WorldWideScience

Sample records for conventional pra methods

  1. Summary of PRA assessment of transient accident risks, human factors considerations, and PRA methods and applications

    International Nuclear Information System (INIS)

    Carnino, A.

    1984-01-01

    This chapter reviews the progress made in the probabilistic risk assessment (PRA) area to help in solving operational transient problems and to integrate human factors considerations, as discussed at the American Nuclear Society Topical Meeting on Anticipated and Abnormal Plant Transients in Light Water Reactors. Topics considered include core-melt frequency, external events (e.g., fires, floods), diagnostic errors, and operator aids. It is concluded that confidence in PRA results, predictions and uses for decisions in both the safety of the plants and their availability will improve

  2. Reliability design of a critical facility: An application of PRA methods

    International Nuclear Information System (INIS)

    Souza Vieira Neto, A.; Souza Borges, W. de

    1987-01-01

    Although a general agreement concerning the enforcement of reliability (probabilistic) design criteria for nuclear utilities is yet to be achieved. PRA methodology can still be used successfully as a project design and review tool, aimed at improving system's prospective performance or minimizing expected accident consequences. In this paper, the potential of such an application of PRA methods is examined in the special case of a critical design project currently being developed in Brazil. (orig.)

  3. Applicability of PRA methods and data to the financial risk assessment of nuclear power plants

    International Nuclear Information System (INIS)

    El-Sheik, K.A.

    1985-01-01

    Financial risk assessment, where the probability and severity of financial consequences are estimated, offers a logical framework for organizing and evaluating data pertinent to nuclear power plant accidents. Under the sponsorship of the Electric Power Research Institute, General Electric investigated the feasibility of financial risk assessment of nuclear power plants and of applying PRA methods and data in such an assessment. This paper summarizes the main findings of this investigation. Specifically, the paper discussed the following topics: definition of financial consequences and financial risk; overall approach for financial risk assessment and how it compares with the approach for PRA used in the Reactor Safety Study; and specific financial risk assessment procedures for defining initiating events, plant response sequences, institutional scenarios, and financial consequences and how they compare to analogous procedures for PRA

  4. Improvement of human reliability analysis method for PRA

    International Nuclear Information System (INIS)

    Tanji, Junichi; Fujimoto, Haruo

    2013-09-01

    It is required to refine human reliability analysis (HRA) method by, for example, incorporating consideration for the cognitive process of operator into the evaluation of diagnosis errors and decision-making errors, as a part of the development and improvement of methods used in probabilistic risk assessments (PRAs). JNES has been developed a HRA method based on ATHENA which is suitable to handle the structured relationship among diagnosis errors, decision-making errors and operator cognition process. This report summarizes outcomes obtained from the improvement of HRA method, in which enhancement to evaluate how the plant degraded condition affects operator cognitive process and to evaluate human error probabilities (HEPs) which correspond to the contents of operator tasks is made. In addition, this report describes the results of case studies on the representative accident sequences to investigate the applicability of HRA method developed. HEPs of the same accident sequences are also estimated using THERP method, which is most popularly used HRA method, and comparisons of the results obtained using these two methods are made to depict the differences of these methods and issues to be solved. Important conclusions obtained are as follows: (1) Improvement of HRA method using operator cognitive action model. Clarification of factors to be considered in the evaluation of human errors, incorporation of degraded plant safety condition into HRA and investigation of HEPs which are affected by the contents of operator tasks were made to improve the HRA method which can integrate operator cognitive action model into ATHENA method. In addition, the detail of procedures of the improved method was delineated in the form of flowchart. (2) Case studies and comparison with the results evaluated by THERP method. Four operator actions modeled in the PRAs of representative BWR5 and 4-loop PWR plants were selected and evaluated as case studies. These cases were also evaluated using

  5. Validation needs of seismic probabilistic risk assessment (PRA) methods applied to nuclear power plants

    International Nuclear Information System (INIS)

    Kot, C.A.; Srinivasan, M.G.; Hsieh, B.J.

    1985-01-01

    An effort to validate seismic PRA methods is in progress. The work concentrates on the validation of plant response and fragility estimates through the use of test data and information from actual earthquake experience. Validation needs have been identified in the areas of soil-structure interaction, structural response and capacity, and equipment fragility. Of particular concern is the adequacy of linear methodology to predict nonlinear behavior. While many questions can be resolved through the judicious use of dynamic test data, other aspects can only be validated by means of input and response measurements during actual earthquakes. A number of past, ongoing, and planned testing programs which can provide useful validation data have been identified, and validation approaches for specific problems are being formulated

  6. Linkage of PRA models. Phase 1, Results

    Energy Technology Data Exchange (ETDEWEB)

    Smith, C.L.; Knudsen, J.K.; Kelly, D.L.

    1995-12-01

    The goal of the Phase I work of the ``Linkage of PRA Models`` project was to postulate methods of providing guidance for US Nuclear Regulator Commission (NRC) personnel on the selection and usage of probabilistic risk assessment (PRA) models that are best suited to the analysis they are performing. In particular, methods and associated features are provided for (a) the selection of an appropriate PRA model for a particular analysis, (b) complementary evaluation tools for the analysis, and (c) a PRA model cross-referencing method. As part of this work, three areas adjoining ``linking`` analyses to PRA models were investigated: (a) the PRA models that are currently available, (b) the various types of analyses that are performed within the NRC, and (c) the difficulty in trying to provide a ``generic`` classification scheme to groups plants based upon a particular plant attribute.

  7. Linkage of PRA models. Phase 1, Results

    International Nuclear Information System (INIS)

    Smith, C.L.; Knudsen, J.K.; Kelly, D.L.

    1995-12-01

    The goal of the Phase I work of the ''Linkage of PRA Models'' project was to postulate methods of providing guidance for US Nuclear Regulator Commission (NRC) personnel on the selection and usage of probabilistic risk assessment (PRA) models that are best suited to the analysis they are performing. In particular, methods and associated features are provided for (a) the selection of an appropriate PRA model for a particular analysis, (b) complementary evaluation tools for the analysis, and (c) a PRA model cross-referencing method. As part of this work, three areas adjoining ''linking'' analyses to PRA models were investigated: (a) the PRA models that are currently available, (b) the various types of analyses that are performed within the NRC, and (c) the difficulty in trying to provide a ''generic'' classification scheme to groups plants based upon a particular plant attribute

  8. PRA and Risk Informed Analysis

    International Nuclear Information System (INIS)

    Bernsen, Sidney A.; Simonen, Fredric A.; Balkey, Kenneth R.

    2006-01-01

    The Boiler and Pressure Vessel Code (BPVC) of the American Society of Mechanical Engineers (ASME) has introduced a risk based approach into Section XI that covers Rules for Inservice Inspection of Nuclear Power Plant Components. The risk based approach requires application of the probabilistic risk assessments (PRA). Because no industry consensus standard existed for PRAs, ASME has developed a standard to evaluate the quality level of an available PRA needed to support a given risk based application. The paper describes the PRA standard, Section XI application of PRAs, and plans for broader applications of PRAs to other ASME nuclear codes and standards. The paper addresses several specific topics of interest to Section XI. Important consideration are special methods (surrogate components) used to overcome the lack of PRA treatments of passive components in PRAs. The approach allows calculations of conditional core damage probabilities both for component failures that cause initiating events and failures in standby systems that decrease the availability of these systems. The paper relates the explicit risk based methods of the new Section XI code cases to the implicit consideration of risk used in the development of Section XI. Other topics include the needed interactions of ISI engineers, plant operating staff, PRA specialists, and members of expert panels that review the risk based programs

  9. Standardized procedure for tsunami PRA by AESJ

    International Nuclear Information System (INIS)

    Kirimoto, Yukihiro; Yamaguchi, Akira; Ebisawa, Katsumi

    2013-01-01

    After Fukushima Accident (March 11, 2011), the Atomic Energy Society of Japan (AESJ) started to develop the standard of Tsunami Probabilistic Risk Assessment (PRA) for nuclear power plants in May 2011. As Japan is one of the countries with frequent earthquakes, a great deal of efforts has been made in the field of seismic research since the early stage. To our regret, the PRA procedures guide for tsunami has not yet been developed although the importance is held in mind of the PRA community. Accordingly, AESJ established a standard to specify the standardized procedure for tsunami PRA considering the results of investigation into the concept, the requirements that should have and the concrete methods regarding tsunami PRA referring the opinions of experts in the associated fields in December 2011 (AESJ-SC-RK004:2011). (author)

  10. Espaços livres em praças inglesas do século XVII: o caso de Convent Garden

    Directory of Open Access Journals (Sweden)

    Maria Fernanda Derntl

    2006-12-01

    Full Text Available Covent Garden é considerada uma experiência modelar entre as primeiras transformações no espaço urbano ainda de aparência medieval de Londres no século XVII. A partir da iconografia da época e das indicações da bibliografia pertinente, procura-se apresentar uma análise abrangente da configuração formal dessa praça. Destaca-se a existência de diferentes tipos de espaços livres contribuindo para determinar seu desenho: além do espaço central, também fizeram parte da praça o pátio da igreja de St. Paul, a oeste e os jardins da mansão Bedford, ao sul. Conclui-se que o desenho apresentado por Covent Garden não era completamente regular ou simétrico e teria sido bem diferente das squares londrinas dos séculos XVII e XVIII.

  11. Conventional laboratory methods for cyanotoxins.

    Science.gov (United States)

    Lawton, Linda A; Edwards, C

    2008-01-01

    It is clear from the literature that numerous methods are available for most cyanotoxins, although many publications on monitoring data indicate that the favored approach is the use proven, robust methods for individual toxins. The most effective approach is the utilization of a robust rapid screen, where positive samples are followed up by qualitative and quantitative analysis to provide the essential decision making data needed for successful management strategies (Fig. 2). Currently, rapid screens are available for microcystins, saxitoxins and anatoxin-a(s), whilst optimisation and validation is needed, many publications report good correlation with the mouse bioassay and HPLC. There is an urgent need for rapid, simple, and inexpensive assays for cylindrospermopsins, anatoxin-a and BMAA. Although methods exist for analysis of BMAA, the fact that a recent study showed 95% of cyanobacteria producing this, some at levels > 6,000 microg g(-1) dry wt, is of concern and rapid screening followed by robust analysis needed. An ideal approach would be a single method capable of extracting and detecting all cyanotoxins. Several publications describe such approaches using LC-MS, but as expected from a group of compounds with diverse chemistry, there are obvious limitations in recoveries during sample processing, chromatographic performance and sensitivity (Dahlmann et al. 2003, Dell'Aversano et al. 2004, Pietsch et al. 2001). Selection of methods must be based on the application requirements, equipment available and cost. For many organisations it may be more cost effective to out-source the occasional analysis. However, as the incidence of blooms appears to be increasing, the need for more rigorous monitoring is needed, sensible investment is needed to meet recommended guidelines. Most of the methods discussed in this paper are suitable for achieving this goal, although clean-up and concentration is usually necessary for physicochemical methods.

  12. Insights into PRA methodologies

    International Nuclear Information System (INIS)

    Gallagher, D.; Lofgren, E.; Atefi, B.; Liner, R.; Blond, R.; Amico, P.

    1984-08-01

    Probabilistic Risk Assessments (PRAs) for six nuclear power plants were examined to gain insight into how the choice of analytical methods can affect the results of PRAs. The PRA sreflectope considered was limited to internally initiated accidents sequences through core melt. For twenty methodological topic areas, a baseline or minimal methodology was specified. The choice of methods for each topic in the six PRAs was characterized in terms of the incremental level of effort above the baseline. A higher level of effort generally reflects a higher level of detail or a higher degree of sophistication in the analytical approach to a particular topic area. The impact on results was measured in terms of how additional effort beyond the baseline level changed the relative importance and ordering of dominant accident sequences compared to what would have been observed had methods corresponding to the baseline level of effort been employed. This measure of impact is a more useful indicator of how methods affect perceptions of plant vulnerabilities than changes in core melt frequency would be. However, the change in core melt frequency was used as a secondary measure of impact for nine topics where availability of information permitted. Results are presented primarily in the form of effort-impact matrices for each of the twenty topic areas. A suggested effort-impact profile for future PRAs is presented

  13. Recovery actions in PRA [probabilistic risk assessment] for the Risk Methods Integration and Evaluation Program (RMIEP): Volume 1, Development of the data-based method

    International Nuclear Information System (INIS)

    Weston, L.M.; Whitehead, D.W.; Graves, N.L.

    1987-06-01

    In a probabilistic risk assessment (PRA) for a nuclear power plant, the analyst identifies a set of potential core damage events consisting of equipment failures and human errors and their estimated probabilities of occurrence. If operator recovery from an event within some specified time is considered, then the probability of this recovery can be included in the PRA. This report provides PRA analysts with an improved methodology for including recovery actions in a PRA. A recovery action can be divided into two distinct phases: a Diagnosis Phase (realizing that there is a problem with a critical parameter and deciding upon the correct course of action) and an Action Phase (physically accomplishing the required action). In this methodology, simulator data are used to estimate recovery probabilities for the diagnosis phase. Different time-reliability curves showing the probability of failure of diagnosis as a function of time from the compelling cue for the event are presented. These curves are based on simulator exercises, and the actions are grouped based upon their operational similarities. This is an improvement over existing diagnosis models that rely greatly upon subjective judgment to obtain such estimates. The action phase is modeled using estimates from available sources. The methodology also includes a recommendation on where and when to apply the recovery action in the PRA process

  14. Fuzzy logic control to be conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Eker, Ilyas [University of Gaziantep, Gaziantep (Turkey). Department of Electrical and Electronic Engineering; Torun, Yunis [University of Gaziantep, Gaziantep (Turkey). Technical Vocational School of Higher Education

    2006-03-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system. (author)

  15. Fuzzy logic control to be conventional method

    International Nuclear Information System (INIS)

    Eker, Ilyas; Torun, Yunis

    2006-01-01

    Increasing demands for flexibility and fast reactions in modern process operation and production methods result in nonlinear system behaviour of partly unknown systems, and this necessitates application of alternative control methods to meet the demands. Fuzzy logic (FL) control can play an important role because knowledge based design rules can easily be implemented in systems with unknown structure, and it is going to be a conventional control method since the control design strategy is simple and practical and is based on linguistic information. Computational complexity is not a limitation any more because the computing power of computers has been significantly improved even for high speed industrial applications. This makes FL control an important alternative method to the conventional PID control method for use in nonlinear industrial systems. This paper presents a practical implementation of the FL control to an electrical drive system. Such drive systems used in industry are composed of masses moving under the action of position and velocity dependent forces. These forces exhibit nonlinear behaviour. For a multi-mass drive system, the nonlinearities, like Coulomb friction and dead zone, significantly influence the operation of the systems. The proposed FL control configuration is based on speed error and change of speed error. The feasibility and effectiveness of the control method are experimentally demonstrated. The results obtained from conventional FL control, fuzzy PID and adaptive FL control are compared with traditional PID control for the dynamic responses of the closed loop drive system

  16. Individual plant examination and future PRA applications

    International Nuclear Information System (INIS)

    Monty, B.S.; Sursock, J.P.; Thierry, R.J.

    1992-01-01

    PRA is being used in many areas of plant operation as has been demonstrated in previous studies. With the U.S. NRC's emphasis on the use of risk to identify plant vulnerabilities and the development of plant specific PRA models for all plants, it is expected that the use of PRA will be expanded. Key areas where this is expected to occur include the development of risk-based Technical Specifications, risk management, and risk-centered maintenance programs. This paper focuses on the Individual Plant Examination requirement and the possible uses of risk-based methods in controlling plant operation to enhance plant safety and availability, and how the IPE requirement will potentially further this area of development. (orig./DG)

  17. A desktop PRA

    International Nuclear Information System (INIS)

    Dolan, B.J.; Weber, B.J.

    1989-01-01

    This paper reports that Duke Power Company has completed full-scope PRAs for each of its nuclear stations - Oconee, McGuire and Catawba. These living PRAs are being maintained using desktop personal computers. Duke's PRA group now has powerful personal computer-based tools that have both decreased direct costs (computer analysis expenses) and increased group efficiency (less time to perform analyses). The shorter turnaround time has already resulted in direct savings through analyses provided in support of justification for continued station operation. Such savings are expected to continue with similar future support

  18. PRA quality and use

    International Nuclear Information System (INIS)

    Okrent, D.; Apostolakis, G.; Whitley, R.; Garrick, B.J.

    1982-10-01

    This report deals with several inter-related aspects of probabilistic risk assessment. Some prior opinion regarding quality assurance, methodology and questions of peer review are reviewed, followed by comments by the authors on these and related subjects. Problems arising in decision-making by different groups concerning the meaning and validity of a PRA are examined, and the role of performance criteria in helping to achieve consensus is treated. Finally, a general approach to the development of performance criteria for systems and functions by the retrospective comparison of existing PRAs is proposed and examined in a preliminary fashion

  19. PRA and Conceptual Design

    Science.gov (United States)

    DeMott, Diana; Fuqua, Bryan; Wilson, Paul

    2013-01-01

    Once a project obtains approval, decision makers have to consider a variety of alternative paths for completing the project and meeting the project objectives. How decisions are made involves a variety of elements including: cost, experience, current technology, ideologies, politics, future needs and desires, capabilities, manpower, timing, available information, and for many ventures management needs to assess the elements of risk versus reward. The use of high level Probabilistic Risk Assessment (PRA) Models during conceptual design phases provides management with additional information during the decision making process regarding the risk potential for proposed operations and design prototypes. The methodology can be used as a tool to: 1) allow trade studies to compare alternatives based on risk, 2) determine which elements (equipment, process or operational parameters) drives the risk, and 3) provide information to mitigate or eliminate risks early in the conceptual design to lower costs. Creating system models using conceptual design proposals and generic key systems based on what is known today can provide an understanding of the magnitudes of proposed systems and operational risks and facilitates trade study comparisons early in the decision making process. Identifying the "best" way to achieve the desired results is difficult, and generally occurs based on limited information. PRA provides a tool for decision makers to explore how some decisions will affect risk before the project is committed to that path, which can ultimately save time and money.

  20. 77 FR 10576 - Methodology for Low Power/Shutdown Fire PRA

    Science.gov (United States)

    2012-02-22

    ... NUCLEAR REGULATORY COMMISSION [NRC-2011-0295] Methodology for Low Power/Shutdown Fire PRA AGENCY.../Shutdown Fire PRA.'' In response to request from members of the public, the NRC is extending the public... risk assessment (PRA) method for quantitatively analyzing fire risk in commercial nuclear power plants...

  1. 76 FR 81998 - Methodology for Low Power/Shutdown Fire PRA

    Science.gov (United States)

    2011-12-29

    ... NUCLEAR REGULATORY COMMISSION [NRC-2011-0295] Methodology for Low Power/Shutdown Fire PRA AGENCY..., ``Methodology for Low Power/Shutdown Fire PRA--Draft Report for Comment.'' DATES: Submit comments by March 01... risk assessment (PRA) method for quantitatively analyzing fire risk in commercial nuclear power plants...

  2. Hiperurisemia pada Pra Diabetes

    Directory of Open Access Journals (Sweden)

    Ellyza Nasrul

    2012-09-01

    Full Text Available AbstrakAsam urat (AU merupakan produk akhir dari katabolisme adenin dan guanin yang berasal dari pemecahannukleotida purin. Urat dihasilkan oleh sel yang mengandung xanthine oxidase, terutama hepar dan usus kecil.Hiperurisemia adalah keadaan kadar asam urat dalam darah lebih dari 7,0 mg/dL.Pra diabetes adalah subjek yangmempunyai kadar glukosa plasma meningkat akan tetapi peningkatannya masih belum mencapai nilai minimaluntuk kriteria diagnosis diabetes melitus (DM. Glukosa darah puasa terganggu merupakan keadaan dimanapeningkatan kadar FPG≥100 mg/dL dan <126 mg/dL. Toleransi glukosa terganggu merupakan peningkatanglukosa plasma 2 jam setelah pembebanan 75 gram glukosa oral (≥140 mg/dL dan <200mg/dL dengan FPG<126 mg/dL.Insulin juga berperan dalam meningkatkan reabsorpsi asam urat di tubuli proksimal ginjal. Sehinggapada keadaan hiperinsulinemia pada pra diabetes terjadi peningkatan reabsorpsi yang akan menyebabkanhiperurisemia. Transporter urat yang berada di membran apikal tubuli renal dikenal sebagai URAT-1 berperandalam reabsorpsi urat.Kata kunci: Hiperurisemia, Pra DiabetesAbstractUric acid (AU is the end product of the catabolism of adenine and guanine nucleotides derived from thebreakdown of purines. Veins produced by cells containing xanthine oxidase, especially the liver and small intestine.Hyperuricemia is a state in the blood uric acid levels over 7.0 mg / dL.Pre-diabetes is a subject which has a plasmaglucose level will rise but the increase is still not reached the minimum value for the diagnostic criteria for diabetesmellitus (DM. Impaired fasting blood glucose is a condition in which increased levels of FPG ≥ 100 mg / dL and<126 mg / dL. Impaired glucose tolerance is an increase in plasma glucose 2 hours after 75 gram oral glucose load(≥ 140 mg / dL and <200mg/dl with FPG <126 mg / dL.Insulin also plays a role in increasing the reabsorption ofuric acid in renal proximal tubule. So that the hyperinsulinemia in the pre

  3. How the chemical industry can benefit from PRA

    International Nuclear Information System (INIS)

    Guymer, P.; Kaiser, G.D.; Mc Kelvey, T.W.; Hannaman, G.W.

    1986-01-01

    Probabilistic Risk Assessment (PRA) is a method of quantifying the frequency of occurrence and the magnitude of the consequences of accidents in systems that contain hazardous materials such as radioactive fission products, and toxic, flammable or explosive chemicals. The frequency and the magnitude of the consequences are the basic elements of any definition or risk, which is often simply expressed as the product of frequency and magnitude, summed over all accident sequences. PRA is now a mature technique that has been used to estimate risk for a number of industrial facilities. In this paper the author gives examples of beneficial uses of PRA

  4. Non-conventional energy and propulsion methods

    International Nuclear Information System (INIS)

    Valone, T.

    1991-01-01

    From the disaster of the Space Shuttle, Challenger, to the Kuwaiti oil well fires, we are reminded constantly of our dependence on dangerous, combustible fuels for energy and propulsion. Over the past ten years, there has been a considerable production of new and exciting inventions which defy conventional analysis. The term non-conventional was coined in 1980 by a Canadian engineer to designate a separate technical discipline for this type of endeavor. Since then, several conferences have been devoted solely to these inventions. Integrity Research Corp., an affiliate of the Institute, has made an effort to investigate each viable product, develop business plans for several to facilitate development and marketing, and in some cases, assign an engineering student intern to building a working prototype. Each inventor discussed in this presentation has produced a unique device for free energy generation or highly efficient force production. Included in this paper is also a short summary for non-specialists explaining the physics of free energy generation along with a working definition. The main topics of discussion include: space power, inertial propulsion, kinetobaric force, magnetic motors, thermal fluctuations, over-unity hat pumps, ambient temperature superconductivity and nuclear battery

  5. REMOVAL OF URANIUM FROM DRINKING WATER BY CONVENTIONAL TREATMENT METHODS

    Science.gov (United States)

    The USEPA currently does not regulate uranium in drinking water but will be revising the radionuclide regulations during 1989 and will propose a maximum contaminant level for uranium. The paper presents treatment technology information on the effectiveness of conventional method...

  6. Fire PRA requantification studies. Final report

    International Nuclear Information System (INIS)

    Parkinson, W.

    1993-03-01

    This report describes the requantification of two existing fire probabilistic risk assessments (PRAs) using a fire PRA method and data that are being developed by the Electric Power Research Institute (EPRI). The two existing studies are the Seabrook Station Probabilistic Safety Assessment that was made in 1983 and the 1989 NUREG-1150 analysis of the Peach Bottom Plant. Except for the fire methods and data, the original assumptions were used. The results from the requantification show that there were excessive conservatisms in the original studies. The principal reason for a hundredfold reduction in the Peach Bottom core- damage frequency is the determination that no electrical cabinet fire in a switchgear room would damage both offsite power feeds. Past studies often overestimated the heat release from electrical cabinet fires. EPRI's electrical cabinet heat release rates are based on tests that were conducted for Sandia's fire research program. The rates are supported by the experience in the EPRI Fire Events Database for U.S. nuclear plants. Test data and fire event experience also removed excessive conservatisms in the Peach Bottom control and cable spreading rooms, and the Seabrook primary component cooling pump, turbine building relay and cable spreading rooms. The EPRI fire PRA method and data will show that there are excessive conservatisms in studies that were made for many plants and can benefit them accordingly

  7. Review of PRA methodology for LMFBR

    International Nuclear Information System (INIS)

    Yang, J. E.

    1999-02-01

    Probabilistic Risk Assessment (PRA) has been widely used as a tool to evaluate the safety of NPPs (Nuclear Power Plants), which are in the design stage as well as in operation. Recently, PRA becomes one of the licensing requirements for many existing and new NPPs. KALIMER is a Liquid Metal Fast Breeder Reactor (LMFBR) being developed by KAERI. Since the design concept of KALIMER is similar to that of the PRISM plant developed by GE, it would be appropriate to review the PRA methodology of PRISM as the first step of KALIMER PRA. Hence, in this report summarizes the PRA methodology of PRISM plant, and the required works for the PSA of KALIMER based on the reviewed results. The PRA technology of PRISM plant consists of following five major tasks: (1) development of initiating event list, (2) development of system event tree, (3) development of core response event tree, (4) development of containment response event tree, and (5) consequences and risk estimation. The estimated individual and societal risk measures show that the risk from a PRISM module is substantially less than the NRC goal. Each task is compared to the PRA methodology of Light Water Reactor (LWR)/Pressurized Heavy Water Reactor (PHWR). In the report, each task of PRISM PRA methodology is reviewed and compared to the corresponding part of LWR/PHWR PSA performed in Korea. The parts that are not modeled appropriately in PRISM PRA are identified, and the recommendations for KALIMER PRA are stated. (author). 14 refs., 9 tabs., 4 figs

  8. Can we trust PRA?

    Energy Technology Data Exchange (ETDEWEB)

    Epstein, S. [ABS Consulting, Koraku Mori, Building, 1-4-14 Koraku Chome, Bunkyo-ku, Tokyo 112-0004 (Japan)]. E-mail: sepstein@absconsulting.com; Rauzy, A. [Institut de Mathematique de Luminy (IML/CNRS), 163 Avenue de Luminy, Case 907, Marseille, Cedex 913288 (France)]. E-mail: arauzy@iml.univ-mrs.fr

    2005-06-01

    The Fault-Tree/Event-Tree method is widely used in industry as the underlying formalism of probabilistic risk assessment. Almost all of the tools available to assess Event-Tree models implement the 'classical' assessment technique based on minimal cutsets and the rare event approximation. Binary decision diagrams (BDDs) are an alternative approach, but they were up to now limited to medium size models because of the exponential blow up of the memory requirements. We have designed a set of heuristics, which make it possible to quantify, by means of BDD, all of the sequences of a large Event-Tree model coming from the nuclear industry. For the first time, it was possible to compare results of the classical approach with those of the BDD approach, i.e. with exact results. This article reports this comparison and shows that the minimal cutsets technique gives overestimated results in a significant proportion of cases and underestimated results in some cases as well. Hence, the (indeed provocative) question in the title of this article.

  9. Load out and offshore lifting of the PRA-1 platform modules; Embarque e icamento offshore dos modulos de PRA-1

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Fernando; Raigorodsky, Jacques; Mitidieri, Jorge L.U.; Ricardi, Paulo S. [Construtora Norberto Odebrecht S.A., Rio de Janeiro, RJ (Brazil)

    2008-07-01

    The technology innovations are characteristics of offshore Engineering around the world. These technologies just make sense when they aim the productivity, security and costs gains compared to ordinary methods. It is in this context that the proposal of the Consorcio PRA-1 (Odebrecht e UTC) team makes sense, in the definition of basic methodology for the PRA-1 platform construction and installation. Through the innovative concept, It was defined (still in the proposal phase) the basic premise that the modules construction and assembly were onshore ending up that just few hours after the offshore installation the modules should be operational in minimal habitability conditions. This innovative method allowed the lack of Flotel, that is a platform which provide support to the offshore construction and assembly (Flotel represents a high costs to the project) and, as consequence, the contract signature by CONSORCIO PRA-1. This work aims to describe the method used for the LOUD-OUT of the PRA-1 modules and the installation of them on the jacket through a vessel provide with cranes the has performed the lifting. Theses operations became unique in Brazil due its challengers characteristics: Module 12 weight = 7203 tf and Module 35 = 5725 tf. For the accomplishment of the Load-out and offshore lifting, was performed a detailed planning and a high level of subcontract interface management. The operations mentioned above were filmed/photographed and published in the specialized media. (author)

  10. Issues in identifying germ tube positive yeasts by conventional methods.

    Science.gov (United States)

    Yazdanpanah, Atta; Khaithir, Tzar Mohd Nizam

    2014-01-01

    Candida speciation is vital for epidemiology and management of candidiasis. Nonmolecular conventional methods often fail to identify closely related germ tube positive yeasts from clinical specimens. The present study was conducted to identify these yeasts and to highlight issues in conventional versus molecular methods of identification. A total of 98 germ tube positive yeasts from high vaginal swabs were studied over a 12-month period. Isolates were examined with various methods including growth at 42 °C and 45 °C on Sabouraud dextrose agar (SDA), color development on CHROMagar Candida medium, chlamydospore production on corn meal agar at 25 °C, carbohydrate assimilation using ID 32C system, and polymerase chain reaction using a single pair of primers targeting the hyphal wall protein 1 (Hwp1) gene. Of all the isolates studied, 97 were molecularly confirmed as C. albicans and one isolate was identified as C. dubliniensis. No C. africana was detected in this study. The molecular method used in our study was an accurate and useful tool for discriminating C. albicans, C. dubliniensis, and C. africana. The conventional methods, however, were less accurate and riddled with many issues that will be discussed in further details. © 2013 Wiley Periodicals, Inc.

  11. Practical PRA applications at Consumers Power Company

    International Nuclear Information System (INIS)

    Blanchard, D.P.

    1985-01-01

    Consumers Power Company has completed two probabilistic risk assessments (PRAs), one each at its Big Rock Point and Midland plants and is in the process of performing a third study at its Palisades Plant. Each PRA is summarized briefly in this paper. Each PRA has been used to evaluate specific plant design features and make operating and design recommendations to plant and Company management as well as to the regulator. This paper is a sumary of those issues on which Consumers Power Company has applied PRAs to date. The technique used in applying PRA to these issues has varied as more was learned about the plants from the PRA and about PRA itself. Some issue resolutions involved deriving technical arguments from small parts of the PRA only, such as the logic models or consequence analysis. Still others required use of the entire PRA including sequence quantification, plant and containment response, consequence analysis and eventually cost-benefit evaluation of proposed resolutions. The benefits derived from these analyses have also varied and include not only a perceived reduction in the risks associated with plant operation but also economic benefit to the Company in that cost-effective alternatives to resolving safety issues have been permitted

  12. IRIS PRA preliminary results and future direction

    International Nuclear Information System (INIS)

    Finnicum, D.J.; Kling, C.L.; Carelli, M.D.

    2004-01-01

    Westinghouse is currently conducting the pre-application licensing of the International Reactor Innovative and Secure (IRIS) on behalf of the IRIS Consortium. One of the key aspects of the IRIS design is the concept of safety-by-design. The PRA (Probabilistic Risk Analysis) is being used as an integral part of the design process. As part of this effort, a PRA of the initial design was generated to address 2 key areas. First, the IRIS PRA supported the evaluation of IRIS design issues by providing a solid risk basis for design and analyses required for the pre-licensing evaluation of the IRIS design. The PRA provides the tool for quantifying the benefit of the safety-by-design approach. Second, the current PRA task is beginning the preparation of the more complete PRA analyses and documentation eventually required for Design Certification. One of the key risk-related goals for IRIS is to reduce the EPZ (Emergency Protection Zone) to within the exclusion area by demonstrating that the off-site doses are consistent with the US Protective Action Guidelines (PAGs) for initiation of emergency response so that the required protective actions would be limited to the exclusion area. The results of the preliminary PRA indicated a core damage frequency of 1.2 E-08 for internal initiators. This is a very good result but much work is needed to meet the ambitious goal of no emergency response. The next phase of the PRA analyses will involve a two-fold expansion of the PRA. First, as the design and analyses approach a greater level of detail, the assumptions used for the initial PRA will be reviewed and the models will be revised as needed to reflect the improved knowledge of the system design and performance. Furthermore, as the full plant design advances, the PRA will be expanded to incorporate risk associated with external challenges such as seismic and fire, and to address low power and shutdowns modes of operation. As with the initial work, the PRA will serve as a tool to

  13. Conventional cable testing methods: strengths, weaknesses and possibilities

    International Nuclear Information System (INIS)

    Reynolds, P.H.

    1988-01-01

    The paper reviews the major conventional methods that can be used to test power plant cables. It assesses their usefulness in diagnosing the condition of the insulation of the cable and then proposes some possible directions for innovation. The methods examined are dc insulation resistance measurement, ac signal injection for continuous monitoring and fault location, and the ac measurement of capacitance and loss angle. Specific subjects considered are the effects of temperature, cable construction and installation, and the validity of insulation resistance or loss angle measurement. The innovative proposals refer to the use of automation in the measurement and of computer-based Expert Systems for the evaluation of the results

  14. Clinical significance of determination of SAC/PRA value in patients with primary aldosteronism

    International Nuclear Information System (INIS)

    Li Liren; Dai Yaozong; Liu Jiumin

    2003-01-01

    Objective: To investigate the diagnostic significance of determining SAC/PRA valve in hyperaldosteronism. Methods: Plasma renin activity (PRA) and angiotensin (AT-II) as well as serum aldosterone contents were measured with RIA in 48 patients with primary aldosteronism and 30 controls. The SAC/PRA value was calculated. Results: Contents of PRA, AT-II and Aldo in blood of patients with primary aldosteronism were very significantly different from those in controls (p < 0.001) (PRA 0.14 ± 0.08 ng/ml/h vs 0.57 ± 0.08 ng/ml/h; AT-II 21.21 ± 7.55 ng/L vs 36.03 ± 6.11 ng/L; Aldo 1.07 ± 0.34 nmol/L vs 0.33 ± 0.04 nmol/L). Calculated SAC/PRA value was 913 ± 409 (normal upper limit 400). Conclusion: SAC/PRA value is an useful accessory diagnostic criterion for primary aldosteronism

  15. Observations on PRA and its applications

    International Nuclear Information System (INIS)

    Yeh, Y.-C.; Shieh, S.-L.

    2004-01-01

    An overview on the experience of PRA and its prospective application in Taiwan's three nuclear power plants is presented. Through the PRA, plant design improvements are performed and several engineering findings are illuminated. The sensitivity study including the internal, seismic, and typhoon events are conducted to justify items that can significantly reduce core meltdown risk. Its resulted plant betterment plans are thus highlighted accordingly. For PRA application, a risk-based inspection program for allocating inspection human resources has been resulted following the importance ranking of each component. The developing risk-based regulation to rationalize technical specification and maintenance program will also be entailed. To enhance the accuracy of the PRA model and its reproducibility, several issues are considered to have high priority for improvement such as external event data and analyses, uncertainty, common mode failure, human reliability, and the relative component importance. Highlight of their significance along with some typical sensitivity analyses are discussed for further investigation. (author)

  16. PRA studies: results, insights and applications

    International Nuclear Information System (INIS)

    Levine, S.; Stetson, F.T.

    1983-01-01

    This paper deals with Probalistic Risk Assessment (PRA) studies and their results. The PRA is a combination of logic structures and analytical techniques that can be used to estimate the likelihood and consequences of events that have not been observed because of their low frequency occurrence. At first attitudes concerning PRA reports were controversial principally because of their new techniques and complex multidisciplinary nature. However these attitudes changed following the accident at Three Mile Island in 1979. Many people after this event came to appreciate the risks associated with the operation of nuclear power plants, and since the TMI accident there has been a rapid expansion, in the use of PRA in the US and other countries. (NEA) [fr

  17. Management and Organization Influences in PRA

    International Nuclear Information System (INIS)

    Gertman, D.I.; Hallbert, B. P.; Blackman, H. S.

    1998-01-01

    The authors present a research program which aimed at increasing the quality of comprehensiveness of contemporary PRA (Probability Risk Assessment) by providing a tool that allows for incorporating M and O in PRA, at improving the quality of NRC assessments, at conducting research to support the risk informed regulation process, at identifying impact of management and organization, safety culture, workplace environment, down-sizing and deregulation on human performance and reliability

  18. Survey and assessment of conventional software verification and validation methods

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.; Mirsky, S.M.

    1993-04-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 134 methods so identified were classified according to their appropriateness for various phases of a developmental lifecycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  19. PRA -- Now that operators have it, what do they do with it?

    International Nuclear Information System (INIS)

    Rasmussen, M.A.; Kolo, R.J.

    1996-01-01

    Many utilities have had Probabilistic Risk Assessment (PRA) projects underway for several years in order to satisfy the NRC Generic Letter 88-20 requirement for an Individual Plant Examination, or IPE. Typically the studies have reached the conclusion that there are significant differences in the contribution of different plant components to preventing core damage should a major plant transient occur. How nuclear plant operators can use this knowledge to DECREASE the overall risk of performing the routine tasks of testing and maintenance is not an easy task. 10CFR50.65; ''The Maintenance Rule,'' requires that any plant maintenance performed with the unit on line be evaluated for risk. Byron Station will satisfy the 10CFR50.65 requirement by using PRA methodology to evaluate testing and maintenance activities performed with the unit at power. The challenge is to effectively use the results of PRA studies to aid in plant operations without having to make on shift plant operations personnel experts in PRA. At Byron, PRA is used to help build the weekly work schedules. Operations personnel tasked with reviewing the work schedule are the departmental experts on the use of the PRA results. The on shift SRO's role in implementing the program is to accurately execute and monitor the work week schedule as written, and to react to unforeseen equipment failures with an appropriate level of response. The response to such emergent work items is also predefined. Handling emergent work in a prescribed manner minimizes the overall risk to the unit and also eliminates the need to have PRA expertise available to make emergent work risk evaluations. Thus the on shift operators' required knowledge of PRA methods and intricacies is minimized. PRA is just another of the many tools used by the shift operator to run the plant in a safe, conservative manner

  20. Organizational extension of PRA models and NASA application

    International Nuclear Information System (INIS)

    Pate-Cornell, E.

    1989-01-01

    This paper describes a probabilistic method which extends classical PRA to include some characteristics of the organization that processes or manages an engineering system. Ataxonomy of errors is presented and their organizational roots are examined. An assembly model is proposed for the analysis of the resulting spectrum of capacities of the system. The management of the Thermal Protection system of the Space Shuttle is used as an illustration. The model allows assessment of the benefits of organizational improvements of the orbiter's processing

  1. Uses of PRA in nuclear reactor regulation

    International Nuclear Information System (INIS)

    Congel, F.

    1987-01-01

    For the past five years, more than ten probabilistic risk assessment (PRA) studies were conducted by the owners of nuclear utilities and were submitted for the review of US Nuclear Regulatory Commission staff. These PRA studies were reviewed under various types of regulatory activities depending on the nature of plant licensing stage. The reviews of these PRAs provided very valuable uses to both the staff and the licensees on safety matters of the plant operation. The licensees developed perspectives using PRA models on the safety profiles of their plants. These PRA perspectives influenced licensees' major decisions to implement improvements to plant design and operating and emergency procedures to reduce and/or eliminate the plant's vulnerability to core damage accidents. The staff's review of these PRAs particularly emphasized the dominant accident sequences. The resulting findings led to the identification of dominant risk contributors, critical areas of plant locations, mechanisms leading to potential early containment failures, and instances of noncompliances of staff's deterministic criteria. Specific examples include single failure criterion and separation requirements to assess the need for any additional measures to further improve the safety of the plant. Some of these PRAs were reviewed under regulatory activities other than safety review such as environmental review, final design review, and licensing hearings. Most importantly, the risk profiles of generic PRAs will continue to be used in reviewing and evaluating unresolved safety issues and other generic issues. The major regulatory uses of PRAs, a summary of full scope PRA review, a summary of plant improvements as a result of PRA reviews, and the future role of PRA reviews are presented

  2. PRA (Probabilistic Risk Assessments) Participation versus Validation

    Science.gov (United States)

    DeMott, Diana; Banke, Richard

    2013-01-01

    Probabilistic Risk Assessments (PRAs) are performed for projects or programs where the consequences of failure are highly undesirable. PRAs primarily address the level of risk those projects or programs posed during operations. PRAs are often developed after the design has been completed. Design and operational details used to develop models include approved and accepted design information regarding equipment, components, systems and failure data. This methodology basically validates the risk parameters of the project or system design. For high risk or high dollar projects, using PRA methodologies during the design process provides new opportunities to influence the design early in the project life cycle to identify, eliminate or mitigate potential risks. Identifying risk drivers before the design has been set allows the design engineers to understand the inherent risk of their current design and consider potential risk mitigation changes. This can become an iterative process where the PRA model can be used to determine if the mitigation technique is effective in reducing risk. This can result in more efficient and cost effective design changes. PRA methodology can be used to assess the risk of design alternatives and can demonstrate how major design changes or program modifications impact the overall program or project risk. PRA has been used for the last two decades to validate risk predictions and acceptability. Providing risk information which can positively influence final system and equipment design the PRA tool can also participate in design development, providing a safe and cost effective product.

  3. Task analysis: How far are we from usable PRA input

    International Nuclear Information System (INIS)

    Gertman, D.I.; Blackman, H.S.; Hinton, M.F.

    1984-01-01

    This chapter reviews data collected at the Idaho National Engineering Laboratory for three DOE-owned reactors (the Advanced Test Reactor, the Power Burst Facility, and the Loss of Fluids Test Reactor) in order to identify usable Probabilistic Risk Assessment (PRA) input. Task analytic procedures involve the determination of manning and skill levels as a means of determining communication requirements, in assessing job performance aids, and in assessing the accuracy and completeness of emergency and maintenance procedures. The least understood aspect in PRA and plant reliability models is the human factor. A number of examples from the data base are discussed and offered as a means of providing more meaningful data than has been available to PRA analysts in the past. It is concluded that the plant hardware-procedures-personnel interfaces are essential to safe and efficient plant operations and that task analysis is a reasonably sound way of achieving a qualitative method for identifying those tasks most strongly associated with task difficulty, severity of consequence, and error probability

  4. ASSESSMENT OF DYNAMIC PRA TECHNIQUES WITH INDUSTRY AVERAGE COMPONENT PERFORMANCE DATA

    Energy Technology Data Exchange (ETDEWEB)

    Yadav, Vaibhav; Agarwal, Vivek; Gribok, Andrei V.; Smith, Curtis L.

    2017-06-01

    In the nuclear industry, risk monitors are intended to provide a point-in-time estimate of the system risk given the current plant configuration. Current risk monitors are limited in that they do not properly take into account the deteriorating states of plant equipment, which are unit-specific. Current approaches to computing risk monitors use probabilistic risk assessment (PRA) techniques, but the assessment is typically a snapshot in time. Living PRA models attempt to address limitations of traditional PRA models in a limited sense by including temporary changes in plant and system configurations. However, information on plant component health are not considered. This often leaves risk monitors using living PRA models incapable of conducting evaluations with dynamic degradation scenarios evolving over time. There is a need to develop enabling approaches to solidify risk monitors to provide time and condition-dependent risk by integrating traditional PRA models with condition monitoring and prognostic techniques. This paper presents estimation of system risk evolution over time by integrating plant risk monitoring data with dynamic PRA methods incorporating aging and degradation. Several online, non-destructive approaches have been developed for diagnosing plant component conditions in nuclear industry, i.e., condition indication index, using vibration analysis, current signatures, and operational history [1]. In this work the component performance measures at U.S. commercial nuclear power plants (NPP) [2] are incorporated within the various dynamic PRA methodologies [3] to provide better estimates of probability of failures. Aging and degradation is modeled within the Level-1 PRA framework and is applied to several failure modes of pumps and can be extended to a range of components, viz. valves, generators, batteries, and pipes.

  5. Level 2 PRA for a German BWR

    International Nuclear Information System (INIS)

    Sassen, F.; Rapp, W.; Tietsch, W.; Roess, P.

    2007-01-01

    A concept for a Level 2 Probabilistic Risk Assessment (L2 PRA) for a German Boiling Water Reactor (BWR) has been developed taking into account the role of L2 PRA within the German regulatory landscape. According to this concept, a plant specific evaluation of the severe accident phenomenology as well as analyses of the accident progression for the severe accident scenarios has been performed. Furthermore a plant specific MELCOR 1.8.6 model has been developed and special MELCOR source term calculations have been performed for the different release paths. This paper will present examples from the different areas described above. (author)

  6. Root canal preparation in endodontics: conventional versus laser methods

    Science.gov (United States)

    Goodis, Harold E.; White, Joel M.; Marshall, Sally J.; Marshall, Grayson W.; Moskowitz, Emrey

    1992-06-01

    Conventional cleaning and shaping of root canal systems employs hand and/or rotary instrumentation to remove the contents of the canal and shape the canal to receive a filling material. With the advent of the Nd:YAG laser system another method of accomplishing proper cleaning and shaping is evaluated. Single rooted teeth were radiographed bucco- lingually and mesio-distally and were divided into 2 groups. The first group was accessed and the root canal systems cleaned and shaped with a step back technique utilizing hand files and gates glidden burs. At completion of the procedure the teeth were again radiographed at the same positions as those prior to the procedure. The teeth were split longitudinally and examined under scanning electron microscopy to assess cleaning. The second group of teeth were accessed, and cleaning and shaping was accomplished using the Nd:YAG laser in combination with hand files and rotary instruments. These teeth were subjected to the same analysis as those in the first group. The before and after radiographs of each group were subjected to image analysis to determine effectiveness of the two methods in shaping the canal systems. We will discuss the ability of Nd:YAG to clean and shape root canal spaces and remove smear layer and organic tissue remnants from those areas.

  7. Probabilistic risk assessment course documentation. Volume 1: PRA fundamentals

    International Nuclear Information System (INIS)

    Breeding, R.J.; Leahy, T.J.; Young, J.

    1985-08-01

    The full range of PRA topics is presented, with a special emphasis on systems analysis and PRA applications. Systems analysis topics include system modeling such as fault tree and event tree construction, failure rate data, and human Reliability. The discussion of PRA applications is centered on past and present PRA based programs, such as WASH-1400 and the Interim Reliability Evaluation Program, as well as on some of the potential future applications of PRA. The relationship of PRA to generic safety issues such as station blackout and Anticipated Transient Without Scram (ATWS) is also discussed. In addition to system modeling, the major PRA tasks of accident process analysis, and consequence analysis are presented. An explanation of the results of these activities, and the techniques by which these results are derived, forms the basis for a discussion of these topics. An additional topic which is presented in this course is the topic of PRA management, organization, and evaluation. 84 figs., 41 tabs

  8. The Angra 1 fire PRA project

    International Nuclear Information System (INIS)

    Silva, Luiz E. Massiere de C.; Kassawara, Robert

    2009-01-01

    The Angra 1 Fire PRA (Probabilistic Risk Assessment) is under development by ELETRONUCLEAR jointly with EPRI (Electric Power Research Institute). The project was started January of 2007 and it is foreseen to be finished in the middle of the next year. The study is being conducted according to the newest methodology developed by EPRI and NRC/RES (U.S. Nuclear Regulatory Commission - Office of Regulatory Research) published in 2005 as Fire PRA Methodology for Nuclear Power Facilities (NUREG/CR-6850 or EPRI TR-1011989) [1]. Starting from the Internal Events Angra 1 PRA model Level 1 the project aims to be a comprehensive plant-specific fire analysis to identify the possible consequences of a fire in the plant vital areas which threaten the integrity of systems relevant to the safety, challenging the safety functions and representing a risk of accident that can lead to a core damage. The main tasks include the plant boundary and partitioning, the fire PRA component selection and the identification of the possible fire scenarios (ignition, propagation, detection, extinction and hazards) considering human failure events to establish the fire-induced risk model for quantification of the risk for nuclear core damage taking into account the plant design and its fire protection resources. This work presents a general discussion on the methodology applied to the completed steps of the project. (author)

  9. PRA: a powerful engineering decision tool

    International Nuclear Information System (INIS)

    Carvalho, H.G. de.

    1988-03-01

    The probabilistic risk analysis (PRA) is studied and its historical development is briefly presented. Human factors, sofware and guides, improvement of utility management of nuclear power operations are discussed. The development of a standardized LWR design, optimized for safety, reliability and economy is studied. The impact of risk assessments in public acceptance of nuclear power is discussed. (M.A.C.) [pt

  10. Probabilistic risk assessment (PRA) reference document. Final report

    International Nuclear Information System (INIS)

    Murphy, J.A.

    1984-09-01

    This document describes the current status of probabilistic risk assessment (PRA) as practiced in the nuclear reactor regulatory process. The PRA studies that have been completed or are under way are reviewed. The levels of maturity of the methodologies used in a PRA are discussed. Insights derived from PRAs are listed. The potential uses of PRA results for regulatory purposes are discussed. This document was issued for comment in February 1984 entitled Probabilistic Risk Assessment (PRA): Status Report and Guidance for Regulatory Application. The comments received on the draft have been considered for this final version of the report

  11. Changing perspective on tissue processing - comparison of microwave histoprocessing method with the conventional method

    Directory of Open Access Journals (Sweden)

    G Shrestha

    2015-09-01

    Full Text Available Background: Histopathological examination of tissues requires sliver of formalin fixed tissue that has been chemically processed and then stained with Haematoxylin and Eosin. The time honored conventional method of tissue processing, which requires 12 to 13 hours for completion, is employed at majority of laboratories but is now seeing the

  12. PRA research and the development of risk-informed regulation at the U.S. nuclear regulatory commission

    International Nuclear Information System (INIS)

    Siu, Nathan; Collins, Dorothy

    2008-01-01

    Over the years, Probabilistic Risk Assessment (PRA) research activities conducted at the U.S. Nuclear Regulatory Commission (NRC) have played an essential role in support of the agency's move towards risk-informed regulation. These research activities have provided the technical basis for NRC's regulatory activities in key areas; provided PRA methods, tools, and data enabling the agency to meet future challenges; supported the implementation of NRC's 1995 PRA Policy Statement by assessing key sources of risk; and supported the development of necessary technical and human resources supporting NRC's risk-informed activities. PRA research aimed at improving the NRC's understanding of risk can positively affect the agency's regulatory activities, as evidenced by three case studies involving research on fire PRA, Human Reliability Analysis (HRA), and Pressurized Thermal Shock (PTS) PRA. These case studies also show that such research can take a considerable amount of time, and that the incorporation of research results into regulatory practice can take even longer. The need for sustained effort and appropriate lead time is an important consideration in the development of a PRA research program aimed at helping the agency address key sources of risk for current and potential future facilities

  13. Dosimetry comparison of pelvimetry methods using conventional radiographs and CT

    International Nuclear Information System (INIS)

    Resten, A.; Suissa, M.; Musset, D.; Mausoleo, F.; Valero, M.; Taylor, S.

    2001-01-01

    To determine the fetal and maternal exposure to radiation by use of thermoluminescent dosimeters in order to compare conventional and CT-scan X-ray. Dosimetry was performed with an anthropomorph phantom. Thermoluminescent dosimeters were positioned on the surface and in the depth of the phantom. Digital radiography of the pelvis was performed according to a standard technique. CT-scan of the pelvis was performed according to the Buthiau's technique. With CT, the dose reached 0.31 to 4.95 mGy, with a dose of 2.32 mGy for the fetal gonads. With standard technique, the doses reached 0.03 to 0.39 mGy, with a dose of 0.39 mGy for the fetal gonads. With CT the fetus and the mother were exposed to 1/10. of the total dose delivered using conventional X-rays and the dose distribution was more homogeneous. (author)

  14. A review on mathematical methods of conventional and Islamic derivatives

    Science.gov (United States)

    Hisham, Azie Farhani Badrol; Jaffar, Maheran Mohd

    2014-12-01

    Despite the impressive growth of risk management tools in financial institutions, Islamic finance remains miles away behind the conventional institutions. Islamic finance products need to comply with the syariah law and prohibitions, therefore they can use fewer of the available risk management tools compared to conventional. Derivatives have proven to be the effective hedging technique and instrument that broadly being used in the conventional institutions to manage their risks. However, derivatives are not generally accepted as the legitimate products in Islamic finance and they remain controversial issues among the Islamic scholars. This paper reviews the evolution of derivatives such as forwards, futures and options and then explores the mathematical models that being used to solve derivatives such as random walk model, asset pricing model that follows Brownian motion and Black-Scholes model. Other than that, this paper also critically discuss the perspective of derivatives from Islamic point of view. In conclusion, this paper delivers the traditional Islamic products such as salam, urbun and istijrar that can be used to create building blocks of Islamic derivatives.

  15. Comparative study of the geostatistical ore reserve estimation method over the conventional methods

    International Nuclear Information System (INIS)

    Kim, Y.C.; Knudsen, H.P.

    1975-01-01

    Part I contains a comprehensive treatment of the comparative study of the geostatistical ore reserve estimation method over the conventional methods. The conventional methods chosen for comparison were: (a) the polygon method, (b) the inverse of the distance squared method, and (c) a method similar to (b) but allowing different weights in different directions. Briefly, the overall result from this comparative study is in favor of the use of geostatistics in most cases because the method has lived up to its theoretical claims. A good exposition on the theory of geostatistics, the adopted study procedures, conclusions and recommended future research are given in Part I. Part II of this report contains the results of the second and the third study objectives, which are to assess the potential benefits that can be derived by the introduction of the geostatistical method to the current state-of-the-art in uranium reserve estimation method and to be instrumental in generating the acceptance of the new method by practitioners through illustrative examples, assuming its superiority and practicality. These are given in the form of illustrative examples on the use of geostatistics and the accompanying computer program user's guide

  16. Role of PRA in new NPP projects

    International Nuclear Information System (INIS)

    Julin, A.; Sandberg, J.; Virolainen, R.

    2012-01-01

    In Finland, a plant specific, Level 1 and 2 Probabilistic Risk Analysis (PRA) is required as a prerequisite for issuing the construction license and operating license. The use of PRA in various applications and the main insights are presented. These applications include e.g. PRA support to the design of SSCs (Systems, Structures and Components), definition of pre-service and in-service inspection programs, evaluation of the safety classification of SSCs, development of procedures, training and in definition of risk informed technical specifications, periodic testing and on-line preventive maintenance programs. In addition, PRA shall be used to assess the adequacy and coverage of the phase and system commissioning programs. Also the potential risks related to commissioning tests during nuclear test phase, shall be assessed with the help of PRA. In OL3 project, risk informed approach has been applied on a large scale for the first time in the design, construction and commissioning of a new NPP unit. Pre-nuclear commissioning tests have started at OL3 site and the plant is foreseen to begin commercial operation in 2013. Decisions have been made to launch new NPP projects. Teollisuuden Voima Oyj (TVO) is planning to build a new unit (OL4) at Olkiluoto site and a new utility, Fennovoima, is planning to build one unit at one of two alternative green field sites in Northern parts of Finland. Insights from PRAs of operating NPPs have been used in the evaluation of possible new sites to ensure that the site specific concerns and environmental conditions are adequately taken into account in the design of SSCs. Although the seismic activity at the Olkiluoto site is low, a comprehensive seismic risk analysis is being conducted. Its results support the review of the deterministic seismic design. For new sites, a probabilistic seismic hazard analysis has been carried out for the determination of the design earthquake. Experiences from OL3 licensing have been utilized in the

  17. Practical Application of PRA as an Integrated Design Tool for Space Systems

    Science.gov (United States)

    Kalia, Prince; Shi, Ying; Pair, Robin; Quaney, Virginia; Uhlenbrock, John

    2013-01-01

    This paper presents the application of the first comprehensive Probabilistic Risk Assessment (PRA) during the design phase of a joint NASA/NOAA weather satellite program, Geostationary Operational Environmental Satellite Series R (GOES-R). GOES-R is the next generation weather satellite primarily to help understand the weather and help save human lives. PRA has been used at NASA for Human Space Flight for many years. PRA was initially adopted and implemented in the operational phase of manned space flight programs and more recently for the next generation human space systems. Since its first use at NASA, PRA has become recognized throughout the Agency as a method of assessing complex mission risks as part of an overall approach to assuring safety and mission success throughout project lifecycles. PRA is now included as a requirement during the design phase of both NASA next generation manned space vehicles as well as for high priority robotic missions. The influence of PRA on GOES-R design and operation concepts are discussed in detail. The GOES-R PRA is unique at NASA for its early implementation. It also represents a pioneering effort to integrate risks from both Spacecraft (SC) and Ground Segment (GS) to fully assess the probability of achieving mission objectives. PRA analysts were actively involved in system engineering and design engineering to ensure that a comprehensive set of technical risks were correctly identified and properly understood from a design and operations perspective. The analysis included an assessment of SC hardware and software, SC fault management system, GS hardware and software, common cause failures, human error, natural hazards, solar weather and infrastructure (such as network and telecommunications failures, fire). PRA findings directly resulted in design changes to reduce SC risk from micro-meteoroids. PRA results also led to design changes in several SC subsystems, e.g. propulsion, guidance, navigation and control (GNC

  18. Conventional and more recent methods of radiodiagnosis of mammary carcinoma

    International Nuclear Information System (INIS)

    Kutarna, A.; Klacko, J.; Malatin, O.; Glomba, J.; Celovsky, F.

    1988-01-01

    The methods are listed and briefly characterized. They are categorized by energy used and for some, future applications are given. X-ray methods are believed to be the most frequently used and deemed to remain so. (M.D.)

  19. Insights on PRA Review Practices: Necessity for Model Shaking

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Inn Seock; Jang, Mi suk; Kim, Seoung Rae [NESS, Daejeon (Korea, Republic of)

    2016-05-15

    Probabilistic risk assessment (PRA) is increasingly used as a technique to help ensure design and operational safety of nuclear power plants (NPPs) in the nuclear industry. Hence, there is considerable interest in the PRA quality, and as a result, a peer review of the PRA model is typically performed to ensure its technical adequacy as part of the PRA development process or for any other reason (e.g., regulatory requirement). For the PRA model to be used as a valuable vehicle for risk-informed applications, it is essential that the PRA model must yield correct and physically meaningful accident sequences and minimal cutsets for specific plant configurations or conditions relating to the applications. Hence, the existing peer review guidelines need to be updated to reflect these insights so that risk-informed applications could be more actively pursued with confidence.

  20. PRA: A PERSPECTIVE ON STRENGTHS, CURRENT LIMITATIONS, AND POSSIBLE IMPROVEMENTS

    Directory of Open Access Journals (Sweden)

    ALI MOSLEH

    2014-02-01

    Full Text Available Probabilistic risk assessment (PRA has been used in various technological fields to assist regulatory agencies, managerial decision makers, and systems designers in assessing and mitigating the risks inherent in these complex arrangements. Has PRA delivered on its promise? How do we gage PRA performance? Are our expectations about value of PRA realistic? Are there disparities between what we get and what we think we are getting form PRA and its various derivatives? Do current PRAs reflect the knowledge gained from actual events? How do we address potential gaps? These are some of the questions that have been raised over the years since the inception of the field more than forty years ago. This paper offers a brief assessment of PRA as a technical discipline in theory and practice, its key strengths and weaknesses, and suggestions on ways to address real and perceived shortcomings.

  1. PRA: A Perspective on Strengths, Current Limitations, And Possible Improvements

    International Nuclear Information System (INIS)

    Mosleh, Ail

    2014-01-01

    Probabilistic risk assessment (PRA) has been used in various technological fields to assist regulatory agencies, managerial decision makers, and systems designers in assessing and mitigating the risks inherent in these complex arrangements. Has PRA delivered on its promise? How do we gage PRA performance? Are our expectations about value of PRA realistic? Are there disparities between what we get and what we think we are getting form PRA and its various derivatives? Do current PRAs reflect the knowledge gained from actual events? How do we address potential gaps? These are some of the questions that have been raised over the years since the inception of the field more than forty years ago. This paper offers a brief assessment of PRA as a technical discipline in theory and practice, its key strengths and weaknesses, and suggestions on ways to address real and perceived shortcomings

  2. Tomographs based on non-conventional radiation sources and methods

    International Nuclear Information System (INIS)

    Barbuzza, R.; Fresno, M. del; Venere, Marcelo J.; Clausse, Alejandro; Moreno, C.

    2000-01-01

    Computer techniques for tomographic reconstruction of objects X-rayed with a compact plasma focus (PF) are presented. The implemented reconstruction algorithms are based on stochastic searching of solutions of Radon equation, using Genetic Algorithms and Monte Carlo methods. Numerical experiments using actual projections were performed concluding the feasibility of the application of both methods in tomographic reconstruction problem. (author)

  3. PRISIM: a computer program that makes PRA useful

    International Nuclear Information System (INIS)

    Fussell, J.B.; Campbell, D.J.; Glynn, J.C.; Burdick, G.R.

    1986-01-01

    PRISIM is an IBM personal computer program that translates probabilistic risk assessment (PRA) information and calculates additional PRA type information for use by those who are not PRA experts. Specifically, PRISIM was developed for the US Nuclear Regulatory Commission for use by their resident inspectors at nuclear power plants. Inspector activities are either scheduled or are in response to a particular status of a plant. PRISIM is useful for either activity

  4. Clinical analysis of the changes of plasma PRA, AT-II and Aid levels in patients with acute renal failure

    International Nuclear Information System (INIS)

    Zhang Qiuyue; Yang Yongqing

    2002-01-01

    Objective: To investigate the role of changes of plasma PRA, AT-II and Ald levels in the pathogenesis of acute renal failure. Methods: Plasma PRA, AT-II and Ald levels were determined with RIA in 40 normal subjects and 72 cases of acute renal failure. Results: Plasma PRA, AT-II and Ald levels in the patients were markedly increased as compared with those in normal subjects (p < 0.05, p < 0.01, p < 0.001 respectively). There were no linearity and exponential relationship between plasma PRA, AT-II, Ald levels and the 24 h urinary sodium excretion amount (within the range of 89.1 - 365.2 mEq). Conclusion: Acute renal failure could activate the RAAS function

  5. Seismic PRA of a BWR plant

    International Nuclear Information System (INIS)

    Nishio, Masahide; Fujimoto, Haruo

    2014-01-01

    Since the occurrence of nuclear power plant accidents in the Fukushima Daichi nuclear power station, the regulatory framework on severe accident (SA) has been discussed in Japan. The basic concept is to typify and identify the accident sequences leading to core/primary containment vessel (PCV) damage and to implement SA measures covering internal and external events extensively. As Japan is an earthquake-prone country and earthquakes and tsunami are important natural external events for nuclear safety of nuclear power plants, JNES performed the seismic probabilistic risk assessment (PRA) on a typical nuclear power plant and evaluated the dominant accident sequences leading to core/PCV damage to discuss dominant scenarios of severe accident (SA). The analytical models and the results of level-1 seismic PRA on a 1,100 MWe BWR-5 plant are shown here. Seismic PRA was performed for a typical BWR5 plant. Initiating events with large contribution to core damage frequency are the loss of all AC powers (station blackout) and the large LOCA. The top of dominant accident sequences is the simultaneous occurrence of station blackout and large LOCA. Important components to core damage frequency are electric power supply equipment. It needs to keep in mind that the results are influenced on site geologic characteristic to a greater or lesser. In the process of analysis, issues such as conservative assumptions related to damages of building or structure and success criteria for excessive LOCA are left to be resolved. These issues will be further studied including thermal hydric analysis in the future. (authors)

  6. Conventional estimating method of earthquake response of mechanical appendage system

    International Nuclear Information System (INIS)

    Aoki, Shigeru; Suzuki, Kohei

    1981-01-01

    Generally, for the estimation of the earthquake response of appendage structure system installed in main structure system, the method of floor response analysis using the response spectra at the point of installing the appendage system has been used. On the other hand, the research on the estimation of the earthquake response of appendage system by the statistical procedure based on probability process theory has been reported. The development of a practical method for simply estimating the response is an important subject in aseismatic engineering. In this study, the method of estimating the earthquake response of appendage system in the general case that the natural frequencies of both structure systems were different was investigated. First, it was shown that floor response amplification factor was able to be estimated simply by giving the ratio of the natural frequencies of both structure systems, and its statistical property was clarified. Next, it was elucidated that the procedure of expressing acceleration, velocity and displacement responses with tri-axial response spectra simultaneously was able to be applied to the expression of FRAF. The applicability of this procedure to nonlinear system was examined. (Kako, I.)

  7. Certification plan for safety and PRA codes

    International Nuclear Information System (INIS)

    Toffer, H.; Crowe, R.D.; Ades, M.J.

    1990-05-01

    A certification plan for computer codes used in Safety Analyses and Probabilistic Risk Assessment (PRA) for the operation of the Savannah River Site (SRS) reactors has been prepared. An action matrix, checklists, and a time schedule have been included in the plan. These items identify what is required to achieve certification of the codes. A list of Safety Analysis and Probabilistic Risk Assessment (SA ampersand PRA) computer codes covered by the certification plan has been assembled. A description of each of the codes was provided in Reference 4. The action matrix for the configuration control plan identifies code specific requirements that need to be met to achieve the certification plan's objectives. The checklist covers the specific procedures that are required to support the configuration control effort and supplement the software life cycle procedures based on QAP 20-1 (Reference 7). A qualification checklist for users establishes the minimum prerequisites and training for achieving levels of proficiency in using configuration controlled codes for critical parameter calculations

  8. A Critical Analysis of the Conventionally Employed Creep Lifing Methods.

    Science.gov (United States)

    Abdallah, Zakaria; Gray, Veronica; Whittaker, Mark; Perkins, Karen

    2014-04-29

    The deformation of structural alloys presents problems for power plants and aerospace applications due to the demand for elevated temperatures for higher efficiencies and reductions in greenhouse gas emissions. The materials used in such applications experience harsh environments which may lead to deformation and failure of critical components. To avoid such catastrophic failures and also increase efficiency, future designs must utilise novel/improved alloy systems with enhanced temperature capability. In recognising this issue, a detailed understanding of creep is essential for the success of these designs by ensuring components do not experience excessive deformation which may ultimately lead to failure. To achieve this, a variety of parametric methods have been developed to quantify creep and creep fracture in high temperature applications. This study reviews a number of well-known traditionally employed creep lifing methods with some more recent approaches also included. The first section of this paper focuses on predicting the long-term creep rupture properties which is an area of interest for the power generation sector. The second section looks at pre-defined strains and the re-production of full creep curves based on available data which is pertinent to the aerospace industry where components are replaced before failure.

  9. Preliminary ATWS analysis for the IRIS PRA

    International Nuclear Information System (INIS)

    Maddalena Barra; Marco S Ghisu; David J Finnicum; Luca Oriani

    2005-01-01

    Full text of publication follows: The pressurized light water cooled, medium power (1000 MWt) IRIS (International Reactor Innovative and Secure) has been under development for four years by an international consortium of over 21 organizations from ten countries. The plant conceptual design was completed in 2001 and the preliminary design is nearing completion. The pre-application licensing process with NRC started in October, 2002. IRIS has been primarily focused on establishing a design with innovative safety characteristics. The first line of defense in IRIS is to eliminate event initiators that could potentially lead to core damage. In IRIS, this concept is implemented through the 'safety by design' approach, which allows to minimize the number and complexity of the safety systems and required operator actions. The end result is a design with significantly reduced complexity and improved operability, and extensive plant simplifications to enhance construction. To support the optimization of the plant design and confirm the effectiveness of the safety by design approach in mitigating or eliminating events and thus providing a significant reduction in the probability of severe accidents, the PRA is being used as an integral part of the design process. A preliminary but extensive Level 1 PRA model has been developed to support the pre-application licensing of the IRIS design. As a result of the Preliminary IRIS PRA, an optimization of the design from a reliability point of view was completed, and an extremely low (about 1.2 E -8 ) core damage frequency (CDF) was assessed to confirm the impact of the safety by design approach. This first assessment is a result of a PRA model including internal initiating events. During this assessment, several assumptions were necessary to complete the CDF evaluation. In particular Anticipated Transients Without Scram (ATWS) were not included in this initial assessment, because their contribution to core damage frequency was assumed

  10. Development of insights from PRAs for non-PRA people

    International Nuclear Information System (INIS)

    Reilly, H.J.; Meale, B.M.

