reflect a long deposition time in the core, probably on the fuel cladding surfaces. Residence times (τ) were calculated from the measured specific activities under various migration-activation conditions. Conclusions about particle transport-activation processes in case of the 4 reactor units have been drawn. The residence time of the migrating corrosion particles is usually small, less than 50 days. Periods of stable operation, shutdown and startup were comparatively evaluated. The 4 reactor units of the plant which have different operation history (including steam generator decontamination in certain cases) were also compared with each other. Significant differences in the Fe/Cr/Ni ratio of the oxide layers of the steam generators were observed. Correlation between the behavior of the migrating particles and particles deposited on the steam generator surfaces were also studied. (author)

United States Department of Energy's reactor core protection evaluation methodology for fires at RBMK and VVER nuclear power plants. Revision 1

International Nuclear Information System (INIS)

1997-06-01

This document provides operators of Soviet-designed RBMK (graphite moderated light water boiling water reactor) and VVER (pressurized light water reactor) nuclear power plants with a systematic Methodology to qualitatively evaluate plant response to fires and to identify remedies to protect the reactor core from fire-initiated damage

The calculational VVER burnup Credit Benchmark No.3 results with the ENDF/B-VI rev.5 (1999)

Energy Technology Data Exchange (ETDEWEB)

Rodriguez Gual, Maritza [Centro de Tecnologia Nuclear, La Habana (Cuba). E-mail: mrgual@ctn.isctn.edu.cu

2000-07-01

The purpose of this papers to present the results of CB3 phase of the VVER calculational benchmark with the recent evaluated nuclear data library ENDF/B-VI Rev.5 (1999). This results are compared with the obtained from the other participants in the calculations (Czech Republic, Finland, Hungary, Slovaquia, Spain and the United Kingdom). The phase (CB3) of the VVER calculation benchmark is similar to the Phase II-A of the OECD/NEA/INSC BUC Working Group benchmark for PWR. The cases without burnup profile (BP) were performed with the WIMS/D-4 code. The rest of the cases have been carried with DOTIII discrete ordinates code. The neutron library used was the ENDF/B-VI rev. 5 (1999). The WIMS/D-4 (69 groups) is used to collapse cross sections from the ENDF/B-VI Rev. 5 (1999) to 36 groups working library for 2-D calculations. This work also comprises the results of CB1 (obtained with ENDF/B-VI rev. 5 (1999), too) and CB3 for cases with Burnup of 30 MWd/TU and cooling time of 1 and 5 years and for case with Burnup of 40 MWd/TU and cooling time of 1 year. (author)

Mechanisms of radiation embrittlement of VVER-1000 RPV steel at irradiation temperatures of (50–400)°C

Energy Technology Data Exchange (ETDEWEB)

Kuleshova, E.A., E-mail: evgenia-orm@yandex.ru [National Research Center “Kurchatov Institute”, Kurchatov Sq. 1, Moscow 123182 (Russian Federation); National Research Nuclear University “MEPhI” (Moscow Engineering Physics Institute), Kashirskoe Highway 31, Moscow 115409 (Russian Federation); Gurovich, B.A.; Bukina, Z.V.; Frolov, A.S.; Maltsev, D.A.; Krikun, E.V.; Zhurko, D.A.; Zhuchkov, G.M. [National Research Center “Kurchatov Institute”, Kurchatov Sq. 1, Moscow 123182 (Russian Federation)

2017-07-15

This work summarizes and analyzes our recent research results on the effect of irradiation temperature within the range of (50–400)°C on microstructure and properties of 15Kh2NMFAA class 1 steel (VVER-1000 reactor pressure vessel (RPV) base metal). The paper considers the influence of accelerated irradiation with different temperature up to different fluences on the carbide and irradiation-induced phases, radiation defects, yield strength changes and critical brittleness temperature shift (ΔT{sub K}) as well as on changes of the fraction of brittle intergranular fracture and segregation processes in the steel. Low temperature irradiation resulted solely in formation of radiation defects – dislocation loops of high number density, the latter increased with increase in irradiation temperature while their size decreased. In this regard high embrittlement rate observed at low temperature irradiation is only due to the hardening mechanism of radiation embrittlement. Accelerated irradiation at VVER-1000 RPV operating temperature (∼300 °C) caused formation of radiation-induced precipitates and dislocation loops, as well as some increase in phosphorus grain boundary segregation. The observed ΔT{sub K} shift being within the regulatory curve for VVER-1000 RPV base metal is due to both hardening and non-hardening mechanisms of radiation embrittlement. Irradiation at elevated temperature caused more intense phosphorus grain boundary segregation, but no formation of radiation-induced precipitates or dislocation loops in contrast to irradiation at 300 °C. Carbide transformations observed only after irradiation at 400 °C caused increase in yield strength and, along with a contribution of the non-hardening mechanism, resulted in the lowest ΔT{sub K} shift in the studied range of irradiation temperature and fluence. - Highlights: •Structural elements in RPV steel are studied at different irradiation temperatures. •Highest number density dislocation loops are

Safety and upgrading of nuclear power plants with WWER-440/V-230; Voprosy bezopasnosti i modernizatsii AEhS s WWER-440 (V-230)

Energy Technology Data Exchange (ETDEWEB)

Melnikov, N [Opytno-Konstruktorskoe Byuro Gidropress, Podol` sk (Russian Federation)

1996-12-31

Modernization of WWER-440/V-230 reactors is considered according to the WANO project `Proposal for reconstruction of WWER-440/V-230 reactors` (1990). The main technical measures to be taken relate to: 1. Expanding the considered spectrum of design basis accidents; 2. Provision of first loop integrity; 3. Safety system structure and components reliability enhancement; 4. Reduction o initiating events probability; 5. Enhancement of hermeticity and integrity of the area surrounding the first loop; 6. Fire fighting system upgrade; 7. Radiation control system upgrade; 8. Provision of seismic resistance. Details of the recommended technical steps for some NPPs are presented. 1 tab.

The strength of the reactor cavity of VVER-1000 NPP against steam explosion

International Nuclear Information System (INIS)

Varpasuo, P.

1995-01-01

The reactor cavity of VVER-1000 NPP is a thick-walled, cylindrical reinforced concrete structure. In case of molten core-water reaction during the severe accident the load carrying capacity of the cavity structure is of interest against the short impulse type loading caused by the steam explosion phenomenon. The assumed size of the impulse was 20 kPa-s and the duration was 10 ms. The static analysis of the structure used the ABAQUS/STANDARD and ANSYS codes. The material properties in both runs were specified to be elasto-plastic, and the cracking of concrete was taken into account. (author). 2 refs., 5 figs

Development of a cross-section methodology and a real-time core model for VVER-1000 simulator application

Energy Technology Data Exchange (ETDEWEB)

Georgieva, Emiliya Lyudmilova

2016-06-06

The novel academic contributions are summarized as follows. A) A cross-section modelling methodology and a cycle-specific cross-section update procedure are developed to meet fidelity requirements applicable to a cycle-specific reactor core simulation, as well as particular customer needs and practices supporting VVER-1000 operation and safety. B) A real-time version of the Nodal Expansion Method code is developed and implemented into Kozloduy 6 full-scope replica control room simulator.

Issues and remedies for secondary system of PWR/VVER

International Nuclear Information System (INIS)

Nordmann, Francis; Odar, Suat; Rochester, Dewey

2012-09-01

Secondary side degradation of steam generators (SG) and Flow Accelerated Corrosion (FAC) in the secondary system have been for a long time important issues in PWR and VVER types of Nuclear Power Plants. With the evolution of the design, the most important issues are progressively moving from secondary side corrosion of Alloy 600 SG tubing, which is being replaced, to a larger variety of risks associated with potential inadequate chemistries. As far as FAC of carbon steel is concerned, the evolution of treatment selection for minimizing corrosion products transport toward the SG, as well as progressive replacement of components in the feedwater train, decreases the risk of dramatic failures which have occurred in the past. After having briefly explained the reason for the past problems encountered in the secondary system of PWR and VVER, this paper evaluates the risk associated with various impurities or contaminants that may be present in the secondary system and how to mitigate them in the most appropriate, efficient, economical and environmental friendly way. The covered species are sodium, calcium, magnesium, chloride, sulfate and sulfur compounds, fluorides, organic compounds, silica, oxygen, lead, ion exchange resins. This paper also proposes the best remedies for mitigating the new issues that may be encountered in operating plants or units under construction. These are mainly: - Selecting a steam water treatment able to minimize the quantity of corrosion products transported toward the SG; - Mitigating the risk of Flow Induced Vibration by a proper control of deposits in sensitive areas; - Minimizing the risk of concentration of impurities in local areas where they may induce corrosion; - Avoiding the presence of abnormal quantities of some species in SG, such as the detrimental presence of lead and ion exchange resin debris or the controversial presence of organic compounds; - Optimizing costs of maintenance activities (SG mechanical, chemical cleaning

Accident management strategies for VVER-1000 reactors. Part 1: text

International Nuclear Information System (INIS)

Sdouz, G.; Sonneck, G.; Pachole, M.