    1992-01-01

    A probabilistic risk assessment (PRA) of the Savannah River K-Reactor was completed in 1990. The PRA estimated the frequency of core damage accidents caused by operational occurrences during power operation of the reactor. The US Department of Energy (DOE) requested Idaho National Engineering Laboratory (INEL) to prepare guidance based on the PRA for use by DOE personnel at the Savannah River Site (SRS). The document had the purpose of informing the DOE system engineers and site representatives about how the information in the PRA might be used to help guide their activities. Opportunities existed to develop a document somewhat different than those developed previously by other programs. The opportunities existed because the audience is different: the principal audience for the document consists of DOE engineers who have continuing oversight responsibility for activities performed by the operating contractor at the K-Reactor, but who may not be knowledgeable about PRA

  11. Use of PRA in Shuttle Decision Making Process

    Science.gov (United States)

    Boyer, Roger L.; Hamlin, Teri L.

    2010-01-01

    How do you use PRA to support an operating program? This presentation will explore how the Shuttle Program Management has used the Shuttle PRA in its decision making process. It will reveal how the PRA has evolved from a tool used to evaluate Shuttle upgrades like Electric Auxiliary Power Unit (EAPU) to a tool that supports Flight Readiness Reviews (FRR) and real-time flight decisions. Specific examples of Shuttle Program decisions that have used the Shuttle PRA as input will be provided including how it was used in the Hubble Space Telescope (HST) manifest decision. It will discuss the importance of providing management with a clear presentation of the analysis, applicable assumptions and limitations, along with estimates of the uncertainty. This presentation will show how the use of PRA by the Shuttle Program has evolved overtime and how it has been used in the decision making process providing specific examples.

  12. The tsunami probabilistic risk assessment (PRA). Example of accident sequence analysis of tsunami PRA according to the standard for procedure of tsunami PRA for nuclear power plants

    International Nuclear Information System (INIS)

    Ohara, Norihiro; Hasegawa, Keiko; Kuroiwa, Katsuya

    2013-01-01

    After the Fukushima Daiichi nuclear power plant (NPP) accident, standard for procedure of tsunami PRA for NPP had been established by the Standardization Committee of AESJ. Industry group had been conducting analysis of Tsunami PRA for PWR based on the standard under the cooperation with electric utilities. This article introduced overview of the standard and examples of accident sequence analysis of Tsunami PRA studied by the industry group according to the standard. The standard consisted of (1) investigation of NPP's composition, characteristics and site information, (2) selection of relevant components for Tsunami PRA and initiating events and identification of accident sequence, (3) evaluation of Tsunami hazards, (4) fragility evaluation of building and components and (5) evaluation of accident sequence. Based on the evaluation, countermeasures for further improvement of safety against Tsunami could be identified by the sensitivity analysis. (T. Tanaka)

  13. Top event prevention analysis: A deterministic use of PRA

    International Nuclear Information System (INIS)

    Worrell, R.B.; Blanchard, D.P.

    1996-01-01

    This paper describes the application of Top Event Prevention Analysis. The analysis finds prevention sets which are combinations of basic events that can prevent the occurrence of a fault tree top event such as core damage. The problem analyzed in this application is that of choosing a subset of Motor-Operated Valves (MOVs) for testing under the Generic Letter 89-10 program such that the desired level of safety is achieved while providing economic relief from the burden of testing all safety-related valves. A brief summary of the method is given, and the process used to produce a core damage expression from Level 1 PRA models for a PWR is described. The analysis provides an alternative to the use of importance measures for finding the important combination of events in a core damage expression. This application of Top Event Prevention Analysis to the MOV problem was achieve with currently available software

  14. Constellation Probabilistic Risk Assessment (PRA): Design Consideration for the Crew Exploration Vehicle

    Science.gov (United States)

    Prassinos, Peter G.; Stamatelatos, Michael G.; Young, Jonathan; Smith, Curtis

    2010-01-01

    Managed by NASA's Office of Safety and Mission Assurance, a pilot probabilistic risk analysis (PRA) of the NASA Crew Exploration Vehicle (CEV) was performed in early 2006. The PRA methods used follow the general guidance provided in the NASA PRA Procedures Guide for NASA Managers and Practitioners'. Phased-mission based event trees and fault trees are used to model a lunar sortie mission of the CEV - involving the following phases: launch of a cargo vessel and a crew vessel; rendezvous of these two vessels in low Earth orbit; transit to th$: moon; lunar surface activities; ascension &om the lunar surface; and return to Earth. The analysis is based upon assumptions, preliminary system diagrams, and failure data that may involve large uncertainties or may lack formal validation. Furthermore, some of the data used were based upon expert judgment or extrapolated from similar componentssystemsT. his paper includes a discussion of the system-level models and provides an overview of the analysis results used to identify insights into CEV risk drivers, and trade and sensitivity studies. Lastly, the PRA model was used to determine changes in risk as the system configurations or key parameters are modified.

  15. Selecting the seismic HRA approach for Savannah River Plant PRA revision 1

    International Nuclear Information System (INIS)

    Papouchado, K.; Salaymeh, J.

    1993-10-01

    The Westinghouse Savannah River Company (WSRC) has prepared a level I probabilistic risk assessment (PRA), Rev. 0 of reactor operations for externally-initiated events including seismic events. The SRS PRA, Rev. 0 Seismic HRA received a critical review that expressed skepticism with the approach used for human reliability analysis because it had not been previously used and accepted in other published PRAs. This report provides a review of published probabilistic risk assessments (PRAs), the associated methodology guidance documents, and the psychological literature to identify parameters important to seismic human reliability analysis (HRA). It also describes a recommended approach for use in the Savannah River Site (SRS) PRA. The SRS seismic event PRA performs HRA to account for the contribution of human errors in the accident sequences. The HRA of human actions during and after a seismic event is an area subject to many uncertainties and involves significant analyst judgment. The approach recommended by this report is based on seismic HRA methods and associated issues and concerns identified from the review of these referenced documents that represent the current state-of-the- art knowledge and acceptance in the seismic HRA field

  16. Seabrook Station Level 2 PRA Update to Include Accident Management

    International Nuclear Information System (INIS)

    Lutz, Robert; Lucci, Melissa; Kiper, Kenneth; Henry, Robert

    2006-01-01

    A ground-breaking study was recently completed as part of the Seabrook Level 2 PRA update. This study updates the post-core damage phenomena to be consistent with the most recent information and includes accident management activities that should be modeled in the Level 2 PRA. Overall, the result is a Level 2 PRA that fully meets the requirements of the ASME PRA Standard with respect to modeling accident management in the LERF assessment and NRC requirements in Regulatory Guide 1.174 for considering late containment failures. This technical paper deals only with the incorporation of operator actions into the Level 2 PRA based on a comprehensive study of the Seabrook Station accident response procedures and guidance. The paper describes the process used to identify the key operator actions that can influence the Level 2 PRA results and the development of success criteria for these key operator actions. This addresses a key requirement of the ASME PRA Standard for considering SAMG. An important benefit of this assessment was the identification of Seabrook specific accident management insights that can be fed back into the Seabrook Station accident management procedures and guidance or the training provided to plant personnel for these procedures and guidance. (authors)

  17. CAM visual stimulation with conventional method of occlusion treatment in amblyopia: a randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Ali Reza Jafari

    2014-04-01

    Conclusion: Using of CAM visual stimulation along with conventional occlusion will further improve visual acuity and stereopsis in amblyopic children. These findings recommended the CAM visual stimulation as an accompanying and complementary method in amblyopia treatment.

  18. PRA-Code Upgrade to Handle a Generic Problem

    International Nuclear Information System (INIS)

    Wilson, J. R.

    1999-01-01

    During the probabilistic risk assessment (PRA) for the proposed Yucca Mountain nuclear waste repository, a problem came up that could not be handled by most PRA computer codes. This problem deals with dependencies between sequential events in time. Two similar scenarios that illustrate this problem are LOOP nonrecovery and sequential wearout failures with units of time. The purpose of this paper is twofold: To explain the problem generically, and to show how the PRA code at the INEEL, SAPHIRE, has been modified to solve this problem correctly

  19. Investigation of Industrialised Building System Performance in Comparison to Conventional Construction Method

    Directory of Open Access Journals (Sweden)

    Othuman Mydin M.A.

    2014-03-01

    Full Text Available Conventional construction methods are still widely practised, although many researches have indicated that this method is less effective compared to the IBS construction method. The existence of the IBS has added to the many techniques within the construction industry. This study is aimed at making comparisons between the two construction approaches. Case studies were conducted at four sites in the state of Penang, Malaysia. Two projects were IBS-based while the remaining two deployed the conventional method of construction. Based on an analysis of the results, it can be concluded that the IBS approach has more to offer compared to the conventional method. Among these advantages are shorter construction periods, reduced overall costs, less labour needs, better site conditions and the production of higher quality components.

  20. The radioprotective effect of a new aminothiol (20-PRA)

    International Nuclear Information System (INIS)

    Dolabela, M.F.; Lopes, M.T.P.; Pereira, M.T.; Steffani, G.M.; Pilo-Veloso, D.; Salas, C.E.; Nelson, D.L.

    1998-01-01

    We examined the radioprotective effect of aminothiol 2-N-propylamine-cyclohexane thiol (20-PRA) on a human leukemic cell line (K562) following various radiation doses (5,7.5 and 20 Gy) using a source of 60 Co γ-rays. At 5 Gy and 1nM 20-PRA, a substantial protective effect (58%) was seen 24 h after irradiation, followed by a decrease at 48 h (11%). At the high radiation dose (20 Gy) a low protective effect was also seen (35%). In addition, the anti tumorigenic potential of 10 nM 20-PRA was shown by the inhibition of crown gall formation induced by Agrobacterium tumefaciens. The radioprotective potency of 20-PRA is 10 5- 10 6 times higher than that of the aminothiol WR-1065 (N(2-mercaptoethyl)-1,3-diamino propane) whose protective effect is in the 0.1 to 1.0 nM range. (author)

  1. The radioprotective effect of a new aminothiol (20-PRA

    Directory of Open Access Journals (Sweden)

    M.F. Dolabela

    1998-08-01

    Full Text Available We examined the radioprotective effect of aminothiol 2-N-propylamine-cyclo-hexanethiol (20-PRA on a human leukemic cell line (K562 following various radiation doses (5, 7.5 and 20 Gy using a source of 60Co g-rays. At 5 Gy and 1 nM 20-PRA, a substantial protective effect (58% was seen 24 h after irradiation, followed by a decrease at 48 h (11%. At the high radiation dose (20 Gy a low protective effect was also seen (35%. In addition, the antitumorigenic potential of 10 nM 20-PRA was shown by the inhibition of crown gall formation induced by Agrobacterium tumefaciens. The radioprotective potency of 20-PRA is 105-106 times higher than that of the aminothiol WR-1065 (N-(2-mercaptoethyl-1,3-diaminopropane whose protective effect is in the 0.1 to 1.0 mM range.

  2. Applications of PRA in nuclear criticality safety

    International Nuclear Information System (INIS)

    McLaughlin, T.P.

    1992-01-01

    Traditionally, criticality accident prevention at Los Alamos has been based on a thorough review and understanding of proposed operations of changes to operations, involving both process supervision and criticality safety staff. The outcome of this communication was usually an agreement, based on professional judgement, that certain accident sequences were credible and had to be reduced in likelihood either by administrative controls or by equipment design and others were not credible, and thus did not warrant expenditures to further reduce their likelihood. The extent of analysis and documentation was generally in proportion to the complexity of the operation but did not include quantified risk assessments. During the last three years nuclear criticality safety related Probabilistic Risk Assessments (PRAs) have been preformed on operations in two Los Alamos facilities. Both of these were conducted in order to better understand the cost/benefit aspects of PRA's as they apply to largely ''hands-on'' operations with fissile material for which human errors or equipment failures significant to criticality safety are both rare and unique. Based on these two applications and an appreciation of the historical criticality accident record (frequency and consequences) it is apparent that quantified risk assessments should be performed very selectively

  3. Two decades of PRA: What next?

    International Nuclear Information System (INIS)

    Rasmussen, N.C.

    1992-01-01

    Two decades ago, in the spring of 1972, the Reactor Safety Study was undertaken for the US Atomic Energy Commission (AEC). The goal of this study was to assess the risk to the public posed by the nuclear power plants operating in the US. Some three and one-half years later in October 1975, the study group issued its final report titled The Reactor Safety Study, also commonly known by its document number WASH 1400. Because it was issued at a time of heated public debate about nuclear safety, WASH 1400 received considerable critical review. By the late 1970s, as a result of the Lewis Report and the accident at Three Mile Island, the value of the WASH 1400 methodology was gradually recognized. A number of utilities undertook such studies of their own plants. The field of probabilistic risk assessment (PRA) developed from these efforts. Challenges remain. Among these are how to effectively communicate the results of the analysis. Just what does a probability of one in a million mean? Is there a de minimis probability - one so small that it can be ignored? How should society make decisions under substantial uncertainty? A number of these questions pose real challenges for the future

  4. Chinshan living PRA model using NUPRA software package

    International Nuclear Information System (INIS)

    Cheng, S.-K.; Lin, T.-J.

    2004-01-01

    A living probabilistic risk assessment (PRA) model has been established for Chinshan Nuclear Power Station (BWR-4, MARK-I) using NUPRA software package. The core damage frequency due to internal events, seismic events and typhoons are evaluated in this model. The methodology and results considering the recent implementation of the 5th emergency diesel generator and automatic boron injection function are presented. The dominant sequences of this PRA model are discussed, and some possible applications of this living model are proposed. (author)

  5. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions

    OpenAIRE

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-01-01

    OBJECTIVES Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. MATERIALS AND METHODS Impressions were obtained via two conventional (metal full-arch tray, CI, ...

  6. 10 CFR Appendix I to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Conventional Ranges, Conventional...

    Science.gov (United States)

    2010-01-01

    ... PROGRAM FOR CONSUMER PRODUCTS Test Procedures Pt. 430, Subpt. B, App. I Appendix I to Subpart B of Part... between the center and the corners of the conventional gas oven on the diagonals of a horizontal plane...

  7. Conventional and digital radiographic methods in the detection of simulated external root resorptions: A comparative study

    Directory of Open Access Journals (Sweden)

    C J Sanjay

    2009-01-01

    Full Text Available Objective : To evaluate and compare the efficacy of conventional and digital radiographic methods in the detection of simulated external root resorption cavities and also to evaluate whether the detectability was influenced by resorption cavity sizes. Methods : Thirty-two selected teeth from human dentate mandibles were radiographed in orthoradial, mesioradial and distoradial aspect using conventional film (Insight Kodak F-speed; Eastman Kodak, Rochester, NY and a digital sensor (Trophy RVG advanced imaging system with 0.7mm and 1.0mm deep cavities prepared on their vestibular, mesial and distal surfaces at the cervical, middle and apical thirds. Three dental professionals, an endodontist, a radiologist and a general practitioner, evaluated the images twice with a one-week time interval. Results : No statistical significance was seen in the first observation for both conventional and digital radiographic methods in the detection of simulated external root resorptions and for small and medium cavities but statistical difference was noted in the second observation (P< 0.001 for both the methods. Conclusion : Considering the methodology and the overall results, conventional radiographic method (F-speed performed slightly better than the digital radiographic method in the detection of simulated radiographic method but better consistency was seen with the digital system. Overall size of the resorption cavity had no influence on the performance of both methods and suggests that initial external root resorption lesion is not well-appreciated with both the methods as compared to the advanced lesion.

  8. 'Living PRA' concept for plant risk: Reliability and availability tracking

    International Nuclear Information System (INIS)

    Sancaktar, S.; Sharp, D.R.

    1985-01-01

    The 'Living PRA' (Probabilistic Risk Assessment) is based on placing a PRA plant model on an interactive computer. This model consists of fault tree analyses for plant systems, event tree analyses for abnormal events and site specific consequence analysis for public and/or financial risks, for a nuclear power plant. A living PRA allows updates and sensitivity analyses by the plant owner throughout the lifetime of a plant. Recently, event and fault trees from two major PRAs were placed in a computerized format. The BYRON PRA study and the Living PRA and Economic Risk examples for Indian Point Unit-3 enabled analysts to gain experience and insight into the problems of plant operation. The above concept is well established for the Nuclear Power Plant evaluation. It has been also used for evaluation of processing facilities. In these studies, systems modeling was carried out by using the GRAFTER system for automated fault tree construction. Presently both the tools and the experience exists to set up useful and viable living PRA models for nuclear and chemical processing plants to enhance risk management by the plant owners through in-house use of micro computer based models

  9. Application of determination of PRA, Ang II and IGF-1 levels in the study of typing of essential hypertension

    International Nuclear Information System (INIS)

    Lu Yongyi; Chen Qun; Yang Yongqing

    2010-01-01

    Objective: To study the clinical application of determination of plasma renin activity (PRA), Angiotensin II (Ang II ) and insulin-like growth factor-1 (IGF-1) levels in typing of essential hypertension (EH). Methods: Determined the levels of PRA and Aug II in 256 patients with EH and 70 healthy volunteers (as control group) by radioimmunoassay, and measured IGF-1 level by enzyme immunoassay. Research on the typing of EH and the difference between the groups. Results: The PRA and Ang II in control group was (0.432±0.236) μg·L -1 ·h -1 and (31.7±7.4) μg/L respectively. In 256 patients with EH, PRA was increased, normal and decreased in 18.0%, 71.8% and 10.2% respectively, while the level of Ang II was increased, normal and decreased in 12.9%, 76.2% and 10.9% respectively. The IGF-1 levels in 256 patients with EH were increased following the increase of blood pressure. Conclusion: Typing of EH patients with PRA and Ang II as well as the determination of IGF-1 were useful in treating and following up the patients with EH. (authors)

  10. The clinical significance of computerized axial tomography (CAT) in consideration of conventional diagnostic methods

    International Nuclear Information System (INIS)

    Huenig, R.

    1976-01-01

    Regarding CAT of the intracranial region, the article informs on a) techniques of examination including the production of normal structures, b) the recognizable pathological changes, c) possibilities of enhancement, d) possibilities of course observation, e) limitations of the methods, as well as on f) risk/benefit aspects g) benefit/cost calculations as compared to conventional methods, and on h) the influence of CAT on the frequency of conventional methods of examination. Regarding CAT of the extracranial region, the information available up to the meeting is reported on. (orig./LH) [de

  11. Comparison between laser terahertz emission microscope and conventional methods for analysis of polycrystalline silicon solar cell

    Directory of Open Access Journals (Sweden)

    Hidetoshi Nakanishi

    2015-11-01

    Full Text Available A laser terahertz emission microscope (LTEM can be used for noncontact inspection to detect the waveforms of photoinduced terahertz emissions from material devices. In this study, we experimentally compared the performance of LTEM with conventional analysis methods, e.g., electroluminescence (EL, photoluminescence (PL, and laser beam induced current (LBIC, as an inspection method for solar cells. The results showed that LTEM was more sensitive to the characteristics of the depletion layer of the polycrystalline solar cell compared with EL, PL, and LBIC and that it could be used as a complementary tool to the conventional analysis methods for a solar cell.

  12. Comparison of the efficacy of conventional slow freezing and rapid cryopreservation methods for bovine embryos

    NARCIS (Netherlands)

    Wagtendonk-de Leeuw, van A.M.; Daas, den J.H.; Kruip, T.A.; Rail, W.F.

    1995-01-01

    Day 7 bovine morulae and early blastocysts were randomly assigned to one of four cryopreservation methods: (i) a modified conventional controlled slow freezing and stepwise dilution after thawing; and three methods which enable direct transfer of the embryo into the recipient upon thawing: (ii)

  13. A Conceptual Design and Analysis Method for Conventional and Unconventional Airplanes

    NARCIS (Netherlands)

    Elmendorp, R.J.M.; Vos, R.; La Rocca, G.

    2014-01-01

    A design method is presented that has been implemented in a software program to investigate the merits of conventional and unconventional transport airplanes. Design and analysis methods are implemented in a design tool capable of creating a conceptual design based on a set of toplevel requirements.

  14. Advanced Small Modular Reactor (SMR) Probabilistic Risk Assessment (PRA) Technical Exchange Meeting

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Curtis [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2013-09-01

    During FY13, the INL developed an advanced SMR PRA framework which has been described in the report Small Modular Reactor (SMR) Probabilistic Risk Assessment (PRA) Detailed Technical Framework Specification, INL/EXT-13-28974 (April 2013). In this framework, the various areas are considered: Probabilistic models to provide information specific to advanced SMRs Representation of specific SMR design issues such as having co-located modules and passive safety features Use of modern open-source and readily available analysis methods Internal and external events resulting in impacts to safety All-hazards considerations Methods to support the identification of design vulnerabilities Mechanistic and probabilistic data needs to support modeling and tools In order to describe this framework more fully and obtain feedback on the proposed approaches, the INL hosted a technical exchange meeting during August 2013. This report describes the outcomes of that meeting.

  15. Why conventional detection methods fail in identifying the existence of contamination events.

    Science.gov (United States)

    Liu, Shuming; Li, Ruonan; Smith, Kate; Che, Han

    2016-04-15

    Early warning systems are widely used to safeguard water security, but their effectiveness has raised many questions. To understand why conventional detection methods fail to identify contamination events, this study evaluates the performance of three contamination detection methods using data from a real contamination accident and two artificial datasets constructed using a widely applied contamination data construction approach. Results show that the Pearson correlation Euclidean distance (PE) based detection method performs better for real contamination incidents, while the Euclidean distance method (MED) and linear prediction filter (LPF) method are more suitable for detecting sudden spike-like variation. This analysis revealed why the conventional MED and LPF methods failed to identify existence of contamination events. The analysis also revealed that the widely used contamination data construction approach is misleading. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Uncertainty and sensitivity studies supporting the interpretation of the results of TVO I/II PRA

    International Nuclear Information System (INIS)

    Holmberg, J.

    1992-01-01

    A comprehensive Level 1 probabilistic risk assessment (PRA) has been performed for the TVO I/II nuclear power units. As a part of the PRA project, uncertainties of risk models and methods were systematically studied in order to describe them and to demonstrate their impact by way of results. The uncertainty study was divided into two phases: a qualitative and a quantitative study. The qualitative study contained identification of uncertainties and qualitative assessments of their importance. The PRA was introduced, and identified assumptions and uncertainties behind the models were documented. The most significant uncertainties were selected by importance measures or other judgements for further quantitative studies. The quantitative study included sensitivity studies and propagation of uncertainty ranges. In the sensitivity studies uncertain assumptions or parameters were varied in order to illustrate the sensitivity of the models. The propagation of the uncertainty ranges demonstrated the impact of the statistical uncertainties of the parameter values. The Monte Carlo method was used as a propagation method. The most significant uncertainties were those involved in modelling human interactions, dependences and common cause failures (CCFs), loss of coolant accident (LOCA) frequencies and pressure suppression. The qualitative mapping out of the uncertainty factors turned out to be useful in planning quantitative studies. It also served as internal review of the assumptions made in the PRA. The sensitivity studies were perhaps the most advantageous part of the quantitative study because they allowed individual analyses of the significance of uncertainty sources identified. The uncertainty study was found reasonable in systematically and critically assessing uncertainties in a risk analysis. The usefulness of this study depends on the decision maker (power company) since uncertainty studies are primarily carried out to support decision making when uncertainties are

  17. Development of fire PRA methodologies for the analysis of typical Italian NPP designs

    International Nuclear Information System (INIS)

    Silvestri, E.; Dore, B.; Ferro, G.; Apostolakis, G.

    1987-01-01

    To compute fire induced Core Melt probability, the results of hazard and propagation analyses were combined with the Core Melt frequency computed for the initiating event and the support state as determined by the fire considered. From the PRA for internal event, the average value of this frequency was found 2.5x10 -3 event/year. Using the average fire frequency the resulting fire induced Core Melt frequency is 1.4x10 -8 event/year. Although high separation of safety systems is required in Italian PWR plants, the frequency of fire induced Core Melt can reach values not negligible with respect to Italian safety standards. For this reason, fire PRA studies for the entire plant are considered necessary and should be performed with appropriate modifications of the methods used for the American plants in order to be able to estimate lower fire induced Core Melt frequencies. (orig./HP)

  18. The comparative evaluation of patients′ body dry weight under hemodialysis using two methods: Bioelectrical impedance analysis and conventional method

    Directory of Open Access Journals (Sweden)

    Neda Alijanian

    2012-01-01

    Full Text Available Background: Dry weight (DW is an important concept related to patients undergoing hemodialysis. Conventional method seems to be time consuming and operator dependent. Bio impedance analysis (BIA is a new and simple method reported to be an accurate way for estimating DW. In this study, we aimed to compare the conventional estimation of DW with measuring DW by BIA. Materials and Methods: This study involved 130 uremic patients, performed in Isfahan, Iran. DW was calculated by both conventional (CDW and BIA (BIADW method and results were compared based on different grouping factors including sex, underlying cause of renal failure (RF (diabetic RF and non-diabetic RF, body mass index (BMI status, and sessions of hemodialysis. We also calculated the difference between DWs of 2 methods (DW diff = CDW-BIADW. Results: The mean of BIADW was significantly lower than CDW (57.20 ± 1.82 vs 59.36 ± 1.77, P value < 0.001. After grouping cases according to the underlying cause, BMI, sex, and dialysis sessions BIADW was significantly lower than CDW. Conclusion: Based on the combination of problems with CDW measurement which are corrected by BIA, and more clinical reliability of CDW, we concluded that although conventional method is a time-consuming and operator-dependent way to assess DW, DW could be estimated by combining both of these methods by finding the mathematic correlation between these methods.

  19. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-03-01

    Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; digitized scannable vinylsiloxanether, VSES-D; and irreversible hydrocolloid, ALG) and 7 digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; Lava COS, LAV; Lava True Definition Scanner, T-Def; 3Shape Trios, TRI; and 3Shape Trios Color, TRC) techniques. Impressions were made 3 times each in 5 participants (N=15). The impressions were then compared within and between the test groups. The cast surfaces were measured point-to-point using the signed nearest neighbor method. Precision was calculated from the (90%-10%)/2 percentile value. The precision ranged from 12.3 μm (VSE) to 167.2 μm (ALG), with the highest precision in the VSE and VSES groups. The deviation pattern varied distinctly according to the impression method. Conventional impressions showed the highest accuracy across the complete dental arch in all groups, except for the ALG group. Conventional and digital impression methods differ significantly in the complete-arch accuracy. Digital impression systems had higher local deviations within the complete arch cast; however, they achieve equal and higher precision than some conventional impression materials. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  20. A new method to characterize dopant profiles in NMOSFETs using conventional transmission electron microscopy

    International Nuclear Information System (INIS)

    Kawamura, Kazuo; Ikeda, Kazuto; Terauchi, Masami

    2004-01-01

    We have developed a new method using conventional transmission electron microscopy (TEM) to obtain two dimensional dopant profiles in silicon and applied it to 40 nm-gate-length N + /p metal oxide semiconductor field effect transistors (MOSFETs). The results are consistent with those of selective-chemically etched samples observed by TEM. This method, using focused ion beam (FIB) sample preparation and conventional TEM, has the great advantage of simple sample preparation and high spatial resolution compared to other characterization methods, such as atomic capacitance microscopy, spreading resistance microscopy, and TEM combined with selective chemical etching. This indicates that this method can be applicable to the analysis of FETs at the 65 nm or smaller node

  1. Conventional and Alternative Disinfection Methods of Legionella in Water Distribution Systems – Review

    Directory of Open Access Journals (Sweden)

    Pūle Daina

    2016-12-01

    Full Text Available Prevalence of Legionella in drinking water distribution systems is a widespread problem. Outbreaks of Legionella caused diseases occur despite various disinfectants are used in order to control Legionella. Conventional methods like thermal disinfection, silver/copper ionization, ultraviolet irradiation or chlorine-based disinfection have not been effective in the long term for control of biofilm bacteria. Therefore, research to develop more effective disinfection methods is still necessary.

  2. Current and future applications of PRA in regulatory activities

    Energy Technology Data Exchange (ETDEWEB)

    Speis, T.P.; Murphy, J.A.; Cunningham, M.A. [Nuclear Regulatory Commission, Washington, DC (United States)] [and others

    1995-04-01

    Probabilistic Risk Assessments (PRAs) have proven valuable in providing the regulators, the nuclear plant operators, and the reactor designers insights into plant safety, reliability, design and operation. Both the NRC Commissioners and the staff have grown to appreciate the valuable contributions PRAs can have in the regulatory arena, though I will admit the existence of some tendencies for strict adherence to the deterministic approach within the agency and the public at large. Any call for change, particularly one involving a major adjustment in approach to the regulation of nuclear power, will meet with a certain degree of resistance and retrenchment. Change can appear threatening and can cause some to question whether the safety mission is being fulfilled. This skepticism is completely appropriate and is, in fact, essential to a proper transition towards risk and performance-based approaches. Our task in the Office of Nuclear Regulatory Research is to increase the PRA knowledge base within the agency and develop appropriate guidance and methods needed to support the transitioning process.

  3. Methods for assessing phosphorus overfeeding on organic and conventional dairy farms.

    Science.gov (United States)

    Nordqvist, M; Holtenius, K; Spörndly, R

    2014-02-01

    Phosphorus (P) losses from dairy farms can severely damage aquatic ecosystems, so it is important to have tools to assess overfeeding of P. This study screened P intake and faecal excretion of different P fractions in dairy cows on conventional and organic farms, compared the P feeding level of the herds against the recommendations and analysed different sampling and analysis methods for assessing the general status of P feeding on the farms. The organic (n=14) and conventional farms (n=15) were of comparable size and were located in southern Sweden. On each farm, feed intake was registered for 10 cows representing four different lactation stages and their P intake was calculated and related to current recommendations. Faecal samples taken from the same cows were analysed for total P (TP) and soluble P. Milk production data for the cows were obtained from the Swedish official milk recording scheme. TP was determined in one slurry sample per farm. More than 70% of the cows studied, representing both conventional and organic herds, consumed P in excess of the recommendations. Conventional herds had higher P content in the ration than organic herds, and lactating cows in conventional herds had higher faecal concentrations of total and soluble P than those in organic herds. However in dry cows, the P content of the ration and soluble P and TP in faeces did not differ between the two management systems. Soluble P was well correlated to TP in faeces, and both were good indicators of P overfeeding.

  4. Development of a methodology for conducting an integrated HRA/PRA --

    International Nuclear Information System (INIS)

    Luckas, W.J.; Barriere, M.T.; Brown, W.S.; Wreathall, J.; Cooper, S.E.

    1993-01-01

    During Low Power and Shutdown (LP ampersand S) conditions in a nuclear power plant (i.e., when the reactor is subcritical or at less than 10--15% power), human interactions with the plant's systems will be more frequent and more direct. Control is typically not mediated by automation, and there are fewer protective systems available. Therefore, an assessment of LP ampersand S related risk should include a greater emphasis on human reliability than such an assessment made for power operation conditions. In order to properly account for the increase in human interaction and thus be able to perform a probabilistic risk assessment (PRA) applicable to operations during LP ampersand S, it is important that a comprehensive human reliability assessment (HRA) methodology be developed and integrated into the LP ampersand S PRA. The tasks comprising the comprehensive HRA methodology development are as follows: (1) identification of the human reliability related influences and associated human actions during LP ampersand S, (2) identification of potentially important LP ampersand S related human actions and appropriate HRA framework and quantification methods, and (3) incorporation and coordination of methodology development with other integrated PRA/HRA efforts. This paper describes the first task, i.e., the assessment of human reliability influences and any associated human actions during LP ampersand S conditions for a pressurized water reactor (PWR)

  5. Development of a methodology for conducting an integrated HRA/PRA --

    Energy Technology Data Exchange (ETDEWEB)

    Luckas, W.J.; Barriere, M.T.; Brown, W.S. (Brookhaven National Lab., Upton, NY (United States)); Wreathall, J. (Wreathall (John) and Co., Dublin, OH (United States)); Cooper, S.E. (Science Applications International Corp., McLean, VA (United States))

    1993-01-01

    During Low Power and Shutdown (LP S) conditions in a nuclear power plant (i.e., when the reactor is subcritical or at less than 10--15% power), human interactions with the plant's systems will be more frequent and more direct. Control is typically not mediated by automation, and there are fewer protective systems available. Therefore, an assessment of LP S related risk should include a greater emphasis on human reliability than such an assessment made for power operation conditions. In order to properly account for the increase in human interaction and thus be able to perform a probabilistic risk assessment (PRA) applicable to operations during LP S, it is important that a comprehensive human reliability assessment (HRA) methodology be developed and integrated into the LP S PRA. The tasks comprising the comprehensive HRA methodology development are as follows: (1) identification of the human reliability related influences and associated human actions during LP S, (2) identification of potentially important LP S related human actions and appropriate HRA framework and quantification methods, and (3) incorporation and coordination of methodology development with other integrated PRA/HRA efforts. This paper describes the first task, i.e., the assessment of human reliability influences and any associated human actions during LP S conditions for a pressurized water reactor (PWR).

  6. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    International Nuclear Information System (INIS)

    Kouchakzadeh, Ahmad; Tavakoli, Teymur

    2011-01-01

    Highlights: → Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. → Using thermophysical properties of air and matter. → This manner could be utilized in similar dryer for other agricultural products. → Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  7. New practical method for evaluation of a conventional flat plate continuous pistachio dryer

    Energy Technology Data Exchange (ETDEWEB)

    Kouchakzadeh, Ahmad [Agri Machinery Engineering, Ilam University, Ilam (Iran, Islamic Republic of); Tavakoli, Teymur [Agri Machinery Engineering, Tarbyat Modares University, Tehran (Iran, Islamic Republic of)

    2011-07-15

    Highlights: {yields} Evaluation of a conventional flat plate continuous pistachio dryer with a new feasible method. {yields} Using thermophysical properties of air and matter. {yields} This manner could be utilized in similar dryer for other agricultural products. {yields} Method shows the heat loss and power separately. -- Abstract: Testing a dryer is necessary to evaluate its absolute and comparative performance with other dryers. A conventional flat plate continuous pistachio dryer was tested by a new practical method of mass and energy equilibrium. Results showed that the average power consumption and heat loss in three tests are 62.13 and 18.99 kW, respectively. The ratio of heat loss on power consumption showed that the efficiency of practical pistachios flat plate dryer is about 69.4%.

  8. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology

    Directory of Open Access Journals (Sweden)

    Udasimath Shivakumarswamy

    2012-01-01

    Full Text Available Background: The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS method. Aims: To compare the morphological features of the CS method with those of the cell block (CB method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. Materials and Methods: The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the ′z test′ was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer′s χ2 test was used to identify the additional yield for malignancy by the CB method. Results: Cellularity and additional yield for malignancy was 15% more by the CB method. Conclusions: The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  9. PRA and the implementation of quantitative safety goals

    International Nuclear Information System (INIS)

    Okrent, D.

    1983-01-01

    With the adoption by the U.S. Nuclear Regulatory Commission (NRC) in January, 1983, of a Policy Statement on Safety Goals for the Operation of Nuclear Power Plants, probabilitstic risk assessment (PRA) has taken on increased importance in nuclear reactor safety. Although the Reactor Safety Study, WASH-1400, was a major pioneering effort that revolutionized thinking about reactor safety, PRA was used only on occasion by the NRC regulatory staff prior to the accident at Three Mile Island. Since then, PRA has been used more and more as an important factor in decision making, usually for specific issues. The nuclear industry has also employed PRA, sometimes to make its case on specific issues, sometimes to present a position on overall risk. The advent of the Zion and Indian Point PRAs, with their treatment of risks from fire, wind, and earthquakes, and their examination of the course of core melt accidents, has added a new dimension to the overall picture. Although the NRC has stated that during the next two year evolution period, its quantitative design objectives and PRA are not to enter directly into the licensing process, many important issues will be influenced significantly by the results of risk and reliability studies. In fact, PRA may be coming into a position of great importance before the methodology, data, and process are sufficiently mature for the task. Large gaps still exist in our understanding of phenomena and in input information; and much of the final result depends on subjective input; large differences of opinion can and should be expected to persist. Accepted standards for quality assurance, and adequacy and depth of independent, peer review remain to be formulated and achieved. This paper will summarize the recently adopted NRC safety policy and the two-year evaluation plan, and will provide, by example, some words of caution concerning a few of the difficulties which may arise. (orig.)

  10. Probabilistic Risk Assessment (PRA): A Practical and Cost Effective Approach

    Science.gov (United States)

    Lee, Lydia L.; Ingegneri, Antonino J.; Djam, Melody

    2006-01-01

    The Lunar Reconnaissance Orbiter (LRO) is the first mission of the Robotic Lunar Exploration Program (RLEP), a space exploration venture to the Moon, Mars and beyond. The LRO mission includes spacecraft developed by NASA Goddard Space Flight Center (GSFC) and seven instruments built by GSFC, Russia, and contractors across the nation. LRO is defined as a measurement mission, not a science mission. It emphasizes the overall objectives of obtaining data to facilitate returning mankind safely to the Moon in preparation for an eventual manned mission to Mars. As the first mission in response to the President's commitment of the journey of exploring the solar system and beyond: returning to the Moon in the next decade, then venturing further into the solar system, ultimately sending humans to Mars and beyond, LRO has high-visibility to the public but limited resources and a tight schedule. This paper demonstrates how NASA's Lunar Reconnaissance Orbiter Mission project office incorporated reliability analyses in assessing risks and performing design tradeoffs to ensure mission success. Risk assessment is performed using NASA Procedural Requirements (NPR) 8705.5 - Probabilistic Risk Assessment (PRA) Procedures for NASA Programs and Projects to formulate probabilistic risk assessment (PRA). As required, a limited scope PRA is being performed for the LRO project. The PRA is used to optimize the mission design within mandated budget, manpower, and schedule constraints. The technique that LRO project office uses to perform PRA relies on the application of a component failure database to quantify the potential mission success risks. To ensure mission success in an efficient manner, low cost and tight schedule, the traditional reliability analyses, such as reliability predictions, Failure Modes and Effects Analysis (FMEA), and Fault Tree Analysis (FTA), are used to perform PRA for the large system of LRO with more than 14,000 piece parts and over 120 purchased or contractor

  11. Selecting the patients for morning report sessions: case-based vs. conventional method.

    Science.gov (United States)

    Rabiei, Mehdi; Saeidi, Masumeh; Kiani, Mohammad Ali; Amin, Sakineh Mohebi; Ahanchian, Hamid; Jafari, Seyed Ali; Kianifar, Hamidreza

    2015-08-01

    One of the most important issues in morning report sessions is the number of patients. The aim of this study was to investigate and compare the number of cases reported in the morning report sessions in terms of case-based and conventional methods from the perspective of pediatric residents of Mashhad University of Medical Sciences. The present study was conducted on 24 pediatric residents of Mashhad University of Medical Sciences in the academic year 2014-2015. In this survey, the residents replied to a 20-question researcher-made questionnaire that had been designed to measure the views of residents regarding the number of patients in the morning report sessions using case-based and conventional methods. The validity of the questionnaire was confirmed by experts' views and its reliability by calculating Cronbach's alpha coefficients. Data were analyzed by t-test analysis. The mean age of the residents was 30.852 ± 2.506, and 66.6% of them were female. The results showed that there was no significant relationship among the variables of academic year, gender, and residents' perspective to choosing the number of patients in the morning report sessions (P > 0.05). T-test analysis showed a significant relationship among the average scores of residents in the selection of the case-based method in comparison to the conventional method (P case-based morning report was preferred compared to the conventional method. This method makes residents pay more attention to the details of patients' issues and therefore helps them to better plan how to address patient problems and improve their differential diagnosis skills.

  12. Comparison of multimedia system and conventional method in patients’ selecting prosthetic treatment

    Directory of Open Access Journals (Sweden)

    Baghai R

    2010-12-01

    Full Text Available "nBackground and Aims: Selecting an appropriate treatment plan is one of the most critical aspects of dental treatments. The purpose of this study was to compare multimedia system and conventional method in patients' selecting prosthetic treatment and the time consumed."nMaterials and Methods: Ninety patients were randomly divided into three groups. Patients in group A, once were instructed using the conventional method of dental office and once multimedia system and time was measured in seconds from the beginning of the instruction till the patient had came to decision. The patients were asked about the satisfaction of the method used for them. In group B, patients were only instructed using the conventional method, whereas they were only exposed to soft ware in group C. The data were analyzed with Paired-T-test"n(in group A and T-test and Mann-Whitney test (in groups B and C."nResult: There was a significant difference between multimedia system and conventional method in group A and also between groups B and C (P<0.001. In group A and between groups B and C, patient's satisfaction about multimedia system was better. However, in comparison between groups B and C, multimedia system did not have a significant effect in treatment selection score (P=0.08."nConclusion: Using multimedia system is recommended due to its high ability in giving answers to a large number of patient's questions as well as in terms of marketing.

  13. Conservation Farming and Changing Climate: More Beneficial than Conventional Methods for Degraded Ugandan Soils

    Directory of Open Access Journals (Sweden)

    Drake N. Mubiru

    2017-06-01

    Full Text Available The extent of land affected by degradation in Uganda ranges from 20% in relatively flat and vegetation-covered areas to 90% in the eastern and southwestern highlands. Land degradation has adversely affected smallholder agro-ecosystems including direct damage and loss of critical ecosystem services such as agricultural land/soil and biodiversity. This study evaluated the extent of bare grounds in Nakasongola, one of the districts in the Cattle Corridor of Uganda and the yield responses of maize (Zea mays and common bean (Phaseolus vulgaris L. to different tillage methods in the district. Bare ground was determined by a supervised multi-band satellite image classification using the Maximum Likelihood Classifier (MLC. Field trials on maize and bean grain yield responses to tillage practices used a randomized complete block design with three replications, evaluating conventional farmer practice (CFP; permanent planting basins (PPB; and rip lines, with or without fertilizer in maize and bean rotations. Bare ground coverage in the Nakasongola District was 187 km2 (11% of the 1741 km2 of arable land due to extreme cases of soil compaction. All practices, whether conventional or the newly introduced conservation farming practices in combination with fertilizer increased bean and maize grain yields, albeit with minimal statistical significance in some cases. The newly introduced conservation farming tillage practices increased the bean grain yield relative to conventional practices by 41% in PPBs and 43% in rip lines. In maize, the newly introduced conservation farming tillage practices increased the grain yield by 78% on average, relative to conventional practices. Apparently, conservation farming tillage methods proved beneficial relative to conventional methods on degraded soils, with the short-term benefit of increasing land productivity leading to better harvests and food security.

  14. Effectiveness of Video Demonstration over Conventional Methods in Teaching Osteology in Anatomy.

    Science.gov (United States)

    Viswasom, Angela A; Jobby, Abraham

    2017-02-01

    Technology and its applications are the most happening things in the world. So, is it in the field of medical education. This study was an evaluation of whether the conventional methods can compete with the test of technology. A comparative study of traditional method of teaching osteology in human anatomy with an innovative visual aided method. The study was conducted on 94 students admitted to MBBS 2014 to 2015 batch of Travancore Medical College. The students were divided into two academically validated groups. They were taught using conventional and video demonstrational techniques in a systematic manner. Post evaluation tests were conducted. Analysis of the mark pattern revealed that the group taught using traditional method scored better when compared to the visual aided method. Feedback analysis showed that, the students were able to identify bony features better with clear visualisation and three dimensional view when taught using the video demonstration method. The students identified visual aided method as the more interesting one for learning which helped them in applying the knowledge gained. In most of the questions asked, the two methods of teaching were found to be comparable on the same scale. As the study ends, we discover that, no new technique can be substituted for time tested techniques of teaching and learning. The ideal method would be incorporating newer multimedia techniques into traditional classes.

  15. Diagnostic utility of the cell block method versus the conventional smear study in pleural fluid cytology.

    Science.gov (United States)

    Shivakumarswamy, Udasimath; Arakeri, Surekha U; Karigowdar, Mahesh H; Yelikar, Br

    2012-01-01

    The cytological examinations of serous effusions have been well-accepted, and a positive diagnosis is often considered as a definitive diagnosis. It helps in staging, prognosis and management of the patients in malignancies and also gives information about various inflammatory and non-inflammatory lesions. Diagnostic problems arise in everyday practice to differentiate reactive atypical mesothelial cells and malignant cells by the routine conventional smear (CS) method. To compare the morphological features of the CS method with those of the cell block (CB) method and also to assess the utility and sensitivity of the CB method in the cytodiagnosis of pleural effusions. The study was conducted in the cytology section of the Department of Pathology. Sixty pleural fluid samples were subjected to diagnostic evaluation for over a period of 20 months. Along with the conventional smears, cell blocks were prepared by using 10% alcohol-formalin as a fixative agent. Statistical analysis with the 'z test' was performed to identify the cellularity, using the CS and CB methods. Mc. Naemer's χ(2)test was used to identify the additional yield for malignancy by the CB method. Cellularity and additional yield for malignancy was 15% more by the CB method. The CB method provides high cellularity, better architectural patterns, morphological features and an additional yield of malignant cells, and thereby, increases the sensitivity of the cytodiagnosis when compared with the CS method.

  16. Interphase Chromosome Profiling: A Method for Conventional Banded Chromosome Analysis Using Interphase Nuclei.

    Science.gov (United States)

    Babu, Ramesh; Van Dyke, Daniel L; Dev, Vaithilingam G; Koduru, Prasad; Rao, Nagesh; Mitter, Navnit S; Liu, Mingya; Fuentes, Ernesto; Fuentes, Sarah; Papa, Stephen

    2018-02-01

    - Chromosome analysis on bone marrow or peripheral blood samples fails in a small proportion of attempts. A method that is more reliable, with similar or better resolution, would be a welcome addition to the armamentarium of the cytogenetics laboratory. - To develop a method similar to banded metaphase chromosome analysis that relies only on interphase nuclei. - To label multiple targets in an equidistant fashion along the entire length of each chromosome, including landmark subtelomere and centromere regions. Each label so generated by using cloned bacterial artificial chromosome probes is molecularly distinct with unique spectral characteristics, so the number and position of the labels can be tracked to identify chromosome abnormalities. - Interphase chromosome profiling (ICP) demonstrated results similar to conventional chromosome analysis and fluorescence in situ hybridization in 55 previously studied cases and obtained useful ICP chromosome analysis results on another 29 cases in which conventional methods failed. - ICP is a new and powerful method to karyotype peripheral blood and bone marrow aspirate preparations without reliance on metaphase chromosome preparations. It will be of particular value for cases with a failed conventional analysis or when a fast turnaround time is required.

  17. Evaluation of stream discharges measurement using radioisotope and conventional method at Sungai Weng catchment area, Kedah

    International Nuclear Information System (INIS)

    Nazrul Hizam Yusoff and Wan Zakaria Wan MuhdTahir

    2006-01-01

    A number of discharge measurements using radioisotope and current metering techniques at selected streams in Sg. Weng Experimental Catchment were conducted by MINT and JPS gauging teams starting from 2003-2005. This study aims to prepare stage-discharge relationships or rating curves of the selected streams during variable flow conditions. The rating curve of the stream is one of the important parameters and usually appraised in certain routine operations of hydrological studies. It may be used in the planning of water resources management and flood control scheme. The radioisotope method employed in this study involved the injection of short-lived radioisotope tracer, that is, technetium-99m ( 99m Tc having its half-life ∼ 6.023 hrs) which was supplied from a high activity technetium generator (55.5 Gbq). Measurement of stream discharges were concurrently undertaken by JPS staff using a current meter type 0TT-C2 mounted on a wading rod at selected gauging stations for comparison purposes. Methodologies from the two methods of discharge measurements, comparison of results and identifying the uncertainties (errors) in performing the measurement during low, medium and high turbulent flows were explained in this paper. Generally, the entire results of streamflow data (2003-2005) measured by both methods during low flows (Q 3 /s) exhibit almost comparable values to each other. However, for moderate flows (1.0 m 3 /s 3 /s), the different in gauging results are slightly higher using radioisotope method ( i.e. Q isotope > Q current meter and may goes up to 40%) , and during high turbulent flows (Q>6.0 m 3 /s) the radioisotope method presented more than 40% higher discharge values as compared to the measurement made by the conventional current-meter. Observation made on site anticipated that inaccurate gauging data measured by conventional means during high flow and turbulent conditions are expected. The average estimated measurement error associated with isotope method

  18. Imaging method of brain surface anatomy structures using conventional T2-weighted MR images

    International Nuclear Information System (INIS)

    Hatanaka, Masahiko; Machida, Yoshio; Yoshida, Tadatoki; Katada, Kazuhiro.

    1992-01-01

    As a non-invasive technique for visualizing the brain surface structure by MRI, surface anatomy scanning (SAS) and the multislice SAS methods have been developed. Both techniques require additional MRI scanning to obtain images for the brain surface. In this paper, we report an alternative method to obtain the brain surface image using conventional T2-weighted multislice images without any additional scanning. The power calculation of the image pixel values, which is incorporated in the routine processing, has been applied in order to enhance the cerebrospinal fluid (CSF) contrast. We think that this method is one of practical approaches for imaging the surface anatomy of the brain. (author)

  19. Evaluation of positional plagiocephaly: Conventional anthropometric measurement versus laser scanning method.

    Science.gov (United States)

    Nahles, Susanne; Klein, Martin; Yacoub, Anke; Neyer, Julia

    2018-01-01

    The incidence of plagiocephaly has increased in the 25 years since the "Back to Sleep" campaign in 1991 to prevent sudden infant death. Plagiocephaly is not considered to be a pathological condition. It is more of an esthetic impairment and could have potentially negative psychological or psychosocial consequences; therefore, treatment is recommended. The aim of this study is to compare conventional anthropometry and laser scanning - two different measurement methods - as diagnostic instruments for plagiocephaly. The present study also tests the measurement time of both methods and whether one method is easier on the patient than the other. A total of 44 children (21 girls, 23 boys) with a mean age of 8.8 months were involved in the present study. Of all patients, the following parameters were routinely evaluated using a standard protocol with the conventional anthropometric method and the scan method: head circumference, head length, head width, head diagonals, and distances ex-t. Furthermore, the time required to obtain measurements and the behavior of the children during measurement were documented. For statistical analysis, a t-test and a Wilcoxon test were used to analyze differences between the two methods. The results for head circumference showed a mean of 441.5 mm for the anthropometric measurements and 441.6 mm for the scan method, with no significant difference between the two methods. A significant difference was found regarding the head width, head length, diagonals, and distance ex-t. The measurement process using the scan method needed a mean of 579.6 s in contrast to the manual anthropometric method, which required a mean time of 180.5 s. In comparison with the conventional anthropometric method, measurements made with a 3D laser scanner yield inconsistent results. Moreover, the current state of technology of 3D cephalometry has no advantages compared with the conventional anthropometric method. Disadvantages worth mentioning appear to be the

  20. Comparison of Different Recruitment Methods for Sexual and Reproductive Health Research: Social Media-Based Versus Conventional Methods.

    Science.gov (United States)

    Motoki, Yoko; Miyagi, Etsuko; Taguri, Masataka; Asai-Sato, Mikiko; Enomoto, Takayuki; Wark, John Dennis; Garland, Suzanne Marie

    2017-03-10

    Prior research about the sexual and reproductive health of young women has relied mostly on self-reported survey studies. Thus, participant recruitment using Web-based methods can improve sexual and reproductive health research about cervical cancer prevention. In our prior study, we reported that Facebook is a promising way to reach young women for sexual and reproductive health research. However, it remains unknown whether Web-based or other conventional recruitment methods (ie, face-to-face or flyer distribution) yield comparable survey responses from similar participants. We conducted a survey to determine whether there was a difference in the sexual and reproductive health survey responses of young Japanese women based on recruitment methods: social media-based and conventional methods. From July 2012 to March 2013 (9 months), we invited women of ages 16-35 years in Kanagawa, Japan, to complete a Web-based questionnaire. They were recruited through either a social media-based (social networking site, SNS, group) or by conventional methods (conventional group). All participants enrolled were required to fill out and submit their responses through a Web-based questionnaire about their sexual and reproductive health for cervical cancer prevention. Of the 243 participants, 52.3% (127/243) were recruited by SNS, whereas 47.7% (116/243) were recruited by conventional methods. We found no differences between recruitment methods in responses to behaviors and attitudes to sexual and reproductive health survey, although more participants from the conventional group (15%, 14/95) chose not to answer the age of first intercourse compared with those from the SNS group (5.2%, 6/116; P=.03). No differences were found between recruitment methods in the responses of young Japanese women to a Web-based sexual and reproductive health survey. ©Yoko Motoki, Etsuko Miyagi, Masataka Taguri, Mikiko Asai-Sato, Takayuki Enomoto, John Dennis Wark, Suzanne Marie Garland. Originally

  1. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    OpenAIRE

    A Pourkhalili; M Mirlohi; E Rahimi; M Hojatoleslami

    2012-01-01

    Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying a...

  2. Loss of coolant accident (LOCA) analysis for McMaster Nuclear Reactor through probabilistic risk assessment (PRA)

    Energy Technology Data Exchange (ETDEWEB)

    Ha, T.; Garland, W.J. [McMaster Univ., Dept. of Engineering Physics, Hamilton, Ontario (Canada)]. E-mail: hats@mcmaster.ca

    2006-07-01

    A probabilistic risk assessment (PRA) was conducted for the loss of coolant accident (LOCA) sequence in the McMaster Nuclear Reactor (MNR). A level 1 PRA was completed including event sequence modeling, system modeling, and quantification. To support the quantification of the accident sequence identified, data analysis using the Bayesian method and human reliability analysis (HRA) using the ASEP approach were performed. Since human performance in research reactors is significantly different from that in power reactors, a different time-oriented HRA model was proposed and applied for the estimation of the human error probability (HEP) of core relocation. This HEP estimate was less than that by the ASEP approach by a factor of about 2. These two HEP estimates were used for sensitivity analysis, and modeling uncertainty in the PRA models was quantified. This showed the necessity of appropriate human reliability models in PRA for research reactors. This method could be implemented for the operators' actions which require extensive manual execution with little cognitive load, as might be the case for some maintenance operations in power reactors. (author)

  3. EPRI/NRC-RES fire PRA guide for nuclear power facilities. Volume 1, summary and overview

    International Nuclear Information System (INIS)

    2004-01-01

    This report documents state-of-the-art methods, tools, and data for the conduct of a fire Probabilistic Risk Assessment (PRA) for a commercial nuclear power plant (NPP) application. The methods have been developed under the Fire Risk Re-quantification Study. This study was conducted as a joint activity between EPRI and the U. S. NRC Office of Nuclear Regulatory Research (RES) under the terms of an EPRI/RES Memorandum of Understanding (RS.1) and an accompanying Fire Research Addendum (RS.2). Industry participants supported demonstration analyses and provided peer review of this methodology. The documented methods are intended to support future applications of Fire PRA, including risk-informed regulatory applications. The documented method reflects state-of-the-art fire risk analysis approaches. The primary objective of the Fire Risk Study was to consolidate recent research and development activities into a single state-of-the-art fire PRA analysis methodology. Methodological issues raised in past fire risk analyses, including the Individual Plant Examination of External Events (IPEEE) fire analyses, have been addressed to the extent allowed by the current state-of-the-art and the overall project scope. Methodological debates were resolved through a consensus process between experts representing both EPRI and RES. The consensus process included a provision whereby each major party (EPRI and RES) could maintain differing technical positions if consensus could not be reached. No cases were encountered where this provision was invoked. While the primary objective of the project was to consolidate existing state-of-the-art methods, in many areas, the newly documented methods represent a significant advancement over previously documented methods. In several areas, this project has, in fact, developed new methods and approaches. Such advances typically relate to areas of past methodological debate.

  4. Probabilistic risk assessment (PRA): status report and guidance for regulatory application. Draft report for comment

    International Nuclear Information System (INIS)

    1984-02-01

    This document describes the current status of the methodologies used in probabilistic risk assessment (PRA) and provides guidance for the application of the results of PRAs to the nuclear reactor regulatory process. The PRA studies that have been completed or are underway are reviewed. The levels of maturity of the methodologies used in a PRA are discussed. Insights derived from PRAs are listed. The potential uses of PRA results for regulatory purposes are discussed

  5. Comparison of Concept Mapping and Conventional Teaching Methods on Critical Thinking Skills of Nursing Students

    Directory of Open Access Journals (Sweden)

    Masoumeh Delaram

    2017-06-01

    Full Text Available Background and Objective: Development of critical thinking and practical skills has remained a serious and considerable challenge throughout the nursing educational system in Iran. Conventional methods of teaching such as lectures as the dominant method used in higher education system is a passive style which ignores critical thinking. Therefore, the aim of this study was to compare the effect of instruction by Concept-Mapping and conventional Method on critical thinking skills of nursing students. Materials and Methods:This quasi-experimental study was carried out on 70 nursing students of Tehran Nursing and Midwifery schoolwho were selected through convenient sampling method, then were divided randomly into the two equal Experimental and Control groups. Educational content was presented in the form of Concept-Mapping in the Experimental group and Lecture,Demonstration and Practicalexercises in the control group. Data collection included a demographic information and California Critical Thinking Skills (form B questionnairewhich was completed at the beginning and at the end of the fourth week of Instructional period. Data were analyzed using SPSS software (V: 21, descriptive and analytical Statistics; at the significant level P<0.05. Results: Before the intervention, the mean of critical thinking skill score was 9.71±2.66 in concept mapping group and 9.64 ± 2.14 in conventional group and the difference was not significant (P=0.121, but after the intervention, a significant difference was found between the intervention and conventionalgroup (15.20±2.71 vs 10.25±2.06, P=0.003. Conclusion: Using Concept mapping strategy in the education of nursing students may lead to developing critical thinking skills as one of the important missions of higher education. So it is recommended to usethis method in clinical nursing education.

  6. Energy indices in irrigated wheat production under conservation and conventional tillage and planting methods

    Directory of Open Access Journals (Sweden)

    S. M Hosseini

    2016-04-01

    Full Text Available Introduction: Conservation tillage system was recommended for soil erosion control in North America for the first time 60 years ago (Wang et al., 2006. Using this tillage system including minimum and zero tillage has been rapidly developed in recent years. Thearea covered by zero tillage in 2006 was 95 million ha all over the world (Dumanski et al., 2006. In addition to saving soil and water resources, conservation tillage system reduces energy consumption and improves energy indices by combining different tillage and planting operations. Results of research conducted in Fars province shows that conservation tillage saves fuel consumption for 77% compared to the conventional system (Afzalinia et al., 2009. Conservation tillage also reduces energy consumption from 23.6 to 42.8% in comparison to the conventional tillage (Rusu, 2005. Since energy indices would be affected by reduced input energies in conservation tillage, this research was conducted to evaluate the effect of different tillage and planting methods on energy inputs and energy indices in irrigated wheat production in Eghlid region. Materials and Methods: This research was performed to evaluate and compare the energy indices in irrigated wheat production under different tillage and planting methods. The study was conducted in the form of a randomized complete block experimental design with five treatments and three replications in Eghlid region. The treatments were included, conventional tillage and seed broadcasting (A, conventional tillage and planting with Machine Barzegar grain drill (B, reduced tillage and seeding with Roto-seeder (C, direct seeding with Jairan Sanaat grain drill (D, and direct seeding with Sfoggia direct drill (E. Experimental plots with 10 by 50 m dimensions were used in this study. Loss crop residues were taken out of the experimental plots and standing crop residues were retained in the plots. In the conventional tillage method, primary tillage was performed

  7. A model for assessing human cognitive reliability in PRA studies

    International Nuclear Information System (INIS)

    Hannaman, G.W.; Spurgin, A.J.; Lukic, Y.

    1985-01-01

    This paper summarizes the status of a research project sponsored by EPRI as part of the Probabilistic Risk Assessment (PRA) technology improvement program and conducted by NUS Corporation to develop a model of Human Cognitive Reliability (HCR). The model was synthesized from features identified in a review of existing models. The model development was based on the hypothesis that the key factors affecting crew response times are separable. The inputs to the model consist of key parameters the values of which can be determined by PRA analysts for each accident situation being assessed. The output is a set of curves which represent the probability of control room crew non-response as a function of time for different conditions affecting their performance. The non-response probability is then a contributor to the overall non-success of operating crews to achieve a functional objective identified in the PRA study. Simulator data and some small scale tests were utilized to illustrate the calibration of interim HCR model coefficients for different types of cognitive processing since the data were sparse. The model can potentially help PRA analysts make human reliability assessments more explicit. The model incorporates concepts from psychological models of human cognitive behavior, information from current collections of human reliability data sources and crew response time data from simulator training exercises

  8. A method to determine the number of nanoparticles in a cluster using conventional optical microscopes

    International Nuclear Information System (INIS)

    Kang, Hyeonggon; Attota, Ravikiran; Tondare, Vipin; Vladár, András E.; Kavuri, Premsagar

    2015-01-01

    We present a method that uses conventional optical microscopes to determine the number of nanoparticles in a cluster, which is typically not possible using traditional image-based optical methods due to the diffraction limit. The method, called through-focus scanning optical microscopy (TSOM), uses a series of optical images taken at varying focus levels to achieve this. The optical images cannot directly resolve the individual nanoparticles, but contain information related to the number of particles. The TSOM method makes use of this information to determine the number of nanoparticles in a cluster. Initial good agreement between the simulations and the measurements is also presented. The TSOM method can be applied to fluorescent and non-fluorescent as well as metallic and non-metallic nano-scale materials, including soft materials, making it attractive for tag-less, high-speed, optical analysis of nanoparticles down to 45 nm diameter

  9. MAXILLARY INCISORS CHANGES DURING SPACE CLOSURE WITH CONVENTIONAL AND SKELETAL ANCHORAGE METHODS: A SYSTEMATIC REVIEW

    Directory of Open Access Journals (Sweden)

    Yasas Shri Nalaka JAYARATNE

    2017-12-01

    Full Text Available Purpose: The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. Materials and Methods: The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Results: Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. Conclusion: More RCT’s that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  10. Ergonomic evaluation of conventional and improved methods of aonla pricking with women workers.

    Science.gov (United States)

    Rai, Arpana; Gandhi, Sudesh; Sharma, D K

    2012-01-01

    Conventional and improved methods of aonla pricking were evaluated ergonomically on an experiment conducted for 20 minute with women workers. The working heart rate, energy expenditure rate, total cardiac cost of work and physiological cost of work with conventional tools varied from 93-102 beats.min-1, 6-7.5 kJ.min-1, 285-470 beats, 14 -23 beats.min-1 while with machine varied from 96-105 beats.min-1, 6.5-8 kJ.min-1 , 336-540 beats, 16-27 beats.min-1 respectively. OWAS score for conventional method was 2 indicating corrective measures in near future while with machine was 1 indicating no corrective measures. Result of Nordic Musculoskeletal Questionnaire revealed that subjects complaint of pain in back, neck, right shoulder and right hand due to unnatural body posture and repetitive movement with hand tool. Moreover pricking was carried out in improper lighting conditions (200-300 lux) resulting into finger injuries from sharp edges of hand tool, whereas with machine no such problems were observed. Output with machine increased thrice than hand pricking in a given time. Machine was found useful in terms of saving time, increased productivity, enhanced safety and comfort as involved improved posture, was easy to handle and operate, thus increasing efficiency of the worker leading to better quality of life.

  11. Genetic improvement of olive (Olea europaea L.) by conventional and in vitro biotechnology methods.

    Science.gov (United States)

    Rugini, E; Cristofori, V; Silvestri, C

    2016-01-01

    In olive (Olea europaea L.) traditional methods of genetic improvement have up to now produced limited results. Intensification of olive growing requires appropriate new cultivars for fully mechanized groves, but among the large number of the traditional varieties very few are suitable. High-density and super high-density hedge row orchards require genotypes with reduced size, reduced apical dominance, a semi-erect growth habit, easy to propagate, resistant to abiotic and biotic stresses, with reliably high productivity and quality of both fruits and oil. Innovative strategies supported by molecular and biotechnological techniques are required to speed up novel hybridisation methods. Among traditional approaches the Gene Pool Method seems a reasonable option, but it requires availability of widely diverse germplasm from both cultivated and wild genotypes, supported by a detailed knowledge of their genetic relationships. The practice of "gene therapy" for the most important existing cultivars, combined with conventional methods, could accelerate achievement of the main goals, but efforts to overcome some technical and ideological obstacles are needed. The present review describes the benefits that olive and its products may obtain from genetic improvement using state of the art of conventional and unconventional methods, and includes progress made in the field of in vitro techniques. The uses of both traditional and modern technologies are discussed with recommendations. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Toxoplasmosis: The value of molecular methods in diagnosis compared to conventional methods

    Directory of Open Access Journals (Sweden)

    Zineb Tlamçani

    2013-06-01

    Full Text Available Toxoplasmosis is a parasitic infection due to Toxoplasma gondii an obligate intracellular protozoan parasite. It is considerateone of the most common parasite worldwide. The contamination of the parasite is generally occurred via consumptionof infected food or water or, undercooked contaminated meat. Toxoplasma gondii infection may lead to seriousillness when the organism is contracted while pregnancy or when it is reactivated in immune-suppressed persons.Diagnosis of toxoplasmosis in humans is elaborated using various techniques such as detection of anti-Toxoplasmaantibodies, mouse inoculation, histological revelation of tachyzoites in tissue sections or smears of body fluid, but thedetection of Toxoplasma gondii DNA by molecular methods has revolutionized prenatal diagnosis of congenital toxoplasmosisand in immunocompromised patients. In this paper we will discuss the parasite and different methods ofdiagnosis including the usefulness of molecular methods. J Microbiol Infect Dis 2013; 3(2: 93-99Key words: Toxoplamosis, Toxoplasma gondii, diagnosis

  13. Comparison of Tooth Color Change After Bleaching With Conventional and Different Light-Activated Methods.

    Science.gov (United States)

    Shahabi, Sima; Assadian, Hadi; Mahmoudi Nahavandi, Alireza; Nokhbatolfoghahaei, Hanieh

    2018-01-01

    Introduction: The demand for esthetic dental treatments is increasing in recent years mainly due to improved oral hygiene and better maintenance of oral health and teeth in older individuals. Bleaching of discolored anterior teeth is the most popular among esthetic dental treatments. Even individuals with sound teeth and adequate esthetics seek to have whiter teeth in the anterior region. The aim of this study was to evaluate tooth color changes following conventional in-office bleaching techniques compared to light-activated methods using different light sources. Methods: Seventy sound anterior teeth (devoided of caries and/or fracture), extracted for periodontal and orthodontic reasons were selected and allocated to 7 groups: (A) control, (B) conventional bleaching (C) LED-activated bleaching, (D) KTP laser-activated bleaching, (E) diode laser-activated bleaching, (F) Nd:YAG laser-activated bleaching and (G) CO2 laser-activated bleaching. Colorimetric evaluation was carried out before and after treatment using a spectrophotoradiometer. Data were analyzed by one- and two-way analysis of variance (ANOVA) as well as multiple comparison methods. Results: The results showed that all bleaching procedures were effective in reducing the yellowness index. However, the KTP laser-activated bleaching was significantly more effective than the other techniques in 95% confidence level. It was also seen that CO2 laser activated method has outperformed groups E, F and G and the conventional bleaching without light activation was not effective at all and represented similar results with the control group. Furthermore, the groups E and G had almost the same results in decreasing the yellowness index. Conclusion: The results showed that all bleaching techniques were effective however, the KTP laser-activated bleaching was significantly more efficient, closely followed by the CO2 laser-activated bleaching technique.

  14. Strategy for identification & characterization of Bartonella henselae with conventional & molecular methods

    Directory of Open Access Journals (Sweden)

    Kavita Diddi

    2013-01-01

    Full Text Available Background & objectives: Bartonella henselae is a fastidious gram-negative bacterium usually causing self limiting infections in immunocompetent individuals but often causes potentially life threatening infection, such as bacillary angiomatosis in immunocompromised patients. Both diagnosis of infections and research into molecular mechanisms of pathogenesis have been hindered by lack of appropriate and reliable diagnostic techniques. We undertook this study to standardize methods to characterize B. henselae in clinical samples to diagnose Bartonella infection correctly. Methods: B. henselae ATCC 49882 strain was procured from American type culture collection, USA. This strain was revived and maintained in the laboratory, and identification and characterization of this strain was done by conventional and molecular techniques, which included culture on various media, staining by different methods including electron microscopy, biochemical analysis by conventional methods and API, polymerase chain reaction (PCR for amplification of citrate synthase gene followed by restriction fragment length polymorphism (RFLP. Results: This organism was biochemically inert due to slow growth and generated unique identification code with API. The amplification of the citrate-synthase gene with primers yielded a 381 bp product followed by specific RFLP profile for B. henselae. Interpretation & conclusions: Bartonella is fastidious and fragile organism and should be handled carefully. Extra effort and careful observation are required to isolate and characterize this organism.

  15. In vivo precision of conventional and digital methods of obtaining complete-arch dental impressions

    OpenAIRE

    Ender, Andreas; Attin, Thomas; Mehl, Albert

    2016-01-01

    STATEMENT OF PROBLEM: Digital impression systems have undergone significant development in recent years, but few studies have investigated the accuracy of the technique in vivo, particularly compared with conventional impression techniques. PURPOSE: The purpose of this in vivo study was to investigate the precision of conventional and digital methods for complete-arch impressions. MATERIAL AND METHODS: Complete-arch impressions were obtained using 5 conventional (polyether, POE; vinylsilox...

  16. Reinforcing the role of the conventional C-arm--a novel method for simplified distal interlocking.

    Science.gov (United States)

    Windolf, Markus; Schroeder, Josh; Fliri, Ladina; Dicht, Benno; Liebergall, Meir; Richards, R Geoff

    2012-01-25

    shot to screw tightened) was on average 22% reduced by guided freehand (p = 0.018). In an experimental setting, the newly developed guided freehand technique for distal interlocking has proven to markedly reduce radiation exposure when compared to the conventional freehand technique. The method utilizes established clinical workflows and does not require cost intensive add-on devices or extensive training. The underlying principle carries potential to assist implant positioning in numerous other applications within orthopedics and trauma from screw insertions to placement of plates, nails or prostheses.

  17. Maxillary incisors changes during space closure with conventional and skeletal anchorage methods: a systematic review.

    Science.gov (United States)

    Jayaratne, Yasas Shri Nalaka; Uribe, Flavio; Janakiraman, Nandakumar

    2017-01-01

    The objective of this systematic review was to compare the antero-posterior, vertical and angular changes of maxillary incisors with conventional anchorage control techniques and mini-implant based space closure methods. The electronic databases Pubmed, Scopus, ISI Web of knowledge, Cochrane Library and Open Grey were searched for potentially eligible studies using a set of predetermined keywords. Full texts meeting the inclusion criteria as well as their references were manually searched. The primary outcome data (linear, angular, and vertical maxillary incisor changes) and secondary outcome data (overbite changes, soft tissue changes, biomechanical factors, root resorption and treatment duration) were extracted from the selected articles and entered into spreadsheets based on the type of anchorage used. The methodological quality of each study was assessed. Six studies met the inclusion criteria. The amount of incisor retraction was greater with buccally placed mini-implants than conventional anchorage techniques. The incisor retraction with indirect anchorage from palatal mini-implants was less when compared with buccally placed mini-implants. Incisor intrusion occurred with buccal mini-implants, whereas extrusion was seen with conventional anchorage. Limited data on the biomechanical variables or adverse effects such as root resorption were reported in these studies. More RCT's that take in to account relevant biomechanical variables and employ three-dimensional quantification of tooth movements are required to provide information on incisor changes during space closure.

  18. Reinforcing the role of the conventional C-arm - a novel method for simplified distal interlocking

    Directory of Open Access Journals (Sweden)

    Windolf Markus

    2012-01-01

    Full Text Available Abstract Background The common practice for insertion of distal locking screws of intramedullary nails is a freehand technique under fluoroscopic control. The process is technically demanding, time-consuming and afflicted to considerable radiation exposure of the patient and the surgical personnel. A new concept is introduced utilizing information from within conventional radiographic images to help accurately guide the surgeon to place the interlocking bolt into the interlocking hole. The newly developed technique was compared to conventional freehand in an operating room (OR like setting on human cadaveric lower legs in terms of operating time and radiation exposure. Methods The proposed concept (guided freehand, generally based on the freehand gold standard, additionally guides the surgeon by means of visible landmarks projected into the C-arm image. A computer program plans the correct drilling trajectory by processing the lens-shaped hole projections of the interlocking holes from a single image. Holes can be drilled by visually aligning the drill to the planned trajectory. Besides a conventional C-arm, no additional tracking or navigation equipment is required. Ten fresh frozen human below-knee specimens were instrumented with an Expert Tibial Nail (Synthes GmbH, Switzerland. The implants were distally locked by performing the newly proposed technique as well as the conventional freehand technique on each specimen. An orthopedic resident surgeon inserted four distal screws per procedure. Operating time, number of images and radiation time were recorded and statistically compared between interlocking techniques using non-parametric tests. Results A 58% reduction in number of taken images per screw was found for the guided freehand technique (7.4 ± 3.4 (mean ± SD compared to the freehand technique (17.6 ± 10.3 (p p = 0.001. Operating time per screw (from first shot to screw tightened was on average 22% reduced by guided freehand (p = 0

  19. A comparison of methods for demonstrating artificial bone lesions; conventional versus computer tomography

    International Nuclear Information System (INIS)

    Heller, M.; Wenk, M.; Jend, H.H.

    1984-01-01

    Conventional tomography (T) and computer tomography (CT) were used for examining 97 artificial bone lesions at various sites. The purpose of the study was to determine how far CT can replace T in the diagnosis of skeletal abnormalities. The results have shown that modern CT, particularly in its high resolution form, equals T and provides additional information (substrate of a lesion, its relationship to neighbouring tissues, simultaneous demonstration of soft tissue etc.). These cannot be shown successfully by T. It follows that CT is indicated as the primary method of examination for lesions of the facial skeleton, skull base, spine, pelvis and, to some extent, extremities. (orig.) [de

  20. Radiation exposure in X-ray angiography and comparisons between digital and conventional methods of imaging

    International Nuclear Information System (INIS)

    Schaberg, J.

    1987-01-01

    The more recent developments and techniques in the field of angiography are examined for associated radiation exposure risks for patients and investigators and then compared to the conventional methods of angiography. It could be shown that digital subtraction angiography is generally associated with a lesser risk of somatic exposure of the patient, provided that the equipment used offers an adjustable useful-beam range and focus. The fact that above-table X-ray tubes are now generally replaced with X-ray systems installed under the examination table permits the relatively high doses, to which investigators are exposed during angiography, to be reduced by a factor of 3. (DG) [de

  1. Review of conventional and novel food processing methods on food allergens.

    Science.gov (United States)

    Vanga, Sai Kranthi; Singh, Ashutosh; Raghavan, Vijaya

    2017-07-03

    With the turn of this century, novel food processing techniques have become commercially very important because of their profound advantages over the traditional methods. These novel processing methods tend to preserve the characteristic properties of food including their organoleptic and nutritional qualities better when compared with the conventional food processing methods. During the same period of time, there is a clear rise in the populations suffering from food allergies, especially infants and children. Though, this fact is widely attributed to the changing livelihood of population in both developed and developing nations and to the introduction of new food habits with advent of novel foods and new processing techniques, their complete role is still uncertain. Under the circumstance, it is very important to understand the structural changes in the protein as food is processed to comprehend whether the specific processing technique (conventional and novel) is increasing or mitigating the allergenicity. Various modern means are now being employed to understand the conformational changes in the protein which can affect the allergenicity. In this review, the processing effects on protein structure and allergenicity are discussed along with the insinuations of recent studies and techniques for establishing a platform to investigate future pathway to reduce or eliminate allergenicity in the population.

  2. Exposure to radiation through the residual activity of waste treated by conventional methods

    International Nuclear Information System (INIS)

    Deckert, A.; Hoppe, G.; John, T.; Thierfeldt, S.

    1993-01-01

    Data obtained by questionnaires provided information on the type, amount, nuclide vector and maximum permissible value of low-level radioactive residues that occur in nuclear installations of due to industrial, scientific and medical uses of radioactive materials and are officially released to be disposed of by conventional methods. The general legal background of waste disposal methods, in particular the official regulations surrounding the waste disposal law, were described. On this basis, parameters and maximum radioactive burdens were specifically defined for garbage dumps for refuse from private households and those for building rubbish. Investigations were carried out into exposure paths that may have a role in the radioactive doses taken up by personnel (inhalation) or the general population (ingestion) through contaminated water. The radiation dose attributable to those exposure paths were expressed in relation to a specific unit activity of waste (1 bq/G). A dose of 10 μ Sv/r was taken as a standard to define a threshold value for each individual nuclide released for conventional waste disposal. It appears reasonable that such values are determined for groups of nuclides. (HP) [de

  3. Extraction and comparison of proteins from natural rubber latex by conventional and ionizing radiation methods

    International Nuclear Information System (INIS)

    Rogero, Sizue O.; Spencer, Patrick J.; Campos, Vania E.; Lusvarghi, Fabio M.; Higa, Olga Z.

    1997-01-01

    Several proteins in natural rubber latex (NRL) have been assigned to be significant allergens. It is known that proteins submitted to ionizing radiation suffer denaturation and immunochemical modification resulting in low antigenic reactivity. The aim of this study was to extract and compare water extractable proteins from NRL films vulcanized by conventional and by ionizing radiation methods. SDS-polyacrylamide gel electrophoresis (SDS--PAGE) and high pressure liquid chromatography (HPLC) showed a diffuse protein band of about 14 KDa, which we believe is rubber elongation factor (REF), in both eluates, but smaller in latex film vulcanized by ionizing radiation. REF has been suggested to be a major latex allergen. These data suggest that ionizing radiation vulcanization could be an useful method for the production of NRL goods with low antigenicity. (author). 8 refs., 2 figs., 1 tab

  4. Intestinal preparation for colon enema with fosfo-soda fleet versus the conventional method

    International Nuclear Information System (INIS)

    Vecchioli Caldazza, A.; Celi, G.; De Franco, A.; Parrella, A.; Minordi, L.M.; Marano, P.

    1999-01-01

    The authors evaluate the possible optimization of a well-tolerated and versatile method of intestinal preparation able to adequately free the lumen and consequently improve diagnostic results with a lower risk of prolonged hospital stay for incorrectly prepared patients. They examined 40 patients, namely 20 men and 20 women referred to the Institute of radiology of the 'Sacro Cuore' Catholic University of Rome (Italy), Gastrointestinal tract unit, to undergo double contrast colonic enema. The statistical analysis of all data was performed with Wilcoxon test. Intestinal preparation with fosfo-soda fleet appeared to be definitely better than the conventional method relative to tolerance, while providing similarly satisfactory data relative to the other parameters [it

  5. Recent advances in conventional and contemporary methods for remediation of heavy metal-contaminated soils.

    Science.gov (United States)

    Sharma, Swati; Tiwari, Sakshi; Hasan, Abshar; Saxena, Varun; Pandey, Lalit M

    2018-04-01

    Remediation of heavy metal-contaminated soils has been drawing our attention toward it for quite some time now and a need for developing new methods toward reclamation has come up as the need of the hour. Conventional methods of heavy metal-contaminated soil remediation have been in use for decades and have shown great results, but they have their own setbacks. The chemical and physical techniques when used singularly generally generate by-products (toxic sludge or pollutants) and are not cost-effective, while the biological process is very slow and time-consuming. Hence to overcome them, an amalgamation of two or more techniques is being used. In view of the facts, new methods of biosorption, nanoremediation as well as microbial fuel cell techniques have been developed, which utilize the metabolic activities of microorganisms for bioremediation purpose. These are cost-effective and efficient methods of remediation, which are now becoming an integral part of all environmental and bioresource technology. In this contribution, we have highlighted various augmentations in physical, chemical, and biological methods for the remediation of heavy metal-contaminated soils, weighing up their pros and cons. Further, we have discussed the amalgamation of the above techniques such as physiochemical and physiobiological methods with recent literature for the removal of heavy metals from the contaminated soils. These combinations have showed synergetic effects with a many fold increase in removal efficiency of heavy metals along with economic feasibility.

  6. PRA: an evaluation of state-of-the-art

    International Nuclear Information System (INIS)

    Joksimovich, V.

    1985-01-01

    Some elements of the probabilistic risk assessment (PRA) methodology can be characterized as mature and are even ready for some kind of a standardization effort. Other elements are still, however, in a rapid state of evolution. Questions are continuously being asked regarding maturity of PRA techniques vis-a-vis a regulatory decision-making process. Establishing a framework for evaluating state-of-the-art in any technological field is a challenging task. An implementation of a selected framework to a satisfactory conclusion is a monumental task. Of course, these types of issues can be discussed meaningfully only if they are tied to a particular application. The author's participation in the NSF-sponsored risk assessment project is discussed in the paper. The evaluation employed here makes use of the following five evaluation criteria: logical soundness, completeness, accuracy, acceptability, and practicality

  7. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Je Hyun; Shim, Chang Ho [Dept. of Nuclear Engineering, Hanyang University, Seoul (Korea, Republic of); Kim, Sung Hyun [Nuclear Fuel Cycle Waste Treatment Research Division, Research Reactor Institute, Kyoto University, Osaka (Japan); Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo [Ionizing Radiation Center, Nuclear Fuel Cycle Waste Treatment Research Division, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho [Ionizing Radiation Center, Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of)

    2016-12-15

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers.

  8. A proposal on evaluation method of neutron absorption performance to substitute conventional neutron attenuation test

    International Nuclear Information System (INIS)

    Kim, Je Hyun; Shim, Chang Ho; Kim, Sung Hyun; Choe, Jung Hun; Cho, In Hak; Park, Hwan Seo; Park, Hyun Seo; Kim, Jung Ho; Kim, Yoon Ho

    2016-01-01

    For a verification of newly-developed neutron absorbers, one of guidelines on the qualification and acceptance of neutron absorbers is the neutron attenuation test. However, this approach can cause a problem for the qualifications that it cannot distinguish how the neutron attenuates from materials. In this study, an estimation method of neutron absorption performances for materials is proposed to detect both direct penetration and back-scattering neutrons. For the verification of the proposed method, MCNP simulations with the experimental system designed in this study were pursued using the polyethylene, iron, normal glass and the vitrified form. The results show that it can easily test neutron absorption ability using single absorber model. Also, from simulation results of single absorber and double absorbers model, it is verified that the proposed method can evaluate not only the direct thermal neutrons passing through materials, but also the scattered neutrons reflected to the materials. Therefore, the neutron absorption performances can be accurately estimated using the proposed method comparing with the conventional neutron attenuation test. It is expected that the proposed method can contribute to increase the reliability of the performance of neutron absorbers

  9. Measuring serotonin synthesis: from conventional methods to PET tracers and their (pre)clinical implications

    Energy Technology Data Exchange (ETDEWEB)

    Visser, Anniek K.D.; Waarde, Aren van; Willemsen, Antoon T.M. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); Bosker, Fokko J. [University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Luiten, Paul G.M. [University of Groningen, Center for Behavior and Neurosciences, Department of Molecular Neurobiology, Haren (Netherlands); Boer, Johan A. den [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University of Groningen, University Medical Center Groningen, University Center of Psychiatry, Groningen (Netherlands); Kema, Ido P. [University of Groningen, University Medical Center Groningen, Department of Laboratory Medicine, Groningen (Netherlands); Dierckx, Rudi A.J.O. [University of Groningen, University Medical Center Groningen, Department of Nuclear Medicine and Molecular Imaging, Groningen (Netherlands); University Hospital Ghent, Department of Nuclear Medicine, Ghent (Belgium)

    2011-03-15

    The serotonergic system of the brain is complex, with an extensive innervation pattern covering all brain regions and endowed with at least 15 different receptors (each with their particular distribution patterns), specific reuptake mechanisms and synthetic processes. Many aspects of the functioning of the serotonergic system are still unclear, partially because of the difficulty of measuring physiological processes in the living brain. In this review we give an overview of the conventional methods of measuring serotonin synthesis and methods using positron emission tomography (PET) tracers, more specifically with respect to serotonergic function in affective disorders. Conventional methods are invasive and do not directly measure synthesis rates. Although they may give insight into turnover rates, a more direct measurement may be preferred. PET is a noninvasive technique which can trace metabolic processes, like serotonin synthesis. Tracers developed for this purpose are {alpha}-[{sup 11}C]methyltryptophan ([{sup 11}C]AMT) and 5-hydroxy-L-[{beta}-{sup 11}C]tryptophan ([{sup 11}C]5-HTP). Both tracers have advantages and disadvantages. [{sup 11}C]AMT can enter the kynurenine pathway under inflammatory conditions (and thus provide a false signal), but this tracer has been used in many studies leading to novel insights regarding antidepressant action. [{sup 11}C]5-HTP is difficult to produce, but trapping of this compound may better represent serotonin synthesis. AMT and 5-HTP kinetics are differently affected by tryptophan depletion and changes of mood. This may indicate that both tracers are associated with different enzymatic processes. In conclusion, PET with radiolabelled substrates for the serotonergic pathway is the only direct way to detect changes of serotonin synthesis in the living brain. (orig.)

  10. In vivo precision of conventional and digital methods for obtaining quadrant dental impressions.

    Science.gov (United States)

    Ender, Andreas; Zimmermann, Moritz; Attin, Thomas; Mehl, Albert

    2016-09-01

    Quadrant impressions are commonly used as alternative to full-arch impressions. Digital impression systems provide the ability to take these impressions very quickly; however, few studies have investigated the accuracy of the technique in vivo. The aim of this study is to assess the precision of digital quadrant impressions in vivo in comparison to conventional impression techniques. Impressions were obtained via two conventional (metal full-arch tray, CI, and triple tray, T-Tray) and seven digital impression systems (Lava True Definition Scanner, T-Def; Lava Chairside Oral Scanner, COS; Cadent iTero, ITE; 3Shape Trios, TRI; 3Shape Trios Color, TRC; CEREC Bluecam, Software 4.0, BC4.0; CEREC Bluecam, Software 4.2, BC4.2; and CEREC Omnicam, OC). Impressions were taken three times for each of five subjects (n = 15). The impressions were then superimposed within the test groups. Differences from model surfaces were measured using a normal surface distance method. Precision was calculated using the Perc90_10 value. The values for all test groups were statistically compared. The precision ranged from 18.8 (CI) to 58.5 μm (T-Tray), with the highest precision in the CI, T-Def, BC4.0, TRC, and TRI groups. The deviation pattern varied distinctly depending on the impression method. Impression systems with single-shot capture exhibited greater deviations at the tooth surface whereas high-frame rate impression systems differed more in gingival areas. Triple tray impressions displayed higher local deviation at the occlusal contact areas of upper and lower jaw. Digital quadrant impression methods achieve a level of precision, comparable to conventional impression techniques. However, there are significant differences in terms of absolute values and deviation pattern. With all tested digital impression systems, time efficient capturing of quadrant impressions is possible. The clinical precision of digital quadrant impression models is sufficient to cover a broad variety of

  11. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for

  12. Conventional and improved cytotoxicity test methods of newly developed biodegradable magnesium alloys

    Science.gov (United States)

    Han, Hyung-Seop; Kim, Hee-Kyoung; Kim, Yu-Chan; Seok, Hyun-Kwang; Kim, Young-Yul

    2015-11-01

    Unique biodegradable property of magnesium has spawned countless studies to develop ideal biodegradable orthopedic implant materials in the last decade. However, due to the rapid pH change and extensive amount of hydrogen gas generated during biocorrosion, it is extremely difficult to determine the accurate cytotoxicity of newly developed magnesium alloys using the existing methods. Herein, we report a new method to accurately determine the cytotoxicity of magnesium alloys with varying corrosion rate while taking in-vivo condition into the consideration. For conventional method, extract quantities of each metal ion were determined using ICP-MS and the result showed that the cytotoxicity due to pH change caused by corrosion affected the cell viability rather than the intrinsic cytotoxicity of magnesium alloy. In physiological environment, pH is regulated and adjusted within normal pH (˜7.4) range by homeostasis. Two new methods using pH buffered extracts were proposed and performed to show that environmental buffering effect of pH, dilution of the extract, and the regulation of eluate surface area must be taken into consideration for accurate cytotoxicity measurement of biodegradable magnesium alloys.

  13. Synthesis of novel chalcone derivatives by conventional and microwave irradiation methods and their pharmacological activities

    Directory of Open Access Journals (Sweden)

    Mohammed Rayees Ahmad

    2016-09-01

    Full Text Available Chalcones are abundant in edible plants and are considered to be the precursors of flavonoids and isoflavonoids. Chalcones belong to an important class of flavonoids, which may be prepared by Claisen–Schmidt condensation. They possess a wide range of biological activities and industrial applications. The cytotoxicity against tumour cell lines may be the result of disruption of the cell cycle, inhibition of angiogenesis, interference with p53-MDM2 interaction, mitochondrial uncoupling or induction of apoptosis. Chalcones are synthesized by conventional and microwave assisted synthesis methods. By microwave assisted synthesis, a considerable increase in the reaction rate has been observed and that too, with better yields. The compounds have been screened for cytotoxic activity and antioxidant activity.

  14. Evaluation of osteoporosis using conventional radiographic methods and dual energy x-ray absorptiometry

    International Nuclear Information System (INIS)

    Anburajan, M.

    2001-01-01

    In India, conventional radiographs play a major part in evaluating osteoporosis since advanced bone densitometers are expensive and not widely available. Our aim in this study was to investigate the usefulness of conventional radiographic methods, viz., clavicle and metacarpal radiogrammetry, quantitative vertebral morphometry, Singh's index, hip geometry compared to a sophisticated method, viz., DXA for studying osteoporosis in south Indian men (n=663) and women (n=741). This study provides data on BMD of the proximal femur in normal south Indian females. In women, aged above 65 years, BMD of femoral neck, trochanter, and Ward's triangle decreased by 0.90%, 0.84%, and 1.66% per annum, respectively. In 45 pre- and post-menopausal women without fractures, total hip BMD correlated significantly ( p 2 =0.47), medial cortical thickness of the femoral shaft (r 2 =0.38) and neck (r 2 =0.29), combined cortical thickness (CCT) and %CCT of the clavicle (r 2 =0.54 each), and the second metacarpal (r 2 =0.51 and r 2 =0.53, respectively). On comparing variables studied for osteoporotic women with corresponding values in the premenopausal group, the average difference in SD from the mean was greatest for clavicle radiogrammetry (-3.7 SD for %CCT of the clavicle). An empirical formula for predicting total hip BMD with good sensitivity was derived from a multiple linear regression equation involving three independent variables, viz., CCT, %CCT of the clavicle (measured from the chest radiograph) and the patient's age. This author's equation, with modified weightings, has 82% sensitivity and 94% specificity and a positive and negative predictive value of 88% and 91% respectively. A chest radiograph in combination with the formula would serve as a readily available, inexpensive tool for assessing post-menopausal osteoporosis, especially in developing countries

  15. System Response Analysis and Model Order Reduction, Using Conventional Method, Bond Graph Technique and Genetic Programming

    Directory of Open Access Journals (Sweden)

    Lubna Moin

    2009-04-01

    Full Text Available This research paper basically explores and compares the different modeling and analysis techniques and than it also explores the model order reduction approach and significance. The traditional modeling and simulation techniques for dynamic systems are generally adequate for single-domain systems only, but the Bond Graph technique provides new strategies for reliable solutions of multi-domain system. They are also used for analyzing linear and non linear dynamic production system, artificial intelligence, image processing, robotics and industrial automation. This paper describes a unique technique of generating the Genetic design from the tree structured transfer function obtained from Bond Graph. This research work combines bond graphs for model representation with Genetic programming for exploring different ideas on design space tree structured transfer function result from replacing typical bond graph element with their impedance equivalent specifying impedance lows for Bond Graph multiport. This tree structured form thus obtained from Bond Graph is applied for generating the Genetic Tree. Application studies will identify key issues and importance for advancing this approach towards becoming on effective and efficient design tool for synthesizing design for Electrical system. In the first phase, the system is modeled using Bond Graph technique. Its system response and transfer function with conventional and Bond Graph method is analyzed and then a approach towards model order reduction is observed. The suggested algorithm and other known modern model order reduction techniques are applied to a 11th order high pass filter [1], with different approach. The model order reduction technique developed in this paper has least reduction errors and secondly the final model retains structural information. The system response and the stability analysis of the system transfer function taken by conventional and by Bond Graph method is compared and

  16. Calculation method of rate and area of sedimentation, by non-conventional mathematical process of data treatment

    International Nuclear Information System (INIS)

    Cota, P.L.

    1987-01-01

    The used methods for calculating the rate and area of sedimentation are based in techniques of graphical resolution. The solution of the problem by a mathematical resolution, using computational methods, is more fast and more accuracy. The comparison between the results from this methods and the conventional method is shown. (E.G.) [pt

  17. Overview of NRC PRA research program

    International Nuclear Information System (INIS)

    Cunningham, M.A.; Drouin, M.T.; Ramey-Smith, A.M.; VanderMolen, M.T.

    1997-01-01

    The NRC's research program in probabilistic risk analysis includes a set of closely-related elements, from basic research to regulatory applications. The elements of this program are as follows: (1) Development and demonstration of methods and advanced models and tools for use by the NRC staff and others performing risk assessments; (2) Support to agency staff on risk analysis and statistics issues; (3) Reviews of risk assessments submitted by licensees in support of regulatory applications, including the IPEs and IPEEEs. Each of these elements is discussed in the paper, providing highlights of work within an element, and, where appropriate, describing important support and feedback mechanisms among elements

  18. Effect of conventional cooking methods on lipid oxidation indices in lamb meat

    Directory of Open Access Journals (Sweden)

    A Pourkhalili

    2012-05-01

    Full Text Available Lipid oxidation is one of the most deteriorative reactions occurred in foodstuff which has harmful impacts on the both food quality and consumer's health. This study was designed to speculate the influence of three conventional cooking methods including boiling, frying and grilling on lipid oxidation parameters in cooked lamb meat. Sections of lamb meat from longissimus dorsi muscle, taken from native Lori-Bakhtiary sheep species were cut into uniform pieces and cooked using boiling, frying and roasting methods according to the cooking routine and tradition in Iranian society, in terms of temperature and time. Proximate compositions (moisture, lipid, ash and protein in the raw and cooked meat were determined using the standard methods of analysis. Moreover, weight loss was measured after each treatment. Lipid oxidation parameters such as peroxide value, conjugated diene and TBARS indices were measured in the raw and cooked samples. Evaluation of lipid oxidation parameters showed that peroxide value was significantly decreased in all cooked samples. In contrast, conjugated diene value was significantly increased in the fried and grilled samples (p

  19. Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food.

    Science.gov (United States)

    Petsios, Stefanos; Fredriksson-Ahomaa, Maria; Sakkas, Hercules; Papadopoulou, Chrissanthy

    2016-11-21

    Yersinia enterocolitica is an important foodborne pathogen, but the prevalence in food is underestimated due to drawbacks in the detection methods. Problems arise from the low concentration of pathogenic strains present in food samples, similarities with other Enterobacteriaceae and Y. enterocolitica-like species and the heterogeneity of Y. enterocolitica as it comprises both pathogenic and non-pathogenic isolates. New rapid, cost-effective and more sensitive culture media and molecular techniques have been developed to overcome the drawbacks of conventional culture methods. Recent molecular subtyping methods have been applied to Y. enterocolitica strains to track infection sources and to investigate phylogenetic relationships between different Yersinia strains. Further application of modern subtyping tools such as WGS in a variety of bioserotypes, and comparison with other members of the genus will help to better understanding of the virulence determinants of pathogenic Y. enterocolitica, its mechanisms to cope in the host environments, and can contribute to the development of more specific detection and typing strategies.

  20. Comparison of digital radiography and apex locator with the conventional method in root length determination of primary teeth

    Directory of Open Access Journals (Sweden)

    I E Neena

    2011-01-01

    Full Text Available Aim: The purpose of this study was to compare the Working length in primary teeth endodontics using intra oral digital radiovisiography and apex locator with conventional method for accuracy. Materials and Methods: This in vivo study was conducted on 30 primary teeth which were indicated for pulpectomy in the patients of the age group of 5-11 years All experimental teeth had adequate remaining tooth structure for rubber dam isolation and radiographicaly visible canals. Endodontic treatment was required due to irreversible pulpitis or pulp necrosis. A standardized intraoral periapical radiograph of the tooth was taken using conventional method by paralleling technique. The distance between the source and the tooth, tooth and the films were standardized using X-ray positioning device. During the pulpectomy procedure, the working length was determined by digital radiograph and apex locator. The measurements were then compared with the conventional method of root canal measurement technique for accuracy Result: From the results obtained we can conclude that Working length determined in primary molars using digital radiography and Apex locator did not show any significant difference in the mean working length measurements when compared with the conventional radiographic method. Conclusions: Apex locator is comparable to conventional radiograph in determining the working length without radiation in the primary teeth. Intraoral digital radiography is the safest method in determining the working length with significant reduction in radiation exposure.Hence, both the techniques can be safely used as alternatives to conventional radiographic methods in determining working length in primary teeth.

  1. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A. [Science Applications International Corp., McLean, VA (United States)

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods` power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V&V (determined by ratings of a system`s complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole.

  2. Guidelines for the verification and validation of expert system software and conventional software: Survey and assessment of conventional software verification and validation methods. Volume 2

    International Nuclear Information System (INIS)

    Mirsky, S.M.; Groundwater, E.H.; Hayes, J.E.; Miller, L.A.

    1995-03-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes by terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each for the identified components of knowledge-based and expert systems, as well as the system as a whole

  3. Screening for depression in epilepsy clinics. A comparison of conventional and visual-analog methods.

    Science.gov (United States)

    Rampling, Jeremy; Mitchell, Alex J; Von Oertzen, Tim; Docker, James; Jackson, Jemima; Cock, Hannah; Agrawal, Niruj

    2012-10-01

    Depression is an important but underdiagnosed complication of epilepsy. This study compares potentially suitable screening tools head-to-head. We enrolled 266 attendees with a confirmed diagnosis of epilepsy at a specialized neurologic epilepsy service in London and compared verbal self-report and visual analog (VAS) screening methods for depression. These included two generic depression scales (Hospital Anxiety and Depression Scale [HADS], Beck Depression Inventory II [BDI-II]), one epilepsy specific scale (Neurological Disorders Depression Inventory for Epilepsy [NDDI-E]) and one new visual-analog scale (Emotional Thermometers [ET]). We used Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria for major depression and International Classification of Diseases, Tenth Revision (ICD-10) criteria for depressive episode as the reference standard. Against ICD-10-defined depression the most accurate scales by receiver operating characteristic (ROC) curve area were HADS Total (HADS-T, 0.924), BDI-II (0.898) and NDDI-E (0.897). New visual-analog methods had similar accuracy measured either in combination or individually. Although no test performed well in a case-finding role, several performed well as a rule-out initial step, owing to high negative predictive value and specificity. In this role, the optimal performing conventional tools were the HADS depression subsscale (HADS-D) and the NDDI-E and the optimal single VAS were the depression thermometer (DepT) and the distress thermometer (DT). Against DSM-IV- defined major depression, results were similar with optimal performance by the HADS-T, BDI-II, and NDDI-E, but here the anxiety thermometer (AnxT) as well as DepT and DT also offered good performance. Given that no test performed well in a case-finding role, we suggest that these tests are used as an initial first step to rule out patients who are unlikely to have depression. We suggest that the six-item NDDI-E or seven-item HADS

  4. Artificial neural networks versus conventional methods for boiling water reactor stability monitoring

    International Nuclear Information System (INIS)

    Hagen, T.H.J.J. van der

    1995-01-01

    The application of an artificial neural network (ANN) for boiling water reactor (BWR) stability monitoring was studied. A three-layer perceptron was trained on synthetic autocorrelation functions to estimate the decay ratio and the resonance frequency from measured neutron noise. Training of the ANN was improved by adding noise to the training patterns and by applying nonconventional error definitions in the generalized delta rule. The performance of the developed ANN was compared with those of conventional stability monitoring techniques. Explicit care was taken for generating unbiased test data. It is found that the trained ANN is capable of monitoring the stability of the Dodewaard BWR for four specific cases. By comparing properties such as the false alarm ratio, the alarm failure ratio, and the average time to alarm, it is shown that it performs worse than model-based methods in stability monitoring of exact second-order systems but that it is more robust (better resistant to corruptions of the input data and to deviations of the system at issue from an exact second-order system) than other methods. The latter explains its good performance on the Dodewaard BWR and is promising for the application of an ANN for stability monitoring of other reactors and for other operating conditions

  5. Treatment of waste water by a combined technique of radiation and conventional method

    International Nuclear Information System (INIS)

    Sakumoto, A.; Miyata, T.

    1984-01-01

    Treatment of waste water by radiation in combination with a conventional method such as biological oxidation, coagulation with Fe 2 (SO 4 ) 3 , and ozonation has been studied for reducing necessary dose. Ethylene glycol ethers, polyoxyethylene n-nonyl phenyl ether (NPE), polyvinyl alcohol (PVA), ethylene glycol, phenol, and oxalic acid were used as a model pollutant. The combined use of radiation and biological oxidation markedly improved the removal of TOC in aqueous oxygenated solution of ethylene glycol ethers. The combined use of radiation and coagulation had remarkable effects on the reduction of TOC in aqueous deoxygenated solution of NPE or PVA. The simultaneous use of radiation and ozone gave a synergistic effect on oxidative degradation of organic pollutants. The synergistic effect was suggested to arise from chain reactions having a powerful oxidizing agent (OH radical). The rate of TOC removal by the process depended on dose rate. Aqueous solution of 150 mg/l oxalic acid was treated by the combined use of electron beams and ozone using a new type of irradiation vessel to reduce TOC with G(-TOC) of 87 at 2.3 x 10 7 rad/h. The simultaneous use of radiation and ozone is superior to the removal of TOC by other combined methods and can be applied irrespective of the type of organic matter. (author)

  6. An evaluation of the reliability and usefulness of external-initiator PRA [probabilistic risk analysis] methodologies

    International Nuclear Information System (INIS)

    Budnitz, R.J.; Lambert, H.E.

    1990-01-01

    The discipline of probabilistic risk analysis (PRA) has become so mature in recent years that it is now being used routinely to assist decision-making throughout the nuclear industry. This includes decision-making that affects design, construction, operation, maintenance, and regulation. Unfortunately, not all sub-areas within the larger discipline of PRA are equally ''mature,'' and therefore the many different types of engineering insights from PRA are not all equally reliable. 93 refs., 4 figs., 1 tab

  7. An evaluation of the reliability and usefulness of external-initiator PRA (probabilistic risk analysis) methodologies

    Energy Technology Data Exchange (ETDEWEB)

    Budnitz, R.J.; Lambert, H.E. (Future Resources Associates, Inc., Berkeley, CA (USA))

    1990-01-01

    The discipline of probabilistic risk analysis (PRA) has become so mature in recent years that it is now being used routinely to assist decision-making throughout the nuclear industry. This includes decision-making that affects design, construction, operation, maintenance, and regulation. Unfortunately, not all sub-areas within the larger discipline of PRA are equally mature,'' and therefore the many different types of engineering insights from PRA are not all equally reliable. 93 refs., 4 figs., 1 tab.

  8. Human factors assessment in PRA using task analysis linked evaluation technique (TALENT)

    International Nuclear Information System (INIS)

    Wells, J.E.; Banks, W.W.

    1990-01-01

    Human error is a primary contributor to risk in complex high-reliability systems. A 1985 U.S. Nuclear Regulatory Commission (USNRC) study of licensee event reports (LERs) suggests that upwards of 65% of commercial nuclear system failures involve human error. Since then, the USNRC has initiated research to fully and properly integrate human errors into the probabilistic risk assessment (PRA) process. The resulting implementation procedure is known as the Task Analysis Linked Evaluation Technique (TALENT). As indicated, TALENT is a broad-based method for integrating human factors expertise into the PRA process. This process achieves results which: (1) provide more realistic estimates of the impact of human performance on nuclear power safety, (2) can be fully audited, (3) provide a firm technical base for equipment-centered and personnel-centered retrofit/redesign of plants enabling them to meet internally and externally imposed safety standards, and (4) yield human and hardware data capable of supporting inquiries into human performance issues that transcend the individual plant. The TALENT procedure is being field-tested to verify its effectiveness and utility. The objectives of the field-test are to examine (1) the operability of the process, (2) its acceptability to the users, and (3) its usefulness for achieving measurable improvements in the credibility of the analysis. The field-test will provide the information needed to enhance the TALENT process

  9. A rigorous assessment of tree height measurements obtained using airborne LIDAR and conventional field methods.

    Science.gov (United States)

    Hans-Erik Andersen; Stephen E. Reutebuch; Robert J. McGaughey

    2006-01-01

    Tree height is an important variable in forest inventory programs but is typically time-consuming and costly to measure in the field using conventional techniques. Airborne light detection and ranging (LIDAR) provides individual tree height measurements that are highly correlated with field-derived measurements, but the imprecision of conventional field techniques does...

  10. Correlation and agreement of a digital and conventional method to measure arch parameters.

    Science.gov (United States)

    Nawi, Nes; Mohamed, Alizae Marny; Marizan Nor, Murshida; Ashar, Nor Atika

    2018-01-01

    The aim of the present study was to determine the overall reliability and validity of arch parameters measured digitally compared to conventional measurement. A sample of 111 plaster study models of Down syndrome (DS) patients were digitized using a blue light three-dimensional (3D) scanner. Digital and manual measurements of defined parameters were performed using Geomagic analysis software (Geomagic Studio 2014 software, 3D Systems, Rock Hill, SC, USA) on digital models and with a digital calliper (Tuten, Germany) on plaster study models. Both measurements were repeated twice to validate the intraexaminer reliability based on intraclass correlation coefficients (ICCs) using the independent t test and Pearson's correlation, respectively. The Bland-Altman method of analysis was used to evaluate the agreement of the measurement between the digital and plaster models. No statistically significant differences (p > 0.05) were found between the manual and digital methods when measuring the arch width, arch length, and space analysis. In addition, all parameters showed a significant correlation coefficient (r ≥ 0.972; p digital and manual measurements. Furthermore, a positive agreement between digital and manual measurements of the arch width (90-96%), arch length and space analysis (95-99%) were also distinguished using the Bland-Altman method. These results demonstrate that 3D blue light scanning and measurement software are able to precisely produce 3D digital model and measure arch width, arch length, and space analysis. The 3D digital model is valid to be used in various clinical applications.

  11. Pemikiran Suksesi Dalam Politik Islam Masa Pra Modern

    Directory of Open Access Journals (Sweden)

    Mazro'atus Sa'adah

    2016-12-01

    Abstrak: Pemikiran politik Islam muncul setelah Islam melalui Nabi Muhammad SAW berhasil membentuk sebuah ummat baru, dari peralihan kekuasaan kerajaan/kesukuan kepada Nabi yang kemudian kepada umat. Nabi Muhammad dinilai berhasil dalam mengatur komunitas barunya yang dikendalikan oleh ajarannya dalam seluruh lini kehidupan. Persoalan muncul kemudian setelah beliau wafat, yang akhirnya memunculkan pemikiran tentang suksesi. Artikel ini akan membahas tentang mengapa terjadi suksesi setelah Nabi Muhammad SAW wafat, bagaimana pemikiran para tokoh politik Islam masa pra modern terkait dengan suksesi, dan apa kontribusi pemikiran suksesi ini terhadap politik Islam di Indonesia. Dengan menggunakan pendekatan sejarah, ditemukan bahwa Nabi Muhammad tidak menetapkan siapa yang akan menggantikannya, dan ketika beliau wafat (632 M, para sahabat memilih seorang pemimpin (imam/khalifah. Masa pemerintahan Abu Bakar, Umar dan Usman banyak terjadi perselisihan yang awalnya terkait kepentingan agama namun berkembang menjadi kepentingan politik. Ketika Ali bin Abi Talib diangkat sebagai khalifah, konflik politik berkepanjangan berkaitan dengan pembunuhan Usman, menjadikan timbulnya perang jamal antara Aisyah dan Ali. Pada masa ini perbedaan kepentingan aqidah dipolitisir lebih jauh menjadi sebuah kepentingan politik. Dinamika politik ini kemudian melahirkan mazhab politik Islam klasik yang terbagi dalam tiga mazhab besar yaitu Sunni, Syi'ah dan Khawarij, yang darinya muncul istilah-istilah khilafah, imamah, ahlul halli wal aqdi, bay’ah, walayah dan lain-lain. Dari ketiga mazhab politik ini, kemudian muncul ide pemikiran politik Islam yang sangat kompleks dan berkepanjangan dari para tokoh politik Islam pra modern yang banyak dipengaruhi oleh filosof Yunani. Di Indonesia, pemikiran suksesi dalam politik Islam masa pra modern ini pernah diwacanakan. Namun untuk pemilihan kepala Negara belum terealisasi mengingat Indonesia bukan Negara Islam.

  12. Limitations of the Conventional Phase Advance Method for Constant Power Operation of the Brushless DC Motor

    International Nuclear Information System (INIS)

    Lawler, J.S.

    2001-01-01

    The brushless dc motor (BDCM) has high-power density and efficiency relative to other motor types. These properties make the BDCM well suited for applications in electric vehicles provided a method can be developed for driving the motor over the 4 to 6:1 constant power speed range (CPSR) required by such applications. The present state of the art for constant power operation of the BDCM is conventional phase advance (CPA)[1]. In this paper, we identify key limitations of CPA. It is shown that the CPA has effective control over the developed power but that the current magnitude is relatively insensitive to power output and is inversely proportional to motor inductance. If the motor inductance is low, then the rms current at rated power and high speed may be several times larger than the current rating. The inductance required to maintain rms current within rating is derived analytically and is found to be large relative to that of BDCM designs using high-strength rare earth magnets. Th us, the CPA requires a BDCM with a large equivalent inductance

  13. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Ghoos, Y.; Brunser, O.; Lawson, F.; Muzeke, A.; Ndjaye, M.F.

    2000-01-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, 13 CO 2 and H 2 breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  14. Treatment of children with Helicobacter pylori infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Ghoos, Y [UZ Gasthuisberg, Gastrointestinal Pathophysiology, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile); Lawson, F [Clinique Padre Pio, Cotonou (Benin); Muzeke, A [Faculte de Medicine, University of Kinshasa, Kinshasa (Congo); Ndjaye, M F [Cercle Senegalais Gastroenterologie, Dakar (Senegal)

    2000-07-01

    It is stated that in developing countries a high rate of Helicobacter pylori infection among newborns and young children occurs. It is further assumed that this incidence may lead to inhibition of defense mechanism (inhibition of acid secretion) against bacteria, per orally ingested. This may result in excessive colonisation of the small intestine by bacteria. This situation may become a major cause for chronic malnutrition and diarrhoea syndrome with failure to thrive. This project aims at determining the occurrence of Helicobacter pylori infection in children at young age. It is aimed also at tracing the relationship between the Helicobacter pylori infection and the state of undernourishment. Finally it is aimed at comparing the usefulness of pre-/probiotics as anti-infection treatment. The methods used to demonstrate above mentioned parameters are based on stable isotopes, {sup 13}CO{sub 2} and H{sub 2} breath tests mainly. To assess nutritional status and progress in growth conventional anthropometric techniques will be used, complementary to the results obtained by stable isotopes. It is put forward that the use of pre-/probiotics, instead of antibiotics, will suppress upper gastrointestinal infection and restore the intestinal cell capacity to assimilate all food ingredients. (author)

  15. Evaluation of various conventional methods for sampling weeds in potato and spinach crops

    Directory of Open Access Journals (Sweden)

    David Jamaica

    2014-04-01

    Full Text Available This study aimed to evaluate (at an exploratory level, some of the different conventional sampling designs in a section of a potato crop and in a commercial crop of spinach. Weeds were sampled in a 16 x 48 m section of a potato crop with a set grid of 192 sections. The cover and density of the weeds were registered in squares of from 0.25 to 64 m². The results were used to create a database that allowed for the simulation of different sampling designs: variables and square size. A second sampling was carried out with these results in a spinach crop of 1.16 ha with a set grid of 6 x 6 m cells, evaluating the cover in 4 m² squares. Another database was created with this information, which was used to simulate other sampling designs such as distribution and quantity of sampling squares. According to the obtained results, a good method for approximating the quantity of squares for diverse samples is 10-12 squares (4 m² for richness per ha and 18 or more squares for abundance per hectare. This square size is optimal since it allows for a sampling of more area without losing sight of low-profile species, with the cover variable best representing the abundance of the weeds.

  16. Comparison of the lysis centrifugation method with the conventional blood culture method in cases of sepsis in a tertiary care hospital.

    Science.gov (United States)

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-07-01

    Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Two hundred nonduplicate blood cultures from cases of sepsis were analyzed using two blood culture methods concurrently for recovery of bacteria from patients diagnosed clinically with sepsis - the conventional blood culture method using trypticase soy broth and the lysis centrifugation method using saponin by centrifuging at 3000 g for 30 minutes. Overall bacteria recovered from 200 blood cultures were 17.5%. The conventional blood culture method had a higher yield of organisms, especially Gram positive cocci. The lysis centrifugation method was comparable with the former method with respect to Gram negative bacilli. The sensitivity of lysis centrifugation method in comparison to conventional blood culture method was 49.75% in this study, specificity was 98.21% and diagnostic accuracy was 89.5%. In almost every instance, the time required for detection of the growth was earlier by lysis centrifugation method, which was statistically significant. Contamination by lysis centrifugation was minimal, while that by conventional method was high. Time to growth by the lysis centrifugation method was highly significant (P value 0.000) as compared to time to growth by the conventional blood culture method. For the diagnosis of sepsis, combination of the lysis centrifugation method and the conventional blood culture method with trypticase soy broth or biphasic media is advocable, in order to achieve faster recovery and a better yield of microorganisms.

  17. Development of margin assessment methodology of decay heat removal function against external hazards. (2) Tornado PRA methodology

    International Nuclear Information System (INIS)

    Nishino, Hiroyuki; Kurisaka, Kenichi; Yamano, Hidemasa

    2014-01-01

    Probabilistic Risk Assessment (PRA) for external events has been recognized as an important safety assessment method after the TEPCO's Fukushima Daiichi nuclear power station accident. The PRA should be performed not only for earthquake and tsunami which are especially key events in Japan, but also the PRA methodology should be developed for the other external hazards (e.g. tornado). In this study, the methodology was developed for Sodium-cooled Fast Reactors paying attention to that the ambient air is their final heat sink for removing decay heat under accident conditions. First, tornado hazard curve was estimated by using data recorded in Japan. Second, important structures and components for decay heat removal were identified and an event tree resulting in core damage was developed in terms of wind load and missiles (i.e. steel pipes, boards and cars) caused by a tornado. Main damage cause for important structures and components is the missiles and the tornado missiles that can reach those components and structures placed on high elevations were identified, and the failure probabilities of the components and structures against the tornado missiles were calculated as a product of two probabilities: i.e., a probability for the missiles to enter the intake or outtake in the decay heat removal system, and a probability of failure caused by the missile impacts. Finally, the event tree was quantified. As a result, the core damage frequency was enough lower than 10 -10 /ry. (author)

  18. Listeria spp. in broiler flocks: recovery rates and species distribution investigated by conventional culture and the EiaFoss method

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård; Madsen, Mogens

    2000-01-01

    The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....

  19. SHARP - a framework for incorporating human interactions into PRA studies

    International Nuclear Information System (INIS)

    Hannaman, G.W.; Joksimovich, V.; Spurgin, A.J.; Worledge, D.H.

    1985-01-01

    Recently, increased attention has been given to understanding the role of humans in the safe operation of nuclear power plants. By virtue of the ability to combine equipment reliability with human reliability probabilistic risk assessment (PRA) technology was deemed capable of providing significant insights about the contributions of human interations in accident scenarios. EPRI recognized the need to strengthen the methodology for incorporating human interactions into PRAs as one element of their broad research program to improve the credibility of PRAs. This research project lead to the development and detailed description of SHARP (Systematic Human Application Reliability Procedure) in EPRI NP-3583. The objective of this paper is to illustrate the SHARP framework. This should help PRA analysts state more clearly their assumptions and approach no matter which human reliability assessment technique is used. SHARP includes a structure of seven analysis steps which can be formally or informally performed during PRAs. The seven steps are termed definition, screening, breakdown, representation, impact assessment, quantification, and documentation

  20. Evaluation of allowed outage time using PRA results

    International Nuclear Information System (INIS)

    Johanson, G.

    1985-01-01

    In a probabilistic risk assessment (PRA) different measures of risk importance can be established. These measures can be used as a basis for further evaluation and determination of allowed outage time for specific components, within safety systems of a nuclear power plant. In order to optimize the allowed outage time (AOT) stipulated in the plant's Technical Specification it is necessary to create a methodology which could incorporate existing PRA data into a quantitative extrapolation. In order to evaluate the plant risk status due to AOT in a quantitative manner, the risk achievement worth is utilized. Risk achievement worth is defined as follows: to measure the worth of a feature, in achieving the present risk, one approach is to remove the feature and then determine how much the risk has increased. Thus, the risk achievement worth is formally defined to be the increase in risk if the feature were assumed not be there or to be failed. Another parameter of interest for this analysis is the shutdown risk increase. The shutdown risk achievement worth must be incorporated into the accident sequence risk achievement worth to arrive at an optimal set of plant specific AOTs

  1. Spatially Informed Plant PRA Models for Security Assessment

    International Nuclear Information System (INIS)

    Wheeler, Timothy A.; Thomas, Willard; Thornsbury, Eric

    2006-01-01

    Traditional risk models can be adapted to evaluate plant response for situations where plant systems and structures are intentionally damaged, such as from sabotage or terrorism. This paper describes a process by which traditional risk models can be spatially informed to analyze the effects of compound and widespread harsh environments through the use of 'damage footprints'. A 'damage footprint' is a spatial map of regions of the plant (zones) where equipment could be physically destroyed or disabled as a direct consequence of an intentional act. The use of 'damage footprints' requires that the basic events from the traditional probabilistic risk assessment (PRA) be spatially transformed so that the failure of individual components can be linked to the destruction of or damage to specific spatial zones within the plant. Given the nature of intentional acts, extensive modifications must be made to the risk models to account for the special nature of the 'initiating events' associated with deliberate adversary actions. Intentional acts might produce harsh environments that in turn could subject components and structures to one or more insults, such as structural, fire, flood, and/or vibration and shock damage. Furthermore, the potential for widespread damage from some of these insults requires an approach that addresses the impacts of these potentially severe insults even when they occur in locations distant from the actual physical location of a component or structure modeled in the traditional PRA. (authors)

  2. A combination of small bowel imaging methods: conventional enteroclysis with complementary magnetic resonance enteroclysis

    Energy Technology Data Exchange (ETDEWEB)

    Akman, C. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Korman, U. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)]. E-mail: ugurk9@istanbul.edu.tr; Oguet, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Kurugoglu, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Urger, E. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Ulus, S. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Esen, G. [Department of Radiology, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey); Tasci, I. [Department of Surgery, Cerrahpasa Medical Faculty, Istanbul University, Istanbul (Turkey)

    2005-07-01

    AIM: The aim of this prospective study was to evaluate the overall findings of conventional enteroclysis (CE) with complementary magnetic resonance enteroclysis (MRE) in small bowel disease. METHODS: The study included 32 patients referred from various clinical departments, with known or suspected small bowel disease and abnormalities on CE. Immediately after CE, true fast imaging with steady-state precession (true FISP), and unenhanced and gadolinium-enhanced T1-weighted fast low-angle shot (FLASH) sequences with fat saturation were obtained. Mucosal, mural and luminal changes of the small bowel were evaluated by each technique. In addition, bowel wall thickening, bowel wall enhancement and perienteric changes were assessed by MRE. The radiological findings obtained were evaluated together as a combination, and the role of MRE in the determination of the activity and complications of the small bowel disease was assessed. Radiological findings were correlated with clinical evaluation and follow-up in all cases, including endoscopy in 14 cases and surgery in 5 cases. RESULTS: MRE provided important supplementary mural and extramural information, including degree of pathological wall thickness, mural enhancement pattern associated with disease activity, perivisceral collection, abscess formation, mesenteric fibrofatty proliferation, lymphadenopathy and increase in perienteric vascularity. Short strictures were not revealed on MRE; however, for patients with a history of abdominal malignancy, MRE helped characterize the level of any obstruction and the extent of the disease. CONCLUSION: We recommend MRE for patients who have findings of advanced inflammatory bowel disease or neoplasm on CE examination. The combination of these two techniques can provide important information on the degree and extent of the disorder.

  3. Treatment of complementary events in event trees in constructing linked fault trees for level 1 and level 2 PRA

    International Nuclear Information System (INIS)

    Jo, Y. G.

    2008-01-01

    Complementary events in the event trees for a PRA model should be treated properly in order to evaluate plant risk correctly. In this study, the characteristics of the following three different cut-set generation methods were investigated first in order to find the best practical way for treating complementary events: 1) exact method which treats complementary events logically, 2) no-delete term method which does not treat complementary events at all, and 3) delete term method which treats complementary events by deleting nonsense cut-sets which are generated as a result of ignoring complementary events. Then, practical methods for treating complementary events in constructing linked fault trees for level 1 and level 2 PRA in EPRI R and R workstation software environment, where CAFTA is the fault tree editor and FORTE is the cut-set engine, were suggested and demonstrated. The suggested methods deal with the following selected four typical cases: Case 1: an event tree event (E) is represented by a fault tree gate whose inputs consist of only fault tree gates, Case 2: E is represented by a single basic event, Case 3: E is represented by an OR fault tree gate which has a single basic event and a fault tree gate as inputs, and Case 4: E is represented by an AND fault tree gate which has a single basic event and a fault tree gate as inputs. In the suggested methods, first the high level logic structures of event tree events are examined and restructured, if needed. Then, the delete term method, the exact method, and the combination of the two methods are applied to Case 1, Case 2, and Cases 3 and 4, respectively. Also, it is recommended to treat complementary events, using the suggested methods, before level 1 and level 2 PRA fault trees are coupled. It should be noted that the selected four typical cases may not cover all different cases encountered in level 1 and level 2 PRA modeling. However, a process similar to the one suggested in this study may be used to find

  4. Comparison of Land, Water, and Energy Requirements of Lettuce Grown Using Hydroponic vs. Conventional Agricultural Methods.

    Science.gov (United States)

    Barbosa, Guilherme Lages; Gadelha, Francisca Daiane Almeida; Kublik, Natalya; Proctor, Alan; Reichelm, Lucas; Weissinger, Emily; Wohlleb, Gregory M; Halden, Rolf U

    2015-06-16

    The land, water, and energy requirements of hydroponics were compared to those of conventional agriculture by example of lettuce production in Yuma, Arizona, USA. Data were obtained from crop budgets and governmental agricultural statistics, and contrasted with theoretical data for hydroponic lettuce production derived by using engineering equations populated with literature values. Yields of lettuce per greenhouse unit (815 m2) of 41 ± 6.1 kg/m2/y had water and energy demands of 20 ± 3.8 L/kg/y and 90,000 ± 11,000 kJ/kg/y (±standard deviation), respectively. In comparison, conventional production yielded 3.9 ± 0.21 kg/m2/y of produce, with water and energy demands of 250 ± 25 L/kg/y and 1100 ± 75 kJ/kg/y, respectively. Hydroponics offered 11 ± 1.7 times higher yields but required 82 ± 11 times more energy compared to conventionally produced lettuce. To the authors' knowledge, this is the first quantitative comparison of conventional and hydroponic produce production by example of lettuce grown in the southwestern United States. It identified energy availability as a major factor in assessing the sustainability of hydroponics, and it points to water-scarce settings offering an abundance of renewable energy (e.g., from solar, geothermal, or wind power) as particularly attractive regions for hydroponic agriculture.

  5. Effect of Chemistry Triangle Oriented Learning Media on Cooperative, Individual and Conventional Method on Chemistry Learning Result

    Science.gov (United States)

    Latisma D, L.; Kurniawan, W.; Seprima, S.; Nirbayani, E. S.; Ellizar, E.; Hardeli, H.

    2018-04-01

    The purpose of this study was to see which method are well used with the Chemistry Triangle-oriented learning media. This quasi experimental research involves first grade of senior high school students in six schools namely each two SMA N in Solok city, in Pasaman and two SMKN in Pariaman. The sampling technique was done by Cluster Random Sampling. Data were collected by test and analyzed by one-way anova and Kruskall Wallish test. The results showed that the high school students in Solok learning taught by cooperative method is better than the results of student learning taught by conventional and Individual methods, both for students who have high initial ability and low-ability. Research in SMK showed that the overall student learning outcomes taught by conventional method is better than the student learning outcomes taught by cooperative and individual methods. Student learning outcomes that have high initial ability taught by individual method is better than student learning outcomes that are taught by cooperative method and for students who have low initial ability, there is no difference in student learning outcomes taught by cooperative, individual and conventional methods. Learning in high school in Pasaman showed no significant difference in learning outcomes of the three methods undertaken.

  6. VOLATILE CONSTITUENTS OF GINGER OIL PREPARED ACCORDING TO IRANIAN TRADITIONAL MEDICINE AND CONVENTIONAL METHOD: A COMPARATIVE STUDY.

    Science.gov (United States)

    Shirooye, Pantea; Mokaberinejad, Roshanak; Ara, Leila; Hamzeloo-Moghadam, Maryam

    2016-01-01

    Herbal medicines formulated as oils were believed to possess more powerful effects than their original plants in Iranian Traditional Medicine (ITM). One of the popular oils suggested for treatment of various indications was ginger oil. In the present study, to suggest a more convenient method of oil preparation (compared to the traditional method), ginger oil has been prepared according to both the traditional and conventional maceration methods and the volatile oil constituents have been compared. Ginger oil was obtained in sesame oil according to both the traditional way and the conventional (maceration) methods. The volatile oil of dried ginger and both oils were obtained by hydro-distillation and analyzed by gas chromatography/mass spectroscopy. Fifty five, fifty nine and fifty one components consisting 94 %, 94 % and 98 % of the total compounds were identified in the volatile oil of ginger, traditional and conventional oils, respectively. The most dominant compounds of the traditional and conventional oils were almost similar; however they were different from ginger essential oil which has also been to possess limited amounts of anti-inflammatory components. It was concluded that ginger oil could be prepared through maceration method and used for indications mentioned in ITM.

  7. Manufacturing and characterization of ceramic pigment Zn1-xFexCr2O4 by synthetic non conventional methods

    International Nuclear Information System (INIS)

    Nieves, Leidy Johana Jaramillo; Baena, Oscar Jaime Restrepo

    2012-01-01

    The ceramic pigment with structure Zn 1-x Fe x Cr 2 O 4 (x = 0, 0.5, 1) was synthesized by non conventional methods of coprecipitation assisted by ultrasound and milling of high energy. This pigment was characterized by XRD, XRF, SEM, UV-VIS spectrophotometry and CIELab colorimetry. The aim of this work was studied two alternative methods to the traditional method of synthesis, evaluating the pigment properties, varying the stoichiometry, such as structure, composition, morphology and colorimetric coordinates. The results showed that is possible to obtain the desired crystalline structure at temperatures below 1000 ° C in both cases, also expected hues are obtained according to each stoichiometry, which shows the advantages of using methods non conventional when produce these pigments, since it has a higher controlling the composition, stoichiometry and is obtained at temperatures below compared with traditional ceramic method

  8. 40 CFR 180.1200 - Pseudomonas fluorescens strain PRA-25; temporary exemption from the requirement of a tolerance.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Pseudomonas fluorescens strain PRA-25... RESIDUES IN FOOD Exemptions From Tolerances § 180.1200 Pseudomonas fluorescens strain PRA-25; temporary... established for residues of the microbial pesticide, pseudomonas fluorescens strain PRA-25 when used on peas...

  9. Studi Awal Pra Desain Pabrik Bioetanol dari Nira Siwalan

    Directory of Open Access Journals (Sweden)

    Novarian Budisetyowati

    2017-01-01

    Full Text Available Bioetanol kini banyak dikembangkan sebagai bahan bakar alternatif pengganti bahan bakar fosil. Bioetanol untuk campuran bensin harus memiliki kemurnian sebesar 99,5-100%. Bioetanol dapat diperoleh dengan proses fermentasi yang melibatkan mikroorganisme. Pra desain pabrik bioetanol dari nira siwalan ini menggunakan proses fermentasi. Bahan baku berupa nira siwalan diasamkan dengan menggunakan H2SO4, kemudian disterilisasi sebelum difermentasi di fermentor selama 36 jam. Adapun mikroorganisme yang digunakan adalah Saccharomyces cereviceae. Bakteri ini mampu mengurai gula tanpa kehadiran oksigen dan menghasilkan etanol dan karbondioksida. Bioetanol dapat diperoleh dengan proses fermentasi yang melibatkan mikroorganisme. Pra desain pabrik bioetanol dari nira siwalan ini menggunakan proses fermentasi. Bahan baku berupa nira siwalan diasamkan dengan menggunakan H2SO4, kemudian disterilisasi sebelum difermentasi di fermentor selama 36 jam. Adapun mikroorganisme yang digunakan adalah Saccharomyces cereviceae. Setelah dari fermentor nira yang sudah difermentasi dinetralkan pH nya menggunakan NH4OH di tangki netralisasi. Dari tangki netralisasi nira dipompakan melewati preheater sebelum masuk ke kolom distilasi. Pemurnian dilakukan dengan menggunakan kolom distilasi sebanyak 2 buah. Pada distilasi yang pertama diperoleh kadar etanol sebesar 60% dan pada distilasi yang kedua diperoleh kadar 96%. Dari kolom distilasi 2 larutan didinginkan menggunakan cooler untuk didapatkan suhu 32oC agar sesuai dengan suhu proses dehidrasi dengan menggunakan Molecular Sieve yang diinginkan. Proses dehidrasi dilakukan untuk mendapat kadar etanol 99,5%. Etanol 99,5% yang dihasilkan kemudian disimpan dalam tangki penampung. Kebutuhan bioetanol dalam negeri pada tahun 2018 diperkirakan 3.166.015,13 kL/tahun. Berdasarkan analisa ekonomi yang dilakukan, diperoleh hasil sebagai berikut internal rate of return 26,53 % per tahun, pay out time 4,73 tahun, dan BEP 34,62 % Ditinjau

  10. Treatment of children with Helicobacter infection and malabsorption syndromes with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Lawson, P F [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); Lawson, W [Clinique des Maladies de l' Appareil Digestif, Cotonou (Benin); De Maio, G; Andriulli, A [Ospedale Casa Sollievo della Sofferenza, San Giovanni Rotondo (Italy); Ghoos, Y [Lab. Digestie Absoptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    There is a large interest about Heliobacter pylori infection in childhood nowadays. The prevalence of infection is very high in developing countries and this is extremely correlated to the living conditions with consequences on the future health of children. Contamination mode is not well known but environment factors are involved. We used {sup 13}C Urea Breath Test to assess the prevalence rate in beninese asymptomatic children aged 7-11 years old (about 86%). We evaluated the influence of either conventional or probiotics therapy in eradicating Hp infection and some relationships with growth parameters. We concluded that conventional therapy or use of probiotics might improve infection status and probably influence growth factors in childhood. (author)

  11. The efficacy of selective calculus ablation at 400 nm: comparison to conventional calculus removal methods

    Science.gov (United States)

    Schoenly, Joshua E.; Seka, Wolf; Romanos, Georgios; Rechmann, Peter

    A desired outcome of scaling and root planing is the complete removal of calculus and infected root tissue and preservation of healthy cementum for rapid healing of periodontal tissues. Conventional periodontal treatments for calculus removal, such as hand instrument scaling and ultrasonic scaling, often deeply scrape the surface of the underlying hard tissue and may leave behind a smear layer. Pulsed lasers emitting at violet wavelengths (specifically, 380 to 400 nm) are a potential alternative treatment since they can selectively ablate dental calculus without ablating pristine hard tissue (i.e., enamel, cementum, and dentin). In this study, light and scanning electron microscopy are used to compare and contrast the efficacy of in vitro calculus removal for several conventional periodontal treatments (hand instruments, ultrasonic scaler, and Er:YAG laser) to calculus removal with a frequency-doubled Ti:sapphire (λ = 400 nm). After calculus removal, enamel and cementum surfaces are investigated for calculus debris and damage to the underlying hard tissue surface. Compared to the smear layer, grooves, and unintentional hard tissue removal typically found using these conventional treatments, calculus removal using the 400-nm laser is complete and selective without any removal of pristine dental hard tissue. Based on these results, selective ablation from the 400-nm laser appears to produce a root surface that would be more suitable for successful healing of periodontal tissues.

  12. Comparative study on flow rate measurement by nuclear and conventional methods in selected rivers at Ulu Langat district, Selangor

    Energy Technology Data Exchange (ETDEWEB)

    Wan Mohamad Tahir, Wan Zakaria; Mohamad, Daud; Hamzah, Abdul Razak; Yusuf, Johari Mohamad; Aziz Wan Mohamad, Wan Abdul

    1986-06-01

    A radiotracer technique using Tc-99 to measure flows of small rivers was introduced in Malaysia. Three rivers in the Ulu Langat District were selected for a comparative study on flow rate determination by conventional and radioisotope methods. Radioisotopic approach, comprising injection procedures, calibration, mixing length and safety aspects are discussed. The results measured by radioisotope method are compared to the Drainage and Irrigation Department's (DID's) discharge curves data collected from 1980 to 1982 which is calibrated using a current meter. The results are comparable and fall within the range obtained by conventional method. Related to this study, a comprehensive work on stream gauging of moderate and high flow rates using both methods is proposed to be carried out directly.

  13. An Alternative to Conventional Rock Fragmentation Methods Using SCDA: A Review

    Directory of Open Access Journals (Sweden)

    Radhika Vidanage De Silva

    2016-11-01

    Full Text Available Global energy and material consumption are expected to rise in exponential proportions during the next few decades, generating huge demands for deep earth energy (oil/gas recovery and mineral processing. Under such circumstances, the continuation of existing methods in rock fragmentation in such applications is questionable due to the proven adverse environmental impacts associated with them. In this regard; the possibility of using more environmentally friendly options as Soundless Chemical Demolition Agents (SCDAs play a vital role in replacing harmful conventional rock fragmentation techniques for gas; oil and mineral recovery. This study reviews up to date research on soundless cracking demolition agent (SCDA application on rock fracturing including its limitations and strengths, possible applications in the petroleum industry and the possibility of using existing rock fragmentation models for SCDA-based rock fragmentation; also known as fracking. Though the expansive properties of SCDAs are currently used in some demolition works, the poor usage guidelines available reflect the insufficient research carried out on its material’s behavior. SCDA is a cementitious powdery substance with quicklime (CaO as its primary ingredient that expands upon contact with water; which results in a huge expansive pressure if this CaO hydration reaction occurs in a confined condition. So, the mechanism can be used for rock fragmentation by injecting the SCDA into boreholes of a rock mass; where the resulting expansive pressure is sufficient to create an effective fracture network in the confined rock mass around the borehole. This expansive pressure development, however, dependent on many factors, where formation water content creates a negative influence on this due to required greater degree of hydration under greater water contents and temperature creates a positive influence by accelerating the reaction. Having a precise understanding of the fracture

  14. Primer uticaja filtriranja slike u sistemima za praćenje ciljeva primenom termovizije / An example of image filtering in target tracking systems with thermal imagery

    Directory of Open Access Journals (Sweden)

    Zvonko M. Radosavljević

    2003-07-01

    Full Text Available U radu je dat primer primene jedne vrste niskofrekventnog filtriranja sa usrednjavanjem, koje se primenjuje u sistemima za detekciju i praćenje ciljeva u vazdušnom prostoru primenom termovizije. Date su dve metode filtriranja slike. Prva metoda koristi niskofrekventno konvoluciono filtriranje a druga usrednjavajući filtar na osnovu srednje vrednosti nivoa sivog. Ovi filtri su primenjeni u sistemima za praćenje uz pomoć infracrvenih senzora. Određivanje nivoa praga filtriranja vrši se uz pomoć statističkih osobina slike. Veoma važan korak u procesu praćenja je određivanje prozora praćenja, koji maze biti, po dimenzijama, fiksan ili adaptibilan. Pogrešna procena o postojanju cilja u prozoru može se doneti u slučaju prisustva šuma pozadine, predpojačavača, detektora, itd. Filtriranje je neophodan korak u ovim sistemima, kao značajan činilac U povećanju brzine i tačnosti praćenja. / A case of image filtering in air target detecting and tracking systems is described in this paper. Two image filtering methods are given. The first method is performed using a low pass convolving filter and the second one uses the mean value of gray level filter. The main goal of the cited filtering is implementation in IR (infra red systems. Some statistical features of the images were used for selecting the threshold level. The next step in the algorithm is the determination of a 'tracking window' that can be fixed or adaptive in size. A false estimation of a target existing in the window may be influenced by the background noise, low noise amplifier detector, etc.