1994-10-01

This report describes the effect of different accident management strategies on the onset, development and end of the core-concrete-interaction as well as on the containment integrity for a TMLB'-type sequence in a Pressurized Water Reactor of the type VVER- 1000. Using the computer code MARCH3 the following strategies were investigated: (1) One or more Spray and LP ECC Systems available with and without coolers after 10 hours (2) Inclusion of the reactor pressure vessel testing facility room to the cavity (3) Containment venting (4) External water supply and (5) Different electric power restoration times. The results show that some of these accident management measures will maintain the containment integrity and reduce the source term drastically, others will reduce the source term rate. For some measures final conclusions can only be given after complete source term calculations have been performed. (authors)

Method of the characteristics for calculation of VVER without homogenization

Energy Technology Data Exchange (ETDEWEB)

Suslov, I.R.; Komlev, O.G.; Novikova, N.N.; Zemskov, E.A.; Tormyshev, I.V.; Melnikov, K.G.; Sidorov, E.B. [Institute of Physics and Power Engineering, Obninsk (Russian Federation)

2005-07-01

The first stage of the development of characteristics code MCCG3D for calculation of the VVER-type reactor without homogenization is presented. The parallel version of the code for MPI was developed and tested on cluster PC with LINUX-OS. Further development of the MCCG3D code for design-level calculations with full-scale space-distributed feedbacks is discussed. For validation of the MCCG3D code we use the critical assembly VENUS-2. The geometrical models with and without homogenization have been used. With both models the MCCG3D results agree well with the experimental power distribution and with results generated by the other codes, but model without homogenization provides better results. The perturbation theory for MCCG3D code is developed and implemented in the module KEFSFGG. The calculations with KEFSFGG are in good agreement with direct calculations. (authors)

40 CFR 300.440 - Procedures for planning and implementing off-site response actions.

Science.gov (United States)

2010-07-01

... unless the Remedial Project Manager or OSC assures the proper management of the CERCLA waste samples or... OIL AND HAZARDOUS SUBSTANCES POLLUTION CONTINGENCY PLAN Hazardous Substance Response § 300.440... § 300.440(d). (5) Off-site transfers of those laboratory samples and treatability study CERCLA wastes...

20 CFR 670.440 - What are the responsibilities of outreach and admissions agencies?

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What are the responsibilities of outreach and admissions agencies? 670.440 Section 670.440 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR THE JOB CORPS UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Recruitment, Eligibility...

Uranium oxide fuel cycle analysis in VVER-1000 with VISTA simulation code

Science.gov (United States)

Mirekhtiary, Seyedeh Fatemeh; Abbasi, Akbar

2018-02-01

The VVER-1000 Nuclear power plant generates about 20-25 tons of spent fuel per year. In this research, the fuel transmutation of Uranium Oxide (UOX) fuel was calculated by using of nuclear fuel cycle simulation system (VISTA) code. In this simulation, we evaluated the back end components fuel cycle. The back end component calculations are Spent Fuel (SF), Actinide Inventory (AI) and Fission Product (FP) radioisotopes. The SF, AI and FP values were obtained 23.792178 ton/y, 22.811139 ton/y, 0.981039 ton/y, respectively. The obtained value of spent fuel, major actinide, and minor actinide and fission products were 23.8 ton/year, 22.795 ton/year, 0.024 ton/year and 0.981 ton/year, respectively.

Economical Feedback of Increasing Fuel Enrichment on Electricity Cost for VVER-1000

Directory of Open Access Journals (Sweden)

Mohammed Saad Dwiddar

2015-08-01

Full Text Available A methodology of evaluating the economics of the front-end nuclear fuel cycle with a price change sensitivity analysis for a VVER-1000 reactor core as a case study is presented. The effect of increasing the fuel enrichment and its corresponding reactor cycle length on the energy cost is investigated. The enrichment component was found to represent the highly expenses dynamic component affecting the economics of the front-end fuel cycle. Nevertheless, the increase of the fuel enrichment will increase the reactor cycle length, which will have a positive feedback on the electricity generation cost (cent/KWh. A long reactor operation time with a cheaper energy cost set the nuclear energy as a competitive alternative when compared with other energy sources.

Support calculations for management of PRISE leakage accidents

Energy Technology Data Exchange (ETDEWEB)

Matejovic, P.; Vranka, L. [Nuclear Power Plants Research Inst. Vuje, Trnava (Slovakia)

1997-12-31

Accidents involving primary-to-secondary leakage (PRISE) caused by rupture of one or a few tubes are well known design basis events in both, western and VVER NPPs. Operating experience and in-service inspections of VVER-440 units have demonstrated also the potential for large PRISE leaks in the case of the steam generator (SG) primary collector cover lift-up (Rovno NPP). Without performing any countermeasure for limitation of SG collector cover lift-up, a full opening results in PRISE leak with an equivalent diameter 107 mm. Although this accident was not considered in the original design, this event is usually analysed as DBA too. Different means are available for detection and mitigation of PRISE leakage in NPPs currently in operation (J.Bohunice V-1 and V-2) or under construction (Mochovce) in Slovakia. 8 refs.

Support calculations for management of PRISE leakage accidents

Energy Technology Data Exchange (ETDEWEB)

Matejovic, P; Vranka, L [Nuclear Power Plants Research Inst. Vuje, Trnava (Slovakia)

1998-12-31

Accidents involving primary-to-secondary leakage (PRISE) caused by rupture of one or a few tubes are well known design basis events in both, western and VVER NPPs. Operating experience and in-service inspections of VVER-440 units have demonstrated also the potential for large PRISE leaks in the case of the steam generator (SG) primary collector cover lift-up (Rovno NPP). Without performing any countermeasure for limitation of SG collector cover lift-up, a full opening results in PRISE leak with an equivalent diameter 107 mm. Although this accident was not considered in the original design, this event is usually analysed as DBA too. Different means are available for detection and mitigation of PRISE leakage in NPPs currently in operation (J.Bohunice V-1 and V-2) or under construction (Mochovce) in Slovakia. 8 refs.

VVER 1000-NPP Temelin safety upgrading

International Nuclear Information System (INIS)

Fleischhans, J.; Ubra, O.

1995-01-01

A modernisation program upgrading Temelin plant to meet internationally adopted standard has been implemented during plant design and construction phases. The initial Czech-Russian design (primary system was of Russian design, secondary system was of Czech design) has been extensively modified and adapted to present western safety criteria and operational requirements. The goals are to achieve a high level of safety, reliability, availability and load-following ability. The load-following ability and response to grid frequency changes are very important for the Czech Republic, since the nuclear capacity represents a high proportion of the overall electrical system there. On the basis of IAEA OSART missions and Halliburton NUS audit results and in compliance with recommendations of The State Office for Nuclear Safety, Czech Power Company and Czech scientists and researchers a modernisation program project for Temelin has been carried out. It includes three main groups of VVER1000 MW unit innovations: - Modernization and upgrading of the safety and control systems. - Fuel replacement and modification of the reactor core. - Innovation of some components of the primary and secondary systems. The tenders for instrumentation and control system, nuclear fuel, diagnostic system and radiation monitoring system were issued to the world-well known suppliers. The US company Westinghouse Electric >Corporation (WEC) was selected to submit contract for the delivery of instrumentation and control system primary side diagnostic system and for the delivery of nuclear fuel. The contract was signed in 1993

Control assembly ejection accident analysis for WWER-440 (Armenian NPP)

International Nuclear Information System (INIS)

Bznuni, S.; Malakyan, Ts.; Amirjanyan, A.; Ghasabyan, L.

2007-01-01

Control Assembly ejection in WWER-440 initiated by the loss of integrity of the Control Assemblies drive housing has been analyzed. This event causes a very rapid reactivity insertion to the core and small break LOCA which potentially could lead to rapid power increase and redistribution of heat release in the core resulting in a fuel, cladding and coolant temperature rise; primary pressure increase, radiological consequences due to loss of primary coolant and potential loss of cladding integrity and fuel disintegration (if applicable). Methodology of the analysis is based on conservative assumptions as well as on deterministic approach for selection of functioning logic of systems and equipment's to maximize reactor core power and minimize power decreasing reactivity feedback. Computational analyses were performed by 3D kinetics PARCS-RELAP coupled code. WWER-440 fuel cross-section libraries, diffusion coefficients and kinetics parameters were calculated by HELOS code. In this paper analysis of accident for Hot Full Power was presented. Results of analysis show that ANPP WWER-440 reactor design meets acceptance criteria prescribed for RIA type design based accidents (Authors)

Issues and remedies for secondary system of PWR/VVER

International Nuclear Information System (INIS)

Nordmann, F.; Odar, S.; Rochester, D.