  15. Application of RIA of PRA, AT II and NPY in typing and therapy of EH patients

    International Nuclear Information System (INIS)

    Yang Yongqing; Wang Xiaozhou; Jiang Qinian

    2001-01-01

    Objective: To study the typing and AT II receptor inhibitor therapy for essential hypertension (EH) patients. Methods: Plasma RA, AT II and NPY levels were measured by radioimmunoassay (RIA) in 208 Patients with EH and 100 controls; plasma NPY levels were measured in 40 EH patients before and after AT II receptor inhibitor therapy. The mean coefficient of variation for intra and inter batch-assay were less than 10% and 15% respectively. Results: In 208 EH patients plasma PRA levels were increased, normal and decreased in 17.8%, 71.6% and 10.6% respectively, while in 128 EH patients Plasma AT II levels were increased, normal and decreased in 20.3%, 64.1% and 15.6% respectively. In 69 EH Plasma NPY levels were significantly higher than those in 40 control subjects. (17 grade I EH, 137.3 +- 32.6 pg/mL; 28 grade II EH, 148.5 +- 41.1 pg/mL; 24 grade III EH, 162.4 +- 42.7 pg/mL; 40 controls, 118.5 +- 30.5 pg/mL). In 40 EH patients plasma NPY levels were decreased after AT II receptor inhibitor therapy as the blood pressure decreased. Conclusion: Typing of EH patients according to levels of plasma PRA and AT II is useful in guiding treatment. AT II receptor inhibitors are indicated in those patients with increased plasma levels and NPY levels can be used for appraisal of the treatment efficacy

  16. Use of PRA techniques to optimize the design of the IRIS nuclear power plant

    International Nuclear Information System (INIS)

    Muhlheim, M.D.; Cletcher, J.W. II

    2003-01-01

    True design optimization of a plants inherent safety and performance characteristics results when a probabilistic risk assessment (PRA) is integrated with the plant-level design process. This is the approach being used throughout the design of the International Reactor Innovative and Secure (IRIS) nuclear power plant to maximize safety. A risk-based design optimization tool employing a 'one-button' architecture is being developed by the Oak Ridge National Laboratory to evaluate design changes; new modeling approaches, methods, or theories modeling uncertainties and completeness; physical assumptions; and data changes on component, cabinet, train, and system bases. Unlike current PRAs, the one-button architecture allows components, modules, and data to be interchanged at will with the probabilistic effect immediately apparent. Because all of the current and previous design, and data sets are available via the one-button architecture, the safety ramifications of design options are evaluated, feedback on design alternatives is immediate, and true optimization and understanding can be achieved. Thus, for the first time, PRA analysts and designers can easily determine the probabilistic implications of different design configurations and operating conditions in various combinations for the entire range of initiating events. The power of the one-button architecture becomes evident by the number of design alternatives that can be evaluated C11 component choices yielded 160 design alternatives. Surprisingly, the lessons learned can be counter-intuitive and significant. For example, one of the alternative designs for IRIS evaluated via this architecture revealed that because of common-cause failure probabilities, using the most reliable components actually decreased systems' reliability. (author)

  17. In-vitro evaluation of the accuracy of conventional and digital methods of obtaining full-arch dental impressions.

    Science.gov (United States)

    Ender, Andreas; Mehl, Albert

    2015-01-01

    To investigate the accuracy of conventional and digital impression methods used to obtain full-arch impressions by using an in-vitro reference model. Eight different conventional (polyether, POE; vinylsiloxanether, VSE; direct scannable vinylsiloxanether, VSES; and irreversible hydrocolloid, ALG) and digital (CEREC Bluecam, CER; CEREC Omnicam, OC; Cadent iTero, ITE; and Lava COS, LAV) full-arch impressions were obtained from a reference model with a known morphology, using a highly accurate reference scanner. The impressions obtained were then compared with the original geometry of the reference model and within each test group. A point-to-point measurement of the surface of the model using the signed nearest neighbour method resulted in a mean (10%-90%)/2 percentile value for the difference between the impression and original model (trueness) as well as the difference between impressions within a test group (precision). Trueness values ranged from 11.5 μm (VSE) to 60.2 μm (POE), and precision ranged from 12.3 μm (VSE) to 66.7 μm (POE). Among the test groups, VSE, VSES, and CER showed the highest trueness and precision. The deviation pattern varied with the impression method. Conventional impressions showed high accuracy across the full dental arch in all groups, except POE and ALG. Conventional and digital impression methods show differences regarding full-arch accuracy. Digital impression systems reveal higher local deviations of the full-arch model. Digital intraoral impression systems do not show superior accuracy compared to highly accurate conventional impression techniques. However, they provide excellent clinical results within their indications applying the correct scanning technique.

  18. Effect of amaranth dye on the growth and properties of conventional and SR method grown KAP single crystals

    Science.gov (United States)

    Babu Rao, G.; P., Rajesh; Ramasamy, P.

    2018-04-01

    The 0.1 mol% amaranth added KAP single crystals were grown from aqueous solutions by both slow evaporation solution technique and Sankaranarayanan-Ramasamy method. The single crystal having dimension of 45 mm length and 12 mm diameter was grown with growth rate of 1.5 mm/day using SR method. 87 % transmittance is obtained for SR method grown amaranth added KAP single crystal. The high intense luminescence at 661 nm is obtained from amaranth added conventional and SR method grown KAP single crystal. The amaranth added KAP single crystal possesses good mechanical and laser damage threshold stability.

  19. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  20. [Study on friction and wear properties of dental zirconia ceramics processed by microwave and conventional sintering methods].

    Science.gov (United States)

    Guoxin, Hu; Ying, Yang; Yuemei, Jiang; Wenjing, Xia

    2017-04-01

    This study evaluated the wear of an antagonist and friction and wear properties of dental zirconia ceramic that was subjected to microwave and conventional sintering methods. Ten specimens were fabricated from Lava brand zirconia and randomly assigned to microwave and conventional sintering groups. A profile tester for surface roughness was used to measure roughness of the specimens. Wear test was performed, and steatite ceramic was used as antagonist. Friction coefficient curves were recorded, and wear volume were calculated. Finally, optical microscope was used to observe the surface morphology of zirconia and steatite ceramics. Field emission scanning electron microscopy was used to observe the microstructure of zirconia. Wear volumes of microwave and conventionally sintered zirconia were (6.940±1.382)×10⁻², (7.952±1.815) ×10⁻² mm³, respectively. Moreover, wear volumes of antagonist after sintering by the considered methods were (14.189±4.745)×10⁻², (15.813±3.481)×10⁻² mm³, correspondingly. Statistically significant difference was not observed in the wear resistance of zirconia and wear volume of steatite ceramic upon exposure to two kinds of sintering methods. Optical microscopy showed that ploughed surfaces were apparent in zirconia. The wear surface of steatite ceramic against had craze, accompanied by plough. Scanning electron microscopy showed that zirconia was sintered compactly when subjected to both conventional sintering and microwave methods, whereas grains of zirconia sintered by microwave alone were smaller and more uniform. Two kinds of sintering methods are successfully used to produce dental zirconia ceramics with similar friction and wear properties.
.

  1. [A comparative study of blood culture conventional method vs. a modified lysis/centrifugation technique for the diagnosis of fungemias].

    Science.gov (United States)

    Santiago, Axel Rodolfo; Hernández, Betsy; Rodríguez, Marina; Romero, Hilda

    2004-12-01

    The purpose of this work was to compare the efficacy of blood culture conventional method vs. a modified lysis/centrifugation technique. Out of 450 blood specimens received in one year, 100 where chosen for this comparative study: 60 from patients with AIDS, 15 from leukemic patients, ten from febrile neutropenic patients, five from patients with respiratory infections, five from diabetics and five from septicemic patients. The specimens were processed, simultaneously, according to the above mentioned methodologies with daily inspections searching for fungal growth in order to obtain the final identification of the causative agent. The number (40) of isolates recovered was the same using both methods, which included; 18 Candida albicans (45%), ten Candida spp. (25%), ten Histoplasma capsulatum (25%), and two Cryptococcus neoformans (5%). When the fungal growth time was compared by both methods, growth was more rapid when using the modified lysis/centrifugation technique than when using the conventional method. Statistical analysis revealed a significant difference (pcentrifugation technique showed to be more efficacious than the conventional one, and therefore the implementation of this methodology is highly recommended for the isolation of fungi from blood.

  2. Structural and electrical properties of copper-nickel-aluminum alloys obtained by conventional powder metallurgy method

    International Nuclear Information System (INIS)

    Monteiro, Waldemar A.; Carrio, Juan A.G.; Silveira, C.R. da; Pertile, H.K.S.

    2009-01-01

    This work looked for to search out systematically, in scale of laboratory, copper-nickel-aluminum alloys (Cu-Ni-Al) with conventional powder metallurgy processing, in view of the maintenance of the electric and mechanical properties with the intention of getting electric connectors of high performance or high mechanical damping. After cold uniaxial pressing (1000 kPa), sintering (780 deg C) and convenient homogenization treatments (500 deg C for different times) under vacuum (powder metallurgy), the obtained Cu-Ni-Al alloys were characterized by optical microscopy, electrical conductivity, Vickers hardness. X rays powder diffraction data were collected for the sintered samples in order to a structural and microstructural analysis. The comparative analysis is based on the sintered density, hardness, macrostructures and microstructures of the samples. (author)

  3. COMPARATIVE EVALUATION OF CONVENTIONAL VERSUS RAPID METHODS FOR AMPLIFIABLE GENOMIC DNA ISOLATION OF CULTURED Azospirillum sp. JG3

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.

  4. Comparison of the Lysis Centrifugation Method with the Conventional Blood Culture Method in Cases of Sepsis in a Tertiary Care Hospital

    OpenAIRE

    Parikh, Harshal R; De, Anuradha S; Baveja, Sujata M

    2012-01-01

    Introduction : Physicians and microbiologists have long recognized that the presence of living microorganisms in the blood of a patient carries with it considerable morbidity and mortality. Hence, blood cultures have become critically important and frequently performed test in clinical microbiology laboratories for diagnosis of sepsis. Objectives: To compare the conventional blood culture method with the lysis centrifugation method in cases of sepsis. Materials and Methods: Two hundred ...

  5. SELECTION OF NON-CONVENTIONAL MACHINING PROCESSES USING THE OCRA METHOD

    Directory of Open Access Journals (Sweden)

    Miloš Madić

    2015-04-01

    Full Text Available Selection of the most suitable nonconventional machining process (NCMP for a given machining application can be viewed as multi-criteria decision making (MCDM problem with many conflicting and diverse criteria. To aid these selection processes, different MCDM methods have been proposed. This paper introduces the use of an almost unexplored MCDM method, i.e. operational competitiveness ratings analysis (OCRA method for solving the NCMP selection problems. Applicability, suitability and computational procedure of OCRA method have been demonstrated while solving three case studies dealing with selection of the most suitable NCMP. In each case study the obtained rankings were compared with those derived by the past researchers using different MCDM methods. The results obtained using the OCRA method have good correlation with those derived by the past researchers which validate the usefulness of this method while solving complex NCMP selection problems.

  6. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods

    Directory of Open Access Journals (Sweden)

    Shiva Alavi

    2017-01-01

    Conclusion: MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  7. Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens

    International Nuclear Information System (INIS)

    Morgan, M.A.; Horstmeier, C.D.; DeYoung, D.R.; Roberts, G.D.

    1983-01-01

    The BACTEC system and three conventional media (Middlebrook 7H10, selective Middlebrook 7H11 [S7H11], and Lowenstein-Jensen [LJ] were compared for their mean recovery times and recovery rates of mycobacteria from acid-fast, smear-negative clinical specimens. Of the 71 smear-negative, culture-positive specimens recovered from 2,165 submitted smear-negative cultures, the BACTEC system detected 71.8%, compared with 88.7% for the conventional three-medium system. When media were individually compared, BACTEC medium (Middlebrook 7H12) was more successful in recovering mycobacteria (71.8%) than was LJ (62%), Middlebrook medium 7H10 (55.9%), or Middlebrook S7H11 medium (52.1%). Middlebrook 7H11 medium containing sodium selenate was also evaluated and did not increase the recovery rate or decrease the recovery time of mycobacterial species when compared with LJ, Middlebrook 7H10, S7H11, and 7H12 media. The mean detection time for the BACTEC system was less than that by conventional methods for the seven species of mycobacteria recovered. Detection times for Mycobacterium tuberculosis on the BACTEC system and conventional cultural systems were 13.7 and 26.3 days, respectively

  8. Comparative Analysis of Conventional Method with Activity Based Costing in PT Mulia Sejati Gallery

    OpenAIRE

    Erena, Irma Nadia; Gani, Engelwati

    2016-01-01

    The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data ana...

  9. Comparison of methods used to estimate conventional undiscovered petroleum resources: World examples

    Science.gov (United States)

    Ahlbrandt, T.S.; Klett, T.R.

    2005-01-01

    Various methods for assessing undiscovered oil, natural gas, and natural gas liquid resources were compared in support of the USGS World Petroleum Assessment 2000. Discovery process, linear fractal, parabolic fractal, engineering estimates, PETRIMES, Delphi, and the USGS 2000 methods were compared. Three comparisons of these methods were made in: (1) the Neuquen Basin province, Argentina (different assessors, same input data); (2) provinces in North Africa, Oman, and Yemen (same assessors, different methods); and (3) the Arabian Peninsula, Arabian (Persian) Gulf, and North Sea (different assessors, different methods). A fourth comparison (same assessors, same assessment methods but different geologic models), between results from structural and stratigraphic assessment units in the North Sea used only the USGS 2000 method, and hence compared the type of assessment unit rather than the method. In comparing methods, differences arise from inherent differences in assumptions regarding: (1) the underlying distribution of the parent field population (all fields, discovered and undiscovered), (2) the population of fields being estimated; that is, the entire parent distribution or the undiscovered resource distribution, (3) inclusion or exclusion of large outlier fields; (4) inclusion or exclusion of field (reserve) growth, (5) deterministic or probabilistic models, (6) data requirements, and (7) scale and time frame of the assessment. Discovery process, Delphi subjective consensus, and the USGS 2000 method yield comparable results because similar procedures are employed. In mature areas such as the Neuquen Basin province in Argentina, the linear and parabolic fractal and engineering methods were conservative compared to the other five methods and relative to new reserve additions there since 1995. The PETRIMES method gave the most optimistic estimates in the Neuquen Basin. In less mature areas, the linear fractal method yielded larger estimates relative to other methods

  10. Issues and insights of PRA methodology in nuclear and space applications

    International Nuclear Information System (INIS)

    Hsu, F.

    2005-01-01

    This paper presents some important issues and technical insights on the scope, conceptual framework, and essential elements of nuclear power plant Probabilistic Risk Assessments (PRAs) and that of the PRAs in general applications of the aerospace industry, such as the Space Shuttle PRA being conducted by NASA. Discussions are focused on various lessons learned in nuclear power plant PRA applications and their potential applicability to the PRAs in the aerospace and launch vehicle systems. Based on insights gained from PRA projects for nuclear power plants and from the current Space Shuttle PRA effort, the paper explores the commonalities and the differences between the conduct of the different PRAs and the key issues and risk insights derived from extensive modeling practices in both industries of nuclear and space. (author)

  11. How Can You Support RIDM/CRM/RM Through the Use of PRA

    Science.gov (United States)

    DoVemto. Tpmu

    2011-01-01

    Probabilistic Risk Assessment (PRA) is one of key Risk Informed Decision Making (RIDM) tools. It is a scenario-based methodology aimed at identifying and assessing Safety and Technical Performance risks in complex technological systems.

  12. Overview of seismic margin insights gained from seismic PRA results

    International Nuclear Information System (INIS)

    Kennedy, R.P.; Sues, R.H.; Campbell, R.D.

    1986-01-01

    This paper presents the findings of a study conducted under NRC and EPRI sponsorship in which published seismic PRAs were reviewed in order to gain insight to the seismic margins inherent in existing nuclear plants. The approach taken was to examine the fragilities of those components which have been found to be dominant contributors to seismic risk at plants in low-to-moderate seismic regions (SSE levels between 0.12g and 0.25g). It is concluded that there is significant margin inherent in the capacity of most critical components above the plant design basis. For ground motions less than about 0.3g, the predominant sources of seismic risk are loss of offsite power coupled with random failure of the emergency diesels, non-recoverable circuit breaker trip due to relay chatter, unanchored equipment, unreinforced non-load bearing block walls, vertical water storage tanks, systems interactions and possibly soil liquefaction. Recommendations as to which components should be reviewed in seismic margin studies for margin earthquakes less than 0.3g, between 0.3g and 0.5g, and greater than 0.5g, developed by the NRC expert panel on the quantification of seismic margins (based on the review of past PRA data, earthquake experience data, and their own personal experience) are presented

  13. Teaching Dental Students to Understand the Temporomandibular Joint Using MRI: Comparison of Conventional and Digital Learning Methods.

    Science.gov (United States)

    Arús, Nádia A; da Silva, Átila M; Duarte, Rogério; da Silveira, Priscila F; Vizzotto, Mariana B; da Silveira, Heraldo L D; da Silveira, Heloisa E D

    2017-06-01

    The aims of this study were to evaluate and compare the performance of dental students in interpreting the temporomandibular joint (TMJ) with magnetic resonance imaging (MRI) scans using two learning methods (conventional and digital interactive learning) and to examine the usability of the digital learning object (DLO). The DLO consisted of tutorials about MRI and anatomic and functional aspects of the TMJ. In 2014, dental students in their final year of study who were enrolled in the elective "MRI Interpretation of the TMJ" course comprised the study sample. After exclusions for nonattendance and other reasons, 29 of the initial 37 students participated in the study, for a participation rate of 78%. The participants were divided into two groups: a digital interactive learning group (n=14) and a conventional learning group (n=15). Both methods were assessed by an objective test applied before and after training and classes. Aspects such as support and training requirements, complexity, and consistency of the DLO were also evaluated using the System Usability Scale (SUS). A significant between-group difference in the posttest results was found, with the conventional learning group scoring better than the DLO group, indicated by mean scores of 9.20 and 8.11, respectively, out of 10. However, when the pretest and posttest results were compared, both groups showed significantly improved performance. The SUS score was 89, which represented a high acceptance of the DLO by the users. The students who used the conventional method of learning showed superior performance in interpreting the TMJ using MRI compared to the group that used digital interactive learning.

  14. Determination of in vitro susceptibility of Mycobacterium tuberculosis to cephalosporins by radiometric and conventional methods

    International Nuclear Information System (INIS)

    Heifets, L.B.; Iseman, M.D.; Cook, J.L.; Lindholm-Levy, P.J.; Drupa, I.

    1985-01-01

    Among eight cephalosporins and cephamycins tested in preliminary in vitro screening against Mycobacterium tuberculosis, the most promising for further study was found to be ceforanide, followed by ceftizoxime, cephapirin, and cefotaxime. Moxalactam, cefoxitin, cefamandole, and cephalothin were found to be not active enough against M. tuberculosis to be considered for further in vitro studies. The antibacterial activity of various ceforanide concentrations was investigated by three methods: (i) the dynamics of radiometric readings (growth index) in 7H12 broth; (ii) the number of CFU in the same medium; and (iii) the proportion method on 7H11 agar plates. There was a good correlation among the results obtained with these methods. The MIC for most strains ranged from 6.0 to 25.0 micrograms/ml. The BACTEC radiometric method is a reliable, rapid, and convenient method for preliminary screening and determination of the level of antibacterial activity of drugs not commonly used against M. tuberculosis

  15. Comparative study of age estimation using dentinal translucency by digital and conventional methods

    Science.gov (United States)

    Bommannavar, Sushma; Kulkarni, Meena

    2015-01-01

    Introduction: Estimating age using the dentition plays a significant role in identification of the individual in forensic cases. Teeth are one of the most durable and strongest structures in the human body. The morphology and arrangement of teeth vary from person-to-person and is unique to an individual as are the fingerprints. Therefore, the use of dentition is the method of choice in the identification of the unknown. Root dentin translucency is considered to be one of the best parameters for dental age estimation. Traditionally, root dentin translucency was measured using calipers. Recently, the use of custom built software programs have been proposed for the same. Objectives: The present study describes a method to measure root dentin translucency on sectioned teeth using a custom built software program Adobe Photoshop 7.0 version (Adobe system Inc, Mountain View California). Materials and Methods: A total of 50 single rooted teeth were sectioned longitudinally to derive a 0.25 mm uniform thickness and the root dentin translucency was measured using digital and caliper methods and compared. The Gustafson's morphohistologic approach is used in this study. Results: Correlation coefficients of translucency measurements to age were statistically significant for both the methods (P < 0.125) and linear regression equations derived from both methods revealed better ability of the digital method to assess age. Conclusion: The custom built software program used in the present study is commercially available and widely used image editing software. Furthermore, this method is easy to use and less time consuming. The measurements obtained using this method are more precise and thus help in more accurate age estimation. Considering these benefits, the present study recommends the use of digital method to assess translucency for age estimation. PMID:25709325

  16. Consumer acceptance and aroma characterization of navy bean (Phaseolus vulgaris) powders prepared by extrusion and conventional processing methods.

    Science.gov (United States)

    Szczygiel, Edward J; Harte, Janice B; Strasburg, Gale M; Cho, Sungeun

    2017-09-01

    Food products produced with bean ingredients are gaining in popularity among consumers due to the reported health benefits. Navy bean (Phaseolus vulgaris) powder produced through extrusion can be considered as a resource-efficient alternative to conventional methods, which often involve high water inputs. Therefore, navy bean powders produced with extrusion and conventional methods were assessed for the impact of processing on consumer liking in end-use products and odor-active compounds. Consumer acceptance results reveal significant differences in flavor, texture and overall acceptance scores of several products produced with navy bean powder. Crackers produced with extruded navy bean powder received higher hedonic flavor ratings than those produced with commercial navy bean powder (P < 0.001). GC-O data showed that the commercial powder produced through conventional processing had much greater contents of several aliphatic aldehydes commonly formed via lipid oxidation, such as hexanal, octanal and nonanal with descriptors of 'grassy', 'nutty', 'fruity', 'dusty', and 'cleaner', compared to the extruded powder. Extrusion processed navy bean powders were preferred over commercial powders for certain navy bean powder applications. This is best explained by substantial differences in aroma profiles of the two powders that may have been caused by lipid oxidation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Prospective, Double-Blind Evaluation of Umbilicoplasty Techniques Using Conventional and Crowdsourcing Methods

    NARCIS (Netherlands)

    Veldhuisen, C.L. Van; Kamali, P.; Wu, W.; Becherer, B.E.; Sinno, H.H.; Ashraf, A.A.; Ibrahim, A.M.S.; Tobias, A.; Lee, B.T.; Lin, S.J.

    2017-01-01

    BACKGROUND: Umbilical reconstruction is an important component of deep inferior epigastric perforator (DIEP) flap breast reconstruction. This study evaluated the aesthetics of three different umbilical reconstruction techniques during DIEP flap breast reconstruction. METHODS: From January to April

  18. An overview on the conventional and nonconventional methods for manufacturing the metallic glasses

    Directory of Open Access Journals (Sweden)

    Axinte Eugen

    2017-01-01

    Full Text Available Metallic glasses (MGs, first discovered in 1959 at Caltech are currently among the most studied metallic materials. MGs called also glassy metals, amorphous metals, liquid metals, are considered to be among the materials of the future. The “classic” methods for industrialization of MGs are : end-casting in copper molds and protected environment, die forging , atomization for obtaining MG powder ,selective laser melting , imprinting in molds, thermoplastic shaping in the super-cooled temperature region. These methods are suitable for producing high value-added precision components but the problems still exists: expensive tools, limited lifetime of tools and the occurring of crystallization. Actually methods (thermoplastic shaping, casting and die forging are limited by the low flexibility of production and by higher costs of tools and accessories. More suitable methods are greatly desired to machine MGs for their wider applications.

  19. Dynamic Positioning System (DPS) Risk Analysis Using Probabilistic Risk Assessment (PRA)

    Science.gov (United States)

    Thigpen, Eric B.; Boyer, Roger L.; Stewart, Michael A.; Fougere, Pete

    2017-01-01

    The National Aeronautics and Space Administration (NASA) Safety & Mission Assurance (S&MA) directorate at the Johnson Space Center (JSC) has applied its knowledge and experience with Probabilistic Risk Assessment (PRA) to projects in industries ranging from spacecraft to nuclear power plants. PRA is a comprehensive and structured process for analyzing risk in complex engineered systems and/or processes. The PRA process enables the user to identify potential risk contributors such as, hardware and software failure, human error, and external events. Recent developments in the oil and gas industry have presented opportunities for NASA to lend their PRA expertise to both ongoing and developmental projects within the industry. This paper provides an overview of the PRA process and demonstrates how this process was applied in estimating the probability that a Mobile Offshore Drilling Unit (MODU) operating in the Gulf of Mexico and equipped with a generically configured Dynamic Positioning System (DPS) loses location and needs to initiate an emergency disconnect. The PRA described in this paper is intended to be generic such that the vessel meets the general requirements of an International Maritime Organization (IMO) Maritime Safety Committee (MSC)/Circ. 645 Class 3 dynamically positioned vessel. The results of this analysis are not intended to be applied to any specific drilling vessel, although provisions were made to allow the analysis to be configured to a specific vessel if required.

  20. Advances in Probabilistic Risk Assessment (PRA): a look into practitioners toolbox

    International Nuclear Information System (INIS)

    Mok, J.; Kaasalainen, S.; Donnelly, K.

    2007-01-01

    The ever-increasing emphasis on the use of Probabilistic Risk Assessment (PRA) in risk-informed decision making translates into increased expectations relating to PRA applications for the groups tasked with developing and maintaining the facility PRAs. In order to succeed in meeting the demand for PRA work, it is essential to develop methodologies and tools (or utilities) that improve the efficiency with which the PRAs are processed and manipulated to obtain a solution. Examples from the Nuclear Safety Solutions (NSS) PRA Practitioners tool box include utilities for cutting logical loops, optimizing fault trees (to decrease run-times), modularizing fault trees, and converting event trees into high level fault tree logic (an important element if the PRA study is to be used to support a risk monitor such as an Equipment Out-of-Service (EOOS) Monitor). The objective of this paper is be to briefly describe the main features of these utilities, and to illustrate the value they have in terms of improving the efficiency and effectiveness of PRA development and maintenance at NSS. (author)

  1. Treatment of children with Helicobacter pylori infection and malabsorption syndrome with probiotics: Comparison with conventional method

    Energy Technology Data Exchange (ETDEWEB)

    Ndiaye, M F; Mbengue, M; Mbaye, P S; Diouf, S [Societe Senegalaise de Gasto-enterologie et d' hepatologie, Dakar (Senegal); Ghoos, Y [Labo. Digestie Absorptie, Leuven (Belgium); Brunser, O [Institute of Nutrition and Food Technology, Santiago (Chile)

    2004-07-01

    Helicobacter pylori infection is one of the most common bacterial infection (82 %) in Senegal where malnutrition is common in children (25 %). Our aims were to definite prevalence of H. pylori, to determine the relationship between Hp infection and undernourishment and to verify the efficiency of treatment with probiotic. In some studies a positive effect of Saccharomyces boulardii has been demonstrated against H. pylori. We have included healthy children 7 to 10 years of age. 108 out of 129 (84%) were H. pylori-positive by breath-test. Two groups were randomised. Group A was treated with ten days' standard triple therapy (Omeprazole 1 mg Kg/day in single day gift, Amoxycillin 50 mg/kg/two times per day and Clarithromycin 250 mg two times per day). Group B received probiotic (250 mg of Saccharomyces boulardii with 5g Inulin three times per day) for 3 months. Evaluation of treatment was done one month after the end of therapy. Seventy one children out of 110 (64.5%) had digestive symptoms in their medical history. The main signs were recurrent abdominal pain in 64 cases. BMI were less than 18.50 in all the children with H. pylori infection without other nutritional abnormaly. Eight children were eradicated after treatment seven in the group under conventional treatment (58%) and one in the group under probiotics (6%). We concluded that prevalence of H. pylori infection is very high in young children as of the 7 years' age in urban as in rural environments. Symptoms are not specific. No significant difference in the nutritional state is observed between H. pylori-positive and H. pylori-negative children. Treatment by probiotics does not seem to give efficient results for eradication of H. pylori. (author)

  2. Conventional methods fail to measure cp(omega) of glass-forming liquids

    DEFF Research Database (Denmark)

    Christensen, Tage Emil; Olsen, Niels Boye; Dyre, Jeppe

    2007-01-01

    thermal-wave method does not measure the isobaric frequency-dependent specific heat cp(omega). This method rather measures a "longitudinal" frequency-dependent specific heat, a quantity defined and detailed here that is in between cp(omega) and cV(omega). This result means that no reliable wide......-frequency measurements of cp(omega) on liquids approaching the calorimetric glass transition exist. We briefly discuss consequences for experiment....

  3. Detection of Staphylococcus aureus among coagulase positive staphylococci from animal origin based on conventional and molecular methods

    Directory of Open Access Journals (Sweden)

    Nikolina Velizarova Rusenova

    2017-03-01

    Full Text Available The present study aimed to detect Staphylococcus aureus (S. aureus among other coagulase positive staphylococci from animal origin by using conventional methods (biochemical tests and latex agglutination and a molecular method, based on the nuc gene, as the gold standard and to assess the usefulness of these methods. For this purpose, total of 344 staphylococcal isolates were collected and analysed. A total of 156 isolates suspicious for S. aureus were detected by a conventional biochemical method – 88 from cows, 18 from goats, 7 from pigs, 17 from poultry, 7 from rabbits and 19 from dogs. The majority of S. aureus strains gave typical biochemical reactions with the exception of 30 (19.2% and 25 (16% that were VP negative and weak positive in fermenting mannitol, respectively. Twelve strains were found to be non-haemolytic (7.7% and four strains did not ferment trehalose (2.6%. Other staphylococci were identified as S. pseudintermedius (n = 103, S. hyicus (n = 23 and the rest were coagulase-negative staphylococci. Latex agglutination test resulted in rapid positive reactions with S. aureus with exception of 5 strains (3.2% from cow mastitis milk. Positive agglutination reactions were also established with S. pseudintermedius, and S. hyicus. PCR confirmed all strains that were preliminary identified as S. aureus by amplification of 270 bp fragment of nuc gene specific for this species. The atypical reactions in certain strains established in this study have shown that the precise detection of S. aureus from animal origin should be done by combination of conventional and molecular methods.

  4. A non-conventional watershed partitioning method for semi-distributed hydrological modelling: the package ALADHYN

    Science.gov (United States)

    Menduni, Giovanni; Pagani, Alessandro; Rulli, Maria Cristina; Rosso, Renzo

    2002-02-01

    The extraction of the river network from a digital elevation model (DEM) plays a fundamental role in modelling spatially distributed hydrological processes. The present paper deals with a new two-step procedure based on the preliminary identification of an ideal drainage network (IDN) from contour lines through a variable mesh size, and the further extraction of the actual drainage network (AND) from the IDN using land morphology. The steepest downslope direction search is used to identify individual channels, which are further merged into a network path draining to a given node of the IDN. The contributing area, peaks and saddles are determined by means of a steepest upslope direction search. The basin area is thus partitioned into physically based finite elements enclosed by irregular polygons. Different methods, i.e. the constant and variable threshold area methods, the contour line curvature method, and a topologic method descending from the Hortonian ordering scheme, are used to extract the ADN from the IDN. The contour line curvature method is shown to provide the most appropriate method from a comparison with field surveys. Using the ADN one can model the hydrological response of any sub-basin using a semi-distributed approach. The model presented here combines storm abstraction by the SCS-CN method with surface runoff routing as a geomorphological dispersion process. This is modelled using the gamma instantaneous unit hydrograph as parameterized by river geomorphology. The results are implemented using a project-oriented software facility for the Analysis of LAnd Digital HYdrological Networks (ALADHYN).

  5. Comparative Analysis Of Conventional Method With Activity Based Costing In PT Mulia Sejati Gallery

    Directory of Open Access Journals (Sweden)

    Irma Nadia Erena

    2016-09-01

    Full Text Available The goal of this research was to provide readers the information about the calculation methods, both traditional and activity-based costing in the application of the cost of production. The method used in this research was the qualitative method. The analysis was done by calculating the amount of the production cost using the traditional system and the magnitude of the production cost when using the activity-based costing system. The amount of each acquisition was then performed into data analysis. The results achieved are massive distortion between the calculations using traditional systems and activity based costing system. The conclusions of the whole thesis are activity-based costing system is considered more relevant than traditional systems that are currently used by the company.

  6. Comparison of accuracies of an intraoral spectrophotometer and conventional visual method for shade matching using two shade guide systems.

    Science.gov (United States)

    Parameswaran, Vidhya; Anilkumar, S; Lylajam, S; Rajesh, C; Narayan, Vivek

    2016-01-01

    This in vitro study compared the shade matching abilities of an intraoral spectrophotometer and the conventional visual method using two shade guides. The results of previous investigations between color perceived by human observers and color assessed by instruments have been inconclusive. The objectives were to determine accuracies and interrater agreement of both methods and effectiveness of two shade guides with either method. In the visual method, 10 examiners with normal color vision matched target control shade tabs taken from the two shade guides (VITAPAN Classical™ and VITAPAN 3D Master™) with other full sets of the respective shade guides. Each tab was matched 3 times to determine repeatability of visual examiners. The spectrophotometric shade matching was performed by two independent examiners using an intraoral spectrophotometer (VITA Easyshade™) with five repetitions for each tab. Results revealed that visual method had greater accuracy than the spectrophotometer. The spectrophotometer; however, exhibited significantly better interrater agreement as compared to the visual method. While VITAPAN Classical shade guide was more accurate with the spectrophotometer, VITAPAN 3D Master shade guide proved better with visual method. This in vitro study clearly delineates the advantages and limitations of both methods. There were significant differences between the methods with the visual method producing more accurate results than the spectrophotometric method. The spectrophotometer showed far better interrater agreement scores irrespective of the shade guide used. Even though visual shade matching is subjective, it is not inferior and should not be underrated. Judicious combination of both techniques is imperative to attain a successful and esthetic outcome.

  7. A Predictive-Control-Based Over-Modulation Method for Conventional Matrix Converters

    DEFF Research Database (Denmark)

    Zhang, Guanguan; Yang, Jian; Sun, Yao

    2018-01-01

    To increase the voltage transfer ratio of the matrix converter and improve the input/output current performance simultaneously, an over-modulation method based on predictive control is proposed in this paper, where the weighting factor is selected by an automatic adjusting mechanism, which is able...... to further enhance the system performance promptly. This method has advantages like the maximum voltage transfer ratio can reach 0.987 in the experiments; the total harmonic distortion of the input and output current are reduced, and the losses in the matrix converter are decreased. Moreover, the specific...

  8. PRA-1 offshore platform start-up within seven days; Operacionalizacao da plataforma offshore PRA-1 em sete dias

    Energy Technology Data Exchange (ETDEWEB)

    Barbosa, Fernando; Mitidieri, Jorge; Faria, Jose Luis Coutinho de; Ribeiro, Juan Carlos; Moura, Mario Arthur [Construtora Norberto Oderbrecht S.A., Rio de Janeiro, RJ (Brazil)

    2008-07-01

    The technologic innovations are very hard features with regards to Offshore Engineering and Construction over the worldwide. The innovations only make sense since they are focus on the high productivity, safe job and cost reduction compared with the current technologies. Inside the scenario mentioned above is Construtora Norberto Odebrecht S.A. concept for the PRA-1 platform Engineering and Construction. Through a very advanced and innovation concept, it was defined as the Main Strategic Planning of the undertaking not use a temporary platform support (named in Brazil as 'Flotel') during the 'Hook-up', commissioning and star-up offshore phase. The success of the strategic made possible through the implementation of new engineering tools, and, besides this, through a very careful offshore planning focused on minimizing and make easier as much as possible the offshore activities. The planning can be basically spitted on the following parts: A- Onshore preparations (Assembly, Integration and Commissioning of the Utilities and Accommodation Modules) B- Offshore detailed planning of the critical activities concerning the start-up of the systems responsible for leaving the platform ready for 'live'. This operation was defined as 'seven days of platform live support' (main target of this paper). (author)

  9. Alternative sintering methods compared to conventional thermal sintering for inkjet printed silver nanoparticle ink

    NARCIS (Netherlands)

    Niittynen, J.; Abbel, R.; Mäntysalo, M.; Perelaer, J.; Schubert, U.S.; Lupo, D.

    2014-01-01

    In this contribution several alternative sintering methods are compared to traditional thermal sintering as high temperature and long process time of thermal sintering are increasing the costs of inkjet-printing and preventing the use of this technology in large scale manufacturing. Alternative

  10. A comparison of new and conventional methods for quantification of tooth color

    NARCIS (Netherlands)

    Burgt, van der T.P.; Bosch, ten J.J.; Borsboom, P.C.F.; Kortsmit, W.J.P.M.

    1990-01-01

    Tooth color is caused by volume reflection, that is, passage of incident light through the tooth followed by backward emergence. This passage is concurrent with sideward displacement of photons that, in effect, influences the result of usual instrumental methods of determining tooth color. This

  11. Near infrared spectrometry for faecal fat measurement: comparison with conventional gravimetric and titrimetric methods.

    Science.gov (United States)

    Benini, L; Caliari, S; Guidi, G C; Vaona, B; Talamini, G; Vantini, I; Scuro, L A

    1989-01-01

    This investigation was aimed at comparing a new method for measuring faecal fat excretion, carried out with a semi-automated instrument by using near infrared analysis (NIRA), with the traditional titrimetric (Van de Kamer) and gravimetric (Sobel) methods. Near infrared analysis faecal fat was assayed on the three day stool collection from 118 patients (68 chronic pancreatitis, 19 organic diseases of the gastrointestinal tract, 19 alcoholic liver disease, 12 functional gastrointestinal disorders). A strict linear correlation was found between NIRA and both the titrimetric (r = 0.928, p less than 0.0001) and the gravimetric (r = 0.971, p less than 0.0001) methods. On homogenised faeces, a mean coefficient of variation of 2.1 (SD 1.71)% was found. Before homogenisation (where a mean coefficient of variation of 7% was found) accurate results were obtained when the mean of five measurements was considered. In conclusion, the assay of faecal fat excretion by the near infrared reflessometry appears a simple, rapid and reliable method for measuring steatorrhoea. PMID:2583563

  12. Rapid descriptive sensory methods – Comparison of Free Multiple Sorting, Partial Napping, Napping, Flash Profiling and conventional profiling

    DEFF Research Database (Denmark)

    Dehlholm, Christian; Brockhoff, Per B.; Meinert, Lene

    2012-01-01

    is a modal restriction of Napping to specific sensory modalities, directing sensation and still allowing a holistic approach to products. The new methods are compared to Flash Profiling, Napping and conventional descriptive sensory profiling. Evaluations are performed by several panels of expert assessors......Two new rapid descriptive sensory evaluation methods are introduced to the field of food sensory evaluation. The first method, free multiple sorting, allows subjects to perform ad libitum free sortings, until they feel that no more relevant dissimilarities among products remain. The second method...... are applied for the graphical validation and comparisons. This allows similar comparisons and is applicable to single-block evaluation designs such as Napping. The partial Napping allows repetitions on multiple sensory modalities, e.g. appearance, taste and mouthfeel, and shows the average...

  13. Evaluation of head and neck cancer with 18F-FDG PET: a comparison with conventional methods

    International Nuclear Information System (INIS)

    Kresnik, E.; Mikosch, P.; Gallowitsch, H.J.; Heinisch, M.; Unterweger, O.; Kumnig, G.; Gomez, I.; Lind, P.; Kogler, D.; Wieser, S.; Gruenbacher, G.; Raunik, W.

    2001-01-01

    The aim of this study was to evaluate the usefulness of 18 F-FDG PET in the diagnosis and staging of primary and recurrent malignant head and neck tumours in comparison with conventional imaging methods [including ultrasonography, radiography, computed tomography (CT) and magnetic resonance imaging (MRI)], physical examination, panendoscopy and biopsies in clinical routine. A total of 54 patients (13 female, 41 male, age 61.3±12 years) were investigated retrospectively. Three groups were formed. In group I, 18 F-FDG PET was performed in 15 patients to detect unknown primary cancers. In group II, 24 studies were obtained for preoperative staging of proven head and neck cancer. In group III, 18 F-FDG PET was used in 15 patients to monitor tumour recurrence after radiotherapy and/or chemotherapy. In all patients, imaging was obtained at 70 min after the intravenous administration of 180 MBq 18 F-FDG. In 11 of the 15 patients in group I, the primary cancer could be found with 18 F-FDG, yielding a detection rate of 73.3%. In 4 of the 15 patients, CT findings were also suggestive of the primary cancer but were nonetheless equivocal. In these patients, 18 F-FDG showed increased 18 F-FDG uptake by the primary tumour, which was confirmed by histology. One patient had recurrence of breast carcinoma that could not be detected with 18 F-FDG PET, but was detected by CT. In three cases, the primary cancer could not be found with any imaging method. Among the 24 patients in group II investigated for staging purposes, 18 F-FDG PET detected a total of 13 local and three distant lymph node metastases, whereas the conventional imaging methods detected only nine local and one distant lymph node metastases. The results of 18 F-FDG PET led to an upstaging in 5/24 (20.8%) patients. The conventional imaging methods were false positive in 5/24 (20.8%). There was one false positive result using 18 F-FDG PET. Among the 15 patients of group III with suspected recurrence after radiotherapy

  14. MANIKIN DEMONSTRATION IN TEACHING CONSERVATIVE MANAGEMENT OF POSTPARTUM HAEMORRHAGE: A COMPARISON WITH CONVENTIONAL METHODS

    Directory of Open Access Journals (Sweden)

    Sathi Mangalam Saraswathi

    2016-07-01

    Full Text Available BACKGROUND Even though there are many innovative methods to make classes more interesting and effective, in my department, topics are taught mainly by didactic lectures. This study attempts to compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of post-partum haemorrhage. OBJECTIVE To compare the effectiveness of manikin demonstration and didactic lectures in teaching conservative management of postpartum haemorrhage. MATERIALS AND METHODS This is an observational study. Eighty four ninth-semester MBBS students posted in Department of Obstetrics and Gynaecology, Government Medical College, Kottayam were selected. They were divided into 2 groups by lottery method. Pre-test was conducted for both groups. Group A was taught by manikin demonstration. Group B was taught by didactic lecture. Feedback response from the students collected after demonstration class was analysed. Post-test was conducted for both the groups after one week. Gain in knowledge of both the groups were calculated from pre-test and post-test scores and compared by Independent sample t test. RESULTS The mean gain in knowledge in group A was 6.4 when compared to group B which is 4.3 and the difference was found to be statistically significant. All of the students in group A felt satisfied and more confident after the class and wanted more topics to be taken by demonstration. CONCLUSION Manikin demonstration class is more effective in teaching conservative management of post-partum haemorrhage and this method can be adopted to teach similar topics in clinical subjects.

  15. Dry matter genotypes of Cynodon by microwave and conventional oven methods

    Directory of Open Access Journals (Sweden)

    Euclides Reuter de Oliveira

    2013-02-01

    Full Text Available The aimed of this work was to comparing the drying process in a microwave oven and forced air ventilation, as well as their effects on the chemical composition of different genotypes of the genus Cynodon (Tifton 85, Jiggs, Russell, Tifton 68 and Vaquero collected at different ages cutting (28, 48, 63 and 79 days. The experimental design was a randomized block in a split-plot design, with 4 replicates. There was no difference (P>0.05 between the methods analyzed on the chemical composition of the genotypes studied. Increasing age cutoff negatively influenced (P<0.05 the crude protein content of the different plant parts. A significant increase (P<0.05 of dry matter, neutral detergent fiber, acid detergent fiber and dry matter production was observed with increasing age cut. The use of the microwave oven is a quick and precise method obtain the dry matter content of the fodder showing efficiency similar to the method of drying in an oven with forced air circulation. The genotypes showed better chemical composition results when handled at age 28 days.

  16. Comparison of conventional and bio-treated methods as dust suppressants.

    Science.gov (United States)

    Naeimi, Maryam; Chu, Jian

    2017-10-01

    Dust is an environmental, geotechnical, health, and economical hazard. Fugitive dust emanating along transportation systems such as roads, railways, and airports especially can have significant impacts on health, safety, material loss, cost of maintenance, and interfere with the facilities. Quantitative studies on the effectiveness of the proper dust palliatives and their environmental impact have been studied with a number of biological and chemical methods. The objective of this study was to establish a method for using the microbial Induced calcium carbonate precipitation (MICP) approach to reduce the percent of mass loss against erosive force of wind regarding to the concentration and characteristics of aggregate used, climate, and traffic amounts. The results of this study showed that the required precipitation for dust control of sand by 70% is less than 15 g CaCO 3 /m 2 between sand grains in bio-treated sand. The wind tunnel test results of this study also indicate that the effectiveness of the bio-treatment method for dust control depends on many variables, such as the percent of precipitated calcium carbonate and tensile strength.

  17. Nasal PCR assay for the detection of Mycobacterium leprae pra gene to study subclinical infection in a community.

    Science.gov (United States)

    Arunagiri, Kamalanathan; Sangeetha, Gopalakrishnan; Sugashini, Padmavathy Krishnan; Balaraman, Sekar; Showkath Ali, M K

    2017-03-01

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. Identification of Mycobacterium leprae is difficult in part due to the inability of the leprosy bacillus to grow in vitro. A number of diagnostic methods for leprosy diagnosis have been proposed. Both serological tests and molecular probes have shown certain potential for detection and identification of Mycobacterium leprae in patients. In this study, we have investigated whether Mycobacterium leprae DNA from the nasal secretion of healthy household contacts and the non contacts could be detected through PCR amplification as a method to study the sub clinical infection in a community. A total of 200 samples, 100 each from contacts and non contacts representing all age groups and sex were included in this study. The M. leprae specific primer (proline-rich region) of pra gene was selected and PCR was performed using extracted DNA from the sample. A total of 13 samples were found to be positive for nasal PCR for pra gene among the male and female contacts out of which 7% were males and 6% were females. Even though several diagnostic tools are available to detect the cases of leprosy, they lack the specificity and sensitivity. PCR technology has demonstrated the improved diagnostic accuracy for epidemiological studies and requires minimal time. Although nasal PCR studies have been reported from many countries it is not usually recommended due to the high percentage of negative results in the contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Comparison of conventional versus Hybrid knife peroral endoscopic myotomy methods for esophageal achalasia: a case-control study.

    Science.gov (United States)

    Tang, Xiaowei; Gong, Wei; Deng, Zhiliang; Zhou, Jieqiong; Ren, Yutang; Zhang, Qiang; Chen, Zhenyu; Jiang, Bo

    2016-01-01

    Peroral endoscopic myotomy (POEM) has been developed to treat achalasia as a novel less invasive modality. We aimed to compare the efficacy and safety of conventional knife versus Hybrid knife (HK) during POEM procedure. Between June 2012 and July 2014, 31 patients underwent POEM using HK in our department (HK group), and 36 patients underwent POEM using conventional method (injection needle and triangular tip [TT] knife, TT group). Procedure-related parameters, symptom relief, adverse events were compared between two groups. There were no significant differences in the age, sex and other baseline characteristics between the two groups. The mean procedural time was significantly shorter in HK group than TT group (53.0 ± 17.2 vs. 67.6 ± 28.4 min, p = 0.015). The mean frequency of devices exchange was 4.7 ± 1.7 in HK group and 10.9 ± 1.8 in TT group (p = 0.000). No serious adverse events occurred postoperatively in both groups. At one-year follow-up, a total of 94% treatment success was achieved in all patients (93.5% in HK group and 94.4% in TT group, p = 0.877). HK in POEM can shorten the procedural time, and achieve similar treatment success compared to conventional TT knife.

  19. Has the ThinPrep method of cervical screening maintained its improvement over conventional smears in terms of specimen adequacy?

    LENUS (Irish Health Repository)

    Treacy, A

    2009-04-01

    Liquid-based cytology (LBC) has replaced conventional smear assessment in many centers over recent years. In our laboratory this transfer took place in 1999. At that time we performed a split sample study comparing the conventional method of cervical smear evaluation with the ThinPrep system. This split sample study identified a dramatic improvement in specimen adequacy with LBC. While 11% of conventional preparations were reported as unsatisfactory and almost 9% were reported as suboptimal, evaluation of the same cases using LBC saw this combined figure reduced to 2.3%. AIM: To evaluate whether this dramatic fall in unsatisfactory smears has been maintained with the use of LBC. The database for all smears reported for 2005 (100% LBC) was interrogated. The number of unsatisfactory reports was calculated. The reason for an unsatisfactory report was recorded for each case. The overall unsatisfactory rate was compared with that reported in the 1999 split sample study. A total of 41,312 smear tests were reported in 2005. 1,342 (3.25%) were reported as unsatisfactory. Our findings support the ongoing value of LBC in a routine cervical screening laboratory in terms of continuing to maintain a low rate of unsatisfactory smears.

  20. ANALISIS INFLASI PRA DAN PASCA KRISIS MONETER DALAM PEREKONOMIAN INDONESIA

    Directory of Open Access Journals (Sweden)

    Deni Sri Haryati

    2014-10-01

    Full Text Available Abstrak ___________________________________________________________________ Penelitian ini menganalisis fluktuasi inflasi yang terjadi pada masa pra, saat, dan pasca krisis moneter. Terdapat 5 variabel yang berkorelasi dengan inflasi di Indonesia. Variabel-variabel tersebut adalah jumlah uang beredar (JUB, nilai tukar nominal (NTN, pertumbuhan ekonomi, pengeluaran pemerintah (PeP,dan  bahan bakar minyak (BBM. Sebenarnya variabel tersebut memiliki hubungan dengan inflasi pada seluruh era. Namun, variabel tesebut memiliki dominasi yang berbeda pada masing-masing eranya. Era prakrisis didominasi oleh 3 variabel, yakni; pertumbuhan ekonomi, NTN, dan JUB, era krisis didominasi oleh seluruh variabel yang ada, dan era pasca krisis didominasi oleh 3 variabel, yakni; PeP, NTN, dan JUB. Variabel-variabel ini akan dijelaskan pengaruhnya terhadap inflasi pada era yang didominasi dimana apakah memiliki hubungan sebanding atau berbanding terbalik. Abstract ___________________________________________________________________ This study analyzes the fluctuations in inflation that occurred in the pre, during and post the financial crisis. There are 5 variables that correlated with inflation in Indonesia. These variables are the money supply (MS, the nominal exchange rate (NER, economic growth, government expenditure (GE, and fuel oil (BBM. Actually, these variables have a relationship with inflation on the whole era. However, the variable has a predominance of different proficiency level in each era. Pre-crisis era dominated by three variables, namely; economic growth, NER, and MS, crisis era dominated by all the variables that exist, and the post-crisis era dominated by three variables, namely; GE, NER, and MS. These variables will be explained influence on inflation in an era dominated where or whether proportional or inversely proportional relationship. © 2014 Universitas Negeri Semarang

  1. Life Cycle Assessment and Water Footprint of Hydrogen Production Methods: From Conventional to Emerging Technologies

    Directory of Open Access Journals (Sweden)

    Andi Mehmeti

    2018-02-01

    Full Text Available A common sustainability issue, arising in production systems, is the efficient use of resources for providing goods or services. With the increased interest in a hydrogen (H2 economy, the life-cycle environmental performance of H2 production has special significance for assisting in identifying opportunities to improve environmental performance and to guide challenging decisions and select between technology paths. Life cycle impact assessment methods are rapidly evolving to analyze multiple environmental impacts of the production of products or processes. This study marks the first step in developing process-based streamlined life cycle analysis (LCA of several H2 production pathways combining life cycle impacts at the midpoint (17 problem-oriented and endpoint (3 damage-oriented levels using the state-of-the-art impact assessment method ReCiPe 2016. Steam reforming of natural gas, coal gasification, water electrolysis via proton exchange membrane fuel cell (PEM, solid oxide electrolyzer cell (SOEC, biomass gasification and reforming, and dark fermentation of lignocellulosic biomass were analyzed. An innovative aspect is developed in this study is an analysis of water consumption associated with H2 production pathways by life-cycle stage to provide a better understanding of the life cycle water-related impacts on human health and natural environment. For water-related scope, Water scarcity footprint (WSF quantified using Available WAter REmaining (AWARE method was applied as a stand-alone indicator. The paper discusses the strengths and weaknesses of each production pathway, identify the drivers of environmental impact, quantify midpoint environmental impact and its influence on the endpoint environmental performance. The findings of this study could serve as a useful theoretical reference and practical basis to decision-makers of potential environmental impacts of H2 production systems.

  2. Identification of Burkholderia spp. in the Clinical Microbiology Laboratory: Comparison of Conventional and Molecular Methods

    Science.gov (United States)

    van Pelt, Cindy; Verduin, Cees M.; Goessens, Wil H. F.; Vos, Margreet C.; Tümmler, Burkhard; Segonds, Christine; Reubsaet, Frans; Verbrugh, Henri; van Belkum, Alex

    1999-01-01

    Cystic fibrosis (CF) predisposes patients to bacterial colonization and infection of the lower airways. Several species belonging to the genus Burkholderia are potential CF-related pathogens, but microbiological identification may be complicated. This situation is not in the least due to the poorly defined taxonomic status of these bacteria, and further validation of the available diagnostic assays is required. A total of 114 geographically diverse bacterial isolates, previously identified in reference laboratories as Burkholderia cepacia (n = 51), B. gladioli (n = 14), Ralstonia pickettii (n = 6), B. multivorans (n = 2), Stenotrophomonas maltophilia (n = 3), and Pseudomonas aeruginosa (n = 11), were collected from environmental, clinical, and reference sources. In addition, 27 clinical isolates putatively identified as Burkholderia spp. were recovered from the sputum of Dutch CF patients. All isolates were used to evaluate the accuracy of two selective growth media, four systems for biochemical identification (API 20NE, Vitek GNI, Vitek NFC, and MicroScan), and three different PCR-based assays. The PCR assays amplify different parts of the ribosomal DNA operon, either alone or in combination with cleavage by various restriction enzymes (PCR-restriction fragment length polymorphism [RFLP] analysis). The best system for the biochemical identification of B. cepacia appeared to be the API 20NE test. None of the biochemical assays successfully grouped the B. gladioli strains. The PCR-RFLP method appeared to be the optimal method for accurate nucleic acid-mediated identification of the different Burkholderia spp. With this method, B. gladioli was also reliably classified in a separate group. For the laboratory diagnosis of B. cepacia, we recommend parallel cultures on blood agar medium and selective agar plates. Further identification of colonies with a Burkholderia phenotype should be performed with the API 20NE test. For final confirmation of species identities, PCR

  3. Evaluation of purity with its uncertainty value in high purity lead stick by conventional and electro-gravimetric methods.

    Science.gov (United States)

    Singh, Nahar; Singh, Niranjan; Tripathy, S Swarupa; Soni, Daya; Singh, Khem; Gupta, Prabhat K

    2013-06-26

    A conventional gravimetry and electro-gravimetry study has been carried out for the precise and accurate purity determination of lead (Pb) in high purity lead stick and for preparation of reference standard. Reference materials are standards containing a known amount of an analyte and provide a reference value to determine unknown concentrations or to calibrate analytical instruments. A stock solution of approximate 2 kg has been prepared after dissolving approximate 2 g of Pb stick in 5% ultra pure nitric acid. From the stock solution five replicates of approximate 50 g have been taken for determination of purity by each method. The Pb has been determined as PbSO4 by conventional gravimetry, as PbO2 by electro gravimetry. The percentage purity of the metallic Pb was calculated accordingly from PbSO4 and PbO2. On the basis of experimental observations it has been concluded that by conventional gravimetry and electro-gravimetry the purity of Pb was found to be 99.98 ± 0.24 and 99.97 ± 0.27 g/100 g and on the basis of Pb purity the concentration of reference standard solutions were found to be 1000.88 ± 2.44 and 1000.81 ± 2.68 mg kg-1 respectively with 95% confidence level (k = 2). The uncertainty evaluation has also been carried out in Pb determination following EURACHEM/GUM guidelines. The final analytical results quantifying uncertainty fulfills this requirement and gives a measure of the confidence level of the concerned laboratory. Gravimetry is the most reliable technique in comparison to titremetry and instrumental method and the results of gravimetry are directly traceable to SI unit. Gravimetric analysis, if methods are followed carefully, provides for exceedingly precise analysis. In classical gravimetry the major uncertainties are due to repeatability but in electro-gravimetry several other factors also affect the final results.

  4. Assessment of the hardness of different orthodontic wires and brackets produced by metal injection molding and conventional methods.

    Science.gov (United States)

    Alavi, Shiva; Kachuie, Marzie

    2017-01-01

    This study was conducted to assess the hardness of orthodontic brackets produced by metal injection molding (MIM) and conventional methods and different orthodontic wires (stainless steel, nickel-titanium [Ni-Ti], and beta-titanium alloys) for better clinical results. A total of 15 specimens from each brand of orthodontic brackets and wires were examined. The brackets (Elite Opti-Mim which is produced by MIM process and Ultratrimm which is produced by conventional brazing method) and the wires (stainless steel, Ni-Ti, and beta-titanium) were embedded in epoxy resin, followed by grinding, polishing, and coating. Then, X-ray energy dispersive spectroscopy (EDS) microanalysis was applied to assess their elemental composition. The same specimen surfaces were repolished and used for Vickers microhardness assessment. Hardness was statistically analyzed with Kruskal-Wallis test, followed by Mann-Whitney test at the 0.05 level of significance. The X-ray EDS analysis revealed different ferrous or co-based alloys in each bracket. The maximum mean hardness values of the wires were achieved for stainless steel (SS) (529.85 Vickers hardness [VHN]) versus the minimum values for beta-titanium (334.65 VHN). Among the brackets, Elite Opti-Mim exhibited significantly higher VHN values (262.66 VHN) compared to Ultratrimm (206.59 VHN). VHN values of wire alloys were significantly higher than those of the brackets. MIM orthodontic brackets exhibited hardness values much lower than those of SS orthodontic archwires and were more compatible with NiTi and beta-titanium archwires. A wide range of microhardness values has been reported for conventional orthodontic brackets and it should be considered that the manufacturing method might be only one of the factors affecting the mechanical properties of orthodontic brackets including hardness.

  5. Comparison of conventional and nuclear-medical examination methods in the field of nephro-urology

    International Nuclear Information System (INIS)

    Pfannenstiel, P.

    1975-07-01

    Main part of this study is a further simplification of the 131 I-hippuran total body clearance, a method which was first described by Oberhausen (1968). As a result of the study the clearance can now be calculated with only one scintillation detector after i.v. injection of 131 I-hippuran. Essential for this simplification is the exact localisation of the detector at the right or left shoulder region of the patient. The unilateral clearance is calculated from the total body clearance in conjunction with the simultaneously registered isotope renogram. This method was routinely applied to 4,138 patients during November 15th 1971 and March 31st 1975. In special groups of patients sequential renal studies with the gamma-camera, renal rectilinear scans, xenon-133-washout curves from the kidneys and radioimmuno-assays of angiotensin were performed for comparison. All data were analysed in view of other clinical and radiological data. Recommendations for rational procedures in diagnosis and control of therapy of the most common nephro-urological disorders were derived from a joint study of 16 hospitals analysing 1,979 cases. (orig.) [de

  6. Comparison of conventional culture methods and two commercial enzyme immunoassays for detection of Salmonella in porcine fecal samples and cecal contents

    DEFF Research Database (Denmark)

    Wegener, Henrik Caspar; Baggesen, Dorte Lau

    1997-01-01

    Two commercial enzyme immunoassays, designated EIA-1 and EIA-2, for the detection of salmonella in feces and cecal contents were compared to conventional culture methods. Out of 362 cecal content samples, 35 were positive by EIA-1 and 30 were positive by EIA-2 and conventional methods. Out of 189...

  7. Comparison of Polyacetylene Content in Organically and Conventionally Grown Carrots Using a Fast Ultrasonic Liquid Extraction Method

    DEFF Research Database (Denmark)

    Søltoft, Malene; Eriksen, Morten Rosbjørn; Träger, Anne Wibe Brændholt

    2010-01-01

    deviations (RSDs) of 2.3−3.6%], and recovery (93% of falcarindiol) of the polyacetylenes. The applicability of the method was documented by comparative analyses of carrots grown organically or conventionally in a 2 year field trial study. The average concentrations of falcarindiol, falcarindiol-3-acetate......, and falcarinol in year 1 were 222, 30, and 94 μg of falcarindiol equiv/g of dry weight, respectively, and 3−15% lower in year 2. The concentrations were not significantly influenced by the growth system, but a significant year−year variation was observed for falcarindiol-3-acetate....

  8. Kinetics study of hydrochlorothiazide lactose liquid state interaction using conventional isothermal arrhenius method under basic and neutral conditions

    Directory of Open Access Journals (Sweden)

    Faranak Ghaderi

    Full Text Available ABSTRACT The Maillard reaction of hydrochlorothiazide (HCTZ and lactose has been previously demonstrated in pharmaceutical formulations. In this study, the activation energy of - hydrohlorothiazide and lactose interaction in the liquid state was ascertained under basic and neutral conditions. Conventional isothermal High Performance Liquid Chromatography (HPLC technique was employed to ascertain the kinetic parameters using Arrhenius method. Results: The activation energy obtained was 82.43 and 100.28 kJ/mol under basic and neutral conditions, respectively. Consequently, it can be inferred that Maillard reaction is significantly affected by pH, which can be used as a control factor whenever the reaction potentially occurs.

  9. Examination of Conservatism in Early/Latent Fatality Estimation in Level 3 PRA

    International Nuclear Information System (INIS)

    Kim, Sung-yeop; Lee, Haneol; Yim, Man-Sung

    2014-01-01

    Due to the computational model driven-nature of the work, there exist various sources of uncertainty in level 3 PRA. They are related with source release, environmental transport and deposition, human behavior involved in dosimetry, health effect and risk assessment. For instance, a total of 376 parameters have been considered in Probabilistic Accident Consequence Uncertainty Assessment Using COSYMA and the details on the number of parameters in each analysis are listed in Table 1. In 2012, the report of NPP accident consequence simulation was distributed by the Korean Federation for Environmental Movement (KFEM). They insisted that Kori Nuclear Power Plant (NPP) accident would lead to 48,000 early fatalities and 850,000 cancer fatalities in Busan and Hanbit NPP accident would lead to 550,000 cancer fatalities in Seoul. This report exemplifies the misuse of collective dose, that is effective dose multiplied by population and time. Even though very low effective dose is considered, collective dose could give over-conservative estimate when high population and long time period is multiplied. International Commission on Radiological Protection (ICRP) forewarned about the misuse of collective dose, in their ICRP Publication 103, such as applying it to simplified calculation of fatality and risk. As part of investigation of conservatism in early and latent fatality estimation, the existing methods of early and latent fatality calculation was reviewed and the results from the use of the existing methodology were examined in this study. The method of early and latent fatality estimation in level 3 PRA was investigated and the conservatism in the result was examined in this study. For the purpose of estimating both early and latent fatality, appropriate dose distributions among the affected population are found to be important. This study showed that large conservatism may be involved in the estimated fatality if the distribution of population dose as a function of

  10. Examination of Conservatism in Early/Latent Fatality Estimation in Level 3 PRA

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung-yeop; Lee, Haneol; Yim, Man-Sung [Korea Advanced Institute of Science and Technology, Daejeon (Korea, Republic of)

    2014-10-15

    Due to the computational model driven-nature of the work, there exist various sources of uncertainty in level 3 PRA. They are related with source release, environmental transport and deposition, human behavior involved in dosimetry, health effect and risk assessment. For instance, a total of 376 parameters have been considered in Probabilistic Accident Consequence Uncertainty Assessment Using COSYMA and the details on the number of parameters in each analysis are listed in Table 1. In 2012, the report of NPP accident consequence simulation was distributed by the Korean Federation for Environmental Movement (KFEM). They insisted that Kori Nuclear Power Plant (NPP) accident would lead to 48,000 early fatalities and 850,000 cancer fatalities in Busan and Hanbit NPP accident would lead to 550,000 cancer fatalities in Seoul. This report exemplifies the misuse of collective dose, that is effective dose multiplied by population and time. Even though very low effective dose is considered, collective dose could give over-conservative estimate when high population and long time period is multiplied. International Commission on Radiological Protection (ICRP) forewarned about the misuse of collective dose, in their ICRP Publication 103, such as applying it to simplified calculation of fatality and risk. As part of investigation of conservatism in early and latent fatality estimation, the existing methods of early and latent fatality calculation was reviewed and the results from the use of the existing methodology were examined in this study. The method of early and latent fatality estimation in level 3 PRA was investigated and the conservatism in the result was examined in this study. For the purpose of estimating both early and latent fatality, appropriate dose distributions among the affected population are found to be important. This study showed that large conservatism may be involved in the estimated fatality if the distribution of population dose as a function of

  11. Neutron activation analysis of archaeological artifacts using the conventional relative method: a realistic approach for analysis of large samples

    International Nuclear Information System (INIS)

    Bedregal, P.S.; Mendoza, A.; Montoya, E.H.; Cohen, I.M.; Universidad Tecnologica Nacional, Buenos Aires; Oscar Baltuano

    2012-01-01

    A new approach for analysis of entire potsherds of archaeological interest by INAA, using the conventional relative method, is described. The analytical method proposed involves, primarily, the preparation of replicates of the original archaeological pottery, with well known chemical composition (standard), destined to be irradiated simultaneously, in a well thermalized external neutron beam of the RP-10 reactor, with the original object (sample). The basic advantage of this proposal is to avoid the need of performing complicated effect corrections when dealing with large samples, due to neutron self shielding, neutron self-thermalization and gamma ray attenuation. In addition, and in contrast with the other methods, the main advantages are the possibility of evaluating the uncertainty of the results and, fundamentally, validating the overall methodology. (author)

  12. Expanded image database of pistachio x-ray images and classification by conventional methods

    Science.gov (United States)

    Keagy, Pamela M.; Schatzki, Thomas F.; Le, Lan Chau; Casasent, David P.; Weber, David

    1996-12-01

    In order to develop sorting methods for insect damaged pistachio nuts, a large data set of pistachio x-ray images (6,759 nuts) was created. Both film and linescan sensor images were acquired, nuts dissected and internal conditions coded using the U.S. Grade standards and definitions for pistachios. A subset of 1199 good and 686 insect damaged nuts was used to calculate and test discriminant functions. Statistical parameters of image histograms were evaluated for inclusion by forward stepwise discrimination. Using three variables in the discriminant function, 89% of test set nuts were correctly identified. Comparable data for 6 human subjects ranged from 67 to 92%. If the loss of good nuts is held to 1% by requiring a high probability to discard a nut as insect damaged, approximately half of the insect damage present in clean pistachio nuts may be detected and removed by x-ray inspection.

  13. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  14. Use of PRA in the nuclear regulatory field in South Africa

    International Nuclear Information System (INIS)

    Hill, T.F.

    1994-01-01

    The nuclear regulatory authority in South Africa (since 1988 the Council for Nuclear Safety (CNS)), established in 1973 nuclear safety criteria against which to assess the level of safety of any facility using radioactive material. It is a regulatory requirement in South Africa to develop and maintain a living PRA for each facility and thereby to provide the necessary information to demonstrate compliance against these criteria. All safety submissions to the CNS must include at least a risk statement based on an accepted PRA study. The function of the CNS is to regulate all activities in South Africa involving the use of radioactive material and posing a significant risk to the public or plant personnel. This includes most aspects of the nuclear fuel cycle and the Koeberg NPS (two 2775 MW(th) PWRs). A PRA study including source terms for the two Koeberg units was presented by the contractor in 1979. This included the risk due to power and shutdown states and non reactor related accidents involving spent fuel storage, fuel handling and waste treatment related activities. At least 20 PRA studies have been performed for other nuclear facilities in the country. The CNS maintains an in-house PRA capability to perform independent assessments of licensee submission, to participate in developments of PRA methodology in the regulatory field, to perform pro-active safety work and to assist in regulatory decision making. Present ongoing work includes the development of a risk monitor, a risk management system, improvement in PRA codes, models, data collection and analysis, off-site risk assessment methodology and associated regulatory policy. (author). 1 fig

  15. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  16. Effect of the irradiation of bacteria upon their survival rate during conventional methods of meat preservation

    International Nuclear Information System (INIS)

    Szczawinska, M.

    1981-01-01

    The purpose of this paper is to define the effect of irradiation upon the survival rate of non-sporing bacteria (Staphylococcus aureus, Salmonella typhimurium, Escherichia coli, Pseudomonas fluorescens) during basic methods of meat preservation. The bacteria were irradiated in broth by X-rays at a dose that destroyed about 90% of the bacteria (D 10 ). The survival rate of unirradiated and irradiated bacteria during cooling and freezing, in solutions of sodium chloride, nitrates and liquid smoke, was defined. The number of microorganisms was determined directly after irradiation as well as 1, 3, 7, 14, 21 and 28 days after irradiation. The effect of irradiation upon heat resistance of the examined species of bacteria was also defined. The microorganisms were heated in broth, at 70 0 C for 1, 2 and 5 minutes. The obtained results were subjected to statistical analysis. On the basis of the research results, a faster dying rate of irradiated populations of S. aureus and E. coli during any type of preservation treatment, the lack of any reaction to irradiation regarding the survival rate of S. typhimurium, and the lack of any effect of irradiation upon the rate of deterioration of P. fluorescens during freezing and storage in a solution with 10% addition of NaCI, were observed. On the other hand, a pronounced effect of irradiation upon the lowering of the heat resistance of the bacteria, as well as delayed growth in other variants of the experiment, was determined. (author)

  17. Modified prepubic TVT-obturator tape procedure versus the conventional method: a preliminary study.

    Science.gov (United States)

    Long, Cheng-Yu; Wu, Ming-Ping; Wang, Chiu-Lin; Lin, Kun-Ling; Liu, Cheng-Min; Wu, Shu-Hui; Juan, Yung-Shun

    2013-12-01

    To compare the efficacy and safety of the modified prepubic tension-free vaginal tape-obturator (PTVT-O) system procedure with the original TVT-O methods. One hundred and ninety women with urodynamic stress incontinence (USI) were included in this study (93 cases in the TVT-O group and 97 in the PTVT-O group). Clinical assessments before and one year after surgery included urinalyses, 1-h pad tests, urodynamic studies, and a personal interview with the overactive bladder symptom score (OABSS) questionnaire. There were no differences between the two groups in mean age, parity, menopausal status, mean operative time and subjective cure rates (P>0.05), but the efficacy of surgery (cure and improvement) in the PTVT-O group was significantly higher than that in the TVT-O group (P=0.038). Complication rates and visual analog scale (VAS) scores were found to be similar (P>0.05). OABSS decreased significantly after surgery in both groups (P0.05). Our modified procedure is a safe and effective treatment for female USI. It has an advantage over the original TVT-O with better surgical efficacy and comparable postoperative pain, although the follow-up times in this study are different. Copyright © 2013. Published by Elsevier Ireland Ltd.

  18. Use of non-conventional cell disruption method for extraction of proteins from black yeasts

    Directory of Open Access Journals (Sweden)

    Maja eLeitgeb

    2016-04-01

    Full Text Available The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2 by varying pressure at fixed temperature (35 °C. The black yeasts cell walls were disrupted and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV-Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2 treated cells. The advantages of the proposed method are in a simple use which is also possible for heat sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions.

  19. Use of Non-Conventional Cell Disruption Method for Extraction of Proteins from Black Yeasts

    Science.gov (United States)

    Čolnik, Maja; Primožič, Mateja; Knez, Željko; Leitgeb, Maja

    2016-01-01

    The influence of pressure and treatment time on cells disruption of different black yeasts and on activities of extracted proteins using supercritical carbon dioxide process was studied. The cells of three different black yeasts Phaeotheca triangularis, Trimatostroma salinum, and Wallemia ichthyophaga were exposed to supercritical carbon dioxide (SC CO2) by varying pressure at fixed temperature (35°C). The black yeasts cell walls were disrupted, and the content of the cells was spilled into the liquid medium. The impact of SC CO2 conditions on secretion of enzymes and proteins from black yeast cells suspension was studied. The residual activity of the enzymes cellulase, β-glucosidase, α-amylase, and protease was studied by enzymatic assay. The viability of black yeast cells was determined by measuring the optical density of the cell suspension at 600 nm. The total protein concentration in the suspension was determined on UV–Vis spectrophotometer at 595 nm. The release of intracellular and extracellular products from black yeast cells was achieved. Also, the observation by an environmental scanning electron microscopy shows major morphological changes with SC CO2-treated cells. The advantages of the proposed method are in a simple use, which is also possible for heat-sensitive materials on one hand and on the other hand integration of the extraction of enzymes and their use in biocatalytical reactions. PMID:27148527

  20. Analysis 'in vivo' of the employ of the Er:YAG laser and conventional method to remove carious tissue

    International Nuclear Information System (INIS)

    Ribeiro, Rafael Cardoso

    2002-01-01

    The aim of this study was to evaluate the removal of carious tissue employing the use of Er:YAG laser in comparison with the conventional burr rotary instrument. The wavelength of this laser is 2,64 μm and have a good absorption by the water and hydroxyapatite present in dental hard tissue. For this purpose were selected 24 molar teeth with occlusal carious, which were divided in random in two groups. For enamel, the laser energy used was in the interval from 250 mJ to 400 mJ, and the frequency range from 2 Hz to 4 Hz; for the dentine the energy laser range was from 150 mJ to 200 mJ and the laser frequency was in the range from 2 Hz to 6 Hz. For the evaluation of the results was used a questionaire to critical evaluation of the professional and another one to evaluation of the patient. The results have shown that the Er:YAG laser is able to remove carious enamel and dentin, without cause crunch or fracture and the irradiated surface was creasy. The patients reported greatest comfort when the cavity preparation was done with the Er:YAG laser than the conventional burr and all the patients treated reported prefer to future treatments the use of the Er:YAG laser. In conclusion, for the critical evaluation of the professional the treatment with the Er:YAG laser is a safe and effective method, and for the critical evaluation of the patient the treatment is one alternative more comfortable than the conventional method to remove caries. (author)

  1. Familiarity Vs Trust: A Comparative Study of Domain Scientists' Trust in Visual Analytics and Conventional Analysis Methods.

    Science.gov (United States)

    Dasgupta, Aritra; Lee, Joon-Yong; Wilson, Ryan; Lafrance, Robert A; Cramer, Nick; Cook, Kristin; Payne, Samuel

    2017-01-01

    Combining interactive visualization with automated analytical methods like statistics and data mining facilitates data-driven discovery. These visual analytic methods are beginning to be instantiated within mixed-initiative systems, where humans and machines collaboratively influence evidence-gathering and decision-making. But an open research question is that, when domain experts analyze their data, can they completely trust the outputs and operations on the machine-side? Visualization potentially leads to a transparent analysis process, but do domain experts always trust what they see? To address these questions, we present results from the design and evaluation of a mixed-initiative, visual analytics system for biologists, focusing on analyzing the relationships between familiarity of an analysis medium and domain experts' trust. We propose a trust-augmented design of the visual analytics system, that explicitly takes into account domain-specific tasks, conventions, and preferences. For evaluating the system, we present the results of a controlled user study with 34 biologists where we compare the variation of the level of trust across conventional and visual analytic mediums and explore the influence of familiarity and task complexity on trust. We find that despite being unfamiliar with a visual analytic medium, scientists seem to have an average level of trust that is comparable with the same in conventional analysis medium. In fact, for complex sense-making tasks, we find that the visual analytic system is able to inspire greater trust than other mediums. We summarize the implications of our findings with directions for future research on trustworthiness of visual analytic systems.

  2. Conventional methods and emerging wastewater polishing technologies for palm oil mill effluent treatment: a review.

    Science.gov (United States)

    Liew, Wai Loan; Kassim, Mohd Azraai; Muda, Khalida; Loh, Soh Kheang; Affam, Augustine Chioma

    2015-02-01

    The Malaysian palm oil industry is a major revenue earner and the country is ranked as one of the largest producers in the world. However, growth of the industry is synonymous with a massive production of agro-industrial wastewater. As an environmental protection and public health concern, the highly polluting palm oil mill effluent (POME) has become a major attention-grabber. Hence, the industry is targeting for POME pollution abatement in order to promote a greener image of palm oil and to achieve sustainability. At present, most palm oil mills have adopted the ponding system for treatment. Due to the successful POME pollution abatement experiences, Malaysia is currently planning to revise the effluent quality standards towards a more stringent discharge limits. Hence, the current trend of POME research focuses on developing tertiary treatment or polishing systems for better effluent management. Biotechnologically-advanced POME tertiary (polishing) technologies as well as other physicochemical methods are gaining much attention as these processes are the key players to push the industry towards the goal of environmental sustainability. There are still ongoing treatment technologies being researched and the outcomes maybe available in a while. However, the research completed so far are compiled herein and reported for the first time to acquire a better perspective and insight on the subject with a view of meeting the new standards. To this end, the most feasible technology could be the combination of advanced biological processes (bioreactor systems) with extended aeration, followed by solids separation prior to discharge. Chemical dosing is favoured only if effluent of higher quality is anticipated. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Brunser, O; Cruchet, S; Gotteland, M; Verbeke, S [Gastroenterology Unit, Institute of Nutrition and Food Technology (INTA), University of Chile, Santiago (Chile)

    2000-07-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The {sup 13}C-urea breath test ({sup 13}C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the {sup 13}C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics.

  4. Treatment of children with H. pylori infection with probiotics: Comparison with conventional methods

    International Nuclear Information System (INIS)

    Brunser, O.; Cruchet, S.; Gotteland, M.; Verbeke, S.

    2000-01-01

    Helicobacter pylori colonizes the gastric mucosa of a high proportion of the population of the less developed countries since an early age. In the developed countries this occurs at a later age and with less frequency. This pathogen causes mostly asymptomatic infection but in a proportion of the population it is associated with chronic gastritis, peptic ulcer, atrophic gastritis. A subset of these individuals will eventually develop gastric carcinoma. For this reason there has always been considerable interest in developing innocuous, fast, inexpensive, sensitive, specific and noninvasive methods for diagnosis. The 13 C-urea breath test ( 13 C-UBT) satisfies most of these requirements. Eradication of H. pylori is accomplished by administration of proton pump blockers and a variety of antibiotics singly or in associations. The rate of success is rather high but treatment is long, expensive, it has secondary effects and it increases bacterial resistance. For this reason it is worth looking at other forms of treatment. Probiotics have demonstrated capacity to stimulate defensive mechanisms and to inhibit and even kill H. pylori in vitro and in animal experiments. We propose to conduct a study in which children 10 to 18 years of age colonized by H. pylori will receive a probiotic (Lactobacillus GG) twice daily for 4 or 8 weeks and the rate of infection will be assessed by the 13 C-UBT. Local immune responses will be evaluated by measuring quantitatively total salivary slgA and specific slgA. A group of children who will not receive Lactobacillus GG will serve as controls for all procedures. We believe that Lactobacillus GG will eradicate H. pylori and thus make it possible to treat this infection without recourse to antibiotics

  5. Supercritical CO2 Extracts and Volatile Oil of Basil (Ocimum basilicum L. Comparison with Conventional Methods

    Directory of Open Access Journals (Sweden)

    José Coelho

    2018-03-01

    Full Text Available Interest in new products from aromatic plants as medical and nutritional compounds is increasing. The aim of this work was to apply different extraction methods, including the use of supercritical carbon dioxide extraction, and to test the antioxidant activity of basil (Ocimum basilicum L. extracts. In vitro efficacy assessments were performed using enzymatic assays. Essential oil obtained by hydrodistillation and volatile oil obtained from supercritical fluid extraction were analyzed by gas chromatography to quantify components. The total phenolic content in the extracts ranged from 35.5 ± 2.9 to 85.3 ± 8.6 mg of gallic acid equivalents and the total flavonoid content ranged from 35.5 ± 2.9 to 93.3 ± 3.9 micromole catechin equivalents per gram of dry weight of extract. All the extracts showed an antioxidant activity with 2,2-diphenyl-1-picrylhydrazyl (DPPH, 2,2-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS, and the reducing power test. Extracts obtained from methanol had a higher antioxidant capacity per the DPPH test results (IC50 = 3.05 ± 0.36 mg/mL and the reducing power test assay 306.8 ± 21.8 μmol of trolox equivalents per gram of extract (TE/g compared with ethanolic or supercritical fluid extracts. However, using the ABTS assay, the extract obtained by supercritical fluid extraction had a higher antioxidant capacity with an IC50 of 1.74 ± 0.05 mg/mL. Finally, the examined extracts showed practically no acetylcholinesterase (AChE inhibitory capacity and a slight inhibitory activity against tyrosinase.

  6. Comparison of conventional methods for diagnosis of visceral leishmaniasis in children of the Center-West Region of Brazil

    Directory of Open Access Journals (Sweden)

    Yvone M. Brustoloni

    Full Text Available In Brazil, sophisticated techniques currently employed for diagnosis of visceral leishmaniasis, such as polymerase chain reaction-based assays, are only available in major research centers, whereas conventional methods are still used in many areas where the disease occurs. In the state of Mato Grosso do Sul, in the country's Center-West Region, visceral leishmaniasis has recently emerged in many cities, and duration of the disease, from the onset of symptoms to diagnosis, has been short. Considering that results of diagnostic tests may depend on the phase of the disease, we compared direct examination of bone marrow aspirates (BMAs, BMA culture, and serology by Indirect Immunofluorescence Antibody Test (IFAT for diagnosis in children, according to time of evolution (30 days and to spleen size ( 5 cm at admission. Duration of the illness did not interfere with test positivity: direct smear examination and IFAT were positive in more than 80% of patients, as was culture in around 60%. Results of positive microscopy, however, where predominant in patients with larger spleens. Thanks to the association of traditional techniques, only a few patients had to begin a treatment trial without confirming the diagnosis. Conventional methods for diagnosis of visceral leishmaniasis are still indispensable in our region, and training professionals in basic techniques should be incremented. The highest sensitivity in laboratory diagnosis among the cases investigated was that obtained with a combination of BMA direct examination and IFAT, nearing 100%.

  7. Characterization and stability studies of a novel liposomal cyclosporin A prepared using the supercritical fluid method: comparison with the modified conventional Bangham method

    Directory of Open Access Journals (Sweden)

    Karn PR

    2013-01-01

    Full Text Available Pankaj Ranjan Karn,1,3 Wonkyung Cho,1,3 Hee-Jun Park,1,3 Jeong-Sook Park,3 Sung-Joo Hwang1,21Yonsei Institute of Pharmaceutical Sciences, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 2College of Pharmacy, Yonsei University, Yeonsu-gu, Incheon, Republic of Korea; 3College of Pharmacy, Chungnam National University, Yuseong-gu, Daejeon, Republic of KoreaAbstract: A novel method to prepare cyclosporin A encapsulated liposomes was introduced using supercritical fluid of carbon dioxide (SCF-CO2 as an antisolvent. To investigate the strength of the newly developed SCF-CO2 method compared with the modified conventional Bangham method, particle size, zeta potential, and polydispersity index (PDI of both liposomal formulations were characterized and compared. In addition, entrapment efficiency (EE and drug loading (DL characteristics were analyzed by reversed-phase high-performance liquid chromatography. Significantly larger particle size and PDI were revealed from the conventional method, while EE (% and DL (% did not exhibit any significant differences. The SCF-CO2 liposomes were found to be relatively smaller, multilamellar, and spherical with a smoother surface as determined by transmission electron microscopy. SCF-CO2 liposomes showed no significant differences in their particle size and PDI after more than 3 months, whereas conventional liposomes exhibited significant changes in their particle size. The initial yield (%, EE (%, and DL (% of SCF-CO2 liposomes and conventional liposomes were 90.98 ± 2.94, 92.20 ± 1.36, 20.99 ± 0.84 and 90.72 ± 2.83, 90.24 ± 1.37, 20.47 ± 0.94, respectively, which changed after 14 weeks to 86.65 ± 0.30, 87.63 ± 0.72, 18.98 ± 0.22 and 75.04 ± 8.80, 84.59 ± 5.13, 15.94 ± 2.80, respectively. Therefore, the newly developed SCF-CO2 method could be a better alternative compared with the conventional method and may provide a promising approach for large-scale production of liposomes

  8. NON-CONVENTIONAL MACHINING PROCESSES SELECTION USING MULTI-OBJECTIVE OPTIMIZATION ON THE BASIS OF RATIO ANALYSIS METHOD

    Directory of Open Access Journals (Sweden)

    MILOŠ MADIĆ

    2015-11-01

    Full Text Available The role of non-conventional machining processes (NCMPs in today’s manufacturing environment has been well acknowledged. For effective utilization of the capabilities and advantages of different NCMPs, selection of the most appropriate NCMP for a given machining application requires consideration of different conflicting criteria. The right choice of the NCMP is critical to the success and competitiveness of the company. As the NCMP selection problem involves consideration of different conflicting criteria, of different relative importance, the multi-criteria decision making (MCDM methods are very useful in systematical selection of the most appropriate NCMP. This paper presents the application of a recent MCDM method, i.e., the multi-objective optimization on the basis of ratio analysis (MOORA method to solve NCMP selection which has been defined considering different performance criteria of four most widely used NCMPs. In order to determine the relative significance of considered quality criteria a pair-wise comparison matrix of the analytic hierarchy process was used. The results obtained using the MOORA method showed perfect correlation with those obtained by the technique for order preference by similarity to ideal solution (TOPSIS method which proves the applicability and potentiality of this MCDM method for solving complex NCMP selection problems.

  9. Comparison of INSURE method with conventional mechanical ventilation after surfactant administration in preterm infants with respiratory distress syndrome: therapeutic challenge.

    Directory of Open Access Journals (Sweden)

    Fatemeh Sadat Nayeri

    2014-08-01

    Full Text Available Administration of endotracheal surfactant is potentially the main treatment for neonates suffering from RDS (Respiratory Distress Syndrome, which is followed by mechanical ventilation. Late and severe complications may develop as a consequence of using mechanical ventilation. In this study, conventional methods for treatment of RDS are compared with surfactant administration, use of mechanical ventilation for a brief period and NCPAP (Nasal Continuous Positive Airway Pressure, (INSURE method ((Intubation, Surfactant administration and extubation. A randomized clinical trial study was performed, including all newborn infants with diagnosed RDS and a gestational age of 35 weeks or less, who were admitted in NICU of Valiasr hospital. The patients were then divided randomly into two CMV (Conventional Mechanical Ventilation and INSURE groups. Surfactant administration and consequent long-term mechanical ventilation were done in the first group (CMV group. In the second group (INSURE group, surfactant was administered followed by a short-term period of mechanical ventilation. The infants were then extubated, and NCPAP was embedded. The comparison included crucial duration of mechanical ventilation and oxygen therapy, IVH (Intraventricular Hemorrhage, PDA (Patent Ductus Arteriosus, air-leak syndromes, BPD (Broncho-Pulmonary Dysplasia and mortality rate. The need for mechanical ventilation in 5th day of admission was 43% decreased (P=0.005 in INSURE group in comparison to CMV group. A decline (P=0.01 in the incidence of IVH and PDA was also achieved. Pneumothorax, chronic pulmonary disease and mortality rates, were not significantly different among two groups. (P=0.25, P=0.14, P=0.25, respectively. This study indicated that INSURE method in the treatment of RDS decreases the need for mechanical ventilation and oxygen-therapy in preterm neonates. Moreover, relevant complications as IVH and PDA were observed to be reduced. Thus, it seems rationale to

  10. MAAP4.0.7 analysis and justification for PRA level 1 mission success criteria

    International Nuclear Information System (INIS)

    Butler, J.S.; Kapitz, D.; Martin, R.P.; Seifaee, F.; Sundaram, R.K.

    2008-01-01

    The U.S. EPR is a 4590 MWth evolutionary pressurized water reactor that incorporates proven technology with innovative system architecture to provide an unprecedented level of safety. One of the measures of safety is provided by Probability Risk Assessment (PRA). PRA Level 1 concerns the evaluation of core damage frequency based on various initiating events and the success or failure of various plant event mitigation features. Determination of this measure requires mission success criteria, which are used to build the logic that makes up the fault trees and event trees of the Level 1 PRA. Developing mission success criteria for the wide variety of accident sequences modeled in the PRA Level 1 model requires a large number of thermal hydraulic calculations. The MAAP4 code, developed by Fauske and Associates, Inc. and distributed by EPRI, was chosen to perform these calculations because of its fast computation times relative to more sophisticated thermal-hydraulics codes This is a unique application of MAAP4, which was developed specifically for severe accident and PRA Level 2 analysis. As such, a study was performed to assess MAAP4 's thermal-hydraulic response capabilities against AREVA 's S-RELAP5 best-estimate integral systems thermal-hydraulic analysis code. (authors)

  11. Application of FIVE methodology in probabilistic risk assessment (PRA) of fire events

    International Nuclear Information System (INIS)

    Lopez Garcia, F.J.; Suarez Alonso, J.; Fiolamengual, M.J.

    1993-01-01

    This paper reflects the experience acquired during the process of evaluation and updating of the fire analysis within the Cofrentes NPP PRA. It determines which points are the least precise, either because of their greater uncertainty or because of their excessive conservatism, as well as the subtasks which have involved a larger work load and could be simplified. These aspects are compared with the steps followed in methodology FIVE (Fire Vulnerability Evaluation Methodology) to assess whether application of this methodology would optimize the task, by making it more systematic and realistic and reducing uncertainties. On the one hand, the FIVE methodology does not have the scope sufficient to carry out a quantitative risk evaluation, but it can easily be complemented -without detriment to its systematic nature- by quantifying core damage in significant areas. On the other hand, certain issues such as definition of the fire growth software program which has to be used, are still not fully closed. Nevertheless, the conclusions derived from this assessment are satisfactory, since it is considered that this methodology would serve to unify the criteria and data of the analysis of fire-induced risks, providing a progressive screening method which would considerably simplify the task. (author)

  12. Implications of an HRA framework for quantifying human acts of commission and dependency: Development of a methodology for conducting an integrated HRA/PRA

    International Nuclear Information System (INIS)

    Barriere, M.T.; Luckas, W.J.; Brown, W.S.; Cooper, S.E.; Wreathall, J.; Bley, D.C.

    1993-01-01

    To support the development of a refined human reliability analysis (HRA) framework, to address identified HRA user needs and improve HRA modeling, unique aspects of human performance have been identified from an analysis of actual plant-specific events. Through the use of the refined framework, relationships between the following HRA, human factors and probabilistic risk assessment (PRA) elements were described: the PRA model, plant states, plant conditions, PRA basic events, unsafe human actions, error mechanisms, and performance shaping factors (PSFs). The event analyses performed in the context of the refined HRA framework, identified the need for new HRA methods that are capable of: evaluating a range of different error mechanisms (e.g., slips as well as mistakes); addressing errors of commission (EOCs) and dependencies between human actions; and incorporating the influence of plant conditions and multiple PSFs on human actions. This report discusses the results of the assessment of user needs, the refinement of the existing HRA framework, as well as, the current status on EOCs, and human dependencies

  13. Implications of an HRA framework for quantifying human acts of commission and dependency: Development of a methodology for conducting an integrated HRA/PRA

    International Nuclear Information System (INIS)

    Barriere, M.T.; Luckas, W.J.; Brown, W.S.; Cooper, S.E.; Wreathall, J.; Bley, D.C.

    1994-01-01

    To support the development of a refined human reliability analysis (HRA) framework, to address identified HRA user needs and improve HRA modeling, unique aspects of human performance have been identified from an analysis of actual plant-specific events. Through the use of the refined framework, relationships between the following HRA, human factors and probabilistic risk assessment (PRA) elements were described: the PRA model, plant states, plant conditions, PRA basic events, unsafe human actions, error mechanisms, and performance shaping factors (PSFs). The event analyses performed in the context of the refined HRA framework, identified the need for new HRA methods that are capable of: evaluating a range of different error mechanisms (e.g., slips as well as mistakes); addressing errors of commission (EOCs) and dependencies between human actions; and incorporating the influence of plant conditions and multiple PSFs on human actions. This report discusses the results of the assessment of user needs, the refinement of the existing HRA framework, as well as, the current status on EOCs, and human dependencies

  14. Development of a methodology for conducting an integrated HRA/PRA --. Task 1, An assessment of human reliability influences during LP&S conditions PWRs

    Energy Technology Data Exchange (ETDEWEB)

    Luckas, W.J.; Barriere, M.T.; Brown, W.S. [Brookhaven National Lab., Upton, NY (United States); Wreathall, J. [Wreathall (John) and Co., Dublin, OH (United States); Cooper, S.E. [Science Applications International Corp., McLean, VA (United States)

    1993-06-01

    During Low Power and Shutdown (LP&S) conditions in a nuclear power plant (i.e., when the reactor is subcritical or at less than 10--15% power), human interactions with the plant`s systems will be more frequent and more direct. Control is typically not mediated by automation, and there are fewer protective systems available. Therefore, an assessment of LP&S related risk should include a greater emphasis on human reliability than such an assessment made for power operation conditions. In order to properly account for the increase in human interaction and thus be able to perform a probabilistic risk assessment (PRA) applicable to operations during LP&S, it is important that a comprehensive human reliability assessment (HRA) methodology be developed and integrated into the LP&S PRA. The tasks comprising the comprehensive HRA methodology development are as follows: (1) identification of the human reliability related influences and associated human actions during LP&S, (2) identification of potentially important LP&S related human actions and appropriate HRA framework and quantification methods, and (3) incorporation and coordination of methodology development with other integrated PRA/HRA efforts. This paper describes the first task, i.e., the assessment of human reliability influences and any associated human actions during LP&S conditions for a pressurized water reactor (PWR).

  15. Using level-I PRA for enhanced safety of the advanced neutron source reactor

    International Nuclear Information System (INIS)

    Ramsey, C.T.; Linn, M.A.

    1995-01-01

    The phase-1, level-I probabilistic risk assessment (PRA) of the Advanced Neutron Source (ANS) reactor has been completed as part of the conceptual design phase of this proposed research facility. Since project inception, PRA and reliability concepts have been an integral part of the design evolutions contributing to many of the safety features in the current design. The level-I PRA has been used to evaluate the internal events core damage frequency against project goals and to identify systems important to safety and availability, and it will continue to guide and provide support to accident analysis, both severe and nonsevere. The results also reflect the risk value of defense-in-depth safety features in reducing the likelihood of core damage

  16. System 80+TM PRA insights on severe accident prevention and mitigation

    International Nuclear Information System (INIS)

    Finnicum, D.J.; Jacob, M.C.; Schneider, R.E.; Weston, R.A.

    2004-01-01

    The System 80 + design is ABB-CE's standardized evolutionary Advanced Light Water Reactor (ALWR) design. It incorporates design enhancements based on Probabilistic Risk Assessment (PRA) insights, guidance from the ALWR Utility Requirements Document (URD), and US NRC's Severe Accident Policy. Major severe accident prevention and mitigation design features of the System 80 + design are described. The results of the System 80 + PRA are presented and the insights gained from the PRA sensitivity analyses are discussed. ABB-CE considered defense-in-depth for accident prevention and mitigation early in the design process and used robust design features to ensure that the System 80 + design achieved a low core damage frequency, low containment conditional failure probability, and excellent deterministic containment performance under severe accident conditions and to ensure that the risk was properly allocated among design features and between prevention and mitigation. (author)

  17. Urgensi Pemeriksaan Psikis Pra-Nikah (Studi Pandangan Kepala KUA dan Psikolog Kota Malang

    Directory of Open Access Journals (Sweden)

    Ika Kurnia Fitriani

    2015-06-01

    Full Text Available Beberapa negara muslim memberikan perhatian terhadap pemeriksaan psikis pra-nikah bagi calon mempelai, sebagai upaya menanggulangi masalah rumah tangga akibat gangguan kejiwaan di masa yang akan datang. Penelitian ini bertujuan menggali informasi dari Kepala KUA dan Psikolog di Kota Malang tentang pemeriksaan psikis pra-nikah dan urgensinya bagi calon mempelai. Penelitian ini termasuk dalam penelitian lapangan (field reasearch, dengan menggunakan pendekatan kualitatif.  Alanisis data dilakukan melalui tiga tahapan yaitu reduksi data, penyajian data, dan menarik kesimpulan. Pengecekan keabsahan data menggunakan triangulasi sumber yang membandingkan hasil wawancara dengan data sekunder, dan triangulasi teori. Hasil dari penelitian ini menunjukkan bahwa Kepala KUA dan Psikolog di kota Malang menyetujui diadakan pemeriksaan psikis pranikah akan tetapi harus ada aturan hukumnya dan dilakukan sosialisasi agar program menjadi efektif. Selain itu, pemeriksaan psikis pra-nikah tidak bertentangan dengan konsep maqashid al-syari’ah dan konsep sadz al-dzari’ah dalam hukum Islam.

  18. Strategies for Solving Potential Problems Associated with Laboratory Diffusion and Batch Experiments - Part 1: An Overview of Conventional Test Methods

    International Nuclear Information System (INIS)

    Zhang, M.; Takeda, M.; Nakajima, H.

    2006-01-01

    Laboratory diffusion testing as well as batch experiments are well established and widely adopted techniques for characterizing the diffusive and adsorptive properties of geological, geotechnical, and synthetic materials in both scientific and applied fields, including geological disposal of radioactive waste. Although several types of diffusion test, such as the through- diffusion test, in-diffusion test, out-diffusion test, and column test, are currently available, different methods may have different advantages and disadvantages. In addition, traditional methods may have limitations, such as the need for relatively long test times, cumbersome test procedures, and the possibility of errors due to differences between analytical assumptions and actual test conditions. Furthermore, traditional batch experiments using mineral powders are known to overestimate the sorption coefficient. In part 1 of this report, we present a brief overview of laboratory diffusion and batch experiments. The advantages, disadvantages, limitations, and/or potential problems associated with individual tests were compared and summarized. This comprehensive report will provide practical references for reviewing the results obtained from relevant experiments, especially from the viewpoint of regulation. To solve and/or eliminate the potential problems associated with conventional methods, and to obtain the diffusion coefficient and rock capacity factor from a laboratory test both rapidly and accurately, part 2 of this study discusses possible strategies involving the development of rigorous solutions to some relevant test methods, and sensitivity analyses for the related tests that may be helpful to judge the accuracy of the two parameters to be determined from individual tests. (authors)

  19. The comparison of assessment of pigeon semen motility and sperm concentration by conventional methods and the CASA system (HTM IVOS).

    Science.gov (United States)

    Klimowicz, M D; Nizanski, W; Batkowski, F; Savic, M A

    2008-07-01

    The aim of these experiments was to compare conventional, microscopic methods of evaluating pigeon sperm motility and concentration to those measured by computer-assisted sperm analysis (CASA system). Semen was collected twice a week from two groups of pigeons, each of 40 males (group I: meat-type breed; group II: fancy pigeon) using the lumbo-sacral and cloacal region massage method. Ejaculates collected in each group were diluted 1:100 in BPSE solution and divided into two equal samples. One sample was examined subjectively by microscope and the second one was analysed using CASA system. The sperm concentration was measured by CASA using the anti-collision (AC) system and fluorescent staining (IDENT). There were not any significant differences between the methods of evaluation of sperm concentration. High positive correlations in both groups were observed between the sperm concentration estimated by Thom counting chamber and AC (r=0.87 and r=0.91, respectively), and between the sperm concentration evaluated by Thom counting chamber and IDENT (r=0.85 and r=0.90, respectively). The mean values for CASA measurement of proportion of motile spermatozoa (MOT) and progressive movement (PMOT) were significantly lower than the values estimated subjectively in both groups of pigeons (pCASA system is very rapid, objective and sensitive method in detecting subtle motility characteristics as well as sperm concentration and is recommended for future research into pigeon semen.

  20. ''Augmented reality'' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    International Nuclear Information System (INIS)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F.; Steininger, P.; Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M.

    2008-01-01

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  1. Storage stability of margarines produced from enzymatically interesterified fats compared to those prepared by conventional methods - Chemical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Pedersen, Lars Saaby

    2006-01-01

    margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25øC for 12wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by the conventional methods (chemical interesterification and physical blending......In this study, four margarine hardstocks were produced, two from enzymatically interesterified fats at 80 and 100% conversion, one from chemically randomized fat and one from physically mixed fat. These four hardstocks, blended with 50% sunflower oil, were mainly used for the production of table...... interesterified fat had higher PV in weeks4, 8 and10 than the margarines produced from the enzymatically interesterified fats and the physically blended fat. These differences were not caused by different contents of tocopherols in the hardstocks. The differences between the processes for chemical and enzymatic...

  2. Comparison of porcelain bond strength of different metal frameworks prepared by using conventional and recently introduced fabrication methods.

    Science.gov (United States)

    Kaleli, Necati; Saraç, Duygu

    2017-07-01

    Most studies evaluating dental laser sintering systems have focused on the marginal accuracy of the restorations. However, the bond strength at the metal-ceramic interface is another important factor that affects the survival of restorations, and currently, few studies focus on this aspect. The purpose of this in vitro study was to compare the porcelain bond strength of cobalt-chromium (Co-Cr) metal frameworks prepared by using the conventional lost-wax technique, milling, direct metal laser sintering (DMLS), and laser cusing, a direct process powder-bed system. A total of 96 metal frameworks (n=24 in each group) were prepared by using conventional lost-wax (group C), milling (group M), DMLS (group LS), and direct process powder-bed (group LC) methods according to International Organization for Standardization standard ISO 9693-1. After porcelain application, a 3-point bend test was applied to each specimen by using a universal testing machine. Data were statistically analyzed using 1-way ANOVA and Tukey honest significant difference tests (α=.05). Failure types at the metal-ceramic interfaces were examined using stereomicroscopy. Additionally, 1 specimen from each group was prepared for scanning electron microscopy analysis to evaluate the surface topography of metal frameworks. The mean bond strength was 38.08 ±3.82 MPa for group C, 39.29 ±3.51 MPa for group M, 40.73 ±3.58 MPa for group LS, and 41.24 ±3.75 MPa for group LC. Statistically significant differences were observed among the 4 groups (P=.016). All groups, except for LS, exhibited adhesive and mixed type bond failure. Both of the laser sintering methods were found to be successful in terms of metal-ceramic bond strength. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  3. Arthroscopic release using F and C method versus conventional open release method in the treatment of gluteal muscle contracture: a comparative study.

    Science.gov (United States)

    Rai, Saroj; Jin, Shengyang; Meng, Chunqing; Chaudhary, Nabin; Tamang, Nira; Wang, Xiaohong; Liu, Xianzhe; Wang, Hong; Yang, Shuhua

    2017-03-16

    Gluteal muscle contracture (GMC), a debilitating disease, usually starts in early childhood after variable dose of injections around the buttock, if left untreated it worsens gradually and persists throughout the life. Because the disease mostly affects adolescents and adults, there is always an aesthetic concerns. Purposeof the study was to introduce the arthroscopic F and C method of GMC release, and to compare its clinical efficiency with conventional open surgery in terms of clinical outcome, rate of complications, patient's satisfactions, and recurrence. Between Jan 2013 and July 2015, 75 patients received an arthroscopic release with F and C release method and 71 patients received conventional open release of GMC. Primary surgeries in 16 years or older patients were included in the study. Two groups were compared clinically using Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL), Hip Outcome Scores - Sports Subscale (HOS-Sports), Visual Analogue Scale (VAS), and Ye et al. evaluation criteria. No statistically significant differences were observed in Hip Outcome Scores - Activities of Daily Living Subscale (HOS-ADL) (P = 0.078), Hip Outcome Scores - Sports Subscale (HOS-Sports) (P = 0.340), and Visual Analogue Scale (VAS) (P = 0.524) between the two groups. 74 (98.7%) patients in the arthroscopic surgery group had good to excellent results, whereas 69 (97.1%) patients in the conventional open surgery group had good to excellent results (P = 0.727). No statistically significant difference was observed in recurrence rate (P = 0.612). Statistically significant differences were observed in incision length, use of post-operative analgesia, post-operative off-bed activity, and hospital stay. Complications were significantly higher in the conventional open surgery group (n = 21) than in the arthroscopic surgery group (n = 10) (P = 0.016). More importantly, cosmetic satisfaction was 100% in arthroscopic release group

  4. Comparative evaluation of the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods.

    Science.gov (United States)

    Devgan, Manish; Nanda, Arun; Ansari, Shahid Husain

    2013-09-01

    The aim of the present study was to assess the anti-diabetic activity of Pterocarpus marsupium Roxb. heartwood in alloxan induced diabetic rats using extracts obtained by optimized conventional and non conventional extraction methods. Aqueous and ethanol extracts of Pterocarpus marsupium heartwood were prepared by conventional methods (infusion, decoction, maceration and percolation) and non conventional methods, such as ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE). The crude aqueous extracts were administered orally to both normal and alloxan induced male albino rats (Sprague-Dawley strain). The experimental set up consisted of 48 male albino rats divided into 6 groups: Normal control, diabetic control (sterile normal saline, 1 ml/100 g body weight), standard (gliclazide, 25 mg/1000g of body weight), groups 4-6 (crude aqueous percolation, optimized UAE and MAE extract, 250 mg/1000g of body weight). In acute treatment, the reduction of blood glucose level was statistically significant with the oral administration of UAE and percolation aqueous extracts to the hyperglycemic rats. In sub-acute treatment, the UAE aqueous extract led to consistent and statistically significant (p<0.001) reduction in the blood glucose levels. There was no abnormal change in body weight of the hyperglycemic animals after 10 days of administration of plant extracts and gliclazide. This study justifies the traditional claim and provides a rationale for the use of Pterocarpus marsupium to treat diabetes mellitus. The antidiabetic activity of Pterocarpus marsupium can be enhanced by extracting the heartwood by non conventional method of UAE.

  5. A case study comparing the use of laser induced fluorescence with cone penetrometer testing to more conventional screening methods

    International Nuclear Information System (INIS)

    Earley, K.; Rapp, K.

    1995-01-01

    Site assessments utilizing in-situ techniques to characterize subsurface stratigraphy and contaminant distribution are becoming more accepted and commonly used. Laser Induced Fluorescence (LIF) spectroscopy with Cone Penetrometer Test (CPT) is a new technology that provides real-time data on stratigraphy and petroleum hydrocarbons (PHCs) in the subsurface environment. Over the last two years, LIF technological advances have led to field equipment with improved durability, reduced bulk and weight, and the ability to integrate LIF systems with CPT equipment. The Rapid Optical Screening Tool (a Unisys registered trademark hereafter referred to as ROST) presents the development of an in-situ data collection system which couples state-of-the-art LIF technology with CPT. ROST/CPT technology has recently been utilized in a variety of field and soil conditions. These advances, along with the need for rapid in-situ information on the horizontal and vertical distribution of petroleum hydrocarbons (PHCs) have resulted in equipment that is now available for commercial applications. This paper presents a comparison of ROST/CPT to more conventional characterization methods at a manufacturing site in Nebraska. Various PHCs were stored in underground and above ground storage tanks across the site. One of these PHC spill areas consisting of a mixture of diesel fuel oil and kerosene was selected for a comparative study between various site assessment methods

  6. Ultrasound-assisted extraction of natural antioxidants from the flower of Limonium sinuatum: Optimization and comparison with conventional methods.

    Science.gov (United States)

    Xu, Dong-Ping; Zheng, Jie; Zhou, Yue; Li, Ya; Li, Sha; Li, Hua-Bin

    2017-02-15

    Natural antioxidants are widely used as dietary supplements or food additives. An optimized method of ultrasound-assisted extraction (UAE) was proposed for the effective extraction of antioxidants from the flowers of Limonium sinuatum and evaluated by response surface methodology. In this study, ethanol concentration, ratio of solvent to solid, ultrasonication time and temperature were investigated and optimized using a central composite rotatable design. The optimum extraction conditions were as follows: ethanol concentration, 60%; ratio of solvent to solid, 56.9:1mL/g; ultrasonication time, 9.8min; and temperature, 40°C. Under the optimal UAE conditions, the experimental values (483.01±15.39μmolTrolox/gDW) matched with those predicted (494.13μmolTrolox/gDW) within a 95% confidence level. In addition, the antioxidant activities of UAE were compared with those of conventional maceration and Soxhlet extraction methods, and the ultrasound-assisted extraction could give higher yield of antioxidants and markedly reduce the extraction time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    International Nuclear Information System (INIS)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-01-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm 3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  8. A comparison of diamond growth rate using in-liquid and conventional plasma chemical vapor deposition methods

    Science.gov (United States)

    Takahashi, Yoshiyuki; Toyota, Hiromichi; Nomura, Shinfuku; Mukasa, Shinobu; Inoue, Toru

    2009-06-01

    In order to make high-speed deposition of diamond effective, diamond growth rates for gas-phase microwave plasma chemical vapor deposition and in-liquid microwave plasma chemical vapor deposition are compared. A mixed gas of methane and hydrogen is used as the source gas for the gas-phase deposition, and a methanol solution of ethanol is used as the source liquid for the in-liquid deposition. The experimental system pressure is in the range of 60-150 kPa. While the growth rate of diamond increases as the pressure increases, the amount of input microwave energy per unit volume of diamond is 1 kW h/mm3 regardless of the method used. Since the in-liquid deposition method provides a superior cooling effect through the evaporation of the liquid itself, a higher electric input power can be applied to the electrodes under higher pressure environments. The growth rate of in-liquid microwave plasma chemical vapor deposition process is found to be greater than conventional gas-phase microwave plasma chemical vapor deposition process under the same pressure conditions.

  9. Microstructural and Mechanical Properties of Porous 60NiTi Prepared by Conventional Press-and-sinter Method

    Directory of Open Access Journals (Sweden)

    Khanlari Khashayar

    2017-01-01

    Full Text Available An intermetallic nickel-titanium alloy, 60NiTi, comprised of approximately 60 wt.% Ni and 40 wt.% Ti, contains a broad combination of physical and mechanical properties such as high hardness, low elastic modulus, resistance to aqueous corrosion and good biocompatibility. These unique combinations make this alloy an attractive candidate for medical components such as implants and prosthesis, where biocompatible materials with high hardness and low stiffness are typically used. The conventional press-and-sinter method which represents the least complex, most flexible and economic powder metallurgy method was used to produce porous 60NiTi parts suitable for biomedical applications. The effect of sintering holding time on the microstructure and mechanical properties is investigated. The structure of the as sintered parts is quite porous which is beneficial based on the medical point of view. The ultimate compressive strength of the samples is higher than that of the compact human bone and can, therefore, meet the strength demand of implants for general bone replacement applications.

  10. Clinical outcomes for patients finished with the SureSmile™ method compared with conventional fixed orthodontic therapy

    Science.gov (United States)

    Alford, Timothy J.; Roberts, W. Eugene; Hartsfield, James K.; Eckert, George J.; Snyder, Ronald J.

    2016-01-01

    Objective Utilize American Board of Orthodontics (ABO) cast/radiographic evaluation (CRE) to compare a series of 63 consecutive patients, finished with manual wire bending (conventional) treatment, vs a subsequent series of 69 consecutive patients, finished by the same orthodontist using the SureSmile™ (SS) method. Materials and Methods Records of 132 nonextraction patients were scored by a calibrated examiner blinded to treatment mode. Age and discrepancy index (DI) between groups were compared by t-tests. A chi-square test was used to compare for differences in sex and whether the patient was treated using braces only (no orthopedic correction). Analysis of covariance tested for differences in CRE outcomes and treatment times, with sex and DI included as covariates. A logarithmic transformation of CRE outcomes and treatment times was used because their distributions were skewed. Significance was defined as P space closure; however, second-order root angulation (RA) was inferior. Conclusion SS patients were treated in less time to better CRE scores for first-order rotation (AR) and interproximal space closure (IC) but on the average, malocclusions were less complex and second order root alignment was inferior, compared with patients finished with manual wire bending. PMID:21261488

  11. Interrogating the Conventional Boundaries of Research Methods in Social Sciences: The Role of Visual Representation in Ethnography

    Directory of Open Access Journals (Sweden)

    Nel Glass

    2008-05-01

    Full Text Available The author will propose that the use of performative social science is a means to deliberately interrogate long held conventions of established research. The innovative role of visual art representation in data collection, analysis and public engagement with research will be discussed. Examples will be drawn from two postmodern feminist ethnographic research which investigated academic professional development, resilience, hope and optimism in the UK, US, Australia and New Zealand from 1997-2005. Artwork was initially created as data collection and digitalised as representation to intentionally validate the voices of research participants, the researcher and viewers of the work. The research participants and viewers were given opportunities to actively engage with the visual work. Artwork complimented two additional research methods: critical conversational interviewing and reflective journaling. This paper will address the ways inclusion of art methods contributed and deepened data representation. The role of crafting artwork in the field, the artistic changes that represented the complexity of data analysis and engagement with the work will be explored. It will be argued that the creation and engagement with artwork in research is an empowering and dynamic process for researchers and participants. It is an innovative means of representing intersubjectivity that results in reciprocity. URN: urn:nbn:de:0114-fqs0802509

  12. Mutation of praR in Rhizobium leguminosarum enhances root biofilms, improving nodulation competitiveness by increased expression of attachment proteins.

    Science.gov (United States)

    Frederix, Marijke; Edwards, Anne; Swiderska, Anna; Stanger, Andrew; Karunakaran, Ramakrishnan; Williams, Alan; Abbruscato, Pamela; Sanchez-Contreras, Maria; Poole, Philip S; Downie, J Allan

    2014-08-01

    In Rhizobium leguminosarum bv. viciae, quorum-sensing is regulated by CinR, which induces the cinIS operon. CinI synthesizes an AHL, whereas CinS inactivates PraR, a repressor. Mutation of praR enhanced biofilms in vitro. We developed a light (lux)-dependent assay of rhizobial attachment to roots and demonstrated that mutation of praR increased biofilms on pea roots. The praR mutant out-competed wild-type for infection of pea nodules in mixed inoculations. Analysis of gene expression by microarrays and promoter fusions revealed that PraR represses its own transcription and mutation of praR increased expression of several genes including those encoding secreted proteins (the adhesins RapA2, RapB and RapC, two cadherins and the glycanase PlyB), the polysaccharide regulator RosR, and another protein similar to PraR. PraR bound to the promoters of several of these genes indicating direct repression. Mutations in rapA2, rapB, rapC, plyB, the cadherins or rosR did not affect the enhanced root attachment or nodule competitiveness of the praR mutant. However combinations of mutations in rapA, rapB and rapC abolished the enhanced attachment and nodule competitiveness. We conclude that relief of PraR-mediated repression determines a lifestyle switch allowing the expression of genes that are important for biofilm formation on roots and the subsequent initiation of infection of legume roots. © 2014 The Authors. Molecular Microbiology published by John Wiley & Sons Ltd.

  13. Influence of Detection Methods in Characterizing Escherichia coli O157:H7 in Raw Goat Meat Using Conventional and Molecular Methods.

    Science.gov (United States)

    Tabashsum, Zajeba; Nazneen, Mafruha; Ahsan, C R; Bari, M L; Yasmin, M

    2016-01-01

     Presence of Escherichia coli O157:H7 on fresh goat meat samples (n= 40) of Dhaka city was analyzed using conventional and molecular methods. A total of 86 presumptive E. coli O157:H7 colonies were isolated from 60% of the samples using selective agar plating method. After conventional biochemical assay followed by API 20E assay, only 11 isolates were found to be E. coli O157:H7. Further serological test identified only four isolates that has strong agglutination reaction against anti-H7 sensitized latex. The biochemically and serologically confirmed isolates were then screened for major virulence factors include eaeA, rfbE, fliC, stx1 and stx2 genes by PCR. PCR analysis of positive isolates showed, 10 isolates were eaeA and rfbE genes positive but fliC gene was only in six, indicating that these isolates were H7 positive with flagellum antigens which might not expressed or detected in serotyping tests. Multiplex PCR against eaeA, stx1 and stx2 genes of the isolates showed similar results as when done individually. These results revealed that only 7% of the primary presumptive E. coli O157:H7 was found to be stx producing E. coli O157:H7 and thus greatly influenced the detection of the pathogen in meat samples.

  14. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    Science.gov (United States)

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  15. Probabilistic risk assessment course documentation. Volume 2. Probability and statistics for PRA applications

    International Nuclear Information System (INIS)

    Iman, R.L.; Prairie, R.R.; Cramond, W.R.

    1985-08-01

    This course is intended to provide the necessary probabilistic and statistical skills to perform a PRA. Fundamental background information is reviewed, but the principal purpose is to address specific techniques used in PRAs and to illustrate them with applications. Specific examples and problems are presented for most of the topics

  16. MATILDA: A Military Laser Range Safety Tool Based on Probabilistic Risk Assessment (PRA) Techniques

    Science.gov (United States)

    2014-08-01

    3 2.1 UK Need for a PRA-Based Approach ............................................................... 3 2.2 A Risk-Based Approach to...Figure 6: MATILDA Coordinate Transformations ....................................................... 22  Figure 7: Geocentric and MICS Coordinates...Star-Shaped Condition ................................................................................. 27  Figure 11: Points of Closest Approach

  17. An integrated PRA module for fast determination of risk significance and improvement effectiveness

    International Nuclear Information System (INIS)

    Chao, Chun-Chang; Lin, Jyh-Der

    2004-01-01

    With the widely use of PRA technology in risk-informed applications, to predict the changes of CDF and LERF becomes a standard process for risk-informed applications. This paper describes an integrated PRA module prepared for risk-informed applications. The module contains a super risk engine, a super fault tree engine, an advanced PRA model and a tool for data base maintenance. The individual element of the module also works well for purpose other than risk-informed applications. The module has been verified and validated through a series of scrupulous benchmark tests with similar software. The results of the benchmark tests showed that the module has remarkable accuracy and speed even for an extremely large-size top-logic fault tree as well as for the case in which large amount of MCSs may be generated. The risk monitor for nuclear power plants in Taiwan is the first application to adopt the module. The results predicted by the risk monitor are now accepted by the regulatory agency. A tool to determine the risk significance according to the inspection findings will be the next application to adopt the module in the near future. This tool classified the risk significance into four different color codes according to the level of increase on CDF. Experience of application showed that the flexibility, the accuracy and speed of the module make it useful in any risk-informed applications when risk indexes must be determined by resolving a PRA model. (author)

  18. Introduction of accidental procedures in the event trees of the 900MW PWR PRA

    International Nuclear Information System (INIS)

    Bars, G.; Champ, M.; Lanore, J.M.; Pochard, R.

    1985-02-01

    This paper presents the example of the small LOCA Event Trees and the studies related to the introduction of procedure actions is case of HPSI failure. The results illustrate the interest of the approach and its significant impact on the PRA. The present studies are related to the Y actions in case of small LOCAs without HPIS

  19. Hydrogeochemical processes influencing groundwater quality within the Lower Pra Basin

    International Nuclear Information System (INIS)

    Tay, Collins

    2015-12-01

    Hydrogeochemical and social impact studies were carried out within the Lower Pra Basin where groundwater serves as a source of potable water supply to majority of the communities. The main objective of the study was to investigate the hydrogeochemical processes and the anthropogenic impact that influence groundwater as well as the perception of inhabitants about the impact of their socio-economic activities on the quality of groundwater and subsequently make recommendations towards proper management and development of groundwater resources within the basin. The methodology involved quarterly sampling of selected surface and groundwater sources between January 2011 and October 2012 for major ions, minor ions, stable isotopes of deuterium ( 2 H) and oxygen-18 ( 18 O) and trace metals analyses as well as administration of questionnaires designed to collect information on the socio-economic impact on the water resources within the basin. In all, a chemical data-base on three hundred and ninety seven (397) point sources was generated and three hundred (300) questionnaires were administered. The hydrochemical results show that, the major processes responsible for chemical evolution of groundwater include: silicate (SiO 4 ) 4- weathering, ion-exchange reactions, sea aerosol spray, the leaching of biotite, chlorite and actinolite. The groundwater is mildly acidic to neutral (pH 3.5 – 7.3) due principally to natural biogeochemical processes. Groundwater acidity studies show that, notwithstanding the moderately low pH, the groundwater still has the potential to neutralize acids due largely to the presence of silicates/aluminosilicates. Results of the Total Dissolved Solids (TDS) show that 98.6 % of groundwater is fresh (TDS < 500 mg/L). The relative abundance of cations and anions is in the order: Na + > Ca 2 + > Mg 2 + > K + and HCO 3 - > Cl - > SO 4 2- respectively. Stable isotopes results show that, the groundwater emanated primarily from meteoric origin with

  20. Comparison on extraction yield of sennoside A and sennoside B from senna (Cassia angustifolia) using conventional and non conventional extraction techniques and their quantification using a validated HPLC-PDA detection method.

    Science.gov (United States)

    Dhanani, Tushar; Singh, Raghuraj; Reddy, Nagaraja; Trivedi, A; Kumar, Satyanshu

    2017-05-01

    Senna is an important medicinal plant and is used in many Ayurvedic formulations. Dianthraquinone glucosides are the main bioactive phytochemicals present in leaves and pods of senna. The extraction efficiency in terms of yield and composition of the extract of senna prepared using both conventional (cold percolation at room temperature and refluxing) and non conventional (ultrasound and microwave assisted solvent extraction as well as supercritical fluid extraction) techniques were compared in the present study. Also a rapid reverse phase HPLC-PDA detection method was developed and validated for the simultaneous determination of sennoside A and sennoside B in the different extracts of senna leaves. Ultrasound and microwave assisted solvent extraction techniques were more effective in terms of yield and composition of the extracts compared to cold percolation at room temperature and refluxing methods of extraction.

  1. Sectional localization of a small hepatocellular carcinoma in the right hepatic lobe by computed tomography: Comparison between the conventional and portal vein tracing methods

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Chun-Gao [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); The First Affiliated Hospital of Nanjing Medical University, Department of Interventional Radiology, Nanjing (China); Chung, Jin Wook; Hur, Saebeom; Lee, Myungsu; Kim, Hyo-Cheol; Jae, Hwan Jun; Yin, Yong-Hu; Kim, Young Il [Seoul National University Hospital, Department of Radiology, Jongro-gu, Seoul (Korea, Republic of); Ahn, Sang-bu [Dongnam Institution of Radiological and Medical Sciences, Department of Radiology, Busan (Korea, Republic of); Cho, Baik Hwan [Chonbuk National University Hospital, Department of Radiology, Jeonju (Korea, Republic of)

    2016-12-15

    To compare the accuracy of the conventional and portal vein tracing methods in the right hepatic lobe in multidetector computed tomography (MDCT). This retrospective study included patients with hepatocellular carcinoma (HCC) lesions in the right hepatic lobe who underwent multiphasic MDCT and C-arm CT hepatic arteriography (C-arm CTHA) for chemoembolization. The accuracies of the conventional and portal vein tracing methods were evaluated using C-arm CTHA as the gold standard. A total of 147 patients with 205 HCC nodules were included. The C-arm CTHA could identify all the tumour-feeding arteries and consequently demonstrated that 120 lesions were located in the anterior section, 78 in the posterior section, and 7 in the border zone. The accuracy rates of conventional vs. portal vein tracing methods were 71.7 % vs. 98.3 % for the anterior section lesions, 67.9 % vs. 96.2 % for the posterior section, and 28.6 % vs. 57.1 % for the border zone. The portal vein tracing method was more accurate than the conventional method (P<0.001). The portal vein tracing method should be used for sectional localization of HCCs in the right lobe, because it predicts the location more accurately than the conventional method. (orig.)

  2. Manutenção de brinquedo em praças públicas

    Directory of Open Access Journals (Sweden)

    Fabio Namiki

    2007-12-01

    Full Text Available O artigo apresenta o jacaré, um dos brinquedos executados no âmbito do Programa Centros de Bairro, que foi responsável pela implantação de cerca de 50 praças na cidade de São Paulo entre 2002 e 2004. O conjunto dos brinquedos deste programa foi apresentado e analisado no mestrado “Manutenção de praças na cidade de São Paulo. Estudo de caso: brinquedos do programa Centros de Bairro”, segundo metodologia que pode ser também aplicada para outros componentes de uma praça e mesmo para a praça em si. Espera-se que esta metodologia sirva como instrumento para o planejamento das ações de manutenção de praças e de mobiliários urbanos de modo geral. Neste texto, são apresentadas informações (da mesma forma que seriam em um manual de uso, operação e manutenção do projeto do brinquedo, obtidas junto aos responsáveis pelo programa, em entrevista com o executor dos brinquedos e através dos desenhos e documentos produzidos para a licitação e execução das peças. São também apresentadas as informações obtidas a partir das inspeções a campo e estimativas do custo de manutenção preventiva. Frente ao custo de reposição de um brinquedo novo, os valores da manutenção nos provam a importância econômica de tais ações.

  3. Applications of Living Fire PRA models to Fire Protection Significance Determination Process in Taiwan

    International Nuclear Information System (INIS)

    De-Cheng, Chen; Chung-Kung, Lo; Tsu-Jen, Lin; Ching-Hui, Wu; Lin, James C.

    2004-01-01

    The living fire probabilistic risk assessment (PRA) models for all three operating nuclear power plants (NPPs) in Taiwan had been established in December 2000. In that study, a scenario-based PRA approach was adopted to systematically evaluate the fire and smoke hazards and associated risks. Using these fire PRA models developed, a risk-informed application project had also been completed in December 2002 for the evaluation of cable-tray fire-barrier wrapping exemption. This paper presents a new application of the fire PRA models to fire protection issues using the fire protection significance determination process (FP SDP). The fire protection issues studied may involve the selection of appropriate compensatory measures during the period when an automatic fire detection or suppression system in a safety-related fire zone becomes inoperable. The compensatory measure can either be a 24-hour fire watch or an hourly fire patrol. The living fire PRA models were used to estimate the increase in risk associated with the fire protection issue in terms of changes in core damage frequency (CDF) and large early release frequency (LERF). In compliance with SDP at-power and the acceptance guidelines specified in RG 1.174, the fire protection issues in question can be grouped into four categories; red, yellow, white and green, in accordance with the guidelines developed for FD SDP. A 24-hour fire watch is suggested only required for the yellow condition, while an hourly fire patrol may be adopted for the white condition. More limiting requirement is suggested for the red condition, but no special consideration is needed for the green condition. For the calculation of risk measures, risk impacts from any additional fire scenarios that may have been introduced, as well as more severe initiating events and fire damages that may accompany the fire protection issue should be considered carefully. Examples are presented in this paper to illustrate the evaluation process. (authors)

  4. Quasimonochromatic x-ray computed tomography by the balanced filter method using a conventional x-ray source

    International Nuclear Information System (INIS)

    Saito, Masatoshi

    2004-01-01

    A quasimonochromatic x-ray computed tomography (CT) system utilizing balanced filters has recently been developed for acquiring quantitative CT images. This system consisted of basic components such as a conventional x-ray generator for radiography, a stage for mounting and rotating objects, and an x-ray line sensor camera. Metallic sheets of Er and Yb were used as the balanced filters for obtaining quasimonochromatic incident x rays that include the characteristic lines of the W Kα doublet from a tungsten target. The mean energy and energy width of the quasimonochromatic x rays were determined to be 59.0 and 1.9 keV, respectively, from x-ray spectroscopic measurements using a high-purity Ge detector. The usefulness of the present x-ray CT system was demonstrated by obtaining spatial distributions of the linear attenuation coefficients of three selected samples--a 20 cm diameter cylindrical water phantom, a 3.5 cm diameter aluminum rod, and a human head phantom. The results clearly indicate that this apparatus is surprisingly effective for estimating the distribution of the linear attenuation coefficients without any correction of the beam-hardening effect. Thus, implementing the balanced filter method on an x-ray CT scanner has promise in producing highly quantitative CT images

  5. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth#

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-01-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%). PMID:27604860

  6. A comparative study of conventional and supercritical fluid extraction methods for the recovery of secondary metabolites from Syzygium campanulatum Korth.

    Science.gov (United States)

    Memon, Abdul Hakeem; Hamil, Mohammad Shahrul Ridzuan; Laghari, Madeeha; Rithwan, Fahim; Zhari, Salman; Saeed, Mohammed Ali Ahmed; Ismail, Zhari; Majid, Amin Malik Shah Abdul

    2016-09-01

    Syzygium campanulatum Korth is a plant, which is a rich source of secondary metabolites (especially flavanones, chalcone, and triterpenoids). In our present study, three conventional solvent extraction (CSE) techniques and supercritical fluid extraction (SFE) techniques were performed to achieve a maximum recovery of two flavanones, chalcone, and two triterpenoids from S. campanulatum leaves. Furthermore, a Box-Behnken design was constructed for the SFE technique using pressure, temperature, and particle size as independent variables, and yields of crude extract, individual and total secondary metabolites as the dependent variables. In the CSE procedure, twenty extracts were produced using ten different solvents and three techniques (maceration, soxhletion, and reflux). An enriched extract of five secondary metabolites was collected using n-hexane:methanol (1:1) soxhletion. Using food-grade ethanol as a modifier, the SFE methods produced a higher recovery (25.5%‒84.9%) of selected secondary metabolites as compared to the CSE techniques (0.92%‒66.00%).

  7. Comparison of Microleakage of Glass Ionomer Restoration in Primary Teeth Prepared by Er: YAG Laser and the Conventional Method

    Directory of Open Access Journals (Sweden)

    M. Ghandehari

    2012-01-01

    Full Text Available Objective: One of the main criteria in evaluating the restorative materials is the degree of microleakage. The aim of this study was to compare the microleakage of glass ionomer restored cavities prepared by Er:YAG laser or turbine and bur.Materials and Methods: Twenty extracted caries-free deciduous posterior teeth were selected for this study. The teeth were randomly divided into two groups for cavity preparation. Cavities in group one were prepared by high speed turbine and bur. In the second group, Er:YAG laser with a 3W output power, 300 mJ energy and 10 Hz frequency was used. Cavities were restored with GC Fuji II LC. After thermocycling, the samples were immersed into 0.5% methylene blue solution. They were sectioned for examination under optic microscope.Results: The Wilcoxon signed ranks test showed no significant difference between microleakage of the laser group and the conventional group (P>0.05.Conclusion: Er:YAG laser with its advantages in pediatric dentistry may be suggested as an alternative device for cavity preparation.Key Words: Er:YAG laser, Glass ionomer, Microleakage

  8. Detection of fungi by conventional methods and semi-nested PCR in patients with presumed fungal keratitis.

    Science.gov (United States)

    Haghani, I; Amirinia, F; Nowroozpoor-Dailami, K; Shokohi, T

    2015-06-01

    Fungal keratitis is a suppurative, ulcerative, and sight-threatening infection of the cornea that sometimes leads to blindness. The aims of this study were: recuperating facilities for laboratory diagnosis, determining the causative microorganisms, and comparing conventional laboratory diagnostic tools and semi-nested PCR. Sampling was conducted in patients with suspected fungal keratitis. Two corneal scrapings specimens, one for direct smear and culture and the other for semi- nested PCR were obtained. Of the 40 expected cases of mycotic keratitis, calcofluor white staining showed positivity in 25%, culture in 17.5%, KOH in 10%, and semi-nested PCR in 27.5%. The sensitivities of semi-nested PCR, KOH, and CFW were 57.1%, 28.5%, and 42% while the specificities were 78.7%, 94%, and 78.7%, respectively. The time taken for PCR assay was 4 to 8 hours, whereas positive fungal cultures took at least 5 to 7 days. Due to the increasing incidence of fungal infections in people with weakened immune systems, uninformed using of topical corticosteroids and improper use of contact lens, fast diagnosis and accurate treatment of keratomycosis seems to be essential . Therefore, according to the current study, molecular methods can detect mycotic keratitis early and correctly leading to appropriate treatment.

  9. POSITIONING ANALYSIS OF ISLAMIC BANK vis-àvis CONVENTIONAL BANK IN INDONESIA USING PARAMETRIC SFA AND DFA METHODS15

    Directory of Open Access Journals (Sweden)

    Ir Ascarya

    2014-03-01

    Full Text Available This study will measure and compare the efficiency of Conventional and Islamic banks in Indonesia using parametric approach stochastic frontier approach (SFA and distribution free approach (DFA. These measurements will provide comprehensive and robust results of efficiency of individual bank compare to its peer group. The results using parametric SFA show that in 2002, conventional banks (0.79 were slightly more efficient than Islamic banks (0.77, while in 2003, the efficiency of Islamic banks improved to 0.84 and the efficiency of conventional banks worsen to 0.76, so that Islamic banks have become more efficient than conventional banks. Conventional and Islamic banks have been improving and converged to the highest level of efficiency (1.00 since 2004. The DFA results show that conventional banks (0.89 are only slightly more efficient than Islamic banks (0.87. Conventional public bank (0.93 is the most efficient, while Islamic regional bank (0.84 is the least efficient. Moreover, efficient banks (conventional and Islamic do not always have lower OCOI (operating costs divided by operating income, while banks with better OCOI usually are more profitable (have better return on assets or ROA. Therefore, technically, Islamic banks have shown their readiness to compete head to head with their conventional counterparts. However, other aspects, such as, number of networks and branches, service quality, convenience, products and services provided, human resources, and pricing, should have become the next priorities for improvements.JEL Classification : C10, C33, G21, G28Keywords : Islamic Banking, Efficiency, Stochastic Frontier Approach, Distribution Free Approach

  10. Narrowing of the middle cerebral artery: artificial intelligence methods and comparison of transcranial color coded duplex sonography with conventional TCD.

    Science.gov (United States)

    Swiercz, Miroslaw; Swiat, Maciej; Pawlak, Mikolaj; Weigele, John; Tarasewicz, Roman; Sobolewski, Andrzej; Hurst, Robert W; Mariak, Zenon D; Melhem, Elias R; Krejza, Jaroslaw

    2010-01-01

    The goal of the study was to compare performances of transcranial color-coded duplex sonography (TCCS) and transcranial Doppler sonography (TCD) in the diagnosis of the middle cerebral artery (MCA) narrowing in the same population of patients using statistical and nonstatistical intelligent models for data analysis. We prospectively collected data from 179 consecutive routine digital subtraction angiography (DSA) procedures performed in 111 patients (mean age 54.17+/-14.4 years; 59 women, 52 men) who underwent TCD and TCCS examinations simultaneously. Each patient was examined independently using both ultrasound techniques, 267 M1 segments of MCA were assessed and narrowings were classified as 50% lumen reduction. Diagnostic performance was estimated by two statistical and two artificial neural networks (ANN) classification methods. Separate models were constructed for the TCD and TCCS sonographic data, as well as for detection of "any narrowing" and "severe narrowing" of the MCA. Input for each classifier consisted of the peak-systolic, mean and end-diastolic velocities measured with each sonographic method; the output was MCA narrowing. Arterial narrowings less or equal 50% of lumen reduction were found in 55 and >50% narrowings in 26 out of 267 arteries, as indicated by DSA. In the category of "any narrowing" the rate of correct assignment by all models was 82% to 83% for TCCS and 79% to 81% for TCD. In the diagnosis of >50% narrowing the overall classification accuracy remained in the range of 89% to 90% for TCCS data and 90% to 91% for TCD data. For the diagnosis of any narrowing, the sensitivity of the TCCS was significantly higher than that of the TCD, while for diagnosis of >50% MCA narrowing, sensitivity of the TCCS was similar to sensitivity of the TCD. Our study showed that TCCS outperforms conventional TCD in detection of diagnosis of >50% MCA narrowing. (E-mail: jaroslaw.krejza@uphs.upenn.edu).