2012-01-01

Secondary side degradation of steam generators (SG) tubing with Alloy 600 MA and flow accelerated corrosion (FAC) of carbon steel have been for a long time important issues for the secondary system of PWR and VVER. With the beneficial evolution of the design (for instance the replacement of Alloy 600 SG tubing), the most important issues are progressively moving to a larger variety of risks associated to potential inadequate chemistries. The best remedies for mitigating the new concerns are: -) selecting a steam water treatment able to minimize the quantity of corrosion products transported to the steam generator, -) mitigating the risk of flow induced vibration by a proper control of deposits in sensitive areas, -) minimizing the risk of concentration of impurities in local areas where they may induce corrosion. The paper also explains: -) the benefit of eliminating or by pass of condensate polishers, -) the absence of need for expensive lead investigation, if no specific pollution occurred, -) the absence of need for very low oxygen in the condensate water, and -) the necessary and optimum number of on-line monitors

Study of long-term loss of all AC power supply sources for VVER-1000/V320 in connection with application of new engineering safety features for SAMG

International Nuclear Information System (INIS)

Borisov, Evgeni; Grigorov, Dobrin; Mancheva, Kaliopa

2013-01-01

Highlights: • In this study we presented analysis for a new SAMG approach. • The approach is applicable for all PWR reactors from 2nd generation. • We investigated two scenarios with total black out. • The RELAP/MOD 3.2 computer code is used in performing the analyses. - Abstract: This paper presents the results of analysis for application of a new Severe Accident Management Guideline (SAMG) approach which is specifically applied for VVER-1000/B320 reactor installations. In general, this innovative approach is fully applicable for all the pressurized water reactors from second generation. The purposes of the analysis for the new SAMG approach application are as follows: • To represent suggestions for new engineering safety features application for SAMG strategies. • To assess the applicability of the new engineering safety features and means for SAMG strategies in case of loss of all off-site power supply sources for VVER-1000/B320 reactor installations. • To represent important operator actions and to analyse the effectiveness of these actions for accidents management in compliance with the new approach. • The RELAP5/MOD3.3 computer code has been used in performing the analyses in a VVER-1000 Nuclear Power Plant (NPP) model. The input data deck for the analysis is optimized, verified and validated

Design and implementation of the control system for nuclear plant VVER-1000. Instrumentation (program technical complexes)

International Nuclear Information System (INIS)

Siora, A.; Tokarev, V.; Bakhmach, E.

2004-01-01

Program-technical complexes (PTC) are designed as control and protection systems in water-moderated atomic reactors, including emergency and preventive systems, automatic control, unloading, reactor capacity limitation and accelerated preventive protection systems. Utilization of programmable logic integrated circuits from world leading manufacturers makes the complexes simple in structure, compact, with low energy demands and mutually independent for key and supporting functions The results of PTC assessment and implementation in Ukraine are outlined. Opportunities for a future development of RADIJ company in the area of control and protection systems for VVER reactors are also discussed

Power peak in vicinity of WWER-440 control rod at end of fuel cycle

International Nuclear Information System (INIS)

Mikus, J.

2003-01-01

This paper presents some results of the axial power distribution measurements carried out in a WWER-440 type core on the light-water, zero-power reactor LR-O in the vicinity of the WWER-440 control rod model at zero boron concentration in moderator. Further presented information concern the description of the control rod model, LR-0 core arrangement, specification of the fuel assemblies and measurement conditions. The aim of performed experiment is enlargement of the available 'power peaking database' to enable the calculation codes validation also by means of data that correspond to the end of WWER-440 fuel cycle (Authors)

Top-Level Software for VVER-1000 In-core Monitoring System under Implementation of Expanded Nuclear Fuel Diversification Program in Ukraine

International Nuclear Information System (INIS)

Khalimonchuk, V.A.

2015-01-01

The paper considers the possibility and expediency of developing mathematical software for VVER-1000 ICMS in Ukraine. This mathematical software is among the most important conditions for implementation of the expanded nuclear fuel diversification program. The top-level software is to be developed based on SSTC own studies in the development of codes for power distribution recovery, which were successfully used previously for RBMK-1000 safety analysis

Granulocyte-Colony Stimulating Factor Receptor, Tissue Factor, and VEGF-R Bound VEGF in Human Breast Cancer In Loco.

Science.gov (United States)

Wojtukiewicz, Marek Z; Sierko, Ewa; Skalij, Piotr; Kamińska, Magda; Zimnoch, Lech; Brekken, Ralf A; Thorpe, Philip E

2016-01-01

Doxorubicin and docetaxel-based chemotherapy regimens used in breast cancer patients are associated with high risk of febrile neutropenia (FN). Granulocyte colony-stimulating factors (G-CSF) are recommended for both treating and preventing chemotherapy-induced neutropenia. Increased thrombosis incidence in G-CSF treated patients was reported; however, the underlying mechanisms remain unclear. The principal activator of blood coagulation in cancer is tissue factor (TF). It additionally contributes to cancer progression and stimulates angiogenesis. The main proangiogenic factor is vascular endothelial growth factor (VEGF). The aim of the study was to evaluate granulocyte-colony stimulating factor receptor (G-CSFR), tissue factor (TF) expression and vascular endothelial growth factor receptor (VEGF-R) bound VEGF in human breast cancer in loco. G-CSFR, TF and VEGFR bound VEGF (VEGF: VEGFR) were assessed in 28 breast cancer tissue samples. Immunohistochemical (IHC) methodologies according to ABC technique and double staining IHC procedure were employed utilizing antibodies against G-CSFR, TF and VEGF associated with VEGFR (VEGF: VEGFR). Expression of G-CSFR was demonstrated in 20 breast cancer tissue specimens (71%). In 6 cases (21%) the expression was strong (IRS 9-12). Strong expression of TF was observed in all investigated cases (100%). Moreover, expression of VEGF: VEGFR was visualized in cancer cells (IRS 5-8). No presence of G-CSFR, TF or VEGF: VEGFR was detected on healthy breast cells. Double staining IHC studies revealed co-localization of G-CSFR and TF, G-CSFR and VEGF: VEGFR, as well as TF and VEGF: VEGFR on breast cancer cells and ECs. The results of the study indicate that GCSFR, TF and VEGF: VEGFR expression as well as their co-expression might influence breast cancer biology, and may increase thromboembolic adverse events incidence.

40 CFR 440.24 - New Source performance standards (NSPS).

Science.gov (United States)

2010-07-01

... GUIDELINES AND STANDARDS ORE MINING AND DRESSING POINT SOURCE CATEGORY Aluminum Ore Subcategory § 440.24 New... pollutants discharged in mine drainage from mines producting bauxite ores shall not exceed: Effluent...

Construction of the Plant RT-2 as a way for solving the problem of VVER-1000 spent fuel management in Russia

International Nuclear Information System (INIS)

Lazarev, L.N.; Lyubtsev, R.I.; Egorov, N.N.; Lebedev, V.A.; Revenko, Y.A.; Fedosov, Y.G.; Dubrovskii, V.M.

1993-01-01

Nuclear power in the Russian Federation in the future will be based on the VVER-1000 and it's modifications. To manage the spent fuels from this plant, the Plant RT-2 was designed to process the spent fuel. Plant construction was started in 1984 and stopped in 1989 due to economic difficulties. The necessity of the continuation of the plant is discussed

3D neutronic codes coupled with thermal-hydraulic system codes for PWR, and BWR and VVER reactors

Energy Technology Data Exchange (ETDEWEB)

Langenbuch, S.; Velkov, K. [GRS, Garching (Germany); Lizorkin, M. [Kurchatov-Institute, Moscow (Russian Federation)] [and others

1997-07-01

This paper describes the objectives of code development for coupling 3D neutronics codes with thermal-hydraulic system codes. The present status of coupling ATHLET with three 3D neutronics codes for VVER- and LWR-reactors is presented. After describing the basic features of the 3D neutronic codes BIPR-8 from Kurchatov-Institute, DYN3D from Research Center Rossendorf and QUABOX/CUBBOX from GRS, first applications of coupled codes for different transient and accident scenarios are presented. The need of further investigations is discussed.

Project for qualification of the Kozloduy confinement system; Proyecto de cualificacion del sistema de confinamiento de Kozloduy

Energy Technology Data Exchange (ETDEWEB)

Montes Rodriguez, J L [Empresarios Agrupados, A.I.E., Madrid (Spain)

1993-12-15

One of the projects awarded to Empresarios Agrupados within the Six-Month WANO Programme for Kozloduy NPP, financed through the European Community's PHARE Programme, relates to the first tasks of plant confinement system qualification. Development of this project - the results of which will serve as a reference for other power plants with VVER-440/230 models - aroused considerable interest in the Bulgarian nuclear community as well as in international entities which render assistance to Eastern power plants. In fact, this is one of the few projects in the programme which takes into account hardware-oriented activities to be carried out urgently in the plant. The VVER-440/230 confinement system performs functions parallel to the containment system of Western PWR reactors. However, it differs significantly in its criteria and operation details. These important differences form the basis for a rational and prudent application of the essence of Western codes and standards relating to the qualification of these systems. The criteria which are developed to make this application viable constitute the most challenging and, at the same time, most risky part of this job. The project will be in its final stages when the 18th Annual Meeting of the Spanish Nuclear Society is held; it is therefore likely that this paper will advance the results and conclusions expected. (author)

Project for qualification of the Kozloduy confinement system

International Nuclear Information System (INIS)

Montes Rodriguez, J.L.