  11. Conventional versus molecular methods for diagnosis of tuberculosis in a tertiary care center: A study from Punjab

    Directory of Open Access Journals (Sweden)

    Shavi Nagpal

    2016-01-01

    Full Text Available Background: A fast and accurate diagnosis is necessary to control and eliminate tuberculosis (TB. There have been various studies evaluating the efficacy of polymerase chain reaction (PCR testing in clinical practice. Most of these studies have found PCR as a useful tool to diagnose TB and more so for the extra-pulmonary cases. Aims and Objectives: The aim of the study was to evaluate the results of TB by real-time PCR versus the conventional methods of diagnosis in a tertiary care center in Punjab. Materials and Methods: This study was done in a tertiary care center of Punjab to look for the results of clinical samples tested for TB using PCR, Ziehl–Neelsen staining and culture on Lowenstein–Jensen medium. 16S rRNA gene was used for Mycobacterium tuberculosis detection in PCR. This study included all samples tested for TB from July 2015 to October 2015. Results: A total of 214 samples were tested for TB using smear microscopy, culture and PCR (including 194 [90.6%] extra-pulmonary and 20 [9.3%] pulmonary samples. These included 76 cerebrospinal fluid, 30 pleural fluid, 42 tissues, 17 ascitic fluid, 13 urine, 15 bronchoalveolar lavage (BAL, 16 pus, and 5 sputum samples. Smear microscopy was positive in a total of 4 samples out of 214 (1.8%, which included 2 sputum, 1 tissue, and 1 ascitic fluid samples, while culture was positive for 6 samples (2.8% which included 2 sputum, 1 pus, 1 BAL, 1 tissue, and 1 ascitic fluid sample. The TB PCR results were positive in a total of 71 (33.1% samples out of 214. In addition, three samples also tested positive for Mycobacteria other than TB. Conclusion: PCR is a very rapid and accurate diagnostic tool for early detection of TB in particularly for extrapulmonary TB.

  12. Application of multivariate statistical technique for hydrogeochemical assessment of groundwater within the Lower Pra Basin, Ghana

    Science.gov (United States)

    Tay, C. K.; Hayford, E. K.; Hodgson, I. O. A.

    2017-06-01

    Multivariate statistical technique and hydrogeochemical approach were employed for groundwater assessment within the Lower Pra Basin. The main objective was to delineate the main processes that are responsible for the water chemistry and pollution of groundwater within the basin. Fifty-four (54) (No) boreholes were sampled in January 2012 for quality assessment. PCA using Varimax with Kaiser Normalization method of extraction for both rotated space and component matrix have been applied to the data. Results show that Spearman's correlation matrix of major ions revealed expected process-based relationships derived mainly from the geochemical processes, such as ion-exchange and silicate/aluminosilicate weathering within the aquifer. Three main principal components influence the water chemistry and pollution of groundwater within the basin. The three principal components have accounted for approximately 79% of the total variance in the hydrochemical data. Component 1 delineates the main natural processes (water-soil-rock interactions) through which groundwater within the basin acquires its chemical characteristics, Component 2 delineates the incongruent dissolution of silicate/aluminosilicates, while Component 3 delineates the prevalence of pollution principally from agricultural input as well as trace metal mobilization in groundwater within the basin. The loadings and score plots of the first two PCs show grouping pattern which indicates the strength of the mutual relation among the hydrochemical variables. In terms of proper management and development of groundwater within the basin, communities, where intense agriculture is taking place, should be monitored and protected from agricultural activities. especially where inorganic fertilizers are used by creating buffer zones. Monitoring of the water quality especially the water pH is recommended to ensure the acid neutralizing potential of groundwater within the basin thereby, curtailing further trace metal

  13. Clinical evaluation of the new TGDc-01 "PRA" palpebral tonometer: comparison with contact and non-contact tonometry.

    Science.gov (United States)

    García Resúa, Carlos; Giráldez Fernández, Maria J; Cerviño Expósito, Alejandro; González Pérez, Javier; Yebra-Pimentel, Eva

    2005-02-01

    The TGDc-01 "PRA" (Ryazan State Instrument, Ryazan, Russia) tonometer is a new portable small-sized tonometer that measures intraocular pressure (IOP) through the eyelid. The purpose of this study is to assess the repeatability of the TGDc-01 IOP measurements by comparing them against those obtained with Goldmann tonometer and with those from Perkins applanation tonometer, Xpert (Reichert, Depew, NY) noncontact tonometer, and Tono-Pen XL (Medtronic Solan, Jacksonville, FL) digital tonometer. Fifty-eight right eyes of 58 young subjects were measured with each of the tonometers. Noncontact tonometry was performed first, followed by Goldmann and Perkins applanation tonometer (in random order), digital Tono-Pen XL, and finally TGDc-01 tonometer (sitting and supine position). Correlation analysis was used to evaluate the relationship between the Goldmann tonometer and the remaining tonometers used in this study. Plotting the difference between the methods against mean was also done to compare the tonometers. The hypothesis of zero bias was examined by a paired t-test. The 95% limits of agreement (LoA) were also calculated. TGDc-01 showed no statistical difference between the IOP measurements obtained in sitting and supine positions. A poor relationship between the TGDc-01 and Goldmann tonometer was found (r = 0.173; p = 0.001). Although the mean differences between Goldmann and Tonopen XL, Xpert, and TGDc-01 IOP measurements were statistically significant, the wider 95% LoA was observed when comparing the Goldmann and TGDc-01 tonometers. Computation of the 95% LoA resulted in a wide bias range when comparing the TGDc-01 with all the tonometers used in this study. The TGDc-01 "PRA" tonometer was not comparable with the other techniques used in the study. The wide dispersion range of the values obtained shows low repeatability of the TGDc-01 for screening purposes. These results could be because of the technique of measurement and/or interindividual variables.

  14. The Evaluation of the Adequacy of PRA Results for Risk-informed Decision Makings With Respect to Incompleteness

    International Nuclear Information System (INIS)

    Kang, Kyungmin; Jae, Moosung

    2007-01-01

    PRA(Probabilistic Risk Assessment), as a quantitative tool, has many strengths as well as weaknesses. There are several limitations on the use of PRA techniques for risk modeling and analysis. First, the true values of most model inputs are unknown. Ideally, probability distribution models are well developed and assigned to the unknown input parameters to reflect the analyst's state of knowledge of the values of this input parameter. The problem of overconfidence and lack of confidence in the values of certain model input parameters can lead to inaccurate PRA results. Secondly, the analyst's lack of knowledge of a system's practical application as opposed to its theoretical operation can lead to modeling errors. The quality of PRAs has been addressed by a number of regulatory and industry organizations Some have argued that a good PRA should be a complete, full scope, three level PRA, while others have claimed that the quality of a PRA should be measured with respect to the application and decision supported. we show by way of an example that the adequacy of a PRA results is important to risk-informed decision making process and should be measured with respect to the application and decision supported

  15. Probabilistic risk assessment (PRA) update in light of the accident at Fukushima Daiichi Nuclear Power Station - 15461

    International Nuclear Information System (INIS)

    Maeda, K.; Abe, H.; Hirokawa, N.; Satou, C.

    2015-01-01

    We have performed internal and external event probabilistic risk assessments (PRA) for boiling water reactor power nuclear plants to identify the important accident sequence groups and to evaluate the effectiveness of the additional severe accident measures, regarding to the new regulatory requirements implemented after the accident at Fukushima Daiichi Nuclear Power Station in Japan in 2011. In addition, we will further update our PRA by extracting problems and improvements from the current PRA, by catching up the state-of-the-art knowledge, modern PRA methodologies in order to contribute voluntarily to safety improvement as well as to comply with regulations. In this document, prior to the extensive PRA updates, we would describe technical contents and qualitative results about PRA updates that have been performed preliminary so far, especially about the external event (seismic) PRA and how to model the additionally deployed severe accident measures (e.g. power supply car, fire engine) so that they can be function external hazards, such as component failure rate of equipment, human reliability 'out of control room', and mission time extension. (authors)

  16. Impact of Gold mining activities on the water quality of the lower pra river

    International Nuclear Information System (INIS)

    Dwamena, Offei Samuel K.

    2013-07-01

    This study was conducted to assess the extent of Mercury (THg) contamination at four locations within the Shama-Mporhor Wassa catchment area of the Lower Pra River. Water, fish and sediment samples were taken twice with the longitudinal transect method at Daboase, Beposo, Bokorkope and Shama during the minor rainy season in October and at the apex of the dry season in March. Careful investigation of the Shama-Mporhor Wassa catchment area revealed that two of the locations Daboase and Beposo had been continuously impacted by the activities of Artisanal Gold miners (AGM). From the study, Total Mercury (THg) levels were found to have persisted in River water several kilometers downstream the second Artisanal Gold mining (AGM) location at Shama estuary for both seasons. Ten trace elements Mercury (Hg), Selenium (Se), Copper (Cu), Chromium (Cr), Lead (Pb), Iron (Fe), Manganese (Mn), Nickel (Ni), Zinc (Zn) and Cadmium (Cd) were determined in water, fish and sediment samples using the Atomic Absorption Spectroscopy (AAS) equipped with both Hydride Generation (HGAAS) for Selenium (Se) and Cold Vapour (CVAAS) for Total Mercury (THg). The levels of Total Mercury (THg) were largely above the WHO and USEPA guidelines for drinking water (1μg/L) and sediments (200 μg/Kg) respectively for the four locations investigated. Total Mercury (THg) exceeded the WHO, 2011 guideline value of 0.5 mg/Kg for fish species Clarias submarginatus but was below the guideline value for Xenomystus nigri. Mean concentration of Cd and Fe exceeded the WHO, 2011 guideline values for drinking water for the wet season. The other trace elements Zn, Ni, Cu, Cr, Se, Mn, and Pb had their mean concentration below the WHO, 2011 guideline values for drinking water. Apart from the mean concentration of Cd that exceeded the Canadian Interim Sediment Quality (ISQG) guideline value of 0.6 mg/Kg for the wet season, Cr, Cu, Zn, Ni and Pb were below their respective guideline values for both seasons. Statistical

  17. Emergence of Participatory Rural Appraisal (PRA Technique as a Strategy towards Sustainable Development: A Sri Lankan Experience

    Directory of Open Access Journals (Sweden)

    D. N. Koralagama

    2007-10-01

    Full Text Available In this millennium all the development activities are mostly focused on sustainable development, i.e. the development which fulfils the requirements of the present without disturbing the utilization of future generation. Basically, the sustainable development deals with environmental, social, and economical initiations. In relation to these three objectives, community participation plays a key role as an effective strategy for sustainable development. Among the numerous types of participation, Participatory Rural Appraisal (PRA technique is the most relevant effective method to receive the participation. Because, it has been strengthen by bottom up approach, well defined objectives, practicable solutions, and remedies. Hence, the out come of such an event is most productive rather than a top bottom approach techniques. In fact, a PRA was practiced to develop a strategic plan for tsunami affected village – Bambaranda east, in southern province of Sri Lanka. PRA sessions were carried out during February, 2007 by the Department of Agric. Economics of Ruhuna University, Sri Lanka in collaboration with Japanese Green Resource Agency, Japan.Participatory mapping, venn diagram, matrix ranking, preference ranking, and pair - wise ranking were demonstrated to gather information from the community. The tsunami affected area, including the paddy fields, four irrigation canals were shown by the group with the help of the participatory map. Preference ranking was resulted the reconstruction of irrigation canals as the most important rehabilitation activity to recover the livelihood of villagers. Intrusion of sea water into the paddy fields was the main limitation revealed by the pair - wise ranking. The second limitation marked as unavailability of enough fertilizer and the dilapidated irrigation canals was the third that has to be solved. Matrix ranking was employed to identify the most facilitated sectors by the government and other institutes in order

  18. Dumping convention

    International Nuclear Information System (INIS)

    Roche, P.

    1992-01-01

    Sea dumping of radioactive waste has, since 1983, been precluded under a moratorium established by the London Dumping Convention. Pressure from the nuclear industry to allow ocean dumping of nuclear waste is reported in this article. (author)

  19. Guidelines for the verification and validation of expert system software and conventional software: Volume 2, Survey and assessment of conventional software verification and validation methods Revision 1, Final report

    International Nuclear Information System (INIS)

    Miller, L.A.; Groundwater, E.H.; Hayes, J.E.; Mirsky, S.M.

    1995-05-01

    By means of a literature survey, a comprehensive set of methods was identified for the verification and validation of conventional software. The 153 methods so identified were classified according to their appropriateness for various phases of a developmental life-cycle -- requirements, design, and implementation; the last category was subdivided into two, static testing and dynamic testing methods. The methods were then characterized in terms of eight rating factors, four concerning ease-of-use of the methods and four concerning the methods' power to detect defects. Based on these factors, two measurements were developed to permit quantitative comparisons among methods, a Cost-Benefit Metric and an Effectiveness Metric. The Effectiveness Metric was further refined to provide three different estimates for each method, depending on three classes of needed stringency of V ampersand V (determined by ratings of a system's complexity and required-integrity). Methods were then rank-ordered for each of the three classes in terms of their overall cost-benefits and effectiveness. The applicability was then assessed of each method for the four identified components of knowledge-based and expert systems, as well as the system as a whole

  20. Comparison Of INAA Methods (Long Conventional, Cyclic And Pseudo-Cyclic) For The Determination Of Se In Biological Samples

    International Nuclear Information System (INIS)

    Sarheel, A.

    2004-01-01

    Selenium content in serum blood, sample were received from international comparison programme (SABC) has been determined by Cyclic irradiation, pseudo-cyclic irradiation and long irradiation conventional Instrumental neutron activation analysis through the 162 keV gamma ray of the 77m Se nuclide for both cyclic and pseudo-cyclic and 264 keV gamma ray of 75 Se nuclide for conventional (long irradiation). The CINAA involve irradiation of samples for 20 s, decay for 15 s and counting for 20 s, samples recycling four times to improve the precision. The PCINAA involve irradiation of samples for 20 s, decay for 20 s and counting for 30s, samples recycling four times day by day. The Conventional (long irradiation) involve irradiation of samples for 20 hr (1 week), decay for 4 weeks and counting for 20 hr. The accuracy has been evaluated by analyzing the certified reference materials. (Author)

  1. Efficacious and safe orotracheal intubation for laboratory mice using slim torqueable guidewire-based technique: comparisons between a modified and a conventional method.

    Science.gov (United States)

    Su, Chieh-Shou; Lai, Hui-Chin; Wang, Chih-Yen; Lee, Wen-Lieng; Wang, Kuo-Yang; Yang, Ya-Ling; Wang, Li-Chun; Liu, Chia-Ning; Liu, Tsun-Jui

    2016-01-18

    Tracheal intubation of laboratory mice remains essential yet challenging for most researchers. The aim of this study was to investigate whether this procedure can be more efficiently and safely accomplished by a novel method using slim and torqueable guidewires to guide access to the trachea. This study was carried out in an animal laboratory affiliated to a tertiary medical center. Mice weighing 22 to 28 g were subjected to various open-chest experiments after being anesthetized with intraperitoneal ketamine (100 mg/kg) and lidocaine hydrochloride (10 mg/kg). The oropharyngeal cavity was opened with angled tissue forceps, and the trachea was transilluminated using an external light. The vocal cords were then crossed using either the Conventional method with a 38-mm-long, end-blunted stiff needle as a guide for insertion of a 22-gauge, 25-mm-long intravenous catheter into the trachea, or the Modified method utilizing using a 0.014-inch-thin torqueable wire as the guide to introduce an identical tube over it into the trachea. The epithelial integrity of the trachea was later examined histologically when the animals were sacrificed either immediately after the surgery or at 28 days post-surgery, depending on the corresponding research protocols. Orotracheal intubation was successfully completed in all mice using either the Conventional (N = 42) or the Modified method (N = 50). With the Modified method, intubation took less time (1.73 vs. 2.17 min, Modified vs. Conventional, p Conventional method. Histological analysis revealed a significantly lower incidence of immediate (0% vs. 39%, p Conventional method. Tracheal intubation for laboratory mice can be completed efficiently, safely and atraumatically using the proposed Modified method employing readily available inexpensive instruments.

  2. Comments of the PRA Senior Review Panel on the meeting held December 1--3, 1987

    International Nuclear Information System (INIS)

    Sharp, D.A.

    1988-01-01

    This memorandum records the minutes of the PRA Senior Review Panel meeting held at Savannah River Laboratory (SRL) on December 1--3, 1987, and the report on that meeting written subsequently by the panel members. The minutes are contained as Attachment 2 of this memorandum, and the report as Attachment 1. The Panel indicated two principal concerns in their report: (1) that insufficient emphasis is being placed on the reliability data development program, and (2) that excessive detail is being built into the fault trees. These concerns have been addressed in a subsequent meeting with the Panel, held March 2--4, 1988. In addition, the members have been provided with a program document (Reference 1) indicating the extent, the timing, and the limitations of the data analysis effort for the PRA

  3. A PRA case study of extended long term decay heat removal for shutdown risk assessment

    International Nuclear Information System (INIS)

    Roglans, J.; Ragland, W.A.; Hill, D.J.

    1992-01-01

    A Probabilistic Risk Assessment (PRA) of the Experimental Breeder Reactor II (EBR-II), a Department of Energy (DOE) Category A research reactor, has recently been completed at Argonne National Laboratory (ANL). The results of this PRA have shown that the decay heat removal system for EBR-II is extremely robust and reliable. In addition, the methodology used demonstrates how the actions of other systems not normally used for actions of other systems not normally used for decay heat removal can be used to expand the mission time of the decay heat removal system and further increase its reliability. The methodology may also be extended to account for the impact of non-safety systems in enhancing the reliability of other dedicated safety systems

  4. Methodology and application of surrogate plant PRA analysis to the Rancho Seco Power Plant: Final report

    International Nuclear Information System (INIS)

    Gore, B.F.; Huenefeld, J.C.

    1987-07-01

    This report presents the development and the first application of generic probabilistic risk assessment (PRA) information for identifying systems and components important to public risk at nuclear power plants lacking plant-specific PRAs. A methodology is presented for using the results of PRAs for similar (surrogate) plants, along with plant-specific information about the plant of interest and the surrogate plants, to infer important failure modes for systems of the plant of interest. This methodology, and the rationale on which it is based, is presented in the context of its application to the Rancho Seco plant. The Rancho Seco plant has been analyzed using PRA information from two surrogate plants. This analysis has been used to guide development of considerable plant-specific information about Rancho Seco systems and components important to minimizing public risk, which is also presented herein

  5. Expected proton signal sizes in the PRaVDA Range Telescope for proton Computed Tomography

    International Nuclear Information System (INIS)

    Price, T.; Parker, D.J.; Green, S.; Esposito, M.; Waltham, C.; Allinson, N.M.; Poludniowski, G.; Evans, P.; Taylor, J.; Manolopoulos, S.; Anaxagoras, T.; Nieto-Camero, J.

    2015-01-01

    Proton radiotherapy has demonstrated benefits in the treatment of certain cancers. Accurate measurements of the proton stopping powers in body tissues are required in order to fully optimise the delivery of such treaments. The PRaVDA Consortium is developing a novel, fully solid state device to measure these stopping powers. The PRaVDA Range Telescope (RT), uses a stack of 24 CMOS Active Pixel Sensors (APS) to measure the residual proton energy after the patient. We present here the ability of the CMOS sensors to detect changes in the signal sizes as the proton traverses the RT, compare the results with theory, and discuss the implications of these results on the reconstruction of proton tracks

  6. Determination of Consumers'Preferences for Conventional, Healthy and Organic Cucumbers in Isfahan City Using Choice Experiment Method

    Directory of Open Access Journals (Sweden)

    A. Sandoghi

    2016-03-01

    Full Text Available Introduction: Continuing growth in human population and consumptionmeans that the global demand for food will increase for at least another 40 years and that the world needs 70-100% more food by 2050. Environmental issues such as climate change, depletion of naturalresources and biodiversity loss increasingly threaten the welfare ofhuman civilization. Confronting these threats requires, among otherthings, behavioral changes in citizens, governments and companies.Farmers and other producers are responding to consumer concerns about pesticides by creating new marketing opportunities for products grown with environmentally sound practices. Environmental economists are increasingly interested in better understanding of how people cognitively organize their beliefs and attitudes towards environmental change in order to identify key motives and barriers that stimulate or prevent action.The purpose of the presentinvestigation is to evaluate the consumers’ preferences and factors affecting their choice for conventional, healthy and organic cucumbers in Isfahan, Iran. Materials and Methods: Data were collected on a sample of 230consumers in 2013 by using the proportionate stratification samplingmethod through face-to-face interviews based on a comprehensive structured questionnaire. Before the survey, the reliability and validity of the questionnaire were initially evaluated in a pre-test study, respectively, by using Cronbach’s alpha coefficient and Kaiser-Meyer-Olkin (KMO criteria. Individual preferences were uncovered in choice experiment method (CEM by a contingent ranking experiment. In a contingent ranking experiment, respondents are required to rank a set of alternative options, characterized by a number of attributes, which are offered at different levels across the options.Data were analyzed by multinomial logit models. The approach consists of modeling utility, that isto say the net benefit a consumer obtains from selecting a

  7. Evaluation of hsp65 Nested PCR-Restriction Analysis (PRA) for Diagnosing Tuberculosis in a High Burden Country

    Science.gov (United States)

    Macente, Sara; Fujimura Leite, Clarice Queico; Santos, Adolfo Carlos Barreto; Siqueira, Vera Lúcia Dias; Machado, Luzia Neri Cosmo; Marcondes, Nadir Rodrigues; Hirata, Mario Hiroyuki; Hirata, Rosário Dominguez Crespo

    2013-01-01

    Current study evaluated the hsp65 Nested PCR Restriction Fragment Length Polymorphism Analysis (hsp65 Nested PCR-PRA) to detect and identify Mycobacterium tuberculosis complex directly in clinical samples for a rapid and specific diagnosis of tuberculosis (TB). hsp65 Nested PCR-PRA was applied directly to 218 clinical samples obtained from 127 patients suspected of TB or another mycobacterial infection from July 2009 to July 2010. The hsp65 Nested PCR-PRA showed 100% sensitivity and 95.0 and 93.1% specificity in comparison with culture and microscopy (acid fast bacillus smear), respectively. hsp65 Nested PCR-PRA was shown to be a fast and reliable assay for diagnosing TB, which may contribute towards a fast diagnosis that could help the selection of appropriate chemotherapeutic and early epidemiological management of the cases which are of paramount importance in a high TB burden country. PMID:24260739

  8. Relay chatter and operator response after a large earthquake: An improved PRA methodology with case studies

    International Nuclear Information System (INIS)

    Budnitz, R.J.; Lambert, H.E.; Hill, E.E.

    1987-08-01

    The purpose of this project has been to develop and demonstrate improvements in the PRA methodology used for analyzing earthquake-induced accidents at nuclear power reactors. Specifically, the project addresses methodological weaknesses in the PRA systems analysis used for studying post-earthquake relay chatter and for quantifying human response under high stress. An improved PRA methodology for relay-chatter analysis is developed, and its use is demonstrated through analysis of the Zion-1 and LaSalle-2 reactors as case studies. This demonstration analysis is intended to show that the methodology can be applied in actual cases, and the numerical values of core-damage frequency are not realistic. The analysis relies on SSMRP-based methodologies and data bases. For both Zion-1 and LaSalle-2, assuming that loss of offsite power (LOSP) occurs after a large earthquake and that there are no operator recovery actions, the analysis finds very many combinations (Boolean minimal cut sets) involving chatter of three or four relays and/or pressure switch contacts. The analysis finds that the number of min-cut-set combinations is so large that there is a very high likelihood (of the order of unity) that at least one combination will occur after earthquake-caused LOSP. This conclusion depends in detail on the fragility curves and response assumptions used for chatter. Core-damage frequencies are calculated, but they are probably pessimistic because assuming zero credit for operator recovery is pessimistic. The project has also developed an improved PRA methodology for quantifying operator error under high-stress conditions such as after a large earthquake. Single-operator and multiple-operator error rates are developed, and a case study involving an 8-step procedure (establishing feed-and-bleed in a PWR after an earthquake-initiated accident) is used to demonstrate the methodology

  9. The Prenylated Rab GTPase Receptor PRA1.F4 Contributes to Protein Exit from the Golgi Apparatus.

    Science.gov (United States)

    Lee, Myoung Hui; Yoo, Yun-Joo; Kim, Dae Heon; Hanh, Nguyen Hong; Kwon, Yun; Hwang, Inhwan

    2017-07-01

    Prenylated Rab acceptor1 (PRA1) functions in the recruitment of prenylated Rab proteins to their cognate organelles. Arabidopsis ( Arabidopsis thaliana ) contains a large number of proteins belonging to the AtPRA1 family. However, their physiological roles remain largely unknown. Here, we investigated the physiological role of AtPRA1.F4, a member of the AtPRA1 family. A T-DNA insertion knockdown mutant of AtPRA1.F4 , atpra1.f4 , was smaller in stature than parent plants and possessed shorter roots, whereas transgenic plants overexpressing HA:AtPRA1.F4 showed enhanced development of secondary roots and root hairs. However, both overexpression and knockdown plants exhibited increased sensitivity to high-salt stress, lower vacuolar Na + /K + -ATPase and plasma membrane ATPase activities, lower and higher pH in the vacuole and apoplast, respectively, and highly vesiculated Golgi apparatus. HA:AtPRA1.F4 localized to the Golgi apparatus and assembled into high-molecular-weight complexes. atpra1.f4 plants displayed a defect in vacuolar trafficking, which was complemented by low but not high levels of HA : AtPRA1.F4 Overexpression of HA:AtPRA1.F4 also inhibited protein trafficking at the Golgi apparatus, albeit differentially depending on the final destination or type of protein: trafficking of vacuolar proteins, plasma membrane proteins, and trans-Golgi network (TGN)-localized SYP61 was strongly inhibited; trafficking of TGN-localized SYP51 was slightly inhibited; and trafficking of secretory proteins and TGN-localized SYP41 was negligibly or not significantly inhibited. Based on these results, we propose that Golgi-localized AtPRA1.F4 is involved in the exit of many but not all types of post-Golgi proteins from the Golgi apparatus. Additionally, an appropriate level of AtPRA1.F4 is crucial for its function at the Golgi apparatus. © 2017 American Society of Plant Biologists. All Rights Reserved.

  10. Estrogen and progesterone receptors have distinct roles in the establishment of the hyperplastic phenotype in PR-A transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Simian, Marina; Bissell, Mina J.; Barcellos-Hoff, Mary Helen; Shyamala, Gopalan

    2009-05-11

    Expression of the A and B forms of progesterone receptor (PR) in an appropriate ratio is critical for mammary development. Mammary glands of PR-A transgenic mice, carrying an additional A form of PR as a transgene, exhibit morphological features associated with the development of mammary tumors. Our objective was to determine the roles of estrogen (E) and progesterone (P) in the genesis of mammary hyperplasias/preneoplasias in PR-A transgenics. We subjected PR-A mice to hormonal treatments and analyzed mammary glands for the presence of hyperplasias and used BrdU incorporation to measure proliferation. Quantitative image analysis was carried out to compare levels of latency-associated peptide and transforming growth factor beta 1 (TGF{beta}1) between PR-A and PR-B transgenics. Basement membrane disruption was examined by immunofluorescence and proteolytic activity by zymography. The hyperplastic phenotype of PR-A transgenics is inhibited by ovariectomy, and is reversed by treatment with E + P. Studies using the antiestrogen ICI 182,780 or antiprogestins RU486 or ZK 98,299 show that the increase in proliferation requires signaling through E/estrogen receptor alpha but is not sufficient to give rise to hyperplasias, whereas signaling through P/PR has little impact on proliferation but is essential for the manifestation of hyperplasias. Increased proliferation is correlated with decreased TGF{beta}1 activation in the PR-A transgenics. Analysis of basement membrane integrity showed loss of laminin-5, collagen III and collagen IV in mammary glands of PR-A mice, which is restored by ovariectomy. Examination of matrix metalloproteases (MMPs) showed that total levels of MMP-2 correlate with the steady-state levels of PR, and that areas of laminin-5 loss coincide with those of activation of MMP-2 in PR-A transgenics. Activation of MMP-2 is dependent on treatment with E and P in ovariectomized wild-type mice, but is achieved only by treatment with P in PR-A mice. These data

  11. Results of the Level 1 probabilistic risk assessment (PRA) of internal events for heavy water production reactors (U)

    International Nuclear Information System (INIS)

    Tinnes, S.P.; Cramer, D.S.; Logan, V.E.; Topp, S.V.; Smith, J.A.; Brandyberry, M.D.

    1990-01-01

    This paper reports on a full-scope probabilistic risk assessment (PRA) performed for the Savannah River Site (SRS) production reactors. The Level 1 PRA for the K Reactor has been completed and includes the assessment of reactor systems response to accidents and estimates of the severe core melt frequency (SCMF). The internal events spectrum includes those events related directly to plant systems and safety functions for which transients or failures may initiate an accident

  12. Survey of seismic fragilities used in PRA studies of nuclear power plants

    International Nuclear Information System (INIS)

    Park, Y.J.; Hofmayer, C.H.; Chokshi, N.C.

    1998-01-01

    In recent years, seismic PRA studies have been performed on a large number of nuclear power plants in the USA. This paper presents a summary of a survey on fragility databases and the range of evaluated fragility values of various equipment categories based on past PRAs. The survey includes the use of experience data, the interpretations of available test data, and the quantification of uncertainties. The surveyed fragility databases are limited to data available in the public domain such as NUREG reports, conference proceedings and other publicly available reports. The extent of the availability of data as well as limitations are studied and tabulated for various equipment categories. The survey of the fragility values in past PRA studies includes not only the best estimate values, but also the dominant failure modes and the estimated uncertainty levels for each equipment category. The engineering judgments employed in estimating the uncertainty in the fragility values are also studied. This paper provides a perspective on the seismic fragility evaluation procedures for equipment in order to clearly identify the engineering analysis and judgment used in past seismic PRA studies

  13. The role of PRA in the safety assessment of VVER Nuclear Power Plants in Ukraine

    International Nuclear Information System (INIS)

    Kot, C.

    1999-01-01

    Ukraine operates thirteen (13) Soviet-designed pressurized water reactors, VVERS. All Ukrainian plants are currently operating with annually renewable permits until they update their safety analysis reports (SARs), in accordance with new SAR content requirements issued in September 1995, by the Nuclear Regulatory Authority and the Government Nuclear Power Coordinating Committee of Ukraine. The requirements are in three major areas: design basis accident (DBA) analysis, probabilistic risk assessment (PRA), and beyond design-basis accident (BDBA) analysis. The last two requirements, on PRA and BDBA, are new, and the DBA requirements are an expanded version of the older SAR requirements. The US Department of Energy (USDOE), as part of its Soviet-Designed Reactor Safety activities, is providing assistance and technology transfer to Ukraine to support their nuclear power plants (NPPs) in developing a Western-type technical basis for the new SARs. USDOE sponsored In-Depth Safety Assessments (ISAs) are in progress at three pilot nuclear reactor units in Ukraine, South Ukraine Unit 1, Zaporizhzhya Unit 5, and Rivne Unit 1, and a follow-on study has been initiated at Khmenytskyy Unit 1. The ISA projects encompass most areas of plant safety evaluation, but the initial emphasis is on performing a detailed, plant-specific Level 1 Internal Events PRA. This allows the early definition of the plant risk profile, the identification of risk significant accident sequences and plant vulnerabilities and provides guidance for the remainder of the safety assessments

  14. Use of plant-specific PRA in an EOP scope audit

    International Nuclear Information System (INIS)

    O'Brien, J.J.

    1991-01-01

    Traditionally, decisions on which accident scenarios to proceduralize as emergency operating procedures (EOPs) have been based on existing design basis analyses, engineering judgment, and probabilistic risk assessments (PRAs) on generic plants. This approach has important strengths and limits. The major limitation of generic PRAs is their inability to account for plant-specific features. Use of plant-specific PRA to determine the impact of proceduralizing, or not proceduralizing, responses to scenarios considers plant-specific features. This helps to eliminate unnecessary EOPs, thus allowing resources to be concentrated on scenarios that are more important for a particular plant. In preparation for a US Nuclear Regulatory Commission audit, a plant-specific PRA was used to assess and quantify the plant's previous decision not to implement six reference emergency response guidelines (ERGs) as procedures. The original justification for nonimplementation of the ERGs was based on engineering judgment. The PRA provided a quantitative justification for implementation/nonimplementation of each guidelines. This analysis accounted for plant-specific design features not common to all reference plants

  15. Use of probabilistic risk assessment (PRA) in expert systems to advise nuclear plant operators and managers

    International Nuclear Information System (INIS)

    Uhrig, R.E.

    1988-01-01

    The use of expert systems in nuclear power plants to provide advice to managers, supervisors and/or operators is a concept that is rapidly gaining acceptance. Generally, expert systems rely on the expertise of human experts or knowledge that has been codified in publications, books, or regulations to provide advice under a wide variety of conditions. In this work, a probabilistic risk assessment (PRA) of a nuclear power plant performed previously is used to assess the safety status of nuclear power plants and to make recommendations to the plant personnel. Nuclear power plants have many redundant systems and can continue to operate when one or more of these systems is disabled or removed from service for maintenance or testing. PRAs provide a means of evaluating the risk to the public associated with the operation of nuclear power plants with components or systems out of service. While the choice of the source term and methodology in a PRA may influence the absolute probability and consequences of a core melt, the ratio of the PRA calculations for two configurations of the same plant, carried out on a consistent basis, can readily identify the increase in risk associated with going from one configuration to the other

  16. Treatment of system dependencies and human interactions in PRA studies: a review and sensitivity study

    International Nuclear Information System (INIS)

    Orvis, D.D.; Joksimovich, V.; Worledge, D.H.

    1985-01-01

    The Electric Power Research Institute sponsored the review and comparison of five PRA studies: Arkansas Nuclear One - Unit 1, Big Rock Point, Grand Gulf, Limerick, and Zion - Unit 1. The review has been conducted in two phases. The Phase I review may be characterized as a qualitative look into many aspects of a PRA study. The Phase II review was performed to quantify the extent that differences in analytical techniques or key assumptions in these areas affect the differences in study results. In each of the PRA studies reviewed, the general descriptions of analytical approaches and descriptions of the analyses of event tree, fault tree and human interaction analyses that affected the dominant core damage sequences were reviewed. When these descriptions aroused interest because of seeming inconsistencies within the study or with other studies, they were pursued in some depth. The approaches or assumptions were contrasted to similar elements from other studies, and sensitivity analyses were performed in many cases to test the significance of results to the analytical models or assumptions. Inferences were drawn from the results regarding significance of the item to plant-specific results and, where possible, were generalized to other PRAs. This paper describes the results of the review of system dependencies and human interactions

  17. Development of risk assessment methodology against natural external hazards for sodium-cooled fast reactors: project overview and strong Wind PRA methodology - 15031

    International Nuclear Information System (INIS)

    Yamano, H.; Nishino, H.; Kurisaka, K.; Okano, Y.; Sakai, T.; Yamamoto, T.; Ishizuka, Y.; Geshi, N.; Furukawa, R.; Nanayama, F.; Takata, T.; Azuma, E.

    2015-01-01

    This paper describes mainly strong wind probabilistic risk assessment (PRA) methodology development in addition to the project overview. In this project, to date, the PRA methodologies against snow, tornado and strong wind were developed as well as the hazard evaluation methodologies. For the volcanic eruption hazard, ash fallout simulation was carried out to contribute to the development of the hazard evaluation methodology. For the forest fire hazard, the concept of the hazard evaluation methodology was developed based on fire simulation. Event sequence assessment methodology was also developed based on plant dynamics analysis coupled with continuous Markov chain Monte Carlo method in order to apply to the event sequence against snow. In developing the strong wind PRA methodology, hazard curves were estimated by using Weibull and Gumbel distributions based on weather data recorded in Japan. The obtained hazard curves were divided into five discrete categories for event tree quantification. Next, failure probabilities for decay heat removal related components were calculated as a product of two probabilities: i.e., a probability for the missiles to enter the intake or out-take in the decay heat removal system, and fragility caused by the missile impacts. Finally, based on the event tree, the core damage frequency was estimated about 6*10 -9 /year by multiplying the discrete hazard probabilities in the Gumbel distribution by the conditional decay heat removal failure probabilities. A dominant sequence was led by the assumption that the operators could not extinguish fuel tank fire caused by the missile impacts and the fire induced loss of the decay heat removal system. (authors)

  18. Synthesis of hydroxyapatite nanorods for application in water defluoridation and optimization of process variables: Advantage of ultrasonication with precipitation method over conventional method.

    Science.gov (United States)

    Mehta, Dhiraj; Mondal, Poonam; Saharan, Virendra Kumar; George, Suja

    2017-07-01

    This research work presents the synthesis of hydroxyapatite (Hap) nanorods for defluoridation of drinking water by using both conventional (CM) and ultrasonication with precipitation (USPM) methods. Calcium nitrate was reacted with potassium phosphate in presence of ammonia for controlled pH to synthesize Hap nanorods, which was characterized using FTIR, XRD, SEM, TG-DTA, and TEM/EDS for determining its phase composition, structural and thermal decomposition behavior. When USPM method was used for synthesis, the yield of the Hap nanorods was improved from 83.24±1.0% to 90.2±1.0%, and complete phase transformation occurred with formation of elongated Hap nanorods. Effects of process parameters such as solution pH, contact time and adsorbent dose were studied through response surface methodology (RSM). A simple quadratic model was developed using Central Composite Design (CCD) and optimum parameters for fluoride adsorption process were determined to be pH 7, contact time 3h and adsorbent dose 7g/L for maximum removal capacity. Fluoride removal efficiency was predicted to be 93.64% which was very close to the experimental value obtained at 92.86% using ultrasonically prepared Hap. Fluoride adsorption isotherms fitted the Freundlich isotherm with an adsorption capacity of 1.49mg/g, while the kinetic studies revealed that the process followed pseudo-second order model. The treated water quality parameters such as residual fluoride, calcium leached, total hardness and alkalinity was investigated, and it was observed that all these parameters were within the permissible limits as per WHO and BIS standards. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Case study on the use of PSA methods: Backfitting decisions

    International Nuclear Information System (INIS)

    1991-04-01

    This case study illustrates the process of using probabilistic risk assessment (PRA) method to evaluate proposed backfits of nuclear power plants (NPP), which are intended to enhance the plant safety by improving equipment operability. Some examples of situations in which PRA techniques have been used to address backfit issues at operating NPPs are summarized. 2 refs, 5 figs, 4 tabs

  20. Perbandingan Tinggi Tulang Maksila dan Mandibula di Regio Interisisivi Sentral antara Pra dan Pasca Perawatan Ortodontik dengan Pencabutan ke Empat Gigi Premolar Pertama (Kajian pada Foto Panoramik

    Directory of Open Access Journals (Sweden)

    Wayan Ardhana

    2012-12-01

    Full Text Available Latar belakang. Perawatan ortodontik pada kasus-kasus gigi berjejal dan protusif sering membutuhkan pencabutan gigi premolar untuk penyediaan ruang agar gigi berjejal dapat dirapikan dan gigi depan yang protusif dapat diundurkan. Gigi insisivus sentral merupakan salah satu gigi yang paling banyak mengalami pergerakan selama proses retrusi. Pergerakan gigi insisivus mengakibatkan terjadinya perubahan pada puncak tulang alveolar selama perawatan yang mungkin akan mempengaruhi tinggi tulang maksila dan mandibula pasca perawatan. Tujuan penelitian. Membandingkan tinggi tulang maksila dan mandibula di daerah interdental gigi insisivi sentral pada foto panoramic antara pra dan pasca perawatan maloklusi dengan pencabutan ke empat gigi premolar pertama. Metode penelitian. Digunakan 30 pasang foto panoramic pra dan pasca perawatan yang dipilih sesuai dengan kriteria penelitian dari pasien-pasien peneliti yang telah selesai mendapat perawatan aktif dengan teknik edgewise. Analisis Kolmogorov-Smirnov dan Shaviro-Wilk digunakan untuk uji normalitas dan Student t-test data berpasangan digunakan untuk menguji perbedaan tinggi tulang maksila dan mandibula antara pra dan pasca perawatan. Hasil Penelitian. Tidak didapatkan perbedaan (p>0,05 tinggi tulang maksila dan amndibula antara pra dan pasca perawatan ortodontik dengan pencabutan keempat gigi premolar pertama.   Background. In orthodontic treatment, premolar extractions are often needed in crowding and prostrusive cases to provide space for the teeth can be aligned and retracted to their desire position. Central incisor teeth are the teeth that mostly undergone more movement during retrusion. The change of the alveolar bone crest in this incisors might affect the maxillary and mandibular bone height post-treatment. Research objectives. The present study aimed to compare the bone height in the interdental maxillary and mandibular central incisors regions before and after orthodontic treatment with four

  1. Broadening failure rate distributions in PRA uncertainty analyses

    International Nuclear Information System (INIS)

    Martz, H.F.

    1984-01-01

    Several recent nuclear power plant probabilistic risk assessments (PRAs) have utilized broadened Reactor Safety Study (RSS) component failure rate population variability curves to compensate for such things as expert overvaluation bias in the estimates upon which the curves are based. A simple two-components of variation empirical Bayes model is proposed for use in estimating the between-expert variability curve in the presence of such biases. Under certain conditions this curve is a population variability curve. Comparisons are made with the existing method. The popular procedure appears to be generally much more conservative than the empirical Bayes method in removing such biases. In one case the broadened curve based on the popular method is more than two orders of magnitude broader than the empirical Bayes curve. In another case it is found that the maximum justifiable degree of broadening of the RSS curve is to increase α from 5% to 12%, which is significantly less than 20% value recommended in the popular approach. 15 references, 1 figure, 5 tables

  2. Overview of methods for uncertainty analysis and sensitivity analysis in probabilistic risk assessment

    International Nuclear Information System (INIS)

    Iman, R.L.; Helton, J.C.

    1985-01-01

    Probabilistic Risk Assessment (PRA) is playing an increasingly important role in the nuclear reactor regulatory process. The assessment of uncertainties associated with PRA results is widely recognized as an important part of the analysis process. One of the major criticisms of the Reactor Safety Study was that its representation of uncertainty was inadequate. The desire for the capability to treat uncertainties with the MELCOR risk code being developed at Sandia National Laboratories is indicative of the current interest in this topic. However, as yet, uncertainty analysis and sensitivity analysis in the context of PRA is a relatively immature field. In this paper, available methods for uncertainty analysis and sensitivity analysis in a PRA are reviewed. This review first treats methods for use with individual components of a PRA and then considers how these methods could be combined in the performance of a complete PRA. In the context of this paper, the goal of uncertainty analysis is to measure the imprecision in PRA outcomes of interest, and the goal of sensitivity analysis is to identify the major contributors to this imprecision. There are a number of areas that must be considered in uncertainty analysis and sensitivity analysis for a PRA: (1) information, (2) systems analysis, (3) thermal-hydraulic phenomena/fission product behavior, (4) health and economic consequences, and (5) display of results. Each of these areas and the synthesis of them into a complete PRA are discussed

  3. [A comparative study between the Vitek YBC and Microscan Walk Away RYID automated systems with conventional phenotypic methods for the identification of yeasts of clinical interest].

    Science.gov (United States)

    Ferrara, Giuseppe; Mercedes Panizol, Maria; Mazzone, Marja; Delia Pequeneze, Maria; Reviakina, Vera

    2014-12-01

    The aim of this study was to compare the identification of clin- ically relevant yeasts by the Vitek YBC and Microscan Walk Away RYID automated methods with conventional phenotypic methods. One hundred and ninety three yeast strains isolated from clinical samples and five controls strains were used. All the yeasts were identified by the automated methods previously mentioned and conventional phenotypic methods such as carbohydrate assimilation, visualization of microscopic morphology on corn meal agar and the use of chromogenic agar. Variables were assessed by 2 x 2 contingency tables, McNemar's Chi square, the Kappa index, and concordance values were calculated, as well as major and minor errors for the automated methods. Yeasts were divided into two groups: (1) frequent isolation and (2) rare isolation. The Vitek YBC and Microscan Walk Away RYID systems were concordant in 88.4 and 85.9% respectively, when compared to conventional phenotypic methods. Although both automated systems can be used for yeasts identification, the presence of major and minor errors indicates the possibility of misidentifications; therefore, the operator of this equipment must use in parallel, phenotypic tests such as visualization of microscopic morphology on corn meal agar and chromogenic agar, especially against infrequently isolated yeasts. Automated systems are a valuable tool; however, the expertise and judgment of the microbiologist are an important strength to ensure the quality of the results.

  4. The RISMC approach to perform advanced PRA analyses - 15332

    International Nuclear Information System (INIS)

    Mandelli, D.; Smith, C.; Riley, T.; Nielsen, J.; Alfonsi, A.; Rabiti, C.; Cogliati, J.

    2015-01-01

    The existing fleet of nuclear power plants is in the process of extending its lifetime and increasing the power generated from these plants via power up-rates. In order to evaluate the impact of these two factors on the safety of the plant, the RISMC (Risk Informed Safety Margin Characterization) Pathway aims to develop simulation-based tools and methods to assess risks for existing nuclear power plants in order to optimize safety. This pathway, by developing new methods, is extending the state-of-the-practice methods that have been traditionally based on logic structures such as Event-Trees and Fault-Trees. These static types of models mimic system response in an inductive and deductive way respectively, yet are restrictive in the ways they can represent spatial and temporal constructs. RISMC analyses are performed by using a combination of thermal-hydraulic codes and a stochastic analysis tool (RAVEN)currently under development at the Idaho National Laboratory. This paper presents a case study in order to show the capabilities of the RISMC methodology to assess impact of power up-rate of a boiling water reactor system during a station blackout accident scenario. We employ the system simulator code, RELAP5-3D, coupled with RAVEN which perform the stochastic analysis. Our analysis is in fact performed by: 1) sampling values of a set of parameters from the uncertainty space of interest, 2) simulating the system behavior for that specific set of parameter values and 3) analyzing the set of simulation runs. Results obtained give a detailed investigation of the issues associated with a plant power up-rate including the effects of station blackout accident scenarios. We are able to quantify how the timing of specific events was impacted by a higher nominal reactor core power. Such safety insights can provide useful information to the decision makers to perform risk informed margins management

  5. Comparison of the quantitative dry culture methods with both conventional media and most probable number method for the enumeration of coliforms and Escherichia coli/coliforms in food.

    Science.gov (United States)

    Teramura, H; Sota, K; Iwasaki, M; Ogihara, H

    2017-07-01

    Sanita-kun™ CC (coliform count) and EC (Escherichia coli/coliform count), sheet quantitative culture systems which can avoid chromogenic interference by lactase in food, were evaluated in comparison with conventional methods for these bacteria. Based on the results of inclusivity and exclusivity studies using 77 micro-organisms, sensitivity and specificity of both Sanita-kun™ met the criteria for ISO 16140. Both media were compared with deoxycholate agar, violet red bile agar, Merck Chromocult™ coliform agar (CCA), 3M Petrifilm™ CC and EC (PEC) and 3-tube MPN, as reference methods, in 100 naturally contaminated food samples. The correlation coefficients of both Sanita-kun™ for coliform detection were more than 0·95 for all comparisons. For E. coli detection, Sanita-kun™ EC was compared with CCA, PEC and MPN in 100 artificially contaminated food samples. The correlation coefficients for E. coli detection of Sanita-kun™ EC were more than 0·95 for all comparisons. There were no significant differences in all comparisons when conducting a one-way analysis of variance (anova). Both Sanita-kun™ significantly inhibited colour interference by lactase when inhibition of enzymatic staining was assessed using 40 natural cheese samples spiked with coliform. Our results demonstrated Sanita-kun™ CC and EC are suitable alternatives for the enumeration of coliforms and E. coli/coliforms, respectively, in a variety of foods, and specifically in fermented foods. Current chromogenic media for coliforms and Escherichia coli/coliforms have enzymatic coloration due to breaking down of chromogenic substrates by food lactase. The novel sheet culture media which have film layer to avoid coloration by food lactase have been developed for enumeration of coliforms and E. coli/coliforms respectively. In this study, we demonstrated these media had comparable performance with reference methods and less interference by food lactase. These media have a possibility not only

  6. Towards non-conventional methods of designing register-based epidemiological studies: An application to pediatric research.

    Science.gov (United States)

    Gong, Tong; Brew, Bronwyn; Sjölander, Arvid; Almqvist, Catarina

    2017-07-01

    Various epidemiological designs have been applied to investigate the causes and consequences of fetal growth restriction in register-based observational studies. This review seeks to provide an overview of several conventional designs, including cohort, case-control and more recently applied non-conventional designs such as family-based designs. We also discuss some practical points regarding the application and interpretation of family-based designs. Definitions of each design, the study population, the exposure and the outcome measures are briefly summarised. Examples of study designs are taken from the field of low birth-weight research for illustrative purposes. Also examined are relative advantages and disadvantages of each design in terms of assumptions, potential selection and information bias, confounding and generalisability. Kinship data linkage, statistical models and result interpretation are discussed specific to family-based designs. When all information is retrieved from registers, there is no evident preference of the case-control design over the cohort design to estimate odds ratios. All conventional designs included in the review are prone to bias, particularly due to residual confounding. Family-based designs are able to reduce such bias and strengthen causal inference. In the field of low birth-weight research, family-based designs have been able to confirm a negative association not confounded by genetic or shared environmental factors between low birth weight and the risk of asthma. We conclude that there is a broader need for family-based design in observational research as evidenced by the meaningful contributions to the understanding of the potential causal association between low birth weight and subsequent outcomes.

  7. Accuracy and precision of 3 intraoral scanners and accuracy of conventional impressions: A novel in vivo analysis method.

    Science.gov (United States)

    Nedelcu, R; Olsson, P; Nyström, I; Rydén, J; Thor, A

    2018-02-01

    To evaluate a novel methodology using industrial scanners as a reference, and assess in vivo accuracy of 3 intraoral scanners (IOS) and conventional impressions. Further, to evaluate IOS precision in vivo. Four reference-bodies were bonded to the buccal surfaces of upper premolars and incisors in five subjects. After three reference-scans, ATOS Core 80 (ATOS), subjects were scanned three times with three IOS systems: 3M True Definition (3M), CEREC Omnicam (OMNI) and Trios 3 (TRIOS). One conventional impression (IMPR) was taken, 3M Impregum Penta Soft, and poured models were digitized with laboratory scanner 3shape D1000 (D1000). Best-fit alignment of reference-bodies and 3D Compare Analysis was performed. Precision of ATOS and D1000 was assessed for quantitative evaluation and comparison. Accuracy of IOS and IMPR were analyzed using ATOS as reference. Precision of IOS was evaluated through intra-system comparison. Precision of ATOS reference scanner (mean 0.6 μm) and D1000 (mean 0.5 μm) was high. Pairwise multiple comparisons of reference-bodies located in different tooth positions displayed a statistically significant difference of accuracy between two scanner-groups: 3M and TRIOS, over OMNI (p value range 0.0001 to 0.0006). IMPR did not show any statistically significant difference to IOS. However, deviations of IOS and IMPR were within a similar magnitude. No statistical difference was found for IOS precision. The methodology can be used for assessing accuracy of IOS and IMPR in vivo in up to five units bilaterally from midline. 3M and TRIOS had a higher accuracy than OMNI. IMPR overlapped both groups. Intraoral scanners can be used as a replacement for conventional impressions when restoring up to ten units without extended edentulous spans. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. The environmental impact of coal technology: Politics and methods of achieving an international convention to protect the earth's atmosphere

    International Nuclear Information System (INIS)

    1992-01-01

    Particular attention will be paid to the following points during the international Round Table discussions: Technology transfer and political opportunities for the environmentally-compatible use of coal in developing and transitional countries who rely on coal to meet their energy needs. Supporting this challenge for the international community of coal-based energy conservation in these countries, particularly through development aid. To increasingly accept our collective responsibility for energy considerations and environmental effects, based on a better understanding of the countries' differing limits and obligations in achieving the goal of a convention to protect the earth's atmosphere. (orig.) [de

  9. Transfer of pharmacopoeial liquid chromatography reversedphase methods for determination of related compounds in diclofenac sodium and metamizole sodium from conventional to core-shell column

    Directory of Open Access Journals (Sweden)

    Katerina Brezovska

    2015-04-01

    Full Text Available Core-shell silica particles were developed as a new material for chromatographic stationary phases in order to provide fast and high efficiency separations of small and large molecules and complex samples, at pressures compatible with conventional HPLC equipment. The aim of our work was to show the applicability of the HPLC columns based on a core-shell technology for determination of related substances in diclofenac sodium and in metamizole sodium using the methods described in the corresponding monographs of the European pharmacopoeia. The obtained results have shown that the proposed methods can be successfully transferred on core shell column, with suitable adjustment of injection volume and flow rate. The advantage of using core-shell column is fast and highly efficient separation on conventional HPLC equipment with increased sensitivity of the method and high throughput of the analysis, providing enhanced lab productivity and reduced costs.

  10. A simple gold nanoparticle-mediated immobilization method to fabricate highly homogeneous DNA microarrays having higher capacities than those prepared by using conventional techniques

    International Nuclear Information System (INIS)

    Jung, Cheulhee; Mun, Hyo Young; Li, Taihua; Park, Hyun Gyu

    2009-01-01

    A simple, highly efficient immobilization method to fabricate DNA microarrays, that utilizes gold nanoparticles as the mediator, has been developed. The fabrication method begins with electrostatic attachment of amine-modified DNA to gold nanoparticles. The resulting gold-DNA complexes are immobilized on conventional amine or aldehyde functionalized glass slides. By employing gold nanoparticles as the immobilization mediator, implementation of this procedure yields highly homogeneous microarrays that have higher binding capacities than those produced by conventional methods. This outcome is due to the increased three-dimensional immobilization surface provided by the gold nanoparticles as well as the intrinsic effects of gold on emission properties. This novel immobilization strategy gives microarrays that produce more intense hybridization signals for the complementary DNA. Furthermore, the silver enhancement technique, made possible only in the case of immobilized gold nanoparticles on the microarrays, enables simple monitoring of the integrity of the immobilized DNA probe.

  11. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Directory of Open Access Journals (Sweden)

    Sung-Hye You

    2017-01-01

    Full Text Available Purpose The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL, for measuring the volume of parathyroid glands. Methods Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D and three-dimensional (3D methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. Results The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. Conclusion The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  12. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Science.gov (United States)

    Géczi, Gábor; Horváth, Márk; Kaszab, Tímea; Alemany, Gonzalo Garnacho

    2013-01-01

    Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values) of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other ways as well.

  13. No major differences found between the effects of microwave-based and conventional heat treatment methods on two different liquid foods.

    Directory of Open Access Journals (Sweden)

    Gábor Géczi

    Full Text Available Extension of shelf life and preservation of products are both very important for the food industry. However, just as with other processes, speed and higher manufacturing performance are also beneficial. Although microwave heating is utilized in a number of industrial processes, there are many unanswered questions about its effects on foods. Here we analyze whether the effects of microwave heating with continuous flow are equivalent to those of traditional heat transfer methods. In our study, the effects of heating of liquid foods by conventional and continuous flow microwave heating were studied. Among other properties, we compared the stability of the liquid foods between the two heat treatments. Our goal was to determine whether the continuous flow microwave heating and the conventional heating methods have the same effects on the liquid foods, and, therefore, whether microwave heat treatment can effectively replace conventional heat treatments. We have compared the colour, separation phenomena of the samples treated by different methods. For milk, we also monitored the total viable cell count, for orange juice, vitamin C contents in addition to the taste of the product by sensory analysis. The majority of the results indicate that the circulating coil microwave method used here is equivalent to the conventional heating method based on thermal conduction and convection. However, some results in the analysis of the milk samples show clear differences between heat transfer methods. According to our results, the colour parameters (lightness, red-green and blue-yellow values of the microwave treated samples differed not only from the untreated control, but also from the traditional heat treated samples. The differences are visually undetectable, however, they become evident through analytical measurement with spectrophotometer. This finding suggests that besides thermal effects, microwave-based food treatment can alter product properties in other

  14. Model Penilaian untuk Kematangan Perencanaan Keselamatan dalam Tahap Pra Konstruksi

    Directory of Open Access Journals (Sweden)

    Bambang Endroyo

    2015-10-01

    Full Text Available The construction sector still has a low achievement in safety issues. Fatal accident rate in construction is higher than average rate in other industries. Because of it, need some attention to minimize the rate of accident in construction. This research examined the key factors of safety planning in the pre-construction stage, and it was based on the theories of accidents causation having the upstream approach. Some theories were: Constraint-Response Theory (CR; Construction Design Management (CDM, and the Process Protocol (Pp. This research broke down the three theories above (CR; CDM; Pp into the concept of the key factors of safety planning in pre-construction. Then, the concept was verified by construction practitioners and academician, using Delphi method three rotations. During the verification, from the first to the third round, there were reduction and the addition concept and language appropriateness. The findings of this research were assessment models of maturity safety planning in the pre construction stages. There were two models, the model of "radar chart" or MISAP 1 and the model of "worksheet" or MISAP 2.

  15. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    Energy Technology Data Exchange (ETDEWEB)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon [Dept. of Radiology, Korea University Anam Hospital, Seoul (Korea, Republic of); Suh, Sangil; Ryoo, In Seon; Seol, Hae Young [Dept. of Radiology, Korea University Guro Hospital, Seoul (Korea, Republic of); Lee, Young Hen; Seo, Hyung Suk [Dept. of Radiology, Korea University Ansan Hospital, Ansan (Korea, Republic of)

    2017-01-15

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism.

  16. Assessing the accuracy and reliability of ultrasonographic three-dimensional parathyroid volume measurement in a patient with secondary hyperparathyroidism: a comparison with the two-dimensional conventional method

    International Nuclear Information System (INIS)

    You, Sung Hye; Son, Gyu Ri; Lee, Nam Joon; Suh, Sangil; Ryoo, In Seon; Seol, Hae Young; Lee, Young Hen; Seo, Hyung Suk

    2017-01-01

    The purpose of this study was to investigate the accuracy and reliability of the semi-automated ultrasonographic volume measurement tool, virtual organ computer-aided analysis (VOCAL), for measuring the volume of parathyroid glands. Volume measurements for 40 parathyroid glands were performed in patients with secondary hyperparathyroidism caused by chronic renal failure. The volume of the parathyroid glands was measured twice by experienced radiologists by two-dimensional (2D) and three-dimensional (3D) methods using conventional sonograms and the VOCAL with 30°angle increments before parathyroidectomy. The specimen volume was also measured postoperatively. Intraclass correlation coefficients (ICCs) and the absolute percentage error were used for estimating the reproducibility and accuracy of the two different methods. The ICC value between two measurements of the 2D method and the 3D method was 0.956 and 0.999, respectively. The mean absolute percentage error of the 2D method and the 3D VOCAL technique was 29.56% and 5.78%, respectively. For accuracy and reliability, the plots of the 3D method showed a more compact distribution than those of the 2D method on the Bland-Altman graph. The rotational VOCAL method for measuring the parathyroid gland is more accurate and reliable than the conventional 2D measurement. This VOCAL method could be used as a more reliable follow-up imaging modality in a patient with hyperparathyroidism

  17. EVNTRE, Code System for Event Progression Analysis for PRA

    International Nuclear Information System (INIS)

    2002-01-01

    1 - Description of program or function: EVNTRE is a generalized event tree processor that was developed for use in probabilistic risk analysis of severe accident progressions for nuclear power plants. The general nature of EVNTRE makes it applicable to a wide variety of analyses that involve the investigation of a progression of events which lead to a large number of sets of conditions or scenarios. EVNTRE efficiently processes large, complex event trees. It can assign probabilities to event tree branch points in several different ways, classify pathways or outcomes into user-specified groupings, and sample input distributions of probabilities and parameters. PSTEVNT, a post-processor program used to sort and reclassify the 'binned' data output from EVNTRE and generate summary tables, is included. 2 - Methods: EVNTRE processes event trees that are cast in the form of questions or events, with multiple choice answers for each question. Split fractions (probabilities or frequencies that sum to unity) are either supplied or calculated for the branches of each question in a path-dependent manner. EVNTRE traverses the tree, enumerating the leaves of the tree and calculating their probabilities or frequencies based upon the initial probability or frequency and the split fractions for the branches taken along the corresponding path to an individual leaf. The questions in the event tree are usually grouped to address specific phases of time regimes in the progression of the scenario or severe accident. Grouping or binning of each path through the event tree in terms of a small number of characteristics or attributes is allowed. Boolean expressions of the branches taken are used to select the appropriate values of the characteristics of interest for the given path. Typically, the user specifies a cutoff tolerance for the frequency of a pathway to terminate further exploration. Multiple sets of input to an event tree can be processed by using Monte Carlo sampling to generate

  18. Incorporating organizational factors into Probabilistic Risk Assessment (PRA) of complex socio-technical systems: A hybrid technique formalization

    International Nuclear Information System (INIS)

    Mohaghegh, Zahra; Kazemi, Reza; Mosleh, Ali

    2009-01-01

    This paper is a result of a research with the primary purpose of extending Probabilistic Risk Assessment (PRA) modeling frameworks to include the effects of organizational factors as the deeper, more fundamental causes of accidents and incidents. There have been significant improvements in the sophistication of quantitative methods of safety and risk assessment, but the progress on techniques most suitable for organizational safety risk frameworks has been limited. The focus of this paper is on the choice of 'representational schemes' and 'techniques.' A methodology for selecting appropriate candidate techniques and their integration in the form of a 'hybrid' approach is proposed. Then an example is given through an integration of System Dynamics (SD), Bayesian Belief Network (BBN), Event Sequence Diagram (ESD), and Fault Tree (FT) in order to demonstrate the feasibility and value of hybrid techniques. The proposed hybrid approach integrates deterministic and probabilistic modeling perspectives, and provides a flexible risk management tool for complex socio-technical systems. An application of the hybrid technique is provided in the aviation safety domain, focusing on airline maintenance systems. The example demonstrates how the hybrid method can be used to analyze the dynamic effects of organizational factors on system risk

  19. Incorporating organizational factors into Probabilistic Risk Assessment (PRA) of complex socio-technical systems: A hybrid technique formalization

    Energy Technology Data Exchange (ETDEWEB)

    Mohaghegh, Zahra [Center for Risk and Reliability, University of Maryland, College Park, MD 20742 (United States)], E-mail: mohagheg@umd.edu; Kazemi, Reza; Mosleh, Ali [Center for Risk and Reliability, University of Maryland, College Park, MD 20742 (United States)

    2009-05-15

    This paper is a result of a research with the primary purpose of extending Probabilistic Risk Assessment (PRA) modeling frameworks to include the effects of organizational factors as the deeper, more fundamental causes of accidents and incidents. There have been significant improvements in the sophistication of quantitative methods of safety and risk assessment, but the progress on techniques most suitable for organizational safety risk frameworks has been limited. The focus of this paper is on the choice of 'representational schemes' and 'techniques.' A methodology for selecting appropriate candidate techniques and their integration in the form of a 'hybrid' approach is proposed. Then an example is given through an integration of System Dynamics (SD), Bayesian Belief Network (BBN), Event Sequence Diagram (ESD), and Fault Tree (FT) in order to demonstrate the feasibility and value of hybrid techniques. The proposed hybrid approach integrates deterministic and probabilistic modeling perspectives, and provides a flexible risk management tool for complex socio-technical systems. An application of the hybrid technique is provided in the aviation safety domain, focusing on airline maintenance systems. The example demonstrates how the hybrid method can be used to analyze the dynamic effects of organizational factors on system risk.

  20. Safety of type and screen method compared to conventional antiglobulin crossmatch procedures for compatibility testing in Indian setting

    Directory of Open Access Journals (Sweden)

    Chaudhary Rajendra

    2011-01-01

    Full Text Available Background: Over the past 30 years, pretransfusion tests have undergone considerable modification. In 1984, AABB recommended that the full cross match could be replaced by an abbreviated cross match in patients with negative antibody screen. However, before implementation of such a policy, issue regarding safety of T & S needs to be evaluated. Objectives: The aim of pretransfusion testing (PTT is to ensure that enough red blood cells (RBCs in the selected red cell components will survive when transfused. Results and Conclusion: We have, therefore in this study; evaluated safety of T & S procedure for PTT in comparison with conventional test tube cross match. The T & S procedure gave a safety of 91.6%. Also, the usefulness of the T & S was shown through the detection of unexpected antibodies in 0.75% (15 out of 2026 of cases.

  1. Comparing Amazon's Mechanical Turk Platform to Conventional Data Collection Methods in the Health and Medical Research Literature.

    Science.gov (United States)

    Mortensen, Karoline; Hughes, Taylor L

    2018-04-01

    The goal of this article is to conduct an assessment of the peer-reviewed primary literature with study objectives to analyze Amazon.com 's Mechanical Turk (MTurk) as a research tool in a health services research and medical context. Searches of Google Scholar and PubMed databases were conducted in February 2017. We screened article titles and abstracts to identify relevant articles that compare data from MTurk samples in a health and medical context to another sample, expert opinion, or other gold standard. Full-text manuscript reviews were conducted for the 35 articles that met the study criteria. The vast majority of the studies supported the use of MTurk for a variety of academic purposes. The literature overwhelmingly concludes that MTurk is an efficient, reliable, cost-effective tool for generating sample responses that are largely comparable to those collected via more conventional means. Caveats include survey responses may not be generalizable to the US population.

  2. An elemental concentration open source database for Hogdahl-Convention and Westcott-Formalism based on K0-INAA method in Malaysia

    International Nuclear Information System (INIS)

    Yavar, A.R.; Sukiman Sarmani; Tan, C.Y.; Rafie, N.N.; Lim, S.W.E.; Khoo, K.S.

    2012-01-01

    An electronic database has been developed and implemented for K 0 -INAA method in Malaysia. Databases are often developed according to national requirements. This database contains constant nuclear data for k 0 -INAA method. Hogdahl-convention and Westcott-formalism as 3 separate command user interfaces. It has been created using Microsoft Access 2007 under a Windows operating system. This database saves time and the quality of results can be assured when the calculation of neutron flux parameters and concentration of elements by k 0 -INAA method are utilised. An evaluation of the database was conducted by IAEA Soil7 where the results published which showed a high level of consistency. (Author)

  3. Comparison of the heat shock response induced by conventional heating and two methods of delivery of pulsed radiofrequency energy

    International Nuclear Information System (INIS)

    Laurence, J.A.; University of Sydney, NSW; McKenzie, D.R.; Veas, L.; French, P.W.