1993-01-01

One of the projects awarded to Empresarios Agrupados within the Six-Month WANO Programme for Kozloduy NPP, financed through the European Community's PHARE Programme, relates to the first tasks of plant confinement system qualification. Development of this project - the results of which will serve as a reference for other power plants with VVER-440/230 models - aroused considerable interest in the Bulgarian nuclear community as well as in international entities which render assistance to Eastern power plants. In fact, this is one of the few projects in the programme which takes into account hardware-oriented activities to be carried out urgently in the plant. The VVER-440/230 confinement system performs functions parallel to the containment system of Western PWR reactors. However, it differs significantly in its criteria and operation details. These important differences form the basis for a rational and prudent application of the essence of Western codes and standards relating to the qualification of these systems. The criteria which are developed to make this application viable constitute the most challenging and, at the same time, most risky part of this job. The project will be in its final stages when the 18th Annual Meeting of the Spanish Nuclear Society is held; it is therefore likely that this paper will advance the results and conclusions expected. (author)

Application of the combined cycle LWR-gas turbine to PWR for NPP life extension, safety upgrade and improving economy

International Nuclear Information System (INIS)

Kuznetsov, Yu.N.; Gabaraev, B.A.

2002-01-01

Full text: The unconventional technology to extend the lifetime for the NPPs now in operation and make a construction of new NPPs cheaper - erection of steam-gas toppings to the nuclear power units - is considered in the paper. Application of the steam-gas toppings permits through reducing power of ageing reactors to extend lifetime of nuclear power unit, enhance its safety and at the same time to keep full load operation of NPP turbine and other balance-of-plant equipment. Proposed technology is examined for Russian VVER-440 reactor as an example and, also, as a pilot project, for Russian boiling VK-50 reactor now in operation Application of the steam-gas topping permits: extend the service life of ageing VVER-440 reactor by 10...15 years; use the turbine and other NPP balance-of-plant equipment at full power; increase the efficiency of combined cycle up to 48% and more; enhance the safety of NPP operation; utilize NPP balance-of-plant equipment after reactor decommissioning; perform the cost-effective operation in maneuvering modes; increase capacity factor of the plant. The construction of pilot project on the basis of the VK-50 reactor will allow not only to demonstrate new technology but also to attain appreciable economic effect including that obtained due to using the available reserves of the NPP turbine. (author)

Possible pressurized thermal shock events during large primary to secondary leakage. The Hungarian AGNES project and PRISE accident scenarios in VVER-440/V213 type reactor

Energy Technology Data Exchange (ETDEWEB)

Perneczky, L. [KFKI Atomic Energy Research Inst., Budabest (Hungary)

1997-12-31

Nuclear power plants of WWER-440/213-type have several special features. Consequently, the transient behaviour of such a reactor system should be different from the behaviour of the PWRs of western design. The opening of the steam generator (SG) collector cover, as a specific primary to secondary circuit leakage (PRISE) occurring in WWER-type reactors happened first time in Rovno NPP Unit I on January 22, 1982. Similar accident was studied in the framework of IAEA project RER/9/004 in 1987-88 using the RELAP4/mod6 code. The Hungarian AGNES (Advanced General and New Evaluation of Safety) project was performed in the period 1991-94 with the aim to reassess the safety of the Paks NPP using state-of-the-art techniques. The project comprised three type of analyses for the primary to secondary circuit leakages: Design Basis Accident (DBA) analyses, Pressurized Thermal Shock (PTS) study and deterministic analyses for Probabilistic Safety Analysis (PSA). Major part of the thermohydraulic analyses has been performed by the RELAP5/mod2.5/V251 code version with two input models. 32 refs.

Possible pressurized thermal shock events during large primary to secondary leakage. The Hungarian AGNES project and PRISE accident scenarios in VVER-440/V213 type reactor

Energy Technology Data Exchange (ETDEWEB)

Perneczky, L [KFKI Atomic Energy Research Inst., Budabest (Hungary)

1998-12-31

Nuclear power plants of WWER-440/213-type have several special features. Consequently, the transient behaviour of such a reactor system should be different from the behaviour of the PWRs of western design. The opening of the steam generator (SG) collector cover, as a specific primary to secondary circuit leakage (PRISE) occurring in WWER-type reactors happened first time in Rovno NPP Unit I on January 22, 1982. Similar accident was studied in the framework of IAEA project RER/9/004 in 1987-88 using the RELAP4/mod6 code. The Hungarian AGNES (Advanced General and New Evaluation of Safety) project was performed in the period 1991-94 with the aim to reassess the safety of the Paks NPP using state-of-the-art techniques. The project comprised three type of analyses for the primary to secondary circuit leakages: Design Basis Accident (DBA) analyses, Pressurized Thermal Shock (PTS) study and deterministic analyses for Probabilistic Safety Analysis (PSA). Major part of the thermohydraulic analyses has been performed by the RELAP5/mod2.5/V251 code version with two input models. 32 refs.

Recent improvements and new features in the Westinghouse lattice physics codes

International Nuclear Information System (INIS)

Huria, H.C.; Buechel, R.J.

1995-01-01

Westinghouse has been using the ANC three-dimensional, two-energy-group nodal model for nuclear analysis and fuel management calculations for standard pressurized water reactor (PWR) reload design analysis since 1988. The cross sections are obtained from PHOENIX-P, a modified version of the PHOENIX lattice physics code for all square-assembly PWR cores. The PHOENIX-H code was developed for modeling both the VVER-1000 and VVER-440 fuel lattice configurations. The PHOENIX-H code has evolved from PHOENIX-P, the primary difference being in the neutronic solution modules. The PHOENIX-P code determines the assembly flux distribution using integral transport theory-based pin-cell nodal coupling followed by two-dimensional discrete ordinates solution in x-y geometry. The PHOENIX-H code uses the two-dimensional heterogeneous response method. The other infrastructure is identical in both the codes, and they share the same 42-group cross-section library

Nuclear power in Czechoslovakia and its development within the CMEA collaboration framework

International Nuclear Information System (INIS)

Gavel, S.

1984-01-01

The state of and prospects for the development of nuclear pwer and energy machine building in Czechoslovakia are considered. In 1980 the NPPs generated 1.5% of the country's energy. It is envisaged that by 1990 the share of NPPs will rise to 9.2% and by 2000 to 15%. Since 1974, when an agreement with the Soviet Union was signed on cooperation and specialization in producing equipment for NPPs, a new industry, nuclear power machine building, has been successfully developed in Czechoslovakia. The production of steam generators, volume compensators, main gate valves, pipelines, special fittings, special pumps and auxiliary systems of the primary circuit has been mastered. Presently, the Czechoslovakian industry is capable of manufacturing above 80% of the whole servicing equipment of WWER-440 power units. Alongside with the USSR, Czechoslovakia has become the second greatest supplier of equipment for NPPs among the COMECON member-states. By 2000 it is planned to put into operation 12 WWER-440 power unit and 6 WWER-1000 power units with the total capacity of 11280 MW. An experimental agro-nuclear complex will soon be constructed in which NPP heat will be utilized for growing vegetables, fruit, mushrooms and for breeding fish

CASTOR - Advanced System for VVER Steam Generator Inspection

International Nuclear Information System (INIS)

Mateljak, Petar

2014-01-01

From the safety point of view, steam generator is a very important component of a nuclear power plant. Only a thin tube wall prevents leakage of radioactive material from the primary side into the environment. Therefore, it is very important to perform inspections in order to detect pipe damage and apply appropriate corrective actions during outage. Application of the nondestructive examination (NDE) technique, that can locate degradation and measure its size and orientation, is an integral part of nuclear power plant maintenance. The steam generator inspection system is consisted of remotely controlled manipulator, testing instrument and software for data acquisition and analysis. Recently, the inspection systems have evolved to a much higher level of automation, efficiency and reliability resulting in a lower cost and shorter outage time. Electronic components have become smaller and deal with more complex algorithms. These systems are very fast, precise, reliable and easy to handle. The whole inspection, from the planning, examination, data analysis and final report, is now a highly automated process, which makes inspection much easier and more reliable. This paper presents the new generation of INETEC's VVER steam generator inspection system as ultimate solution for steam generator inspection and repair. (author)

AER Working Group B activities in 2009

International Nuclear Information System (INIS)

Darilek, P.

2009-01-01

Regular meeting of Core Design Group was organized by SKODA JS a.s. in Plzen (Czech Republic) during the period of 4 to 6 May 2009. There were presented altogether 17 participants from 7 member organizations and 7 presentations were read. Presented papers covered topics as follows: 1) Two presentations dealt with upgrade of calculation and display tools. 2) Three presentations were devoted to benchmark calculations. 3) Two presentations informed about gradual improvement of fuel assembly and cycle for VVER-440 reactors

Comparison of PWR-IMF and FR fuel cycles

International Nuclear Information System (INIS)

Darilek, Petr; Zajac, Radoslav; Breza, Juraj; Necas, Vladimir

2007-01-01

The paper gives a comparison of PWR (Russia origin VVER-440) cycle with improved micro-heterogeneous inert matrix fuel assemblies and FR cycle. Micro-heterogeneous combined assembly contains transmutation pins with Pu and MAs from burned uranium reprocessing and standard uranium pins. Cycle analyses were performed by HELIOS spectral code and SCALE code system. Comparison is based on fuel cycle indicators, used in the project RED-IMPACT - part of EU FP6. Advantages of both closed cycles are pointed out. (authors)

42 CFR 440.330 - Benchmark health benefits coverage.

Science.gov (United States)

2010-10-01

...) Federal Employees Health Benefit Plan Equivalent Coverage (FEHBP—Equivalent Health Insurance Coverage). A... coverage. Health benefits coverage that is offered and generally available to State employees in the State... 42 Public Health 4 2010-10-01 2010-10-01 false Benchmark health benefits coverage. 440.330 Section...

Three-dimensional analysis of the coolant flow characteristics in the fuel assemblies of VVER-1000 reactors

International Nuclear Information System (INIS)

Dinh Van Thin; Tran Thi Nhan

2015-01-01

Computational Fluid Dynamics (CFD) is a widely used method around the world for complex flow and heat industrial problems. In this paper, the coolant flow parameters were investigated in subchannels of VVER-1000 reactor’s fuel assemblies by ANSYS V14.5 programme. The different mesh solutions and turbulence models were carried out to deal with the water flow problems such as velocity distribution, streamline, temperature and pressure change as well as the hydraulic resistances of the spacer grids. The obtained results are good agreement with the measured values and the published reports from other authors. (author)

Experimental investigation of power peak in vicinity of WWER-440 control rod at end of fuel cycle

International Nuclear Information System (INIS)

Mikus, J.

2004-01-01

This paper presents some results of the axial power (fission density) distribution measurements carried out on the light-water, zero-power reactor LR-0 in a WWER-440 type core in vicinity of the WWER-440 control rod model at zero boron concentration in moderator, modelling the conditions at the end of the WWER-440 fuel cycle. Further information concerns the control rod model description, specification of the LR-0 core, fuel assemblies and measurement conditions. The aim of performed experiment is enlargement of the available power peaking database to enable the validation of the calculation codes by means of the measured data that correspond to the end of WWER-440 fuel cycle. (author)

Qualification of the core model DYN3D coupled with the code ATHLET as an advanced tool for the accident analysis of VVER type reactors. Pt. 2. Final report

International Nuclear Information System (INIS)

Grundmann, U.; Kliem, S.; Rohde, U.

2002-10-01

Benchmark calculations for the validation of the coupled neutron kinetics/thermohydraulic code complex DYN3D-ATHLET are described. Two benchmark problems concerning hypothetical accident scenarios with leaks in the steam system for a VVER-440 type reactor and the TMI-1 PWR have been solved. The first benchmark task has been defined by FZR in the frame of the international association 'Atomic Energy Research' (AER), the second exercise has been organized under the auspices of the OECD. While in the first benchmark the break of the main steam collector in the sub-critical hot zero power state of the reactor was considered, the break of one of the two main steam lines at full reactor power was assumed in the OECD benchmark. Therefore, in this exercise the mixing of the coolant from the intact and the defect loops had to be considered, while in the AER benchmark the steam collector break causes a homogeneous overcooling of the primary circuit. In the AER benchmark, each participant had to use its own macroscopic cross section libraries. In the OECD benchmark, the cross sections were given in the benchmark definition. The main task of both benchmark problems was to analyse the re-criticality of the scrammed reactor due to the overcooling. For both benchmark problems, a good agreement of the DYN3D-ATHLET solution with the results of other codes was achieved. Differences in the time of re-criticality and the height of the power peak between various solutions of the AER benchmark can be explained by the use of different cross section data. Significant differences in the thermohydraulic parameters (coolant temperature, pressure) occurred only at the late stage of the transient during the emergency injection of highly borated water. In the OECD benchmark, a broader scattering of the thermohydraulic results can be observed, while a good agreement between the various 3D reactor core calculations with given thermohydraulic boundary conditions was achieved. Reasons for the

Seismic assessment of Kozloduy VVER 440, Model 230 nuclear power plant

International Nuclear Information System (INIS)

Monette, P.; Baltus, R.; Yanev, P.; Campbell, R.

1991-01-01

Excluding system design deficiency relative to US and Western Europe standards, it was found that the plant has many seismic vulnerabilities similar to those that existed in many of the US plants prior to about 1979 when the Systematic Evaluation Program was initiated. The primary coolant system has been substantially upgraded after the 1977 Vrancea earthquake. Other upgrades have been made to weak elements in the ECCS and electrical systems. There are still a number of components that could likely survive the currently defined Safe Shutdown Earthquake of 0.1 g but which would not meet current design standards. Many of the weakest components could be upgraded at a moderate cost to withstand a seismic event exceeding 0.1 g. Current studies of the site seismicity lean toward a higher peak ground acceleration and increased amplification of building motion, thus backfits that have been accomplished may become marginal for newly defined loads. However the proper consideration of soil structure interaction and detailed structural analysis using less conservative modeling assumptions, could mitigate the impact of increasing the seismic input and limit the amount of reinforcement required. In the interim, substantial improvements to seismic safety could be accomplished by simple, inexpensive modifications to equipment anchorage and some achievable improvements to connection detail of the precast concrete structures. (author)

The Paks Nuclear Power Station

International Nuclear Information System (INIS)

Erdosi, N.; Szabo, L.

1978-01-01

As the first stage in the construction of the Paks Nuclear Power Station, two units of 440 MW(e) each will be built. They are operated with two coolant loops each. The reactor units are VVER 440 type water-moderated PWR type heterogeneous power reactors designed in the Soviet Union and manufactured in Czechoslovakia. Each unit operates two Soviet-made K-220-44 steam turbines and Hungarian-made generators of an effective output of 220 MW. The output of the transformer units - also of Hungarian made - is 270 MVA. The radiation protection system of the nuclear power station is described. Protection against system failures is accomplished by specially designed equipment and security measures especially within the primary circuit. Some data on the power station under construction are given. (R.P.)

Three-dimensional neutron kinetics-thermal-hydraulics VVER 1000 main steam line break analysis by RELAP5-3D code

International Nuclear Information System (INIS)

Frisani, A.; Parisi, C.; D'Auria, F.

2007-01-01

After the development and the assessment of Three-Dimensional (3D) Neutron Kinetics (NK) - 1D Thermal-Hydraulics (TH) coupled codes analyses methods, deterministic nuclear safety technology is nowadays producing noticeable efforts for the validation of 3D NK - 3D TH coupled codes analyses methods too. Thus, the purpose of this work was to address the capability of the RELAP5-3D 3D NK-3D TH code to reproduce VVER 1000 Nuclear Power Plant (NPP) core dynamic in simulating the mixing effects that could happen in the vessel downcomer and lower plenum during some scenarios. The work was developed in three steps. The first step dealt with the 3D TH modeling of the Kozloduy-6 VVER 1000 reactor pressure vessel. Then this model was validated following a Steam Generator Isolation transient. The second step has been the development of a 3D NK nodalization for the reactor core region. Then the 3D NK model was directly coupled with the previously developed 3D TH model. The third step was the calculation of a Main Steam Line Break (MSLB) transient. The 3D NK global nuclear parameters were then compared with the 0-D results showing a good agreement; nevertheless only the 3D NK- 3D TH model allowed the calculation of each single assembly power trend for this strong NK-TH asymmetric transient. (author)

32 CFR 644.440 - Application of antitrust laws.

Science.gov (United States)

2010-07-01

... 32 National Defense 4 2010-07-01 2010-07-01 true Application of antitrust laws. 644.440 Section... Application of antitrust laws. Section 207 of the Federal Property Act provides that real property and related... the antitrust laws. Prior to obligating the Government on any such disposal, the District Engineer...

OECD/DOE/CEA VVER-1000 Coolant Transient Benchmark. Summary Record of the Fourth Workshop (V100-CT4)

International Nuclear Information System (INIS)

2006-01-01

The overall objective of the VVER-1000 coolant transient (V1000CT) benchmark is to assess computer codes used in the safety analysis of VVER power plants, specifically for their use in analysis of reactivity transients in a VVER-1000. The V1000CT benchmark consists of two phases: V1000CT-1 is a simulation of the switching on of one main coolant pump (MCP) when the other three MCPs are in operation, and V1000CT-2 concerns calculation of coolant mixing tests and main steam line break (MSLB) scenarios. Each of the two phases contains three exercises. The reference problem chosen for simulation in Phase 1 is a MCP switching on when the other three main coolant pumps are in operation in a VVER-1000. This event is characterized by rapid increase in the flow through the core resulting in a coolant temperature decrease, which is spatially dependent. This leads to insertion of spatially distributed positive reactivity due to the modelled feedback mechanisms and non-symmetric power distribution. Simulation of the transient requires evaluation of core response from a multi-dimensional perspective (coupled three-dimensional neutronics/core thermal-hydraulics) supplemented by a one-dimensional simulation of the remainder of the reactor coolant system. Three exercises are defined in the framework of Phase 1: a) Exercise 1 - Point kinetics plant simulation; b) Exercise 2 - Coupled 3-D neutronics/core thermal-hydraulics response evaluation; c) Exercise 3 - Best-estimate coupled 3-D core/plant system transient modelling. In addition to the measured (experiment) scenario, extreme calculation scenarios were defined in the frame of Exercise 3 for better testing 3-D neutronics/thermal-hydraulics techniques. The proposals concerned: rod ejection simulations with scram set points at two different power levels. Since the previous coupled code benchmarks indicated that further development of the mixing computation models in the integrated codes is necessary, a coolant mixing experiment and