    2002-01-01

    Full text: In 2001, we published a (hypothetical) mechanism by which radiofrequency (RF) radiation from mobile phones could induce cancer, via the chronic induction of the heat shock response (HSR). This hypothesis provides the focus for our research. Other groups have reported induction of the HSR by RF at apparently non thermal levels. The aim of this study was to determine whether the HSR induced by RF is (a) truly non thermal and (b) quantitatively or qualitatively different from that induced by conventional heating of cells. A rat mast cell line, RBL-2H3, was chosen as the target RBL-2H3 cells were exposed in an air incubator at 41.1 deg C for 45 minutes and 75 minutes, and then returned to a 37 deg C incubator. Sham exposures were performed in the same air incubator at 37 deg C. Cells were exposed for 1 hour in the two pulsed RF exposure systems. The first was a converted 750W microwave oven that emits a short burst of 2.45GHz pulses at the start of each contiguous six minute period. This exposes cells to an average specific energy absorption rate (SAR) of 20W/kg. The second system was a TEM cell, which simulates. GSM pulses - the earner frequency is 0.9GHz pulse modulated at 217Hz. The SAR was approx 0.1W/kg. Both of these exposure systems are housed in incubators maintained at 37 deg C. Sham exposures were performed in the two systems with the same conditions but with no RF radiation present. Cell samples for the conventional heating and microwave exposures were taken 0, 2. 5, 5 and 20 hours after exposure, and expression of heat shock proteins hsp 110, 90, 70, 60 and 56 were determined by Western Blotting and compared between exposures

  4. RAVEN: a GUI and an Artificial Intelligence Engine in a Dynamic PRA Framework

    Energy Technology Data Exchange (ETDEWEB)

    C. Rabiti; D. Mandelli; A. Alfonsi; J. Cogliati; R. Kinoshita; D. Gaston; R. Martineau; C. Curtis

    2013-06-01

    Increases in computational power and pressure for more accurate simulations and estimations of accident scenario consequences are driving the need for Dynamic Probabilistic Risk Assessment (PRA) [1] of very complex models. While more sophisticated algorithms and computational power address the back end of this challenge, the front end is still handled by engineers that need to extract meaningful information from the large amount of data and build these complex models. Compounding this problem is the difficulty in knowledge transfer and retention, and the increasing speed of software development. The above-described issues would have negatively impacted deployment of the new high fidelity plant simulator RELAP-7 (Reactor Excursion and Leak Analysis Program) at Idaho National Laboratory. Therefore, RAVEN that was initially focused to be the plant controller for RELAP-7 will help mitigate future RELAP-7 software engineering risks. In order to accomplish this task, Reactor Analysis and Virtual Control Environment (RAVEN) has been designed to provide an easy to use Graphical User Interface (GUI) for building plant models and to leverage artificial intelligence algorithms in order to reduce computational time, improve results, and help the user to identify the behavioral pattern of the Nuclear Power Plants (NPPs). In this paper we will present the GUI implementation and its current capability status. We will also introduce the support vector machine algorithms and show our evaluation of their potentiality in increasing the accuracy and reducing the computational costs of PRA analysis. In this evaluation we will refer to preliminary studies performed under the Risk Informed Safety Margins Characterization (RISMC) project of the Light Water Reactors Sustainability (LWRS) campaign [3]. RISMC simulation needs and algorithm testing are currently used as a guidance to prioritize RAVEN developments relevant to PRA.

  5. Effect of antigravity suit inflation on cardiovascular, PRA, and PVP responses in humans.

    Science.gov (United States)

    Kravik, S E; Keil, L C; Geelen, G; Wade, C E; Barnes, P R; Spaul, W A; Elder, C A; Greenleaf, J E

    1986-08-01

    Blood pressure, pulse rate (PR), serum osmolality and electrolytes, as well as plasma vasopressin (PVP) and plasma renin activity (PRA), were measured in five men and two women [mean age 38.6 +/- 3.9 (SE) yr] before, during, and after inflation of an antigravity suit that covered the legs and abdomen. After 24 h of fluid deprivation the subjects stood quietly for 3 h: the 1st h without inflation, the 2nd with inflation to 60 Torr, and the 3rd without inflation. A similar control noninflation experiment was conducted 10 mo after the inflation experiment using five of the seven subjects except that the suit was not inflated during the 3-h period. Mean arterial pressure increased by 14 +/- 4 (SE) Torr (P less than 0.05) with inflation and decreased by 15 +/- 5 Torr (P less than 0.05) after deflation. Pulse pressure (PP) increased by 7 +/- 2 Torr (P less than 0.05) with inflation and PR decreased by 11 +/- 5 beats/min (P less than 0.05); PP and PR returned to preinflation levels after deflation. Plasma volume decreased by 6.1 +/- 1.5% and 5.3 +/- 1.6% (P less than 0.05) during hours 1 and 3, respectively, and returned to base line during inflation. Inflation decreased PVP from 6.8 +/- 1.1 to 5.6 +/- 1.4 pg/ml (P less than 0.05) and abolished the significant rise in PRA during hour 1. Both PVP and PRA increased significantly after deflation: delta = 18.0 +/- 5.1 pg/ml and 4.34 +/- 1.71 ng angiotensin I X ml-1 X h-1, respectively. Serum osmolality and Na+ and K+ concentrations were unchanged during the 3 h of standing.(ABSTRACT TRUNCATED AT 250 WORDS)

  6. Review of KSNP LPSD PSA model based of ANS LPSD PRA standard, rev.0

    International Nuclear Information System (INIS)

    Jang, S. C.; Park, J. H.; Kim, T. W.; Lim, H. G.; Yang, J. E.; Ha, J. J.

    2004-02-01

    Recently, under the de-regulation environment, nuclear industry has attempted various approaches to improve the economics of Nuclear Power Plants (NPP). One of these efforts is the Risk Informed/Performance-based Operation (RIPBO). This approach uses the risk and performance information to manage the resources effectively and efficiently that are used in the operation of NPP. In RIPBO, PSA quality is one of the most important things. The nuclear industry and regulatory body of U.S.A have developed a measure to evaluate the quality of PSA. NEI (Nuclear Energy Institute) has developed a guidance called 'NEI PRA Peer Review Guidance,' and NRC (Nuclear Regulatory Committee) and ASME have developed the 'PRA Standard.' In Korea, several projects are on going now, such as the extension of AOT/STI of RPS/ESFAS, Risk-informed In-service Inspection (RI-ISI). However, in Korea, there have been no attempts to evaluate the quality of PSA model itself. Therefore, we cannot be sure about the quality of PSA whether or not the present PSA model can be used for the risk-informed applications such as mentioned above. We can say that the evaluation of PSA model quality is the basis for the RIPBO. In this report, we have evaluated the quality of PSA model at Low power and Shutdown operation model for Yongkwang 5 and 6 units based on the ANS LPSD PRA Standard. We, also, have derived what items are to be improved to upgrade the quality of LPSD PSA model and how it can be improved. This report can be used as the base of RIPBO work in Korea

  7. The efficiency of conventional microscopic selection is comparable to the hyaluronic acid binding method in selecting spermatozoa for male infertility patients

    OpenAIRE

    Meng-Ting Huang; Robert Kuo-Kuang Lee; Chung-Hao Lu; Ying-Jie Chen; Sheng-Hsiang Li; Yuh-Ming Hwu

    2015-01-01

    Objective: To evaluate if hyaluronic acid (HA)-bound spermatozoa surpassed conventional microscopy-selected spermatozoa in the status of sperm DNA integrity by acridine orange (AO) fluorescence staining. Materials and methods: Spermatozoa obtained from couples with indication for the intracytoplasmic sperm injection (ICSI) procedure due to male infertility (n = 34) and control males with normal sperm parameters (n = 12) were analyzed using AO fluorescence staining after density-gradient ce...

  8. Use of probabilistic risk assessment (PRA) in expert systems to advise nuclear plant operators and managers

    International Nuclear Information System (INIS)

    Uhrig, R.E.

    1988-01-01

    The use of expert systems in nuclear power plants to provide advice to managers, supervisors and/or operators is a concept that is rapidly gaining acceptance. Generally, expert systems rely on the expertise of human experts or knowledge that has been modified in publications, books, or regulations to provide advice under a wide variety of conditions. In this work, a probabilistic risk assessment (PRA) 3 of a nuclear power plant performed previously is used to assess the safety status of nuclear power plants and to make recommendations to the plant personnel. 5 refs., 1 fig., 2 tabs

  9. Application of the NUREG/CR-6850 EPRI/NRC Fire PRA Methodology to a DOE Facility

    International Nuclear Information System (INIS)

    Elicson, Tom; Harwood, Bentley; Yorg, Richard; Lucek, Heather; Bouchard, Jim; Jukkola, Ray; Phan, Duan

    2011-01-01

    The application NUREG/CR-6850 EPRI/NRC fire PRA methodology to DOE facility presented several challenges. This paper documents the process and discusses several insights gained during development of the fire PRA. A brief review of the tasks performed is provided with particular focus on the following: Tasks 5 and 14: Fire-induced risk model and fire risk quantification. A key lesson learned was to begin model development and quantification as early as possible in the project using screening values and simplified modeling if necessary. Tasks 3 and 9: Fire PRA cable selection and detailed circuit failure analysis. In retrospect, it would have been beneficial to perform the model development and quantification in 2 phases with detailed circuit analysis applied during phase 2. This would have allowed for development of a robust model and quantification earlier in the project and would have provided insights into where to focus the detailed circuit analysis efforts. Tasks 8 and 11: Scoping fire modeling and detailed fire modeling. More focus should be placed on detailed fire modeling and less focus on scoping fire modeling. This was the approach taken for the fire PRA. Task 14: Fire risk quantification. Typically, multiple safe shutdown (SSD) components fail during a given fire scenario. Therefore dependent failure analysis is critical to obtaining a meaningful fire risk quantification. Dependent failure analysis for the fire PRA presented several challenges which will be discussed in the full paper.

  10. Calculation of Fire Severity Factors and Fire Non-Suppression Probabilities For A DOE Facility Fire PRA

    International Nuclear Information System (INIS)

    Elicson, Tom; Harwood, Bentley; Lucek, Heather; Bouchard, Jim

    2011-01-01

    Over a 12 month period, a fire PRA was developed for a DOE facility using the NUREG/CR-6850 EPRI/NRC fire PRA methodology. The fire PRA modeling included calculation of fire severity factors (SFs) and fire non-suppression probabilities (PNS) for each safe shutdown (SSD) component considered in the fire PRA model. The SFs were developed by performing detailed fire modeling through a combination of CFAST fire zone model calculations and Latin Hypercube Sampling (LHS). Component damage times and automatic fire suppression system actuation times calculated in the CFAST LHS analyses were then input to a time-dependent model of fire non-suppression probability. The fire non-suppression probability model is based on the modeling approach outlined in NUREG/CR-6850 and is supplemented with plant specific data. This paper presents the methodology used in the DOE facility fire PRA for modeling fire-induced SSD component failures and includes discussions of modeling techniques for: Development of time-dependent fire heat release rate profiles (required as input to CFAST), Calculation of fire severity factors based on CFAST detailed fire modeling, and Calculation of fire non-suppression probabilities.

  11. Religious versus Conventional Psychotherapy for Major Depression in Patients with Chronic Medical Illness: Rationale, Methods, and Preliminary Results

    Directory of Open Access Journals (Sweden)

    Harold G. Koenig

    2012-01-01

    Full Text Available This paper (1 reviews the physical and religious barriers to CBT that disabled medically ill-depressed patients face, (2 discusses research on the relationship between religion and depression-induced physiological changes, (3 describes an ongoing randomized clinical trial of religious versus secular CBT in chronically ill patients with mild-to-moderate major depression designed to (a overcome physical and religious barriers to CBT and (b compare the efficacy of religious versus secular CBT in relieving depression and improving immune and endocrine functions, and (4 presents preliminary results that illustrate the technical difficulties that have been encountered in implementing this trial. CBT is being delivered remotely via instant messaging, telephone, or Skype, and Christian, Jewish, Muslim, Buddhist, and Hindu versions of religious CBT are being developed. The preliminary results described here are particular to the technologies employed in this study and are not results from the CBT clinical trial whose findings will be published in the future after the study ends and data are analyzed. The ultimate goal is to determine if a psychotherapy delivered remotely that integrates patients’ religious resources improves depression more quickly than a therapy that ignores them, and whether religious CBT is more effective than conventional CBT in reversing depression-induced physiological changes.

  12. The usefulness of levin tube inserted drip infusion spiral CT: comparison with conventional method in subtotal gastrectomy patients

    International Nuclear Information System (INIS)

    Park, Young Jin; Kim, Young Hwan; Yoon, Jung Hee; Cha, Soon Joo; Kim, Jeong Sook; Kim, Sung Rok; Hur, Gham; Rhim, Hyun Chul

    1998-01-01

    The purpose of this study is to access the usefulness of newly designed Levin tube inserted drip infusion spiral CT for the evaluation of remnant stomach and anastomosis site in patients who have undergone subtotal gastrectomy for stomach cancer. A new technique named Levin tube inserted drip infusion spiral CT was used to prospectively study 23 patients. A 16Fr Levin tube was inserted into the remnant stomach; 500 ml of tap water was drip infused just before CT scanning and an additional 500 ml of water was infused during IV contrast injection. Water was infused by gravity, using a water bottle suspended at a height of 90 cm (Group A). The 31 patients who underwent conventional spiral CT scanning immediately after the divided ingestion of 900 ml diluted gastrografin were selected as a control group (Group B). The anatomic delineation of the anastomosis site was graded by two radiologists as excellent (3), good(2), fair (1) or poor (0). To evaluate the degree of distension, the maximal diameters of remnant stomach and the anastomosis site, and the thickness of the stomach wall, were also measured. In patients who had undergone subtobal gastrectomy, Levin tube inserted drip infusion spiral CT showed excellent anatomic delineation of the site of anastomosis and remnant stomach. We found that because it increases the distension of remnant stomach and the anastomosis site, this technique is effective for the evaluation of postoperative stomach. (author). 10 refs., 2 tabs., 3 figs

  13. Comparison of type and frequency of chromosome aberrations by conventional and G-staining methods in Hiroshima atomic bomb survivors

    International Nuclear Information System (INIS)

    Ohtaki, Kazuo; Shimba, Hachiro; Sofuni, Toshio; Awa, A.A.

    1982-07-01

    Somatic chromosomes derived from cultured lymphocytes of 23 atomic bomb survivors of Hiroshima were analyzed to determine the type and frequency of radiation-induced structural aberrations, using in sequence the ordinary staining method (O-method) and the trypsin G-banding method (G-method). Of 896 cells examined, 342 were found to contain induced aberrations, including 31 cells in which the precise identification of the type of aberrations was not possible even by the G-method. The number of chromosome aberrations observed was 376 in the 311 cells where aberrant precise identification was possible. The majority (288 or 76.6%) were intra- or inter-chromosomal symmetric exchanges due to a two-break event, while only 24 were found to be asymmetric exchanges (dicentrics, rings, and interstitial deletions). Further, there were 28 aberrations showing acentric fragments and terminal deletions, and the remaining 36 were complex intra- and inter-chromosomal exchanges involving three or more breaks which result in insertions and double translocations. A comparative karyotype analysis of the same metaphases examined by the sequential 0- And G-methods was carried out independently on 361 aberrations, mostly of the symmetric type. It was found that 78 (21.6%) of the 361 were detected only by the G-method; among these were 14 paracentric inversions, 48 reciprocal interchanges of chromosome segments with either equal length (11) or unequal length (37), 14 minor deletions and 2 complex rearrangements, all of which were nevertheless judged to fall within the normal range of variation by theO-method. In contrast, 25 aberrations detected in O-method chromosomes which were overcontracted or twisted, were shown to have normal banding patterns by the G-method. (author)

  14. Workshop on the use of PRA methodology for the analysis of reactor events and operational data: Proceedings

    International Nuclear Information System (INIS)

    Rasmuson, D.M.

    1992-06-01

    A workshop entitled ''The Use of PRA Methodology for the Analysis of Reactor Events and Operational Data'' was held on January 29--30, 1992 in Annapolis, Maryland. Over 50 participants from the NRC, its contractors, and others participated in the meetings. During the first day, presentations were made by invited speakers to discuss issues in relevant topics. On the second day, discussion groups were held to focus on three areas: risk significance of operational events, industry risk profile and generic concerns, and risk monitoring and risk-based performance indicators. Important considerations identified from the workshop are the following: Improve the Accident Sequence Precursor models and data. Improve the SCSS and NPRDS (e.g., by adding detailed performance information on selected components, by improving narratives on failure causes). Develop risk-based performance indicators. Use risk insights to help focus trending and performance analyses of components, systems, initiators, and sequences. Improve the statistical quality of trending and performance analyses. Flag implications of special conditions (e.g., external events, containment performance) during data studies. Trend common cause and human performance using appropriate models to obtain a better understanding of the impact and causes of failure. Develop a method for producing an industry risk profile

  15. Preparation of nickel and Ni_3Sn nanoparticles via extension of conventional citric acid and ethylene diamine tetraacetic acid mediated sol–gel method

    International Nuclear Information System (INIS)

    Li, Pingyun; Deng, Guodong; Guo, Xiaode; Liu, Hongying; Jiang, Wei; Li, Fengsheng

    2016-01-01

    This work aims to extend the application field of sol–gel process from conventional oxides, carbides, sulfides to metallic nanocrystalline materials. Metallic ions were coordinated with chelating agents of citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) in aqueous solution. Then the solutions were dried at 383 K, resulting in the formation of sol and gel. Heating treatments of dried gels were then carried out with protection of N_2 atmosphere. Ni and Ni_3Sn alloy nanoparticles were obtained by this sol–gel method in the range of 623–823 K. The as-prepared Ni and Ni_3Sn alloy nanoparticles have average grain sizes of 15 and 30 nm, and have face-centred-cubic (fcc) crystalline phase. Our results provide new insight into the application of conventional sol–gel method. - Graphical abstract: Sol–gel method is conventionally applied to prepare oxides, carbides, and sulfides. In this work, the application field of sol–gel method is extended to metallic nanoparticles. By using citric acid (CA) and ethylene diamine tetraacetic acid (EDTA) mediated sol–gel method, metallic Ni (a and c) and Ni_3Sn (b and d) alloy nanoparticles can be prepared when the heating treatments are performed under N_2 protecting atmosphere. The Ni and Ni_3Sn nanoparticles have face-centered-cubic (fcc) crystalline phase and ultrafine grain sizes. Diffraction peaks of (110) superstructure reflection plane of Ni_3Sn nanoparticles can also be observed in Figure b, which can be considered as direct evidence of formation of alloy crystalline phase by performing this sol–gel method. - Highlights: • Ni and Ni_3Sn alloy nanoparticles have been prepared by sol–gel processes. • Citric acid and ethylene diamine tetraacetic acid were applied as chelating agent. • Diffraction peak of superstructure reflection plane of Ni_3Sn was detected by XRD. • A novel strategy for preparation of alloy nanoparticles has been presented.

  16. National implementation of the UNECE convention on long-range transboundary air pollution (effects). Pt. 1. Deposition loads: methods, modelling and mapping results, trends

    Energy Technology Data Exchange (ETDEWEB)

    Gauger, Thomas [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE); Stuttgart Univ. (Germany). Inst. of Navigation; Haenel, Hans-Dieter; Roesemann, Claus [Federal Agricultural Research Centre, Braunschweig (DE). Inst. of Agroecology (FAL-AOE)

    2008-09-15

    The report on the implementation of the UNECE convention on long-range transboundary air pollution Pt.1, deposition loads (methods, modeling and mapping results, trends) includes the following chapters: Introduction, deposition on air pollutants used for the input for critical loads in exceeding calculations, methods applied for mapping total deposition loads, mapping wet deposition, wet deposition mapping results, mapping dry deposition, dry deposition mapping results, cloud and fog mapping results, total deposition mapping results, modeling the air concentration of acidifying components and heavy metals, agricultural emissions of acidifying and eutrophying species.

  17. Calculation of the energy provided by a PV generator. Comparative study: Conventional methods vs. artificial neural networks

    International Nuclear Information System (INIS)

    Almonacid, F.; Rus, C.; Perez-Higueras, P.; Hontoria, L.

    2011-01-01

    The use of photovoltaics for electricity generation purposes has recorded one of the largest increases in the field of renewable energies. The energy production of a grid-connected PV system depends on various factors. In a wide sense, it is considered that the annual energy provided by a generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. However, a range of factors is influencing the expected outcome by reducing the generation of energy. The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network developed by the R and D Group for Solar and Automatic Energy at the University of Jaen. The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study, mainly due to the fact that this method takes also into account some second order effects, such as low irradiance, angular and spectral effects. -- Research highlights: → It is considered that the annual energy provided by a PV generator is directly proportional to the annual radiation incident on the plane of the generator and to the installed nominal power. → A range of factors are influencing the expected outcome by reducing the generation of energy (mismatch losses, dirt and dust, Ohmic losses,.). → The aim of this study is to compare the results of four different methods for estimating the annual energy produced by a PV generator: three of them are classical methods and the fourth one is based on an artificial neural network. → The results obtained shown that the method based on an artificial neural network provides better results than the alternative classical methods in study. While classical methods have only taken into account temperature losses, the method based in

  18. Results of the Level 1 probabilistic risk assessment (PRA) of internal events for heavy water production reactors

    International Nuclear Information System (INIS)

    Tinnes, S.P.; Cramer, D.S.; Logan, V.E.; Topp, S.V.; Smith, J.A.; Brandyberry, M.D.

    1990-01-01

    A full-scope probabilistic risk assessment (PRA) is being performed for the Savannah River site (SRS) production reactors. The Level 1 PRA for the K Reactor has been completed and includes the assessment of reactor systems response to accidents and estimates of the severe core melt frequency (SCMF). The internal events spectrum includes those events related directly to plant systems and safety functions for which transients or failures may initiate an accident. The SRS PRA has three principal objectives: improved understanding of SRS reactor safety issues through discovery and understanding of the mechanisms involved. Improved risk management capability through tools for assessing the safety impact of both current standard operations and proposed revisions. A quantitative measure of the risks posed by SRS reactor operation to employees and the general public, to allow comparison with declared goals and other societal risks

  19. Comparison of conventional, model-based quantitative planar, and quantitative SPECT image processing methods for organ activity estimation using In-111 agents

    International Nuclear Information System (INIS)

    He, Bin; Frey, Eric C

    2006-01-01

    Accurate quantification of organ radionuclide uptake is important for patient-specific dosimetry. The quantitative accuracy from conventional conjugate view methods is limited by overlap of projections from different organs and background activity, and attenuation and scatter. In this work, we propose and validate a quantitative planar (QPlanar) processing method based on maximum likelihood (ML) estimation of organ activities using 3D organ VOIs and a projector that models the image degrading effects. Both a physical phantom experiment and Monte Carlo simulation (MCS) studies were used to evaluate the new method. In these studies, the accuracies and precisions of organ activity estimates for the QPlanar method were compared with those from conventional planar (CPlanar) processing methods with various corrections for scatter, attenuation and organ overlap, and a quantitative SPECT (QSPECT) processing method. Experimental planar and SPECT projections and registered CT data from an RSD Torso phantom were obtained using a GE Millenium VH/Hawkeye system. The MCS data were obtained from the 3D NCAT phantom with organ activity distributions that modelled the uptake of 111 In ibritumomab tiuxetan. The simulations were performed using parameters appropriate for the same system used in the RSD torso phantom experiment. The organ activity estimates obtained from the CPlanar, QPlanar and QSPECT methods from both experiments were compared. From the results of the MCS experiment, even with ideal organ overlap correction and background subtraction, CPlanar methods provided limited quantitative accuracy. The QPlanar method with accurate modelling of the physical factors increased the quantitative accuracy at the cost of requiring estimates of the organ VOIs in 3D. The accuracy of QPlanar approached that of QSPECT, but required much less acquisition and computation time. Similar results were obtained from the physical phantom experiment. We conclude that the QPlanar method, based

  20. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    Science.gov (United States)

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  1. Technical requirements for the ASME PRA standard for nuclear power plant applications

    International Nuclear Information System (INIS)

    Fleming, Karl N.; Bernsen, Sidney A.; Simard, Ronald L.

    2000-01-01

    In 1998 the American Society of Mechanical Engineers (ASME) formed the Committee on Nuclear Risk Management (CNRM) and a Project Team to develop a standard on PRAs for use in risk informed applications. This ASME standard is being developed to help provide an adequate level of quality in PRAs that are being used to support ASME initiatives to risk informed in-service inspection (ISI) and in-service testing (IST) of nuclear power plant components. A related need supported by the industry and the U.S. Nuclear Regulatory Commission is to reduce the level of effort that is being expended in pilot applications of risk informed initiatives to address questions about the sufficiency of quality in the supporting PRA models. The purpose of this paper is to discuss the authors' views on some of the technical issues that were encountered in the effort to develop the ASME PRA standard. Draft 12 of this standard has been issued for comment, and is currently being finalized with the aim of releasing the standard in early 2001. (author)

  2. Human reliability analysis in support of a level 1 PRA for Surry during midloop operations

    International Nuclear Information System (INIS)

    Lin, J.C.; Bley, D.C.; Chu, T.-L.

    2004-01-01

    The objectives of this Level 1 probabilistic risk assessment (PRA) are to evaluate the important accident sequences initiated during midloop operations and to compare the qualitative and quantitative results with those for accidents initiated during power operations. The primary types of human actions analyzed in this study involve the dynamic operator actions and recovery actions that take place during the accident sequence following an initiating event. Two parts of the human actions were analyzed: failure to diagnose and failure to perform the action. The scope of the Level 1 PRA for Surry during midloop operations includes internal, fire, and flood initiating events. The major categories of dynamic operator actions taken during the accident sequence following an initiating event are: providing makeup to the reactor coolant system (RCS), restoring residual heat removal (RHR) cooling, establishing steam generator reflux cooling, establishing primary feed and spill, establishing gravity feed from refueling water storage tank (RWST), establishing high pressure recirculation, establishing recirculation spray, and cross-connecting RWSTs. All categories are not applicable to all initiating events and all plant operating states (POS). (author)

  3. Development of extreme rainfall PRA methodology for sodium-cooled fast reactor

    International Nuclear Information System (INIS)

    Nishino, Hiroyuki; Kurisaka, Kenichi; Yamano, Hidemasa

    2016-01-01

    The objective of this study is to develop a probabilistic risk assessment (PRA) methodology for extreme rainfall with focusing on decay heat removal system of a sodium-cooled fast reactor. For the extreme rainfall, annual excess probability depending on the hazard intensity was statistically estimated based on meteorological data. To identify core damage sequence, event trees were developed by assuming scenarios that structures, systems and components (SSCs) important to safety are flooded with rainwater coming into the buildings through gaps in the doors and the SSCs fail when the level of rainwater on the ground or on the roof of the building becomes higher than thresholds of doors on first floor or on the roof during the rainfall. To estimate the failure probability of the SSCs, the level of water rise was estimated by comparing the difference between precipitation and drainage capacity. By combining annual excess probability and the failure probability of SSCs, the event trees led to quantification of core damage frequency, and therefore the PRA methodology for rainfall was developed. (author)

  4. Review of UCN 5,6 Fire PSA Model based on ANS Fire PRA Standard

    International Nuclear Information System (INIS)

    Yang, Joon Eon; Lee, Yoon Hwan

    2006-12-01

    Recently, under the de-regulation environment, nuclear industry has attempted various approaches to improve the economics of Nuclear Power Plants (NPP). This approach uses the fire risk and performance information to manage the resources effectively and efficiently that are used in the operation of NPP. In fire risk informed/performance-based decision/operation, fire PSA quality is one of the most important things. The nuclear industry and regulatory body of U.S.A have developed a measure to evaluate the quality of fire PSA. ANS (American Nuclear Society) has developed a guidance called 'ANS Fire PRA Methodology Standard'. However, in Korea, there have been no attempts to evaluate the quality of fire PSA model itself. Therefore, we cannot be sure about the quality of fire PSA whether or not the present fire PSA model can be used for the risk-informed applications such as mentioned above. We can say that the evaluation of fire PSA model quality is the basis for the fire risk informed/performance-based decision/operation. In this report, we have evaluated the quality of fire PSA model for Ulchin 5 and 6 units based on the ANS Fire PRA Standard. We, also, have derived what items are to be improved to upgrade the quality of fire PSA model and how it can be improved. This report can be used as the base of the fire risk informed/performance-based decision/operation work in Korea

  5. Clinical comparative study between the use of lasers and conventional methods of diagnosis and treatment in deciduous teeth with presence of carious lesion

    International Nuclear Information System (INIS)

    Pulga, Fabiane Galvao

    2001-01-01

    The aim of this work was to evaluate the efficiency of deciduous tooth cavity preparation by the Er:YAG laser in comparison with the conventional burr rotary instrument. Besides, we have used the laser fluorescence technique (DIAGNOdent equipment) for diagnosis and compared it to the usual tactile and visual examination as well as X-ray diagnosis. For this purpose, 20 chronic occlusal carious deciduous molar teeth from children with the ages between 5 to 10 years old were selected. Selection was ma de according to visual inspection, X-ray periapical image and measures of the DIAGNOdent. For treatment the teeth were divided in two groups, 10 to be treated by the Er:YAG laser and 10 with conventional burr. For enamel, the laser energy used was in the interval from 200 to 300 mJ; for the dentine the range was from 100 mJ to 200 mJ. In both cases, the laser frequency was in the range from 2 to 4 Hz. The results have shown that the laser treatment was more accepted by the children than the conventional burro Clinical evaluation of the cavity preparation indicates that the Er:YAG laser treatment is recommend. The DIAGNOdent evaluation method was very effective for diagnosis of carious tissue for initial detection. After successful removal of the carious tissue, confirmed by visual inspection, the DIAGNOdent evaluation method was only effective for the treatment with conventional burro For evaluation of the tooth after cavity preparation with the Er:YAG laser, the measurements oscillate covering the full range of the equipment. Therefore, the use of the DIAGNOdent equipment is indicated only for initial caries diagnosis. (author)

  6. Medical Updates Number 5 to the International Space Station Probability Risk Assessment (PRA) Model Using the Integrated Medical Model

    Science.gov (United States)

    Butler, Doug; Bauman, David; Johnson-Throop, Kathy

    2011-01-01

    The Integrated Medical Model (IMM) Project has been developing a probabilistic risk assessment tool, the IMM, to help evaluate in-flight crew health needs and impacts to the mission due to medical events. This package is a follow-up to a data package provided in June 2009. The IMM currently represents 83 medical conditions and associated ISS resources required to mitigate medical events. IMM end state forecasts relevant to the ISS PRA model include evacuation (EVAC) and loss of crew life (LOCL). The current version of the IMM provides the basis for the operational version of IMM expected in the January 2011 timeframe. The objectives of this data package are: 1. To provide a preliminary understanding of medical risk data used to update the ISS PRA Model. The IMM has had limited validation and an initial characterization of maturity has been completed using NASA STD 7009 Standard for Models and Simulation. The IMM has been internally validated by IMM personnel but has not been validated by an independent body external to the IMM Project. 2. To support a continued dialogue between the ISS PRA and IMM teams. To ensure accurate data interpretation, and that IMM output format and content meets the needs of the ISS Risk Management Office and ISS PRA Model, periodic discussions are anticipated between the risk teams. 3. To help assess the differences between the current ISS PRA and IMM medical risk forecasts of EVAC and LOCL. Follow-on activities are anticipated based on the differences between the current ISS PRA medical risk data and the latest medical risk data produced by IMM.

  7. Method for Derivatization and Detection of Chemical Weapons Convention Related Sulfur Chlorides via Electrophilic Addition with 3-Hexyne.

    Science.gov (United States)

    Goud, D Raghavender; Pardasani, Deepak; Purohit, Ajay Kumar; Tak, Vijay; Dubey, Devendra Kumar

    2015-07-07

    Sulfur monochloride (S2Cl2) and sulfur dichloride (SCl2) are important precursors of the extremely toxic chemical warfare agent sulfur mustard and classified, respectively, into schedule 3.B.12 and 3.B.13 of the Chemical Weapons Convention (CWC). Hence, their detection and identification is of vital importance for verification of CWC. These chemicals are difficult to detect directly using chromatographic techniques as they decompose and do not elute. Until now, the use of gas chromatographic approaches to follow the derivatized sulfur chlorides is not reported in the literature. The electrophilic addition reaction of sulfur monochloride and sulfur dichloride toward 3-hexyne was explored for the development of a novel derivatization protocol, and the products were subjected to gas chromatography-mass spectrometric (GC-MS) analysis. Among various unsaturated reagents like alkenes and alkynes, symmetrical alkyne 3-hexyne was optimized to be the suitable derivatizing agent for these analytes. Acetonitrile was found to be the suitable solvent for the derivatization reaction. The sample preparation protocol for the identification of these analytes from hexane spiked with petrol matrix was also optimized. Liquid-liquid extraction followed by derivatization was employed for the identification of these analytes from petrol matrix. Under the established conditions, the detection and quantification limits are 2.6 μg/mL, 8.6 μg/mL for S2Cl2 and 2.3 μg/mL, 7.7 μg/mL for SCl2, respectively, in selected ion monitoring (SIM) mode. The calibration curve had a linear relationship with y = 0.022x - 0.331 and r(2) = 0.992 for the working range of 10 to 500 μg/mL for S2Cl2 and y = 0.007x - 0.064 and r(2) = 0.991 for the working range of 10 to 100 μg/mL for SCl2, respectively. The intraday RSDs were between 4.80 to 6.41%, 2.73 to 6.44% and interday RSDs were between 2.20 to 7.25% and 2.34 to 5.95% for S2Cl2 and SCl2, respectively.

  8. Effectiveness of two conventional methods for seismic retrofit of steel and RC moment resisting frames based on damage control criteria

    Science.gov (United States)

    Beheshti Aval, Seyed Bahram; Kouhestani, Hamed Sadegh; Mottaghi, Lida

    2017-07-01

    This study investigates the efficiency of two types of rehabilitation methods based on economic justification that can lead to logical decision making between the retrofitting schemes. Among various rehabilitation methods, concentric chevron bracing (CCB) and cylindrical friction damper (CFD) were selected. The performance assessment procedure of the frames is divided into two distinct phases. First, the limit state probabilities of the structures before and after rehabilitation are investigated. In the second phase, the seismic risk of structures in terms of life safety and financial losses (decision variables) using the recently published FEMA P58 methodology is evaluated. The results show that the proposed retrofitting methods improve the serviceability and life safety performance levels of steel and RC structures at different rates when subjected to earthquake loads. Moreover, these procedures reveal that financial losses are greatly decreased, and were more tangible by the application of CFD rather than using CCB. Although using both retrofitting methods reduced damage state probabilities, incorporation of a site-specific seismic hazard curve to evaluate mean annual occurrence frequency at the collapse prevention limit state caused unexpected results to be obtained. Contrary to CFD, the collapse probability of the structures retrofitted with CCB increased when compared with the primary structures.

  9. A comparison between the conventional manual ROI method and an automatic algorithm for semiquantitative analysis of SPECT studies

    International Nuclear Information System (INIS)

    Pagan, L; Novi, B; Guidarelli, G; Tranfaglia, C; Galli, S; Lucchi, G; Fagioli, G

    2011-01-01

    In this study, the performance of a free software for automatic segmentation of striatal SPECT brain studies (BasGanV2 - www.aimn.it) and a standard manual Region Of Interest (ROI) method were compared. The anthropomorphic Alderson RSD phantom, filled with solutions at different concentration of 123 I-FP-CIT with Caudate-Putamen to Background ratios between 1 and 8.7 and Caudate to Putamen ratios between 1 and 2, was imaged on a Philips-Irix triple head gamma camera. Images were reconstructed using filtered back-projection and processed with both BasGanV2, that provides normalized striatal uptake values on volumetric anatomical ROIs, and a manual method, based on average counts per voxel in ROIs drawn in a three-slice section. Caudate-Putamen/Background and Caudate/Putamen ratios obtained with the two methods were compared with true experimental ratios. Good correlation was found for each method; BasGanV2, however, has higher R index (BasGan R mean = 0.95, p mean = 0.89, p 123 I-FP-CIT SPECT data with, moreover, the advantage of the availability of a control subject's database.

  10. Comparative evaluation of the efficacy of chemomechanical caries removal agent (Papacarie and conventional method of caries removal: An in vitro study

    Directory of Open Access Journals (Sweden)

    Jawa D

    2010-06-01

    Full Text Available Painless dentistry, minimal intervention and thus giving comfort, relief and solace and instill positive attitude toward dental treatments, are some of the factors justifying the specialty of pediatric dentistry. Thus, this in vitro study was undertaken to compare the efficacy of a new chemomechanical caries removal agent, Papacarie (Formula and Acao, with conventional slow-speed rotary instrument (bur. Papacarie is a new formulation and has the main active ingredient papain, an endoprotein with bactericidal, bacteriostatic and anti-inflammatory actions. Twenty extracted human molar teeth with deep dentine caries and no enamel coverage were selected for the study. After the preparation of the teeth and removal of the caries with the respective methods, they were decalcified, dehydrated and embedded in paraffin blocks for histologic studies. Serial sections of 5 μm thickness were examined for the presence of bacteria under light microscope. Though complete removal of caries was achieved significantly in both the methods, there was less marked destruction of dentinal tubules in chemomechanical caries removal method by Papacarie. Thus, Papacarie is recommended as an efficient, easy to perform, comfortable and less destructive solution for the patient seeking an alternative to the conventional method.

  11. Ex Vivo Comparison of Mtwo and RaCe Rotary File Systems in Root Canal Deviation: One File Only versus the Conventional Method.

    Science.gov (United States)

    Aminsobhani, Mohsen; Razmi, Hasan; Nozari, Solmaz

    2015-07-01

    Cleaning and shaping of the root canal system is an important step in endodontic therapy. New instruments incorporate new preparation techniques that can improve the efficacy of cleaning and shaping. The aim of this study was to compare the efficacy of Mtwo and RaCe rotary file systems in straightening the canal curvature using only one file or the conventional method. Sixty mesial roots of extracted human mandibular molars were prepared by RaCe and Mtwo nickel-titanium (NiTi) rotary files using the conventional and only one rotary file methods. The working length was 18 mm and the curvatures of the root canals were between 15-45°. By superimposing x-ray images before and after the instrumentation, deviation of the canals was assessed using Adobe Photoshop CS3 software. Preparation time was recorded. Data were analyzed using three-way ANOVA and Tukey's post hoc test. There were no significant differences between RaCe and Mtwo or between the two root canal preparation methods in root canal deviation in buccolingual and mesiodistal radiographs (P>0.05). Changes of root canal curvature in >35° subgroups were significantly more than in other subgroups with smaller canal curvatures. Preparation time was shorter in one file only technique. According to the results, the two rotary systems and the two root canal preparation methods had equal efficacy in straightening the canals; but the preparation time was shorter in one file only group.

  12. Efficacy of adding the Kinesio Taping method to guideline-endorsed conventional physiotherapy in patients with chronic nonspecific low back pain: a randomised controlled trial.

    Science.gov (United States)

    Added, Marco Aurélio Nemitalla; Costa, Leonardo Oliveira Pena; Fukuda, Thiago Yukio; de Freitas, Diego Galace; Salomão, Evelyn Cassia; Monteiro, Renan Lima; Costa, Lucíola da Cunha Menezes

    2013-10-24

    Chronic nonspecific low back pain is a significant health condition with high prevalence worldwide and it is associated with enormous costs to society. Clinical practice guidelines show that many interventions are available to treat patients with chronic low back pain, but the vast majority of these interventions have a modest effect in reducing pain and disability. An intervention that has been widespread in recent years is the use of elastic bandages called Kinesio Taping. Although Kinesio Taping has been used extensively in clinical practice, current evidence does not support the use of this intervention; however these conclusions are based on a small number of underpowered studies. Therefore, questions remain about the effectiveness of the Kinesio Taping method as an additional treatment to interventions, such as conventional physiotherapy, that have already been recommended by the current clinical practice guidelines in robust and high-quality randomised controlled trials. We aim to determine the effectiveness of the addition of the use of Kinesio Taping in patients with chronic nonspecific low back pain who receive guideline-endorsed conventional physiotherapy. One hundred and forty-eight patients will be randomly allocated to receive either conventional physiotherapy, which consists of a combination of manual therapy techniques, general exercises, and specific stabilisation exercises (Guideline-Endorsed Conventional Physiotherapy Group) or to receive conventional physiotherapy with the addition of Kinesio Taping to the lumbar spine (Conventional Physiotherapy plus Kinesio Taping Group) over a period of 5 weeks (10 sessions of treatment). Clinical outcomes (pain intensity, disability and global perceived effect) will be collected at baseline and at 5 weeks, 3 months, and 6 months after randomisation. We will also collect satisfaction with care and adverse effects after treatment. Data will be collected by a blinded assessor. All statistical analysis will be

  13. Analysis of Longitudinal Studies With Repeated Outcome Measures: Adjusting for Time-Dependent Confounding Using Conventional Methods.

    Science.gov (United States)

    Keogh, Ruth H; Daniel, Rhian M; VanderWeele, Tyler J; Vansteelandt, Stijn

    2018-05-01

    Estimation of causal effects of time-varying exposures using longitudinal data is a common problem in epidemiology. When there are time-varying confounders, which may include past outcomes, affected by prior exposure, standard regression methods can lead to bias. Methods such as inverse probability weighted estimation of marginal structural models have been developed to address this problem. However, in this paper we show how standard regression methods can be used, even in the presence of time-dependent confounding, to estimate the total effect of an exposure on a subsequent outcome by controlling appropriately for prior exposures, outcomes, and time-varying covariates. We refer to the resulting estimation approach as sequential conditional mean models (SCMMs), which can be fitted using generalized estimating equations. We outline this approach and describe how including propensity score adjustment is advantageous. We compare the causal effects being estimated using SCMMs and marginal structural models, and we compare the two approaches using simulations. SCMMs enable more precise inferences, with greater robustness against model misspecification via propensity score adjustment, and easily accommodate continuous exposures and interactions. A new test for direct effects of past exposures on a subsequent outcome is described.

  14. Comparing personal alpha dosimetry with the conventional area monitoring-time weighting methods of exposure estimation: a Canadian assessment

    International Nuclear Information System (INIS)

    Balint, A.B.; Viljoen, J.

    1988-01-01

    An experimental personal alpha dosimetry program for monitoring exposures of uranium mining facility workers in Canada has been completed. All licenced operating mining facilities were participating. Dosimetry techniques, description of dosimeters used by licences, performance and problems associated with the implementation of the programme as well as technical and administrative advantages and difficulties experienced are discussed. Area monitoring-time weighting methods used and results obtained to determine individual radon and thoron daughter exposure and exposure results generated by using dosimeters are assessed and compared

  15. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    Science.gov (United States)

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  16. Comparison of Vitek Matrix-assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry Versus Conventional Methods in Candida Identification.

    Science.gov (United States)

    Keçeli, Sema Aşkın; Dündar, Devrim; Tamer, Gülden Sönmez

    2016-02-01

    Candida species are generally identified by conventional methods such as germ tube or morphological appearance on corn meal agar, biochemical methods using API kits and molecular biological methods. Alternative to these methods, rapid and accurate identification methods of microorganisms called matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDİ-TOF MS) has recently been described. In this study, Candida identification results by API Candida kit, API 20C AUX kit and identifications on corn meal agar (CMA) are compared with the results obtained on Vitek-MS. All results were confirmed by sequencing internal transcribed spacer (ITS) regions of rDNA. Totally, 97 Candida strains were identified by germ tube test, CMA, API and Vitek-MS. Vitek-MS results were compatible with 74.2 % of API 20C AUX and 81.4 % of CMA results. The difference between the results of API Candida and API 20C AUX was detected. The ratio of discrepancy between Vitek-MS and API 20C AUX was 25.8 %. Candida species mostly identified as C. famata or C. tropicalis by and not compatible with API kits were identified as C. albicans by Vitek-MS. Sixteen Candida species having discrepant results with Vitek-MS, API or CMA were randomly chosen, and ITS sequence analysis was performed. The results of sequencing were compatible 56.2 % with API 20C AUX, 50 % with CMA and 93.7 % with Vitek-MS. When compared with conventional identification methods, MS results are more reliable and rapid for Candida identification. MS system may be used as routine identification method in clinical microbiology laboratories.

  17. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  18. Prediction of postoperative pulmonary function. Preliminary comparison of single-breath dual-energy xenon CT with three conventional methods

    International Nuclear Information System (INIS)

    Yanagita, Hisami; Honda, Norinari; Nakayama, Mitsuo

    2013-01-01

    The purpose of this study was to assess the use of xenon ventilation maps (Xe-images) for predicting postoperative pulmonary function. After study approval by the institutional review board, written informed consent was obtained from 30 patients with lung tumors who underwent pre- and postoperative spirometry, pulmonary perfusion single photon emission computed tomography (SPECT) and dual-energy CT (80 kV and 140 kV/Sn) after single-breath inspiration of 35% xenon. Xe-images were calculated by three-material decomposition. Sum of pixel values of the part to be resected (A) and of the whole lung (B) on Xe-images or lung perfusion SPECT, and volumes or the number of segments of the part to be resected (A) and of the whole lung (B) on Xe-images were enumerated, respectively. We multiplied (1-A/B) by each preoperative value from spirometry for prediction. Predictions by each of the four methods were compared with postoperative values. Predicted values for vital capacity (VC), forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV 1 ) by the four methods regressed significantly with measured values (R 2 =0.56-0.77, p 1 with accuracy comparable to that of CT volumetry. (author)

  19. Integrated functional modeling method for NPP plant DiD risk monitor and its application for conventional PWR

    Energy Technology Data Exchange (ETDEWEB)

    Yoshikawa, Hidekazu; Yang, Ming; Zhang, Zhijian [Harbin Engineering University, Harbin (China)

    2014-08-15

    The development of a new risk monitor system is introduced in this paper, which can be applied not only to severe accident prevention in daily operation but also to serve as to mitigate the radiological hazard just after severe accident happens and long term management of post-severe accident consequences. The summary of the fundamental method is summarized on how to configure the Plant Defense in-Depth (Did) Risk Monitor by object-oriented software system based on functional modeling approach. Following the authors??preceding preliminary study for AP1000, the way of realizing the proposed method of configuring the plant Did risk monitor was investigated for a safety-enhanced Japanese PWR design to meet with the tight anti-severe accident requirements set by national regulation in Japan after Fukushima Daiichi accident. The result of this example practice of the presented preliminary study for Japanese PWR was for the level 4 of the Did in case of beyond design basis accident, that is, loss of all AC power + RCP seal LOCA, against the former case of AP1000 for level 3 Did in case of large LOCA.

  20. Clinical value of FDG hybrid-PET in staging and restaging of malignant lymphoma. Compared with conventional diagnostic methods

    International Nuclear Information System (INIS)

    Pichler, R.; Maschek, W.; Hatzl-Griesenhofer, M.; Huber, H.; Wimmer, G.; Wahl, G.; Fridrik, M.

    2000-01-01

    Aim of the present retrospective study was to validate the clinical value of F-18-FDG PET imaging in lymphoma patients with a dual head camera modified for coincidence detection. Staging before and after oncological treatment was compared with a conservative diagnostic approach. Methods: 48 patients (28 non-Hodgkin lymphoma, 20 Hodgkin's disease) received FDG-Hybrid-PET scans. Pretherapeutic staging was realized in 28 patients, 9 of them had control studies after they had completed therapy. Totally 29 persons were examined for posttherapeutic restaging. Computed tomography imaging and lymph node sonography was performed in all cases. Results were validated by clinical follow-up, in three cases a recidive was proven by biopsy. Results: CT and ultrasound detected 77 lesions in 28 patients compared with 100 visualized by PET, but this difference in pretherapeutic staging did not reach significance at p>0.05 by Fisher's t-test. Hybrid-PET obtained a sensitivity of 93%, a specifity of 79%, a positive of 82% and a negative predictive value of 92% for detection of residual disease. The values for CT+US were 87%, 64%, 72% and 88% respectively. Conclusion: FDG Hybrid-PET is as or even more accurate than standard morphologic diagnostic methods for prestaging in malignant lymphoma. Additionally, there is a substancial benefit for therapy monitoring of residual disease using coincidence detection PET with a 3/4-inch crystal gamma camera. (orig.) [de

  1. Comparison of conventional straight and swan-neck straight catheters inserted by percutaneous method for continuous ambulatory peritoneal dialysis: a single-center study.

    Science.gov (United States)

    Singh, Shivendra; Prakash, Jai; Singh, R G; Dole, P K; Pant, Pragya

    2015-10-01

    To evaluate the incidence of mechanical and infectious complications of conventional straight catheter (SC) versus swan-neck straight catheter (SNSC) implanted by percutaneous method. We retrospectively analyzed 45 catheter insertions being done by percutaneous method from January 1, 2011, to May 31, 2014. SC was inserted in 24 patients, and SNSC was inserted in 21 patients. Baseline characteristics for the two groups were similar with respect to age, sex and diabetic nephropathy as the cause for end-stage renal disease. Incidence of mechanical and infectious complications in SNSC group was found to be low as compared to the SC group and was statistically significant (1 in 11.6 patient months vs. 1 in 14.4 patient months, p = 0.02). Catheter migration was found to be the most common mechanical complication (20 %), and peritonitis was found to be the most common infectious complication in conventional SC group (27 episodes in 420 patient months vs. 11 episodes in 333 patient months, p = 0.03). The incidence of exit site and tunnel infection rates revealed no difference between the groups. SNSC insertion by percutaneous method is associated with low mechanical and infectious complications.

  2. Analysis of reverse heat transfer for conventional and optimized lubri-cooling methods during tangential surface grinding of ABNT 1020 steel

    Directory of Open Access Journals (Sweden)

    Henrique Cotait Razuk

    Full Text Available Abstract A numerical thermal model was developed to evaluate the heat flux which is conducted to a rectangular workpiece of steel plate ABNT 1020, thus making it possible to compute the maximum temperature in the grinding surface, taking into account the rectangular distribution of heat flux, the thermal properties of the grinding wheel conventional Al2O3, the piece to be machined and the lubri-refrigerating fluid. The finite volume method was employed for the discretization of the direct thermal problem from the heat diffusion equation associated with the two-dimensional problem of heat conduction in transient regime. The inverse thermal problem was solved by the Golden Section technique. The thermal flux, when compared to the conventional technique of method of application fluid, was reduced by 84.0% in the practices performed with cutting depth of 30µm, at 74.0% in practices with cutting depth of 45µm and 61.2% in the aggressive practices of 60µm, thus demonstrating the applicability of the optimized method for fluid application.

  3. Assessment of adiposity in psoriatic patients by dual energy X-ray absorptiometry compared to conventional methods*

    Science.gov (United States)

    Diniz, Michelle dos Santos; Bavoso, Nádia Couto; Kakehasi, Adriana Maria; Lauria, Márcio Weissheimer; Soares, Maria Marta Sarquis; Machado-Pinto, Jackson

    2016-01-01

    BACKGROUND Obesity is considered a chronic low-grade inflammatory disease that shares mediators of inflammation with psoriasis, such as TNF-α and IL-6. The relationship between these two conditions involves factors such as predisposition and response to therapy, in addition to an association with cardiovascular disease. OBJECTIVES The aim of the present study was to investigate the prevalence of adiposity as determined by body mass index (BMI), waist circumference (WC), and dual energy X-ray absorptiometry (DXA) evaluation in patients with psoriasis. METHODS BMI, WC and body composition by DXA were measured in 42 psoriatic patients without joint complaints and in 41 control patients using standard procedures. In the comparison between cases and controls, we used Pearson’s Χ2 test or Fisher’s exact test, and the nonparametric Mann-Whitney test. The difference between the diverse classification methods for obesity was evaluated using McNemar’s test. To test the level of agreement between those variables, we used the weighted kappa coefficient. RESULTS There was no difference in the prevalence of obesity among cases and controls. Both BMI and WC had low agreement with measures of body fat evaluated by DXA. With the use of DXA scanning, prevalence of overweight and obesity in patients with psoriasis was 83.3%, which constitutes a strong evidence of the need for intervention on this metabolic parameter. CONCLUSION Dual energy X-ray absorptiometry was more capable of identifying obesity compared with BMI and WC both in psoriatic and control patients. PMID:27192512

  4. A study on evaluating validity of SNR calculation using a conventional two region method in MR images applied a multichannel coil and parallel imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Kwan Woo; Son, Soon Yong [Dept. of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Min, Jung Whan [Dept. of Radiological Technology, Shingu University, Sungnam (Korea, Republic of); Kwon, Kyung Tae [Dept. of Radiological Technology, Dongnam Health University, Suwon (Korea, Republic of); Yoo, Beong Gyu; Lee, Jong Seok [Dept. of Radiotechnology, Wonkwang Health Science University, Iksan (Korea, Republic of)

    2015-12-15

    The purpose of this study was to investigate the problems of a signal to noise ratio measurement using a two region measurement method that is conventionally used when using a multi-channel coil and a parallel imaging technique. As a research method, after calculating the standard SNR using a single channel head coil of which coil satisfies three preconditions when using a two region measurement method, we made comparisons and evaluations after calculating an SNR by using a two region measurement method of which method is problematic because it is used without considering the methods recommended by reputable organizations and the preconditions at the time of using a multi-channel coil and a parallel imaging technique. We found that a two region measurement method using a multi-channel coil and a parallel imaging technique shows the highest relative standard deviation, and thus shows a low degree of precision. In addition, we found out that the difference of SNR according to ROI location was very high, and thus a spatial noise distribution was not uniform. Also, 95% confidence interval through Blend-Altman plot is the widest, and thus the conformity degree with a two region measurement method using the standard single channel head coil is low. By directly comparing an AAPM method, which serves as a standard of a performance evaluation test of a magnetic resonance imaging device under the same image acquisition conditions, an NEMA method which can accurately determine the noise level in a signal region and the methods recommended by manufacturers of a magnetic resonance imaging device, there is a significance in that we quantitatively verified the inaccurate problems of a signal to noise ratio using a two region measurement method when using a multi-channel coil and a parallel imaging technique of which method does not satisfy the preconditions that researchers could overlook.

  5. A study on modeling nitrogen dioxide concentrations using land-use regression and conventionally used exposure assessment methods

    Science.gov (United States)

    Choi, Giehae; Bell, Michelle L.; Lee, Jong-Tae

    2017-04-01

    The land-use regression (LUR) approach to estimate the levels of ambient air pollutants is becoming popular due to its high validity in predicting small-area variations. However, only a few studies have been conducted in Asian countries, and much less research has been conducted on comparing the performances and applied estimates of different exposure assessments including LUR. The main objectives of the current study were to conduct nitrogen dioxide (NO2) exposure assessment with four methods including LUR in the Republic of Korea, to compare the model performances, and to estimate the empirical NO2 exposures of a cohort. The study population was defined as the year 2010 participants of a government-supported cohort established for bio-monitoring in Ulsan, Republic of Korea. The annual ambient NO2 exposures of the 969 study participants were estimated with LUR, nearest station, inverse distance weighting, and ordinary kriging. Modeling was based on the annual NO2 average, traffic-related data, land-use data, and altitude of the 13 regularly monitored stations. The final LUR model indicated that area of transportation, distance to residential area, and area of wetland were important predictors of NO2. The LUR model explained 85.8% of the variation observed in the 13 monitoring stations of the year 2009. The LUR model outperformed the others based on leave-one out cross-validation comparing the correlations and root-mean square error. All NO2 estimates ranged from 11.3-18.0 ppb, with that of LUR having the widest range. The NO2 exposure levels of the residents differed by demographics. However, the average was below the national annual guidelines of the Republic of Korea (30 ppb). The LUR models showed high performances in an industrial city in the Republic of Korea, despite the small sample size and limited data. Our findings suggest that the LUR method may be useful in similar settings in Asian countries where the target region is small and availability of data is

  6. Evaluation of conventional and alternative monitoring methods for a recreational marine beach with nonpoint source of fecal contamination.

    Science.gov (United States)

    Shibata, Tomoyuki; Solo-Gabriele, Helena M; Sinigalliano, Christopher D; Gidley, Maribeth L; Plano, Lisa R W; Fleisher, Jay M; Wang, John D; Elmir, Samir M; He, Guoqing; Wright, Mary E; Abdelzaher, Amir M; Ortega, Cristina; Wanless, David; Garza, Anna C; Kish, Jonathan; Scott, Troy; Hollenbeck, Julie; Backer, Lorraine C; Fleming, Lora E

    2010-11-01

    The objectives of this work were to compare enterococci (ENT) measurements based on the membrane filter, ENT(MF) with alternatives that can provide faster results including alternative enterococci methods (e.g., chromogenic substrate (CS), and quantitative polymerase chain reaction (qPCR)), and results from regression models based upon environmental parameters that can be measured in real-time. ENT(MF) were also compared to source tracking markers (Staphylococcus aureus, Bacteroidales human and dog markers, and Catellicoccus gull marker) in an effort to interpret the variability of the signal. Results showed that concentrations of enterococci based upon MF (turbidity and tidal height. Enterococci by MF and CS were also inversely correlated with solar radiation but enterococci by qPCR was not. The regression model based on environmental variables provided fair qualitative predictions of enterococci by MF in real-time, for daily geometric mean levels, but not for individual samples. Overall, ENT(MF) was not significantly correlated with source tracking markers with the exception of samples collected during one storm event. The inability of the regression model to predict ENT(MF) levels for individual samples is likely due to the different sources of ENT impacting the beach at any given time, making it particularly difficult to to predict short-term variability of ENT(MF) for environmental parameters.

  7. Comparison of in-situ gamma ray spectrometry measurements with conventional methods in determination natural and artificial nuclides in soil

    International Nuclear Information System (INIS)

    Al-Masri, M. S.; Doubal, A. W.

    2010-12-01

    Two nuclear analytical techniques (In-Situ Gamma ray spectrometry and laboratory gamma ray spectrometry) for determination of natural and artificial radionuclides in soil have been validated. The first technique depends on determination of radioactivity content of representative samples of the studied soil after laboratory preparation, while the second technique is based on direct determination of radioactivity content of soil using in-situ gamma-ray spectrometer. Analytical validation parameter such as detection limits, repeatability, reproducibility in addition to measurement uncertainties were estimated and compared for both techniques. Comparison results have shown that the determination of radioactivity in soil should apply the two techniques together where each of techniques is characterized by its low detection limit and uncertainty suitable for defined application of measurement. Radioactive isotopes in various locations were determined using the two methods by measuring 40 k, 238 U,and 137 Cs. The results showed that there are differences in attenuation factors due to soil moisture content differences; wet weight corrections should be applied when the two techniques are compared. (author)

  8. Preparation and study of tramadol imprinted micro-and nanoparticles by precipitation polymerization: microwave irradiation and conventional heating method.

    Science.gov (United States)

    Seifi, Mahmoud; Hassanpour Moghadam, Maryam; Hadizadeh, Farzin; Ali-Asgari, Safa; Aboli, Jafar; Mohajeri, Seyed Ahmad

    2014-08-25

    In the present work a series of tramadole imprinted micro- and nanoparticles were prepared and study their recognition properties. Methacrylic acid (MAA), as a functional monomer, ethylene glycol dimethacrylate (EGDMA) as a cross-linker and different solvents (chloroform, toluene and acetonitrile (ACN)) were used for the preparation of molecularly imprinted polymers (MIPs) and non-imprinted polymers (NIPs). Several factors such as template/monomer molar ratio, volume of polymerization solvent, total monomers/solvent volume ratio, polymerization condition (heating or microwave irradiation) were also investigated. Particle size of the polymers, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), rebinding, selectivity tests and release study were applied for evaluation of the polymers. The optimized polymers with smaller particle size and superior binding properties were obtained in acetonitrile under heating method. MIPA4 with a size of 42.6 nm and a binding factor (BF) of 6.79 was selected for selectivity and release tests. The polymerization was not successful in acetonitrile and toluene under microwave irradiation. The MIPA4 could selectively adsorb tramadol, compared to imipramine, naltrexone and gabapentin. The data showed that tramadol release from MIPA4 was significantly slower than that of its non-imprinted polymer. Therefore, MIP nanoparticles with high selectivity, binding capacity and ability to control tramadol release could be obtained in precipitation polymerization with optimized condition. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Clinical and anatomic pathology effects of serial blood sampling in rat toxicology studies, using conventional or microsampling methods.

    Science.gov (United States)

    Caron, Alexis; Lelong, Christine; Bartels, T; Dorchies, O; Gury, T; Chalier, Catherine; Benning, Véronique

    2015-08-01

    As a general practice in rodent toxicology studies, satellite animals are used for toxicokinetic determinations, because of the potential impact of serial blood sampling on toxicological endpoints. Besides toxicological and toxicokinetic determinations, blood samples obtained longitudinally from a same animal may be used for the assessment of additional parameters (e.g., metabolism, pharmacodynamics, safety biomarkers) to maximize information that can be deduced from rodents. We investigated whether removal of up to 6 × 200 μL of blood over 24h can be applied in GLP rat toxicology studies without affecting the scientific outcome. 8 week-old female rats (200-300 g) were dosed for up to 1 month with a standard vehicle and subjected or not (controls) to serial blood sampling for sham toxicokinetic/ancillary determinations, using miniaturized methods allowing collection of 6 × 50, 100 or 200 μL over 24h. In-life endpoints, clinical pathology parameters and histopathology of organs sensitive to blood volume reduction were evaluated at several time points after completion of sampling. In sampled rats, minimal and reversible changes in red blood cell mass (maximally 15%) and subtle variations in liver enzymes, fibrinogen and neutrophils were not associated with any organ/tissue macroscopic or microscopic correlate. Serial blood sampling (up to 6 × 200 μL over 24h) is compatible with the assessment of standard toxicity endpoints in adult rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Comparative evaluation of optical methods and conventional isotope techniques for the detection of insulin receptors in heterogenous cell systems

    International Nuclear Information System (INIS)

    Thun, C.

    1984-01-01

    The findings of studies using radioactively labelled (I-125) insulin to characterise its binding to various heterogenous cell systems had led to a classification of the relevant receptors with those of high affinity and low capacity or vice versa. This, in turn, raised questions as to the binding properties of each individual cell or cell material of a heterogenous nature. Apparently homogenous (lymphocytes) and heterogenous (blood and islet cells) cell populations were investigated on the basis of various techniques for the separate evaluation of individual cells, which were cytofluorometry using FITC insulin and the analysis of gold insulin under the electron microscope. For the association kinetics and equilibration analysis or affinity and receptor quantity a radioactive tracer and light microscope were used. Insulin was shown to bind to erythrocytes, reticulocytes, monocytes and lymphocytes and this result finds confirmation in the relevant literature. Furthermore, binding parameters could be determined for isolated islet cells. Cytofluorometry pointed to the fact that the insulin receptors of an apparently homogenous cell system differed in affinity and number and permitted the use of a multiple parameter procedure. Thus, it holds out promise as a method to be routinely used in the clinical diagnosis of binding parameters, without requiring previous separation procedures that are complicated or involve a loss of material. Transmission electron microscopy permitted conclusions to be drawn as to the type of cell to which insulin is attached. Owing to the use of gold insulin it was possible to throw some light on the factors determining the fate of membrane-bound insulin during its uptake into the cell. (TRV) [de

  11. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

    Directory of Open Access Journals (Sweden)

    J.A. Khan

    2013-09-01

    Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four

  12. A new quantitative index of lobar air trapping in chronic obstructive pulmonary disease (COPD): Comparison with conventional methods

    Energy Technology Data Exchange (ETDEWEB)

    Nagatani, Yukihiro, E-mail: yatsushi@belle.shiga-med.ac.jp [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Murata, Kiyoshi; Takahashi, Masashi; Nitta, Norihisa [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Nakano, Yasutaka [Division of Respiratory Medicine, Department of Internal Medicine, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Sonoda, Akinaga; Otani, Hideji [Department of Radiology, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Okabe, Hidetoshi [Department of Clinical Laboratory, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Ogawa, Emiko [Health Administration Center, Shiga University of Medical Science, Seta-tsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2015-05-15

    Highlights: • In the total lung field, AVI had excellent correlation with FEV{sub 1}/FVC. • AVI showed differences between three groups classified by the COPD severity. • In a lobe-based analysis, AVI did not mostly correlated with volume decrease ratio. • In a lobe-based analysis, coefficient of variation was relatively small in AVI. • In some lobes, AVI associated with the COPD severity despite respiratory level. - Abstract: Purpose: To determine the usefulness of newly-proposed index (attenuation–volume index, AVI: increase in mean value of lung attenuation (MVLA) divided by volume decrease ratio (VDR)) for quantitative assessment of lobar air trapping (LAT) using expiratory/inspiratory (E/I) computed tomography (CT) by minimizing influence of respiratory level. Materials and methods: Institutional review board approved study protocol. Twenty-one moderate or severe COPD (group A), 16 mild COPD (group B) and 26 normal volunteers (group C) underwent both E/I scans via 320-row CT and pulmonary functional test (PFT). Volume image data were automatically segmented into six lung lobes with minimal manual intervention. AVI, pixel index (PI), air trapping ratio (ATR) and relative volume change (RVC{sub 860–950}) were calculated in total lung (TL) and each lobe. Four indices in TL were correlated with both PFT result and VDR and those in TL and each lobe were compared between three groups. Results: Similar to ATR, AVI correlated with both FEV{sub 1}/FVC (r = 0.772, p < 0.01) and RV/TLC (r = −0.726, p < 0.01) and demonstrated a significant difference between three groups in both TL (group A: 1.69 ± 0.45, group B: 2.21 ± 0.45 and group C: 2.80 ± 0.44) and five lobes except for left lingular segment. In a lobe-based analysis regarding relationship with VDR, AVI was much less dependent than ATR, although regression lines of groups A and C were separated for AVI as well as ATR. Coefficient of variation of either PI or RVC{sub 860–950} was significantly

  13. Giving Student Groups a Stronger Voice: Using Participatory Research and Action (PRA) to Initiate Change to a Curriculum

    Science.gov (United States)

    O'Neill, Geraldine; McMahon, Sinead

    2012-01-01

    Traditional student feedback mechanisms have been criticised for being teacher-centred in design and, in particular, for their absence of transparent follow-up actions. In contrast, this study describes the process and the evaluation of a participatory research and action (PRA) approach used in an undergraduate physiotherapy degree. This approach…

  14. Method for automatic localization of MR-visible markers using morphological image processing and conventional pulse sequences: feasibility for image-guided procedures.

    Science.gov (United States)

    Busse, Harald; Trampel, Robert; Gründer, Wilfried; Moche, Michael; Kahn, Thomas

    2007-10-01

    To evaluate the feasibility and accuracy of an automated method to determine the 3D position of MR-visible markers. Inductively coupled RF coils were imaged in a whole-body 1.5T scanner using the body coil and two conventional gradient echo sequences (FLASH and TrueFISP) and large imaging volumes up to (300 mm(3)). To minimize background signals, a flip angle of approximately 1 degrees was used. Morphological 2D image processing in orthogonal scan planes was used to determine the 3D positions of a configuration of three fiducial markers (FMC). The accuracies of the marker positions and of the orientation of the plane defined by the FMC were evaluated at various distances r(M) from the isocenter. Fiducial marker detection with conventional equipment (pulse sequences, imaging coils) was very reliable and highly reproducible over a wide range of experimental conditions. For r(M) method is found to be useful for image-guided procedures. (c) 2007 Wiley-Liss, Inc.

  15. Mercury Distribution in the Deûle River (Northern France) Measured by the Diffusive Gradients in Thin Films Technique and Conventional Methods.

    Science.gov (United States)

    Diviš, Pavel; Kadlecová, Milada; Ouddane, Baghdad

    2016-05-01

    The distribution of mercury in surface water and in sediment from Deûle River in Northern France was studied by application of conventional sampling methods and by diffusive gradients in thin films technique (DGT). Concentration of total dissolved mercury in surface water was 20.8 ± 0.8 ng l(-1). The particulate mercury concentration was 6.2 ± 0.6 µg g(-1). The particulate mercury was accumulated in sediment (9.9 ± 2.3 mg kg(-1)), and it was transformed by methylating bacteria to methylmercury, mainly in the first 2-cm layer of the sediment. Total dissolved concentration of mercury in sediment pore water obtained by application of centrifugation extraction was 17.6 ± 4.1 ng l(-1), and it was comparable with total dissolved pore water mercury concentration measured by DGT probe containing Duolite GT-73 resin gel (18.2 ± 4.3 ng l(-1)), taking the sediment heterogeneity and different principles of the applied methods into account. By application of two DGT probes with different resin gels specific for mercury, it was found that approximately 30% of total dissolved mercury in sediment pore water was present in labile forms easy available for biota. The resolution of mercury DGT depth profiles was 0.5 cm, which allows, unlike conventional techniques, to study the connection of the geochemical cycle of mercury with geochemical cycles of iron and manganese.