Simulation of mixing effects in a VVER-1000 reactor

International Nuclear Information System (INIS)

Ulrich Bieder; Gauthier Fauchet; Sylvie Betin; Nikola Kolev; Dimitar Popov

2005-01-01

Full text of publication follows: The work presented has been performed in the framework of the OECD/NEA thermalhydraulic benchmark V1000CT-2. This benchmark is related to fluid mixing in the reactor vessel during a MSLB accident scenario in a VVER-1000 reactor. The purpose of the first exercise is to test the capability of CFD codes to represent the coolant mixing in the reactor vessel, in particular in the downcomer and the lower plenum. Coolant mixing in a VVER-1000 V320 reactor was investigated in plant experiments during the commissioning of Kozloduy Unit 5 and 6. Starting from nearly symmetric states, asymmetric loop operation in different combinations was caused by disturbing the steam flow from one or more steam generators. Non-uniform and asymmetric loop flow mixing in the reactor vessel has been observed in the event of asymmetric loop operation. For certain flow patterns there is a shift (swirl) of the main loop flows with respect to the cold leg axes. This azimuthal shift as well as mixing coefficients from cold legs to the fuel assembly inlets have been measured. The presented reference problem is a pure TH problem with given boundary conditions and power distributions. During a stabilization phase, the thermal power of the reactor was 281 MW i.e. 9.36% of the nominal power according to primary balance. Then, a transient was initiated by closing the steam isolation valve of the steam generator one (SG-1) and isolating SG-1 from feed water. The coolant temperature in the cold and hot legs of Loop no 1 rose by 13-13.5 C. After about 20 minutes a stabilized state was reached which is considered as 'final state'. This final state has been analysed with the Trio-U code. Trio-U is a CFD code developed by the CEA Grenoble, aimed to supply an efficient computational tool to simulate transient thermalhydraulic mono-phase turbulent flows encountered in nuclear systems as well as in industrial processes. For the presented study, a LES approach was used. Therefore

Microstructures and Mechanical Properties of Austempering SUS440 Steel Thin Plates

Directory of Open Access Journals (Sweden)

Cheng-Yi Chen

2016-02-01

Full Text Available SUS440 is a high-carbon stainless steel, and its martensite matrix has high heat resistance, high corrosion resistance, and high pressure resistance. It has been widely used in mechanical parts and critical materials. However, the SUS440 martempered matrix has reliability problems in thin plate applications and thus research uses different austempering heat treatments (tempering temperature: 200 °C–400 °C to obtain a matrix containing bainite, retained austenite, martensite, and the M7C3 phase to investigate the relationships between the resulting microstructure and tensile mechanical properties. Experimental data showed that the austempering conditions of the specimen affected the volume fraction of phases and distribution of carbides. After austenitizing heat treatment (1080 °C for 30 min, the austempering of the SUS440 thin plates was carried out at a salt-bath temperature 300 °C for 120 min and water quenching was then used to obtain the bainite matrix with fine carbides, with the resulting material having a higher tensile fracture strength and average hardness (HRA 76 makes it suitable for use as a high-strength thin plate for industrial applications.

KUPOL-M code for simulation of the VVER's accident localization system under LOCA conditions

International Nuclear Information System (INIS)

Efanov, A.D.; Lukyanov, A.A.; Shangin, N.N.; Zajtsev, A.A.; Solov'ev, S.L.

2004-01-01

Computer code KUPOL-M is developed for analysis of thermodynamic parameters of medium within full pressure containment for NPPs with VVER under LOCA conditions. The analysis takes into account the effects of non-stationary heat-mass transfer of gas-drop mixture in the containment compartments with natural convection, volume and surface steam condensation in the presence of noncondensables, heat-mass exchange of the compartment atmosphere with water in the sumps. The operation of the main safety systems like a spray system, hydrogen catalytic recombiners, emergency core cooling pumps, valves and a fan system is simulated in KUPOL-M code. The main results of the code verification including the ones of the participation in ISP-47 International Standard Problem on containment thermal-hydraulics are presented. (author)

Evaluation of efficiency of axial profiling in WWER-440 fuel assemblies

International Nuclear Information System (INIS)

Ananjev, Yu. A.; Kurakin, K. Yu.; Artemov, V.G.; Ivanov, A.S.

2005-01-01

The present report deals with consideration of fuel enrichment axial profiling in WWER-440 assemblies. The study is performed on improving the effectiveness of fuel utilization using the example of implementing the axial profiling in the assemblies of the second generation. For simulation of fuel loadings the computer code package SAPFIR 9 5 and RC is used that allows for correct consideration of specific features of assemblies design changes. The methodical approach to assessment of effectiveness of implementing the axial profiling is considered with the use of capabilities of the mentioned code package. In conclusion the recommendations are given on using the fuel enrichment axial profiling in WWER-440 assemblies (Authors)

Development of anti-debris filter for WWER-440 working fuel assembly

International Nuclear Information System (INIS)

Kolosovsky, V.; Aksyonov, P.; Kukushkin, Y.; Molchanov, V.; Kolobaev, A.

2006-01-01

Mechanical damaging of the fuel rod claddings caused by debris is one of the main reasons for fuel assembly failures. The paper focuses on the program and results of experimental and design activities carried out by Russian organizations relating to the development and investigation of operational characteristics of anti-debris filters for WWER-440 working fuel assemblies. Lead working fuel assemblies equipped with anti-debris filters have been loaded in the core of Kola-2 NPP. The results obtained can be used for making the decision concerning the application of anti-debris filter for WWER-440 working fuel assemblies with the purpose of enhancing their debris-resistance properties. (authors)

31 CFR 535.440 - Commercially reasonable interest rates.

Science.gov (United States)

2010-07-01

... Interpretations § 535.440 Commercially reasonable interest rates. (a) For purposes of §§ 535.212 and 535.213, what... transferred as, or as part of, the interest at “commercially reasonable rates” required to be transferred... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Commercially reasonable interest...

Design study on steam generator integration into the VVER reactor pressure vessel

International Nuclear Information System (INIS)

Hort, J.; Matal, O.

2004-01-01

The primary circuit of VVER (PWR) units is arranged into loops where the heat generated by the reactor is removed by means of main circulating pumps, loop pipelines and steam generators, all located outside the reactor pressure vessel. If the primary circuit and reactor core were integrated into one pressure vessel, as proposed, e.g., within the IRIS project (WEC), a LOCA situation would be limited by the reactor pressure vessel integrity only. The aim of this design study regarding the integration of the steam generator into the reactor pressure vessel was to identify the feasibility limits and some issues. Fuel elements and the reactor pressure vessel as used in the Temelin NPP were considered for the analysis. From among the variants analyzed, the variant with steam generators located above the core and vertically oriented circulating pumps at the RPV lower bottom seems to be very promising for future applications

Probabilistic assessment of Juragua Nuclear Power Plant response under station blackout conditions

International Nuclear Information System (INIS)

Valhuerdi, C.; Vilaragut, J.J.; Perdomo, M.; Torres, A.

1995-01-01

The preliminary results concerning the response of station blackout are shown in this paper. These results have been obtained in the framework of initiator lass of external electrical supply as a aport of the revision o of the current probabilistic safety analysis. The work is also based on the results reported in the thermohydraulic calculations of VVER 440 plants responses under these conditions and the experience of this type of notified incidents. Finally, a comparative analysis with the results obtained for other reactor technologies is presented

Application of the REMIX thermal mixing calculation program for the Loviisa reactor

International Nuclear Information System (INIS)

Kokkonen, I.; Tuomisto, H.

1987-08-01

The REMIX computer program has been validated to be used in the pressurized thermal shock study of the Loviisa reactor pressure vessel. The program has been verified against the data from the thermal and fluid mixing experiments. These experiments have been carried out in Imatran voima Oy to study thermal mixing of the high-pressure safety injection water in the Loviisa VVER-440 type pressurized water reactor. The verified REMIX-versions were applied to reactor calculations in the probabilistic pressurized thermal shock study of the Loviisa Plant

42 CFR 440.10 - Inpatient hospital services, other than services in an institution for mental diseases.

Science.gov (United States)

2010-10-01

... an institution for mental diseases. 440.10 Section 440.10 Public Health CENTERS FOR MEDICARE... for mental diseases. (a) Inpatient hospital services means services that— (1) Are ordinarily furnished... and treatment of patients with disorders other than mental diseases; (ii) Is licensed or formally...

Studies on the assessment and validation of reactor dynamics models used in Finland

International Nuclear Information System (INIS)

Vanttola, T.

1993-10-01

Two reactor dynamics related computer codes of the calculation system at the Technical Research Centre of Finland have been assessed. The codes TRAB and SMATRA, have been examined from two points of view. First, models of some critical phenomena determining the worst fuel rod conditions during reactor transients have been evaluated on the basis of experimental information. Second, the the overall behaviour of the codes describing the dynamics of the reactor core and its cooling system has been studied on the basis of simulation of real transients and of performed safety analyses of selected accidents. The emphasis is on the VVER-440 reactors, but the generality of the methods has been demonstrated by showing that the key phenomena of the Chernobyl accident can be reproduced and analysed using the same calculation system. In the study the separate phenomena examined are single- and two-phase friction, post DNB heat transfer and critical heat flux in the VVER rod bundle. (60 refs., 11 figs., 4 tabs.)

Current state of spent fuel management in the Russian Federation

International Nuclear Information System (INIS)

Makarchuk, T.F.; Spichev, V.V.; Tikhonov, N.S.; Simanovsky, V.M.; Tokarenko, A.I.; Bespalov, V.N.

1998-01-01

Twenty nine power units of nine nuclear power plants of total installed capacity 22 GW(e) are now in operation in the Russian Federation. They produce approximately 12% of electric power in the country. The annual spent fuel arising is about 790 tU. The spent fuel from VVER-440 and BN-600 is reprocessed at the RT-1 plant near Chelyabinsk. The VVER-1000 spent fuel is planned to be reprocessed at the reprocessing plant RT-2 which is under construction near Krasnoyarsk. The RBMK-1000 spent fuel is not reprocessed because of its low fissile content. It is meant to be stored in intermediate storage facilities at the NPP sites and in a centralized storage facility during a period not less than 50 years and then to be disposed of in geological formations. State of the art of spent fuel reprocessing, storage and transportation is considered in the paper. Problems of nuclear fuel cycle back-end in Russia are taken into account. (author)

Bulgaria: INIS Center - 45 years experience

International Nuclear Information System (INIS)

Georgieva, Albena

2015-01-01

Bulgaria is one of 35 countries in the world operating nuclear power plants. Bulgaria's nuclear program was launched in 1956 with the construction of an IRT-2000 research reactor at the Institute for Nuclear Research and Nuclear Energy (INRNE), which was commissioned in 1961. The reactor is now under reconstruction. In 1960, construction of the first Bulgarian nuclear power plant started. At the moment, there are 6 power units at the Kozloduy NPP site; 4 of them (VVER-440/B-230) under decommissioning and 2 (VVER-1000/B-320) in operation. Several storage facilities for radioactive waste, mainly from the Kozloduy NPP and from various sources of ionizing radiation in medicine and industry are also in operation. The Kozloduy NPP, INRNE, Sofia University, the Technical University, and the State Enterprise Radioactive Waste are the main generators of nuclear information in Bulgaria and the main consumers of INIS products. The Bulgarian INIS Center, therefore, maintains continuous and effective cooperation with these Institutions

The influence of changes in the VVER-1000 fuel assembly shape during operation on the power density distribution

Energy Technology Data Exchange (ETDEWEB)

Shishkov, L. K., E-mail: Shishkov-LK@nrcki.ru; Gorodkov, S. S.; Mikailov, E. F.; Sukhino-Homenko, E. A.; Sumarokova, A. S., E-mail: Sumarokova-AS@nrcki.ru [National Research Center Kurchatov Institute (Russian Federation)

2016-12-15

A new approach to calculation of the coefficients of sensitivity of the fuel pin power to deviations in gap sizes between fuel assemblies of the VVER-1000 reactor during its operation is proposed. It is shown that the calculations by the MCU code should be performed for a full-size model of the core to take the interference of the gap influence into account. In order to reduce the conservatism of calculations, the coolant density and coolant temperature feedbacks should be taken into account, as well as the fuel burnup.

Power peak in vicinity of WWER-440 control rod

International Nuclear Information System (INIS)

Mikus, J.

2003-01-01

The measurements of axial power (fission density) distribution have been performed by means of gamma activity determination (gamma scanning method) of the irradiated fuel pins detecting gamma quanta in the La peak area - 1596.5 keV of their selected parts having 20 mm length in the axial coordinates range 50-950 mm with a 10 mm step using a rectangular collimator (dimensions 20x10 mm). Two NaI(Tl) scintillation crystals (one as a monitor) with diameter of 40 mm were used, each of them in Pb shielding (thickness 150 mm). The obtained results enlarge the available 'power peaking database' and enable validation of the codes also in important case of zero-boron concentration that corresponds to the end of WWER-440 fuel cycle. This validation can improve the reliability of the calculation results of the power distribution in WWER-440 cores, re-loading schemes etc

Seismic assessment and upgrading of nuclear power plants in Eastern Europe

Energy Technology Data Exchange (ETDEWEB)

Katona, T; Kostov, M

1997-03-01

The basic findings of the seismic re-qualification programmes going on recently at all VVER plants in Eastern Europe can be summarised. The problems of the seismic safety have to be solved taking into account the general concept of the nuclear safety enhancement of the units. There are cases where the system improvements lead to better and more effective solution of the problem than the structural upgrading. The equipment and piping of the primary system have sufficient capacity. The viscous dampers are considered usually for the upgrading. The equipment anchorage especially the electrical and I and C equipment anchorage have to be upgraded. There are general consideration for replacement of the hydraulic snubbers by viscous dampers in the primary circuit of the VVER 440/V230. The considerations are not only because of the better seismic behaviour but mainly because of the better operational performance. There is relatively good seismic instrumentation at the plants considered. The definition of the scram level of the units not designed for an OBE is an essential problem. More effort needed for the definition of this level on the basis of re-evaluation experience of the plant equipment and after the proper definition of post-earthquake activities. The seismic re-evaluation and re-qualification of the VVER units is a general safety issue in Easter European countries. This rather complex problem can be solved adopting the experience, methods and requirements of western countries and taking into account the design features of the VVER units as well as the as built and as it is conditions. (J.P.N.)

Seismic assessment and upgrading of nuclear power plants in Eastern Europe

International Nuclear Information System (INIS)

Katona, T.; Kostov, M.

1997-01-01

The basic findings of the seismic re-qualification programmes going on recently at all VVER plants in Eastern Europe can be summarised. The problems of the seismic safety have to be solved taking into account the general concept of the nuclear safety enhancement of the units. There are cases where the system improvements lead to better and more effective solution of the problem than the structural upgrading. The equipment and piping of the primary system have sufficient capacity. The viscous dampers are considered usually for the upgrading. The equipment anchorage especially the electrical and I and C equipment anchorage have to be upgraded. There are general consideration for replacement of the hydraulic snubbers by viscous dampers in the primary circuit of the VVER 440/V230. The considerations are not only because of the better seismic behaviour but mainly because of the better operational performance. There is relatively good seismic instrumentation at the plants considered. The definition of the scram level of the units not designed for an OBE is an essential problem. More effort needed for the definition of this level on the basis of re-evaluation experience of the plant equipment and after the proper definition of post-earthquake activities. The seismic re-evaluation and re-qualification of the VVER units is a general safety issue in Easter European countries. This rather complex problem can be solved adopting the experience, methods and requirements of western countries and taking into account the design features of the VVER units as well as the as built and as it is conditions. (J.P.N.)

Ranking of safety issues for WWER-440 model 230 nuclear power plants

International Nuclear Information System (INIS)

1992-02-01

In response to requests from Member States operating Soviet designed WWER-440/230 nuclear power plants (NPPs) for assistance through the IAEA's nuclear safety services, a major international project was established to evaluate these first generation reactors as a complement to relevant ongoing national, bilateral and multilateral activities. The objective is to assist countries operating WWER-440/230 NPPs in performing comprehensive safety reviews aimed at identifying design and operational weaknesses. The scope of the project includes a review of the conceptual design of WWER-440/230 NPPs, safety review missions to each one of the operating reactors to review design and operational aspects and studies to resolve issues of generic safety concern. This report was prepared by a group of international experts and the IAEA staff and discussed by the Project Steering Committee, December 9-13, 1991 in Vienna. An overview of the safety issues identified is presented indicating their effect on the performance of the basic safety functions. Conceptual recommendations related to design issues are given as a technical basis for the safety modifications required

Insights from the U.S. department of Energy plant safety evaluation program of VVER and RBMK reactors

International Nuclear Information System (INIS)

Petri, M.C.; Binder, J.L.; Pasedag, W.F.

2001-01-01

Throughout the years 1990 the U.S. Department of Energy has worked build capability in countries of the former Soviet Union to assess the safety of their VVER and RBMK reactors. Through this Plant Safety Evaluation Program, deterministic and probabilistic analyses have been used to provide a documented plant risk profile to support safe plant operation and to set priorities for safety upgrades. Work has been sponsored at thirteen nuclear power plant sites in eight countries. The Plant Safety Evaluation Program has resulted in immediate and long-term safety benefits for the Soviet-designed nuclear plants. (author)

Several perspectives on water-chemical cycles for nuclear power stations equipped with type VVER and RBMK reactors

International Nuclear Information System (INIS)

Mamet, A.P.; Mamet, V.A.; Pashevich, V.I.; Nazarenko, P.N.

1982-01-01

Water-chemical cycles for loops I and II of VVER reactors are discussed. These cycles are mixed ammonia-sodium with a variable concentration of boric acid and ammonia hydrazine with a pH factor of 9.1 +/- 0.1. New water-chemical cycles are considered for use in both existing and new nuclear power plants. Application of these new water-chemical cycles showed produce a significant improvement in operating conditions of nuclear power plants. Upon accumulation of sufficient operating experience with these cycles, it should be possible to raise the issue of revising applicable standard documentation

AER Working Group D on VVER safety analysis - report of the 2009 meeting

International Nuclear Information System (INIS)

Kliem, S.