  16. Comparison of conventional full spine radiographs and fluoroscopic scanning method in young patients with idiopathic scoliosis; Vergleich von konventioneller Wirbelsaeulenganzaufnahme und fluoroskopischer Scan-Methode bei jungen Patienten mit idiopathischer Skoliose

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, J.; Kottke, R.; Claussen, C. [Abt. fuer Radiologische Diagnostik, Universitaetsklinikum Tuebingen (Germany); Kluba, T.; Niemeyer, T.; Hahnfeldt, T. [Klinik und Poliklinik fuer Orthopaedie, Universitaetsklinikum Tuebingen (Germany); Vonthein, R. [Inst. fuer Medizinische Biometrie, Universitaetsklinikum Tuebingen (Germany); Kamm, K.F. [Philips Medizin Systeme GmbH, Hamburg (Germany)

    2005-08-01

    Purpose: evaluation of low-dose full spine radiographs using fluoroscopic images for the assessment of the Cobb angle measurement in patients with scoliosis. Material and methods: twenty-one consecutive patients (aged 10-27 years, mean age 14 years) with a conventional full spine examination (film speed class 800) underwent a follow-up exam using digital pulsed fluoroscopy (Multi Diagnost 4, Philips Medical Systems, Eindhoven, The Netherlands). The mean follow-up was 9 months. During a synchronized scan with a C-arm speed of 4 cm/sec fluoroscopic images were stored with a pulsed frequency of 3 images per second. The single images were merged and reconstructed to one image with the software easy spine (Philips medical Systems, Eindhoven, The Netherlands). The corresponding dose-area product values (DAP) of both methods were compared. Three independent observers assessed Cobb angles and image quality for each technique. Results: the mean DAP values for conventional imaging was 94.9 cGy x cm{sup 2} and for fluoroscopy 7.8 cGy x cm{sup 2}, respectively. A significant dose reduction of 91.8% (CI 91% to 95%) was calculated. The average absolute angle difference between the observers was found to be 2.7 for conventional imaging and 2.4 for the fluoroscopic method. Interobserver standard deviation of 2.9 was lower than the 5.3 for conventional images. Image quality was better in the conventional images. Conclusion: using the scanning method, we could achieve a mean reduction of the radiation dose of 92%, while the accuracy of the Cobb angle measurements was comparable for both techniques despite of reduced image quality of digital fluoroscopy. (orig.)

  17. "VEM PRA RUA": THE POLITICAL AND THE POLITICS ON THE WEB

    Directory of Open Access Journals (Sweden)

    Benedito Fernando Pereira

    2014-12-01

    Full Text Available Considering the political and the social division of senses, this paper seeks to check how is the process of signification in a society increasingly challenged by electronic discourse and the ways in which political and policy find themselves affected by it. In order do that, we make the analysis of discursive statements “vem pra rua” and “somos a rede social” that were present in banners and posters in street protests in Brazil in 2013, which were organized and delivered, in large part, by virtual means. We observed that such utterances go through a process of appropriation and re-signification, with shifting meanings that run of market logic, go to the social politics and go back to the market logic. We had also observed how the urban environment is affected by the electronic discourse that now constitutes the ways it makes sense.

  18. Elastin and Mechanics of Pig Pericardial Resistance Arteries (pPRA)

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Leurgans, Thomas; Rosenstand, Kristoffer

    Resistance arteries are remodeled in hypertension and diabetes. Elastin was reported to play a role herein. The parietal pericardium is opened during cardio-thoracic surgeries and might be a valuable biopsy for research in cardio-vascular diseases. We tested the hypothesis that resistance arteries...... can be isolated from the pericardium to study the micro-architecture of elastin and vascular wall mechanics. The pericardium of pigs served to test the hypothesis. pPRAs were microdissected. Their structure was examined using multiphoton excitation fluorescence microscopy. Diameter......-tension and pressure-diameter-length relationships were recorded in myographs. Findings are compared to rodent mesenteric resistance arteries and –basilar arteries (rMRA, rBA) with comparable lumen diameter (±300µm at 100mmHg). pPRA have no clear external elastic lamina (present in rMRA, but not rBA), scant elastin...

  19. Role of seismic PRA in seismic safety decisions of nuclear power plants

    International Nuclear Information System (INIS)

    Ravindra, M.K.; Kennedy, R.P.; Sues, R.H.

    1985-01-01

    This paper highlights the important roles that seismic probabilistic risk assessments (PRAs) can play in the seismic safety decisions of nuclear power plants. If a seismic PRA has been performed for a plant, its results can be utilized to evaluate the seismic capability beyond the safe shutdown event (SSE). Seismic fragilities of key structures and equipment, fragilities of dominant plant damage states and the frequencies of occurrence of these plant damage states are reviewed to establish the seismic safety of the plant beyond the SSE level. Guidelines for seismic margin reviews and upgrading may be developed by first identifying the generic classes of structures and equipment that have been shown to be dominant risk contributors in the completed seismic PRAs, studying the underlying causes for their contribution and examining why certain other items (e.g., piping) have not proved to be high-risk-contributors

  20. An evaluation of internal event Level 1 PRA methods used in NUREG-1150

    International Nuclear Information System (INIS)

    Camp, A.L.; Cramond, W.R.

    1989-01-01

    As part of the effort to support NUREG-1150, Sandia National Laboratories and its subcontractors have developed innovative techniques for efficiently performing internal event Level I probabilistic risk assessments. This methodology is one of the alternatives for industry to use in performing individual plant evaluations in the future. While this new methodology was very successful, there are some areas where improvements can be made. This paper evaluates the strengths and weaknesses of the methodology and makes some important recommendations for modifications in order to provide insights to future users

  1. Precision Fit of Screw-Retained Implant-Supported Fixed Dental Prostheses Fabricated by CAD/CAM, Copy-Milling, and Conventional Methods.

    Science.gov (United States)

    de França, Danilo Gonzaga; Morais, Maria Helena; das Neves, Flávio D; Carreiro, Adriana Fonte; Barbosa, Gustavo As

    The aim of this study was to evaluate the effectiveness of fabrication methods (computer-aided design/computer-aided manufacture [CAD/CAM], copy-milling, and conventional casting) in the fit accuracy of three-unit, screw-retained fixed dental prostheses. Sixteen three-unit implant-supported screw-retained frameworks were fabricated to fit an in vitro model. Eight frameworks were fabricated using the CAD/CAM system, four in zirconia and four in cobalt-chromium. Four zirconia frameworks were fabricated using the copy-milled system, and four were cast in cobalt-chromium using conventional casting with premachined abutments. The vertical and horizontal misfit at the implant-framework interface was measured using scanning electron microscopy at ×250. The results for vertical misfit were analyzed using Kruskal-Wallis and Mann-Whitney tests. The horizontal misfits were categorized as underextended, equally extended, or overextended. Statistical analysis established differences between groups according to the chi-square test (α = .05). The mean vertical misfit was 5.9 ± 3.6 μm for CAD/CAM-fabricated zirconia, 1.2 ± 2.2 μm for CAD/CAM-fabricated cobalt-chromium frameworks, 7.6 ± 9.2 μm for copy-milling-fabricated zirconia frameworks, and 11.8 (9.8) μm for conventionally fabricated frameworks. The Mann-Whitney test revealed significant differences between all but the zirconia-fabricated frameworks. A significant association was observed between the horizontal misfits and the fabrication method. The percentage of horizontal misfits that were underextended and overextended was higher in milled zirconia (83.3%), CAD/CAM cobaltchromium (66.7%), cast cobalt-chromium (58.3%), and CAD/CAM zirconia (33.3%) frameworks. CAD/CAM-fabricated frameworks exhibit better vertical misfit and low variability compared with copy-milled and conventionally fabricated frameworks. The percentage of interfaces equally extended was higher when CAD/CAM and zirconia were used.

  2. Comparison of revegetation of a gas pipeline right-of-way in two forested wetland crossings involving conventional methods of pipeline installation and horizontal drilling, Nassau County, Florida

    Energy Technology Data Exchange (ETDEWEB)

    Van Dyke, G.D. [Trinity Christian Coll., Palos Heights, IL (United States). Dept. of Biology; Shem, L.M.; Zimmerman, R.E. [Argonne National Lab., IL (United States)

    1993-10-01

    One year after pipeline installation, vegetation in the right-of-way (ROW) was inventoried at two stream floodplain crossings in Nassau County, Florida. Both sites were forested wetlands composed of Acer rubrum, Fraxinus caroliniana, Liquidamber styraciflua, Nyssa ogecho, Quercus laurifolia, and Taxodium distichum, together with other wetland trees. Pipeline installation across the Brandy Branch floodplain was by conventional ditching and backfill methods. Installation across the Deep Creek floodplain was by horizontal drilling after clearcutting the ROW. The latter method left tree stumps, understory vegetation, and soil layers intact, except for disruptions caused by logging. According to the inventory, vegetation at the drilled site was more diverse (nearly twice as many species occurring in the ROW as at the trenched site) and more robust (no unvegetated exposed soil compared to 15% at the trenched site). Differences between the ROW vegetation at the two sites can be attributed to both site differences and installation technologies used.

  3. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    International Nuclear Information System (INIS)

    Koster, Marijke; Reijnders, Lucas; Oost, Nathalie R. van; Peijnenburg, Willie J.G.M.

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl 2 and 0.43 M HNO 3 , digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl 2 correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl 2 . A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C E (effective concentration) measured by a DGT-device, CaCl 2 extracted zinc and the zinc content in the pore water of all soils. The correlation with C E was not significant for lupine, neither for spiked soils, nor for field soils (p ≤ 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods

  4. Application of the gyroscopic method in subterranean orientation. Comparison with conventional methods. Aplicacion del metodo gyroscopic en la orientacion subterranea. Comparacion con los metodos convencionales

    Energy Technology Data Exchange (ETDEWEB)

    Saez Garcia, E.; Fuente Martin, P.L. (HUNOSA, Madrid (Spain))

    1988-01-01

    This entry tries to revise the most used method for the direction transition what with exterior and interior using plumbs in connected with vertical shaft coalmines. A technical and economic cooperation was also realized between the indicated method and the gyroscope.

  5. The effect of different conventional methods of extraction on Marantodes pumila var. pumila leaves in relation to free radical scavenging activity

    Science.gov (United States)

    Hamid, Noor Huda Abd; Latip, Jalifah; Markom, Masturah

    2018-04-01

    Marantodes pumila is one of the important herbs used in traditional medicine. However, there is no report on the optimum method for the preparation of M. pumila extract enriched with bioactive compounds. Therefore, this study aim to establish the suitable method in the preparation of M. pumila extracts enriched with antioxidative compounds. Different conventional extraction methods such as maceration, reflux and Soxhlet in solvents of different polarities i.e. ethanol, 50 % aqueous ethanol and water were employed to prepare extracts. Constituents of each extract were profiled using RP-HPLC followed by the free radical scavenging assay using 2,2 diphenyl-1-picrylhydrazyl (DPPH) to determine the antioxidant activity. Among all extraction methods, maceration in 50 % aqueous ethanol gave the highest total percentage yield (22.41 %) while all extraction methods were able to extract the marker compounds, gallic acid (GA) and methyl gallate (MGA). The free radical scavenging activity of extracts varied from IC50 11.93 µg/mL (50 % aqueous ethanol via reflux) to 64.15 µg/mL (water via maceration). All extracts showed better scavenging activity as compared to synthetic antioxidant, BHT. The variation in the IC50 values is expected due to the presence of different types and/or concentration of bioactive compounds in each extract. This study may provide a preliminary insight for the preparation of standardized extracts of M. pumila enriched with bioactive compounds.

  6. Comparison of oxygen saturation levels in patients receiving Technegas by the conventional unassisted method vs. the positive ventilation delivery system (PVDS)

    International Nuclear Information System (INIS)

    Dobson, M.P.; Leiper, C.A.; Lee, K.; Dixson, H.

    2000-01-01

    Full text: The purpose of this study is to compare oxygen saturation levels (SaO 2 ) in 289 patients undergoing conventional lung ventilation scintigraphy (control group) and 27 patients undergoing Positive Ventilation Delivery System (PVDS). The 27 patients where selected as their conventional method of inhalation proved to be inadequate or non-diagnostic. The patients underwent a second ventilation using PVDS, which improved the diagnostic quality of the ventilation image and assisted in clinical management decisions. Some patients in both the PVDS and the control group experienced a transient lowering in their SaO 2 . The mean initial SaO 2 in the control group did not fall below 94.9% and in the PVDS group measured 90.6%. 93% (25/27) of patients in the PVDS group were assessed as non CO 2 retaining, and received oxygen at 10L/min during Technegas inhalation. The mean trough saturation in the PVDS group was 91.7% which was significantly higher than that of the control group (86.9%). No patient in either group experienced any significant complication attributed to the transient tall in SaO 2 during technegas administration. We conclude that oxygen supplied as part of the PVDS system ameliorates the transient reduction in SaO 2 seen during standard Technegas administration. Copyright (2000) The Australian and New Zealand Society of Nuclear Medicine Inc

  7. Study of the magnetic microstructure of high-coercivity sintered SmCo5 permanent magnets with the conventional Bitter pattern technique and the colloid-SEM method

    International Nuclear Information System (INIS)

    Szmaja, Witold

    2007-01-01

    The magnetic microstructure of high-coercivity sintered SmCo 5 permanent magnets was studied with the conventional Bitter pattern technique, and also for the first time with the colloid-scanning electron microscopy (colloid-SEM) method. Both techniques were supported by digital image acquisition, enhancement and analysis. Thanks to this, it was possible to obtain high-contrast and clear images of the magnetic microstructure and to analyze them in detail, and consequently also to achieve improvements over earlier results. In the thermally demagnetized state the grains were composed of magnetic domains. On the surface perpendicular to the alignment axis, the main domains forming a maze pattern and surface reverse spikes were observed. Investigations on the surface parallel to the alignment axis, especially by the colloid-SEM technique, provided a detailed insight into the orientation of grains. The alignment of grains was good, but certainly not perfect; there were also strongly misaligned grains, although generally very rare. In most cases the domain structures within grains were independent of their neighbors, but in some cases (not so rare) the domain walls were observed to continue through the grain boundaries, indicating significant magnetostatic interaction between neighboring grains. Studies of the behavior of the magnetic microstructure under the influence of an external magnetic field, performed for the first time on the surface parallel to the alignment axis (with the conventional Bitter pattern method), showed that the domain walls move easily within the grains and that the magnetization reversal mechanism is mainly related to the nucleation and growth of reverse domains, i.e. that sintered SmCo 5 magnets are nucleation-dominated systems. Groupwise magnetization reversal of adjacent magnetically coupled grains was observed, an unfavorable effect for high-coercivity magnets. Images obtained by the colloid-SEM technique and the conventional Bitter pattern

  8. Conventional method for the calculation of the global energy cost of buildings; Methode conventionnelle de calcul du cout global energetique des batiments

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-05-01

    A working group driven by Electricite de France (EdF), Chauffage Fioul and Gaz de France (GdF) companies has been built with the sustain of several building engineering companies in order to clarify the use of the method of calculation of the global energy cost of buildings. This global cost is an economical decision help criterion among others. This press kit presents, first, the content of the method (input data, calculation of annual expenses, calculation of the global energy cost, display of results and limitations of the method). Then it fully describes the method and its appendixes necessary for its implementation: economical and financial context, general data of the project in progress, environmental data, occupation and comfort level, variants, investment cost of energy systems, investment cost for the structure linked with the energy system, investment cost for other invariant elements of the structure, calculation of consumptions (space heating, hot water, ventilation), maintenance costs (energy systems, structure), operation and exploitation costs, tariffs and consumption costs and taxes, actualized global cost, annualized global cost, comparison between variants. The method is applied to a council building of 23 flats taken as an example. (J.S.)

  9. Ascertaining year of birth/age at death in forensic cases: A review of conventional methods and methods allowing for absolute chronology

    DEFF Research Database (Denmark)

    Lynnerup, Niels; Kjeldsen, H; Zweihoff, R

    2010-01-01

    Based on an actual case, where we were able to ascertain the year of birth of three dead babies found in a deep-freezer to within 1–2 years (1986, 1988 and 2004, respectively), we review the current state of forensic age determination/year of birth determination. The age of an individual (year...... of birth) is often a fundamental piece of data in connection with forensic identification of unidentified bodies. The methods most often used are based on determining various morphological, age-related, changes on the skeleton (or teeth, although odontological methods are not reviewed in this paper...

  10. [Identification of mycobacteria to the species level by molecular methods in the Public Health Laboratory of Bogotá, Colombia].

    Science.gov (United States)

    Hernández-Toloza, Johana Esther; Rincón-Serrano, María de Pilar; Celis-Bustos, Yamile Adriana; Aguillón, Claudia Inés

    2016-01-01

    Global epidemiology of non-tuberculous mycobacteria (NTM) is unknown due to the fact that notification is not required in many countries, however the number of infection reports and outbreaks caused by NTM suggest a significant increase in the last years. Traditionally, mycobacteria identification is made through biochemical profiles which allow to differentiate M. tuberculosis from NTM, and in some cases the mycobacteria species. Nevertheless, these methods are technically cumbersome and time consuming. On the other hand, the introduction of methods based on molecular biology has improved the laboratory diagnosis of NTM. To establish the NTM frequency in positive cultures for acid-fast bacilli (AAFB) which were sent to Laboratorio de Salud Pública de Bogotá over a 12 month period. A total of 100 positive cultures for acid-fast bacilli from public and private hospitals from Bogotá were identified by both biochemical methods and the molecular methods PRA (PCR-restriction enzyme analysis) and multiplex-PCR. Furthermore, low prevalence mycobacteria species and non-interpretable results were confirmed by 16SrDNA sequentiation analysis. Identification using the PRA method showed NMT occurrence in 11% of cultures. In addition, this molecular methodology allowed to detect the occurrence of more than one mycobacteria in 4% of the cultures. Interestingly, a new M. kubicae pattern of PCR-restriction analysis is reported in our study. Using a mycobacteria identification algorithm, which includes the molecular method PRA, improves the diagnostic power of conventional methods and could help to advance both NTM epidemiology knowledge and mycobacteriosis control. Copyright © 2015 Elsevier España, S.L.U. y Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  11. 'Augmented reality' in conventional simulation by projection of 3-D structures into 2-D images. A comparison with virtual methods

    Energy Technology Data Exchange (ETDEWEB)

    Deutschmann, H.; Nairz, O.; Zehentmayr, F.; Fastner, G.; Sedlmayer, F. [Univ. Clinic for Radiotherapy and Radio-Oncology, Salzburg (Austria); radART - Inst. for research and development on Advanced Radiation Technologies at the Paracelsus Medical Univ., Salzburg (Austria); Steininger, P. [radART - Inst. for research and development on Advanced Radiation Technologies at the Paracelsus Medical Univ., Salzburg (Austria); Dept. of Medical Computer Science and Technology, Univ. for Health Sciences, Hall i. T. (Austria); Kopp, P.; Merz, F.; Wurstbauer, K.; Kranzinger, M.; Kametriser, G.; Kopp, M. [Univ. Clinic for Radiotherapy and Radio-Oncology, Salzburg (Austria)

    2008-02-15

    Background and purpose: in this study, a new method is introduced, which allows the overlay of three-dimensional structures, that have been delineated on transverse slices, onto the fluoroscopy from conventional simulators in real time. Patients and methods: setup deviations between volumetric imaging and simulation were visualized, measured and corrected for 701 patient isocenters. Results: comparing the accuracy to mere virtual simulation lacking additional X-ray imaging, a clear benefit of the new method could be shown. On average, virtual prostate simulations had to be corrected by 0.48 cm (standard deviation [SD] 0.38), and those of the breast by 0.67 cm (SD 0.66). Conclusion: the presented method provides an easy way to determine entity-specific safety margins related to patient setup errors upon registration of bony anatomy (prostate 0.9 cm for 90% of cases, breast 1.3 cm). The important role of planar X-ray imaging was clearly demonstrated. The innovation can also be applied to adaptive image-guided radiotherapy (IGRT) protocols. (orig.)

  12. Storage stability study for margarines produced by enzymatically interesterified fats compared to the margarines by the conventional methods I. Physical properties

    DEFF Research Database (Denmark)

    Zhang, Hong; Jacobsen, Charlotte; Adler-Nissen, Jens

    2005-01-01

    was more similar to that of the physically mixed fat than that of the margarine from the chemically randomized fat, which had less color. Crystal transformation was accelerated at high storage temperature. Crystal size was not only related to the types of crystals, but also to the driving force......In this study, margarine hardstocks were produced from two enzymatically interesterified fats at conversion degrees of 80 and 100%, a chemically randomized fat and a physically mixed fat, respectively. These four hardstocks blended with 50% of sunflower oil were mainly used for the production...... of table margarines in a pilot plant. Storage stability studies were carried out at storage temperatures of 5 and 25 7C during 12 wk. Margarines from the enzymatically interesterified fats were compared to the margarines produced by conventional methods and to selected commercial products. The changes...

  13. Influence of abutment tooth geometry on the accuracy of conventional and digital methods of obtaining dental impressions.

    Science.gov (United States)

    Carbajal Mejía, Jeison B; Wakabayashi, Kazumichi; Nakamura, Takashi; Yatani, Hirofumi

    2017-09-01

    Direct (intraoral) and indirect (desktop) digital scanning can record abutment tooth preparations despite their geometry. However, little peer-reviewed information is available regarding the influence of abutment tooth geometry on the accuracy of digital methods of obtaining dental impressions. The purpose of this in vitro study was to evaluate the influence of abutment tooth geometry on the accuracy of conventional and digital methods of obtaining dental impressions in terms of trueness and precision. Crown preparations with known total occlusal convergence (TOC) angles (-8, -6, -4, 0, 4, 8, 12, 16, and 22 degrees) were digitally created from a maxillary left central incisor and printed in acrylic resin. Each of these 9 reference models was scanned with a highly accurate reference scanner and saved in standard tessellation language (STL) format. Then, 5 conventional polyvinyl siloxane (PVS) impressions were made from each reference model, which was poured with Type IV dental stone scanned using both the reference scanner (group PVS) and the desktop scanner and exported as STL files. Additionally, direct digital impressions (intraoral group) of the reference models were made, and the STL files were exported. The STL files from the impressions obtained were compared with the original geometry of the reference model (trueness) and within each test group (precision). Data were analyzed using 2-way ANOVA with the post hoc least significant difference test (α=.05). Overall trueness values were 19.1 μm (intraoral scanner group), 23.5 μm (desktop group), and 26.2 μm (PVS group), whereas overall precision values were 11.9 μm (intraoral), 18.0 μm (PVS), and 20.7 μm (desktop). Simple main effects analysis showed that impressions made with the intraoral scanner were significantly more accurate than those of the PVS and desktop groups when the TOC angle was less than 8 degrees (Pimpression and the TOC angle on the precision of single-tooth dental impressions (F=2

  14. Clinical target volume localization using conventional methods (anatomy and palpation) and ultrasonography in early breast cancer post-operative external irradiation

    International Nuclear Information System (INIS)

    Valdagni, Riccardo; Italia, Corrado; Montanaro, Paolo; Ciocca, Mario; Morandi, Giovanni; Salvadori, Bruno

    1997-01-01

    Purpose: To evaluate the accuracy of three methods, anatomy (A), palpation (P) and ultrasounds (US) in localizing the clinical target volume (CTV) in patients (pts) with early breast cancer (EBC) undergoing breast external irradiation as part of conservation therapy. Material and methods: One hundred consecutive pts with EBC (T is 1%, T 1 78%, T 2 21%, N- 68%, N+ 32%), treated with conservation surgery and breast irradiation with opposed tangential portals, were prospectively analyzed. Anatomically, palpatory or ultrasound defined field borders for CTV localizations were determined in the same position thanks to the utilization of a vacuum-formed cellulose acetate immobilization cast, removed during CTV definitions. Results: P and US CTV localizations have been found to coincide on the four margins (superior, inferior, medial, lateral) in only(1(100)) pts, while no pt showed identical A and US CTV localizations. Only (31(397)) (8%) field measurements with A, and(98(395)) (25%) with P corresponded to US border definition. If mean and median values of each field border were considered, the CTV was generally over-estimated with P appearing more accurate than A in a gross definition of the target (P < 0.01). However, a geographical miss of at least one field border of CTV occurred in 55% of pts with A and in 36% of pts with P. The most critical margin to be defined with conventional methods was the superior one: an underestimation of the cranial border of CTV with A was observed in 51% and with P in 22% of pts (22% and 8%, respectively, when an underestimation by more than 1.5 cm was considered). When pre-menopausal and peri/post-menopausal groups of pts were separately analyzed, conventional methods were highly inaccurate to define the superior border in younger pts, in which a geographical miss was noted with A in 62% and with P in 35% of cases (P < 0.05). When an underestimation of more than 1.5 cm was evaluated, these values were reduced to 33% and 12

  15. Development of next generation code system as an engineering modeling language (5). Investigation on restructuring method of conventional codes into two-layer system

    International Nuclear Information System (INIS)

    Yokoyama, Kenji

    2006-10-01

    A proposed method for gradually restructuring to the two-level system of next generation analysis system by reusing the conventional analysis system, called 'incremental method', was applied and evaluated. The following functions were selected for the evaluation: Neutron diffusion calculation for the three-dimensional XYZ system based on finite differential method, and input utilities of the cross-section data file used in the conventional system. In order to evaluate the effect of the restructuring, 'Module Coupling Index (MCI)' and 'McCabe's Cyclomatic Complexity (MCC)' were used for quantifying the quality of the modular design and the complexity of the program sequence of each module. Although MCIs of each module before restructuring were mainly 6 - 7 degrees, it was possible to reduce them to under 4 degrees in most module by restructuring with the incremental method. And, it is found that the modules under 4 degrees of MCI can be easily combined with different programming languages, which are necessary for building the two-layer system. In the meantime, MCCs in most module before restructuring were over 20 and some were over 50. The incremental method could reduce them to under 10 when C++ was used, and reduce them to under 20 when FORTRAN was used. It is correspondent to reduction of the error frequency occurred in its modification from 20 - 40% to 5 - 10%. The total number of MCC could be reduced to 1/3 when C++ was used, and to 1/2 when FORTRAN was used. By using the restructured functions in the present study and some previously developed functions, a reactor analysis tool was systematized and applied to criticality analysis of the Experimental Fast Reactor 'JOYO' MR-I. In addition, the following two functionality expansion tests were performed: To add cross section direct perturbation functionality, and to add control rod criticality position search functionality. In the tests, both the functionality expansions were carried out satisfying the condition

  16. On-line high-performance liquid chromatography-ultraviolet-nuclear magnetic resonance method of the markers of nerve agents for verification of the Chemical Weapons Convention.

    Science.gov (United States)

    Mazumder, Avik; Gupta, Hemendra K; Garg, Prabhat; Jain, Rajeev; Dubey, Devendra K

    2009-07-03

    This paper details an on-flow liquid chromatography-ultraviolet-nuclear magnetic resonance (LC-UV-NMR) method for the retrospective detection and identification of alkyl alkylphosphonic acids (AAPAs) and alkylphosphonic acids (APAs), the markers of the toxic nerve agents for verification of the Chemical Weapons Convention (CWC). Initially, the LC-UV-NMR parameters were optimized for benzyl derivatives of the APAs and AAPAs. The optimized parameters include stationary phase C(18), mobile phase methanol:water 78:22 (v/v), UV detection at 268nm and (1)H NMR acquisition conditions. The protocol described herein allowed the detection of analytes through acquisition of high quality NMR spectra from the aqueous solution of the APAs and AAPAs with high concentrations of interfering background chemicals which have been removed by preceding sample preparation. The reported standard deviation for the quantification is related to the UV detector which showed relative standard deviations (RSDs) for quantification within +/-1.1%, while lower limit of detection upto 16mug (in mug absolute) for the NMR detector. Finally the developed LC-UV-NMR method was applied to identify the APAs and AAPAs in real water samples, consequent to solid phase extraction and derivatization. The method is fast (total experiment time approximately 2h), sensitive, rugged and efficient.

  17. Game-based e-learning is more effective than a conventional instructional method: a randomized controlled trial with third-year medical students.

    Directory of Open Access Journals (Sweden)

    Martin Boeker

    Full Text Available BACKGROUND: When compared with more traditional instructional methods, Game-based e-learning (GbEl promises a higher motivation of learners by presenting contents in an interactive, rule-based and competitive way. Most recent systematic reviews and meta-analysis of studies on Game-based learning and GbEl in the medical professions have shown limited effects of these instructional methods. OBJECTIVES: To compare the effectiveness on the learning outcome of a Game-based e-learning (GbEl instruction with a conventional script-based instruction in the teaching of phase contrast microscopy urinalysis under routine training conditions of undergraduate medical students. METHODS: A randomized controlled trial was conducted with 145 medical students in their third year of training in the Department of Urology at the University Medical Center Freiburg, Germany. 82 subjects where allocated for training with an educational adventure-game (GbEl group and 69 subjects for conventional training with a written script-based approach (script group. Learning outcome was measured with a 34 item single choice test. Students' attitudes were collected by a questionnaire regarding fun with the training, motivation to continue the training and self-assessment of acquired knowledge. RESULTS: The students in the GbEl group achieved significantly better results in the cognitive knowledge test than the students in the script group: the mean score was 28.6 for the GbEl group and 26.0 for the script group of a total of 34.0 points with a Cohen's d effect size of 0.71 (ITT analysis. Attitudes towards the recent learning experience were significantly more positive with GbEl. Students reported to have more fun while learning with the game when compared to the script-based approach. CONCLUSIONS: Game-based e-learning is more effective than a script-based approach for the training of urinalysis in regard to cognitive learning outcome and has a high positive motivational impact on

  18. Comparison of the method of diffusive gels in thin films with conventional extraction techniques for evaluating zinc accumulation in plants and isopods

    Energy Technology Data Exchange (ETDEWEB)

    Koster, Marijke [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Open University Netherlands, Heerlen (Netherlands); Reijnders, Lucas [Open University Netherlands, Heerlen (Netherlands); Oost, Nathalie R. van [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Peijnenburg, Willie J.G.M. [National Institute of Public Health and the Environment, Laboratory for Ecological Risk Assessment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: wjgm.peijnenburg@rivm.nl

    2005-01-01

    The measurement of diffusive gels in thin films (DGT) has recently been developed to assess metal bioavailability in soils. The DGT-method is based on diffusion in a porous matrix. To test the predictive capabilities of the method with regard to metal bioavailability, a study was set up with 28 soils having a variety of textures and amounts of zinc salts added. Correlation and regression analyses were performed to compare DGT-extracted zinc levels to zinc concentrations obtained by extraction with 0.01 M CaCl{sub 2} and 0.43 M HNO{sub 3}, digestion with aqua regia and the zinc concentration in pore water. The amount of zinc extracted with CaCl{sub 2} correlated well with DGT-extracted zinc levels in all soils spiked with different amounts of ZnCl{sub 2}. A similar correlation was not found for zinc concentrations in soil samples collected in the field. Experiments were performed to compare zinc content in organisms and in soils. The organisms tested were plants (grass, lettuce and lupine) and the hard bodied soil dwelling isopod Oniscus asellus. Good correlations were found between zinc accumulation in grass and lettuce and the C{sub E} (effective concentration) measured by a DGT-device, CaCl{sub 2} extracted zinc and the zinc content in the pore water of all soils. The correlation with C{sub E} was not significant for lupine, neither for spiked soils, nor for field soils (p {<=} 0.001). Zinc levels in the isopods were not significantly related to any set of zinc measurements. From a synthesis of all results obtained it is concluded that the DGT-methodology does not have an additional value in predicting bioavailability of zinc in terrestrial ecosystems as compared to conventional extraction methods. - Capsule: The newly developed method of diffusive gels in Thin films (DGT) does not have an added value over conventional extraction techniques in predicting zinc uptake by plants and isopods.

  19. The effect of restricted milk feeding through conventional or step-down methods with or without forage provision in starter feed on performance of Holstein bull calves.

    Science.gov (United States)

    Daneshvar, D; Khorvash, M; Ghasemi, E; Mahdavi, A H; Moshiri, B; Mirzaei, M; Pezeshki, A; Ghaffari, M H

    2015-08-01

    The objective of the current study was to examine whether step-down (STP) milk feeding method together with forage provision would improve performance, rumen fermentation, nutrient digestibility, blood metabolites, and structural growth of calves. Holstein bull calves ( = 40) were randomly assigned to 1 of 4 treatments in a completely randomized design with a 2 × 2 factorial arrangement. Treatments were 1) conventional (COV) milk feeding without forage provision (COV-NF), 2) COV milk feeding with forage provision, 3) STP milk feeding without forage provision, and 4) STP milk feeding with forage provision. Calves in the COV method ( = 20) received 5.5 L/d milk until d 56 of age followed by 2 L/d milk from d 56 to 59 of age. Calves in the STP method ( = 20) received 7 L/d milk until d 35, 4 L/d milk from d 35 to 48, and 2 L/d milk from d 50 to 59 of age. All the calves received the starter ration from d 3 of the study until d 74 of age. Forage-supplemented calves ( = 10/milk feeding method) received 15% alfalfa hay mixed with finely ground starter as a total mixed ration. All calves were weaned on d 60 of age and remained in the study until d 74. Regardless of the milk feeding method, the final BW (92.54 vs. 83.14 kg/d), starter intake (0.90 vs. 0.65 kg/d), total DMI (1.43 vs. 1.17 kg/d), and ADG (0.73 vs. 0.60 kg/d) were greater ( calves than those that received no forage during the preweaning, postweaning, and overall periods. Milk feeding method had no effect on ruminal pH, total VFA, acetate, or acetate:propionate ratio as well as body measurements. Ruminal pH and the molar proportions of acetate were greater ( calves than those that received no forage during the pre- and postweaning periods. Regardless of forage provision, STP methods increased ( feeding methods and forage provision with respect to BW, DMI, G:F, apparent nutrient digestibility (DM, OM, and CP), and body measurements. The interaction of milk feeding method and forage provision was significant

  20. Evaluation of safety issues on newly regulated nuclear power plant by tsunami-level 1 PRA

    International Nuclear Information System (INIS)

    Tsuji, Yutaro; Miwa, Shuichiro; Mori, Michitsugu

    2014-01-01

    The tsunami caused by the Great East Japan Earthquake triggered severe accidents involving the units 1 to 4 at the Fukushima Dai-ichi nuclear power station (NPS). In order to re-operate existing nuclear power plants it should be necessary to reduce the core damage frequency on risk by tsunami. In this work, effects of the off-site power supply installation on resuming operation of nuclear power plants were investigated by utilizing the Tsunami-Level 1 Probability Risk Assessment (PRA). Unit 2 of the Onagawa nuclear power station, which resembled units 2 and 3 of Fukushima Dai-ichi, was selected for PRA. First, event-tree was created for the units of the Onagawa nuclear power station with the safety systems such as Emergency Core Cooling System (ECCS), investigating the plant situation at the time of the earthquake and tsunami occurrences. It was assumed that the magnitude of the tsunami was equivalent to the Great East Japan Earthquake. The accident-analytical progression-time was 36 hours, determined from the core-damage occurrence of the unit 3 of Fukushima Dai-ichi nuclear power station. Failure probabilities were calculated by the fault tree, which was created from the elements listed in the event tree. For the calculation, failure rates reported by the NUCIA (NUClear Information Archives) were primarily utilized. Then, obtained failure probabilities were embedded to the event tree. Core damage probabilities were evaluated by calculating success and failure rates for each accidental progression and scenarios. Restoration of the failed equipment and machineries was not considered in the analysis. Installation of the power supply vehicles at the nuclear power plant site reduced the core damage probability from 2.58×10 -6 to 8.56×10 -7 . However, continued addition of the power supply vehicles could not lower the core damage probability further more. In the case of Unit 2 of Onagawa nuclear power station, there could be a limit to lower the core damage

  1. Quantification of incisal tooth wear in upper anterior teeth: conventional vs new method using toolmakers microscope and a three-dimensional measuring technique.

    Science.gov (United States)

    Al-Omiri, Mahmoud K; Sghaireen, Mohd G; Alzarea, Bader K; Lynch, Edward

    2013-12-01

    This study aimed to quantify tooth wear in upper anterior teeth using a new CAD-CAM Laser scanning machine, tool maker microscope and conventional tooth wear index. Fifty participants (25 males and 25 females, mean age = 25 ± 4 years) were assessed for incisal tooth wear of upper anterior teeth using Smith and Knight clinical tooth wear index (TWI) on two occasions, the study baseline and 1 year later. Stone dies for each tooth were prepared and scanned using the CAD-CAM Laser Cercon System. Scanned images were printed and examined under a toolmaker microscope to quantify tooth wear and then the dies were directly assessed under the microscope to measure tooth wear. The Wilcoxon Signed Ranks Test was used to analyze the data. TWI scores for incisal edges were 0-3 and were similar at both occasions. Score 4 was not detected. Wear values measured by directly assessing the dies under the toolmaker microscope (range = 113 - 150 μm, mean = 130 ± 20 μm) were significantly more than those measured from Cercon Digital Machine images (range=52-80 μm, mean = 68 ± 23 μm) and both showed significant differences between the two occasions. Wear progression in upper anterior teeth was effectively detected by directly measuring the dies or the images of dies under toolmaker microscope. Measuring the dies of worn dentition directly under tool maker microscope enabled detection of wear progression more accurately than measuring die images obtained with Cercon Digital Machine. Conventional method was the least sensitive for tooth wear quantification and was unable to identify wear progression in most cases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Game-based e-learning is more effective than a conventional instructional method: a randomized controlled trial with third-year medical students.

    Science.gov (United States)

    Boeker, Martin; Andel, Peter; Vach, Werner; Frankenschmidt, Alexander

    2013-01-01

    When compared with more traditional instructional methods, Game-based e-learning (GbEl) promises a higher motivation of learners by presenting contents in an interactive, rule-based and competitive way. Most recent systematic reviews and meta-analysis of studies on Game-based learning and GbEl in the medical professions have shown limited effects of these instructional methods. To compare the effectiveness on the learning outcome of a Game-based e-learning (GbEl) instruction with a conventional script-based instruction in the teaching of phase contrast microscopy urinalysis under routine training conditions of undergraduate medical students. A randomized controlled trial was conducted with 145 medical students in their third year of training in the Department of Urology at the University Medical Center Freiburg, Germany. 82 subjects where allocated for training with an educational adventure-game (GbEl group) and 69 subjects for conventional training with a written script-based approach (script group). Learning outcome was measured with a 34 item single choice test. Students' attitudes were collected by a questionnaire regarding fun with the training, motivation to continue the training and self-assessment of acquired knowledge. The students in the GbEl group achieved significantly better results in the cognitive knowledge test than the students in the script group: the mean score was 28.6 for the GbEl group and 26.0 for the script group of a total of 34.0 points with a Cohen's d effect size of 0.71 (ITT analysis). Attitudes towards the recent learning experience were significantly more positive with GbEl. Students reported to have more fun while learning with the game when compared to the script-based approach. Game-based e-learning is more effective than a script-based approach for the training of urinalysis in regard to cognitive learning outcome and has a high positive motivational impact on learning. Game-based e-learning can be used as an effective teaching

  3. Comparison of SKIFS 2004:1 and Tillsynshandbok PSA against the ASME PRA Standard and European requirements on PSA

    International Nuclear Information System (INIS)

    Hellstroem, Per

    2005-04-01

    Requirements on PSA for risk informed applications are expressed in different international documents. The ASME PRA standard published in spring 2002 is one such document, PSA requirements are also expressed in the European Utility Requirements (EUR) for new reactors. The Swedish PSA requirements are provided in the Swedish regulators (SKI) statutes SKIFS 2004:1. SKI also has a review handbook for PSA activities (SKI report 2003:48). The review handbook is a support during review of the utilities PSA activities and the PSAs themselves. The review handbook expresses SKIs expectations by providing so called important aspects for both the PSA work and the PSAs, A comparison of SKIFS requirements and the important aspects in the Review handbook, on one side, and the requirements on PSA in EUR and ASME on the other side, is presented. The comparison shows a large difference in the level of detail in the different documents, where ASME is most detailed and specific. This is expected since the SKI review handbook not is a 'PSA guide' in the same way as the ASME PRA standard. A direct comparison of the ASME PRA standard requirements with the important aspects in the review handbook cannot answer the question which ASME capacity level that is achieved by a PSA meeting all important aspects. The conclusion is that it is not likely to achieve capacity level 2 and 3, since very few ASME level 3 attributes are explicitly expressed as important aspects, though many are expressed in general terms. The review handbook important aspects that are most similar to the ASME capacity level 1 attributes are initiating events, sequence analysis, and system analysis while less similarity is found for analysis of operator actions data analysis, quantification and containment analysis (level 2). Less similarity is found for capacity level 2 and 3. However, the number of additional ASME attributes on capacity level 2 and 3 are few. There are also important aspects in the review handbook that

  4. Results and insights of a level-1 internal event PRA of a PWR during mid-loop operations

    International Nuclear Information System (INIS)

    Chu, T.L.; Musicki, Z.; Kohut, P.

    1993-01-01

    Traditionally, probabilistic risk assessments (PRA) of severe accidents in nuclear power plants have considered initiating events potentially occurring only during full power operation. Some previous screening analysis that were performed for other modes of operation suggested that risks during those modes were small relative to full power operation. However, more recent studies and operational experience have implied that accidents during low power and shutdown could be significant contributors to risk. The objective of this paper is to present the approach utilized in the level-1 PRA for the Surry plant, and discuss the results obtained. A comparison of the results with those of other shutdown studies is provided. Relevant safety issues such as plant and hardware configurations, operator training, and instrumentation and control is discussed

  5. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik [Gangnam Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Suh, Jin Suck; Kim, Ah Hyun [Dept. of Radiology and Research Institute of Radiological Science, Severance Hospital, Yonsei University College of Medicine, Seoul (Korea, Republic of); Ryu, Jeong Ah [Dept. of Radiology, Guri Hospital, Hanyang University College of Medicine, Guri (Korea, Republic of); Park, Jeong Seon [Dept. of Radiology, Hanyang University Hospital, Hanyang University College of Medicine, Seoul (Korea, Republic of)

    2012-09-15

    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  6. Determination of Optimal Imaging Mode for Ultrasonographic Detection of Subdermal Contraceptive Rods: Comparison of Spatial Compound, Conventional, and Tissue Harmonic Imaging Methods

    International Nuclear Information System (INIS)

    Kim, Sung Jin; Seo, Kyung; Song, Ho Taek; Park, Ah Young; Kim, Yaena; Yoon, Choon Sik; Suh, Jin Suck; Kim, Ah Hyun; Ryu, Jeong Ah; Park, Jeong Seon

    2012-01-01

    To determine which mode of ultrasonography (US), among the conventional, spatial compound, and tissue-harmonic methods, exhibits the best performance for the detection of Implanon with respect to generation of posterior acoustic shadowing (PAS). A total of 21 patients, referred for localization of impalpable Implanon, underwent US, using the three modes with default settings (i.e., wide focal zone). Representative transverse images of the rods, according to each mode for all patients, were obtained. The resulting 63 images were reviewed by four observers. The observers provided a confidence score for the presence of PAS, using a five-point scale ranging from 1 (definitely absent) to 5 (definitely present), with scores of 4 or 5 for PAS being considered as detection. The average scores of PAS, obtained from the three different modes for each observer, were compared using one-way repeated measure ANOVA. The detection rates were compared using a weighted least square method. Statistically, the tissue harmonic mode was significantly superior to the other two modes, when comparing the average scores of PAS for all observers (p < 0.00-1). The detection rate was also highest for the tissue harmonic mode (p < 0.001). Tissue harmonic mode in US appears to be the most suitable in detecting subdermal contraceptive implant rods.

  7. Comparisons between conventional, ultrasound-assisted and microwave-assisted methods for extraction of anthraquinones from Heterophyllaea pustulata Hook f. (Rubiaceae).

    Science.gov (United States)

    Barrera Vázquez, M F; Comini, L R; Martini, R E; Núñez Montoya, S C; Bottini, S; Cabrera, J L

    2014-03-01

    This work reports a comparative study about extraction methods used to obtain anthraquinones (AQs) from stems and leaves of Heterophyllae pustulata Hook (Rubiáceae). One of the conventional procedures used to extract these metabolites from a vegetable matrix is by successive Soxhlet extractions with solvents of increasing polarity: starting with hexane to eliminate chlorophylls and fatty components, following by benzene and finally ethyl acetate. However, this technique shows a low extraction yield of total AQs, and consumes large quantities of solvent and time. Ultrasound-assisted extraction (UAE) and microwave-assisted extraction (MAE) have been investigated as alternative methods to extract these compounds, using the same sequence of solvents. It was found that UAE increases the extraction yield of total AQs and reduces the time and amount of solvent used. Nevertheless, the combination UAE with benzene, plus MAE with ethyl acetate at a constant power of 900 W showed the best results. A higher yield of total AQs was obtained in less time and using the same amount of solvent that UAE. The optimal conditions for this latter procedure were UAE with benzene at 50 °C during 60 min, followed by MAE at 900 W during 15 min using ethyl acetate as extraction solvent. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Analysis of climate and anthropogenic impacts on runoff in the Lower Pra River Basin of Ghana.

    Science.gov (United States)

    Awotwi, Alfred; Anornu, Geophrey Kwame; Quaye-Ballard, Jonathan; Annor, Thompson; Forkuo, Eric Kwabena

    2017-12-01

    The Lower Pra River Basin (LPRB), located in the forest zone of southern Ghana has experienced changes due to variability in precipitation and diverse anthropogenic activities. Therefore, to maintain the functions of the ecosystem for water resources management, planning and sustainable development, it is important to differentiate the impacts of precipitation variability and anthropogenic activities on stream flow changes. We investigated the variability in runoff and quantified the contributions of precipitation and anthropogenic activities on runoff at the LPRB. Analysis of the precipitation-runoff for the period 1970-2010 revealed breakpoints in 1986, 2000, 2004 and 2010 in the LPRB. The periods influenced by anthropogenic activities were categorized into three periods 1987-2000, 2001-2004 and 2005-2010, revealing a decrease in runoff during 1987-2000 and an increase in runoff during 2001-2004 and 2005-2010. Assessment of monthly, seasonal and annual runoff depicted a significant increasing trend in the runoff time series during the dry season. Generally, runoff increased at a rate of 9.98 × 10 7 m 3 yr -1 , with precipitation variability and human activities contributing 17.4% and 82.3% respectively. The dominant small scale alluvial gold mining activity significantly contributes to the net runoff variability in LPRB.

  9. Value impact analysis utilizing PRA techniques combined with a hybrid plant model

    International Nuclear Information System (INIS)

    Edson, J.L.; Stillwell, D.W.

    1989-01-01

    A value impact analysis (VIA) has been performed by the INEL to support a NRC Regulatory Analysis for resolution of Generic Issue (GI) 29, Bolting Degradation or Failure in Nuclear Power Plants. A VIA for replacing the reactor coolant pressure boundary (RCPB) bolts of BWRs and PWRs was previously prepared by Pacific Northwest Laboratories in 1985 under instructions limiting the VIA to the potential for failure of primary pressure boundary bolting. Subsequently the INEL was requested to perform a VIA that included non primary systems and component support bolts to be compatible with the resolution of the broader issue. Because the initial list of systems and bolting applications that could be included in the VIA was very large, including them all in the VIA would likely result in analyzing some that have little if any effect on public risk. This paper discusses how PRA techniques combined with a hybrid plant model were used to determine which bolts have the potential to be significant contributors to public risk if they were to fail, and therefore were included in the VIA

  10. Perfluoroalkyl acids (PFAAs) in the Pra and Kakum River basins and associated tap water in Ghana.

    Science.gov (United States)

    Essumang, David K; Eshun, Albert; Hogarh, Jonathan N; Bentum, John K; Adjei, Joseph K; Negishi, Junya; Nakamichi, Shihori; Habibullah-Al-Mamun, Md; Masunaga, Shigeki

    2017-02-01

    Perfluoroalkyl acids (PFAAs) are persistent environmental pollutants that have been detected in various media including human serum. Due to concerns regarding their bioaccumulation and possible negative health effects, an understanding of routes of human exposure is necessary. PFAAs are recalcitrant in many water treatment processes, making drinking water a potential source of human exposure. This study presents the first report on contamination from PFAAs in river and drinking water in Ghana. The targeted PFAAs were perfluoroalkyl carboxylic acids (PFCAs) with C 4-14 carbon chain and perfluoroalkane sulphonic acids (PFSAs) with C 6, 8, 10 . Five PFAA congeners - PFOA, PFOS, PFHxA, PFDA and PFPeA - were commonly detected in river and tap water. The mean concentrations of ∑PFAAs in the Kakum and Pra Rivers were 281 and 398ng/L, while tap water (supplied from the treatment of water from those rivers) contained concentrations of 197 and 200ng/L, respectively. PFOA and PFOS constituted about 99% of the ∑PFAAs. The risk quotient (RQ) attributed to drinking of tap water was estimated at 1.01 and 1.74 for PFOA and PFOS, respectively. For a country that has not produced these compounds, the RQs were unexpectedly high, raising concerns particularly about contamination from such emerging pollutants in local water sources. The study revealed limitations of local tap water treatment in getting rid of these emerging pollutants. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. PRA Procedures Guide: a guide to the performance of probabilistic risk assessments for nuclear power plants. Final report, Volume 1 - Chapters 1-8

    International Nuclear Information System (INIS)

    1983-01-01

    This document, the Probabilistic Risk Assessment (PRA) Procedures Guide, is intended to provide an overview of the risk-assessment field as it exists today and to identify acceptable techniques for the systematic assessment of the risk from nuclear power plants. Topics discussed include: organization of PRA; accident-sequence definition and system modeling; human-reliability analysis; data-base development; accident-sequence quantification; physical processes of core-melt accidents; and radionuclide release and transport

  12. Results and insights of a level-1 internal event PRA of a PWR during mid-loop operations

    International Nuclear Information System (INIS)

    Chu, T.L.; Musicki, Z.; Kohut, P.; Yang, J.; Bozoki, G.; Hsu, C.J.; Diamond, D.J.; Wong, S.M.; Holmes, B.; Su, R.F.; Dang, V.; Siu, N.; Bley, D.; Johnson, D.; Lin, J.

    1994-01-01

    Traditionally, probabilistic risk assessments (PRA) of severe accidents in nuclear power plants have considered initiating events potentially occurring only during full power operation. Some previous screening analysis that were performed for other modes of operation suggested that risks during those modes were small relative to full power operation. However, more recent studies and operational experience have implied that accidents during low power and shutdown could be significant contributors to risk. During 1989, the Nuclear Regulatory Commission (NRC) initiated an extensive program to carefully examine the potential risks during low power and shutdown operations. The program includes two parallel projects being performed by BNL and SNL. Two plants, Surry (pressurized water reactor) and Grand Gulf (boiling water reactor), were selected as the plants to be studied. The objectives of the program are to assess the risks of severe accidents initiated during plant operational states other than full power operation and to compare the estimated core damage frequencies, important accident sequences and other qualitative and quantitative results with those accidents initiated during full power operation as assessed in NUREG-1150. The scope of the program includes that of a level-3 PRA. The objective of this paper is to present the approach utilized in the level-1 PRA for the Surry plant, and discuss the results obtained. A comparison of the results with those of other shutdown studies is provided. Relevant safety issues such as plant and hardware configurations, operator training, and instrumentation and control is discussed

  13. Comparative analysis of the toxic effects of natural toxins and harmful substances produced by conventional processing methods or by irradiation and of toxicity tests

    International Nuclear Information System (INIS)

    Dahlhelm, H.; Arndt, K.; Groeger, G.; Schreiber, G.A.; Boegl, K.W.

    1994-01-01

    In this review, tasks and methods of food toxicology as well as the application of the different toxicity tests for the risk assessment of food ingredients are described. Particular reference is made to short-term genotoxicity tests. Enzymatic digestion and extraction methods for complex foodstuffs which are used in the toxicological testing of foods in in vitro systems are described. Radiolytic products which result from irradiation of foods or components of foodstuffs and corresponding results of toxicity testing are reviewed. Foodstuffs irradiated with doses of up to 10 kGy are regarded as toxicologically safe. A survey of the toxicologically tested irradiated foodstuffs as well as the applied maximum doses are given in tables at the end of chapter 8. Among the great number of toxicological studies of irradiated foods those are especially mentioned which have given rise to discussions on the health risks involved. In addition, the difficulties associated with the testing of toxicity of irradiated foodstuffs in feeding experiments are discussed. Short-term tests used to establish the benotoxicity of irradiated foods and essential results of toxicological testing are also presented in tables. An overview is given of the occurrence, frequency and health risks of natural toxins in foods and harmful substances produced by conventional methods of cooking and preservation, in order to enable a comparison with the health risks of irradiated foods. The relevance of animal experiments and in vitro investigations for the prediction of toxic effects of harmful substances of foodstuffs in man is discussed in the final chapter. (VHE) [de

  14. Interaction of CREDO [Centralized Reliability Data Organization] with the EBR-II [Experimental Breeder Reactor II] PRA [probabilistic risk assessment] development

    International Nuclear Information System (INIS)

    Smith, M.S.; Ragland, W.A.

    1989-01-01

    The National Academy of Sciences review of US Department of Energy (DOE) class 1 reactors recommended that the Experimental Breeder Reactor II (EBR-II), operated by Argonne National Laboratory (ANL), develop a level 1 probabilistic risk assessment (PRA) and make provisions for level 2 and level 3 PRAs based on the results of the level 1 PRA. The PRA analysis group at ANL will utilize the Centralized Reliability Data Organization (CREDO) at Oak Ridge National Laboratory to support the PRA data needs. CREDO contains many years of empirical liquid-metal reactor component data from EBR-II. CREDO is a mutual data- and cost-sharing system sponsored by DOE and the Power Reactor and Nuclear Fuels Development Corporation of Japan. CREDO is a component based data system; data are collected on components that are liquid-metal specific, associated with a liquid-metal environment, contained in systems that interface with liquid-metal environments, or are safety related for use in reliability/availability/maintainability (RAM) analyses of advanced reactors. The links between the EBR-II PRA development effort and the CREDO data collection at EBR-II extend beyond the sharing of data. The PRA provides a measure of the relative contribution to risk of the various components. This information can be used to prioritize future CREDO data collection activities at EBR-II and other sites

  15. Are we overlooking infections owing to non-tuberculous mycobacteria during routine conventional laboratory investigations?

    Directory of Open Access Journals (Sweden)

    Kushal Garima

    2012-01-01

    Full Text Available A large number of potentially pathogenic non-tuberculous mycobacteria (NTM encountered in the clinical laboratory makes it necessary to identify their species to ensure appropriate treatment. However, labor-intensive conventional methods of speciation are not used in every laboratory, and hence NTM infections are often ignored. Polymerase chain reaction (PCR restriction analysis (PRA was applied in this study for early identification and speciation of mycobacterial species on 306 cultures of acid-fast bacilli isolated from patients suspected of suffering from tuberculosis. Mycobacterium tuberculosis was identified in 85.6% of the isolates. The NTM isolated most commonly was Mycobacterium kansasii/gastri group (3.5%, followed by Mycobacterium fortuitum (3.2%. Four of the M. fortuitum were grown from cultures obtained on the same day, but from samples from different patients and were probably laboratory contaminants. Mycobacterium intracellulare and Mycobacterium avium were identified in 2.94% and 2.28% of the isolates, respectively. Three isolates of M. avium and two isolates of M. intracellulare were obtained in repeated cultures from sputum samples of the same patients and were thus pathogenic. A single isolate of Mycobacterium abscessus was obtained from a breast abscess. A rare pathogen Mycobacterium phocaicum was isolated from one patient with epididymitis. However, whether it was the causative agent of epididymitis in this patient remains doubtful. The results of this study highlight the importance of speciation of mycobacteria for appropriate diagnosis and the importance of including molecular assays to augment conventional methods of diagnosis of mycobacterial diseases for rapid identification of NTM so that these potential pathogens are not overlooked in routine diagnostic procedures.

  16. The use of hogdahl convention k0 neutron activation analysis (NAA) standardization method and atomic absortion spectroscopy (ASS) for determination of toxic elements in foodstuffs

    International Nuclear Information System (INIS)

    Ahiamadie, H.

    2008-06-01

    Copper, cadmium, tin, chromium, arsenic, antimony, vanadium and mercury contents were determined in various foodstuffs (Mussa paradisiaca (plantains), Manihot esculentus (cassavas), Vantosoma sagittifolium (cocoyam). Vantosoma sagittifolium leaves (kontomire), Lycopersicum esculentus (tomatoes), Capsicum species (peppers), Solanum melongena (garden eggs), Nbelmoschus esculentus (okro), and Colocasia esculenta (kooko or taro)) produced in the Wassa West District, Ghana. These plants are the basis of human nutrition in the study area. These elements were determined using Hogdahl convention k 0 Instrumental Neutron Activation Analysis (NAA) Standardization Method and Atomic Absorption Spectroscopy (AAS). The elements in the various foodstuffs and their concentration ranges were Cu (16.87-180.06) mg/kg, As (2.68-9.84) µg/g, Cd (0.63-5.64) µg/g, Hg (0.01-67) ng/g, Cr (0.03-3.66) µg/g, Sb (1.1- 18.6) ng/g, Sn (3.4-58.4) ng/g, and V (12-99) ng/g. The study showed that there are high levels of toxic elements in the foodstuffs grown in the mining areas as compared to that of the non-mining area (i.e., control area). This could be attributed to gold mines pollution. Compared to the World Health Organization (WHO) permissible levels of toxic elements in foods, Cu, Cr and Hg were above the permissible levels whereas the concentrations of As, Cd. Sb, Sn and V fall within the permissible levels. (au)

  17. Evaluation of conventional therapeutic methods versus maggot therapy in the evolution of healing of tegumental injuries in Wistar rats with and without diabetes mellitus.

    Science.gov (United States)

    Masiero, Franciéle Souza; Thyssen, Patricia Jacqueline

    2016-06-01

    Larval therapy consists on the application of sterilized carrion flies larvae, reared in laboratory, on acute, chronic, and/or infected wounds in order to promote healing. Conventional methods for treating injuries include mechanical debridement or silver-based dressings; however, they are not always effective for wound healing. Larval therapy is a feasible and safe treatment for therapeutic application and, in many cases, the only and the most recommended alternative for difficult healing injuries. Thus, this study aimed to evaluate the competence of Cochliomyia macellaria F. (Diptera: Calliphoridae) as a suitable species for therapeutic application and evaluate time and effectiveness of the types of treatments most commonly used to treat integumental injuries. C. macellaria eggs were obtained from colonies established in laboratory and sterilized prior to application. Twenty-five larvae were applied for each centimeter squared of lesion. Lesions were induced in 24 Wistar rats; type 1 diabetes mellitus was induced in 12 of them. Animals were divided in four groups with three individuals each, being denominated: larval therapy, larval therapy associated with foam dressing with silver release, mechanical debridement with foam dressing silver and control group, without treatment. All treatments were applied once and held for 24 h. Medical application of larvae was found to be safe, as only dead tissue was removed, and efficient to accelerate healing process when compared to other treatments.

  18. Discerning Silk Produced by Bombyx mori from Those Produced by Wild Species Using an Enzyme-Linked Immunosorbent Assay Combined with Conventional Methods.

    Science.gov (United States)

    You, Qiushi; Li, Qingqing; Zheng, Hailing; Hu, Zhiwen; Zhou, Yang; Wang, Bing

    2017-09-06

    Recently, much interest has been paid to the separation of silk produced by Bombyx mori from silk produced by other species and tracing the beginnings of silk cultivation from wild silk exploitation. In this paper, significant differences between silks from Bombyx mori and other species were found by microscopy and spectroscopy, such as morphology, secondary structure, and amino acid composition. For further accurate identification, a diagnostic antibody was designed by comparing the peptide sequences of silks produced by Bombyx mori and other species. The results of the noncompetitive indirect enzyme-linked immunosorbent assay (ELISA) indicated that the antibody that showed good sensitivity and high specificity can definitely discern silk produced by Bombyx mori from silk produced by wild species. Thus, the antibody-based immunoassay has the potential to be a powerful tool for tracing the beginnings of silk cultivation. In addition, combining the sensitive, specific, and convenient ELISA technology with other conventional methods can provide more in-depth and accurate information for species identification.

  19. Evaluation of the effect of salts on chemical, structural, textural, sensory and heating properties of cheese: Contribution of conventional methods and spectral ones.

    Science.gov (United States)

    Loudiyi, M; Aït-Kaddour, A

    2018-03-21

    Chemical composition, sensory characteristics, textural and functional properties are among the most important characteristics, which directly relates to the global quality of cheese and to consumer acceptability. A number of factors including milk composition, processing conditions and salt content, influences these properties. The past decades many investigations were performed on the possibilities to reduce salt content of cheese due to its adverse health effects, the current lifestyle and the awareness of the consumers for nutrition quality products. Due to the multiple potential effects of reducing NaCl (simple reduction or substitution) on cheese attributes, it is of utmost importance to identify and understand those effects in order to control the global quality and safety of the final product. In the present review a collection of the different results and conclusions drawn after studying the effect of salts by conventional (e.g. wet chemistry) and instrumental (e.g. spectral) methods on chemical, structural, textural, sensory and heating properties of cheese are presented.

  20. Distribution of Malassezia species on the skin of patients with atopic dermatitis, psoriasis, and healthy volunteers assessed by conventional and molecular identification methods.

    Science.gov (United States)

    Jagielski, Tomasz; Rup, Elżbieta; Ziółkowska, Aleksandra; Roeske, Katarzyna; Macura, Anna B; Bielecki, Jacek

    2014-03-07

    The Malassezia yeasts which belong to the physiological microflora of human skin have also been implicated in several dermatological disorders, including pityriasis versicolor (PV), atopic dermatitis (AD), and psoriasis (PS). The Malassezia genus has repeatedly been revised and it now accommodates 14 species, all but one being lipid-dependent species. The traditional, phenotype-based identification schemes of Malassezia species are fraught with interpretative ambiguities and inconsistencies, and are thus increasingly being supplemented or replaced by DNA typing methods. The aim of this study was to explore the species composition of Malassezia microflora on the skin of healthy volunteers and patients with AD and PS. Species characterization was performed by conventional, culture-based methods and subsequently molecular techniques: PCR-RFLP and sequencing of the internal transcribed spacer (ITS) 1/2 regions and the D1/D2 domains of the 26S rRNA gene. The Chi-square test and Fisher's exact test were used for statistical analysis. Malassezia sympodialis was the predominant species, having been cultured from 29 (82.9%) skin samples collected from 17 out of 18 subjects under the study. Whereas AD patients yielded exclusively M. sympodialis isolates, M. furfur isolates were observed only in PS patients. The isolation of M. sympodialis was statistically more frequent among AD patients and healthy volunteers than among PS patients (P < 0.03). Whether this mirrors any predilection of particular Malassezia species for certain clinical conditions needs to be further evaluated. The overall concordance between phenotypic and molecular methods was quite high (65%), with the discordant results being rather due to the presence of multiple species in a single culture (co-colonization) than true misidentification. All Malassezia isolates were susceptible to cyclopiroxolamine and azole drugs, with M. furfur isolates being somewhat more drug tolerant than other Malassezia species

  1. Are the Conventional Commercial Yeast Identification Methods Still Helpful in the Era of New Clinical Microbiology Diagnostics? A Meta-Analysis of Their Accuracy.

    Science.gov (United States)

    Posteraro, Brunella; Efremov, Ljupcho; Leoncini, Emanuele; Amore, Rosarita; Posteraro, Patrizia; Ricciardi, Walter; Sanguinetti, Maurizio

    2015-08-01

    Accurate identification of pathogenic species is important for early appropriate patient management, but growing diversity of infectious species/strains makes the identification of clinical yeasts increasingly difficult. Among conventional methods that are commercially available, the API ID32C, AuxaColor, and Vitek 2 systems are currently the most used systems in routine clinical microbiology. We performed a systematic review and meta-analysis to estimate and to compare the accuracy of the three systems, in order to assess whether they are still of value for the species-level identification of medically relevant yeasts. After adopting rigorous selection criteria, we included 26 published studies involving Candida and non-Candida yeasts that were tested with the API ID32C (674 isolates), AuxaColor (1,740 isolates), and Vitek 2 (2,853 isolates) systems. The random-effects pooled identification ratios at the species level were 0.89 (95% confidence interval [CI], 0.80 to 0.95) for the API ID32C system, 0.89 (95% CI, 0.83 to 0.93) for the AuxaColor system, and 0.93 (95% CI, 0.89 to 0.96) for the Vitek 2 system (P for heterogeneity, 0.255). Overall, the accuracy of studies using phenotypic analysis-based comparison methods was comparable to that of studies using molecular analysis-based comparison methods. Subanalysis of studies conducted on Candida yeasts showed that the Vitek 2 system was significantly more accurate (pooled ratio, 0.94 [95% CI, 0.85 to 0.99]) than the API ID32C system (pooled ratio, 0.84 [95% CI, 0.61 to 0.99]) and the AuxaColor system (pooled ratio, 0.76 [95% CI, 0.67 to 0.84]) with respect to uncommon species (P for heterogeneity, 0.05). Nonetheless, clinical microbiologists should reconsider the usefulness of these systems, particularly in light of new diagnostic tools such as matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry, which allow for considerably shortened turnaround times and/or avoid the requirement

  2. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Science.gov (United States)

    Chao, Qiao-Ting; Lee, Tai-Fen; Teng, Shih-Hua; Peng, Li-Yun; Chen, Ping-Hung; Teng, Lee-Jene; Hsueh, Po-Ren

    2014-01-01

    We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) systems (Bruker Biotyper and Vitek MS) and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID) with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex) levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database), Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar) systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis) were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD) system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD) system, 39 (43.8%), including 27 C. orthopsilosis isolates, could be correctly identified Using the Vitek MS Plus SARAMIS database for research use only. This resulted in an increase in the rate of correct identification of all yeast isolates (87.5%) by Vitek 2 MS. The two species in C. guilliermondii complex (C. guilliermondii and C. fermentati) isolates were correctly identified by cluster analysis of spectra generated by the Bruker Biotyper system. Based on the results obtained in the current study, MALDI-TOF MS systems present a promising alternative for the routine identification of yeast species, including clinically commonly and rarely encountered yeast species and several species belonging to C. parapsilosis complex, C. guilliermondii complex

  3. Comparison of the accuracy of two conventional phenotypic methods and two MALDI-TOF MS systems with that of DNA sequencing analysis for correctly identifying clinically encountered yeasts.

    Directory of Open Access Journals (Sweden)

    Qiao-Ting Chao

    Full Text Available We assessed the accuracy of species-level identification of two commercially available matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS systems (Bruker Biotyper and Vitek MS and two conventional phenotypic methods (Phoenix 100 YBC and Vitek 2 Yeast ID with that of rDNA gene sequencing analysis among 200 clinical isolates of commonly encountered yeasts. The correct identification rates of the 200 yeast isolates to species or complex (Candida parapsilosis complex, C. guilliermondii complex and C. rugosa complex levels by the Bruker Biotyper, Vitek MS (using in vitro devices [IVD] database, Phoenix 100 YBC and Vitek 2 Yeast ID (Sabouraud's dextrose agar systems were 92.5%, 79.5%, 89%, and 74%, respectively. An additional 72 isolates of C. parapsilosis complex and 18 from the above 200 isolates (30 in each of C. parapsilosis, C. metapsilosis, and C. orthopsilosis were also evaluated separately. Bruker Biotyper system could accurately identify all C. parapsilosis complex to species level. Using Vitek 2 MS (IVD system, all C. parapsilosis but none of C. metapsilosis, or C. orthopsilosis could be accurately identified. Among the 89 yeasts misidentified by the Vitek 2 MS (IVD system, 39 (43.8%, including 27 C. orthopsilosis iso