2009-01-01

The AER Working Group D on VVER reactor safety analysis held its 18-th meeting in Rez, Czech Republic, during the period 18-19 May, 2009. The meeting was hosted by the Nuclear Research Institute Rez. Altogether 17 participants attended the meeting of the working group D, 16 from AER member organizations and 1 guest from a non-member organization. The co-ordinator of the working group, S. Kliem, served as chairman of the meeting. The meeting started with a general information exchange about the recent activities in the participating organizations. The given presentations and the discussions can be attributed to the following topics: 1) Code validation and benchmarking; 2) Safety analysis and code developments; 3) Reactor pressure vessel thermal hydraulics; 4) Future activities including discussion on the participation in the OECD/NEA Benchmark for the Kalinin-3 NPP

20 CFR 661.440 - What limitations apply to the State's Workforce Flexibility Plan authority under WIA?

Science.gov (United States)

2010-04-01

... limitations apply to the State's Workforce Flexibility Plan authority under WIA? (a)(1) Under work-flex waiver... flexibility plan. Once approved, a State's work-flex designation is conditioned on the State demonstrating it... Workforce Flexibility Plan authority under WIA? 661.440 Section 661.440 Employees' Benefits EMPLOYMENT AND...

WWER-440 type reactor core

International Nuclear Information System (INIS)

Mizov, J.; Svec, P.; Rajci, T.

1987-01-01

Assemblies with patly spent fuel of enrichment within 5 and 36 MWd/kg U or lower than the maximum enrichment of freshly charged fuel are placed in at least one of the peripheral positions of each hexagonal sector of the WWER-440 reactor type core. This increases fuel availability and reduces the integral neutron dose to the reactor vessel. The duration is extended of the reactor campaign and/or the mean fuel enrichment necessary for the required duration of the period between refuellings is reduced. Thus, fuel costs are reduced by 1 up to 3%. The results obtained in the experiment are tabulated. (J.B.). 1 fig., 3 tabs

Coolant mixing in pressurized water reactors. Proceedings

International Nuclear Information System (INIS)

Hoehne, T.; Grunwald, G.; Rohde, U.

1998-10-01

For the analysis of boron dilution transients and main steam like break scenarios the modelling of the coolant mixing inside the reactor vessel is important. The reactivity insertion due to overcooling or deboration depends strongly on the coolant temperature and boron concentration. The three-dimensional flow distribution in the downcomer and the lower plenum of PWR's was calculated with a computational fluid dynamics (CFD) code (CFX-4). Calculations were performed for the PWR's of SIEMENS KWU, Westinghouse and VVER-440 / V-230 type. The following important factors were identified: exact representation of the cold leg inlet region (bend radii etc.), extension of the downcomer below the inlet region at the PWR Konvoi, obstruction of the flow by the outlet nozzles penetrating the downcomer, etc. The k-ε turbulence model was used. Construction elements like perforated plates in the lower plenum have large influence on the velocity field. It is impossible to model all the orifices in the perforated plates. A porous region model was used to simulate perforated plates and the core. The porous medium is added with additional body forces to simulate the pressure drop through perforated plates in the VVER-440. For the PWR Konvoi the whole core was modelled with porous media parameters. The velocity fields of the PWR Konvoi calculated for the case of operation of all four main circulation pumps show a good agreement with experimental results. The CFD-calculation especially confirms the back flow areas below the inlet nozzles. The downcomer flow of the Russian VVER-440 has no recirculation areas under normal operation conditions. By CFD calculations for the downcomer and the lower plenum an analytical mixing model used in the reactor dynamic code DYN3D was verified. The measurements, the analytical model and the CFD-calculations provided very well agreeing results particularly for the inlet region. The difficulties of analytical solutions and the uncertainties of turbulence

Study, analysis, assess and compare the nuclear engineering systems of nuclear power plant with different reactor types VVER-1000, namely AES-91, AES-92 and AES-2006

International Nuclear Information System (INIS)

Le Van Hong; Tran Chi Thanh; Hoang Minh Giang; Le Dai Dien; Nguyen Nhi Dien; Nguyen Minh Tuan

2015-01-01

On November 25, 2009, in Hanoi, the National Assembly had been approved the resolution about policy for investment of nuclear power project in Ninh Thuan province which include two sites, each site has two units with power around 1000 MWe. For the nuclear power project at Ninh Thuan 1, Vietnam Government signed the Joint-Governmental Agreement with Russian Government for building the nuclear power plant with reactor type VVER. At present time, the Russian Consultant proposed four reactor technologies can be used for Ninh Thuan 1 project, namely: AES-91, AES-92, AES-2006/V491 and AES-2006/V392M. This report presents the main reactor engineering systems of nuclear power plants with VVER-1000/1200. The results from analysis, comparison and assessment between the designs of AES-91, AES-92 and AES-2006 are also presented. The obtained results show that the type AES-2006 is appropriate selection for Vietnam. (author)

Investigation on accident management measures for VVER-1000 reactors

International Nuclear Information System (INIS)

Tusheva, P.; Schaefer, F.; Rohde, U.; Reinke, N.

2009-01-01

A consequence of a total loss of AC power supply (station blackout) leading to unavailability of major active safety systems which could not perform their safety functions is that the safety criteria ensuring a secure operation of the nuclear power plant would be violated and a consequent core heat-up with possible core degradation would occur. Currently, a study which examines the thermal-hydraulic behaviour of the plant during the early phase of the scenario is being performed. This paper focuses on the possibilities for delay or mitigation of the accident sequence to progress into a severe one by applying Accident Management Measures (AMM). The strategy 'Primary circuit depressurization' as a basic strategy, which is realized in the management of severe accidents is being investigated. By reducing the load over the vessel under severe accident conditions, prerequisites for maintaining the integrity of the primary circuit are being created. The time-margins for operators' intervention as key issues are being also assessed. The task is accomplished by applying the GRS thermal-hydraulic system code ATHLET. In addition, a comparative analysis of the accident progression for a station blackout event for both a reference German PWR and a reference VVER-1000, taking into account the plant specifics, is being performed. (authors)

Regeneration and localization of radioactive waste in the nuclear fuel cycle

International Nuclear Information System (INIS)

Egorov, N.N.; Kudryavtsev, E.G.; Nikipelov, B.V.; Polyakov, A.S.; Zakharkin, B.S.; Mamaev, L.A.

1993-01-01

Normal functioning of the nuclear-power industry is only possible with a closed fuel cycle, including regeneration of the spent fuel from atomic power plants, the production and recycling of the secondary fuel, and localization of the radioactive waste. Despite the diversity of contemporary attitudes toward the structure of the nuclear fuel cycle around the world, the closure of the fuel cycle has been fundamental to the atomic-power industry in the USSR since the very beginning, and has taken on even greater significance in Russia today. From the beginning, the idea of a closed fuel cycle has been based essentially on one fundamental criterion: the concept of expanded productivity on the basis of fuel regeneration, i.e., the economic factor. Important as economic factors are, safety issues have taken on great significance in recent years: not only power-station reactors but all the ancillary stages of the fuel cycle must meet fundamentally new reliability, safety, and environmental hazards. The RT-1 plant is a versatile operation, regenerating spent fuel from VVER-440, BN-350, and BN-600 reactors, nuclear icebreakers and submarines, research reactors, and other power units. The plant can reprocess 400 ton/year of basic VVER-440 fuel. World-class modern processes have been introduced at the plant, meeting the necessary quality standards: zonal planning, remote operation to eliminate direct contact of the staff with radioactive material, extensive monitoring and control systems, multistage gas-purification systems, and new waste-treatment methods

42 CFR 440.180 - Home or community-based services.

Science.gov (United States)

2010-10-01

...) If the recipients are compensated, they are compensated at less than 50 percent of the minimum wage... or above the minimum wage is unlikely and who, because of their disabilities, need intensive ongoing... SERVICES (CONTINUED) MEDICAL ASSISTANCE PROGRAMS SERVICES: GENERAL PROVISIONS Definitions § 440.180 Home or...

Basket criticality design of a dual purpose cask for VVER 1000 spent fuel assemblies

Energy Technology Data Exchange (ETDEWEB)

Rezaeian, Mahdi [Nuclear Science and Technology Research Institute, Tehran (Iran, Islamic Republic of); Kamali, Jamshid [Atomic Energy Organization of Iran (AEOI), Tehran (Iran, Islamic Republic of)

2016-12-15

Dual purpose cask technology is one of the most prominent options for interim storage of spent fuels following their removal from reactors. Criticality safety of the spent fuel assemblies are ensured by design of the basket within these casks. In this study, a set of criticality design calculations of a dual purpose cask for 12 VVER 1000 spent fuel assemblies of Bushehr nuclear power plant were carried out. The basket material of borated stainless steel with 0.5 to 2.5 wt% of boron and Boral (Al-B{sub 4}C) with 1.5 to 40 wt% of boron carbide, were investigated and the minimum required receptacle pitch of the basket was determined. Using the calculated receptacle pitch of the basket, the minimum required diameter of the cavity could be established.